Vous êtes sur la page 1sur 10

G Model

ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS


Animal Reproduction Science xxx (2014) xxxxxx

Contents lists available at ScienceDirect

Animal Reproduction Science


journal homepage: www.elsevier.com/locate/anireprosci

Subdominant hierarchical ovarian follicles are needed


for steroidogenesis and ovulation in laying hens
(Gallus domesticus)
P.L. Rangel a, , A. Rodrguez a , K. Gutirrez a , P.J. Sharp b , C.G. Gutierrez a
a
Universidad Nacional Autnoma de Mxico, Facultad de Medicina Veterinaria y Zootecnia, Av. Universidad 3000,
Col. UNAM, CU. CP 04510, Mexico City, Mexico
b
The Roslin Institute, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9PS, UK

a r t i c l e i n f o a b s t r a c t

Article history: Ovarian follicle development in avian species is characterized by a strict hierarchical
Received 23 January 2014 arrangement. The hierarchical follicles secrete progesterone, which induces the LH surge,
Received in revised form 5 April 2014 but the capacity to produce other steroids decreases with development. Our aim was to
Accepted 25 April 2014
evaluate the complementary action of subdominant follicles (F4F6) on ovulation and
Available online xxx
steroidogenesis of the preovulatory follicles (F1F3) in domestic laying hens. The rst
study included four groups: control (C); sham-operated (SO); large hierarchical follicles
Keywords: (LHF) from which F4F6 follicles were extracted; and subdominant hierarchical follicles
LH (SHF) from which F1F3 follicles were extracted. Blood samples were collected every 2 h
StAR from 12 h before estimated ovoposition until 2 h after ovoposition. Egg laying continued
3-HSD at the same rates in C and SO hens, with normal preovulatory surges of oestradiol, testos-
Testosterone terone, progesterone and LH. In contrast, in LHF and SHF groups, ovoposition was blocked;
Progesterone oestradiol concentrations were not affected; but no preovulatory surges of testosterone,
Granulosa
progesterone or LH were seen. Further, the testosterone surge was required for the occur-
rence of progesterone and LH surges. In the second study StAR and steroidogenic enzyme
mRNA expression was evaluated within F1F3 follicles from a LHF group and C-14 and C-8
controls groups, in which follicles were collected 14 h and 8 h before expected ovoposition,
respectively. Extraction of F4F6 follicles caused a signicant reduction in StAR and 3-HSD
expressions within theca, but not in granulosa cells. In conclusion, subdominant hierarchi-
cal follicles (F4F6) are required for the preovulatory release of testosterone, progesterone
and LH, which are highly inter-correlated.
2014 Elsevier B.V. All rights reserved.

1. Introduction have a particular follicular development, with a special


arrangement of hierarchical and prehierarchical follicles
Although avian production for human consumption (Johnson et al., 1993). However, the role of subdominant
is an ancient industry, some reproductive physiological follicles within the follicular hierarchical preovulatory fol-
conditions in birds are poorly understood. Avian species licle growth, maturation and ovulation is not completely
known, although their steroid production is believed to be
complementary in the ovulatory process.
Corresponding author. Tel.: +52 5556225860; fax: +52 56225935. In laying hens the largest ovarian follicles, hierarchi-
E-mail address: eliana@unam.mx (P.L. Rangel). cal follicles (F1F7), have sizes between 9 and 35 mm

http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
0378-4320/ 2014 Elsevier B.V. All rights reserved.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
2 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

in diameter, with the largest follicle ovulating each day the removal of subdominant hierarchical follicles affects
(Gilbert et al., 1983; Johnson, 1996). Further, the patterns larger follicles progesterone production by a decreased
of steroidogenic proles in the maturing ovarian follicle mRNA expression of steroidogenic acute regulatory pro-
are well known (Bahr et al., 1983; Porter et al., 1989). tein (StAR), P450 cholesterol side-chain cleavage enzyme
Oestradiol is secreted by the outer theca layer, and its con- (P450scc) and 3-beta-hydroxysteroid dehydrogenase (3-
centrations are highest in the smaller yellow yolky follicles HSD); and testosterone secretion by a reduction in mRNA
and progressively decrease to low values in the mature F1 expression of 17-alfa-hydroxylase (17-OH). Further, the
preovulatory follicle (Armstrong, 1984; Porter et al., 1989). replacement of testosterone, oestradiol or both can restore
Testosterone is mainly released by the inner theca layer in gene expression by granulosa and theca cells.
all the yellow yolky follicles and is lowest in the F1 preovu-
latory mature follicle (Porter et al., 1989; Hernndez-Vrtiz 2. Material and methods
et al., 1993). Progesterone is produced in the granulosa
layer, with lowest concentrations in the smaller yellow 2.1. Animals
yolky follicles and highest in the F1 and F2 follicles (Tilly
et al., 1991; Yu et al., 1992). The Ethics and Animal Welfare Committee of the Facul-
Steroid hormones produced by the ovary are related to tad de Medicina Veterinaria y Zootecnia, UNAM approved
the ovulatory process in the domestic hen, as ovulation is the animal procedures. Hy-line laying hens (Gallus domes-
preceded by simultaneous surges of progesterone and LH ticus) in the middle of their rst laying cycle (40 weeks old)
(Johnson, 1990; Williams and Sharp, 1978; Johnson and were used for both studies. Animals were housed in indi-
van Tienhoven, 1980), with a positive feedback between vidual cages under a 16 h light:8 h dark schedule and had
both hormones (Etches and Cunningham, 1976; Imai and free access to drinking water and food. Laying was recorded
Nalbandov, 1978; Johnson et al., 1985), in which proges- daily in order to estimate time of ovulation, assuming
terone induces the LH peak by stimulating GnRH-I release that ovulation occurs 1560 min after ovoposition (Etches,
(Sterling et al., 1984; Sharp et al., 1989; Fraser and Sharp, 1996).
1978). In addition, prior to the progesterone and LH surges,
a preovulatory release of oestradiol occurs (Johnson and 2.2. Surgical procedure
van Tienhoven, 1980; Etches and Cheng, 1981), and is
further preceded by a well-dened testosterone surge Animals were anesthetized with halothane (Pollock
(Williams and Sharp, 1978; Robinson and Etches, 1986; et al., 2005) at 4% for induction and 3% for mainte-
Robinson et al., 1988). nance. Ovarian follicles were removed through a left lateral
Oestradiol primes the hypothalamus and enhances celiotomy after lateral and ventral retraction of the proven-
the progesterone stimulation of LH release (Wilson and triculus (Bennett and Harrison, 1994). All hens (including
Sharp, 1976; Etches, 1990), while testosterone plays a controls) were fasted for 6 h before the rst scheduled
major role in the ovulatory process, as testosterone immu- surgery, and food was provided again until the last surgery
nization or the use of specic testosterone antagonist was nished (14 h of fasting in total).
blocks ovulation in hens without affecting follicular devel-
opment and blunts the preovulatory surges of progesterone 2.3. First study: evaluation of the complementarity of
and LH (Rangel et al., 2005, 2006). Additionally, testos- steroid production between hierarchical follicles in laying
terone at physiological or greater concentrations, even hens
in absence of LH, stimulates granulosa cell progesterone
production in preovulatory and the three largest follicles Hens were randomly divided into four groups (Fig. 1):
in Japanese quails (Sasanami and Mori, 1999) and hens (a) control group (C, n = 6), hens without surgery; (b) sham-
(Rangel et al., 2006). Further, testosterone increases StAR, operated group (SO, n = 7) hens anesthetized and subjected
P450scc, and LH receptor mRNA expression in hen granu- to an exploratory laparotomy, during which counting and
losa cells cultured in vitro (Rangel et al., 2009). manipulation of the ovarian follicles was performed to
Unlike in mammals, in which the preovulatory follicles simulate the time taken and manipulation made in the
produce all steroids required for ovulation, in avian species oophorectomised groups; (c) large hierarchical follicles
oestradiol and testosterone production is lower in larger group (LHF, n = 6) hens in which the three largest folli-
follicles (Johnson, 1990), despite being needed for the ovu- cles (F1F3) remained and follicles F4F6 were removed;
latory process (Wilson and Sharp, 1976; Etches, 1990; and (d) subdominant hierarchical follicles group (SHF, n = 8)
Rangel et al., 2005, 2006). Therefore, to clarify whether hens with the F4F6 largest follicles and excision of the
follicles are complementary, the present study deter- F1F3 follicles.
mined if large hierarchical follicles (2835 mm, F1F3) After removal of follicles according to the assigned
need the secretions of the subdominant hierarchical fol- group (Fig. 1), animals were cannulated in the radial
licles (1025 mm, F4F6) to trigger steroidogenesis and vein for blood sampling according to our method previ-
ovulation of the largest follicle in the laying hen. Two dif- ously described (Rangel et al., 2005). All surgeries were
ferent studies were done. In the rst, we hypothesized performed 14 h before the estimated time of ovoposi-
that the removal of subdominant hierarchical follicles, and tion. Blood samples were taken at 2 h interval, starting
hence the absence of their endocrine contribution (E2 and 12 h before the estimated laying time and nishing 2 h
T), prevents ovulation and preovulatory surges of proges- after ovoposition. Samples were drawn using 3 mL vacuum
terone and LH. In the second study, the hypothesis was that tubes containing sodium heparin. Plasma was separated by

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx 3

Fig. 1. Schematic representation of the rst study, treatments and sample collection. Animal groups: C = control; SO = sham-operated; LHF = large hierar-
chical follicles; and SHF = subdominant hierarchical follicles.

centrifugation at 1500 rpm, and blood cells were resus- compare the effect of time on mRNA expression; and (c)
pended in 2.5 mL of sterile saline physiological solu- control (C-8, n = 3) hens that were slaughtered 8 h before
tion with 0.5 mg/mL of gentamicine (Bruluart, Tultitlan, next expected ovoposition, to collect the largest hierar-
Mexico) and stored at 4 C, until returned to the hens chical follicles, which were considered more mature at
immediately after the following blood sample was taken. that time point, because the proximity to the ovulatory
Catheters were kept patent by ushing with 0.5 mL saline process. Immediately after surgery, hens from the LHF
solution containing 50 UI/mL of heparin (PISA, Guadalajara, group were subdivided and received a single dose of one
Mexico). of the four steroid treatments: (a) placebo (subgroup P)
hens received 400 l of physiological saline solution (n = 3),
2.3.1. Hormonal assays (b) testosterone (subgroup T) animals received 600 ng of
Progesterone and testosterone concentrations were testosterone (Sigma T1500) (n = 6), (c) oestradiol (subgroup
determined by radioimmunoassay (Coat-a-Count, Diag- E) animals were treated with 360 ng of 17--estradiol
nostic Products Corporation, Los Angeles, CA, USA). (Sigma E8875) (n = 6) and (d) testosterone + oestradiol
Sensitivities of the assays were 0.05 ng and 0.06 ng for (subgroup T + E) hens were injected with both testos-
testosterone and progesterone, respectively; the intra- terone and oestradiol at the doses indicated above (n = 5),
assay coefcients of variation were 5.1% and 6.54%. to evaluate the effect of steroid replacement. Steroids
Oestradiol was measured by ELISA (International Immuno- were purchased from SigmaAldrich (California), diluted
Diagnostics, CA. USA), with an assay sensitivity of 5.98 pg in physiological saline solution, in a nal volume of 400 l
and an intra-assay coefcient of variation of 6.21%. LH per hen, and were applied by intramuscular injection. Six
was measured by RIA in 60% of samples as previously hours after surgery, all animals were slaughtered by cer-
described by Sharp et al. (1987) with an assay sensitivity of vical dislocation, and remaining hierarchical follicles were
0.036 ng/mL and an intra-assay coefcient of variation of collected to assess follicular StAR protein and steroidogenic
7.6%. All samples were measured in a single assay for each enzyme expression.
hormone.
2.4.1. mRNA isolation and quantication
2.4. Second study: evaluation of F4F6 follicular excision Follicles collected, either after surgery or after slaughter,
and exogenous testosterone or oestradiol treatment on were immediately processed in the laboratory. Granulosa
steroidogenic enzymes and StAR protein mRNA expression and theca cells were isolated from each F1, F2 and F3. We
used 1015 mg of each sample to extract total RNA, with
Hens were randomly assigned to one of the three groups the UltraClean tissue and an RNA isolation Kit (MoBio). RNA
(Fig. 2): (a) large hierarchical follicles (LHF, n = 20) hens concentration and purity were calculated using the Ampli-
in which the three largest follicles (F1F3) remain until Quant AQ07 spectro-photometer. A retrotranscription (RT)
slaughter (8 h before next expected ovoposition) and fol- was performed in 5 g of total RNA, using Oligo (dT) primer
licles F4F6 were removed at surgery (14 h before next and RT, as recommended by the manufacturer (SuperScript
expected ovoposition); (b) immature follicles (C-14, n = 23), First-Strand Kit, Invitrogen). Steroidogenic acute regula-
hens in which follicles F1F3 were extracted by surgery tory protein (StAR), P450 cholesterol side-chain cleavage
14 h before next expected ovoposition, and were used to enzyme (P450scc), 3-beta-hydroxysteroid dehydrogenase

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
4 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

Fig. 2. Schematic representation of the second study treatments and follicle collection. Treatment groups: C-14 = F1F3 control follicles collected 14 h before
expected ovulation; C-8 = F1F3 control follicles collected 8 h before expected ovulation; and LHF = F1F3 follicles collected 6 h after follicular extraction of
the subdominant follicles. Animals in LHF group were further divided into four subgroups that received: P = SSF as a placebo, T = testosterone, E = oestradiol,
and T + E = testosterone plus oestradiol.

(3-HSD), and 17-alfa-hydroxylase (17-OH) cDNA were copies for the unknown samples was calculated from the
quantied by real-time PCR using 8.58 ng of total cDNA and regression equation. Each standard curve had a range of
the primers manufactured by Applied Biosystems, which 1 105 1 1011 copies.
are shown in Table 1. Amplication cycles were 50.8 C
for 2 min, 95.8 C for 10 min and then 45 cycles were per- 2.5. Statistical analyses
formed at 95.8 C for 15 s, and 60.8 C for 1 min using
TaqMan Universal PCR Master Mix. The amounts of StAR, 2.5.1. First study
P450scc, 3-HSD, and 17-OH mRNAs expressed in gran- Laying percentage was evaluated by Fischer exact test,
ulosa or theca cells were estimated from standard cDNA to establish differences between groups. The pretreatment
curves prepared for each gene. Briey, 1 l of each total period considered the 10 days prior to and until the day
cDNA sample was taken and amplied in a PCR reaction after surgery, while the post-treatment period included 5
using the same primers as for the real time PCR, at 94 C days starting on the day of the expected ovoposition (two
for 5 min and then for 40 cycles at 94 C for 15 s and days after surgery). The acute effect of treatment on ovu-
60 C for 1 min. The amplication products were isolated lation was evaluated on the day after oophorectomy (day
by electrophoresis in a 2.5% agarose low-melting point gel 0), approximately 24 h after the expected time for ovulation
and identied using a transilluminator. The amplication (Etches, 1990). Differences in the reinitiation of laying were
products were extracted from the gels using the QIAquick estimated by KruskalWallis one-way analysis of variance.
gel extraction Kit (Qiagen), and quantied densitometri- The effect of surgery on ovoposition and on the occur-
cally using a spectrophotometer. Total cDNA copies were rence of steroid and LH surges was evaluated comparing
calculated as described by Tricarico et al. (2002). The rela- the control and sham-operated groups. The occurrence of
tionship between quantitative PCR (Ct) values and cDNA each hormone surge was analyzed by Chi-square, dening
copies in 1 g RNA were determined by regression analy- a surge as an increase of two standard deviations over the
ses, which were found to be linear. The number of cDNA mean concentration of the preceding 4 h.

Table 1
Primers used for the detection of the mRNA by real-time RT-PCR assay. TaqMan gene expression assays: StAR (Gg03338457 g1) and CYP17A1
(Gg03346131 g1).

Target Primer sequence (5 3 ) TaqMan probe (5 3 ) Size (pb) GenBank identication

StAR Data not available ACGGTGGCGGACAACGGAGACAAAG 90 NM 204686.1

For: ACCGTGACTACCGCAACAAG
P450scc-chicken CCTACGGCGTGCTCC 53 NM 001001756
Rev: AGGCCTCCCCTGTCTTGA

3-HSD chicken For: TCAGCAGGGAGGCACTCT


ACTTGCCAAAGCTCC 67 D46763.1
Rev: CCCTTCTAGGATTTTCACCTCAGT

CYP17A1 (17-OH) Data not available GCTGACACCAGCATCGGTGAGTACT 85 NM 001001901.1

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx 5

Table 2
Presence of hormonal surges in control (C), sham-operated (SO) and hens
from which follicles were removed (large hierarchical follicles, LHF, and
subdominant hierarchical follicles, SHF). Values within the same hormone
that differ are indicated by different letters (P < 0.01).

Group Surge incidence percentage

E2 T P4 LH

C (n = 6) 100a 100a 100a 100a


SO (n = 7) 71a 100a 86a 100a
LHF (n = 6) 67a 17b 33b 33b
SHF (n = 8) 75a 0b 0b 0b

Fig. 3. Laying percentage in hens from control (C, n = 6), sham-operated


(SO, n = 7), large hierarchical follicles (LHF, n = 6) and small hierarchical
surgery. Further, in both oophorectomised groups, ovopo-
follicles (SHF, n = 8) groups, during the pre-treatment period ( = 10 days
including the day of surgery), 2 days after surgery ( = day 0) and the sition remained lower than in C and SO groups throughout
post-treatment period ( = 5 days including day 0). (*) and (+) indicate the post-treatment period (P < 0.001).
difference vs the control group the day after surgery and during the post- Ovoposition continued normally throughout the study
treatment period respectively (P < 0.001).
in hens from C and SO groups. In contrast, animals from
the LHF and SHF groups took 3.3 and 3.5 days, respectively,
Hormonal data were analyzed by ANOVA for repeated to restart ovoposition (P < 0.001). Moreover, 3 out of the 8
measurements, considering treatment, hen nested within hens from the SHF group had not resumed laying by day
treatment, time and the interaction between time and 4, when recording of ovoposition concluded, showing a
treatment as independent variables. Finally, endocrine greater time to reset for this group.
complementation of the follicles was analyzed by Chi-
square to evaluate for independence in the occurrence of
every pair of hormone surges. 3.1.2. Effect of oophorectomy on endocrine surges
The frequency of occurrence of hormonal surges
2.5.2. Second study (Table 2) did not differ between C and SO hens (P > 0.05),
StAR protein and enzyme mRNA expression were evalu- further hens showed surges of all studied hormones. Addi-
ated by REML analysis, considering as random variables the tionally, oestradiol surge frequency was similar between
hen, the follicle nested within the hen, and the membrane all groups (P > 0.05). In contrast, testosterone, progesterone
nested within the follicle, nested within the hen. and LH surge occurrence were signicantly reduced by fol-
licular removal (P < 0.01). In the LHF group two animals
3. Results presented testosterone, progesterone or LH surges, how-
ever, they were of lesser magnitude than those of C and SO
3.1. First study: complementarity of steroid production groups, and did not stimulate ovulation in the hens.
between hierarchical follicles in laying hens

3.1.1. Effect of oophorectomy on ovoposition 3.1.3. Endocrine complementation


Pretreatment laying percentage (Fig. 3) was similar Complementarities of hormone production between
(P = 0.68) between groups, with an average of 88%. Ovopo- hierarchical follicles showed that surges of testosterone,
sition was not affected by the surgical procedure, as laying progesterone and LH were independent of the oestradiol
percentage 2 days after surgery was similar between C surge (P > 0.05). In contrast, surges of progesterone and
and SO groups (100 vs 86, respectively; P = 0.82). In con- LH were dependent on the testosterone surge (P < 0.001).
trast, in hens in which follicles were removed (LHF and Finally, the LH surge was highly dependent on the proges-
SHF groups), ovoposition stopped (P < 0.001) 2 days after terone surge (P < 0.001) (Table 3).

Table 3
Matrix of occurrence of the preovulatory hormone surges and their interdependency in ovulation of laying hens.

Hormone Surge Hormone surge dependency


occurrence

Testosterone (%) Progesterone (%) LH (%)

Oestradiol Yes (n = 22) 50 55 59


No (n = 5) 40 40 40
P = 0.686 P = 0.557 P = 0.438

Testosterone Yes (n = 13) 92 100


No (n = 14) 14 14
P < 0.001 P < 0.001

Progesterone Yes (n = 14) 100


No (n = 13) 8
P < 0.001

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
6 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

Fig. 4. Effect of small hierarchical follicle oophorectomy and hormonal treatment on P450scc, StAR and 3-HSD mRNA expression in granulosa (Left panel)
and theca cells (Right panel). Where C-14 = large follicles collected 14 h before the expected ovulation; C-8 = large follicles extracted 8 h before the expected
ovulation and 6 h after oophorectomy without treatment; P = large follicles collected 6 h after oophorectomy of the small follicles, which received SSF as
a placebo, and TX = large follicles collected 6 h after oophorectomy of the small follicles, with a single administration of testosterone, oestradiol or both
hormones immediately after surgery. Values are means of the logarithm of mRNA copies by microgram of cDNA. Expression differs between cell layers.
Differences between groups in the same panel are indicated by different letters (P = 0.04).

3.2. Second study: evaluation of follicular excision and StAR and 3-HSD mRNA expression decreased in theca
exogenous testosterone and oestradiol treatments on cells (Fig. 4).
steroidogenic enzymes and StAR protein mRNA expression No differences were found in mRNA expression of any
steroidogenic enzyme or StAR protein between oophorec-
StAR and all enzyme mRNA expressions were similar for tomized animals with (T, E and T + E groups) or without
F1, F2 and F3 follicles (P > 0.05). Therefore, data from these (group P) hormonal administration. Therefore, data from
follicles was pooled for analysis. all hormonal treatment groups were pooled, analyzed and
Six hours of follicle maturation (groups C-14 vs C-8) dened as treatment group (TX) (Figs. 4 and 5).
caused a decrease on 3-HSD expressions in granulosa Expression of mRNA for steroidogenic enzymes and
and theca cells, while no effect was observed on P450scc StAR protein differed between granulosa and theca cells.
and StAR mRNA expression (Fig. 4). When oophorec- P450scc, StAR and 3-HSD were signicantly higher in
tomy of the small hierarchical follicles was performed, granulosa than in theca cells (P = 0.043 for P450scc;
granulosa cell 3-HSD concentrations remained unal- P < 0.001 for StAR and 3-HSD) (Fig. 4). Six hours of fol-
tered in this 6 h period (group C-8 vs group P). However, licle maturation (group C-14 vs C-8) caused a decrease on

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx 7

The high dependence found between testosterone and


progesterone preovulatory surges agrees with our previ-
ous studies (Rangel et al., 2006), which have shown that
blunting the testosterone preovulatory surge, using a spe-
cic testosterone antagonist, acutely blocks ovulation and
the preovulatory progesterone and LH surges in laying
hens (Rangel et al., 2006). Additionally, a local action of
testosterone at the follicular level stimulated progesterone
production by granulosa cells of the largest preovulatory
follicle (F1) in vitro (Rangel et al., 2007). Our present results
suggest that the preovulatory rise of testosterone occurs
by endocrine complementation between hierarchical folli-
cles. As the progesterone and LH preovulatory surges have
a positive feedback (Lage et al., 1975), the dependence
Fig. 5. Effect of small hierarchical follicle oophorectomy and hormonal
treatment on 17-OH mRNA expression in theca cells. Where C-14 = large between testosterone and LH surges seen could be indi-
follicles collected 14 h before the expected ovulation; C-8 = large follicles rect, due to the lack of progesterone caused by the absence
extracted 8 h before the expected ovulation and 6 h after oophorectomy of testosterone.
without treatment; P = large follicles collected 6 h after oophorectomy of As follicular extraction caused a decrease of testos-
the small follicles, which received SSF as a placebo and TX = large follicles
terone and progesterone production in the rst study, we
collected 6 h after oophorectomy of the small follicles, which received
testosterone, oestradiol or both hormones. Values are means of logarithm expected a reduction on StAR protein, P450scc and 3-
of number of mRNA copies by microgram of cDNA. Differences between HSD expressions in granulosa cells by the same treatment.
groups are indicated by different letters (P = 0.04). Nonetheless, treatment only produced lower expression
of P450scc and 3-HSD within theca cells. These results
suggest that small hierarchical follicles impact larger fol-
17-OH mRNA expression in theca cells, while concentra- licles progesterone production, through their testosterone
tions remained unaltered when oophorectomy of the small production.
hierarchical follicles was performed (Fig. 5). It has been previously stated that F2F4 follicles, and
more specically the F3 follicle, are the main sources of
testosterone in the avian ovary (Robinson and Etches,
4. Discussion 1986; Johnson and van Tienhoven, 1981; Sechman et al.,
2006). However, a preovulatory increase in testosterone
The present study shows that subdominant hierarchical concentrations was not observed in hens in which small
follicles are indispensable for the occurrence of the pre- or large hierarchical follicles were removed (F1F3 and
ovulatory surges of testosterone, progesterone and LH, but F4F6 groups). The lack of testosterone surge in hens in
not of oestradiol, in laying hens. Similarly, the testosterone which F4F6 follicles were removed could indicate that
surge is necessary for progesterone and LH surges to occur. these follicles are responsible for producing testosterone
In addition, subdominant preovulatory follicles affect the (Robinson and Etches, 1986). Alternatively, F4F6 follicles
endocrine activity of larger preovulatory follicles. could stimulate F1F3 follicles to produce testosterone and
Higher concentrations of P450scc, StAR and 3-HSD progesterone. We have previously shown that testosterone
were found in granulosa cells from the larger follicles. stimulates hen granulosa cell progesterone production
This was expected, because granulosa cell steroidogenic in vitro alone or in combination with LH (Rangel et al.,
capacity increases with steroid production (Porter et al., 2007), and that this stimulatory action of testosterone is
1989; Nitta et al., 1993), and they are the main source higher when follicles are closer to ovulation (Rangel et al.,
of progesterone production (Huang et al., 1979; Porter 2009). Further, testosterone increased StAR, P450scc and LH
et al., 1989). Similarly, the highest concentrations of these receptor mRNA expression in hen granulosa cells (Rangel
enzymes were expected in the F1 follicle, since it produces et al., 2009). We now suggest that all hierarchical folli-
the preovulatory surge of progesterone (Yu et al., 1992; cles are needed for the testosterone preovulatory increase
Nakamura et al., 1991). However, in our study mRNA con- and that the rise in testosterone concentrations is not only
centrations for StAR and steroidogenic enzymes did not dependent on the F3 follicle.
differ between the three largest follicles. The absence of Seventeen-alfa-hydroxylase is an important enzyme for
differences may be due to the time of follicle collection testosterone production, and its activity decreases in the
(8 h before expected ovulation), as the preovulatory surge F1 follicle (Nitta et al., 1991). We did not nd differences
of progesterone normally occurs 64 h before ovulation in 17-OH mRNA expression between follicle sizes, but we
(Johnson and van Tienhoven, 1980) and thus it could have observed a decrease with time of follicle maturation at the
been missed. Further, it is now known that StAR expression time when the preovulatory surge of testosterone normally
is regulated by circadian clock genes, involved in the timing occurs, which probably caused a depletion of the enzyme.
of the preovulatory release of progesterone (Nakao et al., In addition, this reduction was observed when small hier-
2007). Hence, the detailed characterization of steroido- archical follicles were removed and the preovulatory surge
genic enzyme expression in the follicle as it matures for of testosterone did not occur.
ovulation will need to consider the relationship with the The lack of dependence between the oestradiol surge
expression of clock genes during the day. and ovulation shown in this work is in agreement with the

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
8 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

study of Lage et al. (1975) in which ovulation in laying We considered the possibility that anaesthesia and
hens occurred independent of the presence of the oestra- surgical procedures could have a negative effect on fol-
diol preovulatory surge. licle development or endocrine secretions, and therefore
The preovulatory oestradiol surge did not depend solely included a sham-operated group in the study design. Our
on subdominant hierarchical follicles (F4F6), as only results ruled out any adverse effect of anaesthesia as in
61.11% hens from the F4F6 follicle group showed a pre- sham-operated hens only one out of eight hens stopped
ovulatory increase in oestradiol concentration. This could laying eggs for 4 days while the rest continued laying. The
be related to the results of Armstrong (1984) and Porter same could be said for the effect of the food restriction, per-
et al. (1989), who found that 50% of aromatase activity formed in preparation for the surgical procedure. In laying
and 85% of oestradiol production is concentrated in ovar- hens, food restriction is commonly used to halt egg lay-
ian stroma and prehierarchical follicles (Johnson, 1990). ing and induce moulting (Scott et al., 1999; Sgavioli et al.,
Further, it has been proposed that oestradiol production 2013). In our study, fasting lasted for 14 h, and although
decreases proportionally with follicle growth and is null we did not measure food intake, we recorded that all hens
in the preovulatory follicle (Armstrong, 1984). In addi- resumed feeding. Hence, the differences in egg laying after
tion, Kawashima et al. (1987) found that oestradiol acts as surgery were not affected by fasting as the control and
an inducer of progesterone receptors at the hypothalamic sham operated hens were subjected to the same fasting
level. Taken together, this evidence suggests that oestra- period and did not show the reduction in laying as the
diol has a longer lasting effect on the hypothalamus for its oophorectomised hens.
ability to respond to progesterone. Finally, treatment with testosterone, oestradiol or both
In contrast, the surges of testosterone, progesterone and did not affect expression of any of the mRNA studied. It is
LH occurred only when subdominant hierarchical follicles possible that no effect was observed because the time of fol-
were present, suggesting that secretions of subdominant licle collection (8 h before ovulation) did not coincide with
follicles are necessary for follicular development and ovu- the preovulatory surge of progesterone, or that hormonal
lation. Previous studies have demonstrated the secretion of doses were ineffective.
activin A, inhibin A and IGF-I, with paracrine and autocrine
actions on follicular development and recruitment. For 5. Conclusions
instance, activin A has a role in keeping hierarchical fol-
licle viability and follicular recruitment (Lovell et al., 1998, We conclude that prehierarchical follicles contribute
2003), since it increases inhibin A secretion by the F1 fol- to the preovulatory increase of oestradiol. In addition,
licle and enhances LH and FSH-stimulated secretion of subdominant hierarchical follicles are necessary to sup-
inhibin A and progesterone (Lovell et al., 2002a). Addi- port large hierarchical follicle development. Finally, we
tionally, inhibin A has a role in the maintenance of tonic propose that, for proper production of testosterone, pro-
secretion of FSH (Lovell et al., 2000), and active immu- gesterone and LH, the entire hierarchical follicle range must
nization against inhibin subunit caused an increase in be present in the hen ovary, and that the testosterone pre-
the number of hierarchical follicles (89.9 mm) and double ovulatory surge is needed for ovulation.
ovulations, regulating the entry of follicles to the preovula-
tory hierarchy (Lovell et al., 2001). Finally, IGF-I increases
Conict of interest
the stimulatory action of LH and FSH on progesterone and
inhibin A production by preovulatory follicles (Lovell et al.,
None of the authors has any nancial or personal rela-
2002b), and follicular recruitment from the prehierarchi-
tionships that could inappropriately inuence or bias the
cal follicle pool into the hierarchical category (Hertelendy
content of the paper.
et al., 1982). Hence, the absence of subdominant hier-
archical follicles and their secretions could have caused
regression of the large hierarchical follicles and, conse- Acknowledgements
quently, the lack of testosterone, progesterone and LH
surges in our study. This work was supported by CONACyT, Mxico, project
The lack of post-treatment egg laying in LHF group sug- number CB-82846 and by the Women Academic Support
gests that follicular atresia could have occurred in response Program (PFAMU) of UNAM (grant number PI200906). Dr.
to the absence of the subdominant hierarchical follicles. P.J. Sharp thanks Roslin Institute for access to research facil-
This is supported by the fact that the average time to ities. Part of this data was presented as a requirement to
resume egg laying was similar to the reported period for the obtain a bachelors degree by Gutierrez K.
rapid follicular growth phase (Johnson, 1990). We suggest
that large hierarchical follicles need the endocrine comple- References
mentation of subdominant hierarchical follicles to continue
their development up to ovulation. The follicular regression Armstrong, D.G., 1984. Ovarian aromatase activity in the domestic fowl
(Gallus domesticus). J. Endocrinol. 100, 8186.
that might have occurred in hens with follicle removal may Bahr, J.M., Wang, S.C., Huang, M.Y., Calvo, F.O., 1983. Steroid concentra-
be compared with induction of moulting in the domestic tions in isolated theca and granulosa layers of preovulatory follicles
chicken, in which hierarchical follicle regression is due to during the ovulatory cycle of the domestic hen. Biol. Reprod. 29,
326334.
a reduction in plasma levels of LH and sex steroids (Oguike Bennett, R.A., Harrison, G.J., 1994. Soft tissue surgery. In: Ranson, W.,
et al., 2005), a hormonal environment similar to that found Harrison, G.J., Harrison, L.R. (Eds.), Avian Medicine: Principles and
in oophorectomised hens in this study. Applications. , 3rd ed. Wingers Publishing, Florida, pp. 10961136.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx 9

Etches, R.J., 1990. The ovulatory cycle of the hen. Crit. Rev. Poult. Biol. 2, fowl (Gallus domesticus) and after induced cessation of egg laying. J.
293313. Reprod. Fertil. 119, 323328.
Etches, R.J., 1996. Reproduction in Poultry. CAB International, Cambridge, Nakamura, T., Funabashi, M., Tanabe, Y., 1991. In vitro studies on steroido-
pp. 318319. genesis in the presence of pregnenolone as precursors by the follicular
Etches, R.J., Cheng, K.W., 1981. Changes in plasma concentrations of tissue of the domestic fowl (Gallus domsticus). J. Steroid Biochem. Mol.
luteinizing hormone, progesterone, oestradiol and testosterone and Biol. 38, 105110.
in the binding of follicle stimulating hormone to the theca of follicles Nakao, N., Yasuo, S., Nishimura, A., Yamamura, T., Watanabe, T., Anraku, T.,
during the ovulation cycle of the hen (Gallus domesticus). J. Endocrinol. Okano, T., Fukada, Y., Sharp, P.J., Ebihara, S., Yoshimura, T., 2007. Circa-
91, 1122. dian clock gene regulation of steroidogenic acute regulatory protein
Etches, R.J., Cunningham, F.J., 1976. The interrelationship between pro- gene expression in preovulatory ovarian follicles. Endocrinology 148,
gesterone and luteinizing hormone during the ovulatory cycle of the 30313038.
hen (Gallus domesticus). J. Endocrinol. 71, 5158. Nitta, H., Osawa, Y., Bahr, J., 1991. Multiple steroidogenic cell popula-
Fraser, H.M., Sharp, P.J., 1978. Prevention of positive feedback in the hen by tions in the thecal layer of preovulatory follicles of the chicken ovary.
antibodies to luteinizing hormone releasing hormone. J. Endocrinol. Endocrinology 129, 20332040.
76, 181182. Nitta, H., Manson, J.I., Bahr, J.M., 1993. Localization of 3-hydroxysteroid
Gilbert, A.B., Perry, M.M., Waddington, D., Hardie, M.A., 1983. Role of atre- dehydrogenase in the chicken ovarian follicle shifts from the theca
sia in establishing the follicular hierarchy in the ovary of the domestic layer to granulosa layer with follicular maturation. Biol. Reprod. 48,
hen (Gallus domesticus). J. Reprod. Fertil. 69, 221227. 110116.
Hernndez-Vrtiz, A., Gonzlez del Pliego, M., Velzquez, P., Pedernera, M., Oguike, M.A., Igboeli, G., Ibe, S.N., Ironkwe, M.O., 2005. Physiological and
1993. Morphological changes in the thecal layer during the maturation endocrinological mechanisms associated with ovulatory cycle and
of the preovulatory ovarian of the domestic fowl (Gallus domesticus). induced-moulting in the domestic chicken a review. World Poult.
Gen. Comp. Endocr. 92, 8087. Sci. 61, 625632.
Hertelendy, F., Linter, F., Asem, E.K., Raab, B., 1982. Synergistic effect of Pollock, C., Carpenter, J.W., Antinoff, N., 2005. Birds. In: Carpenter, J.W.
gonadotropin releasing hormone on LH-stimulated progesterone pro- (Ed.), Exotic Animal Formulary. Elsevier Saunders, Saint Louis, MO,
duction in granulosa cells of the domestic fowl (Gallus domesticus). pp. 199212.
Gen. Comp. Endocr. 48, 117122. Porter, F.E., Hargis, B.M., Silsby, J.L., Halawani, M.E., 1989. Differential
Huang, E.S., Kao, K.J., Nalbandov, A.V., 1979. Synthesis of sex steroids by steroid production between theca interna and theca externa cells:
cellular components of chicken follicles. Biol. Reprod. 20, 454461. a three-cell model for follicular steroidogenesis in avian species.
Imai, K., Nalbandov, A.V., 1978. Plasma and follicular steroid levels of lay- Endocrinology 125, 109116.
ing hens after the administration of gonadotropins. Biol. Reprod. 19, Rangel, P.L., Lassala, A., Gutirrez, C.G., 2005. Testosterone immunization
779784. blocks the ovulatory process in laying hens without affecting ovarian
Johnson, A.L., 1996. The avian ovarian hierarchy: a balance between follicle follicular development. Anim. Reprod. Sci. 86, 143151.
differentiation and atresia. Poult. Avian Biol. Rev. 7, 99110. Rangel, P.L., Rodrguez, A., Gutierrez, C.G., 2007. Testosterone directly
Johnson, A.L., 1990. Steroidogenesis and actions of steroids in the hen induces progesterone production and interacts with physiological
ovary. Crit. Rev. Poult. Biol. 2, 319346. concentrations of LH to increase granulosa cell progesterone produc-
Johnson, P.A., Shu-Yin, W., Brooks, C., 1993. Characterization of source and tion in laying hens (Gallus domesticus). Anim. Reprod. Sci. 102, 5665.
levels of plasma immunoreactive inhibin during the ovulatory cycle Rangel, P.L., Rodrguez, A., Rojas, S., Sharp, P.J., Gutierrez, C.G., 2009.
of the domestic hen. Biol. Reprod. 48, 262267. Testosterone stimulates progesterone production and STAR, P450
Johnson, A.L., van Tienhoven, A., 1980. Plasma concentrations of six cholesterol side-chain cleavage and LH receptor mRNAs expression in
steroids and LH during the ovulatory cycle of the hen, Gallus domes- hen (Gallus domesticus) granulosa cells. Reproduction 138, 961969.
ticus. Biol. Reprod. 23, 386393. Rangel, P.L., Sharp, P.J., Gutierrez, C.G., 2006. Testosterone antagonist (u-
Johnson, A.L., van Tienhoven, A., 1981. Hypophyseal sensitivity to hor- tamide) blocks ovulation and preovulatory surges of progesterone,
mones in the hen. II. Plasma concentration of LH, progesterone, and luteinizing hormone and oestradiol in laying hens. Reproduction 131,
testosterone. Biol. Reprod. 25, 153161. 11091114.
Johnson, P.A., Johnson, A.L., van Tienhoven, A., 1985. Evidence for a positive Robinson, F.E., Etches, R.J., 1986. Ovarian steroidogenesis during follicular
feedback interaction between progesterone and luteinizing hormone maturation in the domestic fowl (Gallus domesticus). Biol. Reprod. 35,
in the induction of ovulation in the hen, Gallus domesticus. Gen. Comp. 10961105.
Endocr. 58, 478485. Robinson, F.E., Etches, R.J., Anderson-Langmuir, C.E., Burke, W.H., Cheng,
Kawashima, M., Kamiyoshi, M., Tanaka, K., 1987. Presence of estrogen K.W., Cunningham, F.J., Ishii, S., Sharp, P.J., Talbot, R.T., 1988. Steroido-
receptors in the hen hypothalamus and pituitary. Endocrinology 120, genic relationships of gonadotrophins hormones in the ovary of the
582588. hen (Gallus domesticus). Gen. Comp. Endocrinol. 69, 455466.
Lage, P.C., van Tienhoven, A., Cunningham, F.J., 1975. Concentration of Sasanami, T., Mori, M., 1999. Effects of oestradiol-17 and testosterone on
estrogens, progesterone and LH during the ovulatory cycle of the lay- progesterone production in the cultured granulosa cells of Japanese
ing chicken (Gallus domesticus). Biol. Reprod. 12, 590598. quail. Brit. Poult. Sci. 40, 536540.
Lovell, T.M., Gladwell, R.T., Cunningham, F.J., Groome, N.P., Knight, P.G., Scott, T.A., Silversides, D., Swift, M.L., 1999. Effect of feed form, formula-
1998. Differential changes in inhibin a, activin a, and total a sub- tion, and restriction on the performance of laying hens. Can. J. Anim.
unit levels in granulosa and theca layers of developing preovulatory Sci. 79, 171178.
follicles in the chicken. Endocrinology 139, 11641171. Sechman, A., Lakota, P., Wojtysiak, D., Hrabia, A., Mika, M., Lisowski, M.,
Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2002a. Modulatory Czekalski, R.J., Kapkowska, E., Bednarczyk, M., 2006. Sex steroids level
effects of gonadotropin-induced secretion of inhibin A and proges- in blood plasma and ovarian follicles of the chimeric chicken. J. Vet.
terone by granulosa cells from preovulatory (F1F3) chicken follicles. Med. A: Physiol. Pathol. Clin. Med. 10, 501508.
Reproduction 124, 649657. Sgavioli, S., Filardi, R.S., Praes, M.F., Domingues, C.H., Pileggi, J., Andrade,
Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2002b. Differential P.C., Boleli, I.C., Junqueira, O.M., 2013. Dietary ber inclusion as an
effect of activin A on basal and gonadotropins and insulin-like growth alternative to Feed Fasting to induce molting in commercial layers.
factor on the secretion of inhibin A and progesterone by granulosa Rev. Bras. Cienc. Avic. 15, 365370.
cells from chicken preovulatory (F1F3) follicles. Reproduction 123, Sharp, P.J., Dunn, I.C., Talbot, R.T., 1987. Sex differences in the LH responses
291300. to chicken LHRH-I and II in the domestic fowl. J. Endocrinol. 115,
Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2003. Ovarian follicle 323331.
development in the laying hen is accompanied by divergent changes Sharp, P.J., Talbot, R.T., Macnamee, M.C., 1989. Evidence for the involve-
in inhibin A, inhibin B, activin A and follistatin production in granulosa ment of dopamine and 5-hydroxytryptamine in the regulation of the
and theca layer. J. Endocrinol. 177, 4555. preovulatory release of luteinizing hormone in the domestic hen. Gen.
Lovell, T.M., Knight, P.G., Groome, N.P., Gladwell, R.T., 2001. Changes in Comp. Endocr. 76, 205213.
plasma inhibin A during sexual maturation in the female chicken Sterling, R.J., Gasc, J.M., Sharp, P.J., Tuohimaa, P., Baulieu, E.E., 1984.
and the effects of active immunization against inhibin subunit on Absence of nuclear progesterone receptor in LH releasing hormone
reproductive hormone proles and ovarian function. Biol. Reprod. 64, neurones in laying hens. J. Endocrinol. 102, R5R7.
188196. Tilly, J.L., Kowalski, K.I., Johnson, A.L., 1991. Cytochrome P450 side-chain
Lovell, T.M., Vanmonfort, D., Bruggeman, V., Decuypere, E., Groome, cleavage (P450scc) in the hen ovary. II. P450scc messenger RNA,
N.P., Knight, P.G., Gladwell, R.T., 2000. Circulating concentrations of immunoreactive protein, and enzyme activity in developing granulosa
inhibin-related proteins during the ovulatory cycle of the domestic cells. Biol. Reprod. 45, 474967.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
10 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

Tricarico, A., Pinzani, P., Bianchi, S., Paglierani, M., Distante, V., Pazzaglia, Wilson, S.C., Sharp, P.J., 1976. Effects of androgens, oestrogens
M., Bustin, S.A., Orlando, C., 2002. Quantitative real-time reverse tran- and deoxycorticosterone acetate on plasma concentrations
scription polymerase chain reaction: normalization to rRNA or single of luteinizing hormone in laying hens. J. Endocrinol. 69, 93
housekeeping genes is inappropriate for human tissue biopsies. Anal. 102.
Biochem. 309, 293300. Yu, M.W., Robinson, F.E., Etches, R.J., 1992. Quantication of ovarian
Williams, J.B., Sharp, P.J., 1978. Control of the preovulatory surge of steroidogenesis in the domestic fowl by incubation of intact large
luteinizing hormone in the hen (Gallus domesticus): the role of pro- follicles. Poult. Sci. 71, 346351.
gesterone and androgens. J. Endocrinol. 77, 5765.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011