PH.D Thesis, Nawal Kishor Yadav, Nepal

STUDY ON GENETIC DIVERSITY, SOURCE OF RESISTANCE TO FUSARIUM WILT
AND STEMPHYLIUM BLIGHT DISEASES AND GENOTYPE ENVIRONMENT
INTERACTION IN LENTIL (Lens culinaris, Medikus)
NAWAL KISHOR YADAV
AUGUST 2017
STUDY ON GENETIC DIVERSITY, SOURCE OF RESISTANCE TO FUSARIUM WILT
AND STEMPHYLIUM BLIGHT DISEASES AND GENOTYPE ENVIRONMENT
INTERACTION IN LENTIL (Lens culinaris, Medikus)
NAWAL KISHOR YADAV
DISSERTATION
SUBMITTED TO THE
TRIBHUVAN UNIVERSITY
INSTITUTE OF AGRICULTURE AND ANIMAL SCIENCE
RAMPUR, CHITWAN, NEPAL
IN FULFILMENT OF THE
REQUIREMENT FOR
THE DEGREE OF
DOCTOR OF PHILOSOPHY IN AGRICULTURE

(PLANT BREEDING)
AUGUST 2017
CERTIFICATE
This is to certify that the dissertation entitled STUDY ON GENETIC
DIVERSITY, SOURCE OF RESISTANCE TO FUSARIUM WILT AND
STEMPHYLIUM BLIGHT DISEASES AND GENOTYPE ENVIRONMENT
INTERACTION IN LENTIL (Lens culinaris, Medikus) submitted in fulfillment of the
requirements for the degree of Doctor of Philosophy with major in Plant Breeding of the
post graduate program, Institute of Agriculture and Animal Science, Rampur, is a record of
original research carried out by Mr. NAWAL KISHOR YADAV, Id. No. R-2010-PLB-
B-01P, under my supervision, and no part of the dissertation has been submitted for any
other degree or diploma.
The assistance and help received during the course of this investigation have been
acknowledged.
iii
iv
ACKNOWLEDGEMENTS
I feel immense pleasure in expressing my deep sense of gratitude and highest
veneration to Dr. Nav Raj Adhikari, Professor, Department of Plant Breeding and
Chairman of my advisory committee for his valuable guidance and keen interest in the
preparation of the manuscript.
I am highly indebted to Dr. Bindeshwar Prasad Sah, Principal Scientist, NARC and
member of my advisory committee, for his helps in trials conduction, molecular marker
analysis, valuable suggestions and guidance during the present investigation.
I am highly thankful to Dr. Sundar Man Shrestha, Professor, Department of Plant
Pathology and Dr. Shrawan Kumar Sah, Professor, Department of Agronomy, AFU and
Members of my Advisory Committee for their valuable suggestions and guidance during
present investigation.
I am highly indebted to Dr. Surya Kant Ghimire, Professor, Department of Plant
Breeding for his valuable guidance, persistent encouragement and keen interest throughout
the course of this investigation and preparation of the manuscript.
I wish to express my sincere thanks to Dr. Asutosh Sarker, Lentil Breeder and
South Asia and China Coordinator, ICARDA for helping in financial support, valuable
suggestions and guidance during the present investigation and preparation of the
manuscript.
I would like to extend my humble gratitude to Dr. Bhartendu Misra, Executive
Director, NARC, Mr. Dinesh Pariyar. Director Planning and Coordination and Dr.
Niranjan Adhikari, Director Crop and horticulture, NARC for their valuable suggestions,
guidance and help. I also extend my gratitude to Nepal Agricultural Research Council for
providing the approval for my study
v
I am greatly thankful to DG, ICARDA for providing financial support for the
present investigation.
I am indebted to Chief, Agronomy Division Khumaltar, Regional Directors, RARS
Parwanipur, RARS, Nepalgunj and Coordinators, NGLRP, Rampur and JRP, Itahari and
their staffs for providing the Research facility, unforgettable help and support throughout
the research work.
Words fail to express my profound sense of gratitude and heartfelt indebtedness to,
my wife Devsunair, daughters Pramila, Urmila and Sangeeta and son Sushil, and
grandsons, Bimal and Rishu and granddaughter Samragi for their love, affection, sincere
advice and everlasting encouragement, without whom this dream would not have come
true.
It is my sincere duty to acknowledge my senior and colleagues Mrs. Sharada Joshi,
Mr. Bharat Adhkari, biometrician, U. K. Singh Kuswaha, Raju Chaudhary, Bal Krishna
Joshi and Rajan Malla for their cooperation and help at various stages of the investigation.
Thanks are also due to all the staff members of the Biotechnology Division and
Plant Pathology Division Khumaltar for their help during the research.
A word of appreciation goes to Mr. Santosh Tamang and Mr. Manoj Tamang for
excellent and careful word processing of this manuscript.
Last but not the least, I record my sincere thanks to all beloved and respected
people who helped me but could not find separate mention.
Nawal Kishor Yadav
vi
TABLE OF CONTENTS
Title Page
ACKNOWLEDGEMENT iii
TABLE OF CONTENTS v
LIST OF TABLES x
LIST FIGURES xii
LIST OF APPENDICES xiii
ACRONYMS xiv
ABSTRACT IN ENGLISH xvii
ABSTRACT IN NEPALI xx
1 INTRODUCTION 1
1.1 Background 1
1.2 Objectives 8
2 REVIEW OF LITERATURE 9
2.1 Genetic divergence using morphological traits 9
2.1.1 Qualitative characters 9
2.1.1.1 Cotyledon color 9
2.1.1.2 Seed coat color and seed coat pattern 9
2.1.1.3 Pod color 10
2.1.1.4 Leaf tendril 10
2.1.2 Quantitative characters 10
2.1.2.1 Studies on variability parameters (variability, heritability and
genetic advance) 10
2.1.2.2 Studies on association among seed yield and other traits 15
vii
2.1.2.3 Genetic divergence 20
2.2 Genetic divergence study using molecular markers 23
2.3 Study on Fusarium wilt 24
2.3.1 Disease inoculums 'build up, infection, losses and scoring 24
2.3.2 Treatment/control 26
2.4 Study on Stemphylium blight 26
2.4.1 Disease inoculums build up, infection and scoring 26
2.4.2 Treatment/control 28
2.5 Study on genotype-environment interaction 29
3 MATERIALS AND METHODS 35
3.1 Genetic divergence study using morphological character 35
3.1.1 Qualitative traits 38
3.1.2 Quantitative traits 39
3.1.2.1 Days to 50 % flowering 39
3.1.2.2 Days to maturity 39
3.1.2.3 Plant height (cm) 39
3.1.2.4 Number of branches per plant 39
3.1.2.5 Number of pods per plant 39
3.1.2.6 Number of seeds per pod 40
3.1.2.7 Hundred seed weight 40
3.1.2.8 Seed yield per plant (g) 40
3.1.2.9 Biological yield per plant (g) 40
3.1.2.10 Harvest index (HI) % 40
3.1.3 Data analysis 40
viii
3.1.3.1 Estimations of phenotypic and genotypic variances 40
3.1.3.2 Estimations of phenotypic and genotypic covariance, heritability
and genetic advance 41
3.2 Genetic divergence study using SSR marker 42
3.2.1 DNA extraction 42
3.2.2 Measurement of DNA purity and quantity 43
3.2.3 Microsatellite marker 43
3.2.4 PCR amplification 45
3.2.5 PCR product separation and microsatellites visualization 45
3.2.6 Statistical analysis 45
3.2.7 Polymorphic information content (PIC) 46
3.2.8 Cluster analysis 46
3.3 Fusarium wilt study 46
3.3.1 Data recording 47
3.4 Stemphylium blight study 48
3.5 Genotype environment interactions 49
3.5.2 Data analysis 51
4 RESULTS AND DISCUSSION 53
4.1 Genetic divergence study using morphological traits 53
4.1.1 Observation of qualitative traits 53
4.1.1.1 Seed coat color 54
4.1.1.2 Seed coat pattern 54
ix
4.1.1.3 Cotyledon color 54
4.1.1.4 Stem color 54
4.1.1.5 Pod pigmentation 54
4.1.1.6 Tendril formation 55
4.1.1.7 Leaf pubescence 55
4.1.2 Quantitative traits 55
4.1.2.1 Analysis of variance and mean performance 55
4.1.2.2 Variability and mean value 57
4.1.2.2.1 Leaflet length 57
4.1.2.2.2 Plant height 57
4.1.2.2.3 Number of primary branches 57
4.1.2.2.4 Days to flowering 57
4.1.2.2.5 Days to maturity 58
4.1.2.2.6 Number of pods per plant 58
4.1.2.2.7 Number of seeds per pod 58
4.1.2.2.8 Hundred seed weight 58
4.1.2.2.9 Biological yield per plant 58
4.1.2.2.10 Grain yield per plant 59
4.1.2.2.11 Harvest index 59
4.1.3 Genetic parameters 61
4.1.3.1 Estimates of coefficient of variation, heritability and expected
genetic advance 61
4.1.3.1.1 Phenotypic and genotypic coefficient of variation 61
4.1.3.1.2 Heritability and genetic advances 64
x
4.1.4 Correlation among traits 64
4.1.5 Path coefficients analysis 65
4.1.6 Genetic divergence 67
4.2 Genetic divergence study using molecular marker 70
4.2.1 Profiling 71
4.2.2 Polymorphic information content 71
4.2.3 Dendrogram construction 75
4.3 Reaction of Fusarium wilt 80
4.3.1 Screening for wilt in field condition 80
4.4 Reaction of Stemphylium blight 81
4.4.1 Screening for Stemphylium blight in field condition 82
4.5 Genotype environment interaction study 86
4.5.1 Grain yield analysis following by AMMI model 86
4.5.2 Mean grain yield comparison 87
4.5.3 Stability analysis by AMMI model 90
4.5.3.1 Expression of genotypes over the environments (AMMI 1 biplot) 92
4.5.3.2 Effect of PC1 and PC2 on the expression of genotypes and
environments (AMMI 2 biplot) 93
5 SUMMARY AND CONCLUSIONS 95
LITERATURE CITED 101
APPENDICES 132
BIOGRAPHICAL SKETCH 139
xi
LIST OF TABLES
Table Page
1 List of lentil accessions used in this study and their source of origin 36
2 List of forward and reverse 30 SSR primers used for lentil characterization,
with annealing temperature and expected size 44
3 Weather data of crop season of the experimental site Nepalgunj during
2012/13 48
4 Geographical, climatic, and soil features of the experimental sites, 2013/14
and2014/15 50
5 Qualitative character of selected genotypes recorded at Khumaltar during
2011/12 53
6 Analysis of variance (ANOVA) for different morphological and economical
traits at Khumaltar, 2011/12 56
7 Mean values for grain yield and yield attributing characters of selected
genotypes at Khumatar, during 2011/12 60
8 Genetic parameter for different morphological traits 62
9 Estimates of phenotypic and genotypic correlation coefficients among the
eleven traits 63
10 a. Phenotypic path coefficient analysis 66
b. Genotypic path coefficient analysis 66
11 Clustering pattern of 185 lentil genotypes based on Pearsons similarity
analysis for 11 characters 69
12 Genotypic means of each cluster for 11 characters 70
13 Intra and inter cluster distance between clusters 70
xii
14 Primer's name and their potential to detect the genetic polymorphism in 185
selected lentil accessions 72
15 Clustering pattern of 185 lentil genotypes based on SSR markers 79
16 Reaction of Fusarium wilts resistant in lentil genotypes 81
17 Reaction of Stemphylium blight at Nepalgunj, 2012/13 84
18 Reaction of combined disease resistant to Fusarium wilt and Stemphylium
blight in lentil genotypes 86
19 AMMI analysis of variance for different quantitative traits of 21 lentil
genotypes across 8 environments 89
20 Mean grain yield in mt ha-1 of 21 genotypes in 8 environments 90
21 Mean grain yield (mt ha-1), AMMI stability values (ASV), stability index and
ranking orders of the 21 genotypes 91
xiii
LIST OF FIGURES
Figure Page
1 Dendrogram construction using 11 morphological traits 68
2 a. Banding patterns of a highly polymorphic SSR34-2 marker in 185 lentil
genotypes in same sequence as given in Table 1 73
b. Banding patterns of a highly polymorphic of SSR 90 marker in 185 lentil
c. Banding patterns of a highly polymorphic SSR207 marker in 185 lentil
3 a. Banding patterns of a low polymorphic SSR 19 marker in 185 lentil
b. Banding patterns of a low polymorphic SSR99 marker in 185 lentil
c. Banding patterns of a low polymorphic SSR 124 marker in 185 lentil
4 Dendrogram construction using 30 SSR markers 78
5 AMMI 1 biplot for grain yield (mt ha-1) of 21 lentil genotypes and eight
environments using genotypic and environmental scores 92
6 AMMI 2 Biplot for grain yield (mt ha-1) showing the interaction of IPCA2
against IPCA1 scores of 21 lentil genotypes in eight environments 94
xiv
LIST OF APPENDICES
Appendix Page
1 Qualitative character of genotypes conducted at Khumaltar during 2011/12 132
2 Mean values for grain yield and yield attributing characters conducted in
augmented design at Khumaltar during 2011/12 135
xv
ACRONYMS
% Percentage
@ At the Rate of
0
C Degree Centigrade
AMMI Additive Main Effects and Multiplicative Interaction
ANOVA Analysis of Variance
ARS Agriculture Research Station
ASV AMMI Stability Value
BY/p Biological Yield per Plant
Cm Centimeter
CTAB Cetyltrimethyl Ammonium Bromide
CV Coefficient of Variation
DF Days to Flowering
DM Days to Maturity
DNA Deoxyribonucleic Acid
ed. Editor
FAO Food and Agriculture Organization
FY Fiscal Year
g Gram
GEI Genotype-Environment Interaction
GY/p Grain yield per plant
GXE Genotype-Environment Interaction
ha Hectare
HI Harvest index
xvi
IAAS Institute of Agriculture and Animal Sciences
IBPGR International Bureau of Plant Genetic Resources
ICARDA International Centre for Agriculture Research in Dry Areas
IPCA Interaction Principal Component Axis
JRP Jute Research Program
K2O Potash
kg Kilogram
m2 Meter Square
masl Meter Above Sea Level
mg Milligram
ml Milliliter
mm Millimeter
MoAD Ministry of Agriculture and Development
Mt/ha Metric ton per Hector
N Nitrogen
NAGRC National Agriculture Genetic Resource Centre
NARC Nepal Agriculture Research Council
NGLRP National Grain Legumes Research Program
Ns Non-significant
NTSYS Numerical Taxonomy and Multivariate Analysis System
PCR Polymerase chain reaction
PH Plant height
PP Pods per plant
RARS Regional Agricultural Research Station
xvii
SP Seeds per Pod
SSR Simple Sequence Repeat
SW 100 Seed weight
xviii
ABSTRACT
Name: Nawal Kishor Yadav Id. No.: R-2010-PLB-B-01P

Semester and year of admission: First, 2010 Degree: Doctor of Philosophy
Major subject: Plant Breeding Department: Plant Breeding
Major advisor: Prof. Nav Raj Adhikari, Ph.D.
The present investigation entitled Study on genetic diversity, source of resistance to

Fusarium wilt and Stemphylium blight and genotype environment interaction in lentil
(Lens culinaries Medik.) was conducted with the objectives-to estimate the genetic
divergence present among local and exotic germplasm using phenotypic attributes and
DNA based SSR molecular markers, identify the potential sources of resistance to
Fusarium wilt and Stemphylium blight diseases in germplasm and to know genotype-
environment interaction among elite lines of lentil. Five experiments were carried out to
fulfill above objectives. The experiment 1 was carried out during winter season in 2011/12
at the crop field of Agronomy division, Khumaltar. The 185 genotypes collected from
different sources including 5 checks (ILL7715, ILL7164, Bari masuro-4, Sindur and
Simal) were planted in augmented design in 4 blocks to get the genetic divergence using
phenotypic traits. The experiment 2 was carried out with 185 genotypes during winter
season in 2011/12 at the Biotechnology division. The experiment 3 was carried out with
185 genotypes/varieties including resistant check ILL7715 and susceptible check Sindur of
Fusarium Wilt, during winter season in2012/13 at the wilt sick plot of RARS, Khajura,
Nepalgunj to identify the Fusarium wilt resistant lines. The experiment 4 was carried out
with 185 genotypes/varieties including resistant checks Bari masuro-4, ILL7164 and
susceptible check Shital of Stemphylium blight during winter season in 2012/13 at RARS,
Khajura, Nepalgunj to identify the Stemphylium blight resistant lines. The experiment 5
was carried out with 21 genotypes selected from the previous trials including 3 checks
BM-4, ILL7164 and Simal at 4 locations during2013/14and 2014/15 representing diverse
agro climate of lentil growing area of Nepal and treats as eight environments to get the
genotype environment interactions. High heritability along with high genetic advance as
percentage of mean were observed for number of pods per plant, grain yield per plant,
biological yield per plant and harvest index. It showed additive gene action and suggested
early generation selection for these traits would be very effective. At phenotypic and
genotypic level grain yield has significant positive correlation with, number of pods per
plant, number of seeds per pod, biological yield per plant and harvest index, these traits
should be considered in selecting the variety in lentil. Non-significant correlation with days
to flowering and days to maturity suggesting that high yielding short duration variety could
be selected simultaneously. Genetic divergence analysis using morphological traits
grouped 185 genotypes into eight clusters. Cluster VII has highest mean value for number
of pods (77.33) and grain yield per plant (2.95g) these traits were lowest for cluster II
(8.83,0.23g). Selection of group having high mean value and crosses between these groups
resulted in raising the average productivity of lentil. Genetic divergence analysis using 30
SSR markers grouped 185 lentil accessions into ten clusters. Genotypes of groups III and
VI were totally different from other groups. Hybridization of any other groups with III and
VI give rise to better progeny. Highly informative and detectable polymorphic markers for
this study were SSR 34-2, SSR 90 and SSR 207 which indicate the power and higher
resolution of those marker systems in detecting molecular diversity. Genotypes RL-13,
RL-21, ILL6468, ILL9996, ILL6024, ILL6811, ILL7164, Arun, and Maheswar Bharti
xix
showed combined resistant reaction to both Fusarium wilt and Stemphylium blight
diseases. These genotypes could be used in future breeding program to increase the country
production. The genotype RL39 (1.254mt/ha) and ILL10071 (1.196mt/ha) produced higher
grain yield) than all other genotypes over the environments and performed better at most of
the places. The genotypes F2003-49L, Arun, 39-S-66L, RL-44, and ILL10071produced
higher grain yield than all checks and were less affected by the G x E interaction and
performed well across a wide range of environments.
________________________ _________________
Prof. Nav Raj Adhikari, Ph.D. Nawal Kishor Yadav
Major advisor Author
xx
zf]w;f/
gfd M gjn lszf]/ ofbj kl/ro kq g= M cf/@)!)lk=Pn=lala )!kL

;q tyf egf{ jif{ M k|yd, @)^* pkflw M ljBfjfl/wL
d'Vo ljifo M jfnL k|hgg\ ljefu M jfnL k|hgg\
d'Vo ;Nnfxsf/ M k|f=8f= gj/fh clwsf/L
of] cg';Gwfg of]hgf d'Vo tLgj6f p2]Zox? k|fKt ug{sf] nflu cf=j= O{=;= @)!!!@ b]lv @)!$!%
;Dd ljleGg s[lif cg';Gwfg s]Gb|x?df ;+rfng ul/Psf] lyof] . klxnf] p2]Zo :yflgo tyf j}b]lzs
d';'/f]sf] cg'j+z -hd{KnfHd_ tyf To;sf] jflx/L cfs[lts u'0f / j+zf0f' u'0f -P;=P;=cf/= dfs{/_ sf]
cfwf/df leGgtf kQf nufpg' lyof] . bf];|f] p2]Zo oL hftx?df cf]O{nfpg] -o'h]l/od ljN6_ tyf 88'jf
-:6]dlkmlnod JnfO{6_ /f]u ;xg ;Sg] hftsf] 5gf}6 ug'{ lyof] . t];|f] p2]Zo g]kfnsf] ljleGg s[lif
cg';Gwfg s]Gb|x?df jftfjf/0fsf] k|efjjf/] cWoog u/L j9L tyf l:y/ pTkfbg lbg] hftx?sf] 5gf}6
ug'{ lyof] . klxnf] p2]Zo k'lt{sf] nflu b'O{ j6f kl/If0fx? cf=j= O{=;+= @)!!!@ df ;+rfng u/LPsf]
lyof] . klxnf] kl/If0f jfnL lj1fg dxfzfvf, v'dn6f/df !*% j6f :jb]zL tyf ljb]zL hd{KnfHd
;+sng u/L kfFr j6f r]s ;d]t /fvL cu'd]G6]8 9f+rfdf nufO{Psf] lyof] . pQm hftx?sf] jflx/L
cfs[lts u'0fx?sf] cWoog u/L ;f]lx cfwf/df ;d'x agfO{Psf] lyof] . bf];f| ] kl/If0f h}ljs k|ljlw
dxfzfvfdf pQm hftx? nufO{ To;sf] l8=Pg=P= lemsL l;Dkn l;Sj]G; l/lk6 -P;=P;=cf/=_ dfs{/
k|of]u u/L hLg Doflk / ;d'x agfO{Psf] lyof] . bf];|f] p2]Zo k'lt{sf] nflu cf=j= @)!@!# df If]lqo
s[lif c';Gwfg s]Gb|, vh'/f, g]kfnu+hdf t];|f] kl/If0f !*% hftsf] d;'/f] nufO{ cf]O{nfpg] /f]u ;xg ;Sg]
hft 5gf}6 ;DalGw cWoogsf] nflu /f]u gnfUg] hft cfO=Pn=Pn= &&!% / /f]u ;xg} g;Sg] hft
l;Gb'/r]ssf] ?kdf /flv kl/If0f ul/Psf] lyof] eg] rf}yf] kl/If0f ;f]lx :yfgdf pQm hftx?df 88'jf
/f]u ;xg] ;DalGw cWoog ug{sf] nflu 88'jf /f]u gnfUg] hftaf/L d;'/f]$ tyf cfO=Pn=Pn= &!^$ /
88'jf /f]u j9L nfUg] hftlztn r]ssf] ?kdf /fvL kl/If0f ;+rfng ul/Psf] lyof] . t];|f] p2]Zo k'lt{sf]
nflu kfFrf} kl/If0f cf=j= @)!#!$ df rf/ j6f :yfgx? jfnL lj1fg dfxfzfvf, v'dn6f/, /fli6o
sf]z]jfnL cg';Gwfg sfo{qmd, /fdk'/, If]lqo s[lif cg';Gwfg s]Gb|, vh'/f, g]kfnu+h / If]lqo s[lif
cg';Gwfg s]Gb|, k/jfgLk'/df tyf @)!$!% df rf/j6f :yfgx? jfnL lj1fg dfxfzfvf, v'dn6f/,
If]lqo s[lif cg';Gwfg s]Gb|, vh'/f, g]kfnu+h, If]lqo s[lif cg';Gwfg s]Gb|, k/jfgLk'/ tyf h'6jfnL
xxi
cg';Gwfg s]Gb|, O{6x/Ldf cl3Nnf] kl/If0fjf6 5gf}6 ul/Psf] @! j6f hftx?sf] pTkfbg nufot l:y/tf
hfr ug{ a[xt kl/If0f ul/Psf] lyof] . klxnf] kl/If0fjf6 Ps k':tfjf6 csf]{ k':tfdf ;g]]{ u'0f, sf];fsf]
;+Vof, bfgfsf] pTkfbg, jf]6sf] pTkfbg, pTkfbg ;'rf+sdf jl9 ePsf] / oL u'0fx? bfgf pTkfbg ;+u
k|ToIf ;/f]sf/ /fVg] ePsf]n] oL u'0fx?sf] cfwf/df hftsf] 5gf}6 ug'{ pko'Qm b]lvof] . ;fy} bfgf
pTkfbg ;+u km'nkm'Ng] lbg / kfSg] lbgsf] s'g} ;DaGw gePsf] b]lvPsf]n] 5f]6f] ;dodf kfSg] / a9L
pTkfbg lbg] hftsf] klg 5gf}6 ug{ ;lsG5 . h}ljs ljljwtf jflx/L cfs[lts u'0fsf] cfwf/df x]bf{
cf7j6f ;d'x kfO{of] . To;df ;d'x ;ft / cf7n] ;j}eGbf j9L pTkfbg lbg] ePsf]n] oL ;d'xsf]
hd{KnfHd lar j0f{z+s/ jgfO{of] eg] /fd|f] pTkfbg lbg] hftsf] ljsf; x'g ;S5 . bf];|f] kl/If0fjf6
P;=P;=cf/= dfs{/ k|of]u u/L h}ljs ljljwtf x]bf{ !) j6f ;d'x jg]sf] / To;df ;d'x # / ^ ;j}eGbf
km/s /x]sf]n] oL ;d'x ;+u k|hgg u/fpbf j9L pTkfbg lbg] hftsf] ljsf; x'g] b]lvG5 . kl/If0f # /
$ jf6 cf/=Pn=!#, @!, cfO{=Pn=Pn=^$^*, (((^, ^)@$, ^*!!, &!^$, c?0f / dx]Zj/ ef/tL
hftx? ;+o'Qm ?kdf b'j} /f]ux? -cf]Onfpg] / 88'jf /f]u_ ;xg ;Sg] hftsf] ?kdf kfOof] . oL
hftx?sf] k|hgg sfo{df k|of]u ubf{ pTkfbgdf j[l4 x'g] b]lvG5 . kfrf}F kl/If0fjf6 b'O{ jif{sf] cf}ift
pTkfbg x]bf{ cf/=Pn=#( / cfO{=Pn=Pn=!)&! Hfft qmdzM !=@%$ d]=6=x]= / !=!(^ d]=6=x]=
pTkfbg lbPsf] kfO{of] / k|foM h;f] 7fpFdf oL hftx?sf] pTkfbg /fd|f] b]lvof] . Pkm@))#$(Pn=,
c?0f, #(P;^^Pn, cf/=Pn=$$ / cfO=Pn=Pn=!))&! hftx?df 7fpF tyf jftfj/0fsf] k|efj sd
k/]sf] b]lvof] ;fy} oL hftx?sf] pTkfbg ;j} r]s eGbf j9L ePsf]n] oL hftx? ;j} 7fpFx?sf] nfuL
pko'Qm b]lvG5 . ;fy} jftfj/0fsf] lx;fjn] v'dn6f/df @)!$ df cf/=Pn=#(, cf/=Pn=!! / @)!%
df cf/=Pn=#(, cfO{=Pn=Pn=^!, g]kfnu+hdf @)!$ df cfO{=Pn=Pn=!))^%, cf/=Pn=$$ / @)!%
df cfO=Pn=Pn=!))&!, cf/=Pn#(, k/jfgLk'/df @)!$ df cfO{=Pn=Pn=@#&#, l;l;/ / @)!% df
cfO{=Pn=Pn=!))$%, cfO{Pn=Pn=^)@$, /fdk'/df @)!$ df cfO{=Pn=Pn=!))&!, cf/=Pn=$$,
O6x/Ldf @)!% df cfO{=Pn=Pn=^@%^, cfO{=Pn=Pn@#&# n] /fd|f] pTkfbg lbPsf] kfOof] . pQm 7fpF /
jftfj/0fsf] nfuL oL hftx? nufpg' pko'Qm b]lvG5 .
k|f=8f= gj/fh clwsf/L gjn lszf]/ ofbj

d'Vo :fNnfxsf/ n]vs
xxii
1
1 INTRODUCTION
1.1 Background
Lentil is leguminous crop that is harvested solely for the dry seed. It is important
for source of high protein and fiber content as food, improves soil fertility and is good for
crop rotation. It has a broad genetic diversity from which climate-resilient varieties can be
selected.
Cultivated lentil is thought to have been originated and/or first domesticated in
western Asia and then introduced into the Indo-Gangetic plain around 2000 BC (Cubero,
1981. According to Cubero (1984) lentil was first spread to the Nile from the near east, to
Central Europe and then to the Indian Subcontinent and the Mediterranean Basin by the
end of Bronze Age. It is now cultivated in most subtropical and also in Northern
hemisphere such as Canada and Pacific Northwest of USA (Oplinger et al., 1990).
Lentil belongs to the genus Lens of the Viceae tribe in the Leguminosae (Fabaceae)
family, commonly known as the legume family (Fikiru et al., 2007). The scientific name
Lens culinaris was given by Medikus, a German botanist and physician in 1787 (Hanelt,
2001).Lentil (Lens culinaris Medikus subsp. culinaris) is a diploid (2n=2x=14
chromosomes), self-pollinating annual species. Its haploid genome size is estimated as
4063 Mbp (Arumuganathan and Earle, 1991). The cultivated lentil has two varietal types:
small seeded (microsperma) and large seeded (macrosperma) (Sharma et al., 1995). It is an
annual bushy herb with slender stem and having many branches with erect, semi-erect or
spreading growth habit (Sandhu and Singh, 2007).
It heights varing from 20 to 75 cm depending on growing conditions, usually with
two seeds per pods. Lentil colors range from yellow to red-orange to green, brown and
black (Dhuppar et al., 2012). Lentil seeds also vary in size, and are sold in many forms,
with or without the skins, whole or split.

2
According to the United States Department of Agriculture (USDA) National
Nutrient Database, 2015, 100 g of raw lentils (variety unspecified) provide 353 calories.
The same weight of cooked lentils provides 116 cal. Raw lentils possess 8% water, 63%
carbohydrates including 11% dietary fiber, 25% protein and 1% fat (Haytowitz and Ahuja
2015). Lentil is a rich source 20% or more of the Daily Value, (DV) of numerous essential
nutrients, including folate (120% DV), thiamin (76% DV), pantothenic acid (43% DV),
vitamin B6 (42% DV), phosphorus (40% DV), iron (50% DV) and zinc (35% DV), among
others (Bahle et al., 1993). When lentils are cooked by boiling, protein content declines to
9% of total composition, and vitamins B and minerals decrease (FAOSTAT, 2013). Lentil
has the second highest ratio of protein per calorie of any legume, after soybeans. The low
levels of readily digestible starch (5%), and high levels of slowly digested starch, make
lentils of potential value to people with diabetes (Akibode and Maredia, 2011; Materne and
Siddique, 2009). The remaining 65% of the starch is a resistant starch classified as RS1
(Sarker and Kumar, 2011). A minimum of 10% starch from lentils escapes digestion and
absorption in the small intestine and therefore called "resistant starch" (Frederick et al.,
2006). Lentil also has antinutrient factors, such as trypsin inhibitors and relatively high
phytate content. Trypsin is an enzyme involved in digestion, and phytate reduces the
bioavailability of dietary minerals (Iqbal et al., 2006). The enrichment of lentil with high
protein makes it the preferred pulse crop to rural poor household in the world, who are not
able to afford expensive animal meat and fish or their products and is also called poor
mans meat due to its low price compared to meat.
Lentil is an important source of dietary protein in human diets and animal feed
throughout West Asia and North Africa, the Indian subcontinent, North and South America
and Australia (Webb and Hawtin, 1981; Erskine, 1997).

3
Globally, lentil ranks sixth in terms of production among the major pulses (FAO,
2013), and constituted 6% of total dry pulse production. Lentils are relatively tolerant to
drought, and are grown throughout the world. The major production is primarily coming
from leading five countries viz. Canada (1,987,000mt), India (1,100,000mt), Australia
(348,080mt), Turkey (345,000mt) and Nepal (226,830mt). South Asia shares almost 50%
of lentil in the world. The total cultivated area of lentil in the world is as around 4.5 million
hectares producing 4.9 million metric tons of grain with an average production of 1260
kg/ha (FAO, 2014). In Nepal, lentil is cultivated in an area of 204,475 ha and produces
227,492 mt with a productivity of 1,113 kg/ha. It shares 64.35 percent production of total
grain legumes (MoAD, 2014/15).In Nepal, annual lentil production has grown from
143,084 to 227,492 mt between 2000/01 and 2014/15 cropping season with productivity of
801 to 1113 kg/ha, respectively (MoAD, 2015). The production of the crop is increased
significantly from year to year through expansion of net cropped area along with its
productivity. This increment was stimulated by greater improvement in demand of both
domestic and international market of the crop. Nepalese lentil has high demand
in Bangladesh and Bhutan (Yadav, 1997) and its demand has been increased in
international market Under temperate climatic conditions, lentil stubbles are left standing
over winter to trap snow to facilitate enough moisture by increasing infiltration, reduce the
rate of evaporation of soil moisture in spring and prevent erosion (Anonymous, 2008).
Lentil is among the principal cool season food legumes (Joseph et al., 2014). It is
grown as a winter crop and particularly important in terai and river basins, however, can
also be grown in medium to high hills in Nepal. It is one of the less selective legumes in
terms of climate and soil features (Cokkizgin and Munqez, 2013; and IBC, 2007). It has
usually well adapted to various soil types ranging from sand to clay loam when there is
good internal drainage (Ozdemir, 2002; and Joseph et al., 2014). It appears very sensitive
4
to water logged field conditions and even with short period of exposure it can cause the
crop to die easily (Brennan et al., 2002). It performs best on deep, sandy loam soils with
high in phosphorus and potassium content. A soil pH of 6-8 is conducive for lentil
production, but it can also tolerate a moderate alkalinity (Mulugeta, 2009). It is widely
grown in areas with annual rainfall ranging from 700-2000 mm. Lentil is considered as
drought-resistant crop that can tolerate low annual rainfall distribution even in the range of
280-300 mm (Brennan et al., 2002). Lentil is capable of germinating at a temperature
above freezing point but optimum germination occurs at the range of 18-21C.
Temperatures exceeding 27C can harm the crop aggressively but optimum temperatures
for growth and yields of lentil are around 24C (Muehlbauer et al., 1998). High humidity
with excessive rainfall during growing season promotes vegetative growth, which prevents
latter good yield and seed quality. It is highly susceptible to excessive moisture stress
hence farmers grow lentil on sloppy fields or use ridge and furrow system to drain excess
water from lentil field specifically from black soils (Vertisols) (Mulugeta, 2009).
Lentil has a capacity to improve soil nutrient status through symbiotic nitrogen
fixation, conserving soil moisture and limiting soil erosion (Muehlbauer et al., 1992).
Lentil has ability to grow in Nitrogen poor soils and it contributes to accumulate the
nitrogen in the soil that N2 can be used by succeeding crops (Mark, 2009). Around 250
million hectares of legumes are grown in the world and fix about 90 trillion gram of
nitrogen each year (Graham and Vance, 2000). According to Carranca et al. (1999), nature
of distribution of rainfall at vegetative growth stage affects the fixation capacity of lentil.
Matus et al. (1997) reported that N2 fixation of lentil was 10% higher when grown in zero
tillage as compared to conventional tillage practices. The study by Saxena and Wassimi
(1980) indicated that lentil can have a capacity to fix up to 107 kg N/ha. This implies about
21,879 ton of N is being fixed annually in Nepal. Moreover, it offers an indispensable

5
additional advantage emanating from its unique property in restoring and maintaining soil
fertility (Mulugeta, 2009; Victoria, 2012). Hence, lentil can also be used as a green manure
crop. The fixed nitrogen is used directly for plant growth and provides an excellent source
of protein for humans and livestock.
Lentil is dominantly cultivated by smallholder farmers based on their indigenous
knowledge. It is produced without chemical inputs and irrigation.
The demand for this commodity both in local and international markets has
increased significantly in recent years. About 68 percent of the lentils produced in the
world are consumed locally where they are produced while remaining 32 percent are
exported (Erskine, 2009). Canada was the biggest exporting country with 58.8 percent of
total world exports in 2010. The second biggest exporting country was Turkey with 13
percent of total exports, which was less than a quarter of Canadas export. Nepal accounted
for only 3.1 percent of total worldwide exports in 2010.
Nepal achieves premium lentil prices in Bangladesh and Middle Eastern countries
compared to anywhere else. Data also shows that there is a high scope of lentil export in
Pakistan and Sri Lanka.
Hence, lentil can be emerged as a cash crop upon cultivation of high yielding
varieties that fetch higher price compare to most of the cereals and pulses grown in Nepal.
However, low productivity per unit area and grain quality (small seeded, low plumpness) is
typical features of Nepali lentils. Very few improved varieties with desirable traits have
been developed in Nepal, in addition the uptake of what so ever available improved
varieties by growers is also very low and there has been little research outside breeding.
Average productivity of lentil in West Asia, North and East Africa including Nepal
is low due to use of predominantly low yielding, disease susceptible local cultivars. Local
cultivars have the limited yield potential and are also vulnerable to an array of stresses
6
(Sarker and Kumar, 2011). The yield limiting factors are lack of seedling vigor, slow leaf
area development, high rate of flower drop, low pod setting, poor dry matter, low harvest
index, lack of lodging resistance variety, low or no response to inputs, and subject to
various biotic (insects, diseases and weeds) and abiotic (temperature, soil fertility and
drought) stresses. Diseases are major factors that limit yields sometimes causes complete
crop failure and cause yield instability. There are about ten important lentil diseases in
Nepal, among which Fusarium wilt, Stemphylium blight, rust and root rots are the major
ones. Wilt and root rot occur as a complex and hence they are dealt together. Stemphylium
blight of lentil is another serious threat to lentil cultivation in South Asia, including Nepal,
Bangladesh, and in North America (ICARDA, 2004; Vandenberg and Morrall, 2002). The
pathogen has wide geographic distribution and infects plants in forty-three genera. These
diseases are usually causing about 25% yield loss in the normal year while 90% crop loss
seldom occurs. To this day the disease caused by Stemphylium blight is poorly understood
and no studies have been undertaken to elucidate the genetics of resistance (Kumar et al.,
2004). Stemphylium blight is a new disease in Nepal but it is assuming an important
position within few years of its appearance (Bayaa et al., 1998; NGLRP, 2000). It was first
reported in 1993 (NGLRP, 1993). Although no yield loss assessment studies have been
reported so far in Nepal. Weevil is another most serious post-harvest pest which infects
seed/grain causing huge loss under storage conditions.
As noted earlier, lentil has wider market opportunity domestically with increasing
and ever changing client demand. The release of only few varieties to date is a major
indicator of how much the crop is ignored for improvement. Thus, the government must
place lentil as a priority crop to receive funding sources from donors. The other major
factor hampering the wider dissemination of the available lentil varieties is the current seed
production problem.
7
Hence, genetic variability is very important for the improvement of crop plants.
The more the variability in the population, the greater is the chances for producing desired
plant types (Yadav, 1995). Heritability estimates and genetic advance in a population
provides information about the expected gain in the following generations. Selection and
yield testing are the two major phases of varietals development and the later one is highly
influenced by the locations and years of testing. The magnitude of genotype-environment
interaction and its components has a direct bearing on the environmental domain of the
varieties to be recommended for commercial cultivation. Developments of widely
adaptable genotypes remain the goal of almost all breeding programs. For this purpose, the
genotypes are grown in different environments and their yield stability is estimated before
giving any recommendations for variety release.
However, effective interpretation and utilization of multi environment test (MET)
data in Yield is a complex quantitative character and is greatly influenced by
environmental fluctuations; hence, the selection for superior genotypes based on yield
parse at a single location in a year may not be very effective. For developing stable
varieties, some stability parameters can be estimated employing models provided by Finlay
and Wilkinson (1963), Eberhart and Russell (1966), Perkins and Jinks (1968) and Freeman
(1973) and have been used in the search for an understanding of the causes of genotypes-
environment (G E) interaction.
Various methods have been introduced in trying to deduce cultivar reaction in
different situations. Additive Main Effects and Multiplicative Interaction (AMMI) analysis
is one of the popular parametric of multivariate methods to predict adaptation and stability
of cultivars. The AMMI model is a hybrid model involving both additive and
multiplicative components of two way data structure which enabled a breeder to get
8
precise prediction on genotypic potentiality and environmental influences on it (Gauch et
al., 1996).
Considering the above mentioned facts and problems for lower yield which laid to
less national production and lower economic benefits, this research was carried out aiming
to develop high yielding widely adaptive, Stemphylium blight and Fusarium wilt resistant
lentil varieties in a shorter period of time.
1.2 Objectives
The main objectives of the research were:
To assess the genetic diversity among local and exotic germplasm using phenotypic
attributes and DNA based SSR molecular markers.
To identify the germplasm for potential sources of resistance to Fusarium wilt and
Stemphylium blight disease of lentil.
To know genotype-environment interaction among elite lines and identify widely
and specifically adopted genotypes.

9
2 REVIEW OF LITERATURE
The available information with respect to various aspects of the present studies in
lentil is briefly reviewed below:
2.1 Genetic divergence using morphological traits
Barulina (1930) first recorded detailed morphological descriptions of lentil
landraces and species from Asia. World lentil germplasm displayed a wide range of
diversity on the basis of morphological traits (Erskine and Witcombe, 1984), hence local
germplasm has never been characterized in detail (Anon, 1996).
Morphological characterization is the first step in the classification and description
of any crop germplasm (Smith and Smith, 1989). Clusters on the basis of plant descriptors
have been described by (Singh, 1988; Caradus et al., 1989; Peeters and Martinelli1989;
and Clements and Cowling 1994).
Although multivariate analysis on quantitative traits provides a good evaluation of
landraces by identifying those that should be further evaluated at the genetic level, but
according to most researchers it should not be disassociated from botanical descriptors
2.1.1 Qualitative characters
2.1.1.1 Cotyledon color
Cotyledon color in lentil can be red/orange, yellow or green. No truly green
cotyledon lentils are being marketed at the present time although genetic stocks with green
cotyledons are available. Lentils with yellow cotyledons and testa without mottling or
other forms of coloration are called green lentils, a term that is a common market jargon
in developed countries. This expression is not used in major lentil producing and
consuming region of South Asia. Large green lentils are marketed to countries of southern
Europe, particularly Spain, Italy and Greece and small red type is exported to South Asia
and the Middle East (Muehlbauer et al., 2009).

10
Knowledge of the genetics of cotyledon color has progressed significantly with the
identification of the genes involved and linked molecular markers. The genetics studies of
cotyledon color of lentil were reported by Tschermak (1928) and by Wilson et al. (1970)
which showed that red/orange cotyledon color was dominant to yellow cotyledons and
controlled by a single gene. Singh (1978) and Slinkard (1978) reported that red cotyledon
color is completely dominant over green and yellow.
2.1.1.2 Seed coat color and seed coat pattern
Monogenic inheritance of seed coat color was reported by Kumar et al. (2005).
Background color of lentil seed coats is controlled by two genes (Vandenberg and
Slinkard, 1990). Dominant Ggc determines grey ground color while the dominant Tgc gene
produces tan ground color. When both dominant genes are present (Ggc Tgc), brown seed
coat color is produced. The double recessive (ggc tgc) has green seed coat color.
Mottled testa is dominant over non-mottled testa and brown testa over tan. (Kumar
et al., 2005) reported flower color is controlled by a single gene and purple colour is
dominant over white.
2.1.1.3 Pod color
Genes that are expressed in the pods are Glp and Grp (Vandenberg and Slinkard,
1989). The dominant Grp gene produces red pods, while the homozygous recessive grp
allele produces green pods
2.1.1.4 Leaf tendril
Leaves without tendrils are controlled by a single recessive gene (Vandenberg and
Slinkard, 1990).
2.1.2 Quantitative characters
2.1.2.1 Studies on variability parameters (variability, heritability and genetic advance)
Genetic variability is the most important basis of selection for making advancement
in any breeding program. Some of the studies on this aspect in lentil are briefly given
below:
11
Nandan and Pandya (1980) recorded significant differences for all the traits studied
except plant height and broad sense heritability was medium to high for seed yield per
plant, seeds/pod and branches per plant. Pods per plant showed the highest genotypic
coefficient of variation.
Basant et al. (1983) reported that the range of variability was the highest for grain
yield per plant followed by the pods per plant and was lowest for days to maturity.
Dixit and Dubey (1984) recorded the highest heritability for days to 50% flowering
(94.50%) followed by seed yield (72.88%).
Shahi et al. (1986) recorded that the genetic variability for seed size ranged from
1.4 - 3.4 g/100-seed.
Sharma and Luthara (1986) reported wide variability for pods per pant, seeds per
plant and seeds per pod over years.
Erskine et al. (1989) observed the high variability for the yield and yield related
traits in a world lentil collection.
Kalia and Gupta (1989) reported high genetic variability for seed yield, biological
yield, harvest index, pods per plant, 100-seed weight, plant height, time to 50% flowering
and days to maturity in the irradiated populations of macrospema and microsperma lentil.
Ramgiri (1989) observed high heritability coupled with high genetic advance for
seed yield, biological yield, harvest index, leaf area, reproductive phase, 100-seed weight
and crushing hardness.
Kishore and Gupta (2002) evaluated 475 recombinant lines and reported that
sufficient genetic variability for seed yield per plant, biological yield per plant, 100-seed
weight, harvest index, seeds per pod, days to 50% flowering, and days to maturity.
Biological yield per plant and seed yield per plant showed high degree of PCV. GCV and
12
genetic advance Heritability was high for biological yield per plant and days to maturity
whereas moderate for seed yield per plant and most of the traits.
Hamdi et al. (2003b) reported the environments (season and location) showed
major effects on the performance of 24 lentil genotypes in two different 1997/98 and
1998/99 seasons. High phenotypic variation was observed for number of pods and seeds
per plant. Considering wide variability, heritability and genetic advance, progress could be
expected from selection for number of seeds per plant and seed yield per plant.
Bicer et al. (2004b) conducted a field experiment with 26 lines of lentil in Turkey,
to evaluate genetic variability. They observed that the highest genetic variation was
recorded for biological yield and seed yield per plant. The highest heritability was recorded
for seed weight and days to 50% flowering.
Gangle and Rao (2005) conducted an experiment with 25 genotypes of lentil to
evaluate genetic variation. High genetic variation was observed for number of effective
pods per plant, number of seeds per pod, and total number of pods per plant, 100-seed
weight and harvest index. Low genetic variation was observed for days to 50% flowering,
days to maturity, days to grain filling, plant height, pod length and biological yield.
Heritability was high for all traits except days to grain filling. Number of seeds per pod,
number of pods per plant showed high heritability and high genetic advance, while 100-
seed weight, number of seeds per pod, plant height and days to 50% flowering showed
high heritability with moderate genetic advance. The results indicated that indirect
selection for number of pods per plant, seed number per plant and number of effective pods
per plant were contributed to the genetic improvement of lentil.
Tayyaba et al. (2005) evaluated three hundred and seventeen accessions of lentil
and characterized them for stem color, pedicle color, growth habit, tendrils, hairiness, leaf
pubescence, leaflet size, pod pigmentation, pod indehiscence, presence/absence of beak,

13
seed coat color, seed coat pattern, seed coat pattern color and cotyledon color. High
variability was observed for growth habit, leaf pubescence, leaflet size, seed coat color,
seed coat pattern and seed coat pattern color that could be expanded and exploited for
developing breeding material and to use for Marker Assisted Selection. Though clusters
analysis grouped together accessions with greater genetic similarity, the cluster did not
necessarily include all the accessions from same origin.
Anita et al. (2007) conducted an experiment and found that the phenotypic
coefficient of variability (PCV) and genotypic coefficient of variability (GCV) showed
similar trends for almost all characters of 39 lentil genotypes. High heritability was
observed in all the characters except number of seeds per pod and plant height. High
heritability coupled with high genetic advance was observed in number of seeds per pod
and all other characters exhibited high heritability with low genetic advance (GA) values.
Sirohi et al. (2007a) found highly significant differences between 25 genotypes of
lentil for all the characters under study. High phenotypic and genotypic coefficient of
variation coupled with higher heritability and high genetic advance, was observed for
biological yield per plant. Correlation and path coefficient analyses revealed that harvest
index, biological yield and number of seeds per pod were the best characters for realizing
improvement in seed yield in lentil.
Nadia et al. (2008) observed significant variation for all the traits under study. High
heritability was observed for all the traits, except primary branches per plant. Heritability
and genetic advance were observed higher for seed yield (97.10%, 90.71%). harvest index
(96.20%, 63.29%) and maturity days (95.90%, 63.39%), indicating that these characters
were mainly controlled by additive genes and selection of such traits might be effective for
the improvement of seed yield. Days to flower, plant height, number of primary branches,
biological yield harvest index and hundred seed weight had positive direct effect on seed
14
yield. Biological yield, hundred seed weight and harvest index also had positive and highly
significant genotypic and phenotypic correlation with seed yield.
Sobia et al. (2008) conducted an experiment during 2006-07, in Faisalabad,
Pakistan, to exploit yield components to the maximum extent and to formulate selection
criteria for the improvement of seed yield with fifteen lentil lines/cultivars. Significant
genetic variation was observed for all the traits under study. All the traits had high
heritability values, except for number of primary branches. Higher values of heritability
coupled with genetic advance were observed for seed yield (98.30%, 128.20%), harvest
index (97.10%, 79.40%), biological yield (94.30%, 56.10%) and hundred seed weight
(88.30%, 50.80%) which indicated the role of additive genes to control these trails.
Hundred seed weight, harvest index and biological yield had positive and highly
significant Correlation with seed yield at both genotypic and phenotypic levels. It was
concluded that the traits like hundred seed weight, harvest index and biological yield can
be exploited for the improvement of seed yield in lentil.
Fikiru et al. (2010) evaluated seventy Ethiopian lentil landrace accessions to study
morphological and genetic diversity using nine morphological traits and four SSR markers
and reported high phenotypic coefficient of variation (PCV) for number of primary and
secondary branches, pods per plant and seeds/pod, and seed yield showed while low PCV
for, plant height, hundred seed weight, days to flowering and days to maturity.
Tyagi and Khan (2011) conducted experiment during winter (rabi) season of 2007
and 2008 using 30 genotypes of lentil and revealed that days to 50% flowering, biological
yield per plant, seed yield per plant and100-seed weight showed significant differences and
wide variations during both years. Pods per plant, days to 50% flowering, biological yield
per plant, seed yield per plant and 100-seed weight showed high heritability coupled with
high genetic advance (per cent of mean) in both the years.

15
2.1.2.2 Studies on association among seed yield and other traits
Since grain yield is the ultimate product of lentil, information on it association with
other characters contributing towards yield is necessary to identify the best characters
combination for high yield. Relationship between yield and yield contributing characters
are usually studied by correlation and path coefficient analysis in lentil. Information on the
nature of magnitude of association between yield and yield contributing characters is
therefore helpful for selection of high yielding genotypes in lentil.
Path coefficient analysis reflects light on the causes of relationship between yield
and yield contributing characters. It could be used for formulation of selection index for
effective improvement through selection. It separates the Correlation coefficients between
yield and yield contributing characters into direct and indirect effects.
Todorov and Todorov (1980) reported that yield was positively correlated with
plant height, length of growth period and number of pods per plant.
Tikka and Asawa (1981) noted that yield was correlated with number of primary
and secondary branches, pods per plant and days to flowering.
Chauhan and Sinha (1982) reported that yield had significant and positive
correlation with pod number, secondary branches and plant height. They further reported
that secondary branches had the highest direct effect on grain yield followed by days to
maturity and pods per plant.
Sarwar et al. (1982) observed the positive and significant association of plant
height, pods per plant, seeds/ pod and yield per plant per day with yield per plant, whereas
days to maturity was significantly and negatively correlated with plant height, number of
seeds/pod, 100-seed weight and yield per plant/day.
Rahman and Sarwar (1982) reported the significant and positive correlation of days
to flowering with days to maturity, number of pods per plant with yield per plant, plant
16
height with number of pods per plant, number of primary braches with secondary branches,
100-grain weight with yield per plant. Days to flowering was significantly but negatively
correlated with 100-seed weight.
Basant et al. (1983) observed that grain yield was significantly and positively
correlated with plant height and number of secondary branches per plant and negatively
with pod breadth. They revealed that pod per plant and secondary branches per plant had
positive direct effect on grain yield, while days to flowering, days to maturity, primary
branches, pod length and pod breadth had negative direct effect on grain yield.
Sarwar et al. (1984) reported that seed yield had high positive association with pods
per plant. He further observed that pods per plant and 100-seed weight had high direct
effect on grain yield.
Saraf et al. (1985) noticed the positive association of 100 seed weight with
branches per plant, pods per plant and plant height.
Eissa et al. (1987) stated that seed yield was positively correlated with pods per
plant, he further observed that pods per plant exerted the highest direct effect on seed yield.
Zaman et al. (1989) observed the positive association of seed yield with branches
per plant and pods per plant.
Gupta et al. (1991) reported positive association of seed yield with biological yield,
harvest index, plant height and days to flowering and negatively with reproductive phase..
Harvest index showed positive association with days to flowering, whereas it had negative
association with single pod weight and 100-seed weight. Seeds/pod had positive
association with plant height, and negative with 100-seed weight. Plant height with days to
flowering and days to maturity exhibited positive correlations.
Dixit and Dubey (1984) reported number of pod per plant, plant height and the
number of branch/per plant had direct effect on grain yield.

17
Kumar et al. (1995) reported positive association between pods per plant number of
and seed yield Singh et al. (1995) revealed positive association between number of pods
per plant and seed yield.
Kishore and Gupta (2002) reported that seed yield per plant showed significant
positive association with biological yield per plant, harvest index, seeds per pod, 100-seed
weight and days to 50% flowering.
Rakesh et al. (2002b) observed the values of genotypic correlation were slightly
higher than, the corresponding phenotypic values. Seed yield exhibited significant positive
association with harvest index, pods per plant, seeds per pod, biological yield, and pods
cluster-1 and plant height.
Yadav et al. (2003) reported 50 diverse genotypes of lentil which were evaluated
for character association and path coefficient analysis under two different environments.
Seed yield per plant showed positive significant association with biological yield per
plant and harvest index in two different environments and with pods per plant in
environment1 (E1) and primary branches per plant in environment2 (E2). Path analysis
indicated that biological yield per plant had the maximum positive direct effect on seed
yield in both the environments, followed by pods per plant and seeds per pod. Almost all
the yield contributing characters had higher positive indirect effects via biological yield per
plant.
Hamdi et al. (2003c) carried out correlation and path analyses for 24 lentil
genotypes and found that seed yield was positively and significantly correlated with pod
and seed numbers, plant height and number of branches per plant and negativity with
flowering duration. Days to 50% flowering had significantly correlated with days to
maturity. Path analysis revealed that number of seeds plant'1 had the highest direct effects
on seed yield followed by pods per plant.

18
Rathi (2004) observed grain yield plant'1 was significantly and positivity correlated
with all the traits, except days to flower, maturity and 1000-grain weight in F1, whereas in
F2, grain yield was positivity and significantly correlated with all the traits except number
of pods cluster-1, 1000-grain weight and protein content.
Verma et al. (2004) reported seed yield under rainfed condition had highly
significant positive correlations with number of pods per plant, number of seeds per plant,
seed weight per plant, total dry matter m-2 and harvest index, whereas under irrigated
condition, seed yield had strong positive correlation with number of seeds per plant, total
dry matter weight and harvest index.
Kakde et al. (2005) carried out an experiment with 25 genotypes of lentil to
estimate correlation and path analysis among these genotypes which were grown under
different fertilizers levels. They revealed that seed yield per plant showed positive
Correlation with harvest index, biological yield,100-seed weight and seeds per plant, while
seed yield per plant showed negative correlation with plant height in environment1 (E1)
and environment2 (E2). In environment3 (E3), seed yield per plant was negatively
correlated with pods per plant.
Anita et al. (2007) reported that seed yield per plant had significant positive
correlation with plant height, number of seeds per pod and primary branches per plant. The
highest positive co-relation values were observed between seed yield per plant and plant
height, number of secondary branches per plant and 100-seed weight. There was high
negative co-relation between seed yield per plant and 100-seed weight.
Sinha and Singh (2007) showed highly significant differences between 25
genotypes of lentil for all the characters under investigation. Correlation and path
coefficient analyses revealed that harvest index, biological yield and number of seeds per
pod were the best characters for realizing improvement in seed yield in lentil.
19
Abdul Latief et al. (2011) evaluated, 214 lentil landraces collected from Jordan and
reported significant differences among them for seed yield, biological yield, pods per plant,
per pod, seed weight, plant height and primary branches. Seed yield showed significant
positive correlation with biological yield, pods per plant, seed yield and plant height and it
has negatively correlated with days to flowering. Biological yield had significant positive
correlation with number of pods per plant, seed weight and plant height. Positive
significant correlation was also observed between plant height and both of seed weight per
plant and number of pods per plant and seed number per pod.
and 2008 using 30 genotypes of lentil and revealed that The characters viz., biological
yield per plant and number of primary branches per plant showed positive and significant
correlations with seed yield per plant and exerted positive and high direct effects on seed
yield per plant for both years.
Tadele et al. (2013) evaluated twelve lentil germplasm at two locations of south
eastern Ethiopia in 2012/13 cropping season to obtain information on genetic diversity and
variability and reported that number of pods per plant (0.92) had positive and highly
significant association with seed yield. Genotypic correlation revealed that number of pod
per plant had positive and highly significant association with seed yield, whereas hundred
seed weight, days to maturity, number of seeds per plant and plant height had positive but
non-significant association with seed yield per plot. Hundred seed weight (0.52), days to
maturity (0.44), number of seeds/pod (0.23) also showed positive association with seed
yield.
Firas and Al-Aysh (2014) revealed that numbers of primary branches per plant,
number of pods per plant, biological yield and seed yield have high estimates of GCV,
heritability and genetic advance over character mean. The seed yield showed positive and
20
highly significant associations with number of primary branches per plant and biological
yield at the both genotypic and phenotypic levels. Numbers of primary branches per plant,
plant height and days to 50 % flowering have direct positive effects on grain yield.
Mara et al. (2014) found plant height has positive correlation with number of pods
per plant, number of seeds per pod and these characters have contributed to high yields and
high harvest index. Populations with larger seeds have a lower harvest index. Largest seeds
are in longest pods, appearing a smaller number of seeds in these pods.
2.1.2.3 Genetic divergence
Jeena and Singh (2001) carried out hierarchical cluster analysis involving 30
genotypes (28 wild accessions and two cultivars) of lentil, based on morphological and
quality parameters they found 3 clusters. Widest range of Euclidian distances (Eds) was
observed for cluster II fallow by cluster I and III.
Singh et al. (2001) investigated the genetic divergence of 58 diverse strains of lentil
by multivariate analysis. A wide genetic distance was observed among the genotypes.
Cluster analysis revealed that cluster VII contained 12 genotypes, while cluster III
contained 2. The inter cluster distance was lowest between clusters II and IV and was
highest between clusters III and VI.
Jeena and Singh (2002) evaluated genetic divergence among sixty-one wild lentil
accessions with 20 quantitative traits using Mahalanobis, I) analysis and accessions were
grouped into 4 clusters, in which cluster I included 58 accessions while other clusters
received only one accession each and concluded that genetic diversity was not related to
geographical diversity and species differences.
Rakesh et al. (2002a) conducted a field experiment and reported genetic variation
in 44 lentil cultivars they grouped into five clusters. Genetic distance was highest between
21
cluster VIII and IX, indicating greater divergence between cultivars belonging to these
clusters.
Tejbir and Gupta (2004) carried out an experiment with forty genotypes of lentil to
study the genetic divergence during two successive years (1998-99 and 1999-2000) in
Uttar Pradesh, India. Analysis of variance (ANOVA) revealed significant differences
among genotypes for all the characters except days to 50% flowering, days to maturity and
harvest index in both the years. The forty genotypes were grouped into six and seven
clusters in the 1st and 2nd years, respectively. The relative composition of clusters differed
in the 2 years due to involvement of genotype environment interactions.
Rakesh et al. (2004a) reported the divergence analysis using Mahalanobis D2
statistics, among 44 genotypes of lentil, which were grown in Hardwar, Uttar Pradesh.
India, during Rabi (1996) the 44 genotypes were grouped into 10 clusters including 4
single genotype clusters. Genotypes of different eco-geographical regions were clustered
together. Maximum genetic distance was observed between cluster VI and X, indicating
greater genetic divergence between the genotypes belonging to these clusters. Number of
days to 50% flowering, number of clusters per plant and number of pods per cluster
indicated number of maximum differences between groups.
Chauhan et al. (2005) conducted an experiment using non- hierarchical Euclidean
cluster analysis and grouped the 160 genotypes of lentil into 6 distinct clusters indicating
existence of considerable genetic diversity in the germplasm collection. The 6 clusters
contained genotypes of heterogeneous origin, thereby indicating no parallel between
genetic and geographic diversity.
Haddad et al. (2007) conducted an experiment with sixty landraces of lentil to
study variability that they had for several yield characters, the investigated landraces
showed various degrees of variation based on the location and the characters under
22
investigation. The heritability (H) values ranged from 0.64 for harvest index 0.81 for straw
yield, Die average diversity index over all studied characters was 0.720 which was less by
around 15% than those reported for lentil landraces collected 20 years ago.
Sirohi et al. (2007b) observed the genetic divergence among 25 cultivars of lentil
using D2 statistic for 12 morphological traits. The cultivars were grouped into seven
clusters. Cluster VII had maximum number of genotypes (6), while, cluster IV had single
genotype. The maximum inter genetic distance was recorded between cluster IV and VI
(7.392) followed by cluster IV and V (6.675), suggesting wide diversity among these
groups.
Fikiru et al. (2010) did cluster analysis of seventy Ethiopian lentil landrace
accessions based on nine morphological traits and four SSR and revealed two and three
major groups respectively.
Tyagi and Khan (2010) studied fifty genotypes of lentil under eight environments
for seed yield and its associated traits. All the genotypes were grouped into seven clusters.
The composition of various clusters varied from 2 to 12. Clustering pattern revealed the
distribution of the genotypes belonging to the same origin in more than one cluster
indicating no correlation between geographic and genetic diversity. Members of cluster II
and VII were highly diverse from each other as these clusters showed maximum inter-
cluster distance. The entries of cluster VII showed the highest mean values for number of
primary branches per plant, biological yield per plant, seed yield per plant and 100-seed
weight.
and 2008 using 30 genotypes of lentil and revealed D2 analysis groped accessions into
three clusters having 16, 10 and 4 accessions. The highest genetic diversity was observed
between cluster I and III.

23
2.2 Genetic divergence study using molecular markers
The first genetic map of lentil was constructed using morphological and isozyme
markers in early 1980s (Zamir and Ladizinsky, 1984; Tadmor et al., 1987). After the
discovery of molecular markers starting from the restriction fragment length polymorphism
(RFLP), significant progress has been made in molecular marker development and
genotyping platforms in lentils. It began with the hybridization based DNA markers such
as RFLP (Havey and Muehlbauer, 1989) and moved toward the use of PCR based markers
such as random amplified polymorphic DNA (RAPD), amplified fragment length
polymorphism (AFLP) and simple sequence repeats (SSR) markers for genotyping. The
first comprehensive linkage map with 177 RAPD, AFLP, RFLP, and morphological
markers was developed using inter specific recombinant inbred lines (RIL) population of a
single cross of L. culinaris L. orientalis (Eujayl et al., 1998a). Among the various PCR
based markers, SSR markers have made significant contribution to the recent development
of lentil genome maps. The first genomic library was constructed from a cultivated
accession, ILL5588 using the restriction enzyme Sau3AI (Staphylococcus aureus 3A) and
screened with (GT)10, (GA)10, (GC)10, (GAA)8, (TA)10, and (TAA) probes (Hamwieh,
2005). Using this library initially a set of 30 highly polymorphic SSR markers were
developed. Since this study was aimed at isolating SSRs that are abundant and well
distributed in the genome, a non-enriched library was used for screening purposes.
Hamwieh (2009) further developed an additional set of 14 SSR markers and used them for
genetic diversity analysis of the lentil core set. A set of 122 functional SSR markers have
recently been developed using a genomic library enriched for GA/CT motifs for utilization
in the lentil breeding program (Verma, 2014).

24
2.3 Study on Fusarium wilt
2.3.1 Disease inoculums 'build up, infection, losses and scoring
Soil-borne fungal diseases of food legumes are more important and cosmopolitan in
nature Fusarium wilt appears in the field in patches at both seedling and adult stages.
Seedling wilt is characterized by sudden drooping, followed by drying of leaves and
seedling death. The roots appear healthy, with reduced proliferation and nodulation and
usually no internal discoloration of the vascular system, while adult wilt symptoms appear
from flowering to late pod-filling stage and are characterized by sudden drooping of top
leaflets of the affected plant, leaflet closure without premature shedding, dull green foliage
followed by wilting of the whole plant or of individual branches. Seeds from plants
affected in mid-pod-fill to late pod-fill are often shriveled.
Symptoms of Fusarium wilt are easily confused with root or crown rots; stem
cankers; insect, grub, or borer injury; drought; compacted or poor soil; and two other
widespread wilt diseases, Verticillium wilt and bacterial wilt, a common disease in the
South In general, Fusariium oxysporum attacks plants and is most severe at air and soil
temperatures of 24C to 32 or 35C (75 to 95F).
Kannaiyan and Nene (1975a) reported sowing date affects wilt incidence In India,
delayed sowing reduces disease incidence, but late sowing dramatically reduces yield
potential and its effect on disease. Development differs over locations and seasons. In
Syria, early sown crops are usually less affected. This is mainly due to differences in
temperature at sowing, in time.
Manandhar (1975) reported vascular wilt in Nepal first time and Fusarium wilt and
root rot can cause up to 100% yield losses under heavy infestation, depending on relative
humidity, soil moisture, and soil temperature.

25
Kannaiyan and Nene (1979) revealed that a crop rotation of 4-5 years reduces
inoculums density in the field, but does not completely eradicate the disease. In India,
cultivation of paddy or sorghum in the rainy season reduced lentil wilt incidence the
following winter.
Bayaa et al. (1994) compared screening methods and found strong correlation
between field and greenhouse disease reaction. Plant age has a dramatic effect on
resistance; for example, many lines exhibiting resistance at the seedling stage are not as
resistant at the adult stage (ICARDA, 1990). Cultivars with resistance to wilt have been
released. Pant L 406 (Pandya et al., 1980) and Pant 4 (Singh et al., 1994) in India.
Beniwal et al. (1993) observed that Fusarium wilt appears in the field in patches at
both seedling and adult stages.
Chowdhury et al. (1997) reported that epidermal hairs, thickness of epidermis and
cortical layer plays an important role in disease resistance in lentil .Resistance in lentil is
considered the most practical and environmentally sound means of vascular wilt
management for lentil.
ICARDA (2003) reported yield losses up to 72% in Syria due to vascular wilt and
complete crop failure has been reported in other areas where conditions favor infection,
especially in years with warm temperatures in spring.
Joshi (2006) reported that in Nepal wilt and root rot occur as a complex and hence
they are dealt with together and yield losses due to wilt/ root rot complex in Nepal are
estimated at 25-40% land lentil varieties/genotypes such as Simal, Smrik, Khajura-1Shital,
Bari Masur-4, and Maheswor Bharati possess field resistance to vascular wilt. She also
reported that Root rot severity was increased by soil compaction, poor drainage, excess or
deficient soil moisture, poor fertility, low pH and extremes of both low and high
temperatures.
26
Neupane et al. (2008) observed that application of wilt management technology
(IWM) in lentil, chickpea and pigeon pea resulted in considerably lowering the wilt disease
incidence and yield increases of 26% over the control (non-IWM). IWM technology
included use of disease resistant varieties/genotypes, seed dressing with a mixture of
fungicides Bavistin and Thiram and crop rotation with non-host crop.
Gharti et al. (2011) reported genotypes, ILL 9993 and ILL 7715 possess field
resistance to vascular wilt while ILL 590, PL 406, ILL 7164 and F 2003-49L were
moderately resistant to wilt.
2.3.2 Treatment/control
We should choose resistant varieties when available. Control garden insects, such
as cucumber beetles, which are known to spread the disease. Remove all weeds from the
garden (many weed species host the disease). The biological fungicide Mycostop will
control wilt caused by Fusarium. If the disease persists, remove the entire plant and
solarize the soil before planting again. Soil solarization will reduce or eliminate many soil
inhabiting pests, including nematodes, fungi, insects, weeds and weed seeds (Kannaiyan
and Nene, 1974).
Kannaiyan and Nene, (1974) reported seed treatment with benomyl control the
disease. Agrawal et al. (1975) reported that seed treatment with thiram +
pentachloronitrobenzene or thiram + carboxin reduced the disease incidence. Khalid
(1990) observed benomyl and captan to be effective in Pakistan.
2.4 Study on Stemphylium blight
2.4.1 Disease inoculums build up, infection and scoring
Stemphylium blight is a serious problem in some parts of the world especially in
West Asia and South Asia, North Africa and widely distributed in Saskatchewan, Canada
where it was considered to be a minor disease of lentil. Stemphylium blight is a new

27
disease in Nepal. It was first reported in 1993 (NGLRP, 1993) the disease is wide spread in
terai, inner terai and foot hills of Nepal.
Environment plays a major role in Stemphylium blight disease development and
that is why understanding the environmental role in disease development is important for
effectively controlling the disease. The diverse host range S. botryosum that includes
leguminous and non- leguminous crops in different parts of the world indicates the
adaptability of the pathogen to different environmental conditions.
Bakr and Ahmad (1992) found differences in susceptibility in different genotypes.
They have reported 62% yield loss due to Stemphylium blight in Bangladesh.
Sinha and Singh (1992) found that disease intensity reached 82.5% on unsprayed
plot of a local susceptible cultivar causing losses of 93.4% in yield with natural infection
by Stemphylium botryosum.
Erskine and Sarker (1997) reported that in Bangladesh it can cause 70% yield loss
up to total crop failure in epidemic years and in South Asia, temperatures of 18-20C and
relative humidity of over 85% were favorable for the development of disease. They also
mentioned that Barimasur-4 (developed from a local cultivar of Bangladesh, Utfala) shows
significant resistance against rust and Stemphylium blight.
Bayaa and Erskine (1998) reported that Stemphylium botryosum is spread by air
borne conidia. They also mentioned that it leave on seed and as mycelium on dead stems
and leaves in many crops.
Bayaa et al. (1998) reported the disease from Banke, Bardia, Rupandehi, Chitwan,
Makwanpur, Bara, Parsa and Rautahat districts. The disease is regular in appearance.
Although no yield loss assessments have been done so far in Nepal.
Du Toit and Derie (2001) reported that temperature and moisture are the two most
important environmental factors for Stemphylium blight infection.

28
Camara et al. (2002) reported that morphological and developmental characters
such as size and shape of the conidia, conidiophores, ascosporous and the size and time of
maturation of pseudothecia were useful for diagnosing species Conidiophores are short,
arise singly or in groups and are aseptate and swollen at the apex.
Vandenberg and Morrall (2002) reported that with the increase of lentil production
and deployment of resistance to ascochyta blight and anthracnose in new cultivars,
Stemphylium blight has become a more serious problem.
Mwakutuya (2006) observed that the pathogen requires at least 8 hours of wetness
at low temperatures (10C) for successful infection and infection increases with increased
leaf wetness for 24hr. Hashemi (2005b) modified Horsfall-Barrats logarithmic scale to a
0-10 linear semi-quantitative scale. This scale considered disease development pattern
consisting of the appearance of chlorotic spots followed by gradual defoliation of plants
(0= free of disease, 1= a few tiny tan spots, 2= few small to large chlorotic spots,
3=expanding lesions on leaves to defoliation started, 4=20% nodes on main stem showing
necrotic symptoms and defoliation, 5= 40% nodes on main stem showing necrotic
symptoms and defoliation, 6= 60% nodes on main stem showing necrotic symptoms and
defoliation, 7=80% nodes on main stem showing necrotic symptoms and defoliation,
8=100% leaves defoliate but small green tip recovering, 9=100% leaves defoliate but stem
still green, 10= Completely dead). Kumar (2007) used this scale (0-10) for Stemphylium
blight screening.
2.4.2 Treatment/control
Preliminary screening at the Crop Development Center (CDC) of University of
Saskatchewan showed that Crimson, Eston and ILL 4605-2 and ILL-8008 have good
resistance against Stemphylium blight.

29
Gharti et al. (2008) reported that use of moderately resistant genotypes like ILL
7164 and Bari Masur-4, intercropping either with rape seed mustard or linseed or coriander
in 2:1 ratio and two sprays of Mancozeb 75 WP after disease appearance could reduce
Stemphylium blight disease severity to a great extent.
2.5 Study on genotype-environment interaction
Genotype-environment (g e) interaction is the interplay between genetic
constitution of individuals and the environment to which they are exposed. Therefore, the
knowledge of g e interaction is of paramount importance in evaluating any breeding
material. Stability of yield, a breeding objective, difficult to be achieved is defined as the
ability of genotype to avoid substantial fluctuations in yield over a wide range of
environments. Yet the plant breeder's worldwide have been striving hard to evolve
varieties which are stable and adaptive to wide range of agro-climatic conditions. Due to
lack of precise techniques, the plant breeders were unable to quantify the g e interactions
and were not able to exploit them either due to complexities of the environments or
cumbersome measurement of the stability parameters. The covalence 'approach of Wricke
(1962), in which individual variety is assigned an index on the basis of value obtained from
the sum of deviations due to a variety's regression being different from unity plus deviation
from its own regression, was also not appreciated as it did not clearly indicate the nature of
differential response to changing environments. The recent developments suggested that
genotype-environment interaction can be considered as the response of a genotype to the
environments in which it is placed. Not only is this response predictable but perhaps
heritable also. These possibilities arose only with the realization that a range of genotypes
could provide a powerful tool to measure the environmental complexity and can be used to
grade a series of environments. This concept of using the biological scale to measure
environment was first suggested by Finlay and Wilkinson (1963). They first utilized the
30
regression approach, developed by Yates and Cochran (1938), for measuring the
differential response of genotypes of barley and established the regression of an individual
genotype on the environmental index as a measure of phenotypic stability. This regression
approach was further modified by Eberhart and Russell (1966) and Perkins and Jinks
(1968) by relating the expectations of statistical analysis to the standard biometrical model
of gene effects for g e interaction Johnson (1977), whose analysis provided complete
information on genotypic similarity in terms of mean differences, relative stability and
comparative stability. Verma et al. (1978) mentioning the limitations of conventional
regression analysis for detecting theoretical ideal genotype, having low responsiveness in
poor environments but high responsiveness in favorable environment along with high yield
and stability, proposed the computation of separate regression coefficients on the two
regions of the response curve.
Despite the above developments in measuring g e interaction, the regression
approach of Eberhart and Russell (1966) and Perkins and Jinks (1968) is still the best for
measuring the nature and causes of g e interaction, not only for population but also for
individual genotypes, because it provides both statistical and genetic interpretation of g e
interaction. The only major objection to this approach has been the use of dependent
environmental index measuring the response of a genotype (Freeman and Perkins, 1971).
Various alternatives have also been proposed to make the measurement of environmental
index independent of the values of genotypes evaluated for their responsiveness and
stability (Freeman and Perkins, 1971) have suggested that the alternative approaches make
little difference to the conclusion drawn from most experiments using dependent
environmental index.
Eulaxias and Eliades (1980) studied the 10 small seeded lentils at seven sites in two
years, and reported that varietal yields varied with years and site.
31
Yadav et al. (1991) reported that a large proportion of populations have predictable
behavior of g e interaction for seed yield and yield components and only limited
genotypes showed non predictable behavior for component characters.
Study on genetic divergence for yield and yield contributing character is very
important in evaluating the variation in a breeding population. In addition genetic diversity
is essential to meet the diversified goals of plant breeding such as producing cultivars with
increased yield, wider adaption, desirable quality, pest and disease resistance (Nevo et al.,
1982). Genotypes from different clusters as grouped by Euclidean Ward's method usually
give wider variation for yield and yield contributing characters when they are crossed.
Solanki (2001) conducted a field experiment to evaluate stability analysis of seed
yield and its components among 72 genotypes of lentil. Out of seventy-two genotypes,
nine genotypes (LH91-9, LH 84-8, L 9-12, LH 94-5, PL 81-17, LH 92-63 and LH 92-65)
showed high yields and were stable over a wide range of environments; L 4603, IPL 71,
KH 94-12, LH 92-78 and L 4146 were responsive to superior environments and IPL 76 and
LH 90-110 to inferior environments. The stability of genotypes for yield in the superior or
inferior environment was impaired by the stability of different yield contributing traits.
Singh and Singh (2004) study genetic gain for yield and yield components of lentil, in the
crosses of Precoz Set. and Pant lentil 639 and observed high genetic gain for phenotypic
variances: harvest index, number of primary branches plant per plant, number of secondary
branches per plant, and number of seeds. The additive genetic variance (sigma2 A) was also
high for all the characters except number of seeds per pod and number of primary branches
per plant. The heritability in the narrow sense was high for all the characters except
number of days to 50% flowering and harvest index.
Bicer and Sakar (2004a) studied genetic variability among 14 genotypes of lentil, in
two different locations, in Turkey and revealed that analysis of variance for all the traits
32
under study showed considerable variations. Grain yield ranges from 158.4 to 235.7 kg/ha.
Genotype location interaction for biological yield per plant, seed yield per plant, number
of pods per plant and number of seeds per plant was significant for these characters.
Rakesh et al. (2005) conducted an experiment with 44 lentil genotypes under eight
environments in Hisar, Haryana, India, to study their stability for yield and other relevant
characters. Individual regression analysis over all the eight environments revealed that
most of the genotypes exhibited predictable linear type of genotype* environment
interaction in terms of mean performance and response to changing environment for the
traits
Bicer et al. (2006) conducted an experiment in Turkey, to study the grain yield of
some lentil genotypes. Combined analysis of variance for grain yield indicated that the
genotype year interaction effects were statistically significant.
Sarvan et al. (2007) studied stability analysis using 15 diverse genotypes of lentil
for eight characters which were evaluated under four environments (varying dates of
sowing and fertilizer application condition). The ANOVA indicated that significant
differences for genotype, environments and most of the characters under study. Genotype
by environments interaction was significant for plant height and seeds per plant.
Salehi et al. (2008) studied seed yield and its components in 20 lentil genotypes
under two normal and drought stress conditions. They found that the significant differences
between traits. The seed yield per plant was sensitive to drought stress but 100-seed weight
was more tolerant and stable trait in drought conditions. At various stress condition, the
harvest index, seed yield per plant, pods per plant and biological yield were positively
correlated with grain yield.
Karimizadeh and Mohammadi (2010), carried out study to determine the yield
performances of ten lentil genotypes across five environments in Iran for two years in
33
2003-2004 growing season and AMMI ANOVA showed that environments, genotypes and
GE interactions were highly significant (P<0.01) and they accounted for 89%, 2% and
8.6% of the treatment combinations sum of square respectively and also reported that only
first two IPCA axes of AMMI model were significant at the 0.05 probability level and
reminded in the model. A combined analysis of variance showed high magnitude of GE
interaction. The significances among the environments indicate that these locations can be
used as testing stations for different environments while significant differences among
genotypes reveals the differential response of genotypes to different environments.
Ali et al. (2012) evaluated 12 lentil genotypes at 11 locations falling in different
agro-ecological zones of Pakistan for 2 years during 2006/07 and 2007/08 and reported
percent variation as 5.93, 75.27 and 18.80 for genotypes, environments and genotype
environment interaction, respectively. The percent variation of 2 major contributors
namely environment and g e interaction was permissible to perform stability analysis to
identify stable genotypes across the environments.
Sabaghnia et al. (2012) evaluated 10 lentil genotypes in 4 locations in two years
reported that the genotype main effect, year by location(YL) interaction, genotype by
location (GL) interaction and genotype, location and year (GLY) interaction were highly
significant (P<0.01). The partitioning general pattern of relationships among stability
parameters and lentil genotypes through principle component (PC) analysis indicated that
the first two PCs explained 79% (PC1 = 55% and PC2 = 24%) of the total variation.
Plotting the scores of the first two PCs in one graph indicated that DI and PI stability
parameters were grouped with mean yield and showed dynamic stability.
Abo-Hegazy et al. (2013) genotypes varied highly significantly from one
environment to another for all traits except 100 seed weight, as proved by the significance
of G E interaction. From combined analysis, the magnitudes of variances due to

34
environments were larger compared to those of genotypes, particularly for pods per plants
(17 fold), seeds/pod and seed yield per plant (10 fold) and seed yield/fed (43 fold).
Therefore, further stability analysis could be performed for traits that recorded significant
G E interaction. The analysis of stability was performed only for pods and seed yield per
plant.
35
3 MATERIALS AND METHODS
The present investigation entitled study on genetic diversity, source of resistant to
Fusarium wilt and Stemphylium blight and genotype environment interaction in lentil (lens
culinaris Medik.) was conducted with the objectives to estimate the genetic divergence
present among local and exotic germplasm using phenotypic attributes and DNA based
SSR molecular markers, identify the germplasm for potential sources of resistance to
Fusarium wilt and Stemphylium blight diseases and know genotype-environment
interaction among elite lines of lentil.
Experiment 1
3.1 Genetic divergence study using morphological character
The present investigation was carried out during winter season in 2011 at the crop
field of Agronomy Division, Khumaltar, Lalitpur located at, 2700300 north latitude
8535 00 east longitude and at an elevation of 1368 meter above sea level with 1340 mm
annual rainfall.
The experimental materials used in experiment comprised of 185 genotypes
including 5 checks collected from International Centre for Agricultural Research in the Dry
Areas (ICARDA), National Grain Legumes Research Program, Rampur (NGLRP) and
National Agricultural Genetic Resource Center (NAGRC), Khumaltar. Considering each
germplasm line as one treatment these genotypes were planted in augmented design with 4
blocks. Plot size was of 2 rows of 1.5 meters length. Crop was planted at spacing of 25 cm
row to row and 5 cm plant to plant. Five checks (ILL7715, ILL7164, Bari masuro-4,
Sindur and Simal) were planted in each block randomly with 45 test entries. Six plants
were randomly selected to study inter and intra variations.

36
Table 1. List of lentil accessions used in this study and their source of origin
SN Variety name Source of origin SN Variety name Source of origin

1 LN-0135 Nepal Local 93 khajura-2 Nepal Local
2 RL-45 Nepal Cross 94 RL-28 Nepal Cross
5 RL-79 Nepal Cross 97 Shital ICARDA
6 ILL3338 ICARDA 98 ILL7220 ICARDA
7 RL-56 Nepal Cross 99 ILL6025 ICARDA
8 RL-68 Nepal Cross 100 NRX9801-1 Nepal Corss
9 RL-8 Nepal Cross 101 39-S-66L ICARDA
10 X94s-48 Nepal Cross 102 ILL6408 ICARDA
12 ILL1970 ICARDA 104 FLIP2006- ICARDA
55L(ILL10134)
13 ILL10071 ICARDA 105 FLIP05-44L) ICARDA
14 ILL9924 ICARDA 106 X94 S-43 ICARDA
17 ILL6458 ICARDA 109 PL-639 ICARDA
18 ILL1920 ICARDA 110 F2003-49L ICARDA
20 HUL-57 ICARDA 112 ILL7980 ICARDA
21 Sagun ICARDA 113 RL-9 Nepal Cross
22 M-Bharatai ICARDA 114 RL-12 Nepal Cross
23 ILL7162 ICARDA 115 PL-406 ICARDA
25 LN-0136 Nepal Local 117 RL-83 Nepal Cross
27 DPL-62 India 119 ILL6447 ICARDA
28 ILL7537R ICARDA 120 ILL2373 ICARDA
29 WBL-77 India 121 RL-11 Nepal Cross
30 IL-1 ICARDA 122 ILL9943 ICARDA
32 ILL7715 ICARDA 124 RL-55 ICARDA
33 RL-4 Nepal Cross 125 PL-4402 Nepal Cross
37

34 ILL6467 ICARDA 126 ILL3280 India
35 ILL7164 ICARDA 127 Khajura-1 Nepal Local
37 ILL6256 ICARDA 129 ILL6024 Nepal Local
38 LG-12 India 130 ILL8132 ICARDA
41 FLIP-2006-99L ICARDA 133 RL-84 ICARDA
42 FLIP 95-1L ICARDA 134 ILL9949 ICARDA
43 RL-60 Nepal Cross 135 LN-0137 Nepal Cross
44 FLIP2009-60L ICARDA 136 Smrik ICARDA
45 FLIP04-60L ICARDA 137 ILL9927 Nepal Local
(ILL10013)
48 ILL6021 ICARDA 140 RL-51 ICARDA
49 FLIP05-24L ICARDA 141 ILL8187 ICARDA
(ILL10045)
50 FLIP05-24L-1 ICARDA 142 ILL7986 Nepal Cross
(ILL10065)
52 NRx2001-72-3 Nepal Cross 144 ILL8191 ICARDA
54 FLIP 2009-54L ICARDA 146 ILL2501 ICARDA
55 RL-75 Nepal Cross 147 NRX2001-71-3 ICARDA
56 RL-35 Nepal Cross 148 Cumara ICARDA
57 RL-43 Nepal Cross 149 ILL27001-1 Nepal Cross
61 RL-76 Nepal Cross 153 Shikhar ICARDA
62 RL-26 Nepal Cross 154 X49s-48 Nepal Cross
64 RL-39 Nepal Cross 156 Arun Nepal Local
65 RL-58 Nepal Cross 157 Sindur ICARDA
66 RL-62 Nepal Cross 158 NRX - 99S -95- Nepal Cross
95-1
38

67 RL-47 Nepal Cross 159 Simal ICARDA
69 RL-21 Nepal Cross 161 Shisir Nepal Local
71 FLIP05-52 ICARDA 163 ILL7163 ICARDA
(ILL10073)
73 RL-94 Nepal Cross 165 Jutpani Nepal Local
74 X39S-66L ICARDA 166 Mangal Bazar Nepal Local
75 ILL10134 ICARDA 167 RL-77 Nepal Cross
76 NRX2001-71-4 Nepal Cross 168 ILLI970 ICARDA
83 RL-38 Nepal Cross 175 Baitadi 6A Nepal Local
86 DIGGER ICARDA 178 ILL9976 ICARDA
87 Bari Masuro-4 ICARDA 179 ILL3236 ICARDA
88 NRX9901-1 Nepal Cross 180 PL-4 India
89 Aarial Nepal Local 181 RL-85 Nepal Cross
90 ILL6458 ICARDA 182 RL-81 Nepal Cross
91 X95S-83 ICARDA 183 LN-0111 Nepal Local
185 NRx-99S-95-1-12 Nepal Cross
3.1.1 Qualitative traits
Seven qualitative traits like Seed coat color (1= Green, 2= Grey, 3=Brown,
4=Black, 5=Pink), seed coat pattern (0=Absent, 1=Dotted, 2=Spotted, 3=Marbled,
4=Complex), Cotyledon color (1=Yellow,2 =orange/red, 3=Olive green), Stem color-
(1=absent, 2=present), Pod pigmentation (Yes=1=Green pod with spots, No=0=Green pod
39
without spots), Tendril Formation (Yes=1= tendril formed, No=0= tendril not formed) and
Leaf Pubescence formation (0= absent, 3=slight, 7=dense) were recorded following
IBPGR descriptions 1985.
3.1.2 Quantitative traits
Eleven quantitative traits i.e. leaflet length (LL), days to 50% flowering (DF), days
to 90% maturity (DM), plant height (PH), number of primary branches (PB), number of
pods per plant (PP), number of seeds per pod (SP), 100 seed weight (SW), biological yield
per plant (BY), grain yield per plant (GY) were recorded following IBPGR descriptions
1985 and harvest index (HI) were calculated. All recommended agronomic practices were
followed during the experiment. Observations were recorded on five randomly taken plants
from each line for the following traits:
3.1.2.1 Days to 50 % flowering
Number of days from sowing to 50% flowering in each row was counted.
3.1.2.2 Days to maturity
Number of days from the date of sowing to the date of physiological maturity was
calculated.
3.1.2.3 Plant height (cm)
It was measured in centimeter from the base of the plant to the tip of the main shoot
at the time of maturity.
3.1.2.4 Number of branches per plant
The numbers of branches originating from the main shoot of each plant were
counted at maturity.
3.1.2.5 Number of pods per plant
Number of pods of 5 plants were taken at maturity and recorded as plant basis.
40
3.1.2.6 Number of seeds per pod
The 10 pods from five plants were randomly taken, threshed and their seeds were
counted for calculating the number of seeds/pod.
3.1.2.7 Hundred seed weight
Hundred seeds were taken randomly from each plot and their weight was recorded
in grams.
3.1.2.8 Seed yield per plant (g)
The weight of dried seed produce was recorded, in grams.
3.1.2.9 Biological yield per plant (g)
Plants were harvested at the time of maturity at the ground level, dried and weight
of the whole plant was recorded, in grams.
3.1.2.10 Harvest index (HI) %
Harvest index was calculated as below:
HI (%) = (seed yield/ biological yield) 100
3.1.3 Data analysis
Data analysis was performed on the basis of 6 plants randomly selected from each
plot. ANOVA of augmented design was calculated by using Federer, 1956. The genetic
parameter, correlations coefficient and path coefficient at genotypic and phenotypic levels
were computed following Singh and Chaudhary (1985), while divergence analysis and
Dendrogram were prepared using Wards hierarchical clustering method (Ward, 1963).
3.1.3.1 Estimations of phenotypic and genotypic variances
Phenotypic variance (2p) =2g +2e
MSt - MSe
Genotypic variance (2 g) = -------------------
r
Error variance (2 e) = MSe
41
Where,
MSt = treatment mean square, MSe = Error mean square
r= number of replication
3.1.3.2 Estimations of phenotypic and genotypic covariance, heritability and genetic
advance
Phenotypic, genotypic and environmental coefficients of variation were obtained as
the ratio of respective standard deviation to the general mean of the character and
expressed in percentage following Burton (1952).
Phenotypic coefficient of variation (PCV %)
pi
PCV (%) = - --------- 100
Xi
Genotypic coefficient of variation (GCV %)

gi
GCV (%) - ---- ----- 100
Xi
Environmental coefficient of variation (ECV %)
e
ECV (%) = -- ------- 100
Xi
Where, pij,gi and eare the phenotypic, genotypic and environmental standard
deviations for the character 'i' and Xi is the general mean of the character ' i' .
Estimation of heritability (H)
Where is the genetic variance, is the phenotypic variance, is the error
variance Expected genetic advance (GA) and percentage of GA were calculated according
to (Shukla et al., 2006). Expected genetic advance (GA) = i H
GA
GA (%) = ----------------- 100
Mean
42
Where, i= standardized selection differential constant (2.06 at 5% level),
=phenotypic variance and H= broad sense heritability.
PCV and GCV values of approximately more than 20% are regarded as high,
whereas values less than 10 % are regarded as low and between these two values are
regarded as medium (Deshmukh and Reddy, 1986).
Experiment 2
3.2 Genetic divergence study using SSR marker
The present investigation was carried out during winter season in 2011 at the crop
field of Agronomy Division, Khumaltar, Kathmandu located at 27 3' 86" north latitude
and 85 35' 52" east longitude and at an elevation of 1368 meter above sea level with 1340
mm annual rainfall.
The experimental materials used in experiment comprised of 185 genotypes
including 5 checks collected from International Centre for Agricultural Research in the Dry
Areas (ICARDA), National Grain Legumes Research Program, Rampur (NGLRP) and
National Agricultural Genetic Resource Center (NAGRC), Khumaltar. Considering each
germplasm line as one treatment these genotypes were sown in earthen pot containing five
kg of well fertilized soil and allowed to grown inside the glasshouse until maturity. The
genotypes name and sources of origen are presented in Table 1.
3.2.1 DNA extraction
DNA was extracted from one month old seedlings using young leaves from each
five individual plants and placed on ice box. About 0.2 gm of leaf samples were ground
into fine powder in liquid nitrogen. The DNA was extracted using modified
Cetyltrimethylammonium bromide (CTAB) methodand washed in 70% ethanol (Doyle and
Doyle 1987). The extracted DNA was then run in 1.5% agarose gel in 1 TAE buffer
(0.11% (V/V) Glacial Acetic acid, 0.5 M EDTA and 0.04M Tris base) at 100 v for an hour
43
and stained with ethidium bromide to assess the quality and quantity of DNA. The
concentration of the DNA was estimated by comparing with known concentration of 100
bp DNA ladder (Genetix, Biotech Asia Pvt. Ltd).
3.2.2 Measurement of DNA purity and quantity
Before Polymerase chain reaction PCR and after DNA extraction, the yield of
extracted DNA was also measured using a UV-Spectrophotometer at absorbance 260 nm.
The purity of DNA was also determined by calculating the ratio of absorbance at 260 nm
to that of 280 nm (Sambrook et al., 1989). The DNA concentration was determined by
using the standard formula: DNA concentration = OD260 50 g/ml dilution factor
(Linacero et al., 1998).
3.2.3 Microsatellite marker
A total of 30 polymorphic microsatellites markers selected based on the results of
previous work (Hamwieh et al., 2005 and 2009). These SSR markers were synthesized at
20nM scale and purchased from Bioneer Company (South Korea). Primers were diluted
following manufacture protocol. The list of highly polymorphic SSR markers, their name,
sequence information, motif, annealing temperature and amplicon size are given in
Table 2.
44
Table 2. List of forward and reverse 30 SSR primers used for lentil characterization, with
annealing temperature and expected size
SSR No. Forward Reverse Annealing Expected

temp.(oC) size(bp)
used for
PCR(0C)
SSR 34-2 CGGCGGATGAAACTAAAG CATTTCCTTCACAAACCAAC 53 185
SSR 66 GGTAGTGGTGAGGAATGAC GCATCACTGCAACAGACC 55 253
SSR 90 CCGTGTACACCCCTAC CGTCTTAAAGAGAGTGACAC 55 181
SSR 132RN CCAGAACAAACGTAAACC CTATCGCATATGAGTGAAC 52 330
SSR 191 GCAAATTTCTTGGTCTACAC GGGCACAGATTCATAAGG 53 238
SSR 197 CACCAATCACCAACACAC GAGCTGTGAAGTCTTATCTG 54 173
SSR 207 GAGAGATACGTCAGAGTAG GATTGTGCTTCGGTGGTTC 55 227
SSR 33 CAAGCATGACGCCTATGAAG CTTTCACTCACTCAACTCTC 56 289
SSR 19 GACTCATACTTTGTTCTTAGCAGGAACGGAGCGGTCACATTAG 58 250
SSR 48 CATGGTGGAATAGTGATGGC CTCCATACACCACTCATTCAC 57 165
SSR 96 GTTATCTTCCAGCGTC GATATACAATCAGAGATG 49 210
SSR 99 GGGAATTTGTGGAGGGAAG CCTCAGAATGTCCCTGTC 57 161
SSR 107 GCGGCGAGCAAATAAAT GGAGAATAAGAGTGAAATG 51 161
SSR 113 CCGTAAGAATTAGGTGTC GGAAAATAGGGTGGAAAG 51 211
SSR 124 GTATGTGACTGTATGCTTC GCATTGCATTTCACAAACC 52 174
SSR 130 CCACGTATGTGACTGTATG GAAAGAGAGGCTGAAACTTG 55 196
SSR 156 GTACATTGAACAGCATCATC CAAATGGGCATGAAAGGAG 53 176
SSR 167 CACATATGAAGATTGGTCAC CATTTATGTCTCACACACAC 54 160
SSR 199 GTGTGCATGGTGTGTG CCATCCCCCTCTATC 51 182
SSR 213 CACTCGCACCTCTTATG GAAATTGTCTCTTAGCAAG 51 151
SSR 309-2 GTATGTCGTTAACTGTCGTG GAGGAAGGAAGTATTCGTC 50 182
SSR 317-1 GTGGGTGTAATTATTGCTAC GTATCAAACTTATGGTGAAATC 53 308
SSR 317-2 CACGTAACATCTTGCTTATG GTAGCAATAATTACACCCAC 53 120
SSR 323 AGTGACAACAAAATGTGAGT GTACCTAGTTTCATCATTG 51 250
SSR 336 GTGTAACCCAACTGTTCC GGCCGAGGTTGTAACAC 54 253
SSR 183 GCTCGCATTGGTGAAAC CATATATAGCAGACCGTG 52 119
SSR 202 CAACCTCACTTACCTTAC GCTCTTTATCATCATTCTAC 52 220
SSR 28 GAGGGCATAAATTCAGATTC GGACAACGCACATTTGATG 53 383
SSR 72 CAAACAGTACAAGGAAAGGAG CTGACTGAGCTGCTTGAAC 55 253
SSR 230 CCAACAACAATTCACCATAC AACATTGTACTGAGAGGTG 53 251
45
3.2.4 PCR amplification
Polymerase chain reaction (PCR) was conducted in the 15 l volume containing 2.5
l (150ng) of genomic DNA, 1.5l (1M) of each primer, 7.5 l of 2x GoTaq Green PCR
Master Mix (Promega Corporation, Madison, WI, USA) and 2l PCR H2O. The reaction
mixture without template DNA (12.5 l) was dispensed in each 96 wells round bottom
plate. Finally the DNA template from respective lentil accessions was added in PCR plate.
PCR mixture was amplified in a MJ Research PTC -100 Programmable Thermal
Controller (MJ Research, Inc, Watertown, MA, USA) with the following temperature
regimes: initial denaturation for 2 min. at 95C followed by 30 cycles of 95Cfor 30 sec.,
annealing at 51-56C depending on the primers TM for 1 minute, extension at 72C for 1
minute and final extension at 72C for 7 minutes followed by holding at 4C for .
3.2.5 PCR product separation and microsatellites visualization
Amplified Polymerase chain reaction (PCR) products were separated in 2% agarose
gel with low EEO (GENEI, Banglore GENE Pvt. Ltd, India) using horizontal gel
electrophoresis unit in 1 TAE (0.11% (V/V) Glacial Acetic acid,0.5 M EDTA and 0.04M
Tris base) buffer and run at 100v for 1 hr. Gels were stained with 0.1g/ml ethidium
bromide (Promega Corporation, Madison, WI, USA) and then visualized under UV trans
illuminator gel documentation system (Wilber Lourmat, Marne-La-Valleen, France) using
1 g guide size DNA ladder (Genetix, Biotech Asia Pvt. Ltd).
3.2.6 Statistical analysis
The amplified products were scored as bands on visualization on gel on ultra violet
(UV) illuminator. Only the reliable bands were included in analysis. These scored bands
were computed into binary matrix. The presence of the band was scored as 1 and
absence as well as missing band was scored as 0. The respective statistical analyses were
carried using Numerical Taxonomy and Multivariate Analysis System (NTSYS)(Rohlf,

46
2004, version 2.11) and Excel software. The following diversity and relationship analysis
were carried out to interpret the data obtained from the experiment.
3.2.7 Polymorphic information content (PIC)
The gene diversity was calculated according to the formula of Nei (1973): Gene
diversity = 1 Pi2, where Pi is the frequency of ith microsatellite allele present in the
examined accessions. Polymorphic Information Content (PIC) for each marker was
calculated. The number of alleles per locus, size range, gene frequencies and genetic
distance were estimated. The PIC value index is the function of gene frequencies.
3.2.8 Cluster analysis
Cluster analysis, a method for displaying the similarity or differences between pairs
of subjects in a set, was employed for grouping together genotypes that showed similarity
in the microsatellite patterns. The genetic similarities (GS) were calculated for each pair of
accessions using the Similarity Coefficient (SM) and Jaccards Coefficient of Similarity
for genotyping data. The similarity matrix was used to construct UPGMA (un-weighted
pair group methods using arithmetic averages algorithm) clustering and neighbor-joining
(NJ) grouping methods to visualize the relationships among lentil accessions in
Dendrogram with the help of the Sequential, Agglomerative, Hierarchical and Nested
(SAHN) clustering methods (Sneath and Sokal, 1973) using NTSYS-pc.V.2.11.
Experiment 3
3.3 Fusarium wilt study
The present investigation was carried out during winter growing season in 2012/13
at the crop field of Nepalgunj. The latitude, longitude and altitude of Nepalgunj is 28 05'
N,81 61' E and 181 masl respectively with1111mm annual rain fall. The experimental
materials used in the experiment were collected from International Centre for Agricultural
Research in the Dry Areas (ICARDA) and National Grain Legumes Research Program,
47
Rampur (NGLRP) each germplasm line as one treatment was planted in road row design
with 4 blocks.
One hundred eighty five lentil genotypes/varieties including resistant check
ILL7715 and susceptible check Sindur, were sown in a previously developed wilt sick plot,
Debris of previous crops were incorporated to the soil to develop sick plot. Sindur (a
highly susceptible line) was repeatedly planted after every two test entries to increase the
inoculums pressure of Fol under natural conditions. Plot size was of 1 row of 2 meter
length. Crop was planted at 25 cm row to row and 5cm plant to plant spacing. Fertilizer
was applied at the rate of 20:40:20 kg NPK /ha. No insecticide and fungicide were applied.
The weather conditions were highly favorable for disease development. Disease specimens
were examined for confirmation in laboratory of Plant Pathology Division, National
Agricultural Research Institute, Khumaltar, Lalitpur. Weather data is given in table 3.
3.3.1 Data recording
Disease reaction, on individual plant basis, was estimated using a 1-9 scale: 1 = no
symptoms (Highly resistant); 3 = yellowing of the basal leaves only (resistant); 5 =
yellowing on 50% of the foliage (moderately susceptible); 7 = complete yellowing of the
foliage, flaccidity of the top leaves, partial drying (susceptible); 9 = The whole plant or a
unilateral shoot is Wilted and/or dry (highly susceptible).
Observations of infected/wilted plant on plot basis were recorded at vegetative and
maturity stages following 1-9 scoring scale (Bayaa et al., 1997) as 1 = No infection
(Highly Resistant), 3 = 1-10% plants affected (Resistant), 5 = 10-20% of plants affected
(Moderately Resistant), 7 = 20-50% of plants affected (Susceptible), 9 = More than 50% of
plants affected (Highly Susceptible).

48
Table 3. Weather data of crop season of the experimental site Nepalgunj during 2012/13
Year Month Rainfall (mm) Min. temp. (0C) Max. temp. (0C)
2012 Nov 0 8.5 31.4
2012 Dec 2.5 4.5 26.8
2013 Jan 9.2 0.5 25
2013 Feb 79.5 7.0 28
2013 Mar 3.5 11.5 33.5
Experiment 4
3.4 Stemphylium blight study
The present investigation was carried out during winter growing season in 2012/13
at the crop field of Nepalgunj. The latitude, longitude and altitude of Nepalgunj is 28 05'
N,81 61' E and 181 masl, respectively with 1111 mm annual rain fall. The experimental
materials used in the experiment were collected from ICARDA and NGLRP. Each
germplasm line was considered as one treatment and planted in rod row design with 4
blocks.
One hundred eighty five lentil genotypes/varieties including Bari masur-4 and
ILL7164 as resistant checks and Shital as a susceptible checks were planted. Plot size was
of 1 row of 2 meter length. Crop was planted at 25 cm row to row and 5 cm plant to plant
spacing. Fertilizer was applied at the rate of 20:40:20 kg NPK/ha. Debris of previous crops
was incorporated to the soil to develop sick plot Shital (susceptible check of SB) were
repeatedly planted after two test entries. The lentil crop was raised by following
recommended agronomic practice. No insecticide and fungicide were applied. The weather
conditions were highly favorable for disease development, particularly for Stemphylium
blight. Disease specimens were examined for confirmation in laboratory of Plant Pathology
Division, National Agricultural Research Institute, Khumaltar, Lalitpur.

49
Observations of infected plants on plot basis were recorded at vegetative, and
maturity stages following 1-9 scoring scale suggested by Bayaa et al. (1997) for foliar
diseases. 1= No infection (Highly Resistant), 3= 1-10% plants affected (Resistant), 5 = 10-
20% of plants affected (Moderately Resistant), 7= 20-50% of plants affected (Susceptible),
9 = More than 50% of plants affected (Highly Susceptible).
Experiment 5
3.5 Genotype environment interactions
The present experiment material comprised of 21 genotypes of lentil including
three checks, selected on the basis of yield performance and other characters from the
observation nursery conducted at Agronomy Division, Khumaltar during 2011. The trial
was conducted for studying interactions between genotypes and environments as multi-
locations repeating in two years. There were eight environments viz. Agronomy Division,
Khumalta (Khu14), Regional Agriculture Research Station, Nepalgung (Nep14), Regional
Agriculture Research Station, Parwanipu (Par14), and National Grain Legumes Research
Program, Rampur (Ram14) during 2013/14 and Agronomy Division, Khumaltar (Khu15),
Regional Agriculture Research Station, Nepalgung (Nep15), Regional Agriculture
Research Station, Parwanipur (Par15) and Jute Research Program, Itahari (Itahari15),
during 2014/15 representing diverse agro climate of lentil growing area of Nepal. These
were treated as eight environments as varying in their latitude, rainfall, soil types,
temperature and other agro-climatic factors. The geographical, climatic, and soil features
of the experimental sites are given in Table 4. In second year instead of Rampur one set
trial was planted in eastern part of the country (Ithari) which was lacking in first year
which is emerging potential area for lentil growing

50
Table 4. Geographical, climatic, and soil features of the experimental sites, 2013/14 and2014/15
Annual Min Max Severity of

Locations Year Latitude Longitude Altitude(masl) Soil type & pH rainfall temp temp disease*
SB FW
Khumaltar (Khu14) 2014 27 03' N 85 35'E 1368 Clay loam5.5-6.5 1340 0.2 29.0 L L
"(Khu15) 2015 " " " " 1230 -0.4 28.0 M L
Nepalgunj (Nep14) 2014 28 05' N 81 61' E 181 Clay loam, 7.2-7.5 1111 5.4 46 L L
"(Nep15) 2015 " " " " 1250 7.2 42 M L
Parwnipur (Par14) 2014 27 20' N 84 53' E 115 Silty loam6.0-6.2 1687 5.0 38.0 L L
" (Par15) 2015 " " " Silty loam6.0-6.2 1450 6.7 36 M L
Rampur (Ram14) 2014 27 40'N 84 19' E 228 Sandy loam4.6-5.7 1138 1.0 34 L L
Itahari (Itahari15) 2015 26.66'N 87.28'E 344 Clay loam6.2-7.2 1782 7.5 34.3 VL VL
Note: * FW= Fusarium wilt, SB= Stemphylium blight, L=low, M=medium, VL=very low
50
51
The trials were conducted in a randomized complete block design (RCBD) with
three replications. The plot size was of 4 meter length of four rows (1 m wide) of 25 cm
spacing between rows and 5 cm between plants. Fertilizer was applied at the rate of
20:40:20 kg N, P, K /ha.
Observations were recorded of nine quantitative traits viz., days to 50% flowering
(DF), days to 90% maturity (DM), plant height (PH) in cm, number of primary branches
(PB), number of pods per plant (PP), number of seeds per pod (SP), 100 seed weight (SW)
in gram, biological yield in metric ton per hector (BY mt ha-1), grain yield metric ton/ha
(GY mt ha-1) were recorded following IBPGR descriptor.
Five plants were randomly selected from each plot to take the data of yield
attributing characters. Grain yield and biological yields were recorded on the plot basis and
converted in to metric ton /ha.
3.5.2 Data analysis
ANOVA, adaptability phenotypic stability analysis, AMMI Stability Value (ASV)
and AMMI stable index were carried out by using the AMMI model suggested by (Zobel
et al., 1998 and Purchase et al., 2000) using the following statistical model:
Where Yij is the mean response of genotype i in the environment j; is the overall
mean; gi is the fixed effect of genotype i (i = 1, 2, ... g); ej is the random effect of
environment j (j = 1, 2, ... e); ij is the average experimental error; the G E interaction is
represented by the factors; k is a unique value of the kth interaction principal component
analysis (IPCA), (k = 1, 2, ... p, where p is the maximum number of estimable main
components), ikis a singular value for the ith genotype in the kth IPCA, yjk is a unique
52
value of the jth environment in the kth IPCA; rij is the error for the G E interaction or
AMMI residue (noise present in the data); and k is the characteristic non-zero roots, k = [1,
2, ... min (G - 1, E - 1)].
The sum of squares for the G E interaction (SSGE) was divided into n singular
axes or main components of interaction (IPCA), which was described the standard portion,
each axis corresponding to an AMMI model. The choice of model that best described the G
E interaction was done based on the FR test proposed by Cornelius et al. (1992).
53
4 RESULTS AND DISCUSSION
Results of the present study are derived from five experiments conducted at
different locations during different years in Nepal. Data were subjected to appropriate
statistical analyses and the results obtained are presenting under following heads
Experiment 1
4.1 Genetic divergence study using morphological traits
4.1.1 Observation of qualitative traits
Qualitative traits like seed coat color, seed coat pattern, cotyledon color, stem color,
pod pigmentation; tendril formation and leaf pubescence formation are most important
traits for morphological identification of any genotypes ,these qualitative traits data of
selected lines are presented in Table 5 and remaining lines in Appendix 1.
Table 5. Qualitative character of selected genotypes recorded at Khumaltar during 2011/12
SN Genotypes Seed Seed Cotyledon Stem Pod Tendril Leaf

coat coat Color color pigmentation formation pubescence
color pattern
13 ILL10071 2 1 2 1 0 1 7
19 ILL6811 3 1 2 1 0 1 7
49 FLIP05-24L 3 1 2 1 0 0 3
(ILL10045)
105 FLIP 05 - 2 2 2 1 0 1 7
44L (ILL
10065)
59 RL-44 3 0 2 1 0 1 3
64 RL-39 2 1 2 1 0 1 3
37 ILL6256 2 1 2 1 0 1 7
101 39-S-66L 3 1 2 1 1 1 3
110 F 2003-49L 3 1 2 1 0 1 3
120 ILL 2373 3 1 2 1 1 1 3
121 RL- - 11 2 1 2 1 1 1 7
127 Khajura - 1 3 2 2 1 0 1 7
129 ILL 6024 3 1 2 1 0 1 7
130 ILL8132 2 1 2 1 0 1 7
160 Shisir 2 1 2 1 0 1 3
177 ILL 9976 2 1 2 1 0 1 7
172 ILL 6818 2 1 2 1 1 1 3
54
SN Genotypes Seed Seed Cotyledon Stem Pod Tendril Leaf

coat coat Color color pigmentation formation pubescence
color pattern
185 Arun 2 1 2 1 1 1 3
158 Simal 2 1 2 1 1 1 7
87 Bari Masuro-4 2 1 2 1 0 1 7
35 ILL7164 2 1 2 1 1 1 7
1=22 0=30 1=25 1=167 0=134 0=7 3=84
2=100 1=129 2=160 2=18 1=51 1=178 7=101
3=63 2=17
3=9
Note-C1=ILL7715 (32), C2=ILL7164 (35), C3=Bari Musuro-4 (87), C4= Sindur (156), C5=Simal (158)
1 Seed coat color:1=Green, 2=Grey, 3=Brown, 4=Black, 5=Pink
2 Pattern of testa (seed coat pattern): 0=Absent, 1=Dotted, 2=Spotted, 3=Marbled, 4=Complex
3 Cotyledon color:1=Yellow, 2=orange/red, 3=Olive green
4 Stem color:1=absent, 2=present
5 Pod pigmentation:0=Green pod without spots, 1=Green pod with spots
6 Tendril Formation: No=0= tendril not formed, Yes=1= tendril formed
7 Leaf Pubescence formation: 0=absent, 3=slight, 7=dense
4.1.1.1 Seed coat color
Seed coat color is very important in characterization. Out of 185 genotypes 22
showed green colors, while 100 exhibited grey and 63 brown color.
4.1.1.2 Seed coat pattern
Seed coat pattern is important in characterization. Out of 185 genotypes, it was
absent in 30 while 129 showed dotted, 17 spotted and 9 marble.
4.1.1.3 Cotyledon color
It is more important character for preferring and for marketable purposes. Out of
185 genotypes, 25 showed yellow cotyledons, while 160 orange or red cotyledons. Our
local and cultivated lentil have orange/red cotyledon and are preferred by the Indian
subcontinent peoples. While Syrian and Macrosperma types lentil have yellow cotyledon.
4.1.1.4 Stem color
Stem color is also important in morphological characterization. Out of 185, stem
color of 167 genotypes have no (green) color, while 18 have brown color.
4.1.1.5 Pod pigmentation
It is also important for characterization out of 185, 134 genotypes have green pod
while 51 have green pods with pigmentations (spot on pod).

55
4.1.1.6 Tendril formation
It is easily visible characters and play important role in characterization. Out of 185
genotypes, tendril was not formed in 7 genotypes while in 178 genotypes, tendril was
formed.
4.1.1.7 Leaf pubescence
It is very important character for characterization. It played significant role in insect
control and usually resistant to diseases. In 8 genotypes it was absent while in 84, it was
slight and in 101 it was dense.
4.1.2 Quantitative traits
4.1.2.1 Analysis of variance and mean performance
Analysis of variances (ANOVA) for augmented design revealed significant
differences among lentil entries (including checks) and tested genotypes for all 11
characters (Table 6). Genetic variability in the initial breeding materials ensures better
chances of producing desired recombinants for crop improvement.

56
Table 6. Analysis of variance (ANOVA) for different morphological and economical traits at Khumaltar, 2011/12
LL PH NB DF DM PP SP GY/p BY/p SW HI
Source
DF MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS MSS
Blocks (b) 3 0.072 104.222 5.923 299.473 71.572 712.313 0.241 2.162 11.269 2.190 713.618
Entries (e) 184 0.067** 7.355** 3.227** 8.237** 8.774** 221.461** 0.069** 0.341** 1.386** 0.208** 159.281**
Checks (c) 4 0.037 6.335 4.956 9.243 11.317 101.516** 0.011 0.140** 2.156** 0.079* 88.261**
Varieties (v) 179 0.068** 7.407** 3.206** 8.250** 8.688** 262.592** 0.071** 0.347** 1.376** 0.206** 161.737**
Check vs. Var 1 0.040 2.118 0.050 1.819 14.090** 183.291** 0.1320 0.213 0.136 0.235 57.295**
Error 12 0.012 1.751 0.640 4.800 3.800 33.500 0.030 0.038 0.065 0.033 46.696
GM 2.398 23.475 6.424 95.559 133.973 31.553 1.430 1.208 2.892 1.743 29.693
CV% 4.657 5.636 12.456 2.293 1.455 18.343 12.028 16.116 8.789 10.389 23.014
Note: ** = significant at 1%,* = significant at 5% probability levels
LL=leaflet length (cm), PH= plant height, NB = number of primary branches per plant, DF = days to 50% flowering, DM = days to 90% maturity, PP = number of pods per
plant, SP = seeds per pods, BY/p= biologic yield per plant (g), GY/p = grain yield per plant (g), SW = 100 seed weight (g), and HI = harvest index
56
57
4.1.2.2 Variability and mean value
Higher range of variation for all the traits i.e. leaflet length (1.77-3.08), days to
50% flowering (88.50-110.67), days to 90% maturity (122.50-148.83), plant height (16.67-
35.00cm), number of primary branches (3.5-12.67), number of pods per plant (6.33-80.17),
number of seeds per pod (0.93-2.00), 100 seed weight (0.91-3.31g), biological yield per
plant (1.24-6.68g), grain yield per plant (0.90-3.02g) and harvest index (5.50-65.41%)
were recorded. These indicate selection could be done for any character (Table 7 and
Appendix 2).
4.1.2.2.1 Leaflet length
Leaf let length ranges from 1.77 to3.08cm with mean value 2.39cm. Genotypes
NRx2001-72-3(3.08cm), ILL3496(3.05cm), RL-21(2.98cm), RL-20(2.9cm), 39s-66L
(2.9cm), RL-6(2.90cm), RL74(2.87cm), Khajura-1(2.72cm) showed higher number of
leaflet length than best check ILL7164 (2.5cm).
4.1.2.2.2 Plant height
Plant height ranges from 16.67 to 35.00cm with mean value 23.47cm. Higher plant
height from genotypes RL-20(35cm), Aarial(30.83cm), RL-85(30.33cm), F2003-49L
(29.50cm), PL-4(29.25cm), Khajura-1(29.17cm) were found taller than Simal (24.77cm)
4.1.2.2.3 Number of primary branches
Number of braches ranges from 3.5-12.67 with mean value 6.42. Genotypes
ILL3236 (13.58), RL-11 (12.98), 94 S-43 (11.98), F2003-49L (10.81), ILL819110.24),
x49s-48 (10.08), ILL8132 (9.98), ILL9932 (9.91), Khajura-1 (9.81) produced significantly
higher number of branches per plant than best check Simal (8.16),
4.1.2.2.4 Days to flowering
Days to flowering ranges from 88-111 with mean value 95.56. Genotypes
FLIP2008-7L(111), ILL10065(108), ILL6256(108), ILL10013(107), ILL6811(104),
RL75(103), ILL10045(103) while Simal flowered in 94 days.

58
4.1.2.2.5 Days to maturity
Days to maturity ranges from 122-149 with mean value133.98. Genotypes ILL
10013(149), ILL6256(143), ILL10065(142), FLIP2008-7L(142), ILL10045(141), ILL6811
(141) matured late while Simal matured in 134 days.
4.1.2.2.6 Number of pods per plant
It ranges from 6.33 to 80.17 with mean value 31.55.Genotypes RL-11 (81.46),
Aarial (75.55), ILL3236 (74.66), RL-6 (74.66), F2003-49L (74.46), NRX-99s-95-1-1
(71.49), ILL9932 (70.16) Khajura-1(69.120 and RL-39(68.05) produced significantly
higher number of pods per plant than best check Simal (39.7).
4.1.2.2.7 Number of seeds per pod
It ranges from 0.93-2.00 with mean value 1.43. Significantly high number of seeds
per pod were obtained from NRX-99s-95-1-1 ( 2.00 ), X 49s-48 (2.00), ILL10071 (1.98 ),
ILL7979 ( 1.96), ILL3236 (1.94) , RL-95( 1.93), Arun (1.91) , ILL1920(1.91), ILL6811
(1.90), ILL2712 (1.88) , LN-0111 ( 1.87).
4.1.2.2.8 Hundred seed weight
100 seed weight ranges from 0.91-3.56g with mean value1.74g. High 100 seed
weight were recorded from RL-81 (3.56g ), FLIP05-44L (3.31g ) RL-83 (3.09g ), RL-25
(2.95g) NRX9901-1 (2.75g), RL-47 (2.75g), RL-85 ( 2.73g).
4.1.2.2.9 Biological yield per plant
Biological yield per plant ranges from 1.24-6.68 with mean value 2.89.Significantly
higher biological yield per plant was produced from ILL3236 (7.43g), F2003-49L (6.62g),
LN-0137 (6.22g), RL-11 (6.05g), Aarial (5.92g), Khajura-1 (5.87g), RL-6 (5.66g),
ILL1704(5.49g), ILL9932 (5.43g), ILL4139 ( 5.37g) ILL9993 (5.30g), RL-81 ( 5.21g)
than best check Simal (4.09g).

59
4.1.2.2.10 Grain yield per plant
Grain yield per plant ranges from 0.9 -3.02g with mean value 1.21g.Genotypes
ILL3236 (3.02g), RL-39 (3.01g), Aarial (2.96g) RL-11 (2.86g) ILL9932 (2.42g), Khajura-
1 (2.34g), RL-6 (2.30g) produced significantly higher grain yield per plant than best check
Simal (1.0g).
4.1.2.2.11 Harvest index
Harvest index % ranges from 5.5-65.41 with mean value 29.69. High harvest index
% were recorded from RL-39 (65.41 ), Aarial ( 60.39 ), ILL6024 (54.9 ), Jutpani (54.86),
LL2373 (54.77), NRX-99s-95-1-1 (54.23), RL-85 (53.88 ), RL-95 (53.35 ), ILL9932
(52.89), 39-S-66L (52.5), ILL4139 (52.15 ), Arun (50.7 ), ILL7538 (50.5), ILL3236
(50.2), RL-11(50.11) than best check Bari masuro-4 (33).

60
Table 7. Mean values for grain yield and yield attributing characters of selected genotypes at Khumatar, during 2011/12
En Genotypes LL PH NB DF DM PP SP GY/P BY/P SW HI

18 ILL10071 2.25 22.08 9.83 99.83 134.67 43.83 1.85 1.73 4.52 2.11 41.65
24 ILL6811 2.67 23.42 8 104.17 140.83 66.5 1.77 1.41 3.95 1.21 39.02
52 ILL10045 2.23 25.33 9.33 102.83 141.17 62.5 1.63 1.39 4.75 1.37 30.63
107 ILL10065 2.57 21.50 8.17 95.00 131.33 28.17 1.75 1.55 3.07 3.15 51.48
62 RL-44 2.40 25.25 7.50 95.33 130.83 47.00 1.8 1.68 3.89 1.95 43.29
67 RL-39 2.60 26.25 8.50 92.67 129 65.83 1.68 3 4.57 2.66 65.41
99 ILL6256 2.75 27.33 6.17 98.33 136.83 55.83 1.67 1.8 3.54 1.91 54.57
103 39-S-66L 2.9 24.67 6.83 95.33 133.5 63.83 1.73 2.01 3.62 1.83 57.43
112 F2003-49L 2.48 29.75 10 92.83 133.17 73.17 1.45 1.57 6.1 1.52 28.98
122 ILL2373 2.38 24.75 8.5 93.33 130.33 64.67 1.73 1.94 3.48 1.72 59.70
123 RL-11 2.3 25.92 12.17 92.67 129.17 80.17 1.90 2.81 5.53 1.83 55.04
129 Khajura-1 2.72 29.17 9.00 91.67 135.5 67.83 1.67 2.29 5.35 2.11 46.51
131 ILL6024 2.57 27.5 7.33 91 131.83 58.17 1.70 2.23 4.22 2.27 59.83
132 ILL8132 2.13 24.92 9.17 92.17 130.5 59.67 1.60 2.01 4.43 2.11 51.59
161 Shisir 2.37 25.5 8.33 93.17 132.83 31.33 1.37 0.84 4.45 1.93 20.3
178 ILL9976 2.72 24.42 8.33 91.17 136.83 36.67 1.50 1.00 3.90 1.7 25.17
173 ILL6818 2.38 23.5 7.5 94.83 133 38.17 1.17 0.72 3.06 1.6 28.52
158 Arun 2.27 23.17 6 95.83 137 40.67 1.87 1.25 2.94 1.63 45.36
5 Simal 2.33 24.77 8.17 94.04 134.46 39.71 1.42 1.00 4.09 1.65 27.19
3 Bari masuro-4 2.32 23.19 6.67 93.25 132.46 36.71 1.47 0.88 2.96 1.63 33.27
2 ILL7164 2.50 22.96 6.21 96.38 135 38.25 1.49 0.80 2.74 1.44 32.00
Mean 2.40 23.47 6.42 95.56 133.97 31.53 1.43 1.21 2.89 1.74 29.69
Range 1.77-3.08 16.67-35.00 3.5-12.67 88 -110 122-149 6.33-80.17 0.93-2.0 0.9 -3.02 1.24-6.68 0.9-3.31 5.5-65.41
60
61
4.1.3 Genetic parameters
The range, mean value, genotypic covariance (GCV)phenotypic covariance (PCV),
heritability and genetic advance as percent of mean at 5% levels for all 11 agro-
morphological traits analyzed is presented in Table 8.
4.1.3.1 Estimates of coefficient of variation, heritability and expected genetic advance
4.1.3.1.1 Phenotypic and genotypic coefficient of variation
Genetic variability in the source population is an important pre-requisite for any
genetic improvement however; it is not only the criterion for deciding as to which traits is
showing the highest degree of variability. Phenotypic coefficient of variation (PCV) and
genotypic coefficient of variation (GCV) can help in this regards. PCV and GCV values of
approximately more than 20% are regarded as high, whereas values less than 10 % are
regarded as low and between these two values are regarded as medium (Deshmukh and
Reddy, 1986). High GCV and PCV were recorded for grain yield as 51.13 and 55.10;
number of pods per plant as 47.56 and 49.31; harvest index as40.88 and 53.17; biological
yield as 37.93 and 48.12; 100 seed weight as 26.91and 26.93; number of branches per plant
as 32.14 and 35.26; and number of seeds per pod as 26.13 and 28.61 respectively. Medium
GCV and PCV were recorded for leaflet length and plant height while low for days to
flowering and days to maturity (Table 8). High genotypic and phenotypic coefficient of
variation for these traits was recorded by (Tyagi and Khan, 2011).
62
Table 8. Genetic parameter for different morphological traits
Traits Range Mean GCV% PCV% HA GA as% mean

LL 1.77-3.08 2.40 16.28 19.62 68.83 27.82
PH 16.67-35.00 23.48 12.81 15.07 72.22 22.42
NB/P 3.5-12.67 6.42 32.11 35.26 82.93 60.25
DF 88.50-110.67 95.56 3.63 3.77 92.75 7.20
DM 122.50-148.83 133.97 2.23 2.46 81.98 4.16
P/P 6.33-80.17 31.55 47.56 49.31 93.03 94.51
S/P 0.93-2.00 1.43 26.13 28.61 83.39 49.15
BY/P 1.24-6.68 2.89 37.93 48.12 62.13 61.59
SW 0.91-3.31 1.74 26.91 26.93 99.86 55.39
HI 5.50-65.41 29.69 40.88 53.17 59.10 64.73
GY/P 0.09-3.02 1.21 51.15 55.10 86.18 97.82
LL=leaflet length (cm), DF = days to 50% flowering, DM = days to 90 maturity, PH= Plant height, P/P =
number of pods per plant, NB/p = Number of primary branches per plant, seeds per pods, BY/p= biologic
yield per plant (g), GY/p= Grain yield per plant (g), SW= 100 seed weight (g) and HI= harvest index
63
Table 9. Estimates of phenotypic and genotypic correlation coefficients among the eleven traits
Level of Traits (Abbreviated)

Traits
correlation PH BP DF DM P/P S/P SW BY/Pt HI GY/pt
Leaflet length Pheno 0.072 0.059 0.024 0.008 0.112 0.034 0.017 0.074 0.054 0.081
Geno 0.324** 0.333** 0.083 0.069 0.347** 0.226** 0.055 0.445** 0.192** 0.320**
Plant height Pheno 0.209** -0.338** -0.193** 0.310** 0.144** 0.333** 0.501** 0.095 0.390**
Geno 0.315** -0.456** -0.256** 0.381** 0.306** 0.446** 0.692** 0.273** 0.507**
Number of branches/pt Pheno -0.119 -0.042 0.474** 0.122 -0.023 0.564** 0.057 0.395**
Geno -0.189** -0.071 0.675** 0.358** -0.036 0.757** 0.317** 0.587**
Days to flowering Pheno 0.632** 0.024 -0.036 -0.353** -0.188** 0.002 -0.118
Geno 0.715** 0.027 -0.075 -0.367** -0.325** 0.005 -0.151
Days to maturity Pheno 0.114 0.039 -0.253** -0.049 0.043 -0.036
Geno 0.130 0.094 -0.279** -0.072 0.055 -0.047
Pods per plant Pheno 0.372** 0.015 0.580** 0.608** 0.797**
Geno 0.695** 0.016 0.781** 0.777** 0.888**
Seeds per pod Pheno 0.099 0.331** 0.616** 0.623**
Geno 0.209** 0.523** 0.838** 0.756**
100 seed wt Pheno 0.214** 0.271** 0.317**
Geno 0.350** 0.353** 0.393**
Biological yield Pheno 0.099 0.677**
per plant Geno 0.490** 0.801**
Harvest index Pheno 0.732**
Geno 0.882**
Pheno=Phenotypic, Geno=Genotypic, df=n-2 , r value at 0.05=-0.138, r at 0.01 = 0.181, *=significant at 0.05 and**=significant at 0.01 level of probability
63
64
4.1.3.1.2 Heritability and genetic advances
The broad sense of heritability (h2) estimates of the traits under study ranged from
59.10 to 99.86 percent. According to Agrawal et al. (1976), heritability estimates in
cultivable plants can be placed in the following categories, 5-10 (low), 10-30 (medium)
and above 30 as high heritability. Based on this, all the traits showed high heritability.
Number of pods per plant showed highest heritability and genetic advance (93.03, 94.51),
followed by grain yield per plant (86.18, 97.82). High heritability with high genetic
advance was also reported by Yainis et al. (2008) in lentil while by Patel et al. (2012) in
green gram. Therefore, on the basis of these traits, early generation selection is possible.
Hence, genotypes having higher number of pods and grain yield per plant viz. RL-11,
Aarial, ILL3236, RL-6, F2003-49L, NRX-99s-95-1-1, ILL9932, Khajura-1 and RL-39 can
be selected for future breeding program (Table 8).
4.1.4 Correlation among traits
Table 9 showed the genetic and phenotypic correlation coefficients of 11 traits
recorded on 185 genotypes of lentil. The genotypic correlation coefficients were higher as
compared to phenotypic in all the characters indicating high consistence of results. Similar
results were also reported by Tyagi and Khan (2011). Grain yield per plant had positive
and significant correlation with all the characters except days to flowering and days to
maturity. Number of pods per plant was found positively correlated with plant height,
number of branches, leaflet length, number of seeds per pod, biological yield per plant,
harvest index, and grain yield per plant. Plant height has significant positive correlation
with number of branches, number of pods per plant, number of seeds per pod, seed weight,
biological yield, harvest index and grain yield while significant negative correlation with
days to flowering and days to maturity. Number of branches had positive correlation with
number of pods per plant, number of seeds per pod, biological yield and harvest index.
65
Hundred seed weight had positive and significant correlation with harvest index. This
positive association was earlier reported by Chauhan and Singh (2001). Moreover, positive
association of pods per plant, biological yield per plant, plant height and 100-seed weight
was additionally supported by Hamdi et al. (2003), Joshi and Singh (2005) and Luthra and
Sharma (1990). Genotypes having high number of pods per plant are RL-11, Aarial,
F2003-49L, Khajura1, Simal, ILL6811, RL-39, ILL2373, while genotypes having higher
harvest index are RL-39, Aerial, ILL6024, ILL2373, 39s-66L, RL-11, ILL3236, Khajura-1,
ILL9932, ILL8132, RL-95, NRX-99s-1, x49s-8, RL-11and ILL3236. These genotypes
were selected for further study.
4.1.5 Path coefficients analysis
The grain yield per plant is influenced by several characteristics (causes) and these
characteristics show various degrees of relationship among themselves. The correlation
coefficients of the causal characteristics with grain yield per plant were partitioned into
direct and indirect effects through path coefficient analysis at phenotypic and genotypic
levels. The direct and indirect effects of the casual variables on seed yield per plant were
shown in Table 10a and 10b. Residual represents only 0.2929 out of 1. This indicates that
the traits studied and included in the path coefficient analysis represent 1-0.2929=0.7071
which comprises more than two third of total. However, some other quantitative traits can
also be recorded for further partition and reduction of residual effect. Therefore, the result
of path coefficient analysis will help to know the significance of effect or cause i.e. trait
which leads to increase the yield of a plant. Present study revealed that higher positive
direct effect on grain yield was recorded by harvest index (0.525) followed by biological
yield (0.489), and pods per plant (0.368) at phenotypic level (Table 10a) while it was
0.923, 0.769 and 0.429, respectively, at genotypic level (Table 10b). The results are
consistence with those of Ghafoor et al. (1990), and Yaqoob et al. (1997). Seed weight
66
showed negative direct effect while it had positive indirect effect via biological yield and
harvest index on grain yield. Selection of genotypes having high harvest index and
biological yield/plan (RL-39, Aerial, ILL6024, ILL2373, 39s-66L, RL-11, ILL 3236,
Khajura-1, ILL9932, ILL8132, F2003-49L, LN-0137, RL-6) for future breeding program
considering those traits will certainly lead to fruitful results.
Table 10a. Phenotypic path coefficient analysis
Traits Direct LL PH B/P DF DM P/P S/P SW BY/P HI SUM_PATH

LL -0.008 -0.008 0.001 0.000 0.001 -0.001 0.019 0.002 0.001 0.036 0.028 0.081
PH 0.016 -0.001 0.016 0.000 -0.012 0.012 0.052 0.010 0.017 0.245 0.050 0.390
NB/P 0.001 0.000 0.003 0.001 -0.004 0.003 0.079 0.009 -0.001 0.276 0.030 0.395
DF 0.035 0.000 -0.005 0.000 0.035 -0.039 0.004 -0.003 -0.018 -0.092 0.001 -0.118
DM -0.062 0.000 -0.003 0.000 0.022 -0.062 0.019 0.003 -0.013 -0.024 0.023 -0.036
P/P 0.368 -0.001 0.005 0.000 -0.100 -0.101 0.368 0.027 0.001 0.284 0.319 0.797
S/P 0.072 0.000 0.002 0.000 -0.001 -0.002 0.062 0.072 0.005 0.162 0.323 0.623
SW 0.052 0.000 0.005 0.000 -0.012 0.016 0.002 0.007 0.052 0.105 0.142 0.317
BY/P 0.489 -0.001 0.008 0.000 -0.007 0.003 0.097 0.024 0.011 0.489 0.052 0.677
HI 0.525 0.000 0.002 0.000 0.000 -0.003 0.102 0.044 0.014 0.048 0.525 0.732
Residual = 0.2929
Table 10b. Genotypic path coefficient analysis

Traits Direct LL PH B/P DF DM P/P S/P SW BY/P HI SUM_PATH
LL -0.050 -0.050 -0.007 -0.008 0.009 -0.008 -0.090 -0.037 -0.008 0.342 0.177 0.320
PH -0.020 -0.016 -0.020 -0.008 -0.049 0.029 -0.099 -0.050 -0.065 0.532 0.252 0.507
NB/P -0.024 -0.017 -0.006 -0.024 -0.020 0.008 -0.175 -0.059 0.005 0.582 0.293 0.587
DF 0.107 -0.004 0.009 0.005 0.107 -0.081 -0.007 0.012 0.053 -0.250 0.005 -0.151
DM -0.114 -0.004 0.005 0.002 0.077 -0.114 -0.034 -0.015 0.041 -0.055 0.050 -0.047
P/P 0.429 -0.202 -0.018 -0.016 0.007 -0.015 0.429 -0.114 -0.003 0.400 0.417 0.888
S/P -0.164 -0.011 -0.006 -0.009 -0.008 -0.011 -0.180 -0.164 -0.030 0.402 0.774 0.756
SW -0.145 -0.003 -0.009 0.001 -0.039 0.032 -0.004 -0.034 -0.145 0.269 0.326 0.393
BY/P 0.769 -0.022 -0.014 -0.018 -0.035 0.008 -0.203 -0.086 -0.051 0.769 0.453 0.801
HI 0.923 -0.010 -0.005 -0.008 0.001 -0.006 -0.201 -0.137 -0.051 0.377 0.923 0.882
Residual 0.182
67
4.1.6 Genetic divergence
The genetic divergence is an outcome of several factors such as changing of
breeding material, genetic drift, natural variation and artificial selection rather than
ecological and geographical diversification (Sirohi and Dar, 2009). Through multivariate
analysis, all 185 genotypes were grouped into eight clusters based on Wards method,
(Ward, 1963). The composition of different clusters varied from 1 to 145 genotypes
(Figure 1), their number and names are given in Table 11. The cluster I has 145 genotypes
while clusters II, VI and VII have single in each. Cluster mean for 11 characteristics are
presented in Table 12. Cluster VIII has higher number of pods per plant, higher grain
yield; higher biological yield per plant and higher harvest index followed by cluster VII
and III, while lowest in cluster II. The distribution of genotypes from different eco-
geographical regions into these clusters was apparently random. Genotypes of similar
origin were grouped into different cluster and vice versa, thereby indicating non-
relationship between geographical and genetic diversity. Similar results were obtained by
(Jeena and Singh, 2002 and Tyagi and Khan, 2010). This tendency of genotypes to occur in
cluster cutting across geographical isolations is not the only factor causing genetic
diversity (Singh et al., 2004). This also suggests that genotypes falling in a cluster may
have some degree of ancestral relationship and distributed during the process of human
civilization and migration. Similar finding were reported by Sirohi et al. (2007), Solanki
(2007) and Jeena and Singh (2002). Breeding program may be initiated involving the
genotypes of superior clusters having high mean value for almost all required traits are
selected for further testing. Inter cluster distances between cluster is presented in Table-13.
Highest cluster distance 10.41 was observed between cluster II and VIII followed by
between II and VIII (9.80) and IV and VIII (9.62).

68
Figure 1. Dendrogram construction using 11 morphological traits
68
69
Table 11. Clustering pattern of 185 lentil genotypes based on Pearsons similarity analysis
for 11 characters
SN Genotypes Entries name

Arun, Baitadi 6A, Bari masuro-4, Cumara, DIGGER, DPL-62, FLIP 2009-
54L, FLIP 95-1L, FLIP05-52(ILL10073), Flip2006-55L, FLIP-2006-99L,
FLIP2009-59L, FLIP2009-60L, HUL-57, IL-1, ILL10068, ILL10134,
ILL1672, ILL1704, ILL1920, ILL1970, ILL2501, ILL2526, ILL2527,
ILL2573, ILL2701-1, ILL2712, ILL2716, ILL3111, ILL3280, ILL3338,
ILL7537R, ILL7616, ILL7664, ILL7715, ILL7723, ILL7978, ILL7980,
1 145
LL9992, ILL9993, ILL9996, ILLI970, Khajura-2, LG-12, LN-0111, LN-
0135, LN-0136, LN-3885, Mangal Bazar, M-Bharatai, NRX2001-71-3,
NRX2001-71-4, NRX2001-2-3, NRX9801-1, NRX9901-1, NRx-99S-95-1-
12, PL-4, PL-406, PL-4402, PL-639, RL-12, RL-13, RL-15, RL-21, RL-22,
RL-23, RL-25, RL-26, RL-28, RL-35, RL-38, RL-4, RL-41, RL-42, RL-43,
RL-45, RL-47, RL-49, RL-51, RL-55, RL-56, RL-58, RL-60, RL-62, RL-
67, RL-69, RL-71, RL-73, RL-74, RL-76, RL-77, RL-78, RL-79, RL-8,
RL-80, RL-81, RL-83, RL-84, RL-85, RL-9, RL-94, RL-95, Shikhar,
Shisir, Simal, Smrik, Sindur, WBL-77, X39S-66L, X49s-48
2 1 RL-68
39-S-66L, F2003-49L, FLIP05-44L(ILL100), ILL10045, ILL10071,
3 26
ILL7979, ILL8132, ILL9932, ILL9943, ILL9990, Jutpani, Khajura-1, LN-
0137, NRX-99s-95-1-1, RL-39, RL-44, RL-6, X94s-48, X95S-83
FLIP04-60L(ILL10013), FLIP2008-7L, ILL10065, ILL6256, ILL6458,
4 7
RL-70, RL-75
5 2 Sagun, X94 S-43
6 1 RL-20
7 1 Aarial
8 2 ILL3236, RL-11
70
Table 12. Genotypic means of each cluster for 11 characters
Cluster Genotypes LL PH B/P DF DM P/P S/P GY/P BY/P SW HI

I 145 2.37 23.18 6.04 95.20 133.83 26.58 1.38 0.66 2.64 1.71 26.38
II 1 2.10 23.08 4.17 95.83 122.50 8.83 1.40 0.23 1.24 1.93 20.76
III 26 2.51 25.10 7.95 95.47 134.16 55.70 1.67 1.72 4.09 1.89 45.84
IV 7 2.42 19.67 5.90 104.38 140.62 31.21 1.45 0.72 2.33 1.55 32.98
V 2 2.72 23.29 11.25 92.25 130.08 35.67 1.28 0.78 3.66 1.48 21.42
VI 1 2.90 35.00 6.33 92.83 131.67 17.83 1.23 0.64 2.89 2.81 21.20
VII 1 2.13 30.83 6.67 102.50 131.00 73.33 1.77 2.95 6.00 2.21 60.03
VIII 2 2.50 27.71 12.42 93.00 131.08 72.33 1.90 2.77 6.11 2.02 49.95
Table 13. Intra and inter cluster distance between clusters
Cluster I II III IV V VI VII VIII

I 0 4.54 4.03 4.30 4.03 5.47 7.81 7.85
II 0 7.30 7.60 6.55 6.92 9.80 10.42
III 0 5.94 4.43 6.27 4.83 4.20
IV 0 6.79 8.22 8.85 9.62
V 0 6.08 8.44 6.36
VI 0 8.68 8.67
VII 0 4.90
VIII 0
Experiment 2
4.2 Genetic divergence study using molecular marker
Molecular marker is used for estimating genetic variation at population level and
among closely related species (Nienhuis et al., 1995). Different types of molecular markers
have been developed showing that lentil has relatively low levels of genetic variation
(Eujaylet al., 1997; Sonnante and Pignone, 2001). Plant descriptors coupled with
molecular markers provide a valid evidence of diversity as these are least affected by
environmental fluctuations (Ahmad et al., 1997; Jha and Ohri, 1996; Margale et al., 1995).
71
Knowledge of genetic variation and genetic relationship between lentil genotypes is
important for efficient utilization of germplasm resources and is more important to know
which marker techniques and how many of the markers represent variation in the entire
genome and should be used in order to derive reliable diversity pattern (Saini et al., 2004).
4.2.1 Profiling
Thirty polymorphic SSR markers were used to study 185 lentil accessions during
this study. On an average 160 alleles per markers and 1 alleles per locus were amplified
from 185 lentil accessions from 30 SSR markers. Maximum alleles (178) were amplified
from SSR 19, SSR 99, SSR 113, SSR 156 and SSR 202 and minimum alleles (72) from
SSR 90 and SSR 207 with amplicon size of 180-395. The allelic frequency ranged from
0.4 to 0.98 with an average of 0.88. Only 16.6 per cent markers were able to amplify
maximum number of alleles and 6.6per cent markers gave minimum alleles per locus. SSR
317-1 showed heterozygosity with double alleles per locus which showed that this marker
may be made between cross of two related accessions. Similar results were obtained by
Salahvarzi et al. (2013) who reported that based on molecular data, 165 bands were
detected and 117 bands were polymorphic. The mean number of bands was 9.1 bands per
primer using ISJ, the fragment size varied within a significantly narrower range (150-2500
bp). Similarly, Verma et al. (2014) also reported that a total of 123 alleles were amplified
at 33 loci ranging from 2-5 alleles with an average of 3.73 alleles per locus.
4.2.2 Polymorphic information content
The polymorphic information content (PIC) value ranged from 0.039 to 0.84 for
SSR based 30 selected markers. The PIC highest value was 0.84 for SSR 34-2, SSR 90 and
SSR 207 and the lowest value 0.039 was for SSR 19, SSR 99, SSR 113, SSR 124, SSR
156, SSR 199 and SSR 202. Several researches showed that markers with PIC value 0.4 to
0.8 are considered good and informative with high polymorphism (Kushwaha et al., 2013).
72
Table 14. Primer's name and their potential to detect the genetic polymorphism in 185
selected lentil accessions
SN Marker name Number of alleles/locus Allelic frequency PIC value

1 SSR 34-2 73 0.40 0.840
2 SSR 66 176 0.97 0.059
3 SSR 90 72 0.40 0.840
4 SSR132RN 176 0.97 0.059
5 SSR 191 173 0.96 0.078
6 SSR 197 164 0.91 0.170
7 SSR 207 72 0.40 0.840
8 SSR 33 151 0.83 0.310
9 SSR 19 178 0.98 0.039
10 SSR 48 176 0.97 0.059
11 SSR 96 175 0.97 0.059
12 SSR 99 178 0.98 0.039
13 SSR 107 172 0.95 0.097
14 SSR 113 178 0.98 0.039
15 SSR 124 177 0.98 0.039
16 SSR 130 173 0.96 0.078
17 SSR 156 178 0.98 0.039
18 SSR 167 160 0.88 0.220
19 SSR 199 177 0.98 0.039
20 SSR 213 152 0.84 0.290
21 SSR 309-2 168 0.93 0.130
22 SSR 317-1 166 0.92 0.150
23 SSR 317-2 168 0.93 0.130
24 SSR 323 169 0.93 0.130
25 SSR 336 154 0.85 0.270
26 SSR 183 160 0.88 0.220
27 SSR 202 178 0.98 0.039
28 SSR 28 175 0.97 0.059
29 SSR 72 171 0.95 0.097
30 SSR 230 172 0.95 0.097
Average 160.4 0.886 0.185
73
Figure 2a. Banding patterns of a highly polymorphic SSR34-2 marker in 185 lentil
genotypes in same sequence as given in Table 1
Figure 2b. Banding patterns of a highly polymorphic of SSR 90 marker in 185 lentil

74
Figure 2c. Banding patterns of a highly polymorphic SSR207 marker in 185 lentil
Figure 3a. Banding patterns of a low polymorphic SSR 19 marker in 185 lentil genotypes
in same sequence as given in Table 1

75
Figure 3b. Banding patterns of a low polymorphic SSR99 marker in 185 lentil genotypes
Figure 3c. Banding patterns of a low polymorphic SSR 124 marker in 185 lentil genotypes

76
The average PIC value was 0.185 for 30 markers used in this study. Highly
informative and detectable polymorphic markers for this study were SSR 34-2, SSR 90 and
SSR 207and their banding pattern with all the tested genotypes are given in Figures 2a, 2b
and 2c respectively. Similarly, markers SSR 19, SSR 99, SSR 113, SSR 124, SSR 156,
SSR 199 and SSR 202 had low PIC value which was less informative. Banding pattern of
SSR19, SSR99 and SSR124 with all the 185 tested genotypes in the same sequence are
given in figures 3a, 3b and 3c respectively. Similar results have been reported by several
authors using SSR, RAPD and ISSR profiling in the literature (Hamweih et al., 2009 and
Alabboud et al., 2009). Hamweih et al. (2009) observed that cultigens accessions are less
diverse comparing to wild accessions. Their study revealed that the diversity index for
same set of SSR markers ranged from 0.03 to 0.87 with a mean of 0.65 in 109 accessions
from 15 countries representing 57 cultigens and breeding lines from eight countries. Unlike
their observation on PIC value, the present study revealed that relatively little
polymorphism in 185 lentil breeding lines being used in this study. PIC values for SRAP
and AFLP markers were higher than 0.8, indicating the power and higher resolution of
those marker systems in detecting molecular diversity (Alghamdi et al., 2014). Similar
results were also evidenced by (Seyedimoradi and Talebi, 2014 and Kushwaha et al.,
2013).
4.2.3 Dendrogram construction
Dendrogram constructed by highly polymorphic 30 SSR markers from 185 lentil
accessions showed ten major groups from Group I to X based on source of origin and their
pedigree (Table 15 and Figure 2). Group one was the largest one followed by Group II,
Group IX, Group VIII, Group VII, Group V, Group IV and Group X. Group III and Group
VI consisted only one genotype. Group Ist was the largest one and it contains genotypes of
different origin, which can be again divided into different sub groups. Genotypes falling in
77
Groups IIIrd and VIth were totally different from other groups whereas Group Xth
genotypes were lines from Nepal cross. This study show the divergence among lentil
genotypes which can be further used in lentil breeding programs. The present results based
on SSR profiling are much similar to the earlier reports of Fikiru et al. (2010) and
Hamweih et al. (2009). Fikiru et al. (2010) observed five groups of lentil by analyzing 70
Ethiopian lentil accessions using set of ISSR markers. Likewise, Babayeva et al. (2009)
classified 39 lentil accessions from Central Asia and Caucasian region and found six
cluster using five pair of SSR markers. Other researchers also reported five to nine cluster
using SSR marker in diverse lentil accessions. On contrary to this, Alabboud et al. (2009)
reported very low level of genetic diversity with only two groups signifies low level of
detective power of RAPD comparing to SSR marker system. Hamwieh et al. (2009)
observed the highest genetic diversity in wild and cultivated species using SSR-66 in
contrary to the present result reflecting the lentil accessions included in this study are
relatively diverse and in most of the accessions displayed heterozygosis for that locus. The
heterozygosis in this locus probably is due to the introgression of genes or duplication of
microsatellite motif during the breeding and or the course of evolution. Thus, the level of
genetic diversity detection largely depends on the type of molecular markers, nature of
SSR repeat motif, number of SSR markers and the genetic relatedness of the lentil
germplasm to be analyzed. All genotypes involved in this study exhibited wide range of
genetic variability due to different center of origin, different genetic constitution. The
genetic relatedness detected in this study may constitute the foundation for future
systematic lentil breeding programs.

78
IL-1
ILL6256
RL-39
NRX2001-71-4
FLIP2009-59L
RL-13
ILL6468
F2003-49L
ILL7980
ILL6467
LN-3885
Jutpani
RL-12
RL-6
ILL9943
RL-95
RL-15
ILL590
RL-4
khajura-2
RL-67
X49s-48
ILL10134
ILL6024
ILL27001-1
LN-0137
Simrik
ILL9927
Baitadi 6A
RL-84
ILLI970
ILL8132
ILL2501
ILL4139
ILL3236
HUL-57
ILL2373
PL-4402
WBL-77
39-S-66L
ILL9990
RL-51
ILL8191
ILL7163
I
ILL9996
ILL8605
ILL7990
Shisir
RL-85
ILL7616
ILL7157
ILL3280
ILL6408
Shikhar
ILL9993
Khajura-1
ILL6256
NRX9801-1
ILL6447
ILL9932
ILL1672
ILL6021
FLIP2009-60L
X39S-66L
ILL7537R
ILL6260
ILL7220
ILL2716
X95S-83
ILL9949
ILL2527
ILL8186
PL-639
ILL3496
X94 S-43
ILL7162
RL-73
ILL3768
Bari Masuro-4
ILL10068
LN-0136
RL-11
Cumara
ILL7538
ILL9881
ILL7164
NRX2001-71-3
ILL3490
ILL6458
ILL8188
Arun
Flip2006-55L
ILL6829
Simal
ILL6025
RL-83
NRX-99S-95-95-1
ILL9992
ILL7986
Mangal Bazar
PL-406
RL-77 II
ILL3490
ILL2526
ILL2573
ILL7978
Aarial
ILL8187
ILL9976
NRx-99S-95-1-12
LN-0111
RL-81
ILL9885
ILL6818
PL-4
ILL1704
FLIP05-44L
ILL6811
FLIP05-24L
RL-55
Sindur
RL-56
III
RL-68
RL-49
RL-79 IV
RL-45
LN-0135
ILL7723
ILL7979
RL-28
V
FLIP04-60L
RL-9
DPL-62 VI
RL-41
RL-47
RL-26
RL-76
RL-62
RL-69 VII
LG-12
FLIP05-52
ILL3111
FLIP-2006-99L
FLIP 95-1L
ILL7664
DIGGER
ILL6821
ILL7715
RL-78
Sagun
M-Bharatai VIII
RL-75
RL-43
NRx2001-72-3
RL-21
RL-20
RL-25
RL-8
ILL1970
ILL1920
RL-60
RL-23
NRX9901-1
ILL3338
X94s-48
RL-70
RL-74
ILL2712
ILL6458
RL-35
RL-22
IX
RL-38
RL-94
RL-58
FLIP 2009-54L
RL-80
ILL10071
FLIP05-24L
ILL9926
FLIP2008-7L
ILL9924
ILL6465
RL-44
RL-42
RL-71 X
0.100
Figure 4. Dendrogram construction using 30 SSR markers

79
Table 15. Clustering pattern of 185 lentil genotypes based on SSR markers
SN Genotypes Entries name

Baitadi 6A, Bari masuro-4, Cumara, F2003-49L, FLIP2009-59L,
FLIP2009-60L, HUL-57, IL-1, ILL10068, ILL10134, ILL1672,
ILL1970, ILL2373, ILL2501, ILL2527, ILL27001-1, ILL2716,
ILL6468, ILL7157, ILL7162, ILL7163, ILL7220, ILL7537R, ILL7616,
1 83
ILL9932, ILL9943, ILL9949, ILL9990, ILL9993, ILL9996, Jutpani,
Khajura-1, Khajura-2, LN-0136, LN-0137, LN-3885, NRX2001-71-4,
NRX9801-1, PL-4402, PL-639, RL-11, RL-13, RL-15, RL-39, RL-4,
RL-51, RL-6, RL-67, RL-73, RL-84, RL-85, RL-95, Shikhar, Shisir,
Smrik, WBL-77, X39S-66L, X94 S-43, X94s-48, X95S-83, 39-s-66L
Aarial, Arun, FLIP05-44L(ILL100), Flip06-55L, FLIP05-24L-1
(ILL10045), ILL1704, ILL2526, ILL2573, ILL3490, ILL3492,
ILL6025, ILL6458,ILL6811, ILL6818, ILL6829, ILL7164, ILL7538,
2 37
ILL9992, LN-0111, Mangal Bazar, NRx2001-72-3, NRX-99s-95-1-1,
NRx-99S-95-1-12, PL-4, PL-406, RL-55, RL-77, RL-81, RL-83, Simal
3 2 RL-56, Sindur
4 4 RL-45, RL-49, RL-68, RL-79
5 5 ILL10013, ILL7723, ILL7979, LN-0135, RL-28
6 2 DPL-62, RL-9
FLIP-2006-99L, ILL10073, ILL3111, LG-12, RL-26, RL-41, RL-47,
7 10
RL-62, RL-69, RL-76
DIGGER, FLIP 95-1L, ILL6821, ILL7664, ILL7715, M-Bharatai,
8 13
NRX2001-71-3, RL-20, RL-21, RL-43, RL-75, RL-78, Sagun
FLIP 2009-54L, FLIP2008-7L, ILL10065, ILL10071, ILL1920,
ILL2712, ILL3338, ILL6458, ILL6465, ILL9924, ILL9926, ILLI970,
9 27
NRX9901-1, RL-22, RL-23, RL-25, RL-35, RL-38, RL-44, RL-58, RL-
60, RL-70, RL-74, RL-8, RL-80, RL-94, X49s-48
10 2 RL-42, RL-71
80
Experiment 3
4.3 Reaction of Fusarium wilt
4.3.1 Screening for wilt in field condition
This study was conducted under natural infection conditions in the field of RARS,
Nepalgunj during 2012/13 lentil growing season. The climatic conditions during the
experiment were favorable for the development of wilt. Results of disease reaction of
germplasm accessions have been summarized in Table 16. A wide range of variation in
disease reaction was observed among lentil genotypes.
Out of 185 genotypes tested; fifteen genotypes i.e. RL-13,ILL1672, ILL6468,
ILL6260, ILL8191, ILL9996, ILL7164, RL-85, Arun, ILL6811, ILL6024, RL-77, DPL-
62, M-Bharati, RL-21, and Sagun were found resistant to Fusarium wilt, while 23
genotypes i.e. ILL1920, ILL9932, ILL7980, RL-51, RL-44, ILL6021, ILL7157, RL-6,
ILL8187, ILL3490, ILL2526, FLIP2009-60L, ILL6256, ILL9949, LN-0111, ILL8132,
LN-0137, FLIP05-24L(ILL10045), 39-s-66L, ILL6025, LN-0135 were found moderately
resistant to Fusarium wilt on the basis of plant infection(Table-16) .Sixty seven genotypes
showed susceptible while79 genotypes showed highly susceptible reaction to Fusarium
wilt.
Bayaa et al. (1997) reported that genotypes. ILL590, ILL632, ILL2313, ILL2692,
ILL4829, ILL4954, ILL6120,ILL6404, ILL6797, ILL6811, ILL6994, ILL7193, ILL7199,
ILL7363, ILL7502, ILL7553,ILL7617, ILL7668, ILL7683, ILL7698, ILL7713, ILL7803,
ILL7880, ILL8076, ILL8077,ILL8174, ILL9918, ILL9981, and ILL10124 complete
resistance to Fusarium wilt over years in ICARDA, Aleppo, Syria.
Joshi, 2006 observe that varieties i.e. Simal, Smrik, Khajura-1Shital, Bari Masur-4,
and Maheswor Bharati possess field resistance to vascular wilt at Khumaltar, Nepal, while
Gharti et al 2011 found that genotypes ILL 9993 and ILL 7715 were resistant and ILL 590,
PL 406, ILL 7164 and F 2003-49L were moderately resistant to wilt/ root rot complex in
Nepalgunj condition.
81
Table 16. Reaction of Fusarium wilts resistant in lentil genotypes
D. Disease Infection No. of Genotypes name

score reaction (%) genotypes
1 Highly 0 0 N0
resistant
2 Resistant 1-10 16 RL-13,ILL1672, ILL6468, ILL6260,
ILL8191, ILL9996, ILL7164, RL-85,
Arun, ILL6811, ILL6024, RL-77, DPL-
62, M-Bharatai, RL-21, Sagun
3 MR 10-20 23 ILL1920, ILL9932, ILL7980, RL-51,
RL-44, ILL6021, ILL7157, RL-6,
ILL8187, ILL3490, ILL2526,
FLIP2009-60L, ILL6256, ILL9949,
LN-0111, ILL8132, LN-0137, FLIP05-
24L(ILL10045), 39-s-66L, ILL6025,
LN-0135, , ILL9993, , ILL7715
4 S 20-50 67 ILL7162, RL-74, RL-83, PL-4402,
ILL6408, ILL3496, ILL4139, LN-
0136, ILL7163, RL-55, ILL6465,
ILL8188, Khajura-1, ILL2573,
ILL2527, Cumara, ILL7664, RL-20,
ILL7978, WBL-77,Bari masuri -4,
FLIP04-60L(ILL10013), RL-81,
ILL3236, FLIP2008-7L, ILL7537R,
FLIP 95-1L, X49s-48, ILL7220,
Sindur, RL-35, shisir, F2003-49L,
ILL9926, RL-9, RL-76, FLIP2009-
59L(ILL), ILL6458 ,HUL-57,
FLIP2009-54L, RL-94, RL-4, RL-70,
RL-84, Aarial, RL-45, ILL9885,
ILL9976, ILL1970, X94s-48,
Baitadi6A, RL-47, Simal, PL-639,PL-
4, NRx2001-71-3, ILL3768, ILL10068,
RL-75, LN-3885, ILL3280, PL-406,
Digger, ILL7979, RL-26,
ILL10071,ILL7616
82
D. Disease Infection No. of Genotypes name

score reaction (%) genotypes
HS 50%and 79 RL-11, ILL7723, ILL9927, ILL-6458,
above RL-58, ILL6467, ILL7990, RL-25,
ILL2716, RL-78, FLIP05-
44L(ILL100), ILL590, Smrik, RL-38,
ILL9881, ILL1704, Flip2006-
55L(ILL1), Mangal Bazar, RL-68,
RNx99S-95-1-12, LG-12, ILL8186,
ILL9992, RL-80, ILL3111, RL-73, RL-
39, ILL6447, RL-60, ILL10134, RL-
43, RL-8, khajura-2, NRx2001-72-
3,Shital, RL-95, ILL8605, FLIP05-
24L(ILL10065), ILL7986, ILL280,
ILL6818, RL-15, shikhar, ILL2712,
ILL27001-1, ILL9943, NRx9901-1,
NRx2001-71-4, FLIP-2006-99L,
ILL2373, RL-23, RL-12, RL-42, RL-
56, NRx995-95-1, RL-22, ILL9924,
FLIP05-52(ILL10073), ILL7538, RL-
28, IL-1, ILL3338, RL-67, ILL9990,
ILL3490, RL-71, Jutpani, RL-69,
X95s83, ILL6821, RL-49, RL-62,
ILL2501, X39S-66L, ILL6829,
ILL6256, RL-79, NRX9801-1, RL-41
Experiment 4
4.4 Reaction of Stemphylium blight
4.4.1 Screening for Stemphylium blight in field condition
One hundred eighty five genotypes including resistant (Barimasuro-4) and
susceptible (Shital) checks were tested. Out of that 87 genotypes i.e. ILL 7980, RL- 9, RL-
12, PL 406, ILL 3490, ILL 6821, ILL 6447, RL- 11, LN-0135, Khajura-1, ILL 7990, ILL
9949, LN-0137, ILL 8187, ILL 7986, ILL 9992, Cumara, ILL 8188, Simal, ILL7978,
83
ILL7349, ILL 7163, Jutpani, Mangal Bazar, ILL2712, ILL1970, ILL10071, ILL6465,
ILL9926, ILL6458, ILL1920, ILL6811, M.Bharati, ILL7723, ILL3768, ILL7537R, WBL-
77, ILL6467, ILL6256, RL-60, FLIP2009-60L, RL-73, RL-75, RL-35, RL-43, RL-69, RL-
44, RL-39, RL-58, RL-21, FLIP05-52L(ILL10073, ILL6260, RL-94, RL-74, RL-20, RL-5,
ILL 7664, Bari Masuro-4 (Res check), Aarial, ILL 6458, FLIP 2009 - 59L ( ILL 10716),
RL- 28, RL- 78, ILL 6256, ILL 6408, ILL 10134, ILL 10065, ILL 2716, ILL 8186, PL
639, F 2003-49L, ILL 9990, RL- 77, ILL 9993, ILL 6818, ILL 3236, PL 4, LN 0111, NRx
99S-95-1-12, Arun, 94-S-38, ILL 1672, ILL 7715, X 94s43, RL-70, Digger, X49S-48
showed resistant reactions while 36 genotypes were found moderately resistant to
Stemphylium blight (Table 17). Forty four genotypes were found susceptible while 17 were
recorded as highly susceptible. Similar results were observed by the previous worker.
Gharti et al. (2011) reported that genotypes ILL 7164, ILL 6458, ILL 1704, ILL
9927, ILL 8006(BM-4), ILL 1672, X94s43, ILL 2573, ILL 9992, ILL 6025, Aarial, ILL
8093, ILL 9976, ILL 6256, IL-1, ILL 6818, ILL 2700-1, X94s29, ILL 9931, ILL 9996,
ILL 5787 and ILL 8191 were found moderately resistant to Stemphylium blight.
Khadka et al. (2014) reported that genotypes X94-s-38, RL-75 were found to be
resistant both the year while other genotypes ILL 1672, ILL 7537, ILL 7164, NRX 99S95-
2-4, ILL 8603, ILL 7715, Cumara, Arun, RL-47, ILL 10638, ILL 10134, FLIP 2008-7L
and ILL 8009 were found to be resistant only in 2013 to SB at Nepalgunj condition.
84
Table 17. Reaction of Stemphylium blight at Nepalgunj, 2012/13
D Disease Infection% Genotypes Genotypes

score reaction
1 Highly 0 None
resistant
3 Resistant 1-10 87 ILL 7980, RL- 9, RL- 12, PL 406,
ILL 3490, ILL 6821, ILL 6447, RL-
11, LN-0135, Khajura-1, ILL 7990,
ILL 9949, LN-0137, ILL 8187, ILL
7986, ILL 9992, Cumara, ILL 8188,
Simal, ILL7978, ILL7349, ILL
7163, Jutpani, Mangal Bazar,
ILL2712, ILL1970, ILL10071,
ILL6465, ILL9926, ILL6458,
ILL1920, ILL6811, M. Bharati,
ILL7723, ILL3768, ILL7537R,
WBL-77, ILL6467, ILL6256, RL-
60, FLIP2009-60L, RL-73, RL-75,
RL-35, RL-43, RL-69, RL-44, RL-
39, RL-58, RL-21, FLIP05-
52L(ILL10073, ILL6260, RL-94,
RL-74, RL-20, RL-5, ILL 7664,
Bari Masuro-4 (Res check), Aarial,
ILL 6458, FLIP 2009 - 59L ( ILL
10716), RL- 28, RL- 78, ILL 6256,
ILL 6408, ILL 10134, ILL 10065,
ILL 2716, ILL 8186, PL 639, F
2003-49L, ILL 9990, RL- 77, ILL
9993, ILL 6818, ILL 3236, PL 4,
LN 0111, NRx 99S-95-1-12, Arun,
94-S-38, ILL 1672, ILL 7715, X
94s43, RL-70, Digger, X49S-48
5 MR 10-20 36 RL-79, RL-8, X94S-48, ILL9924,
HUL-57, Sagun, DPL-62, LG-12,
ILL3111, FLIP-2006-99L, FLIP04-
60L(ILL10013), ILL6021, RL-76,
85
D Disease Infection% Genotypes Genotypes

score reaction
RL-26, RL-23, X 95 s83, Khajura -
2, ILL7220, NRX9801-1, 39-5-66L,
ILL 6468, ILL 9943, PL 4402, ILL
6024, ILL 3496, ILL 8191, RL- 85,
RL-83, IL-1, ILL7164 , ILL 1704,
FLIP 05-24L (ILL10045), RL-47,
RL-62, ILL 9976,ILL7980
7 S 20-50 45 RL-45, RL-67, RL-49, ILL3338,
RL-56, RL-68, ILL7162, LN-0136,
ILL7979, RL-4, ILL2527, FLIP95-
1L, RL-71, NRx2001-72-3,
FLIP2008-7L, FLIP2009-54L, RL-
42, RL-41, RL-80, X39S-66L,
NR2001-71-4, RL-25, RL-95,
ILL10068, RL-22, RL-38, RL- 13,
ILL 6025, ILL 3280, ILL 9996, RL-
55, ILL 6829, ILL8132, ILL8605,
RL-84, Smrik, ILL 9927, RL-51,
ILL590, ILL2501, ILL27001-1,
ILL4139, ILL 2573, Shikhar,ILL280
9 HS 50% and 17 Sindur, NRx-99s-95-1-1, Shisir,
above ILL9932, LN 3885, ILL9885, RL- 6,
ILL7157, ILL7538, Baitadi6A, ILL
2526, ILL9881, RL-81, ILL7616
Shital (sus. check) NRx9901-1,
ILL2373
Screening for combine resistant-combined observation of both the diseases showed
that 9 genotypes i.e. RL-13, RL-21, ILL6468, ILL9996, ILL6024, ILL6811, ILL7164,
Arun, Maheswarbharti were found combine resistant to both the diseases while DPL-
62,Sagun resistant to wilt and moderately resistant to SB. Genotypes ILL6021, ILL6256,
ILL9949, ILL8132, LN0137, ILL10045 were found resistant S.B and moderately resistant
86
to FW while genotype ILL3490 and ILL7980 exhibits moderately resistant to both diseases
(Table 17). Hussain et al. (2008), studied multiple resistant in lentil and found two lines
66013-3 and 66013-4 were resistant to blight and rust.
Table 18. Reaction of combined disease resistant to Fusarium wilt and Stemphylium blight
in lentil genotypes
SN Particular No. Genotypes

1 Combined resistant to Wilt and 9 RL-13, RL-21, ILL6468, ILL9996, ILL6024,
Stemphylium blight ILL6811, ILL7164, Arun, Maheswar Bharti
2 Resistant to wilt and MRto SB 2 DPL-62, Sagun
3 Resistant to SB and MR toFW 6 ILL6021, ILL6256, ILL9949, ILL8132,
LN0137, ILL10045
4 MR to F.W and SB 2 ILL3490, ILL7980
Experiment 5
4.5 Genotype environment interaction study
Several statistical methods are available to minimize the effect of the G E
interaction on the selection of cultivars and the prediction of the phenotypic response to
environmental changes. The additive main effect and multiplicative interaction (AMMI)
method, integrates analysis of variance (ANOVA) and principal component analysis
(PCA) into a unified approach that can be used to analyze multi-location trials (Zobel et
al., 1988; Crossa et al., 1990; Gauch and Zobel, 1996). AMMI uses analysis of variance to
study the main effects of genotypes and environments and a principal component analysis
for the residual multiplicative interaction among genotypes and environments. AMMI
provides the G E interaction sum of squares (SSGE) with a minimum number of
degrees of freedom.
4.5.1 Grain yield analysis following by AMMI model
The genotypes, environments and genotype environment interactions showed
significant differences for all the characters studied indicating distinct nature of genotypes,
87
environments and genotype environment interactions in phenotypic expression. Higher
sum of squares (SS) for all the traits are expressed by environments. Partitioning of sum of
square (SS) of grain yield among the major sources of variations viz. environments,
genotypes, and genotype environment interactions were estimated and found sharing
54.86, 19.86 and 25.28 per cent, respectively (Table 14). More than half of the total
variation is shared by environments i.e. location effect. A large yield variation, explained
by environments, indicated that the environments at the testing site and during the season
were diverse and a major part of variation in grain yield can be resulted from
environmental changes. The differences among the environments indicate that these
locations can be used as testing stations for breeding program. Almost one fifth of the total
variation is found to be due to significant differences among genotypes. GEI shared one
fourth of the total variation i.e. 25.289 per cent variation in grain yield. This is in
agreement with (Karimizadeh and Mohammadi, 2010 and Akter et al., 2014). As the
presence of genotype-environment interaction (GEI) is clearly demonstrated by the AMMI
model, the interaction is further partitioned among the first three interaction principal
component axis (IPCA). IPCA 1 and IPCA 2 are significant while the IPCA 3 is very low
as non- significant. IPCA1 explained 26.25 per cent of the interaction sum of square in 26
per cent of the Interaction degree of freedom (DF). Similarly, the second principal
component axis (IPCA 2) explained a further 22.61 per cent of the GEI sum of squares at
24 per cent of the Interaction degree of freedom which is in agreement (Gauch and Zobel,
1996). This recommends that the most accurate model for AMMI can be predicted using
the first two IPCAs.
4.5.2 Mean grain yield comparison
The mean yields of all the environments are presented in Table 3. Only 11
genotypes have produced above the grand mean yield, while all the checks produced below
the grand mean. The highest mean grain yield of genotypes averaged over environments
88
was produced by RL 39 (1.254 mt/ha) followed by ILL10071 (1.196 mt/ha) and ILL 2373
(1.172 mt/ha) and LL6256 (1.162 mt/ha) while lowest by Bari masuro-4 (0.736 mt/ha).
Different genotypes showed in consistent performance across all environments.
The highest environments mean grain yield over genotypes was recorded from
Itahari15 (1.580 mt/ha) followed by Khu14 (1.427 mt/ha) and Par14 (1.407 mt/ha) while
lowest by Khu15 (0.624 mt/ha) these environments are rich while other environments are
poor and produces lower than the averaged grain yield over environments and genotypes
(1.013 mt/ha). During 213/14 highest grain yield was produced by RL39 (2.260 mt/ha) at
Khu14 while it was highest by ILL6256 at Itahari15 during 2014/15. The high yielding
genotypes RL 39, RL11, ILL6256 and ILL 2373 are suitable for specific environments.
89
Table 19. AMMI analysis of variance for different quantitative traits of 21 lentil genotypes across 8 environments
Mean sum of square Explained % of

Source DF
DF DM PH NB PP SP By mt ha-1 Gy mt ha-1 SW GY
ENV 7 4285.50** 9345.20** 4002.50** 568.04** 22995.70** 0.52** 22.29** 9.86** 3.71** 54.86
GEN 20 237.90** 105.10** 27.70** 12.19** 1643.50** 0.06** 1.13** 0.23** 0.57** 19.86
ENVxGEN 140 48.20** 19.30** 17.50** 8.15** 741.20** 0.04** 0.58** 0.32** 0.23** 25.28
Error 320 12.50 5.70 9.60 3.88 379.80 0.02 0.34 0.050 0.06
PC1 26 115.44** 38.57** 45.20** 25.53** 1395.02** 0.07** 1.01** 0.32** 0.61** 26.25 of GxE
PC2 24 80.15** 28.12** 20.88** 8.77** 1135.67** 0.06** 0.88** 0.30** 0.37** 22.61 of GxE
PC3 22 39.22** 13.16** 12.62** 4.49** 814.69** 0.04** 0.67** 0.18ns 0.20**
Mean 92.24 131.98 31.16 7.23 64.68 1.82 2.04 1.013 1.64
CV% 3.83 1.80 9.93 17.22 15.13 7.82 14.59 15.01 14.72
Note-**= significant at 1% level, *=significant at 5% level, ns= non-significant
89
90
Table 20. Mean grain yield in mt ha-1 of 21 genotypes in 8 environments
2013/14 2014/15
En Genotypes Mean
Khu14 Nep14 Par14 Ram14 Khu15 Nep15 Par15 Ithari15
1 ILL 10071 1.497 0.834 1.296 1.377 0.852 1.187 0.749 1.774 1.196
2 ILL6811 1.305 0.691 1.673 1.247 1.090 0.954 0.630 1.172 1.095
3 ILL 10045 1.294 1.091 1.703 0.995 0.688 0.934 1.006 1.496 1.151
4 ILL 10065 1.385 1.231 1.313 0.827 0.938 0.975 0.546 1.421 1.080
5 RL-44 1.467 1.166 1.120 1.245 0.622 0.612 0.511 1.318 1.008
6 RL-39 2.260 1.042 1.521 0.985 1.000 0.963 0.917 1.344 1.254
7 ILL 6256 1.537 1.066 1.454 1.072 0.718 0.647 0.603 2.204 1.162
8 39-S-66L 1.662 0.906 1.265 0.772 0.587 0.845 0.866 1.631 1.067
9 F2003-49L 1.399 0.890 1.391 0.744 0.421 0.638 0.616 1.512 0.951
10 ILL 2373 1.624 1.089 1.962 0.969 0.782 0.423 0.506 2.023 1.172
11 RL-11 2.146 0.853 1.161 0.665 0.485 0.501 0.506 1.998 1.039
12 Khajura-1 1.830 0.958 1.281 0.951 0.655 0.528 0.664 1.490 1.045
13 ILL 6024 1.796 0.248 1.208 0.944 0.567 0.522 0.982 1.930 1.025
14 ILL 8132 1.666 0.752 1.240 0.927 0.779 0.723 0.553 1.413 1.007
15 Shishir 0.964 0.902 1.992 0.681 0.543 0.293 0.757 1.451 0.948
16 ILL 9976 1.059 1.060 1.488 0.663 0.525 0.357 0.781 1.615 0.943
17 ILL 6818 0.890 0.621 0.901 0.660 0.521 0.634 0.998 1.043 0.783
18 Arun 1.207 0.963 1.302 0.816 0.428 0.386 0.741 1.782 0.953
19 Simal(C1) 1.057 0.522 1.926 0.963 0.204 0.269 0.340 1.351 0.829
20 Bari masuro-4(C2) 0.988 0.481 0.930 0.704 0.261 0.318 0.403 1.802 0.736
21 ILL 7164(C3) 0.936 0.327 1.420 0.865 0.443 0.545 0.613 1.403 0.819
Mean 1.427 0.843 1.407 0.908 0.624 0.631 0.680 1.580 1.013
4.5.3 Stability analysis by AMMI model
The AMMI Stability Value (ASV) and AMMI stable index are calculated as
suggested by Zobel et al. (1998) and Purchase et al. (2000), and their ranks are presented
in table 4. The highest mean grain yield of genotypes averaged over environments was
produced by RL 39 (1.254 mt/ha) followed by ILL10071 (1.196 mt/ha), ILL 2373 (1.172
mt/ha) and LL6256 (1.162 mt/ha) while lowest by Bari masuro-4 (0.736 mt/ha). The
91
genotypes which has low stability value (ASV) is understood as stable and therefore,
stable genotypes having grain yield above the mean grand yield are chosen. In this
experiment genotype F2003-49L ranked 1st in stability followed by Arun, 39-s-66L, RL-44
and ILL10071 and suitable for all environment but out of that only ILL10071 produced the
mean yield above grand mean.
Table 21. Mean grain yield (mt ha-1), AMMI stability values (ASV), stability index and
ranking orders of the 21 genotypes
Genotypes Mean GY mt ha-1 ASV rASV YSI rYSI

F2003-49L 0.951 0.029 1 16 15
Arun 0.953 0.239 2 16 14
39-s-66L 1.067 0.239 3 11 8
RL-44 1.008 0.247 4 16 12
ILL10071 1.196 0.272 5 7 2
Bari masura-4(Ch-2) 0.736 0.275 6 27 21
ILL7164 (Check-3) 0.819 0.279 7 26 19
Khajura-1 1.045 0.280 8 17 9
ILL8132 1.007 0.292 9 22 13
ILL10065 1.080 0.307 10 17 7
ILL9976 0.943 0.324 11 28 17
ILL10045 1.151 0.339 12 17 5
ILL6256 1.163 0.358 13 17 4
ILL6024 1.025 0.450 14 25 11
ILL6818 0.784 0.462 15 35 20
ILL2373 1.172 0.478 16 19 3
RL-39 1.254 0.493 17 18 1
ILL6811 1.095 0.539 18 24 6
Simal (check-1) 0.829 0.557 19 37 18
Shisir 0.948 0.652 20 36 16
RL-11 1.039 0.751 21 31 10
Note- ASV=AMMI stability value, rASV=Rank of AMMI stability value, YSI=stability index of grain yield,
rYSI=rank stability index of grain yield
92
4.5.3.1 Expression of genotypes over the environments (AMMI 1 biplot)
Biplots are graphs where aspects of both genotypes and environments are plotted
on the same axes so that inter relationships can be visualized. There are two basic AMMI
biplots, the AMMI 1 biplot where the main effects of grain yield (genotype mean and
environment mean) and IPCA1 scores for both genotypes and environments are plotted
against each other. On the other hand, the second biplot is AMMI 2 biplot where scores for
IPCA1 and IPCA2 are plotted.
In the AMMI 1 biplot, the usual interpretation of biplot is that the displacements
along the abscissa indicate differences in main (additive) effects, whereas displacements
along the ordinate indicate differences in interaction effects. Genotypes that group together
have similar adaptation while environments which group together influences the genotypes
in the same way (Kepton, 1984). The graph shows that the genotypes which are in the right
side of perpendicular i.e. RL-39, ILL10071, ILL2373, ILL6818, ILL10065, and ILL6256
produce the higher grain yield than mean value (Figure 5).
Figure 5. AMMI 1 biplot for grain yield (mt ha-1) of 21 lentil genotypes and eight
environments using genotypic and environmental scores
The above mentioned genotypes are less affected by GxE interaction. The
environment Itahari15, Par14 and Khu14 produced the higher grain yield than mean (1.013
93
m/ha) and are rich environment. While remaining environments Nep14, Ram14, Khu15,
Nep15, and Par15 fall in one mega environments. The remaining genotypes and
environments produce lower grain yield than mean value. The environment Ram14 and
Nep14 are closer and genotypes ILL9976, ILL7164, and Simal are more favorable for
those locations.
4.5.3.2 Effect of PC1 and PC2 on the expression of genotypes and environments
(AMMI 2 biplot)
The environmental scores are joined to the origin by side lines. Sites with short
arrow do not exert strong interactive forces, while those with long arrow exert strong
interaction. The genotypes close to ordinate expressed general adaptation, whereas the
further genotypes depicted more specific adaptation to environments (Ebdon and Gauch,
2002). All the environments Khu14, Nep14, Par14, Ram14, Khu15, Nep15, Par14 and
Ithari15 are connected to the origin (Figure 6). The environments Nep14 and Ram14 had
short spokes and they do not exert strong interactive forces. The genotypes occurring close
together on the plot will tend to have similar yields in all environments, while genotypes
far apart may either differ in mean yield or show a different pattern of response over the
environments. Hence, the genotypes near the origin are not sensitive to environmental
interaction and those distant from the origins are sensitive and have large interaction. In the
present study, genotype RL39 and RL 11 (Khu14), ILL10065 and RL44 (Nep14), ILL2373
and Shisir (Par14), ILL10071 and RL-44 (Ram14), RL39 and ILL6811 (Khu15),
ILL10071 and RL39 (Nep15) ILL10045 and ILL6024 (Par15), and ILL6256 and ILL 2373
(Itahari15) are more responsive to the environment and are specific adopted. The
genotypes F2003-49L, Arun, 39-s-66L, RL-44 and ILL10071 are less affected by the G
E interaction and thus would perform well across a wide range of environments.
94
Figure 6. AMMI 2 Biplot for grain yield (mt ha-1) showing the interaction of IPCA2
against IPCA1 scores of 21 lentil genotypes in eight environments

95
5 SUMMARY AND CONCLUSIONS
Lentil is leguminous crop fixes the nitrogen, improve soil fertility and hence good
for crop rotation. It is important because it has high protein and fiber content and said to
the meat of poor. Lentils also have anti nutrient factors, such as trypsin inhibitors and
relatively high phytate content. Trypsin is an enzyme involved in digestion, and reduces
the bioavailability of dietary minerals). Globally, lentil ranks sixth in terms of production
among the major pulses (FAO, 2013), and constituted 6% of total dry pulse production.
Lentils are relatively tolerant to drought, and are grown throughout the world The total
cultivated area of lentil in the world is as around 4.5 million hectares producing 4.9 million
metric tons of grain with an average production of 1260 kg/ha (FAO, 2014).
Lentil ranks first among pulse crops in Nepal. It contributes to human diet and
plays an important role in enhancing the fertility status of soil as it fixes atmospheric
nitrogen in symbiotic association with bacteria. It can be successfully integrated into the
existing cereal-based cropping pattern. Its seed is a rich source of protein, amino acids,
minerals, and vitamins for human nutrition. Lentil straw is a valued animal feed. Its ability
in nitrogen and carbon sequestration improves soil nutrient status, which in turn provides
sustainability in production systems.
In Nepal, lentil is cultivated in an area of 204,475 ha and produces 227,492 mt with
a productivity of 1,113 kg/ha. It shares 64.35 percent production of total grain legumes
(MoAD, 2014/15).
The demand of lentil both in local and international markets has increased
significantly in recent years. Hence, lentil can be emerged as a cash crop upon cultivation
of high yielding varieties that fetch higher price compared to most of the cereals and pulses
grown in Nepal. However, low productivity per unit area and grain quality (small seeded,
low plumpness) is typical features of Nepali lentils.

96
In Nepal lentil is only exportable crop. A quantum jump is required in the total
production of pulses to increase the per capita availability and to meet the challenges of
increasing population. Very few improved varieties with desirable traits have been
developed in Nepal, in addition the uptake of what so ever available improved varieties by
growers is also very low and there has been little research outside breeding. Still farmers
are hesitating to grow lentil due to high risk in production mainly due to biotic factors
(Fusarium wilt and Stemphylium blight).
Considering the above problems the present investigation entitled Study on
genetic divergence, source of resistant to Fusarium wilt and Stemphylium blight and
genotype environment interaction in lentil (Lens culinaries Medik.) was conducted with
the objectives -To estimate the genetic divergence present among local and exotic
germplasm using phenotypic attributes and DNA based SSR molecular markers., identify
the germplasm for potential sources of resistance to Fusarium wilt and Stemphylium blight
diseases and to know genotype-environment interaction among elite lines of lentil. The
results obtained from 5 experiments conducted during different years and locations are
summarizes as fallow.
Experiment 1
Statistical Analysis of variance revealed significant differences among the
treatments (including checks) and varieties (tested line) for all the traits. It indicates wide
range of variation for mean values and existence of variability in the experimental
materials.
Genotypes, RL-39, RL-11, ILL 3236, Khajura-1, ILL6024, ILL9932, ILL8132 and
ILL 2373 produced significantly higher number of pods and grain yield per plant than best
check (Simal).
97
Estimates of genotypic and phenotypic coefficients of variation were high for grain
yield per plant (55.10, 51.15), number of pods per plant (49.31, 47.56) and harvest index
(53.17, 40.89) whereas very low for days to flowering (3.77, 3.63) and days to maturity
(2.46, 2.23).
Estimates of genotypic coefficient of variability constituted major component of
variability suggested variation in the genetic constitution irrespective of environmental
influences.
All the characters showed high heritability. High heritability along with high
genetic advance as percentage of mean were observed for number of pods per plant, grain
yield per plant, biological yield per plant and harvest index suggested early generation
selection for these traits would be effective.
At phenotypic and genotypic level grain yield has significant positive correlation
with, number of pods per plant, number of seeds per pod, biological yield per plant and
harvest index, these traits should be consider in selecting the variety in lentil. Non-
significant correlation with days to flowering and days to maturity suggesting that high
yielding short duration variety could be selected simultaneously.
Genotypic and phenotypic path coefficient analysis revealed that traits like number
of pods per plant; biological yield per plant and harvest index have direct positive effect on
grain yield.
Genetic divergence analysis using morphological traits grouped 185 genotypes into
eight clusters. Cluster VII has highest mean value for number of pods (73.33) and grain
yield per plant (2.95 g) followed by cluster VIII (number of pods of 72.33 and grain yield
per plant of 2.77 g while these traits were lowest value for cluster II (8.83, 0.23g).
98
Therefore, selection of genotypes from diverse clusters especially for desirable
traits and make crosses between these groups resulted in raising the average productivity of
lentil in the country.
Experiment 2
Genetic divergence analysis using SSR molecular marker indicated that Micro
satellites profiling revealed maximum alleles, were amplified from SSR 19, SSR 99, SSR
113, SSR 156 and SSR 202 with amplicon size 180-395.
Highly informative and detectable polymorphic markers for this study were SSR 34-2,
SSR 90 and SSR 207. Therefore, use of these markers can be recommended for future
application specially for detecting molecular diversity in lentil.
Dendrogram constructed by 30 SSR markers from 185 lentil accessions showed ten
groups. Genotypes of groups III and VI were totally different from other groups, whereas
genotypes of group X were from Nepal cross lines. The level of genetic relatedness largely
depends on the type of molecular markers used in the study, nature of SSR repeat motif,
number of SSR markers and the genetic relatedness of the lentil germplasm to be analyzed.
Experiment 3
Sixteen genotypes viz. RL-13, ILL1672, ILL6468, ILL6260, ILL8191, ILL9996,
ILL7164, RL-85, Arun, ILL6811, ILL6024, RL-77, DPL-62, M-Bharatai, RL-21 and
Sagun were found to be resistant, while twenty three moderately resistant to Fusarium wilt.
Experiment 4
Eighty seven genotypes namely, ILL 7980, RL- 9, RL- 12, PL 406, ILL 3490, ILL
6821, ILL 6447, RL- 11, LN-0135, Khajura-1, ILL 7990, ILL 9949, LN-0137, ILL 8187,
ILL 7986, ILL 9992, Cumara, ILL 8188, Simal, ILL7978, ILL7349, ILL 7163, Jutpani,
Mangal Bazar, ILL2712, ILL1970, ILL10071, ILL6465, ILL9926, ILL6458, ILL1920,
ILL6811, Maheswor Bharati, ILL7723, ILL3768, ILL7537R, WBL-77, ILL6467,

99
ILL6256, RL-60, FLIP2009-60L, RL-73, RL-75, RL-35, RL-43, RL-69, RL-44, RL-39,
RL-58, RL-21, FLIP05-52L (ILL10073, ILL6260, RL-94, RL-74, RL-20, RL-5, ILL 7664,
Bari Masuro-4 (Res check), Aarial, ILL 6458, FLIP 2009 - 59L ( ILL 10716), RL- 28, RL-
78, ILL 6256, ILL 6408, ILL 10134, ILL 10065, ILL 2716, ILL 8186, PL 639, F 2003-
49L, ILL 9990, RL- 77, ILL 9993, ILL 6818, ILL 3236, PL 4, LN 0111, NRx 99S-95-1-
12, Arun, 94-S-38, ILL 1672, ILL 7715, X 94s43, RL-70, Digger, X49S-48) showed
resistant reaction, while 36 moderately resistant to Stemphylium blight in field condition.
Genotypes RL-13, RL-21, ILL6468, ILL9996, ILL6024, ILL6811, ILL7164, Arun
and Maheswar Bharti showed combined resistant to both Fusarium wilt and Stemphylium
blight diseases, while DPL-62 and Sagun were found resistant to Fusarium wilt and
moderately resistant to Stemphylium blight. These genotypes are suggested to utilize in
future breeding program to develop high yielding disease resistant varieties in order to
increase the national production.
Genotypes ILL6021, ILL6256, ILL9949, ILL8132, LN0137, and ILL10045 were
found resistant to SB and moderately resistant to FW while genotype ILL3490 and
ILL7980 exhibits moderately resistant to both diseases. These genotypes are selected to
use in future breeding program.
Experiment 5
Data analysis showed significant variations for all the characters studies indicating
distinct nature of genotypes, environments and genotype environment interactions in
phenotypic expression.
Grain yield was found to be a complex trait that is influenced by a number of
components along with direct or indirect influence of environments. In the present study,
AMMI model has shown that the largest proportion of the total variation in grain yield was
attributed to environments.
100
High sum of square (SS) for all the traits were expressed by environment. The
proportion of grain yield is found to be shared by environment; genotype and genotype
environment interaction as 54.86, 19.86 and 25.28, respectively.
Application of AMMI model to extract stability value and draw bi-plot is found to
be highly informative methods to explore adaptation pattern of genotypes in practical plant
breeding and in subsequent variety recommendations. Genotypes, RL-39, ILL10071,
ILL2373, ILL6818, ILL10065 and ILL6256 produced the higher grain yield than the
experimental mean value of 1.013 m/ha.
The environment Itahari15, Par14 and Khu14 produced the higher grain yield than
the overall locations mean of 1.013 m/ha. These locations are found to be rich environment
and highly representative for higher productivity of lentil in Nepal.
The genotypes viz. RL39 and RL 11 (Khu14), ILL10065 and RL44 (Nep14),
ILL2373 and Shisir (Par14), ILL10071 and RL-44 (Ram14), RL39 and ILL6811 (Khu15),
ILL10071 and RL39 (Nep15) ILL10045 and ILL6024 (Par15), and ILL6256 and ILL 2373
(Itahari15) performed better in their tested environments mentioned in parenthesis and are
especially recommended for those environments.
The genotypes RL39 (1.254 mt/ha) and ILL10071 (1.196 mt/ha) produced higher
grain yield than all other genotypes over the environments and performed better at most of
the locations.
The genotypes F2003-49L, Arun, 39-S-66L, RL-44, and ILL10071 performed
better , showed stable nature and less influence of G E interaction and thus would
perform well across a wide range of environments. These genotypes produced higher grain
yield than all checks. Therefore, these genotypes are recommended for further evaluation
in the farmers field to know their response.

101
LITERATURE CITED
Abay, F. and A. Bjrnstad. 2009. Specific Adaptation of Barley Varieties in Different
Locations in Ethiopia. Euphytica167(2): 181-195.
Abdul Latief, A. Al-Ghzawi, Emad Bsoul, Fakher aukour, Zakaria Al-Ajlouni, Maram Al-
Azzam and Mohammad M. Ajlouni. 2011. Genetic Variation for Quantitative
Traits in Jordanian Lentil Landraces. Advances in Environmental Biology, 5(11):
3676-3680, 2011 ISSN 1995-0756.
Abo-Hegazy, S.R.E., T. Selim and A.A.M. Ashrie. 2013. Genotype environment
interaction and stability analysis for yield and its components in lentil. Journal of
Plant Breeding and Crop Science Vol. 5(5): 85-90.
Agrawal, S.C., M.N. Khare and P.S. Agrawal. 1976. Field screening of lentil line for rust.
Indian journal of phyto-pathology.Vol. 292: 20-28.
Ahlawat, I.P.S. 2012.Agronomyrabi crops, Lentil. Division of Agronomy. Indian
Agricultural Research Institute, New Delhi-110 012 Agronomy.
Ahmad, M., A.C. Russell and D.L. McNeil. 1997. Identification and genetic
characterization of different resistance sources to Aschochyta blight within the
genus Lens. Euphytica 97: 311-315.
Akter, A., M. Jamil Hassan, M. UmmaKulsum, M.R. Islam and K. Hossain. 2014. AMMI
Biplot Analysis for Stability of Grain Yield in Hybrid Rice (Oryza sativa )analysis
of genotype-by-environment data. Crop Sci. 47: 643-655.
Alabboud, I., L. Szilagyi and G.H.V. Roman. 2009. Assessment of genetic diversity in
lentil (Lens culinaris Medik) as revealed by RAPD markers. Scientific papers,
USAMV Bucharest, Series A, LII 439.

102
Alghamdi, Salem S., A.M. Khan, H.A. Megahed, H. El-Harty Ehab, M.M. Hussein, M.
Abd El-Khalik Samah, M. Al-Shameri Aref, M.M. Javed and A. Al-Faifi Sulieman.
2014. Phenological, nutritional and molecular diversity assessment among 35
introduced lentil (Lens culinaris Medik.) genotypes grown in Saudi Arabia Int. J.
Mol. Sci. 15: 277-295.
Ali, A., A.M. Muhammad and M. Ashraf Zahid. 2012. Identifying the most promising
genotypes in lentil for cultivation in a wide range of environments of Pakistan
using various yield stability measures, Pak. J. Bot. 44(6): 1919-1922, 2012.
Altaf, R., C.A. Rauf, F. Naz. and G. Shabbir. 2014. Surveillance and morphological
characterization of Fusarium isolates associated with lentil wilt. Pakistan Journal of
Phytopathology 26 (1): 85-90.
Alwala, S., T. Kwolek, M. McPherson, J. Pellow and D. Meyer. 2010. A Comprehensive
Comparison between Eberhart and Russell Joint Regression and GGE Biplot
Analyses to Identify Stable and High Yielding Maize Hybrids. Field Crops Res.
119: 225-230.
Andrahennadi, C.P. 1994. Genetics and linkage of isozyme markers and resistance to seed
borne Aschochyta infection in lentil. M.Sc. Thesis, Univ. of Saskatchewan,
Saskatoon, Canada. Ahemad, M and Khan, MS (2010). Growth promotion and
protection of lentil (Lens esculenta) against herbicide stress by Rhizobium species.
Annals of Microbiology 60 (4): 735-745.
Andrahennadi, C.P. 1997. RAPD markers for Aschochyta blight resistance, phylogenetic
studies and cultivar identification in lentil. Ph.D. Thesis, Univ. of Saskatchewan,
Saskatoon, Canada.
103
Anita, A., S.S. Aich and M.P. Shrivastava. 2007. Genetic variability, correlation and co-
hertitability studies on yield and its components in lentil. Journal of
Interacademicia, vol. 11, no. 3, pp. 247250.
Annicchiarico, P., N.Harzic, and A.M. Carroni. 2010. Adaptation, Diversity, and
Exploitation of Global White Lupin (Lupinus albus L.) Landrace Genetic
Resources. Field Crops Res. 119 (1): 114-124.
Anonymous, 2008.Agriculture knowledge centre. Saskatchewan Agriculture.
Anonymous. 1996. Plant Genetic Resources Institute. Annual Report, 1995.National
Agricultural Research Centre, Islamabad, Pakistan.
Arumuganathan, K. and E.D. Earle. 1991. Nuclear DNA content of some important plant
species. Plant MolBiol 9: 208-218.
Attanayake, R.N., D.A. Glawe, F.M. Dugan, and W. Chen. 2009. Erysiphetri folii causing
powdery mildew of lentil (Lens culinaris). Plant Dis. 93: 797-803.
Ayliffe, M.A., J.K. Roberts, H.J. Mitchell, R. Zhang, G.J. Lawrence, J.G. Ellis and J.P.
Tony. 2002. A plant gene up-regulated at rust infection sites. Plan Physiol 129: 1
12.
Bahle, P.N., S. Lal and B.M. Sharma. 1993. An overview of the production and problems
in Southeast Asia. In: Erskine W & Saxena MC (Eds.), Lentil in South Asia.
Proceedings of the seminar on lentils in south Asia, ICARDA, Aleppo, Syria. pp. 1-
10.
Bakr, M.A. and F. Ahmed. 1992. Development of Stemphylium blight of Lentil and its
chemical control. Bangladesh J. Plant Pathol 8 (1 & 2): 39-40.
Banniza, S., E. Mwakutuya, P. Kumar and A. Vanderberg. 2005. Investigation into the
biology Gujarat Agric. Uni. Res. J. 22: 101-102.

104
Banniza, S., J.A. Parmelee, R.A.A. Morrall, A. Tullu and C.J. Beauchamp. 2004. First
record of powdery mildew on lentil in Canada. Can Plant Dis Surv 84: 102-103.
Barulina, H. 1930. Lentils of the USSR and other counties. Bull Appl Bot Gen Plant Breed
40: 225-238.
Bashi, E. and J. Rotem. 1974. Adaptation of four pathogens to semi-arid habitats as
conditioned by penetration rate and germinating spore survival. Phytopathology 64:
1035-1039.
Baum, M., N.F. Weeden, F.J. Muehlbauer, G. Kahl, S.M. Udupa, I. Eujayl, F. Weigand,
M. Harrabi and Z. Bouznad. 2000. Marker technology for plant breeding. In:
Knight R (ed) Linkage research and marketing opportunities for pulses in the 21st
century. Kluwer, Dordrecht. pp. 421-427.
Basant, Kumar; K.L. Mehra. and R.L Sapra. 1983. An investigation on correlation pattern
among yield components in lentil. Lens 10 (2): 10-12.
Bayaa, B. and W. Erskine. 1998. Diseases of lentils. In: The Pathology of Food and
Pasture Legumes (pp. 423-471) Allen Di and Lenn JM (eds.) CAB International
and ICRISAT, Wallingford, UK.
Bayaa, B. and W.Erskine. 1994. Response of wild lentil to Ascochyta fabae f. sp. Lentis
from Syria. Genet Crop Evol 41: 61-65.
Bayaa, B., and W. Erskine. 1998. Lentil Pathology. Pathology of Food and Pasture
Legumes (eds D. Allen and J. Lenn), Commonwealth Agricultural Bureaux
International, U.K in association with: International Crop Research Center for the
Semi-Arid Tropics, Patancheru 502 324. Andhra Pradesh, India. pp. 423-472.
Bayaa, B., S. Joshi, P.B. Karki and P. Jha. 1998. Survey Report 23 February to 10 March
1998 .
105
Bayaa, B., W. Erskine and M. Singh. 1997. Screening lentil for resistance to Fuanum wilt:
methodology and sources of resistance. Euphytica 98: 69-74.
Belabid, L., M. Baum, Z. Fortas, Z. Bouznad and I. Eujayl. 2004. Pathogenic and genetic
characterization of Algerian isolates of Fusarium oxysporum f. sp. Lentis by RAPD
and AFLP analysis. African Journal of Biotechnology 3 (1): 25-31.
Beniwal, S.P.S., B. Bayaa, S. Weigand, Kh. Makkouk and M.C. Saxena. 1993. Field
Guide to Lentil Diseases and Insect Pests. ICARDA. 107p.
Bent, A. 1996. Function meets structure in the study of plant disease resistance genes.
Plant Cell 8: 1757-1771.
Bicer, B. T. and D.Sakar.2004a.Evaluation of some lentil genotypes at different locations
in Turkey.Int.J. of Agri. and Bio. 6(2): 317-320.
Bicer, B.T. and D. Sakar.2004b.Genetic variability and heritability for grain yield and
other characters in lentil. J. Bio. Sci. 4(2): 216-218.
Bicer, B.T. and D. Sakar. 2006. Stability parameters in lentil. Central European J. Agri.
7(3): 439-443.
Boss, L., R.O. Hampton and K.M. Makkouk. 1988. Virus and virus diseases of pea, lentil,
faba bean, and chickpea. In World Crops: Cool Season Food Legumes. (Ed.): R.J.
Summerfield, Kluwar Academic Publishers. pp. 591-615.
Brennan, J., A. Aw-Hassan, K. Quade and T. Nordblom. 2002. Impact of Ashutosh and
Shiv, 2011. Research on Australian Agriculture, Economic Research Report No.
11, NSW Agriculture.
Buchwaldt, L., A. Vandenberg, A. Tullu and C.C. Bernier. 2001. Genetics of resistance to
anthracnose (Colletotrichum truncatum) in lentil. 4th European Conference on
Grain Legumes. Cracow, Poland. 242p.

106
Buddenhagen, I.W. and R.A. Richards. 1988. Breeding cool season food legumes for
improved performance in stress environments. In: World Crops: Cool Season Food
Legumes, (Summerfield, R.J., Ed.) Dordrecht, Kluwer Academic. pp. 8195.
Camara, M.P.S., N.R. ONeilland and P. van Berkum. 2002. Phylogeny of Stemphylium
spp. based on ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences.
Mycologia 94: 660672.
Cane. H. and C. Lolcer. 2006. Evaluation of selection criteria in large-seeded lentil (Lens
culinaris M.) genotypes using phenotypic correlations, path and factor analysis.
Turkish J. Field Crops 11(2): 19-27.
Caradus, J.R., A.C. Mackay, D.R. Woodfield, J. Van den Bosch and S. Wewala. 1989.
Classification of a world collection of white clover cultivars. Euphytica 42: 183-
196.
Carranca, C., A. de Varennes and D. Rolston. 1999. Biological nitrogen fixation by
fababean, pea and chickpea, under field conditions, estimated by the N isotope
dilution technique. Eur J Agron 10(1): 49-56.
Causse, M.A., T.M. Fulton, Y.G. Cho, S.N. Ahn, J. Chunwongse, K.W., J. Xiao, Z. Yu,
P.C. Ronald, S.E. Harrington, G. Second, S.R. McCouch and S.D. Tanksley. 1994.
Saturated molecular map of the rice genome based on interspecific backcross
population. Genetics 138: 1251-1274.
Chahota, P.K., V.P. Gupta and S.K. Sharma. 2002. Inheritance of rust resistance in lentil.
Indian J Genet Plant Breed 62: 226-227.
Chaudhary, R. and A. Kaur. 2002. Wilt disease as a cause of shift from lentil cultivation in
Sangod Tehsil of Kota (Rajasthan). Indian Journal of Pulses Research 15 (2): 193-
194.
107
Chaudhary, R. and A. Kaur. 2002. Wilt disease as a cause of shift from lentil cultivation in
Sangod Tehsil.
Chauhan, M.P. and I.S. Singh. 2001. Relationship between seed yield and its component
characters in lentil (Lens culinaris Medik). LegumeRes. 24(4): 278-280.
Chauhan, M.P. and P.K. Sinha. 1982. Correlation and path analysis in lentil. LENS Newsl.
9: 19-22.
Chauhan, M.P., M. Nathand R.K. Srivastava. 2005. Classification of genetic diversity in
Indian lentil germplasm. Legume Res. 28(2): 125-127.
Choi, W., D. Chung, J. Kang, H. Kim, Y. Jin, I. Han, Y. Lee, J. Jung, N. Lee and G. Park.
1999. Fully sealed, high-brightness carbon-nanotube field-emission display.
Applied physics letters 75 (20): 3129-3131.
Chongo, G. and C.C. Bernier. 1999. Field and growth chamber evaluation of components
of partial resistance to Colletotrichum truncatum in lentil. Can J Plant Pathol 21:
58-63.
Chongo, G., S. Banniza and T.Warkentin. 2002. Occurrence of Ascochytablight and other
diseases in Saskatchewan in the 2001 drought year. Can Plant Dis Surv. 83: 8589.
Chowdhury, A. M., A. Ahmed, M. Zaman and M.A. Bakr. 1996. Sporulation of
Stemphylium botryosum Wallr. Journal of Mycopath Res 34: 69-71.
Chowdhury, A.M., A. Ahmed and M. Zaman. 1997. Studies on the defence structural
factors of some susceptible and resistant varieties of lentil plants. Journal of
Mycopath Res 35: 35-39.
Chowdhury, M.A., C.P. Andrahennadi, A.E. Slinkard, and A. Vandenberg. 2001. RAPD
and SCAR markers for resistance to Ascochyta blight in lentil. Euphytica 118: 331-
337.
108
Clements, J.C. and W.A. Cowling. 1994. Pattern of morphological diversity in relation to
geographical origins of wild Lupinus angustifolius from the Aegean region.
Genetic Resources and Crop Evolution 41: 109-122.
Cohen, D., G. Ladizinsky, M. Ziv, and F.J. Muehlbauer. 1984: Rescue of interspecific Lens
hybrids by means of embryo culture. Plant Cell Tiss. Org.Cult. 3: 343-347.
Cokkizgin, A. and J.Y. Munqez. 2013. Lentil: Origin, Cultivation Techniques, Utilization
and Advances in Transformation. Agricultural Science 1(1): 55-62.
Conner, R.L. and C.C. Bernier. 1982. Race identification of in Uromycesvicia-fabae.
Phytopathology 72: 687-689.
Cornelius, P.L.; M. Seyedsadr,; J. Crossa,. 1992. Using the shifted multiplicative model to
search for "separability" in crop cultivar trials. Theorical and Applied Genetics 84:
161-172.
Crossa, J.; H.G. Gauch; R.W. Zobel. 1990. Additive main effects and multiplicative
analysis of two international maize cultivar trials. Crop Science 30: 493-500
Cubero, J.I. 1981. Origin, domestication and evolution. In C. Webb and G. C. Hawtin
(Eds.), Lentils (pp. 15-38). Commonwealth Agricultural Bureau, Slough, UK.
Cubero, J.I. 1981. Origin, taxonomy and domestication. In: Webb C & Hawtin G (Eds.),
Commonwealth Agricultural Bureau, Slough, United Kingdom. pp. 15-38.
Cubero, J.I. 1984. Taxonomy, distribution and evolution of the lentil and its wild relatives.
In: Witcombe JR & Erskine W (Eds.), Genetic resources and their exploitation:
chickpeas, faba beans and lentils, Martinus Nijhof, Boston, MA, USA.
Davis, P.E., and U. Plitmann. 1970. Lens MILLER, In: (Ed Davis P.E.) Flora of Turkey.
Edinburgh Univ. Press, Edinburgh 3: 325-328.
Dehghani, H., A. Ebadi and A. Yousefi. 2006. Biplotanalysis of genotype by environment
interactionfor barley yield in Iran. Agron. J. 98:388-393.

109
Deshmukh, S.N. and P.S. Reddy. 1986. Genetic variability, character association and path
coefficients of quantitative traits in Virginia bunch variety of groundnut. Indian J.
Syria. 45p. Agricultural Science 56: 816-821.
Dewey, D.R. and K.H. Lu 1959. A correlation and path coefficient analysis of components
of crested wheat grass seed production. Agron. J. 51: 515-518
Dhuppar, P., S. Biyan, B. Chintapalli and S. Rao. 2012. Lentil Crop Production in the
Context of Climate Change: An Appraisal. Indian Research Journal of Extension
Education 2(Special Issue): 33-35.
Dirlewanger, E., A. Moing, C. Rothan, L. Svanella, V. Pronier, A. Guye, C. Plomion, and
R. Monet. 1999. Mapping QTLs controlling fruit quality in peach [Prunus persica
(L.) Batsch]. TheorAppl Genet 98: 1831.
Dixit, P. and D.K. Dubey. 1984. Path Analysis in Lentil (Lens culinaris Medic.).Lens
Newsletter 11(2): 15-17.
Doyle, J.J. and J.L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochemical Bulletin 19: 11-15.
du Toit, L.J. and M.L. Derie. 2001. Stemphylium botryosum pathogenic on spinach seed
crops in Washington. Plant Dis 85: 920.
Duran, Y., R. Fratini, P. Garcia, and M.V. Perez de la, 2004.An inter-subspecific genetic
map of Lens.TheorAppl Genet 108: 1265-1237.
Eagling, D. 2009. Soilborne diseases in the context of plant biosecurity. Australasian Plant
Pathology 38 (4): 334-337.
Eagling, D. 2009. Soilborne diseases in the context of plant biosecurity. Australasian Plant
Pathology 38 (4): 334-337.

110
Ebdon, J. and H. Gauch. 2002. Additive Main Effect and Multiplicative Interaction
Analysis of National Turfgrass Performance Trials. I. Interpretation of Genotype
Environment Interaction. Crop Sci.42(2): 489-496
Eberhart, S.A. and W.A. Russell. 1966. Stability parameters for comparing varieties. Crop
Science 6(1): 36-40.
Eissa, A.M., M.A. El. Morshidy., E.E. Mahdy and A.A.El.Wafa.1987.Correlation and path
coefficient analysis inlentil. Assiat. J. Agric. Scien. 18(3): 110-118.
Ellis, M. and J. Waller. 1974. Sclerotiniafuckeliana (conidial state: Botrytis cinerea). CMI
DescrPathog Fungi BactCommonwMycol Inst.
Erskine, W. 1997.Lessons for breeders from land races of lentil. Euphytica 93: 107-112.
Erskine, W. and A. Sarker. 1997. Lentil: the Bangladesh breakthrough. ICARDA, Carvan
No. 6.
Erskine, W. and A. Sarker. 1997. Lentil: The Bangladesh breakthrough. Caravan 6: 89.
Erskine, W. and M.A. Chaudhary. 1986. Variation between and within lentil landraces
from Yemen republic. Euphytica 35: 695-700.
Erskine, W., A. Hussain, M. Tahir, A. Bahksh, R.H. Ellis, R.J. Summerfield and E.H.
Roberts. 1994b. Field evaluation of a model phototermal responses in a world lentil
collection. TheorAppl Genet 88: 423428.
Erskine, W., A. Hussain, M. Tahir, A. Bahksh, R.H. Ellis, R.J. Summerfield and E.H.
Roberts. 1994b. Field evaluation of a model phototermal responses in a world lentil
collection. TheorAppl Genet 88: 423428.
Erskine, W., B. Bayaa and M.C. Saxena. 1996. Registration of ILL 5588 lentil
germplasmresistant to vascular wilt and ascochyta blight. Crop Science36:1080

111
Erskine, W., M. Tufail, A. Russell, M.C. Tyagi, M.M. Rahman and M.C.
Saxena.1994a.Current and future strategies in breeding in lentil for resistance to
biotic and abiotic stresses. Euphytica. 73p.
Erskine, W., Y. Adham and L. Holly. 1989. Geographic distribution of variation in
quantitative traits in a world lentil collection. Euphytica 43: 97-103.
Eujayl, I., M. Baum, W. Erskine, E. Pehu and F.J. Muehlbauer. 1997. The use of RAPD
markers for lentil geneticmapping and the evaluation of distorted F2 segregation.
Euphytica 96: 405-412.
Eujayl, I., M. Baum, W. Powell, W. Erskine and E. Pehu. 1998. A genetic linkage map of
lentil (Lens sp.) based on RAPD and AFLP markers using recombinant inbred
lines. TheorAppl Genet 97: 83-89.
Eujayl, I., W. Erskine, B. Bayaa, M. Baum and E. Pehu. 1998. Fusarium vascular wilt in
lentil: Inheritance and identification of DNA markers for resistance. Plant breeding.
117 (5): 497-499.
Ezekiel, M. 1930. Methods of correlation programme. Australian Journal of Agricultural
Research 14(7): 742-754. Analysis.
FalahatiRastegar, M., B. Jafarpour and A. Fatima Bagheri. 2010. Pathogenic and genetic
characterization of Fusarium oxysporumf. sp. lentisby RAPD and IGS analysis in
Khorasan province. World Applied Sciences Journal. 9.
Falconer, D.S. 1960. Introduction to Quantitative Genetics, 1st edn. Oliver and Boyd:
Edinburgh.
FAO. 2010. FAOSTAT, FAO. Statistical Database. Available at: http://www.fao.org
(Retrieved on June 10, 2015).
FAO. 2014. Statistical Database. Food and Agricultural Organization of the United
Nations, USA.
112
FAOSTAT. 2009. Available at: http://faostat.fao.org (Retrieved on October 15, 2015).
FAOSTAT. 2013. Agricultural Data on Primary Crops.
FAOSTAT. 2014. Available at: http://faostat3.fao.org/browse/Q/QC/E (Retrieved on
January 15, 2015).
Federer, W.T. 1961. Augmented designs with one-way elimination of heterogeneity. Bio-
metrics 17: 447-473
Ferguson, M. and W. Erskine. 2001. Lentils (Lens L). In: Maxted N and Bennett SJ (eds)
Plant Genetic Resources of Legumes in the Mediterranean. Dordrecht: Kluwer
Academic Publishers. pp. 125131.
Ferguson, M.E., M. Maxted, M. van Slageren and L.D. Robertson. 2000. A re-assessment
of the taxonomy of Lens Mill. (Leguminosae, Papilionoideae, Vicieae). Bot J Linn
Soc. 133: 4159.
Fiala, J.V., A. Tullu, S. Banniza, G. Sguin-Swartz and A. Vandenberg. 2009. Interspecies
Transfer of Resistance to Anthracnose in Lentil (Lens culinaris Medic.). Crop Sci
49: 825-830.
Fikiru, E., K. Tesfaye and E. Bekele. 2007. Genetic diversity and population structure of
Ethiopian lentil (Lens culinaris Medikus) landraces as revealed by ISSR marker.
African J Biotechnol 6(12): 1460-1468.
Fikiru, E., K.Tesfaye and E. Bekele. 2010. A comparative study of morphological and
molecular diversity in Ethiopean lentil (Lens culinaris Medikus) landraces. African
journal of Plant Science 4: 242-254.
Final Report. Project: 20020156 (ADF). CRDA # AGRO 301(SPCDB). 41p.
Finlay, K.W. and G.N. Wilkinson. 1963. The analysis of adaptation in a plant breeding
programme. Aust. J. Agric. Res. 14: 742-754.

113
Firas, M. and Al-Aysh. 2014. Genetic Variability, Correlation and Path Coefficient
Analysis of Yield and SomeYield Components in Landraces of Lentil (Lens
culinaris Medik). Jordan Journal of Agricultural Sciences, Volume 10, No. 4 2014.
Fisher, R.A. 1918. The correlation between relatives on the supposition of Mendelian
inheritance. Trans R SOC Edinb 52: 399-433.
Flor, H.H. 1947. Inheritance of reaction to rust in flax. J Agric Res 74: 241-262.
Frederick, M., S. Cho, A. Sarker, K. McPhee and C. Coyne. 2006. Application of
biotechnology in breeding lentil for resistance to biotic and abiotic stress.
Euphytica 147(1-2): 149-165.
Freeman, G.H. 1973. Statistical methods for the analysis of Genotype Environment
Interactions. Heredity 31(3): 339-354.
Freeman, G.H. and J.M. Perkins, 1971.Environmental and genotype-environmental
components of variability VIII. Relations between genotypes grown in different
environments and measures of these environments. Heredity 27: 15-23.
Gangele, N.K. and S.K. Rao. 2005. Heritability and genetic advance for yield and its
components in lentil. JNKVV Res. J. 39(1): 43-46.
Gauch, H.G. 1993. Matmodel version 2.0.AMMI and related analysis for two-way data
matrics.Micro computer power, Ithaca, New York, USA. J. 80: 388-39.
Gauch, H.G. and R.W. Zobel. 1996. AMMI analysis of yield trials. In M.S. Kang & H.G.
Gauch. (eds.). Genotype-by-environment interaction. pp. 85-122.
Ghafoor, A., M. Zubair and B.A. Malik. 1990. Path analysis in mash (Vigna mungo L.).
Pak. J. Bot. 22: 160-167.
Gharti, D.B., P. Jha, R. Darai, D. Ghale, S. Joshi and B.P. Wagle. 2008. Studies on the
management of Stemphylium blight (Stemphylium botryosum Walr.) of lentil (Lens
culinaris Medikus) at NGLRP, Rampur and RARS, Nepalgunj. Paper presented

114
at the 27th Winter Crops Research Workshop held at NARI hall, Khumaltar,
Lalitpur, Bhadra 25-27, 2065 (10-12 Sept., 2008).
Gharti, D.B., S. Joshi, R. Darai, T.N. Ghimire and M.B. Chadaro. 2011. Identifying
Sources of Resistance to Major Diseases of Lentil. Paper presented in the 28th
National Winter Crops Research Workshop held at RARS, Lumle, Kaski. Falgun
25-26, 2067 (March 9-10, 2011).
GoP. 2013. Agricultural Statistics of Pakistan, Economic Wing, Ministry of Food,
Agriculture and Livestock, Government of Pakistan. Islamabad. pp. 50-51.
Grafins, J.K. 1959. Heterosis in Barley. Agronomy J. 51: 551-554.
Graham, P.H. and C.P. Vance. 2000. Nitrogen fixation in perspective: an overview of
research and extension needs. Field Crops Research 65(2-3): 93-106.
Gupta, V.P., A.S. Khera and K.S. Bains, 1977.Concepts in Stability Analysis. In: Genetics
and Wheat Improvement, Gupta, A.K. (Ed.). Oxford and IBH Publishing Co., New
Delhi.
Gupta, V.P., M.S. Sekhon and D.R. Satija. 1991. Studies on genetic diversity, heterosis and
combining ability in Indian mustard (Brassica juncea L.). Indian J. Genet. 51: 448-
453.
Haddad, N.I., H.M. Saoub, M. Sader and M. Syouf. 2007. Diversity status of lentil (Lens
culinaris M.) landraces collected from Jordan. Crop Res. Hisar. 34(1/3): 103-109.
Hamdi, A., E.L.A.A. Ghareib, S.A. Shafey and M.A. M.Ibrahim.2003c. Direct and indirect
relationships among lentil characters.Egyptian J. Agril. Res. 81(1): 139-150.
Hamdi, A., E.L;.A.A. Ghareib, S.A. Shafey and M.A.M. Ibrahim. 2003. Direct and indirect
relationships among lentil characters. Journal of Agril. Res. 81: 224-229.

115
Hamdi, A., E.L.A.A. Ghareib, S.A. Shafey and M.A.M. Ibrahim. 2003b. Genetic
variability, heritability and expected genetic advance for earliness and seed yield
from selection in lentil. Egyptian J. Agril. Res. 81(1): 125-138.
Hamdi, A., M.M. Somia and E.L.E. M. Ghareib. 2002. Genetic and environmental
variation in seed yield and its components, protein and cooking quality of lentil.
Egyptian J. Agril. Res. 80(2): 737-752.
Hamwieh, A., S.M. Udupa, A.Sarker, C. Jung and M. Baum. 2009. Development of new
microsatellite markers and their application in the analysis of genetic diversity in
lentils. Breed. Sci. 59, 7786.
Hamwieh, A., S.M. Udupa, W.M. Choumane, A. Sarker, F. Dreyer C. Jung and M. Baum.
2005. A genetic linkagemap of Lens sp. based on microsatellite and AFLPmarkers
and the localization of fusarium vascular wiltresistance. Theor. Appl. Genet. 110:
669-677.
Hanelt, P. 2001. Lens Mill. In P. Hanelt (Ed.), Mansfelds encyclopedia of agricultural and
horticultural crops (Vol. 2, 849852).
Hashemi, P., A. Vandenberg and S. Banniza. 2005. Developing a protocol for large scale
inoculation of lentil germplasms with Stemphylium botryosum. In Proceedings of
Plant Canada 2005. Edmonton, AB, June 15-18.
Havey, M.J. and F.J. Muehlbauer. 1989. Linkages between restriction fragment length,
isozyme and morphological markers in lentil. Theor. Appl. Genet. 77: 395401.
Haytowitz, D. and J. Ahuja. 2015. Composition of Foods processing. USDA National
Nutrient Database for Standard Reference, Release 27. United States Department of
Agriculture.
Hussain, S., A. Ali, M. A. Zahid and S.M. Iqbal. 2008. Multiple disease resistance in lentil
germplasm from Pakistan. Pak. J. Bot., 40(2): 897-903, 2008

116
IBC. 2007. Institute of Biodiversity Conservation, Ethiopia: Second Country Report on the
State of Plant genetic resources for food and agriculture to United Nations food and
agricultural organization. Addis Ababa, Ethiopia.
ICARDA. 1990. Germplasm program legumes: Annual report. ICARDA, Tel Hadya,
Aleppo, Syria.
Aleppo, Syria. 316p.
Aleppo, Syria.
Aleppo, Syria.
Iqbal, A., I.A. Khalil, N. Ateeq and N. Khan. 2006. Nutritional quality of important
legumes. Food chemistry 97(2): 331-335.
Jeena, A. and I.S. Singh. 2001. Estimation of genetic diversity in lentil germplasm. Crop
Improvement 28(1): 81-88.
Jeena, A. and I.S. Singh. 2002. Genetic Divergences analysis in wild lentil. Legume Res.
25(3): 175-179.
Jha, S.S. and D. Ohri. 1996. Phylogenetic relationships of Cajanuscajan (L.) Millsp.
(Pigeonpea) and its wild relatives based on seed proteinprofiles. Genet. Resour.
Crop Evol. 43: 275-281.
Joseph, P., W. Gary and H .Vincent. 2014. Lentils: Trends in Production, Trade, and Price.
Briefing No. 61, Policy Center, Agricultural Marketing, Montana, USA.
Joshi, M., S. Singh and I. Singh. 2005. Variability and association studies in lentil (Lens
culinaris Medik). Indian Journal of Pulse Research, 18(2):144-146.

117
Joshi, S. 2006. Review of important grain legume diseases and their management. In:
Proceedings of a national workshop on Integrated Pest Management (IPM). Plant
Protection Society of Nepal. pp. 100-116.
Kaiser, W.J. 1997. Inter-and intra-national spread of ascochyta pathogens of chickpea, faba
bean, and lentil. Canadian Journal of Plant Pathology. 19 (2):215-224.
Kakde, S.S., R.N. Sharma, A.S. Khillarc and B.M. Lambade. 2005. Correlation and path
analysis in lentil (Lens culinaris L.). J. Soils and Crops 15(1): 67-71.
Kang, M.S. 1998. Using genotype-by-environment interactionfor crop cultivar
development.Adv.Agron. 62: 199-252.
Kang, M.S. 2004. Breeding: Genotype-by-environment interaction. In: Encyclopedia of
Plant and Crop Science. (Ed.): R.M.Goodman. Marcel-Dekker, New York, USA.
pp. 218-221.
Kalia, N.R. and V.P. Gupta. 1989. Induced polygenic variation in lentils. Lens Newsletter,
16(1): 8- 16.
Kannaiyan, J. and Y. L. Nene. 1976. Reaction of lentil germplasm and cultivars against
three root pathogens. Indian Journal of Agricultural Sciences. 46, 165167.
Kari Dolatabadi, H., E. Mohammadi Goltapeh, N. Mohammadi, M. Rabiey, N. Rohani and
A.A. Varma. 2011. Biocontrol potential of root endophytic fungi and Trichoderma
species against Fusarium wilt of lentil under in vitro and greenhouse conditions.
Journal of Agricultural Science and Technology 14 (2):407-420.
Karimizadeh, R. and M. Mohammadi. 2010. AMMI adjustment for rain fed lentil yield
trials in Iran. Bulg. J. Agric. Sci. 16: 66-73.
Kempton, R.A. 1984. The use of biplots in interpreting variety by environment
interactions. Journal of Agricultural Science 103: 123-135

118
Khadka, R.B., N. Pathak, D.B. Gharti and S. Joshi. 2014. Screening of lentil genotypes for
resistance against Stemphylium blight at RARS, Nepalgunj, Proceedings of the
29th Winter Crops Workshop Held at 11 & 12 June 2014 at RARS, Lumle, Nepal.
Kishore, N. and V.P. Gupta. 2002. Early generation selection in microspcrma and
macrosperma derived gene pool of lentil. Indian J. Genet, and PI. Breeding 62(1):
34- 37.
Kraft, J.M., D.W. Burke and W.A. Haglund. 1981. Fusarium diseases of beans, peas, and
lentils. Fusarium: Diseases, Biology, and Taxonomy. Pennsylvania State
University, University Park, PA, USA. pp. 142-156.
Kumar, A., D.P. Singh and B.B. Singh. 1995. Association analysis in lentil.Indian J. Pulses
Res. 8(1): 20-24.
Kumar, R., S.K. Sharma, B.P. Malik and S. Sharma 2004a. Genetic diversity in lentil (Lens
culinaris Medik.). Legume Res. 27(2): 111-11.
Kumar, R., S.K. Sharma, B.P. Malik and S. Sharma. 2004b. Path coefficient analysis of
seed yield components in lentil (Lem culinaris Medik.). Legume Res. 27(4): 305-
307.
Kumar, Y., S. K. Mishra, M.C. Tyagi, S.P. Singh and B. Sharma. 2005. Linkage between
genes for leaf color, plant pubescence, number of leaflets and plant height in lentil
(Lens culinaris Medik.). Euphytica 145 (1-2): 41-48.
Ladizinsky, G. 1979. The genetics of several morphological traits in the lentil. J. Hered.
70: 135-137.
Lee, H., Y.C. Chang, G. Nardone and K.J. KwonChung. 2007. TUP1 disruption in
ryptococcus neoformans uncovers a peptidemediated densitydependent growth
phenomenon that mimics quorum sensing. Molecular microbiology 64 (3): 591-
601.
119
Luthra, S.K., P.C. Sharma. 1990. Correlation and path analysis in lentils. Lens Newsletter,
17(2): 5-8.
Manandhar, J.B. 1975. Notes on winter pulse diseases. Division of Plant Pathology.
Maredia, M. 2011. Global and Regional Trends in Production, Trade and Consumption of
Food Legume Crops.
Margale, E., Y. Herve, J. Hu and C.V. Quiros. 1995. Determination of geneticvariability
by RAPD markers in cauliflower, cabbage and kale localcultivar from France.
Genet. Resour. Crop Evol. 42:281-289
Mara, D.C., V. Pando and B. Herrero. 2014. Morphological Characterization Of Lentil
(Lens Culinaris Medik.) Landraces from Castilla Y Len, Spain. Pak. J. Bot. 46(4):
1373-1380.
Mark, A. 2009. Biological Nitrogen Fixation and Soil Health Improvement. In: Erskine W,
et al. (Eds.), The Lentil botany, Production and use. CAB International Ltd, United
Kingdom. pp. 229-240.
Materne, M., and K.H.M.Siddique. 2009. Agro-ecology and lentil crop adaption. In:
Erskine W, et al. (Eds.), The Lentil botany, Production and use. CAB International
Ltd, Europe. pp. 47-63.
Matus, A., D.A. Derksen, F.L. Walley, H.A. Loeppky and C. Van Kessel. 1997. The
influence of tillage and crop rotation on nitrogen fixation in lentil and pea. Can J
Plant Sci. 77(2): 197-200.
MoAD. 2011. Stastistical Information on Nepalese Agriculture 2010-11. Government of
Nepal, Ministry of agriculture and Development, Agribusiness promotion and
Stastistics Division, Singh Darbar, Kathmandu, Nepal.

120
MoAD. 2015. Stastistical Information on Nepalese Agriculture 2010-11. Government of
Nepal, Ministry of agriculture and Development, Agribusiness promotion and
Stastistics Division, Singh Darbar, Kathmandu, Nepal.
Mohebodin, M., R. Karimizadeh, M. Mohammadi and N. Sabaghnia.2012 .Principal
Coordinates Analysis of Genotype Environment Interaction in Grain Yield of
Lentil Genotypes.Agriculture & Forestry, Vol. 57. (11) Issue 3: 93-107.
Muehlbauer, F.J., S. Cho, A. Sarker, K.E. McPhee, C.J. Coyne, P.N. Rajesh and R. Ford.
2006. Application of biotechnology in breeding lentil for resistance to biotic and
abiotic stress. Euphytica 147(1-2): 149-165.
Muehlbauer, F.J., W.J. Kaiser, R.M. Hannan and T. Abebe. 1998. Lentil crop production
manual.
Mulugeta, F. 2009. Ethiopia Commodity Exchange Authority; Lentil Production, Supply,
Demand and Marketing issues in Ethiopia.
Mwakutuya, E. 2006. Epidemiology of Stemphyliurn blight on lentil (Lens cu/mans) in
Saskatchewan. M.Sc. Thesis, Department of Plant Sciences. University of
Saskatchewan, Saskatoon.
Nadia, Y., M. Hanif, S. Siddique, A. Ghulam, M.J. Asghar and M.A. llaq. 2008. Estimates
of genetic parameters and path analysis in lentil (Lens culinuris M.). Pakistan J.
Agril. Sci. 45(3): 44-48.
Nandan, R. and B.P. Pandya. 1980. Correlation Path Coefficient and Selection Indices in
Lentil. Indian Journal of Genetics and Plant Breeding Year:, Volume : 40, Issue : 2
399- 404.
Neupane, R., A. Sarker, R. Shrestha, N. K. Yadav, W. Erskine, and C. Francis, 2008.
Lentil production in Nepal.A success story of fruitful partnership between the
Nepal Agricultural Research Council, the Centre for Legumes in Mediterranean

121
Agriculture and the International Center for Agricultural Research in the Dry
Areas. APAARI Publication: 2008/1, APAARI, Thailand. pp 142.
Nevo, E., E.M. Golenberg, A. Beiles, A.H.D. Brown and D. Zohary.1982 Theory of
Applied Genetics, 62: 241-254.
NGLRP. 1993. Annual Report 1992/93. National Grain Legumes Research Program.
NGLRP. 2000. Annual Report 1992/93. National Grain Legumes Research Program.
Nienhuis, J., J. Tivang and P. Skroch. 1995. Genetic relationship among cultivars and
landraces of lima bean (Phaseolus lunatus L.) asmeasured by RAPD markers. J.
Amer. Soc. Hort. Sci. 120: 300-306.
Nutter, F.F.W. 2007. The role of plant disease epidemiology in developing successful
integrated disease management programs. In General concepts in integrated pest
and disease management: Springer.
Om, V. and V.P. Gupta. 2001a. Association among yield and yield contributing characters
in macrosperma microsperma derivatives of lentil. Crop Improvement 28(1): 75-
80.
Om.V. and V.P. Gupta. 2001. Studies on crossover and non-crossover interactions for
phenological traits in macrosperm microsperma derived lines of lentil. Indian J.
Agril. Res. 35(2): 130-132.
Onyike, N.B. and P.E. Nelson. 1993. The distribution of Fusarium species in soils planted
to millet and sorghum in Lesotho, Nigeria and Zimbabwe. Mycopathologia 121 (2):
105-114.
Oplinger, E.S., L.L. Hardman, A.R. Kaminski, K.A. Kelling, and J.D. Doll. 1990.
Departments of Agronomy and Soil Science, College of Agricultural and Life
Sciences and Cooperative Extension Service, University of Wisconsin-Madison
and Department of Agronomy and Plant Genetics, University of Minnesota.

122
Ozdemir S. 2002. Grain legume crops. Hasad Publishing, Istanbul, Turkey. 42p.
Panse, V. and P.V.G. Sukhatma. 1969. Statistical methods for Agricultural Workers.
Indian Council for Agricultural Research, New Delhi.
Panse, V.G. 1957. Genetics of quantitative characters in relation to plant breeding. Indian
J. Genet.Pl. Breed. 17: 318-320.
Paroda, R.S. and J.D. Hays. 1971. An investigation of genotype-environmental interaction
for rate of ear-emergence spring barley. Heredity 26: 157-175.
Patel, A.I., S.C. Mali, C.G. Intwal and J.R. Nizma. 2012 Genetic variability, correlation
path analysis and genetic a divergence in green gram (Vigna radiate), Crop Res.
43(12,3): 178-184.
Peeters, J.P. and J.A. Martinelli. 1989. Hierarchical cluster analysis as a tool to manage
variation in germplasm collections. Theor. Appl. Genet. 78: 42-48.
Perkins, J.M. and J.L. Jinks, 1968. Environmental and genotype-environmental component
of variability. III. Multiple lines and crosses. Heredity 23: 339-356.
Purchase, J.L. 1997. Parametric analysis to described G E interaction and yield stability
in winter yield. Ph.D Thesis. Department of Agronomy, Faculty of Agriculture,
University of Orange Free State, Bloemfontein, South Africa. pp. 4-83.
Purchase, J.L., H. Hatting and C.S. Van Deventer. 2000. Genotype environment
interaction of winter wheat (T. aestivum) in South Africa: Stability analysis of yield
performance. S Afr J Plant Soil 17(3): 101-107.
Rahman, A.R.M.S. and M.D. Sarwar. 1982. Path coefficient analysis in lentil (Lens
culinaris). Bangladesh. J. Agric. 7 (3/4): 121-127.
Rakesh, K., S.K. Sharma and S. Sharma.2002a.Genetic divergence analysis in lentil (Lens
culinaris). Crop Res. Hisar. 24(3): 497-500.

123
Rakesh, K., S.K. Sharma, A. Sharma and S. Sharma. 2004b. Path coefficient analysis of
seed yield components in lentil (Lens culinaris M.). Legume Res. 27(4): 305-307.
Rakesh, K., S.K. Sharma, B.P.S. Malik, A. Sharma and S. Sharma.2004a.Genetic diversity
in lentil (Lens culinaris M.). Legume Res. 27(2): 111-114.
Rakesh, K., S.K. Sharma, B.P.S. Malik, D. Anuja and S. Anuja. 2002b. Correlation studies
in lentil (Lens culinarisM.). Ann. of Biology 18(2): 121-123.
Rakesh, K., S.K. Sharma, O.P. Iuthra and S. Sudhir. 2005. Phenotypic stability of lentil
genotypes under different environments. Ann. of Biology 21(2): 155-158.
Ramgiri, S.R. 1989. Variability and correlation of grain yield and quantitative character in
lentil. Lens 16:19-21.
Rathi, A. 2004. Character association analysis for yield and its components in lentil. Farm
Sci. J. 13(2): 170.
Sabaghnia, N., H. Dehghani and S.H. Sabaghpour. 2006. Nonparametric Methods for
Interpreting Genotype Environment Interaction of Lentil Genotypes, Crop Sci.
46:11001106, USA.
Sabaghnia, N., H. Dehghani and S.H. Sabaghpour. 2008. Graphic analysis of genotype
environmentinteraction of lentil yield in Iran. Agron J. 100: 760-764.
Sabaghnia, N., R. Karimizadeh, M. Mohammadi. 2012. Genotype by environment
interaction and stability analysis for grain yield of lentil genotypes, emdirbyst =
Agriculture Vol. 99, No. 3. pp. 305312
Sabghania, N., H. Dehghani and S.H. Sabaghpour. 2006. Non parametric methods for
interpreting genotype environment interaction of lentil genotypes. Crop Science.
46: 1100-1106
124
Saini, N., N. Jain, S. Jain and R.K. Jain. 2004. Assessment of genetic diversity within and
among Basmati and non-Basmati rice varieties using AFLP, ISSR and SSR
markers. Euphytica 140: 133146.
Salahvarzi, E., A. Salahvarzi and R. Drikvand. 2013. Assessment of genetic diversity in
(Lens culinaris M.) using ISJ marker. Annals of Biological Research 4 (7): 157-
160.
Salehi, M., A. Haghnazari, F. Shekari and A. Faramarzi. 2008. The study of seed yield and
seed yield components of lentil (Lens culinaris M.) under normal and drought
stress conditions. Pakistan J. Bio. Sci. 11(5): 758-762.
Sandhu, J.S. and S. Singh. 2007. History and origin. In: S.S. Yadav et al.(Eds.), Lentil: An
ancient crop for modern times, Dordrecht, Springer Verlag. pp. 1-9.
Saraf, C.S., R.R. Patil and M. Parshad. 1985. Correlation and regression studies in lentil
cultivars (Lens culinaris). LENS Newsl. 12(2): 11-12.
Saravanan, K., M. Gopalan and N. Senthil. 1996. Heritability and genetic advance in
sunflower.
Sarker, A. and S. Kumar. 2011. Lentils in production and food systems in West Asia and
Africa. International Center for Agricultural Research in the Dry Areas (ICARDA),
Aleppo, Syria. Grain Legumes 57: 46-48.
Sarker, A., W. Erskine, B. Sharma and M.C. Tyagi. 1999. Inheritance and linkage
relationship of days to flower and morphological loci in lentil. J. Hernel. 90: 270-
275.
Sarvan, K., V.K. Dwivedi and S. Dhircndra. 2007. Stability analysis for yield its
components in lentil (Lens culinaris M.). Legume Res. 30(1): 45-48.
Sarwar, D.M., A.K. Kaul and M. Quadar. 1982. Correlation studies in lentil. Lens News
letter. 9.22-23
125
Sarwar. D.M, K. Fateme and C.L.L. Gowda. 1984. Comparative correlation and path
analysis in local and exotic germplasm in lentil. Indian journal of jenetics and plant
breeding. 44 (2):201-205
Saxena, M.C. and N .Wassimi. 1980. Effect of fertilizer application and inoculation on the
performance of lentil and subsequent wheat crop. LENS 7: 52-53.
Sehirali, S. 1988. Grain legume crops. Ankara University, Faculty of Agricultural
Engineering, Ankara, Turkey 1089 (314): 435.
Seyedimoradi, H. and R. Talebi. 2014. Detecting DNA polymorphism and genetic
diversity in Lentil (Lens culinaris Medik.) germplasm: comparison of ISSR and
DAMD marker Physiol Mol Biol Plants. 20(4): 495500.
Shahi, J.P., J. Singh., L. Agarwal and M.S. Lal. 1986. Studies on variability for seed size,
permeability of seed coat to water and germination in lentil, LENS Newsl. 13(2):
14-15.
Shakoor, U., A. Saboor, I. Ali and A.Q. Mohsin. 2011. Impactof climate change on
agriculture: empirical evidence from arid region. Pak. J. Agri. Sci. 48: 327-333.
Shaner, G. and R. Finney. 1977. The effect of nitrogen fertilization on the expression of
slow-mildewing resistance in Knox wheat. Phytopathology 67 (8): 1051-1056.
Shankar, M., D. Jorgensen, D. Foster, G. Hollaway, M. McLean and S. Neate. 2013.
Identification of novel sources of yellow spot resistance in wheat. Crop Updates,
Perth, Western Australia.
Sharma, P.C. and S.K. Luthra. 1987. Genetic divergence in lentil (Lens culinaris Med.).
Genet.Agr., 41: 349-360.
Sharma, S.K., I.K. Dawson and R. Waugh. 1995. Relationships among cultivated and wild
lentils revealed by RAPD analysis. Theor Appl Genet 91(4): 647-654.

126
Shukla, G.K. 1972. Some aspects of partitioning genotype-environmental components of
variability. Hered 28: 237245.
Singh, A.P., R. Krishna. R. Kumar and N.P. Singh. 2001. Assaying divergence in lentil
(Lens culinaris M.). Crop Res. Hisar. 22(3): 469-473.
Singh, I.P. and J.D. Singh. 2007. Genetics of yield and its components in lentil (Lens
culinaris M.). National J. Plant Imprv. 9(1): 29-31.
Singh, I.S. and R.K. Singh. 2004. Study of genetic variability and heritability in two
growing seasons in lentil. Crop Improvement 27(2): 232-235.
Singh, I.S., J.P. Singh, A.K. Singh and M.P. Chauhan. 1994. Pant Lentil4: A high yielding,
rust, wilt and blight resistant variety for the North Western Plains of India. LENS
Newslett 21: 89.
Singh, J.P. and I.S. Singh. 1992. Genetics of seed coat color in lentil, Euphytica 66(3):
231-233.
Singh, R.K. and B.D. Chaudhary. 1985. Biometrical methods in quantitative genetics
analysis. Kalyani Publishers, New Delhi, India. pp. 229-252.
Singh, S., M. Hodda and G. Ash. 2013. Plantparasitic nematodes of potential
phytosanitary importance, their main hosts and reported yield losses. EPPO
Bulletin 43 (2): 334-374.
Singh, S.P. 1988. Clustering of genotypes for selection for heterosis in yield and response
to environmental variation in mungbean (Vigna radiata (L.) Wilczek): a proposed
method. Genome 30(6): 835-837.
Singh, S.P., K.B. Lal and R. Krishna.1995. Physiological parameters for selection in lentil
(Lens esculenta L.). Legumes Res. 18(2): 129-132.
Singh, T.P. 1978. Inheritance of cotyledon color in lentil. Ind. J. Genet. PI, Breed. 38:11-1.
Singh, T.P. 1978. Inheritance of cotyledon color in lentil. Indian J. Agric. Sci. 41: 54-56.
127
Sinha, R.P. and R.N. Singh. 2007. Correlation of seed yield with other traits in lentil. J.
App. Bio. 12(1/2): 1-3.
Sirohi, S.P.S., R. Yadav and S. Meenakshi. 2003. Assaying genetic divergence for
morpho-physiological traits in lentil (Lens culinaris Medik). Palntarchies 7(1): 331-
333.
Sirohi, S.P.S., Y. Ramashray and S. Meenakshi. 2007b. Assaying genetic divergence for
morpho-physiological traits in lentil (Lens culinaris Medik). Plant Archives 7(1):
331.
Sirohi, S.P.S., Y. Ramashray and S. Ranvir. 2007a. Genetic variability, correlations and
path analysis of yield and its component characters in lentil (Lens culinaris M.).
Plant Archives 7(1): 295-299.
Slinkard, A.E. 1978. Inheritance of cotyledon color in lentils. J. Hered. 69: 139-140.
Smith, J.S. and O.S. Smith. 1989. Environmental effects on ze in chromatograms of maize
inbred lines revealed by reversed-phase high-performance-liquid chromatography.
Theor. Appl. Genet. 71: 607-612.
Sobia, R., M. Hanif. S. Siddique, A. Ghulam, M.J. Asghar and M.A. Haq. 2008.
Inheritance of seed yield and related traits in some lentil (Lens culinaris M.)
genotypes. Pakistan J. Agril. Sci. 45(3): 49-52.
Solanki, I.S. 2001. Stability of seed yield and its component characters in lentil (Lains
culinaris). Indian J. Agril. Sci. 71(6): 414-416.
Solanki, I.S. 2007. Divergence analysis in lentil (Lens culinaris Medik) National J. of Plant
Improvement 9(2): 123-125.
Solfrizzo, M., R.N. Strange, C. Sabia and A. Visconti. 1994. Production of a toxin
stemphol by Stemphyliums pecies. Natural Toxins 2: 14-18.

128
Sonnante, G. and D. Pignone. 2001. Assessment of genetic variation in a collection of
lentil using molecular tools. Euphytica 120: 301307.
Srivastava, R.P. and H. Vasishtha. 2012. Saponins and lectins of Indian chickpeas (Cicer
arietinum) and lentils (Lens culinaris). Indian J. Agric. Biochem. 25: 4447.
Stoilova, T. and P. Chavdarov. 2006. Evaluation of Lentil Germplasm for Disease
Resistance to Fusarium wilt (Fusarium oxysporumf. sp. lentis). Journal of Central
European Agriculture 7 (1):121-126.
Tadele, T., L. Teshome, M. Behailu and S. Gashaw. 2014. Correlation and path coefficient
analysis of yield and yield components in lentil (Lens culinaris Medik.) germplasm
in the highlands of Bale, Ethiopia.International Journal of Biodiversity and
Conservation Vol. 6(1): 115-120.
Tadmor, Y., Zamir D and Ladizinsky G, 1987. Genetic mapping of an ancient translocation
in the genus Lens. Theor Appl Genet 73:883-892.
Tamietti, G. and D. Valentino. 2006. Soil solarization as an ecological method for the
control of Fusarium wilt of melon in Italy. Crop protection 25 (4): 389-397.
Taylor, P., K. Lindbeck, W. Chen and R. Ford. 2007. Lentil diseases. In Lentil: Springer.
Acad. Res. J. Agri. Sci. Res. variability. III. Multiple line and crosses. Heredity
23(4): 339-356.
Tayyaba, S., G. Abdul and A. Muhammad. 2005. Genetic divergence in lentil germplasm
for botanical descriptors in relation with geographic origin.Pak. J. Bot. 37(1): 61-
69.
Tejbir, S. and K.K. Gupta. 2004. Genetic diversity for yield and related traits in lentil (Lens
culinaris M.). Plant Archives 4(I): 39-43.
Tejbir, S. and K.K. Gupta. 2005. Character association analysis in lentil (Lens culinaris
M). Plant Archives 5(1): 261-264.

129
Tikka, S.B.S. and B.M. Asawa. 1981. Factor analysis in lentil. Lens news letter.8:19-20.
Todorov, J. and Y. Todorov. 1980. Variability and correlation of some characters in lentil.
Genetikai Selektsiya 13 (1): 37-49.
Tschermak-Seysenegg, E. 1928. Lentil and Field bean crosses. Sityringsber, Akad.
Wiss.Wein math.Nat. KI.I. Abt. 137: 171-181.
Tyagi, S.D. and M.H. Khan. 2010. Geneticdivergence in lentil.African Crop Science
Journal, Vol. 18, No. 2. 9p.
Tyagi, S.D. and M.H. Khan. 2011. Correlation, path-coefficient and genetic diversity
inlentil (Lens culinaris Medik) under rainfed conditions. International Research
Journal of Plant Science (ISSN: 2141-5447) Vol. 2(7): 191-200
Vandenberg, A. 2009. Lentil expansion in Canada, in Milestones in Legume Research,
eds M. Ali and S. Kumar (Kanpur: Indian Institute of Pulses Research). pp. 5872.
Vandenberg, A. and A.E. Slinkard. 1990. Genetics of seed coat color and pattern in lentil.
J. Hered. 81: 484-488.
Vanderberg, A. and R.A.A. Morrall. 2002. Pulse crop variety development strategies in
Saskatchewan pulse growers, pulse day.
Verma, A.K., R.N. Mahto and A. Bhattacharya. 2004. Path analysis in lentil (Lens
culinaris M.). J. Res. Birsa Agril. University 16(1): 135-138.
Verma, P., T.R. Sharma, P.S. Srivastava, M.Z. Abdin and S. Bhatia. 2014. Exploring
genetic variability within lentil (Lens culinaris Medik.) and across related legumes
using a newly developed set of microsatellite markers. Mol. Biol. Rep. 41: 5607
5625.
Victoria, 2012. Victoria No-Till Farmers Association.
Ward, J. H., Jr. 1963. Hierarchical Grouping to Optimize an Objective Function, Journal of
the American Statistical Association, 58, 236244.

130
Whitihouse, R.N.H., J.B. Thompson and N. Riberio. 1958. Studies of self-pollinating
cereals in the use of di-allele cross analysis in yield production. Euphytica 7: 147-
169.
Wilson, V.E., A.G. Law and R.L. Warner. 1970. Inheritance of flower color in lens
culinaris (Medik). Crop. Sci. 10: 205-207.
Wricke, G. 1962. On a method of understanding the biological diversity in field research.
Z. Pfl.- Zcht 47: 92146.
Yadav, N.K. 1997. Studies on variability, character association, path coefficient and
genetic divergence in finger millet. M.Sc.Ag. Thesis, Department of Genetics and
Plant Breeding, G.B. Pant University of Agriculture and Technology, Pantnagar,
India.
Yadav, N.K. 2004. Status of Grain Legumes Research and Production in Nepal. In. Role of
Legumes in Crop Diversification and Poverty reduction in Asia Proceeding of the
joint 7th CLAN Steering committee meeting 10-12November,ICRISAT, Hyderabad,
India. pp. 102-114.
Yadav, S.S., D.S. Phogat, I.S. Solanki and B.P.S. Malik. 2002. Impact of different
environments on genetic variation in lentil. Indian J. Pulses Res. 15(2): 181-182.
Yadav, S.S., D.S. Phogat, I.S. Solanki and Y.S. Tomer. 2003. Character association and
path coefficient analysis in lentil. Indian J. Pulses Res. 16(1): 22-24.
Yan, W. and M.S. Kang. 2003. GGE-biplot analysis: A graphical tool for breeders,
geneticists, andagronomists. CRC Press, Boca Raton, FL, USA.variability. III.
Multiple line and crosses. Heredity23 (4): 339-356.
Yan, W., M.S. Kang, B. Ma, S. Woods and P.L. Cornelius. 2007. GGE Biplot vs. AMMI
analysis of genotype-by-environment data. Crop Sci. 47: 643-655.

131
Yaqoob, M., H.V. Khan, A.J. Malik, K. Nawab and B.A. Malik. 1997. Path co-efficient
analysis in some mungbean [Vigna radiata (L.) Wilezek] mutants. Sarhad J. Agric.
13: 277-281.
Yates, F. and W.F. Cochran. 1938. The analysis of groups of experiments. J Agri Sci. 28:
556-580.
Younis, N., M.H. Siddqu, G. Abbas, M.J. Asghar and M.A. Haq. 2008. Estimates of
genetic parameters and path analysis in lentil. Pak. J. Agri. Sci. 45(3): 212-250.
Zaman, M.W., M.A.K. Mian and M.M. Rahman. 1989. Variability and correlation studies
in local germplasm of lentil in Bangladesh. LENS Newsl. 16(1): 17-19.
Zamir, D. and G. Ladizinsky. 1984. Genetics of alzyme variants and linkage groups in
lentil. Euphytika 3: 329-336.
Zobel, R.W., M. J. Wright and H.G. Gauch. 1988. Statistical Analysis of a Yield Trial.
Agron. J. 80: 388-393.

132
APPENDICES
Appendix 1. Qualitative character of genotypes conducted at Khumaltar during2011/12

1 2 3 4 5 6 7
SN Genotypes
Seed coat Seed coat Cotyledon Stem Pod Tendril Leaf
color pattern color color pigmentation formation pubescence
1 LN-0135 3 1 2 1 1 1 3
2 RL-45 1 0 1 2 0 1 3
3 RL-67 3 0 2 1 0 1 3
4 RL--49 1 0 1 2 0 1 3
5 RL-79 3 0 2 2 0 1 7
6 ILL3338 2 1 2 1 0 1 7
7 RL-56 3 0 2 1 0 1 3
8 RL-68 1 0 1 1 0 1 3
9 RL-8 3 0 1 1 0 1 3
10 X94S-48 3 1 2 1 0 1 7
11 ILL2712 1 1 2 1 1 1 7
12 ILL1970 2 1 2 1 0 1 3
13 ILL10071 2 1 2 1 0 1 7
14 ILL9924 3 1 2 1 0 1 7
15 ILL6465 3 1 2 1 0 1 7
16 ILL9926 2 1 2 1 0 0 7
17 ILL6458 2 1 2 2 0 1 7
18 ILL1920 3 1 2 2 0 1 3
19 ILL6811 3 1 2 1 0 1 7
20 HUL-57 2 1 2 2 0 1 7
21 Sagun 3 1 2 1 0 1 3
22 M.Bharati 2 1 2 1 0 1 3
23 ILL7162 3 1 2 1 0 1 7
24 ILL7723 3 1 2 1 1 1 7
25 LN-0136 3 1 2 1 0 1 7
26 ILL3768 3 1 2 1 0 1 7
27 DPL-62 1 1 2 1 0 0 3
28 ILL7537 R 2 1 2 1 0 1 7
29 WBL-77 2 1 2 1 0 0 7
30 IL-1 2 1 2 1 1 1 7
31 ILL7979 3 1 2 1 0 1 7
32 ILL7715 2 1 2 1 1 1 7
33 RL-4 3 0 2 1 1 1 7
34 ILL6467 2 1 2 1 1 1 7
35 ILL7164 2 1 2 1 1 1 7
36 ILL3490 2 1 2 1 0 1 7
37 ILL6256 2 1 2 1 0 1 7
38 LG-12 2 1 2 1 1 1 7
39 ILL3111 3 1 2 2 1 1 7
40 ILL2527 3 1 2 1 0 1 7
41 FLIP-2006-99L 2 1 2 1 1 1 7
42 FLIP95-1L 3 1 2 1 0 1 7
43 RL-60 3 0 2 2 0 1 3
44 FLIP2009-60L 2 2 2 1 0 1 3
45 FLIP04-60L (ILL10013) 2 1 2 1 0 1 7
46 RL-70 1 0 1 1 0 1 3
47 RL-73 3 3 2 2 0 1 7
48 ILL6021 2 2 1 1 0 1 7
49 FLIP05-24L (ILL10045) 3 1 2 1 0 0 3
50 FLIP05-24L (ILL10065) 3 1 2 1 0 0 3
51 RL-71 3 0 1 1 0 1 3
52 NRX2001-72-3 3 1 2 1 0 1 7
53 FLIP2008-7L 3 1 2 1 0 1 3
54 FLIP2009-54L 2 1 2 1 0 1 7
55 RL-75 3 1 2 1 0 1 3
56 RL-35 2 1 1 2 1 1 3
57 RL-43 3 0 1 1 0 1 3
133
1 2 3 4 5 6 7
SN Genotypes
58 RL-69 3 0 2 1 0 1 3
59 RL-44 3 0 2 1 0 1 3
60 RL-42 2 1 2 1 0 1 3
61 RL-76 3 1 2 2 0 1 7
62 RL-26 3 0 1 1 1 1 3
63 RL-41 1 0 1 1 0 1 3
64 RL-39 2 1 2 1 0 1 3
65 RL-58 1 0 2 2 0 1 3
66 RL-62 1 3 1 1 0 1 3
67 RL-47 1 0 1 1 0 1 3
68 RL-80 2 1 2 1 0 1 3
69 RL-21 1 3 2 1 0 1 3
70 RL-23 2 1 2 1 1 1 3
71 FLIP05-52L (ILL10073) 2 1 2 1 0 1 7
72 ILL6260 2 1 2 1 0 1 7
73 RL-94 3 0 2 1 0 1 3
74 X39S-66L 2 1 2 1 0 1 7
75 ILL10134 2 1 2 1 1 1 7
76 NR2001-71-4 2 1 2 1 1 1 3
77 RL-74 3 0 2 2 0 1 3
78 RL-20 1 3 1 1 0 1 3
79 RL-25 1 0 1 1 0 1 3
80 RL-95 2 1 2 1 0 1 3
81 ILL10068 1 3 1 1 0 1 3
82 RL-22 1 0 1 1 0 1 3
83 RL-38 3 3 2 1 0 1 3
84 RL-5 3 1 2 1 1 1 7
85 ILL 7664 2 1 2 1 0 1 3
86 Digger 2 1 2 2 0 1 7
87 Bari Masuro-4 2 1 2 1 0 1 7
88 NRx9901 - 1 1 0 1 1 0 1 3
89 Aarial 3 0 2 1 0 0 3
90 ILL 6458 2 1 1 1 0 1 7
91 X 95s83 2 1 2 1 1 1 7
92 FLIP 2009 -59L (LL 10716) 2 1 2 1 0 1 7
93 Khajura musuro-2 2 1 2 1 0 1 7
94 RL- 28 1 0 2 1 0 1 3
95 RL- 78 3 3 2 1 0 1 3
96 RL-13 2 1 2 1 1 1 7
97 ILL 6256 2 1 2 2 0 1 3
98 ILL7220 2 3 2 1 0 1 7
99 ILL 6025 2 1 2 1 1 1 7
100 NRX9801 -1 1 2 1 1 1 1 3
101 39-S-66L 3 1 2 1 1 1 3
102 ILL 6408 2 1 2 1 0 1 3
103 ILL 6468 2 1 2 1 0 1 7
104 FLIP 2006-55L(ILL 10134) 3 1 2 1 0 1 3
105 FLIP 05 -44L(ILL 10065) 2 2 2 1 0 1 7
106 X 94 S-43 2 1 2 1 0 1 7
107 ILL 2716 2 2 2 1 1 1 7
108 ILL 8186 2 1 2 1 1 1 7
109 PL 639 2 1 2 2 0 1 3
110 F 2003-49L 3 1 2 1 0 1 3
111 ILL 9990 3 1 2 1 1 1 7
112 ILL 7980 2 2 2 1 1 1 7
113 RL- - 9 2 1 2 1 1 1 7
114 RL- - 12 2 1 2 1 0 1 7
115 PL 406 3 1 2 1 1 1 7
116 Shital 2 1 2 1 1 1 7
117 RL- 83 1 3 1 1 0 1 3
118 ILL 6821 2 1 2 1 0 1 7
119 ILL 6447 2 2 2 1 0 1 7
120 ILL 2373 3 1 2 1 1 1 3
134
1 2 3 4 5 6 7
SN Genotypes
121 RL- - 11 2 1 2 1 1 1 7
122 ILL 09943 2 1 2 1 0 1 7
123 ILL 3280 2 1 2 1 0 1 7
124 ILL 9996 2 1 2 1 0 1 3
125 RL- -55 2 2 2 1 0 1 3
126 PL 4402 3 2 2 1 0 1 7
127 Khajura - 1 3 2 2 1 0 1 7
128 ILL 6829 2 1 2 1 1 1 3
129 ILL 6024 3 1 2 1 0 1 7
130 ILL8132 2 1 2 1 0 1 7
131 ILL 7990 1 0 1 1 1 1 7
132 ILL 8605 4 2 2 1 0 1 7
133 RL- 84 3 0 2 2 0 1 3
134 ILL 9949 2 1 2 1 0 1 7
135 LN 0137 2 1 2 1 0 1 7
136 Smrik 2 1 2 1 0 1 7
137 ILL 9927 1 2 2 1 1 1 3
138 ILL 1672 3 1 2 1 0 1 7
139 ILL 3496 3 1 2 1 0 1 3
140 RL- 51 2 0 1 1 0 1 3
141 ILL 8187 3 1 2 1 0 1 7
142 ILL 7986 3 1 2 1 1 1 3
143 ILL 9992 2 1 2 1 1 1 3
144 ILL 8191 2 1 2 1 0 1 7
145 ILL 590 2 1 2 1 1 1 3
146 ILL 2501 2 1 2 1 1 1 3
147 NR2001-71-3 2 1 2 1 0 1 7
148 Cumara 2 2 2 1 1 1 3
149 ILL 27001-1 2 1 2 1 1 1 7
150 ILL 8188 2 1 2 1 0 1 7
151 ILL4139 3 1 2 1 0 1 7
152 ILL 2573 3 1 2 1 0 1 7
153 Shikhar 2 1 2 1 0 1 7
154 X49S-48 2 2 2 1 1 1 3
155 ILL1704 2 1 2 1 0 1 7
156 Sindur 3 1 2 1 0 1 7
157 NRx - 99s -95-1 2 1 2 1 0 1 3
158 Simal 2 1 2 1 1 1 7
159 ILL7978 2 1 2 1 0 1 7
160 Shisir 2 1 2 1 0 1 3
161 ILL 9932 3 1 0 1 0 1 7
162 ILL 7163 2 1 2 1 0 1 7
163 LN 3885 2 1 2 1 0 1 7
164 Jutpani 2 2 2 1 0 1 3
165 Mangal Bazar 3 1 2 1 0 1 7
166 RL- 77 2 1 2 1 0 1 3
167 L 280 (ILL 1970) 2 1 2 1 1 1 7
168 ILL 9885 1 2 2 1 1 1 7
169 RL- 6 2 1 2 1 1 1 7
170 ILL 7157 2 1 2 1 1 1 3
171 ILL 9993 2 1 2 1 0 1 7
172 ILL 6818 2 1 2 1 1 1 3
173 ILL 7538 2 2 2 1 0 1 3
174 Baitadi 6A 2 1 2 1 0 1 3
175 ILL 2526 2 1 2 1 0 1 3
176 ILL 9881 3 1 2 1 1 1 3
177 ILL 9976 2 1 2 1 0 1 7
178 ILL 3236 3 1 2 1 0 1 3
179 PL 4 2 1 2 1 0 0 3
180 RL- 85 3 0 2 1 0 1 3
181 RL- 81 2 0 1 2 0 1 3
182 LN 0111 3 1 2 1 0 1 7
183 ILL 7616 2 1 2 1 1 1 7
135
1 2 3 4 5 6 7
SN Genotypes
184 NRx 99S-95-1-12 2 1 2 1 1 1 7
185 Arun 2 1 2 1 1 1 3
1=22 0=30 1=25 1=167 0=134 0=7 3=84
2=100 1=129 2=160 2=18 1=51 1=178 7=101
3=63 2=17
3=9
Note-C1=ILL7715 (32), C2=ILL7164 (35), C3=Bari Musuro-4(87)C4= Sindur(156),C5=Simal (158)
1 Seed coat color-1= Green,2= Grey,3= Brown,= Black,5= Pink
2Pattern of testa (seed coat pattern):- 0=Absent,1=Dotted,2=Spotted,3=Marbled,4=Complex
3Cotyledon color:-1= Yellow,2= orange/red,= Olive green
4 Stem color:-1= absent,2=-present
5Pod pigmentation-:-0=Green pod without spots,1=Green pod with spots
6Tendril Formation-:-0= tendril not formed 1= tendril formed
7Leaf Pubescence formation-3=slight,7=dense
Appendix 2. Mean values for grain yield and yield attributing characters conducted in
augmented design at Khumaltar during 2011/12
Sel
Entry Genotypes LL PH NB DF DM PP SP GY/P BY/P SW HI
EN
1 ILL7715 2.37 23.52 6.25 95.88 137.17 28.38 1.36 0.60 2.96 1.48 21.93
2 ILL7164 2.50 22.96 6.21 96.38 135.00 38.25 1.49 0.80 2.74 1.44 32.00 21
3 Bari 2.32 23.19 6.67 93.25 132.46 36.71 1.47 0.88 2.96 1.63 33.27 20
masuro-4
4 Sindur 2.25 21.27 5.08 96.71 135.08 30.25 1.40 0.56 2.04 1.31 31.84
5 Simal 2.33 24.77 8.17 94.04 134.46 39.71 1.42 1.00 4.09 1.65 27.19 19
6 LN-0135 1.98 19.08 3.83 96.17 136.83 32.00 1.73 0.79 1.84 1.45 46.38
7 RL-45 2.42 20.92 4.33 96.00 138.00 15.33 1.40 0.51 1.89 2.32 30.73
8 RL-67 2.30 19.83 4.83 95.33 132.17 9.17 1.12 0.14 1.70 1.38 9.08
9 RL-49 2.12 21.50 5.00 94.17 131.67 17.17 1.00 0.36 2.23 2.07 17.16
10 RL-79 2.45 25.08 4.00 98.00 135.00 25.00 1.07 0.44 2.09 1.65 29.53
11 ILL3338 2.68 21.00 5.83 97.00 133.00 26.83 1.15 0.42 2.28 1.35 18.67
12 RL-56 2.45 20.92 7.00 98.33 135.50 19.67 1.02 0.19 1.66 1.00 14.15
13 RL-68 2.10 23.08 4.17 95.83 122.50 8.83 1.40 0.23 1.24 1.93 20.76
14 RL-8 2.12 24.50 3.50 96.50 133.83 6.33 1.23 0.16 1.86 1.99 9.74
15 X94s-48 2.50 21.83 6.67 101.83 138.50 42.33 1.28 0.59 2.41 1.09 34.42
16 ILL2712 2.50 22.17 4.83 100.17 137.83 38.83 1.75 0.97 2.22 1.41 44.61
17 ILL1970 2.48 23.08 5.67 100.83 138.67 40.83 1.43 1.05 2.49 1.80 47.08
18 ILL10071 2.25 22.08 9.83 99.83 134.67 43.83 1.85 1.73 4.52 2.11 41.65 1
19 ILL9924 2.18 23.33 4.50 99.00 140.50 39.67 1.65 1.30 2.79 1.93 45.32
20 ILL6465 2.18 21.67 4.83 100.33 137.33 28.67 1.48 0.81 2.86 1.80 31.87
21 ILL9926 2.22 18.67 6.17 96.50 134.00 18.67 1.23 0.31 1.31 1.35 22.67
22 ILL6458 2.62 17.92 5.83 104.17 138.17 25.50 1.30 0.69 2.21 2.20 35.14
23 ILL1920 2.53 19.42 5.33 100.50 137.33 30.33 1.78 0.55 2.39 1.03 24.11
24 ILL6811 2.67 23.42 8.00 104.17 140.83 66.50 1.77 1.41 3.95 1.21 39.02 2
25 HUL-57 2.37 21.75 5.50 95.00 132.33 19.67 1.05 0.33 2.29 1.61 14.53
26 Sagun 2.63 22.83 11.33 92.33 131.17 28.00 1.22 0.42 2.81 1.15 15.42
27 M-Bharatai 2.70 16.67 6.00 101.00 134.17 30.50 1.27 0.50 1.88 1.26 30.17
28 ILL7162 2.55 20.00 6.67 99.67 134.83 23.33 1.10 0.34 2.36 1.23 18.52
29 ILL7723 2.53 20.25 5.17 97.17 134.50 22.50 1.62 0.42 2.13 1.05 17.41
30 LN-0136 2.70 23.55 5.00 96.83 129.00 28.50 1.23 0.56 2.14 1.52 30.88
31 ILL3768 2.58 23.33 6.50 97.50 137.00 37.17 1.53 0.95 2.86 1.64 34.87
32 DPL-62 2.53 24.17 5.50 97.83 135.67 20.17 1.40 0.74 2.21 2.67 41.01
33 ILL7537R 2.05 22.08 6.83 97.67 135.33 31.67 1.55 0.63 2.14 1.24 32.07
34 WBL-77 2.40 22.42 4.83 98.33 137.50 20.50 1.12 0.32 1.83 1.38 20.36
35 IL-1 2.58 21.17 5.67 95.67 136.00 32.17 1.27 0.61 2.24 1.51 28.56
36 ILL7979 2.65 22.58 6.00 97.33 133.33 53.50 1.83 1.59 4.01 1.62 44.13
37 RL-4 2.30 21.83 7.17 100.17 138.50 35.67 1.53 0.73 1.94 1.26 37.03
136
Sel
EN
38 ILL6467 2.70 24.08 7.67 99.83 137.33 56.50 1.65 1.18 3.12 1.27 40.72
39 ILL3490 2.32 21.67 6.33 95.83 133.33 22.83 1.48 0.42 2.72 1.27 16.12
40 ILL6256 2.57 19.00 6.33 108.33 143.00 41.67 1.35 0.61 2.45 1.11 30.63
41 LG-12 2.45 21.17 7.67 97.33 135.17 21.67 1.37 0.36 1.94 1.14 19.71
42 ILL3111 2.50 20.83 5.17 100.50 136.83 29.83 1.32 0.53 1.99 1.29 29.43
43 ILL2527 2.22 21.75 6.83 102.17 137.83 40.17 1.05 0.46 2.68 1.08 18.90
44 FLIP-2006 2.50 20.75 6.17 98.17 133.17 29.00 1.22 0.49 2.17 1.42 24.69
-99L
45 FLIP 95-1L 2.58 22.92 7.33 95.83 134.67 21.33 1.23 0.33 2.73 1.23 13.44
46 RL-60 2.40 19.25 5.00 97.67 138.17 37.50 1.53 1.18 2.38 2.00 49.23
47 FLIP2009 2.38 21.25 3.83 100.00 136.83 18.17 1.23 0.37 2.21 1.65 18.58
-60L
48 FLIP04-60L 2.38 19.33 6.67 106.67 148.83 25.67 1.27 0.42 1.70 1.29 25.96
(ILL10013)
49 RL-70 2.37 18.17 5.50 100.83 136.83 30.67 1.37 1.18 2.53 2.69 50.27
50 RL-73 2.85 24.17 4.67 96.17 132.33 15.00 0.93 0.24 1.63 1.69 15.69
51 ILL6021 2.33 22.33 4.67 99.67 139.17 27.33 1.67 0.55 2.42 1.20 23.55
52 ILL10045 2.23 25.33 9.33 102.83 141.17 62.50 1.63 1.39 4.75 1.37 30.63 3
53 ILL10065 2.25 19.83 6.33 108.33 142.33 17.33 1.45 0.24 2.56 0.99 9.73
54 RL-71 2.28 22.17 4.00 94.83 132.00 11.67 1.18 0.31 1.51 2.10 21.17
55 NRx2001 3.08 21.00 6.33 99.50 133.67 19.50 1.35 0.27 1.84 0.98 13.84
-72-3
56 FLIP2008 2.53 22.50 6.00 110.67 141.67 43.67 1.43 0.77 2.59 1.24 32.10
-7L
57 FLIP 2009 2.58 17.67 6.83 100.00 137.00 23.17 1.27 0.30 2.38 1.00 15.53
-54L
58 RL-75 2.75 19.17 3.83 103.00 140.00 30.67 1.60 0.74 1.97 1.43 37.63
59 RL-35 1.92 22.00 4.83 97.50 134.17 30.17 1.58 0.73 1.72 1.41 41.95
60 RL-43 2.65 21.50 6.17 96.17 134.67 20.17 1.35 0.48 2.46 1.78 21.91
61 RL-69 1.77 18.92 6.17 99.50 134.67 11.50 1.07 0.13 1.30 1.03 11.82
62 RL-44 2.40 25.25 7.50 95.33 130.83 47.00 1.80 1.68 3.89 1.95 43.29 5
63 RL-42 2.52 21.42 4.17 96.67 134.67 22.83 1.13 0.38 1.38 1.43 30.88
64 RL-76 2.12 21.00 6.00 95.00 136.17 10.50 1.32 0.28 2.45 2.02 12.55
65 RL-26 2.42 22.17 4.50 95.67 127.50 16.17 1.18 0.47 1.91 2.45 26.09
66 RL-41 1.88 22.67 4.33 91.67 128.67 14.17 1.00 0.30 2.15 2.10 16.50
67 RL-39 2.60 26.25 8.50 92.67 129.00 65.83 1.68 3.00 4.57 2.66 65.41 6
68 RL-58 2.17 20.33 4.00 97.00 131.50 10.33 1.03 0.16 1.37 1.46 16.37
69 RL-62 2.20 22.50 3.83 93.17 132.17 8.50 1.33 0.24 1.45 2.09 19.25
70 RL-47 2.55 27.67 4.83 93.17 130.67 11.33 1.50 0.53 3.40 2.84 14.43
71 RL-80 2.25 21.83 7.83 93.17 131.67 27.17 1.50 0.71 2.82 1.67 23.28
72 RL-21 2.98 25.00 6.17 95.17 134.17 27.83 1.53 1.00 3.21 2.27 30.60
73 RL-23 1.97 21.17 7.50 95.50 136.33 22.67 1.13 0.42 2.97 1.61 14.43
74 FLIP05-52 2.10 23.25 7.50 97.67 136.00 32.50 1.70 1.20 3.31 2.07 36.11
(ILL10073)
75 ILL6260 2.32 20.00 5.83 96.17 133.67 32.50 1.50 0.68 2.70 1.39 27.33
76 RL-94 1.98 25.83 5.83 91.83 131.17 21.17 1.50 0.90 2.77 2.77 35.23
77 X39S-66L 2.42 25.25 7.50 92.17 130.67 27.00 1.67 0.88 2.93 1.85 31.93
78 ILL10134 2.20 22.58 7.17 92.17 130.33 29.50 1.67 0.97 2.60 2.00 41.50
79 NRX2001 2.57 24.17 5.83 95.33 132.00 27.00 1.50 0.65 2.20 1.47 30.95
-71-4
80 RL-74 2.87 21.83 5.33 93.00 131.67 18.83 1.47 0.65 2.32 2.32 28.31
81 RL-20 2.90 35.00 6.33 92.83 131.67 17.83 1.23 0.64 2.89 2.81 21.20
82 RL-25 2.30 24.33 4.50 93.33 134.33 14.00 1.35 0.60 2.35 3.04 25.25
83 RL-95 2.45 22.50 4.17 95.50 134.67 27.83 2.00 0.93 1.78 1.67 52.99
84 ILL10068 2.22 23.92 7.33 97.67 136.83 22.33 1.00 0.32 2.55 1.42 13.15
85 RL-22 2.22 23.17 3.83 95.33 132.83 14.83 1.00 0.30 2.07 2.02 14.04
86 RL-38 2.15 22.83 5.33 95.83 135.67 22.83 1.75 1.10 2.80 2.76 42.29
87 RL-15 2.60 23.67 7.50 94.17 133.00 39.83 1.47 1.08 2.95 1.82 38.06
88 ILL7664 2.35 26.50 7.50 93.33 131.83 28.00 1.30 0.59 3.36 1.52 19.88
89 DIGGER 2.12 19.67 6.17 95.50 132.50 12.50 1.03 0.19 1.76 1.51 12.86
90 NRX9901-1 2.25 24.17 4.33 93.17 133.33 14.50 1.60 0.66 2.62 2.84 27.17
91 Aarial 2.13 30.83 6.67 102.50 131.00 73.33 1.77 2.95 6.00 2.21 60.03
92 ILL6458 2.08 19.67 6.67 92.83 131.67 28.83 1.70 1.08 2.50 2.09 44.56
93 X95S-83 2.38 22.42 9.33 93.00 131.33 54.17 1.63 1.36 3.83 1.63 43.93
137
Sel
EN
94 FLIP2009- 2.70 26.33 6.83 93.17 131.83 29.33 1.57 0.74 3.82 1.53 18.69
59L
95 khajura-2 2.45 19.58 4.33 94.83 129.67 9.00 1.17 0.12 1.24 1.01 9.25
96 RL-28 2.17 30.50 5.17 91.67 131.67 19.50 1.20 0.52 3.32 2.17 16.12
97 RL-78 2.38 25.67 5.50 92.67 131.67 31.00 1.23 0.97 2.96 2.55 37.24
98 RL-13 2.70 25.17 6.50 94.17 131.17 37.67 1.62 0.93 3.28 1.52 32.34
99 ILL6256 2.75 27.33 6.17 98.33 136.83 55.83 1.67 1.80 3.54 1.91 54.57 7
100 ILL7220 2.28 22.25 5.67 95.67 133.83 24.17 1.43 0.57 2.49 1.61 24.41
101 ILL6025 2.28 24.83 6.67 93.33 133.33 24.17 1.27 0.41 3.13 1.27 15.82
102 NRX9801-1 2.20 24.17 5.17 93.17 128.83 10.50 1.10 0.24 2.51 2.06 12.88
103 39-S-66L 2.90 24.67 6.83 95.33 133.50 63.83 1.73 2.01 3.62 1.83 57.43 8
104 ILL6408 2.43 23.25 8.00 92.00 131.83 35.83 1.47 1.05 3.15 1.99 35.86
105 ILL6468 2.13 24.75 6.17 93.00 132.67 24.33 1.23 0.43 2.08 1.33 19.79
106 Flip2006- 1.98 20.83 8.83 96.83 134.33 40.00 1.57 1.14 2.72 1.91 43.73
55L(ILL1)
107 FLIP05-44L 2.57 21.50 8.17 95.00 131.33 28.17 1.75 1.55 3.07 3.15 51.48 4
(ILL100)
108 X94 S-43 2.80 23.75 11.17 92.17 129.00 43.33 1.33 1.14 4.51 1.82 27.43
109 ILL2716 2.83 22.33 6.83 95.17 130.17 26.33 1.33 0.66 2.22 1.71 29.29
110 ILL8186 2.00 22.50 7.33 93.17 131.33 15.17 1.03 0.26 1.88 1.65 15.08
111 PL-639 2.30 25.33 7.83 97.67 133.00 43.00 1.23 0.68 4.52 1.26 21.63
112 F2003-49L 2.48 29.75 10.00 92.83 133.17 73.17 1.45 1.57 6.10 1.52 28.98 9
113 ILL9990 2.45 25.92 8.33 95.67 133.33 41.33 1.77 1.70 3.66 2.38 45.71
114 ILL7980 2.37 24.33 6.67 91.50 134.33 28.33 1.83 0.82 2.81 1.59 39.31
115 RL-9 2.33 21.83 5.33 93.33 134.17 34.17 1.50 0.73 2.20 1.50 41.11
116 RL-12 2.40 22.42 7.00 92.33 132.00 29.17 1.70 0.77 3.28 1.48 22.37
117 PL-406 1.98 22.75 4.33 93.00 130.50 16.83 1.00 0.21 1.56 1.27 14.18
118 ILL3490 2.18 21.17 5.33 93.00 132.00 23.83 1.43 0.44 2.20 1.37 20.73
119 RL-83 2.42 26.67 5.33 93.83 134.17 14.67 1.07 0.46 2.49 2.93 18.25
120 ILL6821 2.02 17.92 6.00 92.50 131.83 8.50 0.97 0.09 1.51 1.05 5.50
121 ILL6447 2.03 26.67 5.67 95.83 134.00 35.83 1.67 0.81 3.07 1.33 26.41
122 ILL2373 2.38 24.75 8.50 93.33 130.33 64.67 1.73 1.94 3.48 1.72 59.70 10
123 RL-11 2.30 25.92 12.17 92.67 129.17 80.17 1.90 2.81 5.53 1.83 55.04 11
124 ILL9943 2.27 24.67 8.67 95.17 132.00 45.67 1.80 1.53 3.54 1.91 47.79
125 ILL9996 2.27 24.50 5.33 95.17 134.17 18.17 1.33 0.38 1.83 1.55 22.69
126 RL-55 2.38 23.42 5.33 95.50 134.00 29.33 1.57 0.76 2.35 1.56 33.48
127 PL-4402 2.25 24.83 7.33 95.33 133.00 20.83 1.03 0.26 2.02 1.16 14.37
128 ILL3280 2.18 23.17 5.67 95.17 133.83 12.17 1.17 0.20 1.77 1.40 11.95
129 Khajura-1 2.72 29.17 9.00 91.67 135.50 67.83 1.67 2.29 5.35 2.11 46.51 12
130 ILL6829 2.53 22.67 7.00 97.33 135.50 19.83 1.20 0.34 2.33 1.31 14.95
131 ILL6024 2.57 27.50 7.33 91.00 131.83 58.17 1.70 2.23 4.22 2.27 59.83 13
132 ILL8132 2.13 24.92 9.17 92.17 130.50 59.67 1.60 2.01 4.43 2.11 51.59 14
133 ILL7990 2.50 22.83 7.33 94.17 134.50 36.83 1.50 1.25 4.03 2.11 32.32
134 ILL8605 2.43 26.50 5.67 91.33 133.50 26.33 1.37 0.50 3.80 1.31 16.42
135 RL-84 2.23 28.08 5.67 96.50 135.00 36.33 1.33 1.26 3.95 2.48 31.62
136 ILL9949 2.53 23.50 4.50 93.50 131.50 24.67 1.50 0.62 1.80 1.76 37.46
137 LN-0137 2.47 27.33 8.83 93.50 134.83 52.33 1.33 1.45 5.70 2.03 26.42
138 Smrik 1.92 26.20 6.80 93.20 135.20 23.20 1.40 0.66 3.42 1.99 20.93
139 ILL9927 2.56 27.57 5.71 93.86 136.71 22.57 1.57 0.64 3.83 1.80 19.56
140 ILL1672 2.18 19.83 6.50 93.17 133.83 30.50 1.17 0.76 2.28 2.08 35.13
141 ILL3496 3.05 27.33 6.50 93.50 132.17 28.33 1.50 0.74 3.93 1.71 18.97
142 RL-51 2.40 27.00 7.83 93.33 132.33 38.00 1.50 1.00 3.53 1.85 30.54
143 ILL8187 2.22 21.67 4.33 92.00 133.17 6.33 1.03 0.12 1.68 1.85 7.48
144 ILL7986 2.45 26.75 8.00 93.00 132.50 33.50 1.73 0.96 4.28 1.62 25.91
145 ILL9992 2.33 24.67 6.83 92.33 134.00 33.83 1.50 0.88 3.52 1.67 28.81
146 ILL8191 2.62 23.17 9.33 93.00 134.00 39.17 1.33 0.86 3.27 1.52 25.62
147 ILL590 2.38 23.50 6.00 91.83 129.50 31.17 1.50 0.86 2.32 1.91 42.47
148 ILL2501 2.60 27.83 7.33 93.83 137.50 34.33 1.33 0.78 3.90 1.67 22.76
149 NRX2001- 2.43 22.00 6.17 95.83 133.00 26.67 1.60 0.69 2.42 1.63 33.11
71-3
150 Cumara 2.47 23.00 4.83 93.33 134.17 30.00 1.67 1.03 2.48 1.99 43.10
151 ILL27001-1 2.52 23.67 7.83 97.17 132.67 22.50 1.33 0.37 2.80 1.25 15.83
152 ILL8188 2.47 22.83 4.33 93.33 131.83 22.17 1.45 0.57 2.00 1.71 30.28
153 ILL4139 2.57 28.58 7.50 93.83 135.50 57.67 1.67 1.73 4.61 1.82 46.81
138
Sel
EN
154 ILL2573 2.25 24.50 4.67 93.17 131.83 20.83 1.63 0.55 2.34 1.59 24.03
155 Shikhar 2.48 23.67 7.17 94.50 133.17 28.50 1.00 0.49 3.55 1.73 14.08
156 X49s-48 2.57 26.33 9.17 91.00 131.67 39.83 2.00 1.32 4.27 1.66 35.50
157 ILL1704 2.62 25.33 7.50 92.50 133.00 47.67 1.70 1.53 4.73 1.85 36.33
158 Arun 2.27 23.17 6.00 95.83 137.00 40.67 1.87 1.25 2.94 1.63 45.36 18
159 NRX-99s- 1.90 22.33 8.00 94.50 136.17 61.33 2.00 1.61 3.27 1.41 48.89
95-1-1
160 ILL7978 2.30 19.67 7.33 92.17 130.83 24.67 1.00 0.41 2.53 1.68 20.72
161 Shisir 2.37 25.50 8.33 93.17 132.83 31.33 1.37 0.84 4.45 1.93 20.30 15
162 ILL9932 2.87 26.83 9.00 92.50 134.83 60.00 1.77 2.12 4.67 1.99 47.55
163 ILL7163 2.13 23.33 6.50 96.83 137.00 32.83 1.67 1.27 3.65 2.27 36.63
164 LN-3885 2.17 22.83 6.50 92.33 132.33 33.00 1.17 0.64 2.75 1.59 23.87
165 Jutpani 2.50 24.08 5.50 92.83 133.67 56.50 1.67 1.83 3.77 1.88 49.52
166 Mangal 2.43 24.83 6.33 92.50 134.00 49.33 1.50 1.29 3.90 1.68 32.47
Bazar
167 RL-77 2.05 21.33 3.67 95.17 132.17 18.33 1.67 0.57 1.38 1.74 38.54
168 ILLI970 2.32 24.67 3.50 96.00 134.00 19.67 1.50 0.71 2.17 2.34 33.89
169 ILL9885 2.43 24.67 7.50 93.33 134.17 29.17 1.40 0.76 3.42 1.68 21.13
170 RL-6 2.90 25.75 6.83 92.33 132.50 64.50 1.50 2.00 4.90 2.04 40.84
171 ILL7157 2.10 24.00 8.17 93.33 134.33 48.17 1.50 1.07 3.62 1.41 32.71
172 ILL9993 2.62 26.33 8.33 93.33 133.83 45.67 1.50 1.16 4.55 1.73 31.10
173 ILL6818 2.38 23.50 7.50 94.83 133.00 38.17 1.17 0.72 3.06 1.60 28.52 17
174 ILL7538 2.38 24.33 6.00 95.33 135.33 45.33 1.50 1.44 3.45 2.12 45.16
175 Baitadi 6A 2.37 23.92 5.83 97.83 135.67 14.00 1.03 0.16 2.10 1.10 7.96
176 ILL2526 2.42 23.83 7.33 91.33 131.67 27.67 1.50 0.82 3.15 1.87 26.20
177 ILL9881 2.72 21.50 7.50 91.83 134.00 31.00 1.40 0.75 2.80 1.73 28.39
178 ILL9976 2.72 24.42 8.33 91.17 136.83 36.67 1.50 1.00 3.90 1.70 25.17 16
179 ILL3236 2.70 29.50 12.67 93.33 133.00 64.50 1.90 2.72 6.68 2.21 44.86
180 PL-4 2.62 29.25 6.83 95.83 134.17 31.83 1.30 1.09 4.12 2.52 27.07
181 RL-85 2.27 30.33 6.00 88.50 132.83 38.67 1.53 1.56 3.37 2.58 48.54
182 RL-81 2.63 26.58 7.67 92.17 132.50 21.83 1.20 0.90 4.45 3.41 20.85
183 LN-0111 2.30 26.00 3.83 92.50 131.83 17.33 1.83 0.61 1.47 1.95 44.30
184 ILL7616 2.41 26.17 7.17 95.67 133.83 57.50 1.33 1.37 4.15 1.70 30.89
185 NRx-99S- 2.39 27.50 5.00 93.33 134.00 37.50 1.53 0.95 3.06 1.71 40.71
95-1-12
Mean 2.40 23.47 6.42 95.56 133.97 31.53 1.43 1.21 2.89 1.74 29.69
Range 1.77- 16.67- 3.5- 88 - 122- 6.33- 0.93- 0.9 - 1.24- 0.9- 5.5-
3.08 35.00 12.67 110 149 80.17 2.0 3.02 6.68 3.31 65.41
BIOGRAPHICAL SKETCH
The author was born on 5th October, 1956 at Village Development Committee
(VDC) Aurahi Ward No. 7 Kaptaul, District Dhanusha, Janakpur, Nepal as a eldest son of
late Shree Julum Yadav and Smt. Chaurasia Devi. He passed his high School in 1972 from
H.E. School Khirhar (B.S.E. Board, Patna) and I.Sc. (Biology) in 1974 from R.K. College,
Madhubani (L.N. Mithila University), Bihar. He completed his B.Sc. (Ag.Ed) degree in
1977 from IAAS, Rampur (Tribhuvan University), Nepal. He completed his B.Sc. (Ag.)
degree in 1980 from IAAS, Rampur (Tribhuvan University), Nepal. He completed his
M.Sc.Ag. in Genetics and Plant breeding in 1997 from G.B. Pant University of Agriculture
and Technology, UP, India under IDRC (Canada) Scholarship.
After completing B.Sc.Ag. Ed., he started his professional career in January 1977;
he joined Ministry of Education as Agriculture Specialist (Vocational Supervisor Gazette
Officer). After completion of B.Sc.Ag. in 1980, he joined, Department of Agriculture as
an Assistant Agriculture Development Officer in 1981 and thereafter worked on different
posts as Assistant Agronomist, Assistant Crop Production Officer, Site Coordinator (FSP)
and Scientist (NARC). He became Senior, Scientist (S3), in 1996 and Sr. Scientist (S4) in
2003. He became Director Financial Administration, NARC in 2010. He also became
Council member and member of recruitment committee, NARC in 2012. In 2010 he
received financial support from ICARDA for perusing Ph.D. degree in Plant breeding at
Institute of Agriculture and Animal Science, Rampur, Chitwan, Tribhuwan University,
Nepal. In his service period, he participated in different National and International training,
seminar and work shop. He received two international awards by ICRISAT in 2008 and
2014.
Author

PH.D Thesis, Nawal Kishor Yadav, Nepal

Transféré par

Informations du document

Titre original

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

PH.D Thesis, Nawal Kishor Yadav, Nepal

Transféré par

Droits d'auteur :

Formats disponibles

STUDY ON GENETIC DIVERSITY, SOURCE OF RESISTANCE TO FUSARIUM WILT

AND STEMPHYLIUM BLIGHT DISEASES AND GENOTYPE ENVIRONMENT

INTERACTION IN LENTIL (Lens culinaris, Medikus)

NAWAL KISHOR YADAV

AND STEMPHYLIUM BLIGHT DISEASES AND GENOTYPE ENVIRONMENT

INTERACTION IN LENTIL (Lens culinaris, Medikus)

NAWAL KISHOR YADAV

DOCTOR OF PHILOSOPHY IN AGRICULTURE

This is to certify that the dissertation entitled STUDY ON GENETIC

DIVERSITY, SOURCE OF RESISTANCE TO FUSARIUM WILT AND

STEMPHYLIUM BLIGHT DISEASES AND GENOTYPE ENVIRONMENT

INTERACTION IN LENTIL (Lens culinaris, Medikus) submitted in fulfillment of the

other degree or diploma.

I feel immense pleasure in expressing my deep sense of gratitude and highest

preparation of the manuscript.

analysis, valuable suggestions and guidance during the present investigation.

I am highly thankful to Dr. Sundar Man Shrestha, Professor, Department of Plant

I am highly indebted to Dr. Surya Kant Ghimire, Professor, Department of Plant

the course of this investigation and preparation of the manuscript.

I would like to extend my humble gratitude to Dr. Bhartendu Misra, Executive

providing the approval for my study

I am indebted to Chief, Agronomy Division Khumaltar, Regional Directors, RARS

the research work.

It is my sincere duty to acknowledge my senior and colleagues Mrs. Sharada Joshi,

excellent and careful word processing of this manuscript.

people who helped me but could not find separate mention.

Nawal Kishor Yadav

LIST FIGURES xii

LIST OF APPENDICES xiii

ABSTRACT IN ENGLISH xvii

2.1 Genetic divergence using morphological traits 9

2.1.1 Qualitative characters 9

2.1.1.1 Cotyledon color 9

2.1.1.2 Seed coat color and seed coat pattern 9

2.1.1.3 Pod color 10

2.1.1.4 Leaf tendril 10

2.1.2 Quantitative characters 10

2.1.2.1 Studies on variability parameters (variability, heritability and

2.1.2.2 Studies on association among seed yield and other traits 15

2.2 Genetic divergence study using molecular markers 23

2.3 Study on Fusarium wilt 24

2.3.1 Disease inoculums 'build up, infection, losses and scoring 24

2.4 Study on Stemphylium blight 26

2.4.1 Disease inoculums build up, infection and scoring 26

2.5 Study on genotype-environment interaction 29

3 MATERIALS AND METHODS 35

3.1 Genetic divergence study using morphological character 35

3.1.1 Qualitative traits 38

3.1.2 Quantitative traits 39

3.1.2.1 Days to 50 % flowering 39

3.1.2.2 Days to maturity 39

3.1.2.3 Plant height (cm) 39

3.1.2.4 Number of branches per plant 39

3.1.2.5 Number of pods per plant 39

3.1.2.6 Number of seeds per pod 40

3.1.2.7 Hundred seed weight 40

3.1.2.8 Seed yield per plant (g) 40

3.1.2.9 Biological yield per plant (g) 40

3.1.2.10 Harvest index (HI) % 40

3.1.3 Data analysis 40

3.1.3.2 Estimations of phenotypic and genotypic covariance, heritability

and genetic advance 41

3.2 Genetic divergence study using SSR marker 42