Vous êtes sur la page 1sur 964

Investigaciones en Ciencia e Inocuidad de Alimentos

Laura Ofelia Orozco Hernndez


Luz Eduviges Garay Martnez
Ma. Refugio Torres Vitela
Coordinadoras

UNIVERSIDAD DE GUADALAJARA
CENTRO UNIVERSITARIO DE CIENCIAS EXACTAS E INGENIERAS
Primera edicin, noviembre 2017

Derechos Reservados Universidad de Guadalajara, 2017


Centro Universitario de Ciencias Exactas e Ingenieras
Blvd. Marcelino Garca Barragn 1421
Col. Olmpica, C.P. 44430
Guadalajara, Jalisco, Mxico

Coordinadoras:

Laura Ofelia Orozco Hernndez


Luz Eduviges Garay Martnez
Ma. Refugio Torres Vitela

ISBN: 978-607-8490-35-6

Diseo:
Gerardo Daniel Cervantes Toscano
Laura Ofelia Orozco Hernndez

Reproduccin:
Prometeo Editores S.A. de C.V.
C. Libertad 1457 / Col. Americana / C.P. 44160
Guadalajara, Jalisco Mxico.
Tels: 38262726, 38262782
Comit cientfico editorial

Coordinacin: Laura Ofelia Orozco Hernndez


CUCEI - Universidad de Guadalajara

Alejandro Castillo Ayala


Universidad de Texas A&M

Anglica Villaruel Lpez


CUCEI - Universidad de Guadalajara

Elsa L. Ramrez Cerda


Centro de Investigaciones y Asistencia en Tecnologa y Diseo del Estado de
Jalisco - CIATEJ

Javier Castro Rosas


Universidad Autnoma del Estado de Hidalgo

Julia Aurora Prez Montao


CUCEI - Universidad de Guadalajara

Luz Eduviges Garay Martnez


CUCEI - Universidad de Guadalajara

Ma. Refugio Torres Vitela


CUCEI - Universidad de Guadalajara

Mara Esther Macas Rodrguez


CUCEI - Universidad de Guadalajara

Maria de los ngeles Olea Rodrguez


CUCEI - Universidad de Guadalajara

Mara Patricia Chombo Morales


Centro de Investigaciones y Asistencia en Tecnologa y Diseo del Estado de
Jalisco CIATEJ
NDICE

Prefacio........ 1

1. Efecto del secado de leche humana sobre la calidad microbiolgica y nutrimental 2

2. Aislamiento y seleccin de cepas de Streptomyces con potencial para produccin de antibiticos. 6

3. Actividad antimicrobiana de nanopartculas de plata sintetizadas con extractos de plantas y


microondas.... 10

4. Efecto de la combinacin de aceite esencial de Cymbopogon citratus y aceites de vegetales


sobre la inhibicin/crecimiento de Pseudomonas fluorescens CDBB-1243 en un sistema modelo.. 14

5. Efecto combinado del germinado de cha (Salvia hispanica) y el pH sobre la


inhibicin/crecimiento de Salmonella choleraseuis.... 18

6. Efecto de la combinacin de la hoja de aguacate (Persea americana), pH (4,6 y 8) y


temperaturas de congelacin/refrigeracin sobre el control de Listeria monocytogenes NCTC
11994. 22

7. Efecto combinado de la concentracin de hoja de aguacate (Persea americana), pH (4,6 y 8) y


temperaturas de congelacin/refrigeracin sobre el contenido de fenoles totales con el diseo
estadstico de punto central.. 26

8. Actividad antioxidante de cscara de Xoconostle (Opuntia matudae) y elaboracin de un alimento


modelo con trucha arco iris (Onchorhynchus mykiss)... 30

9. Anlisis microbiolgico en mermelada de Carica papaya L. usando dos conservadores elaborada


en Cunduacn, Tabasco 34

10. Evaluacin de la calidad higinico - sanitaria de una cadena de carniceras en Culiacn, Sinaloa. 38

11. Estudio de la Calidad higinica e identificacin de Pseudomonas aeruginosa en agua para


consumo humano provista de expendios informales en Villahermosa Tabasco... 42

12. Efecto de la adicin de extracto acuoso de ajo en la dieta de conejos sobre la calidad
microbiolgica de la carne 46

13. Efecto del pretratamiento por fermentacin en medio slido en la purificacin qumica de quitina
en exoesqueletos de chapuln (Sphenarium purpurascens). 50

14. Cuantificacin de plomo por complejometra en muestras de atn. 54

15. Determinacin de residuos de antimicrobianos en msculo y rin de cerdos sacrificados en dos


rastros municipales de la zona metropolitana de Guadalajara. 58

16. Comparativo analtico de la nata (crema) de rancho vs procesada de origen animal.. 62

17. Evaluacin de la aceptacin y caracterizacin de una barra de cereales y leguminosa adicionada


con Pleurotus ostreatus. 66

18. Estudio de la crema como producto de la leche bronca durante su almacenamiento. 70

19. Identificacin por el mtodo de vaciado en placa de Coliformes, Hongos y Levaduras en muestras
de comida obtenidas en la cafetera de la Unidad Acadmica de Fsica de la Universidad
Autnoma de Zacatecas.... 74

20. Frecuencia y nmero ms probable de Clostridium perfringens en chorizo de pollo comercializado


en Guadalajara y Zapopan, Jalisco, Mxico.. 78
21. Influencia del pelado termoqumico sobre la carga de Enterobacterias y Staphylococcus aureus
en pulpa de chirimoya 82

22. Comparacin de la carga de microorganismos indicadores de la alteracin en mangos frescos de


venta en mercados y supermercados de Lima, Per. 86

23. Cronobacter sakazakii y parmetros microbiolgicos en alimentos lcteos asociados a la alerta


alimentaria nacional en Chile 2017.. 90

24. Desarrollo de un producto alimentario extruido, similar a papa frita en base a subproductos de
papa y arroz. Evaluacin fsico-qumica, microbiolgica... 94

25. Nanopartculas de Quitosano con aceite esencial de Pirul (Schinus molle L): Efecto antifngico y
anti-aflatoxignico 98

26. Aislamiento de bacterifagos especficos contra cepas de Escherichia coli formadoras de


biopelculas... 102

27. Deteccin de antibiticos en quesos utilizando la prueba Trisensor 106

28. Resistencia y susceptibilidad de seis bacterias aplicables para recuperar suelos contaminados
con TPH. 110

29. Caracterizacin y elaboracin de biopelculas a base de almidn de chayotextle y mucilago de


cha Salvia hispanica.. 114

30. Antagonistas de Bacillus aisladas de costas del estado de Sonora en contra del agente etiolgico
del sndrome de mortalidad temprana en cultivos de camarn 118

31. Anlisis de la incidencia de Escherichia coli enteropatgena en productos crnicos en el sur de


Sonora... 122

32. Aprovisionamiento de leche cruda en el departamento de Sucre Colombia.. 126

33. Dinmica de internalizacin Salmonella Newport en tomates cherry (Solanum lycopersicum var.
cerasiforme) y cuantificacin del gen rpoS. ... 130

34. Identificacin de los agentes patgenos causantes de mastitis caprina en el municipio de


Yurecuaro Michoacn.. 134

35. Determinacin de la calidad de la leche del ganado bovino de Campo Hermoso Municipio de
Maravatio Michoacn.. 138

36. Mejoramiento de la calidad sanitaria de conchas de abanico (Argopecten purpuratus) a travs del
efecto combinado de cido lctico y nisina. 142

37. Cremas de aj de la casa listas para consumir y el monitoreo de su calidad microbiolgica en los
puntos de venta de Lima y Callao, Per.. 146

38. Propuesta de un analisis alternativo para determinar compuestos nitrogenados en embutidos 150

39. Propiedades antioxidantes de una bebida de jamaica (Hibiscus sabdariffa L.) y perejil
(Petroselinum hortense). 154

40. Efecto de la aplicacin de elicitores sobre el contenido de esteviosidos y fenlicos en stevia


(Stevia rebaudiana). 158

41. Efecto del ultrasonido de alta intensidad en las propiedades emulsificantes y gelificantes de un
aislado protenico de canola (Brassica napus L) 162
42. Inhibicin de hongos fitopatgenos de Guanbana (Annona muricata.L) mediante metabolitos
secundarios de bacterias del gnero Pseudomonas. 166

43. Evaluacin de la capacidad de formacin de biopelcula de los aislamientos de Staphylococcus


aureus provenientes de manipuladores de alimentos que intervienen en la industria lctea. 170

44. Bioaccesibilidad in vitro de compuestos fenlicos de chiltepn (Capsicum annuum L. var.


glabriusculum).. 174

45. Glicacin de protenas del tejido conectivo de calamar (Dosidicus gigas) va reaccin de Maillard
y su potencial antihipertensivo in vitro. 178
46. Estudio del potencial antimicrobiano de plantas medicinales y comestibles. 182

47. Actividad antibacteriana de desinfectantes utilizados en la industria alimentaria en Mxico.. 186

48. Aislamiento de agentes patgenos causantes de mastitis en hatos lecheros caprinos del
municipio de Venustiano Carranza, Michoacn. 190

49. Anlisis comparativo y conductual entre una dieta restrictiva a dos variedades de maz (MR y
QPM) comparado con una dieta convencional en un modelo murino. 194

50. Validacin del mtodo microbiolgico para la cuantificacin de Staphylococcus aureus 198

51. Desarrollo de un anlogo de cochinita pibil empleando el residuo de jamaica (Hibiscus sabdariffa L.) y
la prevalencia de patgenos especficos tras el proceso. 202

52. Control de calidad higinica en la produccin artesanal de yogurt. 206

53. Residuos de piretroides promueven oxidacin irreversible en principales fracciones proteicas de


leche bovina.. 210

54. Optimizacin de un procedimiento de fraccionamiento de casenas y protenas del lactosuero


bovino... 214

55. Carbonilacin in vitro en protenas de pollo inducida por residuos de sarafloxacina, clorpirifs y
su combinacin. 218

56. Elaboracin de queso crema adicionado con Enterococcus faecium..... 222

57. Diagnstico higinico-sanitario e identificacin de factores de riesgo en servicios de restauracin


alimenticia. 226

58. Agro-homeopata aplicada al mejoramiento del maz 230

59. Efecto del uso de clulas lavadas y del mtodo de muestreo en el recuento de bacterias
patgenas adheridas al epicarpio de naranjas Valencia... 234

60. Recuento de bacterias cido lcticas en lcteos fermentados comercializados en la regin


cinega de Jalisco 238

61. Actividad antifngica de cidos grasos sobre el crecimiento micelial de patgenos de fresa
(Fragaria x ananassa). 242

62. Efecto protector del compsito quitosano-octanoato de sodio sobre Botrytis cinerea en frutos de
fresa (Fragaria x ananassa) 246

63. Evaluacin de la Actividad antibacteriana del fito-extracto del fruto rojo de Stenocereus
queretaroensis frente a patgenos 250

64. Tipificacin de virulencia cepas de serotipos no tifoideos de Salmonella aisladas de ros de


Culiacn, Sinaloa. 254
65. Cuantificacin de poblaciones de bacterias lcticas durante la fermentacin lctica controlada del
aj Charapita (Capsicum frutescens) por qPCR usando SYBR Green. 258

66. Evaluacin de la formacin de biopelculas de cepas de Salmonella spp en superficies de vidrio y


plstico aisladas del entorno alimenticio de las escuelas de tiempo completo. 262

67. Valoracin microbiolgica de recursos hdricos en el distrito 010 en el estado de Sinaloa. 266

68. Evaluacin de agentes desinfectantes: cloro y plata coloidal en lechuga contaminada con
Staphylococcus spp y Salmonella spp. 270

69. Optimizacin de la obtencin del extracto de semillas de annatto a partir de diferentes tcnicas de
extraccin. 274
70. Pelculas comestibles para la inhibicin de crecimiento de Colletotrichum sp.. 278

71. Microencapsulacin del aceite esencial de organo (Lippia berlandieri Schauer) para su
aplicacin en la conservacin de carne de res 282

72. Evaluacin de la actividad antioxidante de un bioempaque activo, a base de polisuccinimida y


almidn, funcionalizado con aceite esencial del organo (Lippia berlandieri Schauer).. 286

73. Determinacin cualitativa de biopelculas e identificacin de genes asociados a su formacin en


una cepa silvestre de Listeria monocytogenes.. 290

74. Resistencia bacteriana al coloide de plata a diferentes concentraciones de diversas marcas


comerciales en vegetales... 294

75. Indicadores de contaminacin fecal en agua superficial y su asociacin con actividades


antropognicas de la regin Centro-Norte de Sinaloa....................................................................... 298

76. Caracterizacin fisicoqumica del aceite de Cocos nucifera, comercializado en Villahermosa,


Tabasco. 302

77. Actividad antibacteriana de extractos de Prodigiosa y Real de Oro plantas medicinales usadas en
Valle de Santiago. 306

78. Deteccin de Listeria spp. en carne molida comercializada en supermercados.. 310

79. Identificacin de patgenos en alimentos del comedor de la Unidad Acadmica de Medicina


Humana del Campus UAZ Siglo XXI 314

80. Adaptacin y validacin del mtodo de anlisis de TCMTB y sus metabolitos en jitomate. 318

81. Quantifying Escherichia coli in irrigation water used in papaya (Carica papaya L.) farms:
application of the US-FDA Produce Safety Rule microbiological criteria 322

82. Sobrevivencia e inactivacin de una cepa toxigenica de Clostridium perfringens en birria y pozole
sometidos a recalentamiento en horno de microondas. 326

83. Evaluacin del Efecto Antimicrobiano de Aceites Vegetales Ozonizados contra Pseudomonas
aeruginosa, Escherichia coli y Listeria monocytogenes 330

84. Incidencia de Listeria spp. y Listeria monocytogenes en queso Oaxaca expendido en el Valle de
Tulancingo. 334

85. Determinacin de patgenos en superficies vivas en el SAUS Campus Siglo XXI.. 338

86. Anlisis de calidad sanitaria en ensaladas de vegetales crudos, listos para su consumo.. 342

87. Evaluacin fisicoqumica y microbiolgica de leche de cabra comercializada en San Salvador 346
88. Aislamiento e identificacin de patgenos en quesos artesanales en el municipio de Jerez,
Zacatecas.. 350

89. Cuantificacin de mesfilos, coliformes, hongos y levaduras presentes en quesos artesanales en


el municipio de Jerez, Zacatecas.. 354

90. Comportamiento de Escherichia coli O157:H7 en lechuga (Lactuca sativa), cilantro (Coriandrum
sativum) y espinaca (Spinacia oleracea) provenientes del mercado Zapata de la ciudad de
Puebla 358

91. Importancia de la gestin de la cadena de fro en frutas... 362

92. Aplicacin de Buenas Prcticas de Manufactura en el proceso de elaboracin del queso


artesanal de Cabra de Coahuila... 366

93. Diseo de experimentos para quesos adicionados con Bacterias Acido Lcticas 370

94. Proceso de elaboracin del queso artesanal de cabra en tres comunidades del sureste de
Coahuila. 374

95. Cintica de degradacin de los compuestos bioactivos del extracto de semillas annatto (Bixa
orellana L.) a diferentes condiciones de almacenamiento 378

96. Microencapsulacin del extracto de Bixa orellana L. (annatto) por las tcnicas de secado por
aspersin y liofilizacin 382

97. Sensibilidad in-vitro de cepas bacterianas aisladas en ganado de engorda frente a dos
antibiticos tilosina+gentamicina y oxitetraciclina. 386

98. Susceptibilidad de cepas de Salmonella spp. aisladas de aves ponedoras clnicamente sanas por
el mtodo de Concentraciones Inhibitorias Mnimas (CIM) a diferentes antibiticos... 390

99. Deteccin de Brettanomyces/Dekkera en vinos de Baja California. 394

100. Niveles residuales de levofloxacina en tejidos comestibles de pollos parrilleros.. 398

101. Cuantificacin y determinacin del periodo de suspensin de fluoroquinolonas en leche caprina 402

102. Deshidratacin Osmtica de Membrillo (Cydonia oblonga).. 406

103. La quercetina inhibe la secrecin de sustancias polimricas durante la formacin de biopelculas


de Listeria monocytogenes en superficies de acero inoxidable.. 410

104. Capacitacin y educacin sanitaria en la recolecta de hongos comestibles silvestres en la


comunidad de Canoas Altas y Jess Mara del Municipio de Chalchicomula de Sesma Puebla. 414

105. Evaluacin de superficies vivas en la cafetera de la facultad de medicina en la Universidad


Autnoma de Zacatecas. 418

106. Contenido de Arsnico, Plomo y Litio en leche y quesos en reas irrigadas con aguas residuales.. 422

107. Propiedades fisicoqumicas de jugo de mamey (Pouteria sapota Jacq. HE Moore & Stearn) y
aislado proteico de suero de leche secado por aspersin 426

108. Caracterizacin fisicoqumica y contenido de compuestos fenlicos en malanga (Colocasia


esculenta L. Schott), de Veracruz, Mxico.. 430

109. Diseo de un modulo de evaporacin Solar al vaco para la concentracin de jarabe de agave. 434

110. Combinacin de aceite esencial de clavo e irradiacin UV-C para erradicar biopelculas de
Salmonella Typhimurium. 438
111. Prevalencia de Alicyclobacillus spp. y A. acidoterrestris productor de guayacol en productos de
fruta y aguas de proceso industrial elaborados en Argentina durante el periodo 2014-2016 442

112. Niveles de contaminacin y cintica de degradacin de plaguicidas en pulque.. 446

113. Caracterizacin de la microbiota deterioradora de salchicha en empaques disponibles para su


venta en Mxico y del programa de retiro de una empresa productora. 450

114. Bsqueda y presencia de parsitos en filetes de pescado importado y pescados enteros sin
eviscerar que se comercializan en Guadalajara, Zapopan y Tlaquepaque 454

115. Identificacin de anticuerpos contra Trichinella spiralis en muestras de caballos 458

116. Alimento para cultivo en granja de camarn blanco (Litopenaeus vannamei) de postlarva y
engorda a base de cereal como fuente de protena... 462

117. Tostada horneada de maz azul enriquecida con polvo de nopal y hongo seta (Pleurotus
ostreatus).. 466

118. Aprovechamiento de los residuos del fruto del caf para el desarrollo de un edulcorante.. 470

119. Estrategias para disminucin y/o sustitucin de AGS Y AGT en productos de panadera
artesanal, caso Municipio Fmeque, Cundinamarca, Colombia.. 474

120. Metilmercurio en peces procedentes del sur del departamento de Sucre, Norte de Colombia 478

121. Efecto antibacteriano de la cscara de Oxalis tuberosa en bacterias aisladas de productos de


panificacin 482

122. Actividad antimicrobiana de Moringa oleifera en cepas de Staphylococcus aureus resistentes a


antibiticos aisladas de productos lcteos del Valle del Mezquital, Hidalgo. 486

123. Elaboracin de una barra nutritiva a base de palomitas de sorgo y amaranto. 490

124. Evaluacin de las caractersticas que confiere la semilla de cha (Salvia hispanica L), en
formulaciones que enriquecen las propiedades nutritivas y sensoriales de los alimentos. 494

125. Bacillus thuringiensis subsp. morrisoni incrementa la calidad e inocuidad del cultivo de tomate
(Solanum lycoperisicum L). 498

126. Presencia y caracterizacin Fenotpica de Salmonella spp. aislada de la Laguna de Zapotln,


Jalisco 502

127 Evaluacin del Sistema de Deteccin Molecular 3M para Cronobacter spp. desde cultivo puro y
leches en polvo. 506

128 Calidad microbiolgica de los alimentos preparados en escuelas inscritas al programa de tiempo
completo ... 510

129. Disminucin de comunicacin intercelular y formacin de biopelculas de Pseudomonas


aeruginosa expuestas a carvacrol. 514

130. Prevalencia de Salmonella spp en pollo crudo del noreste de Tamaulipas.. 518

131. Deteccin de factores de virulencia en Escherichia coli aislada de carne en el noreste de


Tamaulipas 522
132. Efecto antimicrobiano de extracto de Jamaica (Hibiscus sabdariffa) contra Salmonella
Typhimurium, Staphylococcus aureus, Listeria monocyogenes y Escherichia coli O157:H7
resistentes a la Rifampicina en frutas y hortalizas 526

133. Microbial diversity of the edible fruit of Guamuchil (Pithecellobium dulce (Roxb) Benth) 530
134. Identificacin de microorganismos patgenos en alimentos que se consumen en SAUS-UAZ 534

135. Nivel de contaminacin de superficie por Escherichia coli y coliformes en canales de ovino
sacrificados en un matadero del valle de Toluca 538

136. Determinacin de E. coli productoras de Toxinas Shiga en Alimentos Utilizando Mtodos


Microbiolgicos y PCR en Tiempo Real... 542

137. Desarrollo de un dulce con pulpa de tamarindo y pectina de alto grado de metoxilacin y su
evaluacin fisicoqumica, microbiolgica y sensorial. 546

138. Determinacin de concentraciones mnimas inhibitorias de antibiticos en cepas de Vibrio


parahaemolyticus aisladas de camarn Litopenaeus vannamei. 550

139. Anlisis In Silico para la identificacin de similitudes y diferencias de las secuencias reportadas
de Hepatitis viral A y Norovirus GII.4 con base a su origen geogrfico.. 554

140. Caracteres culinarios y contenido de protena en frijol de acuerdo a las buenas prcticas
agrcolas 558

141. Aceites esenciales con actividad antifngica para el control de Rhizopus stolonifer.. 562

142. Seleccin de levaduras silvestres procedentes diferentes fermentaciones naturales con uso
potencial como cultivos iniciadores en la produccin de tequila.. 566

143. Efectividad del propleo para reducir la contaminacin de Aspergillus en semillas de maz. 570

144. Cuantificacin de microorganismos patgenos en alimentos del jardn de nios CECIUAZ de la


Universidad Autnoma de Zacatecas... 574

145. Efecto antimicrobiano de Moringa oleifera en cepas de E. coli y Salmonella aisladas de cilantro
cultivado en el valle del Mezquital. 578

146. Impacto del tratamiento trmico y de ultrasonido sobre la actividad pectin metilesterasa. 582

147. Validacin de agentes desinfectantes en la Empresa SANA INTERNACIONAL S. de R.L de C.V... 586

148. Inactivation of Salmonella and Shiga-toxin-producing Escherichia coli (STEC) on the surface of
alfalfa seeds and sprouts by combined antimicrobial treatments using ozone and electrolyzed
water. 590

149. Formulacin y evaluacin sensorial de galletas con potencial prebitico elaboradas con bagazo
de Agave (Agave atrovirens y Agave salmiana). 594

150. Evaluacin de calidad microbiolgica de alimentos expendidos en la secundaria Ignacio Zaragoza


de Ojocaliente, Zacatecas.. 598

151. Potencial antioxidante de encapsulados obtenidos con extractos del pericarpio del fruto xkijit
(Renealmia alpinia). 602

152. Calidad sanitaria del huevo de Gallus gallus comercializado en una ciudad del sureste de
Mxico.. 606

153. Biotipos de Staphylococcus aureus aislados de productos lcteos artesanales comercializados en


una ciudad del suroeste de Mxico. 610

154. Dulce de leche artesanal y bajo en colesterol. 614

155. Confite de maracuy 618

156. Produccin y estudio de la calidad de mieles de dos especies de Agave.. 622


157. Riesgos microbiolgicos en la elaboracin de queso fresco en el norte del pas. 626

158. Determinacin de microorganismos indicadores en queso fresco de cabra producido en una


regin norte de Mxico 630

159. Perfil de textura y de vida de anaquel de productos de panificacin adicionados con xilanasa
(SRXL1) producida por Sporisorium reilianum 634

160. Contaminacin de agua embotellada por migracin de ftalatos. 638

161. Plaguicidas organoclorados en leche vacuna cruda de tres municipios productores del estado de
Chiapas 642

162. Evaluacin de hidrocarburos aromticos policclicos (HAP) en pasto para consumo de ganado
productor de leche orgnica en el municipio de Tuxpan, Veracruz 646

163. Actividad antioxidante de los productos de fermentacin de harina de semilla de Moringa oleifera
obtenidos con Lactobacillus spp 650

164. Identificacin de las protenas presentes en los diferentes instares larvales de Comadia
redthenbacheri indiviuo del Altiplano Hidalguense. 654

165. Perfil de lpidos presentes en maz poliembrinico. 658

166. Persistencia de Listeria monocytogenes en una industria de hortalizas congeladas: Influencia de


la huella gentica y huella de vida del patgeno 662

167. Lactobacillus casei ATCC 334 en helado de ciruela amarilla: Comparacin de clulas libres y
encapsuladas en alginato de calcio y quitosana. 666

168. Caractersticas fsico-qumicas de harina de nopal sometida al pre-tratamiento ultrasnico de


secado 670

169. Validacin de una PCR en tiempo real para la cuantificacin de Escherichia coli 674

170. Caracterizacin del proceso de formacin y composicin de biopelculas de Pectobacterium


carotovorum subsp. carotovorum. 678

171. Extraccin de betalainas a partir del betabel y su aplicacin en confitera 682

172. Anlisis microbiolgico y fisicoqumico en pozol slido y licuado, elaborado en Villahermosa


Tabasco, Mxico 686

173. Caracterizacin fenotpica y determinacin de perfiles antimicrobianos de cepas de Salmonella


aisladas en alimentos en Culiacn, Sinaloa. 690

174. Presencia de Salmonella y Escherichia coli en muestras ambientales y de alimentos y efecto


antimicrobiano de Moringa oleifera en cepas aisladas y adheridas a la superficie de brcoli y
pepino. 694

175. Evaluacin de mtodos de extraccin de ADN en muestras de agua ultrafiltrada del ro Culiacn
para elaborar libreras metagenmicas 698

176. Implementacin de herramientas para la estandarizacin y ejecucin del Sistema de Anlisis de


Peligros y Puntos Crticos de Control (HACCP) en la produccin de jamoncillo en fbrica de
dulces de confitera tradicional. 702

177. Determinacin de actividad antioxidante y caracterizacin fsico-qumica en el mucilago de la


semilla de cha (Salvia hispanica). 706

178. Caracterizacin de la composicin qumica y de cidos grasos en leche de cabra de cuatro


unidades productoras de Guanajuato. 710
179. Evaluacin de un producto crnico emulsionado y adicionado con cacahuate (Arachis hypogaea)
como sustituto de grasa de cerdo.. 714

180. Efecto citotxico y genotxico de bis-(2-etil-hexil) ftalato aislado de Paraoctopus limaculatus. 718

181. Calidad sanitaria de un alimento elaborado a base de sorgo. 722

182. Validacin parcial de un mtodo de PCR en tiempo real para la deteccin de Salmonella spp. en
alimentos, superficies vivas e inertes 726

183. Actividad antifngica de extractos de cscara de mamey (Pouteria sapota Jacq.) sobre el hongo
Lasiodiplodia theobromae. 730

184. Caracterizacin de Gln3 en la levadura Lachancea kluyveri en diferentes fuentes de Nitrgeno 734

185. Exploracin del perfil de inocuidad microbiolgica de queso adobera elaborado artesanalmente 738

186. Valor Nutricional de Productos Alimenticios Elaborados con Variedades de Maz Nativo 742

187. Metabolitos secundarios de la raz y tallos de Heterotheca inuloides Cass 746

188. Influencia de la temperatura en el contenido de polifenoles y actividad antimicrobiana de mieles


de agave.. 750

189. Goma de mascar adicionada con extracto de t verde (Camellia sinensis) y aceite de clavo
(Syzygium aromaticum) 754

190. Determinacin de la actividad antioxidante en microencapsulados de aceite de cacahuate


(Arachis hypogaea) 758

191. Inhibicin de patgenos transmitidos por alimentos por distintas cepas de Lactobacillus plantarum
aisladas del proceso de fermentacin de aguamiel.. 762

192. Prevalencia de Listeria monocytogenes y Salmonella en alimentos de mercados de Guadalajara,


Jalisco.. 766

193. Aislamiento de cepas bacterianas con caractersticas de probioticos en muestras de forraje de


sorgo 770

194. Determinacin de la actividad inhibitoria de la -amilasa, -glucosidasa y la enzima convertidora


de angiotensina (ECA) en Zapote blanco (Casimiroa edulis) y Flor de palma (Yucca filifera C.) 774

195. Influencia del nivel de pH y concentracin de NaCl en el comportamiento de Salmonella spp. y


Listeria monocytogenes en queso ranchero. 778

196. Comparacion del comportamiento de cepas resistentes y no resistentes a rifampicina de


Salmonella spp. y Listeria monocytogenes 782

197. Anlisis microbiolgico de Listeria en carne proveniente de un rastro Tipo Inspeccin Federal y
de uno Municipal en Tepatitln de Morelos, Jalisco. 786

198. Anlisis microbiolgico de Escherichia coli en carne de cerdo proveniente de un rastro Tipo
Inspeccin Federal y de uno Municipal en Tepatitln de Morelos, Jalisco..... 790

199. Diversidad de las poblaciones microbianas dominantes de queso fresco de diferentes regiones
de tierra caliente Michoacn. 794

200. Desinfeccin de piloncillo utilizando luz UV 798

201. Investigacin sobre el probable origen de bacterias termoflicas en un alimento enlatado de baja
acidez 802
202. Composicin qumica y actividad antimicrobiana del aceite esencial de pino en bacterias de
productos hortofrutcolas.. 806

203. Evaluacin de cuatro tcnicas para el cultivo in vitro y monitoreo del proceso evolutivo del huevo
de Ascaris lumbricoides hasta su eclosin en la fase larvaria, enriqueciendo con medio Pavlova
modificado 810

204. Listeria monocytogenes patgeno presente en quesos frescos provenientes de diferentes


mercados de la ciudad de Puebla 814

205. Determinacin de aflatoxinas totales y AFB1 en mazapn a base de semillas oleaginosas de


diversas marcas comerciales 818

206. Prevalencia de reacciones adversas alimentarias en estudiantes de medicina veterinaria del


Centro Universitario de Ciencias Biolgicas y Agropecuarias, Guadalajara, Mxico.. 822

207. Evaluacin de la resistencia antimicrobiana y tolerancia salina de cepas de Salmonella spp


aisladas de diferentes fuentes de contaminacin de comedores escolares en Mxico.. 826

208. Diseo de un curso-taller de acuerdo al Estndar EC0217 enfocado a la ganadera de traspatio


en el estado de Veracruz.. 830

209. Verificacin microbiolgica en manipuladores y comensales de las cafeteras de una universidad


peruana bajo los estndares de la R.M. N 461-2007/MINSA 834

210. Evolucin de los principales grupos microbiolgicos que afectan la calidad del queso de aro
(ranchero) durante su conservacin 838

211. Caracterizacin microbiolgica del queso de Aro de la Huasteca Hidalguense 842

212. Effect of lactic acid bacteria on obesity and the intestinal tract. 846

213. Evaluacin de la calidad sanitaria por presencia de metales traza en alimentos comerciales
provenientes de pueblos afectados por el derrame minero del ro Sonora 850

214. Evaluacin de un sistema de visin por computadora (svc) para controlar la calidad de pulpa de
aguacate v. Hass (Persea americana Mill). 854

215. Aislamiento e identificacin de Bacterias Acido Lcticas de un queso crema adicionado con
Yucca sp 858

216. Evaluacin microbiolgica y mejoramiento sanitario del proceso de extraccin de la leche de un


queso crema adicionado con Yucca sp. 862

217. Caracterizacin fsico qumica de la leche de cabra de raza alpina que se produce en el municipio
de Venustiano Carranza, Michoacn.. 866

218. Determinacin de E. coli productoras de Toxinas Shiga en alimentos utilizando mtodos


microbiolgicos y PCR en Tiempo Real. 870

219. Obtencin de biopelculas con base a Zena va Electrospraying. 874

220. Determinacin y cuantificacin de mesfilos aerobios en los alimentos elaborados en un comedor


estudiantil. 878

221. Evaluacin de la inhibicin de nanopartculas de xido de cerio y nisina contra microorganismos


patgenos alimentarios: Salmonella Enteritidis y Escherichia coli O157:H7. 882

222. Bacterias patgenas y factores condicionantes en ensaladas frescas que se consumen en


restaurantes del Distrito Los Olivos Lima, Per 886
223. Deteccin y Cuantificacin de maz transgnico en alimentos mediante RT-PCR con promotor
35S 890

224. Efecto bactericida de la Solucin Electrolizada de Superoxidacin con pH neutro en carne de


cerdo contaminada con Listeria monocytogenes y su posible uso como conservador 894

225. Efecto antimicrobiano de aceites esenciales de naranja (Citrus sinensis), romero (Rosmarinus
Officinalis L.) y zacate limn (Cymbopogon Citratus) en bacterias Gram + y Gram 898

226. Caractersticas de ejotes y contenido de protena en semillas de variedades de haba


(Vicia faba L).............................. 902

227. Produccin de Cholupa (Passiflora maliformis) enriquecida con probitico Lactobacillus


acidophillus 906

228. Seguimiento de la calidad microbiolgica de alimentos y manipuladores de ventas en la va


pblica del municipio de Rionegro-Antioquia, para la prevencin de riesgos asociados a las
enfermedades transmitidas por alimentos (ETAs). 910

229. Evaluacin de un producto funcional elaborado con cutcula de cacahuate sobre el perfil lipdico
en ratones macho ICR 914

230. Calidad microbiolgica del pollo en salsa agridulce tipo cantons en restaurantes de la Cd de
Mxico 918

231. Determinacin de la efectividad del aceite esencial de albahaca (Ocimum basilicum L.) como
agente antibacteriano para Escherichia coli y Staphylococcus aureus en filetes de lomo de res 922

232. Elaboracin y evaluacin de un extracto de Tropaeolum majus como antimicrobiano en carne de


cerdo y desinfectante de superficies.. 926

233. Elaboracin de bioempaques a partir de almidones nativos y aceites esenciales de la


regin Cundinamarca, Colombia determinando y prolongando el tiempo de vida til de frutas del
gnero Fragaria 930

234. Calidad microbiolgica en alimentos cocinados que se expenden en el Centro Universitario de


Ciencias Exactas e Ingenieras 934

235. Evaluacin preliminar del uso de subproductos de la industria cervecera en la elaboracin de


alimento para mascotas 938

236. Anlisis prospectivo de hongos levaduriformes en cervezas artesanales y su vinculacin con la


normatividad alimentaria 942
Investigaciones en Ciencia e Inocuidad de Alimentos

Prefacio

La insalubridad de los alimentos ha representado un problema de salud para el ser


humano desde los albores de la historia, y muchos de los problemas actuales en
esta materia no son nuevos. Aunque los gobiernos de todo el mundo se estn
esforzando al mximo por aumentar la salubridad del suministro de alimentos, la
existencia de enfermedades de transmisin alimentaria sigue siendo un problema
de salud significativo tanto en los pases desarrollados como en los pases en
desarrollo.

La inocuidad de los alimentos cubre una gama muy diversa de peligros qumicos,
fsicos y biolgicos que participan de manera determinante en la calidad e
inocuidad de un alimento. El impacto de los riesgos transmitidos por alimentos se
puede medir desde dos puntos de vista: el impacto comercial y el impacto que
para la salud pblica representa su consumo.

Todos los pases necesitan contar con programas de control de alimentos para
garantizar que los suministros nacionales sean inocuos, de buena calidad y estn
disponibles en cantidades adecuadas y precios asequibles, para asegurar que
todos los grupos de la poblacin puedan gozar de un estado de salud y nutricin
aceptable. El control de alimentos incluye todas las actividades que se lleven a
cabo para asegurar la calidad, la inocuidad y la presentacin honesta del alimento
en todas las etapas, desde la produccin primaria, pasando por la elaboracin y
almacenamiento, hasta la comercializacin y el consumo. El control de alimentos
incluye todas las iniciativas nacionales que se emprenden de conformidad con un
procedimiento integrado, en el que participan el gobierno y sectores de la industria
alimentaria. El control de alimentos est vinculado con la mejora de la salud de la
poblacin, el potencial de desarrollo econmico del pas y la disminucin del
deterioro y de las prdidas de alimentos.

Desde el punto de vista comercial se consideran grandes prdidas econmicas y


desperdicio de alimentos por causa de deterioro; en lo que respecta a la salud, la
perdida por productividad por enfermedad y gastos mdicos por enfermedades
transmitidas por alimentos.

Esta publicacin tiene como propsito hacer disponible informacin integral sobre
biotecnologa, calidad, inocuidad y aspectos de nutricin.

La participacin de los diferentes investigadores y sus hallazgos cientficos


aportan conocimiento nuevo de gran utilidad para la implementacin de medidas
de prevencin y control a favor de la salud pblica.

1
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto del secado de leche humana sobre la calidad microbiolgica y


nutrimental
Aguilar-Uscanga B.R., Cavazos Garduo A., Rodrguez-Arreola Ariana., Amzcua-Lpez J.A.,
Serrano Nio J.C., Gutirrez-Padilla J.A., Sols Pacheco J.R.

Centro Universitario de Ciencias Exactas e Ingenieras de la Universidad de Guadalajara,. Blvd.


Marcelino Garca Barragn 1421, C.P 44430. Col. Olmpica, Guadalajara, Jalisco. Tel: 3313785900
ext. 27648. Email: aublanca@gmail.com

Palabras clave: Leche humana, secado por aspersin, conservacin.

Introduccin.
La leche materna, es un alimento valioso para el recin nacido, ya que aporta mltiples
beneficios sobre la salud de lactantes, incluso a largo plazo. Por su condicin nutrimental
y en situaciones en que no se dispone de leche de la propia madre para alimentar a
bebes prematuros o con problemas de lactancia y con la finalidad de proporcionar leche
humana donada a estos nios, existen bancos de leche humana (BLH) ampliamente
distribuidos en todo el mundo y con presencia creciente en nuestro pas1.

La Organizacin Mundial de la Salud y la UNICEF, en su estrategia global para la


alimentacin del lactante y el nio, apoyan conjuntamente la existencia de bancos de
leche humana (BLH) para promocionar y apoyar la lactancia materna. Los BLH son un
servicio especializado orientado a la promocin y al apoyo a la lactancia materna, el cual
recolecta y almacena la leche de madres donantes o de aquellas que tienen hijos
hospitalizados, siendo responsable de proporcionar esta leche a los nios que precisen de
este alimento, garantizando su seguridad y calidad. Los BLH se encargan de la seleccin
de las donantes, la donadora, adems de presentar exceso de leche, debe estar sana y
no usar medicamentos que impidan la donacin. Los BLH son responsables del
almacenamiento, el procesamiento, el anlisis y la distribucin de la leche, la cual puede
requerir una costosa tecnologa para la pasteurizacin y anlisis microbiolgico de la
leche1,2.

Los BLH para conservar la leche practican la pasteurizacin lenta o Holder, capaz de
inactivar el 100% de los microorganismos patognicos y 99,9% de la microbiota saprofita,
sin embargo, existe una alteracin qumica producida sobre la lactosa, que origina la
produccin de cido lctico y consecuente reduccin en el valor calrico del producto, as
como en la biodisponibilidad de calcio y fsforo3. Adems, conlleva a una alteracin en el
proceso de pasteurizacin por calor4 y la posterior refrigeracin5 destruyendo parcialmente
las propiedades nutricionales y biolgicas de la leche, por ejemplo, inactivacin de
componentes activos, como las inmunoglobulinas, enzimas, hormonas, factores de
crecimiento, citocinas y vitaminas termolbiles4, siendo este un punto muy importante para
la conservacin de la calidad de la Leche humana (LH).

Se ha demostrado que almacenamientos prolongados en refrigeracin de la leche


humana, a partir de 72 horas o ms, existe una prdida de la capacidad bactericida y
nutrimentos como la vitamina C (Silvestre et al., 2008). La degradacin es ms
significativa con almacenamientos a largo plazo y con ciclos de congelacin-
descongelacin consecutivos6.

Por lo tanto, un mtodo alternativo de conservacin para la leche humana y


almacenamiento, es la deshidratacin o secado, ya que al disminuir la actividad de

2
Investigaciones en Ciencia e Inocuidad de Alimentos

agua, el alimento seco se puede almacenar y conservar a temperatura ambiente durante


largos perodos de tiempo, sin alterar significativamente las propiedades nutrimentales. En
la actualidad el secado por atomizacin es un mtodo de conservacin muy utilizado para
diversos productos alimenticios, entre los que se encuentra la leche de vaca en polvo.
Este mtodo ha sido tambin usado como una tcnica estratgica para encapsular
alimentos conservando sus propiedades nutricionales. La maximizacin de la calidad de
los productos deshidratados requiere la seleccin de una tecnologa de secado adecuada
y las condiciones operativas adaptadas a cada producto para evitar efectos de deterioro
en la calidad7.

De acuerdo a la importancia nutricional y biolgica de la leche materna que debe ser


garantizada despus de un proceso de conservacin, nuestro trabajo tiene por objetivo
analizar la calidad microbiolgica y nutrimental de leche humana en polvo, evaluando el
impacto que pueda tener el secado por aspersin en su calidad sanitaria.

Metodologa
Materia prima.
La leche humana utilizada para este estudio fue donada por madres sanas del rea de
Neonatologa del Hospital Civil de Guadalajara. Las muestras fueron recolectadas en
bolsas estriles y congelas para su posterior estudio.

Secado por aspersin.


Antes del proceso de secado la leche fue homogenizada con un homogeneizador vertical
(Silverson) y posteriormente pasteurizada a 65C por 30 min. Despus es secada con un
secador por aspersin (LabPlant SD-Basic), el cual se encuentra ubicado en la Planta
Piloto de Ingeniera de Alimentos del CUCEI. Las condiciones de secado utilizadas
fueron: flujo de 2mL/min, presin 2.5 Bar, temperatura de secado de 150C y temperatura
de salida de 50C. Las muestras secadas fueron recolectadas y empaquetadas en bolsas
de plstico y selladas, para almacenarse en refrigeracin y a temperatura ambiente, para
anlisis y uso posterior.

Anlisis microbiolgicos.
Para analizar el contenido de microorganismos presentes en las muestras de leche
humana antes y despus del proceso de secado, se utiliz el mtodo de vaciado en placa,
midiendo el nmero de clulas viables en UFC/mL. Para determinar la presencia de
bacterias mesfilas aerobias (BMA), Mohos y levaduras (M/L) se realiz de acuerdo a las
normas NOM-092-SSA1-1994 y NOM-111-SSA1-1994. Las muestras se prepararon para
su procesamiento microbiolgico tal y como lo indica la NOM-110-SSA1-1994.

Anlisis nutrimental.
El anlisis de protenas de la leche humana antes y despus del proceso de secado se
llev a cabo por el mtodo de Lowry (1951). La cuantificacin de azcares totales se
realiz por el mtodo de Dubois et al., (1956), utilizando lactosa como estndar para la
curva de calibracin. El contenido de humedad se realiz de una muestra de 0.5 g la cual
se meti a una estufa de secado a temperatura de 70C hasta obtener un peso constante.
Las muestras fueron pesadas antes y despus del tratamiento de secado, la diferencia de
peso se calcul y la humedad se determin como porcentaje del peso del polvo. El
contenido de lpidos se determin mediante un mtodo por HPLC, usando una columna
C18 Microsorv-MV (Agilent), fase mvil A (agua: acetonitrilo 75:25 v / v) y fase B (100%
acetonitrilo) con un sistema de gradiente, caudal 1 mL / min y deteccin UV a 205 nm.

3
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin.
La tabla 1 muestra los resultados obtenidos de los anlisis nutrimentales de la leche
materna lquida de mujeres mexicanas antes del proceso de secado. De acuerdo a
Ballard (2013) y Christen et al., (2013), el contenido de protena en muestras de leche
humana de mujeres Australianas es de 0.9 a 1.2 g/100 mL, mientras que Wojcik et al.
(2009) presentan contenidos de 0.7 a 2.10 g/100 mL en mujeres de USA. Por lo tanto
nuestros valores se encuentran entre la media estndar a comparacin del resultados de
estos autores.

Tabla 1. Composicin nutrimental de leche humana lquida.

Leche humana Leche humana en


Componente
lquida (g/100 mL) polvo (g/100 mL)
Humedad (%) 86.03 1.7
Protenas 1.65 1.53
Grasa total 2.46 2.13
Lactosa 7.36 6.25
Cenizas (%) 0.26 9.4
Aw 0.21
pH 6.9 6.8

Respecto a la calidad microbiolgica de la leche humana en polvo observamos que el


proceso de secado disminuye la flora inicial microbiana hasta en un 99.9%, respecto a la
leche sin procesar (Figura 1).

(a) (b)

Figura 1. Conteo de microorganismos en agar cuenta estndar. (a) Leche lquida y (b)
Leche secada por aspersin.

La tabla 2 muestra el conteo de colonias de la leche humana en polvo, respecto al tiempo


de almacenamiento a temperatura ambiente. Constatamos que no existe un crecimiento
significativo de microorganismos (cuenta total) durante 2.5 meses, debido a la baja Aw de
0.21. Siendo este resultado interesante para la conservacin de la leche humana ya que
los valores encontrados en las muestras en polvo mantuvieron los valores de conteo de
colonias muy bajos, respecto a la norma de las Bancos de Leche Humana, que permite
hasta < 1 x104 UFC/mL en leche lquida.

4
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2. Estabilidad microbiolgica de la leche humana en polvo a temperatura ambiente

Semana Colonias (UFC/mL)

Tiempo 0 1
Semana 1 1
Semana 2 1
Semana 3 1
Semana 4 2
Semana 5 2
Semana 6 2
Semana 7 3
Semana 8 2
Semana 9 3
Semana 10 3

Conclusiones.
El proceso de secado por aspersin es una excelente alternativa para la conservacin de
la leche humana, el cual garantiza la inocuidad del producto en polvo durante 2.5 meses
en almacenamiento a temperatura ambiente, sin alterar significativamente el contenido
nutrimental.

Bibliografa.

1. Gormaz M., Roqus V., Dalmau J., Vento M., Torres E., Vitoria I. 2011. Actividad
de un banco de leche humana implantado en una unidad neonatal. Acta Pediatr
Esp. 69(6): 283-287.
2. Bejarano Roncancio Jhon Jairo. 2013. El banco de leche humana y el lactario
hospitalario. Revista Gastrohnup. 15(1) 2: S30-S40.
3. Dauncey M.J, Shaw J.C, and Urman J. 1977. The Absorption and Retention of
Magnesium, Zinc, and Copper by Low Birth Weight Infants Fed Pasteurized Human
Breast Milk. Pediat. Res. 11: 991-997.
4. Andersson Y, Savman K, lackberg L.B, Hernel O. 2007. Pasteurization of mothers
own milk reduces fat absorption and growth in preterm infants. ActaPdiatrica.
6:1445-1449.
5. Slutzah M, Codipilly C.N, Potak D, Clark R.M and Schanler R.J. 2010. Refrigerator
Storage of Expressed Human Milk in the Neonatal Intensive Care Unit. J Pediatr.
156:26-28.
6. Rasmussen KM, Geraghty S.R 2011. The quiet revolution: breastfeeding
transformedwith the use of breast pumps. Am J Public Health. 101(8):1356-9.
7. Ratti, C., and Kudra, T. 2006. Drying of Foamed Biological Materials: Opportunities
and Challenges. Drying Technology. 24(9):1101-1108.

5
Investigaciones en Ciencia e Inocuidad de Alimentos

Aislamiento y seleccin de cepas de Streptomyces con potencial para


produccin de antibiticos
Sols-Pacheco J.R., Ramrez-Robles J.D., Alatorre-lvarez M.N., Cavazos Garduo A., Serrano
Nio J.C., Aguilar-Uscanga B.R.

Centro Universitario de Ciencias Exactas e Ingenieras de la Universidad de Guadalajara,. Blvd.


Marcelino Garca Barragn 1421, C.P 44430. Col. Olmpica, Guadalajara, Jalisco. Tel: 3313785900
ext. 27648. Email: aublanca@gmail.com

Palabras clave: Streptomycetes, antibiticos, aislamiento.

Introduccin.
La biotecnologa abri por completo nuevas perspectivas para el uso de microorganismos
como generadores de productos farmacuticos. En contraste a los metabolitos
secundarios producidos por las plantas, cuyo uso contra enfermedades tiene sus races
en la medicina tradicional, los compuestos de importancia farmacutica obtenidos a partir
de microorganismos como fuente de compuestos bioactivos, son el resultado de intensas
investigaciones llevadas a cabo por un gran nmero de laboratorios en todo el mundo. La
identificacin y caracterizacin biolgica y molecular de microorganismos tiles como
agentes de biocontrol, productores de compuestos bioactivos o sustitutos de antibiticos,
ha sido de gran inters para la medicina y la industria moderna 1.

Streptomyces es un gnero de bacterias Gram-positivas que crece en diversos


ambientes, y su forma se asemeja a los hongos filamentosos. La propiedad ms
interesante de Streptomyces es la capacidad de producir metabolitos secundarios, tales
como antifngicos, antivirales, antitumorales, antihipertensivos, inmunosupresores y
especialmente antibiticos. La produccin de la mayora de los antibiticos es especfica
de la especie, y estos metabolitos secundarios son importantes para las especies de
Streptomyces con el fin de competir con otros microorganismos que entran en contacto,
incluso dentro del mismo gnero 2,3. A pesar del xito del descubrimiento de antibiticos y
de los avances en las tcnicas de produccin, las enfermedades infecciosas siguen
siendo la segunda causa de muerte en todo el mundo y las infecciones bacterianas
causan aproximadamente 17 millones de muertes anuales, afectando principalmente a
nios y ancianos. La automedicacin y el uso excesivo de antibiticos es otro factor
importante a la resistencia, reduciendo la vida til del antibitico, provocando as la
necesidad constante de investigacin y desarrollo de nuevos antibiticos 4,5.

Es importante remarcar que la microbiologa industrial, enfocada a la farmacia, posiciona


a los microorganismos, como de mayor importancia en el Sector Salud y en el mbito
Cientfico Internacional. Por ello, este trabajo tuvo por objetivo realizar el aislamiento e
identificacin de cepas de Streptomyces presentes en muestra de tierra, lo que nos
permiti analizar su crecimiento y produccin de metabolitos con actividad antimicrobiana.

Metodologa.
Aislamiento y caracterizacin de cepas de Streptomyces.
Se tom 1g muestra de tierra de diferentes jardines, los cuales se suspendieron en 9 mL
de agua peptonada estril (0.1% de peptona y 0.85% de NaCl), hasta obtener las
diluciones 10-3, 10-4 y 10-5. Luego se sembraron por vaciado en placa 1 mL de cada
muestra en agar ISSA (agar almidn con sal inorgnica marca DIFCO). Las cajas se
incubaron a temperatura ambiente por 48 horas. Posteriormente, se observaron al

6
Investigaciones en Ciencia e Inocuidad de Alimentos

microscopio las diferentes colonias, seleccionando aquellas que tuvieron caractersticas


morfolgicas a los Streptomycetes. Se realiz la tincin al Gram y pruebas bioqumicas
(oxidasa y catalasa). Las cepas seleccionadas fueron resembradas en caja Petri con agar
ISSA hasta lograr el aislamiento y obtener la una cepa pura.

Seleccin de las cepas de Streptomyces y cultivo en caldo sinttico de las cepas


productoras de antibiticos.
Una vez identificadas las cepas y teniendo cultivos puros, se llev a cabo los cultivos en
medio lquido sinttico, el cual se formul de acuerdo a Evangelista Martnez y Moreno-
Enrquez (2007). Los cultivos fueron incubados a temperatura ambiente durante 24, 48 y
76 horas, tomando muestras en cada tiempo y centrifugando a 5000 rpm/10mn, para
separar el sobrenadante o extracto crudo.

Anlisis de la actividad antimicrobiana de los extractos crudos de la fermentacin


con las cepas de Streptomyces, contra bacterias patgenas.
Los extractos crudos obtenidos de los cultivos con las diferentes cepas de Streptomyces,
fueron filtrados con filtros milipore de 20 micras y se analiz su actividad antimicrobiana,
contra Listeria y S. aureus, cultivados en agar Muelle Hilton, mediante la aparicin de
halos de inhibicin.

Resultados y discusin.
La figura 1 muestra los resultados del aislamiento de las colonias contenidas en las
muestras de tierra. Para este estudio se tom a las diluciones 10-3 y 10-4, para aislar las
cepas de Streptomyces facilitando el aislamiento, as como logrando el crecimiento de
colonias con caractersticas morfolgicamente aceptables.

a) b)

Figura 1. Aislamiento de Streptomyces en muestra de tierra, a) dilucin 10-3 y b) dilucin


10-4.

Los resultados de las pruebas bioqumicas para caracterizar las cepas fueron catalasa
positiva y oxidasa negativa.

Las tinciones al Gram (figura 2), mostraron bacilos Gram positivos formando micelios,
caractersticos del gnero Streptomyces.

7
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 2. Tincin al Gram de una cepa aislada de tierra de Streptomyces.

Las pruebas de inhibicin se muestran en las figuras 3, fueron llevadas a cabo con los
extractos crudos de las cepas identificadas contra Listeria y S. aureus sp. La cepa
identificada como L1, L2, y L5 mostraron halos de inhibicin de 0.4, 0.3 y 0.3 mm de
dimetro respectivamente contra Listeria. Sin embargo, no se observ ninguna inhibicin
contra S. aureus sp.

Figura 3. Prueba de inhibicin de las cepas L1 y L2 contra Listeria monocytogenes sp.

Conclusiones.
Logramos aislar a partir de muestra de tierra 3 cepas con caractersticas morfolgicas
parecidas a Streptomyces. Estas cepas presentaron halos de inhibicin contra Listeria,
pero no contra S. aureus sp. Consideramos que para que el extracto crudo, producido por
fermentacin de estas bacterias, sea eficaz contra otros patgenos, deber ser y
concentrado por liofilizacin y purificado por ultrafiltracin. Con los resultados obtenidos
constatamos que la produccin de un metabolito secundario se hace presente durante la
fermentacin despus de 24 horas de cultivo y este es el responsable de la actividad
antimicrobiana mostrada contra Listeria monocytogenes sp.

8
Investigaciones en Ciencia e Inocuidad de Alimentos

Bibliografa.

1. Evangelista-Martnez Z. y Moreno-Enrquez A. 2007. Metabolitos secundarios de


importancia farmacutica producidos por actinomicetos. BioTecnologa.11 (3):37-
50.

2. Dvila Medina M.D., Morales G.G., Hernndez Castillo F.D., Ochoa Fuente Y.M.,
Olivas Flores A. 2013. Antagonistic actinomycetes against phytopathogenic fungi
of agricultural importance. Revista Mexicana de Ciencias Agrcolas. 4(8): 1187-
1196.

3. De Lima Procpio R.E., Da Silva I.R., Martins M.K., De Azevedo J.L., De Arajo
J.M. 2012. Antibiotics produced by Streptomyces. Braz j infect dis.16 (5):466-471.

4. Prez-Corral D.A., Garca-Gonzlez N.Y., Gallegos-Morales G., Ruiz-Cisneros


M.F., Berlanga-Reyes D.I., Ros-Velasco C. 2015. Isolation of actinomycetes
associated to apple tres rhizosphere antagonistic to Fusarium equiseti. Revista
Mexicana de Ciencias Agrcolas. 6(7): 1629-1638.

5. Amin Hasani1, Ashraf Kariminik, Khosrow Issazadeh 2014. Streptomycetes:


Characteristics and Their Antimicrobial Activities. International Journal of Advanced
Biological and Biomedical Research. 2(1): 63-75.

9
Investigaciones en Ciencia e Inocuidad de Alimentos

Actividad antimicrobiana de nanopartculas de plata sintetizadas con


extractos de plantas y microondas
Cavazos-Garduo A.*, Serrano-Nio J. C., Aguilar Uscanga B. R., Sols Pacheco J. R., Zamudio
Ojeda A. y Hernndez Jimnez M. A.
Centro Universitario de Ciencias Exactas e Ingenieras, Universidad de Guadalajara; Boulevard
Marcelino Garca Barragn 1421, 44420. Guadalajara, Jalisco. Mxico. Phone/Fax. +52 (33)
13785900-27525
*adrianacavgar@gmail.com
Palabras clave: nanopartculas de plata, extractos vegetales, actividad antimicrobiana.

Introduccin

La nanotecnologa permite disear materiales con propiedades exclusivas, se han


desarrollado protocolos rpidos y confiables para la sntesis de estos nanomateriales,
esto ha impulsado la investigacin hacia una multitud de usos potenciales para los
nanomateriales (3). Las nanopartculas metlicas son estructuras de tamao alrededor de
1-100 nm, con propiedades pticas, trmicas, qumicas y fsicas especficas diferentes a
cuando tienen una escala macromtrica. La naturaleza y propiedades nicas de las
nanopartculas metlicas permiten una amplia gama de aplicaciones tales como
acarreadores de compuestos teraputicos, agentes antimicrobianos, agentes
fluorescentes (marcadores biolgicos), sistemas de administracin de frmacos, terapia
gnica, deteccin de organismos causantes de enfermedades, destruccin de tumores,
estudios farmacocinticos, entre otros (1 - 4).

Las tcnicas desarrolladas para sintetizar nanopartculas metlicas incluyen la va qumica


mediante la reduccin con compuestos qumicos como etanol, etilenglicol; la va fsica
donde se realizan reducciones fotoqumicas, sntesis electroqumica e irradiaciones
ultrasnicas y ultravioleta; sin embargo una tcnica que ha mostrado ser relevante es la
sntesis verde donde se han empleado microorganismos y extractos de plantas como una
alternativa simple y viable aunque con mayor requerimiento de tiempo; por lo que la
combinacin de medios fsicos y biolgicos permiten el ahorro en tiempo y sntesis de
nuevas nanoestructuras (3). Los agentes reductores que se han reportado intervienen en
la sntesis verde de nanopartculas de metales, son grupos funcionales como alcoholes,
aldehdos, aminos, carboxilos, cetonas, hidroxilos, sulfidrilos por lo que cualquier
compuesto biolgico que aporte dichos grupos podra ser utilizable para transformar iones
de metales en nanopartculas metlicas; adems estos reductores pueden modificar las
caractersticas fsicas (cargas y rea superficial) y morfolgicas de las nanopartculas
formadas para su aplicacin en el rea de inocuidad (antimicrobianos), farmacutica
(marcadores biolgicos) y mdicas (agentes anticncer) (5).

Dentro de las nanopartculas metlicas en desarrollo se encuentran de hierro, plata y


cobre y oro. Compuestos y iones de plata han sido empleados para propsitos de higiene;
sin embargo los nanomateriales de plata debido a su escala mejoran sus propiedades
fsico-qumicas y propiedades biolgicas. Una amplia gama de aplicaciones ha surgido en
productos de consumo que van desde la desinfeccin de dispositivos mdicos,
electrodomsticos, el tratamiento del agua y recientemente se estn empleando para
usarlos como agentes contra el cncer en diferentes lneas celulares (2, 6). Las tcnicas
de sntesis de las nanopartculas metlicas no solo se estn enfocando a lograr la escala
nanomtrica sino tambin al desarrollo de nuevas estructuras y geometras que permiten
obtener propiedades mejoradas tales como tubos, hilos, cajas, valos, entre otras (1). Por
lo que el objetivo del presente trabajo fue sintetizar nanopartculas de plata combinando la

10
Investigaciones en Ciencia e Inocuidad de Alimentos

sntesis fsica y verde mediante el uso de diferentes extractos vegetales y microondas,


caracterizar las estructuras formadas y evaluar su capacidad antimicrobiana.

Metodologa

Como materiales se emplearon hojas y partes de las plantas de Ficus benjamina,


Euphorbia mili (rosa del desierto), Geranium pelargonium (Geranio), Romero, Canela y
Clavo, obtenidas del mercado local. Como compuesto precursor de plata se emple el
nitrato de plata (AgNO3). La preparacin de los extractos vegetales se realiz reduciendo
el tamao de partcula del material vegetal con ayuda de un molino de navaja, espues a 2
g del polvo se agregaron 60 ml de agua estril y se procedi a la realizacin de una
infusin a 50 C por 30 minutos, se centrifug la infusin a 5,000 rpm durante 10 minutos
y se filtr con un filtro de jeringa (0.45 m). La sntesis de nanoparticulas de plata se llev
a cabo usando una solucin 2 mM de AgNO3 (4 ml) y 300 l de los diferentes extractos
vegetales, los cuales fueron tratados en un horno de microondas domstico durante 7
segundos. Los tratamientos formados se caracterizaron mediante espectroscopia UV-Vis
(Thermo Scientific, Genesys 10S UV-Vis) en una longitud de onda entre 300 y 750 nm; el
tamao de las nanopartculas se midi utilizando un equipo de difraccin de la luz
(Zetasizer Nano-ZS90, Malvern Instruments Inc.) y la morfologa por microscopa
electrnica de transmisin. Al tratamiento con las mejores caractersticas se le realiz un
diseo factorial completo 3n con el que se analiz el efecto de los factores tales como,
concentracin de plata, cantidad de reductor en el tamao de particula y actividad
antimicrobiana.
El efecto antimicrobiano se evalu utilizando el mtodo de difusin en pozos, donde se
utilizaron como microorganismos modelo las cepas de Staphylococcus aureus y
Escherichia coli. Se emplearon cultivos activos de la cepas y se prepararon a diluciones a
la escala 0.5 de McFarland. Las placas de agar Mueller-Hinton se inocularon con la cepa
bacteriana bajo condiciones aspticas, los pozos se llenaron con 80 l de los tratamientos
y se incubaron a 37 C durante 24 h. Despus del perodo de incubacin, se midi el
dimetro de los halos de inhibicin del crecimiento.

Resultados y discusin

La formacin de nanopartculas de plata se pudo apreciar visualmente por el cambio de


los tratamientos a una coloracin marrn, lo que indica que el AgNO3 se redujo a plata
metlica. El anlisis por espectrofotometra de los diferentes tratamientos se realiz para
encontrar absorcin a la longitud de onda de 420 nm, caracterstica en las nanopartculas
de plata, la cual estuvo presente en todos los tratamientos, sin embargo a pesar de
encontrarse la absorcin caracterstica no garantiza que se tengan tamao menores a 100
nm. El tamao de las partculas de plata fue analizado (Tabla 1) y todos los tratamientos
presentaron tamaos nanomtricos, las nanopartculas formadas con el extracto de clavo
fueron aquellas que presentaban menor tamao de partcula, sin embargo el que se forme
una estructura a escala nanomtrica no significa que pueda presentar actividad
antimicrobiana. Es por esto que se realiz la prueba de actividad antimicrobiana a cada
uno de los tratamientos (tabla 2), el mayor efecto inhibitorio fue observado empleando el
extracto de Geranio y Ficus benjamina, los cuales fueron los tratamientos con mayor
tamao de partcula. Se evalu la estabilidad de los tratamientos durante el
almacenamiento, para lo que a los tratamientos un vez formados se les dio seguimiento
determinando el tiempo el llegar a la agregacin e las partculas, de los tratamientos de
Geranio y Ficus benjamina, el tratamiento de Geranio fue el que mostr mayor estabilidad

11
Investigaciones en Ciencia e Inocuidad de Alimentos

mantenindose sin la agregacin de las partculas por mayor tiempo (4 h), este
tratamiento fue seleccionado para realizar el diseo factorial completo 3n

.
Tabla 1. Tamao de partcula promedio de los tratamientos con los diferentes extractos
empleados

Tratamiento Tamao de partcula (nm)

Geranium pelargonium 77.00 1.08

Ficus benjamina 65.96 6.69

Canela 52.56 2.50

Euphorbia mili 52.52 1.09

Romero 44.75 1.35

Clavo 23.11 0.96

En el diseo factorial las concentraciones de AgNO3 evaluadas fueron 2, 4 y 6 mM y las


cantidades de extracto fueron 20, 160 y 300 L; los resultados del tamao de partcula se
muestran en la figura 1. El tratamiento con el que se logr menor tamao de partcula fue
empleando una concentracin de AgNO3 de 2 mM y 160 L de extracto, posiblemente la
cantidad de extracto empleado fue lo suficiente para lograr reducir al mximo una
concentracin de plata tan baja como 2 mM.

Tabla 2. Actividad antimicrobiana de las nanopartculas de plata

Tratamiento Microorganismo
Zona de inhibicin (mm)
E. coli S. aureus
E. mili 14 2 12 2
F. benjamina 15 2.5 12 2
G. pelargonium 16 2.5 13 2
Canela 14 1 0
Romero 12 1 11 2
Clavo 83 0

Se evalu el efecto antimicrobiano del tratamiento con menor tamao de partcula


alcanzado y se compar con el tratamiento con mayor concentracin de plata (6mM) con
la finalidad de evaluar si es el tamao el que influye sobre el efecto antimicrobiano o la
concetracin de las partculas, obteniendose el mismo halo de inhibicin en ambos
tratamientos cuando se emple la cepa E. coli, por lo que el efecto no se ve afectado por
la concetracin de las nanopartculas, sino por el tamao, menor tamao podra permitir el
paso a travs de la membrana sin embargo es necesario de otros estudios para elucidar

12
Investigaciones en Ciencia e Inocuidad de Alimentos

el mecanismo. Se llevaron a cabo las observaciones de los tratamientos por microscopia y


en todos los casos se obtuvieron estructuras esfricas.

Figura 1. Tamao de partcula obtenido en el diseo factorial

Conclusiones
La formacin, caractersticas y estabilidad de las nanopartculas de plata estuvo
influenciado por el agente reductor empleado. El extracto de geranio permiti obtener
partcula con mayor estabilidad durante el almacenamiento y al realizar el diseo factorial
se pudo encontrar el menor tamao de partcula (39 nm). La actividad antimicrobiana
esta influencia por el tamao partcula obtenido y no por la concentracin.

Bibliografa
1. Tolaymat, T. M., El Badawy, A. M., Genaidy, A., Scheckel, K. G., Luxton, T. P., & Suidan,
M. (2010). An evidence-based environmental perspective of manufactured silver
nanoparticle in syntheses and applications: a systematic review and critical appraisal of
peer-reviewed scientific papers. Science of the Total Environment, 408(5), 999-1006.
2. Farah, M. A., Ali, M. A., Chen, S. M., Li, Y., Al-Hemaid, F. M., Abou-Tarboush, F. M., ..&
Lee, J. (2016). Silver nanoparticles synthesized from Adenium obesum leaf extract induced
DNA damage, apoptosis and autophagy via generation of reactive oxygen species. Colloids
and Surfaces B: Biointerfaces, 141, 158-169.
3. Saifuddin, N., Wong, C. W., & Yasumira, A. A. (2009). Rapid biosynthesis of silver
nanoparticles using culture supernatant of bacteria with microwave irradiation. Journal of
Chemistry, 6(1), 61-70.
4. Mody, V. V., Siwale, R., Singh, A., & Mody, H. R. (2010). Introduction to metallic
nanoparticles. Journal of Pharmacy and Bioallied Sciences, 2(4), 282.
5. Morales-Daz, A. B., Jurez-Maldonado, A., Morelos-Moreno, ., Gonzlez-Morales, S., &
Benavides-Mendoza, A. (2016). Biofabricacin de nanopartculas de metales usando
clulas vegetales o extractos de plantas. Revista Mexicana de Ciencias Agrcolas, 7(5),
1211-1224.
6. Li, Q., Mahendra, S., Lyon, D. Y., Brunet, L., Liga, M. V., Li, D., & Alvarez, P. J. (2008).
Antimicrobial nanomaterials for water disinfection and microbial control: potential
applications and implications. Water research, 42(18), 4591-4602.

13
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto de la combinacin de aceite esencial de Cymbopogon citratus y


aceites de vegetales sobre la inhibicin/crecimiento de Pseudomonas
fluorescens CDBB-1243 en un sistema modelo
2 1 1
Garca-Barrientos, R. Prez-Vargas, J. y Minor-Prez, H.
1
Divisin de Ingeniera Qumica y Bioqumica, Tecnolgico de Estudios Superiores de Ecatepec,
Av. Tecnolgico s/n Esq. Av. Carlos Hank Gnzalez (Av. Central), Col. Valle de Anhuac, C. P.
55210, Ecatepec de Morelos, Estado de Mxico, Mxico, E-mail: hminorperez@yahoo.com.mx
2
Laboratorio de Procesos Biotecnolgicos. Universidad Politcnica de Tlaxcala. Av. Universidad
Politcnica No. 1, San Pedro Xalcaltzinco, Tepeyanco, CP 90180 Tlaxcala, Mxico. E-mail:
raquel.garcia@uptlax.edu.mx

Palabras clave: Pseudomonas fluorescens, aceite esencial de Cymbopogon citratus, actividad


antimicrobiana

Introduccin

La combinacin de diversas sustancias puede contribuir a mejorar el control microbiano


de microorganismos (2) como Pseudomonas fluorescens en los alimentos Una gran
cantidad de alimentos procesados o frescos consumidos por el ser humano tienen como
componente los lpidos. stos tienen diversas funciones tecnolgicas como proporcionar
una textura, aroma y sabor caractersticos. En relacin al aspecto nutricional proporcionan
vitaminas A, D, E y K y cidos grasos indispensables (que el organismo humano no
puede biosintetizarlos) como el cido -linolnico (18:3 n-3) y el cido linleico (18:2 n-6)
(1). Sin embargo, es poca la informacin en relacin al efecto de los aceites de cadena
corta (< 8 tomos de carbono) o media sobre la inhibicin de bacterias como
Pseudomonas fluorescens. Esta bacteria es comn encontrarla en alimentos
almacenados en refrigeracin como las carnes rojas. La bacteria es la responsable de la
produccin de un pigmento que da la coloracin verde de estos productos en estado de
descomposicin. El objetivo de este trabajo fue evaluar el efecto de los aceites de soya,
maz y olivo, as como su combinacin con aceite esencial de Cymbopogon citratus sobre
la inhibicin o crecimiento de Pseudomonas fluorescens en un sistema modelo.

Metodologa

*Preparacin del aceite esencial de Cymbopogon citratus. El aceite esencial de citral, se


adquiri en la empresa Herbalise and essence oils, S.A. de C.V. ubicada en Av. Miguel
Hidalgo No. 57, Col. Santa Clara, Ecatepec, Estado de Mxico, C.P. 55540. El aceite
esencial se filtr con membranas de acetato de celulosa (0.22 m, Durapore Membrane
Filters Millipore). Posteriormente se prepararon soluciones stock de 106 mg/L, 105 mg/L,
104 mg/L y 103 mg/L en agua destilada estril (adicionada de Tween 80 al 1%). Estas
soluciones se almacenaron en frasco mbar a una temperatura de -20C. Tambin se
determin la densidad de cada solucin.

*Cepa microbiana y condiciones de crecimiento. Pseudomonas fluorescens CDBB-1243


pertenece a la Coleccin Nacional de Cepas Microbianas del CINVESTAV
respectivamente. Durante este estudio las cepas se conservaron en crioviales a -80C. Se
sembraron por estra cruzada en agar nutritivo (Caldo Nutritivo, Bioxon, Mxico) y 1.5% de
agar bacteriolgico (w/v Bioxon, Mxico). Las muestras se incubaron a 30C por 24 h.
Una colonia de las bacterias control se utiliz para inocular 5 mL caldo nutritivo (CN). Las

14
Investigaciones en Ciencia e Inocuidad de Alimentos

muestras se incubaron a 30C por 24 h. Se tomaron 100 L de este pre-cultivo para ser
inoculados en 5 mL de CN y nuevamente se realiz una incubacin durante 24 h a 30C
para obtener el cultivo de estudio.

*Anlisis microbiolgico. El cultivo control (1 x108 UFC/mL) se diluy vaciando 100 L de


muestra en 900 L de agua peptonada (0.85% de NaCl + 1% de peptona de carne) hasta
alcanzar una poblacin de 2x105 UFC/mL en los tratamientos evaluados. El estudio del
efecto de los aceites de soya, maz y olivo (0%, 2% y 4%) sobre la bacteria control se
realiz en 1 mL de medio slido (CN) en tubos Eppendorf, adicionados con el surfactante
Tween 80 (1%). Previamente con las soluciones stock del aceite esencial de Cymbopogon
citratus se agregaron diferentes volmenes para obtener 0 mg/L, 250 mg/L, 500 mg/L y
1000 mg/L de aceite esencial de citral. El control consisti de tratamientos con la bacteria
de estudio sin aceite esencial. El estudio se realiz por duplicado. Se empleo la tcnica de
gota (4) para realizar la cuenta en placa de las poblaciones microbianas. Los resultados
se sometieron a un Anlisis de Varianza y una comparacin mltiple de medias con la
prueba de Duncan, utilizando el paquete estadstico SAS System, WindowsTM Versin
6.12, USA.

Resultados y discusin
Pseudomonas fluorescens CDBB-1243 present menor crecimiento en presencia del
aceite de soya a 2% y 4% en comparacin con la muestra control (Figura 1). El aceite de
soya tiene cido linleico (omega-6) en valores de 54% y de cido oleico en 22%.
Tambin tiene un 7.5% de cido linolnico. En general se acepta que los cidos grasos
deben su accin antimicrobiana a su molcula no disociada. En estudios (3,5) con
Clostridium botulinum se observ que los cidos grasos que tuvieron los valores menores
de MICs fueron los poliinsaturados, como el linoleico, linolenico y araquidnico. La MIC
del cido linoleico con dos insaturaciones fue menor en comparacin con el cido
linolnico con tres insaturaciones. Con excepcin de los cidos grasos de cadena corta
(menores de 8 tomos de carbono), los lpidos no tienen efecto antimicrobiano sobre
bacterias Gram negativas. Se observ un efecto del modelo con las variables evaluadas
sobre la fraccin de supervivientes de Pseudomonas fluorescens. El modelo explica el
98.7% de variabilidad en la respuesta de bacterias sobrevivientes. Los factores en forma
independientes y en todas las interacciones tuvieron un efecto significativo sobre la
variable respuesta. La comparacin mltiple de medias con Duncan mostr que la mayor
inhibicin de la bacteria control fue en orden aceite de soya > aceite maz > aceite de
olivo. La mayor inhibicin del aceite de Cymbopogon citratus se present a valores de
1000 mg/L con alrededor del 40% de inhibicin con respecto a una poblacin inicial de 5
ciclos logartmicos.

Conclusin
La combinacin de los aceites de soya, olivo y maz y el aceite esencial de Cymbopogon
citratus puede ser empleado para el control de Pseudomonas flurescens CDBB-1243.

15
Investigaciones en Ciencia e Inocuidad de Alimentos

1.5
2.0 1.5
Fraccin de supervivientes

Fraccin de supervivientes
Fraccin de supervivientes
1.0 1.5
1.0

1.0
0.5 0.5
0.5

0.0 0.0 0.0


0%

2%

4%

0%

2%

4%
0%

2%

4%
Aceite de soya (%) Aceite de olivo (%) Aceite de maz (%)

(a) (b) (c)

Figura 1. Inhibicin/crecimiento de Pseudomonas fluorescens CDBB-1243 en agar nutritivo con: (a) aceite de soya (0%,
2% y 4%), (b) aceite de olivo (0%, 2% y 4%) (a) aceite de maz (0%, 2% y 4%) a la temperatura de 30C

1.5 2.0
0 ppm 0 ppm
Fraccin de supervivientes

1.5
Fraccin de supervivientes

250 ppm 250 ppm 0 ppm

Fraccin de supervivientes
1.5 250 ppm
500 ppm 500 ppm
1.0
1000 ppm 500 ppm
1000 ppm 1.0
1.0 1000 ppm

0.5
0.5 0.5

0.0 0.0 0.0


0%
2%
4%

0%
2%
4%

0%
2%
4%

0%
2%
4%
0%
2%
4%

0%
2%
4%

0%
2%
4%

0%
2%
4%

0%
2%
4%

0%
2%
4%

0%
2%
4%

0%
2%
4%
Aceite de soya (%) Aceite de olivo (%) Aceite de maz (%)

Figura 2. Efecto combinado del aceite de soya (a), aceite de olivo (b) y aceites de maz (c) (0%, 2% y 4%) con aceite
esencial de Cymbopogon citratus (0 mg/L, 250 mg/L, 500 mg/L y 1000 mg/L) sobre Pseudomonas fluorescens CDBB-
1243 a 30C en agar nutritivo.

16
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 1. ANOVA y comparacin mltiple de medias la inhibicin/crecimiento de Psedumonas fluorescens CDBB-1243


con la combinacin de aceite de soya, olivo y maz y el aceite esencial de Cymbopogon citratus en un sistema modelo.

ANOVA Prueba de Duncan

Aceite vegetal Promedio


Fuente de Grados de Suma de Cuadrados Valor de F Pr > F Soya 0.8952 A1
variacin libertad cuadrados medios Maz 0.873 A
Olivo 0.738 B
Concentracin
Modelo 35 5.199 0.148 78.99 0.0001 de aceite vegetal
4% 0.978 A
Error 36 0.067 0.001 2% 0.813 B
0% 0.714 C
Total 72 5.266 Concentracin
de aceite de
R2 0.987 Cymbopogon
citratus
0 mg/L 0.991 A
250 mg/L 0.931 B
500 mg/L 0.844 C
1000 mg/L 0.575 D
1
Letras iguales no son significativamente diferentes con una = 0.05
2
Promedio de la fraccin de sobrevivientes de Pseudomonas fluorescens CDBB-1243 en los tratamientos evaluados

Bibliografa

1. Miles, AA; Misra, SS, Irwin, JO (1938 Nov). "The estimation of the bactericidal power of the blood." The Journal of hygiene, 38 (6): 73249.
2. Coronado-Herrera, M., Vega y Len, S., Gutirrez-Tolentino, R., Garca-Fernndez, B. y Daz-Gnzalez. G. 2006. Los cidos grasos omega-3 y omega-
6: Nutricin, bioqumica y salud. REB. 25(3):72-96
3. Jay, J. 2011. Microbiologa moderna de los alimentos. Capitulo 3. Editorial Acribia, Zaragoza, Espaa
4. Kabara, J.J. y Marshal, D.L. 2005. Medium-Chain Fatty Acids and Esters. En: Antimicrobials in food. Davidson, P.M., Sofos, J.N. y Branen, A.L.
(Editores). Tercera Edicin. Taylor & Francis
5. Tetsumoto, S. 1933. Sterilizing action of acids. III. Sterilizing action of satured monobasic fatty acids. J. Agric. Chem. Soc. Jpn.9:388-395

17
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto combinado del germinado de cha (Salvia hispanica) y el pH sobre la


inhibicin/crecimiento de Salmonella choleraseuis
1 1 1
Compa-Aguilar, L. Neria-Gnzalez, I. y Minor-Prez, H.
1
Divisin de Ingeniera Qumica y Bioqumica, Tecnolgico de Estudios Superiores de Ecatepec, Av.
Tecnolgico s/n Esq. Av. Carlos Hank Gonzlez (Av. Central), Col. Valle de Anhuac, C.P. 55210, Ecatepec
de Morelos, Estado de Mxico, Mxico, E-mail: hminorperez@yahoo.com.mx

Palabras clave: Salmonella choleraseuis, germinado de cha, actividad microbiana

Introduccin

Las semillas de cha provienen de una planta herbcea perteneciente a la familia de la


menta, conocida como Salvia hispanica, que es nativa de Mxico y Guatemala, contiene
calcio, manganeso, magnesio, potasio, fsforo y zinc, vitamina B3 (niacina), vitamina B1
(tiamina) y vitamina B2. Tambin los germinados de cha tienen alto valor nutricional (2).
Las semillas de cha de buena calidad son, naturalmente, de color negro o de color
blanco. Las de color blanco tienen mayor concentracin de protenas que las de color
negro, y stas ltimas tienen ms fibra. La cha tiene una alta capacidad de absorber
agua (10 veces su peso en agua), formando un gel voluminoso que algunos estudios
indican provoca la sensacin de saciedad. Cuando las semillas de cha se combinan con
lquidos (como agua, leche, zumo o yogur) forman un gel debido a la fibra soluble que
contiene. Salmonela choleraseuis es una bacteria que puede contaminar diversos
alimentos. Las bacterias de este grupo perteneces a la familia de Enterobacteriacaea, son
bacilos Gram negativos, anaerobios facultativos, tienen forma bacilar, con flagelos
perifricos y no desarrollan capsula (excepto la especie Salmonella typhi) ni esporas (1,4).
En este estudio se evalu el efecto de germinados de cha y el pH (4, 6 y 8) sobre la
inhibicin/crecimiento de Salmonella choleraseuis ATCC 43890.

Metodologa

*Preparacin de la harina y el germinado de cha.

Se pesaron 50 g de cha (Salvia hispanica) que se sometieron a desinfeccin por


inmersin en una solucin de etanol (95%) durante 30 s. Las muestras se mantuvieron a
temperatura ambiente durante 12 h para eliminar el exceso de etanol. Posteriormente
para realizar la germinacin de la cha se mantuvo en remojo en agua estril a 30C
durante 8-12 h; el exceso de agua se elimin y las muestras se dejaron a una temperatura
de 30C durante 5-7 d y constantemente se humedecieron para permitir el proceso de
germinacin. Una vez obtenidos los germinados, se secaron a una temperatura de
40C/24 h en un horno de charolas (Felisa FE-294AD, Mxico) y se molieron en una
licuadora convencional durante 5 min, hasta obtener una harina. La harina de germinado
de cha se guard en tubos Eppendorf estriles y se almacen a -20C hasta su uso.

*Salmonella choleraseuis y condiciones de crecimiento

Salmonella choleraesuis ATCC 43890 fue proporcionada por el Laboratorio de


Biotecnologa y Fermentaciones del Instituto Tecnolgico de Sonora (ITSON, Mxico).
Durante este estudio la cepa control se conserv en crioviales a -80C. El microorganismo
se creci por siembra por estra en medio TSAYE (Tryptic Soy Broth, Bioxon, Mxico)
adicionado con 0.6% de extracto de levadura (w/v Bioxon, Mxico) y 1.5% de agar
bacteriolgico (w/v Bioxon, Mxico). La muestra se incub a 37C por 24 h. Una colonia
de la bacteria se utiliz para inocular caldo TSBYE (Tryptic Soy Broth, Bioxon, Mxico)

18
Investigaciones en Ciencia e Inocuidad de Alimentos

adicionado con 0.6% de extracto de levadura (w/v Bioxon, Mxico) y se incub a 37C por
12 h. Se tomaron 100 L de este precultivo para ser inoculados en 5 mL de TSBYE. La
muestra se incub durante 24 h 37C para obtener el cultivo de estudio.

*Anlisis microbiolgico

El cultivo de Salmonella choleraseuis se diluy en agua peptonada y un volumen de 100


L se vaci de 800 L contenidos en tubos Eppendorf con la solucin amortiguadora
citrato-fosfato (con pH de 4, 6 o 8). Previamente en cada tubo se pes 0.1 g de las
muestras de harinas y germinado de cha. Los controles fueron tratamientos con agua
estril los cuales tenan las muestras de harinas y germinados de cha. Todos los
tratamientos fueron incubados a 37C durante 1 h. La cuenta microbiana se realiz
utilizando un volumen 100 L de los tratamientos, que se diluy en 900 L de agua
destilada estril. Estos se agitaron en un vortex (Labnet, EUA) a 350 rpm durante 10s. Se
emple la tcnica de gota (3), para cuantificar las poblaciones microbianas. Un volumen
de 20 L de las muestras se vaci en cajas de petri con medio TSA. Se sembraron cuatro
diluciones por cada placa. Las muestras se incubaron durante 24 h a 37C. Se reportan
las UFC/mL. Los resultados se sometieron a una comparacin mltiple de medias con la
prueba de Duncan, utilizando el paquete estadstico SAS System, WindowsTM Versin
6.12, USA.
Resultados y Discusin.

Las Figuras 1a y 1b muestran los resultados sobre el control de la inhibicin/crecimiento


de Salmonella choleraseuis con la combinacin de pH (4,6 y 8) y el germinado o harina de
cha. Se observa una reduccin significativa en las muestras de germinado de cha en
combinacin con el pH de 6 y 8. En este ltimo tratamiento se obtuvo una reduccin del
95% con respecto al pH 8 del tiempo 1 min.

(a) . (b)

Figura 1. Efecto del pH y el (a) germinado de chia o (b) harina de chia sobre la
inhibicin/crecimiento de Salmonella choleraseuis

Las Tablas 1 y 2 muestran el ANOVA y el efecto de los parmetros evaluados sobre la


variable respuesta. Se obtuvo un efecto significativo del modelo sobre la
inhibicin/crecimiento de Salmonella choleraseuis. El coeficiente de determinacin fue de
0.9734. Hubo un efecto significativo del pH y el tiempo sobre Salmonella choleraseuis.
No se observ un efecto significativo al comparar la harina de cha y el germinado. Sin
embargo en los tratamientos de germinado de cha y pH 6, 8 se observ una reduccin
significativa de la bacteria control. Todas las interacciones evaluadas pH*tiempo,
germinado-harina*pH, germinado-harina*tiempo, pH*tiempo*germinado-harina tuvieron un
efecto significativo sobre las poblaciones de Salmonella choleraseuis (Tabla 2). La
prueba de Duncan mostr una diferencia significativa (P<0.05) al comparar los diferentes

19
Investigaciones en Ciencia e Inocuidad de Alimentos

valores de pH (control, 4, 6 y 8). As mismo, hubo un efecto significativo con respecto al


tiempo de 1 min y 60 min.

150
Harina de chia
Germinado de chia

% Inhibicion
95.3397
100

50 37.5869
24.435

0 0 0 0 0
0

0
ia

4.

6.

8.
ch

pH

pH

pH
+
a
gu
(A
ol
tr
on
C

Figura 2. Inhibicin (%) de Salmonella choleraseuis en harina y germinado de cha

Tabla 1 ANOVA para el efecto de la harina o germinado de alpiste, pH y tiempo sobre la inhibicin
de Salmonella cholaraseuis
Fuente de Grados de Suma de Cuadrado medio Valor de Pr > f
variacin libertad cuadrados F
Modelo 15 16.38335168 0.02790715 39.14 0.0001
Error 16 0.44651435 .09222345
Corrected 31 16.82986603
Total
R-Square= 0.973469
*Los valores de Prob>F menores que 0.050 indican que los parmetros evaluados son significativos

Tabla 2. ANOVA para el efecto de factores: harina o germinado de cha, pH y tiempo sobre
Salmonella choleraseuis.
Fuente de variacin Valor de F Pr > F
A-Germinado/Harina de cha 1.41 0.2521
B-pH 114.82 0.0001
C-Tiempo 3.47 0.0410
A*B 15.46 0.0012
A*C 104.30 0.0001
B*C 28.13 0.0001
A*B*C 8.8 0.0011
*Los valores de Prob>F menores que 0.050 indican que los parmetros evaluados son significativos

20
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 3. Prueba de Duncan para la comparacin de harina o germinado sobre Salmonella


choleraseuis

1
Muestra Promedio Duncan

Cha
Germinado de cha 5.46581 A
Harina de cha 5.39563 A

Tiempo
1 min 5.31463 B
60 min 5.54682 A

pH
4 6.26801 A
Control (agua) 5.57338 B
6 4.94444 C
8 4.93706 C

1
Letras iguales no son significativamente diferentes con una = 0.05

Conclusin

Los germinados de harina de cha en combinacin con el pH de 6 y 8 tuvieron un efecto


significativo en la inhibicin de Salmonella choleraseuis. La harina de cha y el germinado
en forma independiente no tuvieron un efecto significativo sobre la inhibicin de
Salmonella choleraseuis.

Bibliografia

1. ICMSF. 1996. Microorganismos de los alimentos: caractersticas de los patgenos


microbianos. Editorial Acribia, Zaragoza (Espaa), pp 165-174
2. Propiedades de los germinados y ventajas a nivel bioqumico. [En lnea]
http://www.botanical-online.com/germinados.htm [ 24 de enero de 2014]
3. Rodrguez-Garca, M.O., Mrquez-Gnzalez, M. y Hernndez-Mireles, C. 2013.
Salmonella. En: Riesgos asociados al consumo de alimentos. Torres-Vitela, M.R.
(Editor). Universidad de Guadalajara. ISBN 978-607-450-641-9.
4. Miles, AA; Misra, SS, Irwin, JO (1938 Nov). "The estimation of the bactericidal
power of the blood." The Journal of hygiene, 38 (6): 73249.

21
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto de la combinacin de la hoja de aguacate (Persea americana), pH (4,6


y 8) y temperaturas de congelacin/refrigeracin sobre el control de Listeria
monocytogenes NCTC 11994
1 2 1
Bastida-Murrieta, A. L. Marin-Iniesta, F. y Minor-Prez, H.
1
Divisin de ingeniera Qumica y Bioqumica, Tecnolgico de Estudios Superiores de Ecatepec,
Av. Tecnolgico s/n Esq. Av. Carlos Hank Gonzlez (Av. Central), Col. Valle de Anhuac, C. P.
55210, Ecatepec de Morelos, Estado de Mxico, Mxico, E-mail: hminorperez@yahoo.com.mx.
2
Universidad de Murcia, Espaa.

Palabras clave: Hoja de aguacate (Persea ameriana), antioxidante, Listeria monocytogenes

Introduccin
Mxico es el primer productor a nivel mundial de aguacate y las exportaciones a pases
como Estados Unidos se estn incrementando a un ritmo acelerado en los ltimos aos.
Esta condicin provoca que se eleve su produccin y se generen una gran cantidad de
sub-productos que generalmente son desechados empleando solamente para consumo
humano la pulpa del fruto. Los huesos, las hojas y tallo de la planta, as como la cscara
pueden ser una fuente de compuestos bioactivos (1). Especficamente las hojas de
aguacate pueden ser una fuente de compuestos antioxidantes como los fenoles. Algunos
antioxidantes de naturaleza fenlica tiene actividad antimicrobiana sobre bacterias gram
(+) y gram (-). Se reporta (3) actividad bactericida de compuestos fenlicos contra
Escherichia coli y en general sobre microorganismos coliformes psicrtrofos (4). Sin
embargo, an cuando se conoce que las hojas de aguacate tienen propiedades anti-
inflamatorias y anti-fngicas, es poca la informacin sobre la actividad antimicrobiana,
Algunos estudios (2,6) reportan actividad antimicrobiana de extractos de hoja a aguacate
sobre Mycobacterium tuberculosis; as mismo se reporta (6) actividad biolgica de
extractos de hoja de aguacate sobre microorganismos como Escherichia coli, Salmonella
typhi y Pseudomonas aeroginosa. En este estudio se explora la combinacin de pH,
temperatura de congelacin y la hoja de aguacate para el control de Listeria
monocytogenes NCTC 11994.

Metodologa
*Preparacin de la hoja de aguacate. La hoja de aguacate (Persea americana) se sec
durante 48 h a una temperatura de 50C. La muestra se moli en una licuadora
convencional hasta obtener una harina homgenea.

*Listeria monocytogenes NCTC 11994 y condiciones de crecimiento. Listeria


monocytogenes NCTC 11994 pertenece a la coleccin microbiana de la Universidad de
Murcia, Espaa. Durante este estudio la cepa se conserv en crioviales a -80C. sta se
sembr por estra cruzada en medio TSAYE (Tryptic Soy Broth, Bioxon, Mxico)
suplementado con 0.6% de extracto de levadura (w/v Bioxon, Mxico) y 1.5% de agar
bacteriolgico (w/v Bioxon, Mxico). La muestra se incub a 37C por 24 h. Una colonia
de la bacteria control se utiliz para inocular en caldo TSBYE (Tryptic Soy Broth, Bioxon,
Mxico) con 0.6% de extracto de levadura (w/v Bioxon, Mxico) y se incub a 37C por 12
h. Se tomaron 100 L de este pre-cultivo para ser inoculados en 5 mL de TSBYE y la
muestra se incub durante 24 h 37C para obtener el cultivo de estudio.

22
Investigaciones en Ciencia e Inocuidad de Alimentos

*Anlisis microbiolgico. El cultivo de Listeria monocytogenes se diluy en agua


peptonada y se vaci un volumen de 100 L en tubos Eppendorf con 900 L de una
solucin amortiguadora de citrato-fosfato a los diferentes valores de pH. Las
combinaciones y repeticiones se obtuvieron del programa Design-Expert, utilizando un
diseo estadstico de punto central. Los valores de las variables fijas analizadas fueron:
pH 4,6 y 8, concentracin de hoja de aguacate 0 g/mL, 0.05 g/mL y 0.1 g/mL y la
temperatura de -15C, -5C y 5C. Todos los tratamientos se mantuvieron en agitacin a
350 rpm en un vortex (Labnet, EUA) durante 1 min. Las cuentas microbianas se realizaron
a los tiempos de 0 d y 10 d en incubacin a 37C. Se empleo la tcnica de gota (5) para
cuantificar las poblaciones microbianas.
*Anlisis estadstico. Los resultados fueron analizados utilizando el programa estadstico
Design-Expert Versin 6.0.6, 2002, Minneapolis, EUA.

Resultados y discusin
El anlisis estadstico muestra que los resultados experimentales se ajustaron a un
modelo cuadrtico, al tiempo de almacenamiento de 0 d y 10 d respectivamente. Estos
modelos describen la influencia de los factores investigados en forma independiente: pH,
concentracin de hoja de aguacate (C) en g/mL y temperatura (T) C; el efecto de las
interacciones: T*pH, T*C y pH*C y el efecto de los cuadrados: T2, pH2 y C2. La ecuacin
obtenida para el tiempo de 0 d es Y =+4.60431+0.82910*pH+7.96201*Hoja de aguacate -
0.023208*Temperatura-0.057746*pH2-12.39439* Hoja de aguacate 2-3.09860E-004*
Temperatura2-1.06812*pH* Hoja de aguacate+1.64063E-003*pH*Temperatura-0.012125*
Hoja de aguacate*Temperatura. Para el tiempo de 10 d se obtuvo la ecuacin
Y=+9.23204-1.12991*pH-22.37047*Hoja de aguacate +0.049096*Temperatura+0.09713*
pH2+101.20748* Hoja de aguacate 2-2.86981E-003* Temperatura2+0.48375*pH* Hoja de
aguacate-5.85000E-003*pH*Temperatura-0.4170*Hoja de aguacate*Temperatura

Los coeficientes de determinacin para el tiempo de almacenamiento de 0 d y 10 d


indican que el 15.03% y el 20.00% respectivamente de la variacin total en la respuesta
no se puede explicar por los modelos desarrollados. Los valores F-Modelo fueron 4.69 y
1.88 respectivamente, estos valores indican que los modelos cuadrticos para los tiempos
de 0 d y 10 d fueron significativos (p > 0.05). Los valores Fo para los parmetros de cada
modelo fueron tiles para explicar el grado de significancia de los efectos de las variables
y sus interacciones. Para el tiempo de 0 d el parmetro que tuvo un mayor efecto
significativo fue el pH. El segundo parmetros ms significativo y no hubo efecto
significativo de la concentracin de la hoja de aguacate. A los 10 d de almacenamiento la
concentracin de hoja de aguacate tuvo el mayor efecto significativo sobre la variable
respuesta. El segundo parmetro con ms significancia fue la interaccin pH*C. Esto
significa que los cambios en concentracin de hoja de aguacate tienen un efecto
significativo sobre la inactivacin de Listeria monocytogenes NCTC 11994. A los 10 d de
almacenamiento las interacciones entre el pH y la concentracin de hoja de aguacate
tambin tienen un efecto significativo sobre la inactivacin de la bacteria control.
La temperatura de -15C y el pH a los 10 das de almacenamiento provocaron la inhibicin
microbiana mayor. Este comportamiento puede ser explicado posiblemente a que en la
temperatura de -15C las bacteria de Listeria monocytogenes NCTCT 11994 puede sufrir
dao subletal. La bacteria sufre daos que no la inactivan pero la hacen tener cambios
como alteracin en la membrana celular que las hace ms sensibles a los agentes
antimicrobianos.

23
Investigaciones en Ciencia e Inocuidad de Alimentos

7.6361 7.51636
7.70103
7.49513 7.36372
7.56995
7.35417 7.21107
7.43887

Log UFC/mL

Log UFC/mL
7.2132 7.05842
Log UFC/mL

7.3078
7.07223 6.90577
7.17672

0.10 0.10
0.10 8.00 8.00
0.08 0.08
8.00
7.00 7.00
0.08
7.00 0.05 0.05
6.00 6.00
0.05
6.00 Y: Hoja de aguacate (g/mL) 0.03 5.00
Y: Hoja de aguacate (g/mL) 0.03 5.00
Y: Hoja de aguacate (g/mL) 0.03 X : pH X : pH
5.00
X : pH 0.00 4.00 0.00 4.00
0.00 4.00

1a 1b 1c

6.3488 6.32583 5.72891

5.9609 6.00251 5.44684

5.573 5.67919 5.16478


Log UFC/mL

Log UFC/mL

Log UFC/mL
5.18509 5.35587 4.88271

4.79719 5.03255 4.60065

0.10 0.10 0.10


8.00 8.00 8.00
0.08 0.08 0.08
7.00 7.00 7.00
0.05 0.05 0.05
6.00 6.00 6.00
Y: Hoja de aguacate (g/mL) 0.03 5.00
Y: Hoja de aguacate (g/mL) 0.03 5.00
Y: Hoja de aguacate (g/mL) 0.03 5.00
X: pH X: pH X: pH
0.00 4.00 0.00 4.00 0.00 4.00

2a 2b 2c

Figura 1. Grficas de superficie de respuesta para las temperaturas de (1a, 2a) -15C, (1b, 2b) -
5C, (1c, 2c) 5C a un tiempo de almacenamiento de (1) 0 d y (2) 10 d.

24
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones

En las condiciones experimentales evaluadas se encontr un efecto significativo sobre la


inhibicin de Listeria monocytogenes en valores de pH de a la temperatura de -15C en
presencia de diferentes concentraciones de hoja de aguacate (g/mL). La mayor inhibicin
microbiana se observ a valores de pH 4.0 con reduccin de tres ciclos logartimicos con
respecto a una poblacin inicial de 7.5 ciclos.

Bibliografa

1. Guzmn-Maldonado, S.H., Morales-Montelongo, A.L., Mondragn-Jacobo, C., Herrera-


Hernndez, G., Guevara-Lara, F. y Reynoso-Camacho, R. 2010. Physocohemical,
nutritional, and functional characterization pf fruits xoconostle ( Opuntia matudae) pears
from central-Mxico region. Journal of Food Science.
2. Gomez-Flores, R., Arzate-Quintana, C., Quintanilla-Licea, R., Tamez-Guerra, P., R.
Tamez-Guerra, R., Monreal-Cuevas., E. y Rodrguez-Padilla. C. 2008. Antimicrobial
Activity of Persea americana Mill (Lauraceae) (Avocado) and Gymnosperma glutinosum
(Spreng.) Less (Asteraceae) Leaf Extracts and Active Fractions Against Mycobacterium
tuberculosis. American-Eurasian Journal of Scientific Research 3 (2): 188-194, 2008
3. Hall, C.l. 2001. Sources of natural antioxindants: oilseeds, nuts, cereals, legume, animal
products and microbial sources. En: Antioxidants in food. Practical Applications. Pokorny,
J., Yanishlieva, N. y Gordon, M. (Editores). CRC Woodhead Publishing Limited.
Cambrige, Inglaterra.
4. ICMSF. 1996. Microorganismos de los alimentos: caractersticas de los patgenos
microbianos. Editorial Acribia, Zaragoza (Espaa), pp 165-174
5. Miles, A.A, Misra, SS, Irwin, JO (1938). The estimation of the bactericidal power of the
blood. The Journal of hygiene, 38 (6): 73249.
6. Owusu-Boadi, N., Ama-Saah, S., Kenneth-Mensah, J., Badu, M., Addai-Arhinand, S., y
Baah-Mensah, M. 2015. Phytoconstituens, antimicrobial and antioxidant propierties of the
leaves of Persea americana Mill cultivated in Ghana. Journal of medicinal plants research.
9(36):933-939

25
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto combinado de la concentracin de hoja de aguacate (Persea


americana), pH (4,6 y 8) y temperaturas de congelacin/refrigeracin sobre el
contenido de fenoles totales con el diseo estadstico de punto central
1 2 1
Flores-Jimnez, C. , Garca-Barrientos, R. y Minor-Prez, H.

1
Divisin de ingeniera Qumica y Bioqumica, Tecnolgico de Estudios Superiores de Ecatepec,
Av. Tecnolgico s/n Esq. Av. Carlos Hank Gonzlez (Av. Central), Col. Valle de Anhuac, C. P.
55210, Ecatepec de Morelos, Estado de Mxico, Mxico, E-mail: hminorperez@yahoo.com.mx.
2
Universidad Politcnica de Tlaxcala

Palabras clave: Hoja de aguacate (Persea americana), antioxidante, diseo de punto central

Introduccin
Los lpidos en alimentos se encuentran propensos a procesos de oxidacin, que dan lugar
a olores indeseables y compuestos txicos como los radicales libres. Especficamente en
relacin a los mecanismos de la actividad antioxidante, algunos estudios indican una
correlacin entre el contenido de fenoles totales y la actividad de captura de radicales
libres (5). Los compuestos fenlicos capturan las especies reactivas del oxgeno, tales
como radicales anin superxido y radicales lpidos peroxi (1,2). En general de los
productos vegetales como el aguacate se pueden obtener sub-productos con alto
potencial para obtener compuestos bioactivos. Especficamente las hojas de aguacate
pueden ser una fuente de compuestos antioxidantes como los fenoles (6,7). Adems,
algunos antioxidantes de naturaleza fenlica pueden tener actividad antimicrobiana sobre
bacterias gram (+) y gram (-). Algunos estudios (3,4) mencionan actividad bactericida de
compuestos fenlicos contra Escherichia coli y en general sobre microorganismos
coliformes psicrtrofos. El objetivo de este estudio fue evaluar el efecto combinado de la
concentracin de hoja de aguacate, pH y temperaturas de congelacin/refrigeracin sobre
la concentracin de fenoles totales en un sistema modelo. Las combinaciones y
repeticiones se obtuvieron aplicando un diseo estadstico de punto central (Design-
Expert Versin 6.0.6, 2002, Minneapolis, EUA).

Metodologa
*Preparacin de la hoja de aguacate. La hoja de aguacate (Persea americana) se sec
durante 48 h a una temperatura de 50C. La muestra se moli en una licuadora
convencional hasta obtener una harina homgenea.

Extractos metanlicos. Se pesaron diferentes muestras de hoja de aguacate (Persea


americana), 0 g, 0.05 g y 0.1 g y se agreg 1 mL de una solucin amortiguadora de pH
4,6 y 8. Las muestras se almacenaron a -15C, -5C y 5C y a los tiempos de 0 d y 6 d se
analizaron los fenoles totales. Las muestras se dejaron en reposo durante 1 h a
temperatura ambiente para el anlisis del tiempo 0 d. Los extractos fenlicos se
obtuvieron tomando un volumen de 100 L y se agreg 0.4 mL de metanol. Las muestras
se agitaron en un vortex durante 1 min. Estos son los extractos a los cuales se les
determin fenoles totales.

Fenoles totales. A partir de los extractos metanlicos obtenidos se tom un volumen de


200 L y se coloc la muestra en tubos de 5 mL; se agreg 1000 L de reactivo de Folin-

26
Investigaciones en Ciencia e Inocuidad de Alimentos

Ciocaltea y 800 L de carbonato de sodio al 7.5%. Se dej reposar durante 1.5 h a 30C.
Las muestras se leyeron a 765 nm

*Anlisis estadstico. Los resultados fueron analizados utilizando el programa estadstico


Design-Expert Versin 6.0.6, 2002, Minneapolis, EUA.

Resultados y discusin

El anlisis estadstico muestra que los resultados experimentales se ajustaron a un


modelo cuadrtico y un modelo 2FI, al tiempo de almacenamiento de 0 d y 6 d
respectivamente. Estos modelos describen la influencia de los factores investigados en
forma independiente: pH, concentracin de hoja de aguacate (C) en g/mL y temperatura
(T) C; el efecto de las interacciones: T*pH, T*C y pH*C y el efecto de los cuadrados: T 2,
pH2 y C2. La ecuacin obtenida para el tiempo de 0 d es Fenoles totales (mg/L) = -
169.60121+62.99192*pH -33.69344*Hoja de aguacate -6.22303*Temperatura-
4.89670*pH2+17990.28785* Hoja de aguacate 2-0.22136*Temperatura2-
103.92062*pH*Hoja de aguacate+0.68546* pH * Temperatura-27.41813* Hoja de
aguacate*Temperatura

Para el tiempo de 6 d se obtuvo la ecuacin: Fenoles totales (mg/L) =+7.92074-


1.21927*pH+1421.20618* Hoja de aguacate +0.57808* Temperatura-107.80313 *pH*Hoja
de aguacate -0.10764 * pH * Temperatura-4.01162*Hoja de aguacate * Temperatura.
Los coeficientes de determinacin para el tiempo de almacenamiento de 0 d y 6 d fueron
0.862 y 0.949 lo que indica que el 13.97% y el 5.08% respectivamente de la variacin total
en la respuesta no se puede explicar por los modelos desarrollados. Los valores F-
Modelo fueron 4.88 y 1.88 respectivamente, estos valores indican que los modelos
cuadrticos para los tiempos de 0 d y 6 d fueron significativos (p > 0.05). Los valores Fo
para los parmetros de cada modelo fueron tiles para explicar el grado de significancia
de los efectos de las variables y sus interacciones. Para el tiempo de 0 d el parmetro
que tuvo un mayor efecto significativo fue la concentracin de hoja de aguacate (mg/L) y
no hubo efecto significativo de la temperatura y el pH. A los 6 d de almacenamiento la
concentracin de hoja de aguacate y el pH tuvieron el mayor efecto significativo sobre la
variable respuesta. Tambin hubo un efecto significativo de la interaccin pH*Hoja de
aguacate. Esto significa que los cambios en concentracin de hoja de aguacate tienen un
efecto significativo sobre la variable respuesta de concentracin de fenoles totales.

Las temperaturas de -15C y -5C y el pH de 4.0 a los 6 das fueron los tratamientos
donde se obtuvieron las ms altas concentraciones de fenoles totales (mg/L).

27
Investigaciones en Ciencia e Inocuidad de Alimentos

182.999 169.668 116.807

Fenoles totales (mg/L) 132.117 130.187 81.6877

Fenoles totales (mg/L)

Fenoles totales (mg/L)


81.235 90.7066 46.5685

30.3533 51.226 11.4494

-20.5285 11.7453 -23.6698

0.10 0.10 0.10


8.00 8.00 8.00
0.08 0.08 0.08
7.00 7.00 7.00
0.05 0.05 0.05
6.00 6.00 6.00
Y: Hoja de aguacate (g/mL) 0.03 5.00
X: Hoja de aguacate (g/mL)0.03 5.00
Y: Hoja de aguacate (g/mL) 0.03 5.00
X: pH X: pH X: pH
0.00 4.00 0.00 4.00 0.00 4.00

1a 1b 1c

103.311 105.848 100.775

77.3789 79.5935 74.7689


Fenoles totales (mg/L)

Fenoles totales (mg/L)

Total phenols (mg/L)


51.4465 53.3393 48.7631

25.5142 27.0851 22.7572

-0.418195 0.830888 -3.24864

0.10 0.10 0.10


8.00 8.00 8.00
0.08 0.08 0.08
7.00 7.00 7.00
0.05 0.05 0.05
6.00 6.00 6.00
Y: Hoja e aguacate (g/mL) 0.03 5.00
Y: Hoja e aguacate (g/mL) 0.03 5.00
Y: Avocado leaf (g/mL) 0.03 5.00
X: pH X: pH X: pH
0.00 4.00 0.00 4.00 0.00 4.00

2a 2b 2c
Figura 1. Grficas de superficie de respuesta para las temperaturas de (1a, 2a) -15C, (1b, 2b) -
5C, (1c, 2c) 5C a un tiempo de almacenamiento de (1) 0 d y (2) 6 d.

28
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones
En las condiciones experimentales evaluadas se encontr un efecto significativo sobre la
concentracin de fenoles totales (mg/mL) en los algunos tratamientos evaluados. La
mayor concentracin de fenoles totales a los 6 d de almacenamiento se obtuvo a las
temperaturas de -15C y -5C a un pH de 4.0.

Bibliografa

1. Da Silva, R.J., Darmon, N.; Fernndez, Y. y Mitjavila, S. 1991. Oxygen free radical
scavenger capacity in aqueous models of different procyanidins from grape seeds.
J. Agric. Food Chem. Vol. 39, 1549-1552.
2. De Freitas, V., Glories, Y. y Laguerre, M.1998. Incidente of molecular structure in
oxidation of grape seed procyanidins. J. Agric. Food Chem. Vol. 46, 376- 382.
3. Hall, C.l. 2001. Sources of natural antioxindants: oilseeds, nuts, cereals, legume,
animal products and microbial sources. En: Antioxidants in food. Practical
Applications. Pokorny, J., Yanishlieva, N. y Gordon, M. (Editores). CRC
Woodhead Publishing Limited. Cambrige, Inglaterra.
4. ICMSF. 1996. Microorganismos de los alimentos: caractersticas de los patgenos
microbianos. Editorial Acribia, Zaragoza (Espaa), pp 165-174
5. Pokorny, J., Yanishlieva, N. y Gordon, M. (2001). Antioxidantes de los alimentos.
Zaragoza, Espaa: Acribia, S.A. pp. 141-148,269
6. Gomez-Flores, R., Arzate-Quintana, C., Quintanilla-Licea, R., Tamez-Guerra, P.,
R. Tamez-Guerra, R., Monreal-Cuevas., E. y Rodrguez-Padilla. C. 2008.
Antimicrobial Activity of Persea americana Mill (Lauraceae) (Avocado) and
Gymnosperma glutinosum (Spreng.) Less (Asteraceae) Leaf Extracts and Active
Fractions Against Mycobacterium tuberculosis. American-Eurasian Journal of
Scientific Research 3 (2): 188-194, 2008
7. Owusu-Boadi, N., Ama-Saah, S., Kenneth-Mensah, J., Badu, M., Addai-Arhinand,
S., y Baah-Mensah, M. 2015. Phytoconstituens, antimicrobial and antioxidant
propierties of the leaves of Persea americana Mill cultivated in Ghana. Journal of
medicinal plants research. 9(36):933-939

29
Investigaciones en Ciencia e Inocuidad de Alimentos

Actividad antioxidante de cscara de Xoconostle (Opuntia matudae) y


elaboracin de un alimento modelo con trucha arco iris (Onchorhynchus
mykiss)
1 2 1
Andrade-Arredondo, J. , Garca-Barrientos, R. y Minor-Prez, H.

1
Divisin de ingeniera Qumica y Bioqumica, Tecnolgico de Estudios Superiores de Ecatepec,
Av. Tecnolgico s/n Esq. Av. Carlos Hank Gonzlez (Av. Central), Col. Valle de Anhuac, C. P.
55210, Ecatepec de Morelos, Estado de Mxico, Mxico, E-mail: hminorperez@yahoo.com.mx.
2
Universidad Politcnica de Tlaxcala

Palabras clave: Xoconostle (Opuntia matudae), antioxidante, emulsin, trucha arcoris


(Oncorhynchus mykiss).

Introduccin
La cscara de xoconostle tiene un aporte importante de antioxidantes. Sin embargo,
generalmente se desecha y slo se emplea para consumo humano la pulpa del fruto.
Algunos autores (3,4) mencionan que el contenido en fenoles simples (como catequina o
epicatequina), as como los cidos fenlicos (cido glico, cido vinlico o cido-4-
hidroxybenzoico) en la cscara tienen una concentracin alrededor de 5 veces mayor en
comparacin con la piel o la pulpa del fruto. Adems algunos antioxidantes de naturaleza
fenlica pueden tener actividad antimicrobiana sobre bacterias gram (+) y gram (-).
Diversos estudios (5) mencionan actividad bactericida de compuestos fenlicos contra
Escherichia coli y en general sobre microorganismos coliformes psicrtrofos.

Los lpidos en alimentos se encuentran propensos a procesos de oxidacin, que da lugar


a olores indeseables y compuestos txicos como los radicales libres. Especficamente en
relacin a los mecanismos de la actividad antioxidante, algunos estudios indican una
correlacin entre el contenido de fenoles totales y la actividad de captura de radicales
libres. Los compuestos fenlicos capturan las especies reactivas del oxgeno, tales como
radicales anin superxido y radicales lpidos peroxi (2). Las procianidinas tienen
actividad de captura de radicales libres (6) y de oxgeno singulete (7). Las procianidinas
(especficamente la procianidina BB 2 3- O galato), son efectivas para capturar el
radical oxgeno. Los dmeros son ms activos que los monmeros. La presencia de
esterificaciones con el cido glico en los monmeros incrementa la capacidad de captura
de radicales oxgeno (1). La (+) catequina muestra tambin actividad de captura de los
siguientes radicales libres: hidrxilo, perxilo y superxido. La (+) catequina y la
epicatequina capturan al radical peroxilo con una eficiencia 10 veces superior a la que
presentan el L ascorbato y el caroteno (1,2). En este estudio se evalu el efecto
antioxidante de la cscara de xoconostle en una emulsin elaborada de trucha arcoris
(Oncorhynchus mykiss) y se evaluaron los cambios en pH y cidez titulable durante el
almacenamiento a 5C.

Metodologa
Preparacin de la muestra. La muestra de xoconostle (Opuntia matudae) se sometieron a
un proceso de secado a una temperatura de 50C durante 24 h. Se obtuvo una harina de
las cscaras y la pulpa del fruto.

30
Investigaciones en Ciencia e Inocuidad de Alimentos

Extractos metanlicos y etanlicos de la harina de xoconostle. Se pesaron 250 mg de las


diferentes muestras y se agreg 1 mL de metanol o etanol al 80%. Posteriormente se
agitaron en un vortex durante 1 min y se centrifugaron a 10,000 rpm/15 min, Se recuper
el sobrenadante y se transfiri a un tubo Eppendorf. Se agreg 0.5 mL de metanol o
etanol al 100% y se agit nuevamente durante 1 min. Estos son los extractos a los cuales
se les determina fenoles totales.
Fenoles totales. A partir de los extractos metanlicos y etanlicos obtenidos se tom un
volumen de 200 L y se coloc la muestra en tubos de 5 mL; se agreg 1000 L de
reactivo de Folin-Ciocaltea y 800 L de carbonato de sodio al 7.5%. Se dej reposar
durante 1.5 h a 30C. Las muestras se leyeron a 765 nm
Trucha arcoris (Onchorhynchus mykiss). La trucha arcoris (Onchorhynchus mykiss) se
adquiri en el Mercado de la Nueva Viga en la Ciudad de Mxico, Mxico. La flora
microbiana contaminante se elimin por inmersin de la muestra (10 g) en una solucin
de etanol al 95% (v/v), con un cuchillo estril se retir la zona flameada y se cortaron
piezas de 50 g (Solomakos et al., 2008). Las muestras del msculo de caz se
empacaron en bolsas de polietileno estril y se almacenaron a -25C hasta su anlisis.
Preparacin de las emulsiones modelo. Una muestra de trucha arcoris de 230 g
(previamente sometida a esterilizacin) se adicion de 20 mL de aceite de maz.
Posteriormente se agreg 22 g de harina de amaranto. Finalmente se adicionaron 40 mL
de agua estril fra. La muestra se homogeniz durante 2 min hasta obtener una emulsin
homognea. Posteriormente 30 g de emulsin modelo se vaciaron en 10 bolsas de
polietileno estriles y se almacenaron a -20C hasta su anlisis. A las muestras se les
adicion la cscara de xoconostle para tener 0%, 1%, 5% y 10% (p/p) en las emulsiones
de estudio. Los tratamientos se guardaron en bolsas de polietileno estriles y se
almacenaron a 5C. A cada tratamiento se le realizaron pruebas de acidez titulable, ndice
de perxido y pH en los diferentes tiempos, T0 = 0 das, T1= 6 das, T2= 12 das

Resultados y discusin
En la Tabla 1, se muestran los valores de fenoles totales (g cido glico/mL), como se
observa los valores de fenoles totales se encontraron en las muestras de cscara de
xoconostle.
Tabla 1. Concentracin de fenoles totales en las muestras de cscara de xoconostle

31
Investigaciones en Ciencia e Inocuidad de Alimentos

Algunos estudios indican que el control de pH puede favorecer la regulacin de la


oxidacin de las grasas de productos marinos. Por ejemplo, los cidos grasos
poliinsaturados presentes en alimentos como las emulsiones pueden presentar un
fenmeno de oxidacin autocalitica. Las molculas lipdicas pierden un tomo de
hidrgeno para formar un radical lipdico (L) reacciona rpidamente con el oxgeno
atmosfrico formando un radical perxido (LOO), el cual puede nuevamente desprender
un tomo de hidrgeno de otra acil-cadena para formar un hidroperxido (LOOH) y un
nuevo radical (L). Esta propagacin contina hasta que se tiene por ejemplo la presencia
de un agente antioxidante. En este estudio se observ que hay una reduccin en el pH
de las muestras adicionadas de cscara de xoconostle (Opuntia matudae) a valores de
alrededor de 5.0 (Figura 1). Los valores de pH bsico favorecen la oxidacin debido a la
formacin en la emulsin radicales hidroxilos (OH-) considerados especies reactivas al
oxgeno que favorecen la auto-oxidacin de lpidos. El anlisis de la prueba de Tukey
mostr una diferencia significativa (P>0.05) entre los tratamientos control sin cscara de
xoconostle y los tratamientos con cscara de xoconostle. En general todos los
tratamientos con cscara de xoconostle tuvieron valores menores de pH de alrededor de
5.0. Esta condicin favorece el control de la oxidacin de lpidos debido a que no se tiene
altos valores de radicales hidroxilo y tampoco se tiene un pH con elevada concentracin
de radicales H+.

8
0d
6d
6 12 d
pH

0
1%

5%

1%

5%

1%

5%
l

l
%

%
ro

ro

ro
10

10

10
nt

nt

nt
co

co

co

Figura 1. pH de las muestras de emulsin de calamar a diferentes concentraciones de


cscara de xoconostle (Opuntia matudae) a una temperatura de 5C.

La concentracin de cido oleico se emple como un parmetro para evaluar la oxidacin


de lpidos (Figura 2). Se obtuvieron valores mayores de cido oleico (%) al tiempo de 0 d
entre 5-10%, y una reduccin significativa despus de un tiempo de almacenamiento de 6
d y 12 d. En general se observa que conforme transcurre el tiempo de almacenamiento a
5C la disminucin de cido oleico es mayor hasta alcanzar valores menores del 5%. A
los 12 d de almacenamiento se obtuvo una mayor concentracin de cido oleico en las
muestras con cscara de xoconostle a 1%, 5% y 10%, sin embargo esta diferencia no es
significativa (p>0.05) con respecto a las muestras control para cada tiempo de
almacenamiento. A los 12 d de almacenamiento se observa en los tratamientos con
cscara de xoconostle una mayor concentracin de cido oleico en comparacin con el
control, este fenmeno posiblemente se deba al efecto en conjunto del pH de las
muestras (aproximadamente 5.0); condiciones donde no se tiene elevada concentracin
de radicales hidroxilo e hidrgeno y a la presencia de antioxidantes de la cscara de
xoconostle especficamente los fenoles simples (como catequina o epicatequina), as
como los cidos fenlicos (cido glico, cido vanillico o cido-4-hidroxybenzoico).

32
Investigaciones en Ciencia e Inocuidad de Alimentos

15
0d
6d

% de acido oleico
12 d
10

1%

5%

1%

5%

1%

5%
l

l
%

%
ro

ro

ro
10

10

10
nt

nt

nt
co

co

co
Figura 2. cido oleico (%) en las muestras de la emulsin modelo de trucha arcoris
(Oncorhynchus mykiss) y cscara de xoconostle (Opuntia matudae) a 5C.

Conclusiones
*A los 12 das de almacenamiento se obtuvo una mayor concentracin de cido oleico en
las muestras con cscara de xoconostle 1%, 5% y 10%, aunque esta diferencia no es
significativa (p<0.05) con respecto a las muestras control.
*El parmetro de pH mostr una diferencia significativa entre todos los tratamientos
debido a la presencia de la cscara de xoconostle. Los valores menores de pH se
observaron en los tratamientos con cscara de xoconostle al 10%.
*Con respecto a los resultados del ndice de acidez (%), se diferencias significativas entre
los tratamientos de 0 d y 10% de cascara de xoconostle y los tratamientos de 6 d y 0%,
1%. 5% y 10% de cscara de xoconostle.
*La cscara de xoconostle puede emplearse como una fuente de antioxidante para
sistemas alimentarios como las emulsiones.
Bibliografa
1. Da Silva, R.J., Darmon, N.; Fernndez, Y. y Mitjavila, S. 1991. Oxygen free radical scavenger
capacity in aqueous models of different procyanidins from grape seeds. J. Agric. Food Chem. Vol. 39,
1549-1552.
2. De Freitas, V., Glories, Y. y Laguerre, M.1998. Incidente of molecular structure in oxidation of grape
seed procyanidins. J. Agric. Food Chem. Vol. 46, 376- 382.
3. Fox, A y Cameron, A. (2008). Ciencia de los Alimentos Nutricin y Salud. Balderas 95, Mxico, D.F:
Limusa, S.A DE C.V. pp. 369-374
4. Guzmn-Maldonado, S.H., Morales-Montelongo, A.L., Mondragn-Jacobo, C., Herrera-Hernndez,
G., Guevara-Lara, F. y Reynoso-Camacho, R. 2010. Physocohemical, nutritional, and functional
characterization of fruits xoconostle (Opuntia matudae) pears from central-Mxico region .Journal of
Food Science.
5. Hall, C.l. 2001. Sources of natural antioxidants: oilseeds, nuts, cereals, legume, animal products and
microbial sources. En: Antioxidants in food. Practical Applications. Pokorny, J., Yanishlieva, N. y
Gordon, M. (Editores). CRC Woodhead Publishing Limited. Cambrige, Inglaterra.
6. Pokorny, J., Yanishlieva, N. y Gordon, M. (2001). Antioxidantes de los alimentos. Zaragoza, Espaa:
Acribia, S.A. pp. 141-148,269
7. Takuro, K., Mori, K., Nakamori, K., Yamakoshi, J., Hosoyama, H., Kataoka, S. y Toshiaki Ariga.1999.
Increase of antioxidative potential of rat plasma by oral administration of proanthocyanidin rich
extract from grape seeds. J. Agric. Food Chem. Vol. 47, 1892 1897.

33
Investigaciones en Ciencia e Inocuidad de Alimentos

Anlisis microbiolgico en mermelada de Carica papaya L. usando dos


conservadores elaborada en Cunduacn, Tabasco

Alor Chvez M. J., Estrada Andrade L. F., De la O De la O, B.

Universidad Jurez Autnoma de Tabasco, Km. 1 carretera Cunduacn-Jalpa de Mndez, Col


Esmeralda. Cunduacn, Tabasco. CP 86690. Tel. (914) 3360928

maricelaalor@hotmail.com

Palabras clave: microbiolgico, mermelada, Carica papaya

Introduccin
El dao microbiano en alimentos es un problema que tiene implicaciones econmicas
evidentes para los fabricantes en la alteracin de materias primas, productos elaborados
antes de su comercializacin, as como para distribuidores y consumidores, considerando
el deterioro de los productos despus de su adquisicin y antes de su consumo. Por otro
lado, existen mtodos de conservacin de poscosecha como los fsicos mediante el
calentamiento, deshidratacin, irradiacin o congelacin, los cuales pueden asociarse a
mtodos qumicos. Tal es el caso del uso de conservadores qumicos, el cual previene,
retarda o al menos inhibe el crecimiento de los microorganismos (1).

La produccin de papaya maradol (Carica papaya L.) en Tabasco, ha sido uno de los
principales cultivos generadores de empleos e ingresos, cabe mencionar que en 2004
export a EE.UU el 94% y el 16% a Blgica, Espaa, Francia, Canad, Alemania, Japn e
Inglaterra (2). La fruta verde se utiliza para la elaboracin de dulces en cubo cristalizado,
almbar, ensaladas, orejones, hasta llegar a la fruta madura que se consume como fruta
fresca, helados, jaleas, jugos, nctares y mermeladas. El estado de Tabasco cuenta con
una gran variedad de frutas tropicales, mismas que se cosechan en diferentes
temporadas del ao y en grandes cantidades que a veces no es posible vender, distribuir
o consumir, es por ello que se elaboran conservas tpicas de la regin, siendo sta una
opcin ms para el aprovechamiento integral del fruto; as como la degustacin
permanente segn se requiera (3)

Las mermeladas se definen como un producto alimenticio obtenido por la concentracin,


coccin de frutas enteras, sanas, limpias con un grado de madurez adecuado y a la cual
se le adiciona edulcorantes tales como sacarosa, sustancias gelificantes (pectina) y
acidificantes (cido ctrico). Estos contribuyen a que el producto obtenido sea un
semifluido espeso, desde el punto de vista tecnolgico la formulacin de una mermelada
de primera calidad debe tener una proporcin 50:50 (fruta:azcar), adems que la
mermelada contenga un mnimo de 68 solidos solubles (Brix) y un pH de 3.5, asegurando
su conservacin. Para la adicin de conservadores qumicos en alimentos cuya finalidad
es la de preservar el producto, las reglamentaciones son muy estrictas en todos los
pases del mundo, existiendo lmites en las concentraciones adicionadas en los productos
alimenticios (4).

Los objetivos de este trabajo fueron realizar anlisis fisicoqumico y estudiar el


comportamiento del cido srbico y benzoato de sodio a diferentes concentraciones
adicionadas como inhibidor de microorganismos en mermelada de Carica papaya L.

34
Investigaciones en Ciencia e Inocuidad de Alimentos

Metodologa

La fruta fue comprada en el mercado de Cunduacn, Tabasco. Se elabor la mermelada


de papaya maradol, en el laboratorio de investigacin de la Divisin Acadmica de
Ciencias Bsicas de la Universidad Jurez Autnoma de Tabasco; utilizando
concentraciones de cido ascrbico (0.05, 0.04, 0.03, 0.02, 0.01 %) y concentraciones de
benzoato de sodio (0.2, 0.16, 0.12, 0.08, 0.04 %) se determinaron parmetros como pH,
Brix por refractometra, aw, % azucares reductores (4), anlisis microbiolgico por el
mtodo para la cuenta de bacterias aerobias en placa por la NOM-092-SSA1-1994 (5),
determinacin de bacterias coliformes por la NOM-112-SSA1-1994 (6), determinacin de
la cuenta de mohos y levaduras en alimentos de acuerdo a NOM-111-SSA1-1994 (7).

Resultados y discusin

Se utilizaron 3 frascos de 450 g de mermelada de papaya maradol, para cada una de las
concentraciones de conservadores. De acuerdo a la NOM-130-SSA1-1995 (8), se
consider como referencia para cido srbico 0.05% y benzoato de sodio 0.1%. En la
tabla 1 y 2 se indican las cantidades de ingredientes, condiciones del proceso, valores de
pH, Brix de la mermelada con cido srbico y benzoato de sodio respectivamente.

Tabla 1. Cantidades de ingredientes, condiciones del proceso, valores de pH, Brix de la


mermelada con cido srbico

Parmetros Concentraciones de cido srbico y benzoato de sodio %


0.05 0.04 0.03 0.02 0.01
Fruta (kg) 2 2 2 2 2
Azcar (kg) 2 2 2 2 2
Pectina de tejocote (g) 20 20 20 20 20
Agua para escaldado (mL) 500 500 500 500 500
T (C) requerida 100 100 100 100 100
cido ctrico (g) 13 13 13 13 13
Tiempo de escaldado (min) 20 20 20 20 20
Agua para disolucin (mL) 400 400 400 400 400
T (C) requerida 80 80 80 80 80
pH 3.4 3.3 3.3 3.3 3.3
Brix 67 67 67 67 67

Con los valores obtenidos de pH obtenidos en los 5 lotes y considerando buenas prcticas
de higiene, se evita el crecimiento de microorganismos, ya que entre ms cido es el
alimento menor probabilidad de la presencia de bacterias, mohos y levaduras. En la tabla
2, se muestran los valores de actividad de agua (aw) y % promedio de azcares
reductores.

Por la importancia que tienen los azcares reductores para evitar la cristalizacin de la
sacarosa en mermelada y los valores de aw ayudan a predecir el crecimiento de
microorganismos cuando son menores de 0.5.

35
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2. Valores obtenidos de aw y % promedio de azcares reductores en la mermelada


con las diferentes % de cido srbico y benzoato de sodio

% cido aw % Azcares % benzoato aw % Azcares


sorbico reductores de sodio reductores
0.05 0.643 31.1 0.1 0.651 28.3
0.04 0.666 28.1 0.08 0.671 28.2
0.03 0.666 29.6 0.06 0.666 28.1
0.02 0.685 28.7 0.04 0.672 28.7
0.01 0.694 30.0 0.02 0.680 31.7

Tabla 3. Resultados del anlisis microbiolgico en la mermelada de Carica papaya con


conservadores

Anlisis % de cido srbico % de benzoato de sodio


0.05 0.04 0.03 0.02 0.01 0.1 0.08 0.06 0.04 0.02
Mesfilos aerobios 25 65 85 120 130 15 40 65 110 115
(UFC/g)
Coliformes totales 0 0 0 0 0 0 0 0 0 0
(UFC/g)
Mohos y levaduras 0 0 0 0 0 0 0 0 0 0
(UFC/g)

En la tabla 3 se muestra que a menor concentracin de conservador, mayor crecimiento


de mesfilos aerobios, tanto para el cido srbico como para el benzoato de sodio. El
crecimiento de estos microorganismos tambin se relaciona con los valores obtenidos de
aw, ya que fueron incrementando a medida que las concentraciones de los conservadores
disminuan. Hay mayor inhibicin al utilizar concentraciones de 0.0.5% de cido srbico y
para el benzoato de sodio las concentraciones de 0.1 y 0.08 %.

Los resultados de coliformes totales as como mohos y levaduras no presentaron


crecimiento de microorganismos.

Conclusiones

El pH es uno de los parmetros determinantes en el crecimiento de bacterias, mohos y


levaduras en alimentos, en el caso de la mermelada se mantuvo en promedio en 3.3, el
cual no permite crecimiento de los microorganismos.

La aw se mantuvo en promedio en 0.67, el contenido de solidos solubles en todas las


muestras fue de 68 Brix.

De los resultados obtenidos en el anlisis microbiolgico se concluye que las mermeladas


con las concentraciones de 0.1 y 0.08 % de benzoato de sodio y la concentracin de 0.05
% de cido srbico fueron las concentraciones ptimas para mantener con mayor tiempo
de anaquel, siguiendo la recomendacin que una vez abierto el recipiente hay que
mantenerlo bajo refrigeracin.

36
Investigaciones en Ciencia e Inocuidad de Alimentos

El nmero de mesfilos aerobios se incrementaron al disminuir la concentracin de cada


uno de los conservadores, con cido srbico al 0.04% se elev de 25 a 65 UFC/g y con
benzoato de sodio al 0.06 %, 0.04 y 0.02 % se elev al doble de 65 a 115 UFC/g.

En cuanto a coliformes totales, mohos y levaduras no mostraron crecimiento en ninguna


de las concentraciones utilizadas de conservadores.

Por ltimo, la mermelada de Carica papaya L. es un producto que ofrece una alternativa
ms para el aprovechamiento de la fruta, que a su vez permite ampliar el mercado de
productores y exportadores, generar fuentes de empleo y brindar al consumidor un
producto nuevo a base de una fruta tpica de la regin.

Bibliografa

1. Gmez S. A. 2008.Tecnologas de obstculos como mtodo de inhibicin del crecimiento


de mohos en alimentos. Temas selectos de ingeniera de alimentos. 2-2: 52-68.
2. Guzmn R E., Gmez A.R., Pohlan H., Herman A. J., lvarez R. Pat F.J., Geissen V. 2008.
La produccin de papaya en Tabasco y los retos del desarrollo sustentable. El Cotidiano,
vol. 23, nm. 147, enero-febrero 2008. Pp 99-106.
3. Vzquez G E, Mata V H, Ariza F R, Santamaria B F. 2010. Produccin y manejo
poscosecha de papaya maradol en la planicie huasteca. INIFAP. Pp 180.
4. Gmez M L., y Alor Ch M J. 2003. Elaboracin de un producto tipo mermelada y su
caracterizacin de fibra diettica a partir de Carica papaya L. Tesis de licenciatura.
Universidad Jurez Autnoma de Tabasco. Pp 55.
5. Norma Oficial Mexicana NOM-092-SSA1-1994, anlisis microbiolgico por el mtodo para
la cuenta de bacterias aerobias en placa.
6. Norma Oficial Mexicana NOM-112-SSA1-1994, determinacin de bacterias coliformes.
7. Norma Oficial Mexicana NOM-111-SSA1-1994, determinacin de la cuenta de mohos y
levaduras en alimentos.
8. Norma Oficial Mexicana NOM-130-SSA1-1995, Alimentos envasados en recipientes de
cierre hermtico y sometido a tratamiento trmico. Disposiciones y especificaciones
sanitarias.

37
Investigaciones en Ciencia e Inocuidad de Alimentos

Evaluacin de la calidad higinico - sanitaria de una cadena de carniceras


en Culiacn, Sinaloa

Cota Verdugo, O., Castaeda-Ruelas, G.M., Bojrquez Garca, M.V., Gutirrez Angulo, M.F.,
Hernndez Morga, F.L., Leyva Ramrez, A.C., Amzquita Hermosillo, S., Garca-Castro, B.
1
Tecnologico de Monterrey, Escuela de Ingeniera y Ciencias, Blvd. Pedro Infante 3773 Pte., Col.
2
Recursos Hidrulicos 80100, Culiacn, Sin., Mxico, 6677165900. Facultad de Ciencias Qumico
Biolgicas Universidad Autnoma de Sinaloa, Calz de las Amricas Norte 2771, Burcrata,
80030 Culiacn Rosales, Sin., 6677137860. (A01114704@itesm.mx)

Palabras clave: Inocuidad, Indicadores de contaminacin, Carnicera.

Introduccin
Sinaloa representa uno de los principales estados de produccin de carne de canal bovino
a nivel nacional. Sin embargo, la manipulacin y el manejo higinico incorrecto a travs de
la cadena alimentaria puede exponer la carne a un riesgo de contaminacin por
microorganismos patgenos (1,2). Los principales focos de contaminacin microbiolgica
se manifiestan en el sacrificio de la vaca, el transporte de la carne, y en su punto de venta
(3). En Mxico, Heredia y col. (2) han identificado en los puntos de venta de carne de
bovinos la presencia de ciertos tipos virulentos de Escherichia coli, Staphylococcus
aureus, Listeria monocytogenes y Salmonella, lo cual evidenca la prdida de la inocuidad
y expone la salud del consumidor.
La norma oficial mexicana NOM-251-SSA1-2009 establece los requisitos mnimos de
buenas prcticas de higiene que deben cumplir los establecimientos dedicados al proceso
y venta de los alimentos, bebidas, suplementos alimenticios y sus materias primas con el
fin de evitar la contaminacin y garantizar la inocuidad del producto (7). Esta norma
cuenta con lineamientos que rigen las condiciones de higiene del personal, la limpieza y
desinfeccin de las instalaciones, equipos y utensilios, as como el control de materia
prima y operaciones, entre otros (7). Adicionalmente, el monitoreo microbiolgico
peridico de las plantas de procesamiento de alimentos basado en la cuantifcacin de
indicadores de contaminacin resulta una herramienta til que permite indentificar los
puntos de contamiancin, el cumplimiento sanitario y el diseo de estrategias de
intervencin para el control de la contaminacin (1). En Mxico, se cuentan con normas
nacionales que establecen los lmites permisibles en el agua potable (NOM-093-SSA1-
1994) (4), o la eficacia de los procesos de desinfeccin sobre superficies vivas o inertes
(NOM-127-SSA1-1994) (5) con el fin de determinar la seguridad de su uso y minimizar el
riesgo de enfermedades alimentarias.
Por lo tanto, el objetivo de este estudio fue evaluar (i) el cumplimiento de las buenas
prcticas higinicas de acuerdo a la norma mexicana NOM-251-SSA1-2009 y (ii) la
calidad microbiolgica mediante indicadores de contaminacin de la venta de carne
bovina en una cadena de carniceras de Culiacn, Sinaloa.

Metodologa
Toma de muestras: se seleccionaron cuatro carniceras distribuidas en la zona sur, centro
y norte de la ciudad de Culiacn, Sinaloa (Tabla 1). Se recolectaron un total de 39
muestras, incluyendo superficies de utensilios (n=9), materia prima (n=10), agua potable
(n=10) y superficie de manos del personal (n=10) previo al inicio de las actividades de
venta. La Tabla 1 describe la distribucin de muestras tomadas por establecimiento.
Brevemente, bajo condiciones aspticas se tomaron las muestras de superficie de
utensilios y manos del personal mediente la tcnica de hisopo humedecido frotanto un

38
Investigaciones en Ciencia e Inocuidad de Alimentos

rea de 100 cm y par de manos, respectivamente. Las muestras de materia prima fueron
proporcionadas por el personal cortando un trozo de 100 gr de carne cruda y
colocndola en una bolsa estril de plstico. Finalmente, las muestras de agua potable se
recolectaron en tubos falcon estriles con tiosulfato de sodio.
Anlisis microbiolgico: Para la determinacin de coliformes totales y E. coli se utilizaron
placas petrifilm E. coli/Coliform count plate 3m, de acuerdo a las instrucciones del
fabricante. Se deposit 1 ml de la muetra directa (agua, utensilios y manos) y de la
dilucin 10-1 de las muestras de alimentos en placas Petrifilm, para incubarse por 24 horas
a 37 C. Despus de la incubacin, se realiz la identificacin y cuantificacin de las
colonias caractersticas de coliformes totales (colonias rojas y azules con o sin gas) y E.
coli (colonias azules con gas). La concentracin de coliformes totales y E. coli se
expresaron en UCF/ml, g, pieza, mano o cm2. Para la deteccin de Salmonella se sigui la
metodologa descrita por el manual analtico de bacteriologa. Brevemente, las muestras
se pre-enriquecimiento 1:9 en agua peptonada, y se incub por 24 h a 37 C. Despus, se
transfiri una alcuota del cultivo a caldo selectivo Rappaport-Vassiliadis (RV), y se incub
por 24 horas a 37 C. Posteriormente, el cultivo de RV se sembr en agar selectivo
Hektoen, y se incub en posicin invertida a 37 C por 24 h. Las colonias presuntivas se
identificaron mediante pruebas bioqumicas.

Verificacin de la NOM-251-SSA1-2009: Se utiliz un cuestionario que consiste en 16


secciones importantes para la evaluacin de las buenas prcticas higinicas de los
establecimientos de acuerdo a la normatividad vigente de mxico (NOM-251-SSA1-2009)
(Figura 2) (7). El cumplimiento de las bunas prcticas higinicas se expreso como total,
parcial o no cumplimiento.

Resultados y discusin
Anlisis microbiolgico: En el 100% de las carnicerias seleccionadas para este estudio se
detect de manera global en el 66% (26/39) de las muestra la presencia de coliformes
totales; 100% carne cruda de res (8/8), 88% manos de personal (7/8), 50% superficies
(4/8), 50% utensilios (4/8), y 38% agua potable (3/8). La figura 1 muestra la frecuencia de
deteccin de coliformes totales en cada categora de muestras recolectadas en las
diferentes carniceras. La carnicera D present el mayor porcentaje de contaminacin
(90%) seguido de la tienda B (78%). Respecto a E. coli, este indicador solo se detect en
las muestras de carne cruda de res de la tienda D (Tabla 1). Salmonella no se dectect en
el total de las muestras evaluadas. La constante deteccin de coliformes totales en las
muestras de utensilios, superficies y personal de esta cadena de carniceras, se relaciona
con la deficiencia en los procesos de limpieza y sanitizacin del entorno en el
procesamiento de los alimentos (1), lo cual requiere un reforzamiento de las buenas
prcticas higinicas o el rotar los protocolos y/o desinfectantes utilizados.
La Tabla 1 muestra los valores cuantificados de coliformes totales en las categoras de
muestras de cada carnicera. De manera general se exhibe que las manos del personal
(<10 UFC/cm2) y los utensilios (<200 UFC/cm2) se encuentran fuera de especificacin de
acuerdo a los lmites marcados por la NOM-093-SSA1-1994 (4). Adiconalmente, se
identific que los locales no cuentan con mtodos que garanticen la potabilidad del agua
en contacto con los alimentos, dado que las muestras exceden el lmite microbiolgico (<2
UFC/100 ml) establecido por la NOM-127-SSA1-1994 (5). A pesar que la carne cruda est
excenta de la cuantificacin de coliformes totales y fecales (6), se observ una elevada
carga microbiana (70-2100 UFC/g) y la presencia de E. coli en las muestras analizadas, lo
cual puede representar un riesgo para la presencia de patotipos de E. coli. Hernndez y
col. (2) ha detectado la presencia de patotipos de E. coli en la carne de venta en

39
Investigaciones en Ciencia e Inocuidad de Alimentos

mercados, lo cual puede sugerir un riesgo de enfermedades cuando el alimento no lleva


una coccin adecuada.
Figura 1. Deteccin de coliformes totales en las muestras recolectadas de las carniceras.

*Carniceras: A, B, C, D.

Tabla 1. Cuantificacin de coliformes totales en las muestras recolectadas de las


carniceras.
Muestra Unidad Carnicera
A B C D
Superficie UFC/cm2 0 0.4 2.4 62
Utensilio UFC/pza 2 520b 0 1,520b
Carne UFC/g 170 2,100 70 1,525a
Manos UFC/mano 2 36b 35b 21b
Agua UFC/ml 73c 300c 0 5c
* Carniceras: A, B, C, D.
a
Presencia de E. coli.
b
Valores fuera de especificacin microbiolgica de acuerdo a la NOM-093-SSA1-1994.
c
Valores fuera de especificacin microbiolgica de acuerdo a la NOM-0127-SSA1-1994.

Verificacin de la NOM-251-SSA1-2009: La Figura 2 muestra el cumplimiento de la NOM-


251-SSA-2009, la cual describe los requisitos mnimos de buenas prcticas higinicas en
los establecimientos dedicados a los alimentos. Como fortaleza de los establecimientos se
observa en las instalaciones el control sobre la materia prima, las operaciones, residuos y
plagas. Sin embargo, las deficiencias se observan en el personal, limpieza y desinfeccin,
lo cual se relaciona directamente con los valores de coliformes totales cuantificados en las
muestras de superficie de manos de personal y utensilios. Algunos estudios han descrito
que el personal es una de las principales fuentes de contaminacin microbiolgica en la
preparacin de los alimentos (1,2). La capacitacin del personal es clave para el
seguimiento y cumplimiento de las buenas prcticas higinicas (4,7). Dado que las
deficiencias detectadas en las carniceras es similar, se sugiere que la cadena concientice
y eduque al personal sobre el riesgo de la contaminacin microbiolgica y el
mantenimiento de las inocuidad en entorno de elaboracin de los alimentos con base a
protocolos de higiene y desinfeccin homologados.

40
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 2. Cumplimiento de la NOM-251-SSA1-2009 de la cadena de carniceras.

I: Instalaciones y reas, II: Equipos y utensilios, III: Servicios, IV: Almacenamiento, V: Control de
operaciones, VI: Materias primas, VII: Envases, VIII: Agua en contacto con los alimentos, IX:
Mantenimiento y limpieza, X: Control de plagas, XI: Manejo de residuos, XII: Salud e higiene de
personal, XIII: Transporte, XIV: Capacitacin, XV: Control de plagas, XVI: Venta.
Cumplimiento total (100%), Cumplimineto parcial (50%), No Cumplimiento (0%).

Bibliografa
1. Castaeda-Ruelas, G.M. y Chaidez-Quiroz, C. 2015. Evaluacin de la calidad
microbiolgica de la cadena de produccin de queso fresco en una planta en la
noroeste de Mxico. En eds Orozco LO, Garay LE, Torres-Vitela MR. (Coordinadores).
Avances en Microbiologa, Higiene y Toxicologa de Alimentos. Edicin 1, (pp 50-53).
Prometeo. Editores S.A. de C.V.
2. Heredia, N., Garca, S., Rojas, G., Salazar, L. 2001. Microbiological condition of
ground meat retailed in Monterrey, Mexico. J. Food Prot. 64:1249-1251.
3. Jimnez-Edeza, M., Chaidez, C., Len, J. 2012. Calidad microbiolgica de carne de
res comercializada en el mercado municipal de Culiacn, Sinaloa. Vet. Mx. 43:273-
284.
4. Norma Oficial Mexicana NOM-093-SSA1-1994. Bienes y servicios. Preparacin de
alimentos que se ofrecen en establecimientos fijos. Especificaciones sanitarias.
Disponible en la pgina: http://www.salud.gob.mx/unidades/cdi/nom/093ssa14.html.
Fecha de acceso: marzo de 2017.
5. Norma Oficial Mexicana NOM-127-SSA1-1994. Salud ambiental. Agua para uso y
consumo humano. Lmites permisibles de calidad y tratamiento al que debe someterse
el agua para su potabilizacin. Disponible en la pgina:
http://www.salud.gob.mx/unidades/cdi/nom/127ssa14.html. Fecha de acceso: marzo
de 2017.
6. Norma Oficial Mexicana NOM-230-SSA1-2002. Disponible en la pgina:
http://www.salud.gob.mx/unidades/cdi/nom/230ssa102.html. Fecha de acceso: marzo
de 2017.
7. Norma Oficial Mexicana NOM-251-SSA1-2009. Prcticas de higiene para el proceso
de alimentos, bebidas o suplementos alimenticios. Disponible en la pgina:
http://dof.gob.mx/nota_detalle.php?codigo=5133449&fecha=01/03/2010. Fecha de
acceso: marzo de 2017.

41
Investigaciones en Ciencia e Inocuidad de Alimentos

Estudio de la calidad higinica e identificacin de Pseudomonas aeruginosa


en agua para consumo humano provista de expendios informales en
Villahermosa Tabasco

Estrada Andrade, L.F., Alor Chvez, M. de J. y Snchez Vzquez, R.


Universidad Jurez Autnoma de Tabasco, Km 1.0 carretera Cunduacn-Jalpa de Mndez,
Cunduacn Tabasco, Mxico, (01)4143360928.
laura.estrada@ujat.mx
Palabras clave: agua, microbiolgicos, Tabasco

Introduccin
En la ltima dcada, la preocupacin sobre la calidad del agua que se consume se ha
generalizado entre la poblacin. El sabor y algunos problemas asociados con el agua
potable han sido la causa del aumento en el consumo de agua embotellada.
El agua embotellada puede ser cualquier fuente de agua potable que recibe tratamientos
fsicos y qumicos, y que est libre de agentes infecciosos. Las fuentes pueden ser pozos
profundos, deshielos de las montaas o bien el suministro municipal de agua. Como
cualquier otro producto alimenticio, debe ser procesada, empacada y almacenada de
manera sanitaria y libre de contaminacin (2).
Muchas enfermedades infecciosas del hombre como la fiebre tifoidea, la disentera y el
clera son causadas por bacterias patgenas que se transmiten por medio de aguas
contaminadas, de ah la importancia de cuantificar el ndice de contaminacin por la
presencia de Coliformes fecales y totales, los cuales son indicadores inmediatos de
contaminacin en agua destinada al consumo humano (1).
Las fuentes de agua embotellada generalmente contienen una microflora muy variada,
que incluye las siguientes especies: Achromobacter spp., Aeromonas spp.,
Flavobacterium spp., Alcaligens spp., Acinetobacter spp., Cytophagas spp., Moraxella
spp., y Pseudomonas spp. Estas bacterias se encuentran en pequeas cantidades, pero
pueden multiplicarse rpidamente durante el envasado y almacenamiento del agua (8).
Por tal motivo en el presente estudio se llevar a cabo el aislamiento e identificacin de
Pseudomonas aeruginosa (P. aeruginosa), en agua destinada al consumo humano
provista de expendios rellenadores o informales en la ciudad de Villahermosa Tabasco.
De igual manera, se evaluar la calidad higinica y los parmetros fisicoqumicos del
mismo, de tal manera que los resultados obtenidos permitirn conocer la calidad e
inocuidad del alimento en este tipo de establecimientos, los cuales se han convertido en
un negocio redituable, a pesar del desconocimiento de su confiabilidad higinica, lo cual
podra ser un riesgo de salud pblica.

Metodologa
Se llev a cabo una investigacin de campo de todas las purificadoras informales
dedicadas al relleno de garrafones en la ciudad de Villahermosa Tabasco, las cuales
fueron sometidas a un anlisis que permiti conocer las condiciones en las que se llevaba
a cabo el proceso de purificacin, as como la higiene tanto en los establecimientos como
en el lavado y llenado de los garrafones. La recoleccin de las muestras se llev a cabo
en frascos estriles a partir de la seleccin aleatoria de dos garrafones de 20 L de agua
purificada y envasada en cada uno de los establecimientos, desconociendo el origen y las
condiciones del agua empleada para el proceso.
A las muestras se les realizaron ensayos organolpticos (olor, color y sabor),
fisicoqumicos (pH, dureza, alcalinidad, cloro residual y slidos disueltos) y
microbiolgicos correspondientes.

42
Investigaciones en Ciencia e Inocuidad de Alimentos

Para analizar los niveles de alcalinidad de las muestras, se llevaron a cabo titulaciones
cido-base empleando anaranjado de metilo como indicador. Para conocer el contenido
de cloro residual libre, slidos disueltos totales, dureza total como CaCO3, se emplearon
KITS marca Hanna instruments, modelos HI 38020, HI 38033-0 y HI 38085
respectivamente, cuyos valores se determinaron de acuerdo a las tablas contenidas en
cada KIT regulados de acuerdo a la NOM-201- SSA1-2002 (7).
Para el anlisis microbiolgico, se determin la presencia de coliformes totales y fecales
por la tcnica de nmero ms probable de acuerdo a la NOM-proy-NMX-AA-042/1-SCFI
2008 (5), realizando en cada caso la prueba presuntiva correspondiente, empleando
Caldo Lactosado como medio de enriquecimiento a las diluciones realizadas por triplicado
correspondientes (10, 1.0 y 0.1 mL), incubndose a 36 C por 48 horas para coliformes
totales y 45 C por 24 horas para coliformes fecales. A los tubos positivos se les realiz la
prueba confirmatoria, empleando caldo Verde Bilis Brillante y medio EC respectivamente
para cada determinacin. Para evaluar el nmero de bacterias mesoflicas aerobias
presentes en las muestras, se emple la tcnica de vaciado en placa para diluciones
seriadas hasta 10-5, de acuerdo a la NOM-092-SSA1-1994 (6). Para tal efecto, se llevaron
a efecto siembras por triplicado de las tres ltimas diluciones en agar para mtodos
estndar bajo un periodo de incubacin de 35C 1C por 24 horas, para finalmente
efectuar el conteo de colonias correspondiente.
El aislamiento de Pseudomonas aeruginosa se llev a cabo por la tcnica del NMP de
acuerdo a la NOM-201-SSA1-2015 (8), iniciando con la prueba presuntiva de muestras
seriadas en solucin buffer fosfatos y caldo asparagina a concentracin doble (10 mL de
caldo con 10 ml de muestra), de las tres ltimas diluciones, bajo un periodo de incubacin
a 35C 1C por un lapso de 48 horas, de donde se evalu el grado de turbidez y la
presencia de signos de fluorescencia empleando una lmpara de luz UV. Los cultivos con
crecimiento bacteriano y fluorescencia positiva, se sembraron en agar cetrimida,
incubndose a 35C 1C por 24 horas, con la finalidad de observar el crecimiento y
cuantificar las unidades formadoras de colonias por mililitro (UFC/mL). La identificacin
positiva de la presencia de Pseudomonas, se fundament en las caractersticas claves del
grupo fluorescente propuestas por Koneman (4).

Resultados y discusin
Se seleccionaron tres purificadoras de mayor demanda en la ciudad de Villahermosa
Tabasco, ubicadas en las colonias de: Atasta, Tamult y Gaviotas Sur de esta ciudad. El
estudio fisicoqumico denot que 87% de las muestras present valores de dureza de 710
mg/L y alcalinidad de 387 mg/L, valores por arriba de los lmites de referencia (500 y 300
mg/L) respectivamente, as como un pH y contenido de cloro residual ptimo para el 92%
de las muestras, tal como se muestra en la tabla 1.

Tabla 1. Evaluacin fisicoqumica de las muestras

Parmetro Valores determinados Valores Referencia No. de


muestras que
(mg/L) (mg/L) cumplen
parmetros
permisibles

43
Investigaciones en Ciencia e Inocuidad de Alimentos

Alcalinidad 387 300 9


Cloro residual 0.12 0.1 43
Slidos disueltos 8.0 0 10 50
Dureza 710 500 4
pH 7.2 6.5 - 8.5 50

Fig. 1. Calidad higinica de las muestras

Cabe destacar que valores de dureza y alcalinidad elevada en un agua para consumo
humano generalmente se atribuyen a un mal funcionamiento del suavizador y/o a las
condiciones fisicoqumicas propias del agua suministrada en la regin (3), que para el
Estado de Tabasco presenta un elevado contenido de sales minerales.
La caracterizacin morfolgica y colonial de la cepa tipo, se llev a cabo de manera
efectiva, observando la presencia de bacilos rectos Gram negativos y colonias grises y
opacas de 2 a 3 mm en agar cetrimida respectivamente.
En cuanto a la calidad higinica se observ que 84 % de las muestras mostraron
parmetros aceptables para Coliformes Totales (< 1.1 NMP/100 mL), sin embargo en el
7% hubo desarrollo de bacterias coliformes fecales, lo cual podra atribuirse a un mal
funcionamiento en la lmpara de luz UV, cuya finalidad es eliminar la presencia de
cualquier gnero bacteriano, asegurando as, la inocuidad del producto. Para el recuento
de bacterias mesoflicas aerobias, se observ que 76% de las muestras analizadas
oscilaron en un rango (<100 UFC/100 mL), cumpliendo con los parmetros propuestos
para este indicador de acuerdo a la NOM-092-SSA1-1994 (5). El 24% restante, estuvieron
comprendidos entre (500 a 999 UFC/mL), sobrepasando los lmites permisibles.
Se identific la presencia del gnero Pseudomonas en 8% de las muestras denotando
valores por arriba de los referentes (cero UFC/100 mL), lo que indica una deficiencia en el
proceso de purificacin y falta de higiene en el lavado y llenado de los garrafones.

Conclusiones
Se identific la presencia de P. aeruginosa en 8% de las muestras, parmetro que indica
contaminacin del alimento ante un deficiente proceso de purificacin.
El 87% de las muestras mostr valores por arriba de los rangos de referencia en las
determinaciones de dureza y alcalinidad de acuerdo a lo establecido en la NOM-201-
SSA1-2002, indicativo a la falta de tratamiento y control en las plantas de tratamiento de
agua del Estado.

44
Investigaciones en Ciencia e Inocuidad de Alimentos

El ndice de bacterias coliformes totales y mesoflicas, es adecuado para efecto de su


consumo de acuerdo a la NOM-proy-NMX-AA-042/1-SCFI 2008 y la NOM-092-SSA1-
1994.
La presencia de Coliformes fecales en 7% de las muestras, es un indicativo de falta de
mantenimiento y limpieza en las tuberas, ineficiente lavado de garrafones.
Los resultados obtenidos en el presente estudio, ponen de manifiesto la urgente
intervencin por parte de las autoridades sanitarias del Estado, en la supervisin y control
peridico en este tipo de establecimientos, los cuales podran convertirse en un riesgo de
salud pblica para la poblacin.

Bibliografa
1. Asociacin Americana de Salud Pblica (2005). Standard methods for the examination of
water and wastewater. 18va ed., Washington.
2. Chaidez, Quiroz, Ph.D. 2002. Agua Embotellada y su Calidad Bacteriolgica. Disponible en
la pgina: http://biblio.upmx.mx/Estudios/Documentos/adiccionpotomania021.asp
Fecha de acceso: septiembre 2016
3. Gua Para La Vigilancia Y Control de La Calidad Del Agua Para Consumo Humano, 2002.
Disponible en la pgina:
http://190.128/biblioteca/Servicio_Sanitario/Guia_Calidad_Agua/CD_GuiasOMS/Biblioteca/
GuiasGDW/Guia%20para%20la%20VCCA%20RR0jas.pdf
4. Koneman E., Allen S., William J., Schereckenberger P. y Washington W. (1999).
Diagnstico Microbiolgico. Texto y Atlas a color. 5ta ed., Madrid, Panamericana, S.A.
5. Norma Oficial Mexicana NOM-proy-NMX-AA-042/1-SCFl 2008. Anlisis de agua deteccin
y enumeracin de organismos coliformes, termotolerantes y Escherichia coli presuntiva.
Mtodo del NMP.
6. Norma Oficial Mexicana NOM-092-SSA1-1994. Mtodo para la cuenta de organismos
mesoflicos aerobios. Diario Oficial de la Federacin. Gobierno constitucional de los
Estados Unidos Mexicanos. Mxico D.F.
7. Norma Oficial Mexicana NOM-201-SSA1-2002. Productos y servicios agua purificada y
envasada.
8. NORMA Oficial Mexicana NOM-201-SSA1-2015, Productos y servicios. Agua y hielo para
consumo humano, envasados y a granel. Especificaciones sanitarias.
9. Warburton J., McCormick S. (2004). The bacterial flora of non-carbonated, natural mineral
water from springs to reservoir and glass and plastic bottles. Canadian Journal of
Microbiology, 40 (3): 145-148.

45
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto de la adicin de extracto acuoso de ajo en la dieta de conejos


sobre la calidad microbiolgica de la carne
1* 1 1
Arzate Serrano, H.D. , Mariezcurrena Berasain, M.A. , Marn Mendoza, P.M ., Mariezcurrena
2
Berasain M.D.
1
Universidad Autnoma del Estado de Mxico. Facultad de Medicina Veterinaria y Zootecnia.
Campus Universitario El Cerrillo. Toluca, Mxico. C.P. 50090, Mxico.
2
Universidad Autnoma del Estado de Mxico. Facultad de Ciencias Agrcolas. Campus
Universitario El Cerrillo. Toluca, Mxico. C.P. 50090, Mxico.
*
(044) 722 414 00 71; arzate_uaem@hotmail.com.
Palabras clave: Allium sativum, vida de anaquel, calidad de carne.

Introduccin
La industria crnica emplea diversos mtodos para retrasar los cambios deteriorantes y
prolongar el periodo de aceptabilidad, mismos que se relacionan directamente con la
presencia de microorganismos. En la actualidad, se busca la combinacin de dos o ms
factores que interaccionen sinrgicamente, para controlar la poblacin microbiana y evitar
la aplicacin de un solo factor de conservacin, lo que mejora la calidad sensorial y
nutrimental del alimento y permite la produccin de alimentos mnimamente procesados
(1). El uso de antimicrobianos artificiales es comn en la industria de la carne, sin
embargo, actualmente son rechazados por parte de los consumidores. Por lo cual, ha
surgido la necesidad de buscar otros antimicrobianos de origen natural. El ajo (Allium
sativum) es un antimicrobiano natural con una amplia gama de propiedades nutracuticas,
debido a su contenido de compuestos sulfurados secundarios, entre ellos la alicina.
Igualmente, se ha demostrado el efecto benfico del extracto de ajo sobre la salud de
animales, como es el caso de los conejos y sobre la carne de stos, en la cual, puede
prolongarse la vida til y, por consiguiente, la seguridad del consumidor. El deterioro de la
carne de conejo en refrigeracin, se debe a la actividad de enzimas endgenas junto con
la actividad de microorganismos contaminantes del producto durante el proceso de
faenado y despiece. Cuando el producto se distribuye en temperaturas de refrigeracin, la
carne tiene una vida de anaquel entre 6 y 8 das, tal como algunos reportes lo han
mencionado (6). Aunque existen reportes de la utilizacin de extracto de ajo en carnes de
diferentes especies, no se ha evaluado la carga microbiana al adicionar el extracto en la
dieta en conejos. Derivado de lo anterior, el objetivo de este estudio fue evaluar el efecto
de la adicin de extracto acuoso de ajo en la dieta de conejos, sobre la calidad fsica y
microbiolgica de la carne en vida de anaquel.

Materiales y mtodos

Engorda
El estudio se realiz en la Granja Matriz de Distribuidora de Conejos Nezahualcyotl
(DISCONNEZA), ubicada en el Municipio de Nezahualcyotl, Estado de Mxico.
El extracto acuoso de ajo (EAA) se elabor a partir de una dilucin madre de 0,125 g/mL
(8). Para lo cual, los ajos sin cascara se licuaron por 5 min (ster 6630-13) y dicho
extracto se filtr dos veces con gasas. El EAA resultante se almacen en refrigeracin (4
C) hasta su uso. Se utilizaron 84 conejos destetados (PV 1,10,4 kg) machos y hembras,
en un sistema modular dispuesto en piso, equipado con bebederos automticos tipo tetina
y tolvas de alimentacin. Los cuales, se dividieron en tres tratamientos; grupo testigo GT
(sin EAA aadido), tratamiento 1 (T1: 0,9 % EEA) y tratamiento 2 (T2: 1,8 % EAA). Los
extractos fueron asperjados sobre el alimento comercial (Conejo plus unin Tepexpan;

46
Investigaciones en Ciencia e Inocuidad de Alimentos

protena bruta: 16,5%; grasa cruda: 3%; fibra cruda: 15%; cenizas: 9% y humedad: 12%)
cada tercer da. Agua y alimento fueron proporcionados add libitum.
Faenado
Los conejos fueron restringidos de alimento 12 h para ser faenados. Se aturdieron por
dislocacin atlanto-occipital (NOM-033-SAG/ZOO-2014), se degollaron y desangraron, se
evisceraron mediante un corte en la lnea alba para retirar las vsceras abdominales y
torcicas. Por ltimo, se cortaron las extremidades y se disminuy la temperatura de la
canal hasta 4 C. Las canales fueron identificadas y transportadas a temperatura de
refrigeracin al Laboratorio de Calidad de los Productos Agropecuarios, Facultad de
Ciencias Agrcolas de la Universidad Autnoma del Estado de Mxico, para los anlisis
correspondientes.
Anlisis microbiolgicos
Se cuantificaron por duplicado las Unidades Formadoras de Colonias (UFC) de
Coliformes Fecales, Mesfilos Aerobios y Psicrfilos. La AFNOR-NF-V0860-1996 se us
para la cuenta de Coliformes Fecales, ya que en Mxico no hay Norma Oficial para estos
microorganismos. Para Mesfilos Aerobios y Psicrfilos, se procedi con la NOM-092-
SSA1-1994. Los anlisis subsecuentes se realizaron en las muestras tomadas del mismo
msculo durante los das 1, 3, 5, 7 y 9 en vida de anaquel a 4 C, por duplicado.
Anlisis estadstico
A los resultados del estudio microbiolgico obtenidos, se les aplic un Anlisis de
Varianza Multivariado (P0,05) para determinar el efecto de los tratamientos y vida de
anaquel, donde las variables de estudio fueron los tratamientos (GT, T1 y T2). Las
variables respuesta: UFC de Coliformes Fecales, Mesfilos Aerobios y Psicrfilos. Para
los valores que presentaron diferencias significativas, se realiz la prueba de Tukey al 5%.

Resultados y discusin
Despus de realizar el Anlisis de Varianza Multivariado se encontr que existieron
diferencias significativas (P0,05) para Mesfilos Aerobios y Psicrfilos en vida de
anaquel y para pH en la combinacin tratamiento por vida de anaquel. Al encontrar
diferencias significativas para estas variables, se aplic una prueba de Tukey 5% que se
presenta en la tabla 4.
En Mesfilos Aerobios, existieron diferencias significativas (P0,05) para vida de anaquel,
nicamente en el GT, en el cual se formaron tres grupos estadsticamente diferentes
(Tabla 1). El rango con el que se inici la vida de anaquel en los tres tratamientos para
esta poblacin microbiana fu de 1,50 a 2,23 log10 UFC/cm2. Aunque en la Norma
Mexicana no se indica un valor de referencia para esta poblacin microbiana en carnes
crudas de otras especies, se sugiere considerar que la Unin Europea de acuerdo a la
Directiva 2001/471/CE reporta valores aceptables menores a 3,50 log10 UFC/cm2 y no
existen reportes para la carne de conejo. As, en el ltimo da de la vida de anaquel del
presente experimento (da 9) todos los tratamientos se encontraron dentro de los lmites
permisibles, aunque no hubo diferencias significativas (P0,05) entre ellos. Los
tratamientos concuerdan con los lmites establecidos en el primer da en vida de anaquel.
La presencia de Mesfilos Aerobios se usa como indicador general de higiene y de la
poblacin de microorganismos presentes, da una idea de la calidad del manejo y
manipulacin de la carne, incluye bacterias, mohos y levaduras capaces de desarrollarse
a 30 C. Otros estudios en carne de conejo sin ningn antimicrobiano, reportan valores
ms altos de Mesfilos Aerobios (5,87 log10 UFC/cm2) que exceden el lmite permisible (7).
En el presente estudio, no hubo diferencia significativa (P0,05) al final de la vida de
anaquel en sta variable, lo cual sugiere que el manejo e higiene fue el indicado en los
tres tratamientos.

47
Investigaciones en Ciencia e Inocuidad de Alimentos

Para el caso de los Psicrfilos hubo diferencias significativas (P0,05) en vida de anaquel
pero no entre tratamientos. El rango que se present al inicio de la vida de anaquel fue de
1,57 a 2,01 log10 UFC/cm2. En la vida de anaquel la cintica de crecimiento mostr que el
T2 comienza con una carga mayor (2,01 log10 UFC/cm2) en comparacin del GT y T1. Sin
embargo, en el da 9 de vida de anaquel del T2 el nmero de UFC (3,02 log10 UFC/cm2)
en comparacin con el GT y T1 (3,19 y 3,40 log10 UFC/cm2, respectivamente) fue menor.
Por lo que el crecimiento de Psicrfilos fue disminuido en el T2. Estos microorganismos
son importantes para predecir la estabilidad del producto bajo condiciones de refrigeracin
y se sugiere que el T2 mostr la mayor estabilidad, aunque no existen normativas para
sus lmites permisibles en carne de conejo. En Mesfilos Aerobios y Psicrfilos, existe
problemtica para establecer lmites mximos permisibles, ya que la carne es un producto
que mayoritariamente, antes de ser consumido pasa por un proceso de coccin, donde se
alcanzan altas temperaturas que eliminan dichos microorganismos. Otros trabajos,
mencionaron que el ayuno de 24 h mejora la calidad microbiolgica ya que, al vaciarse el
tracto digestivo, disminuye la presencia de microorganismos no deseables en la canal (4).

Tabla 1. Prueba de Tukey (5%) sobre el perfil fsico y microbiolgico, durante la vida de
anaquel de carne de conejo.
Tratamiento
P EEM
GT 1 2
MA (log10 UFC/ cm2)
Da 1 1,50x 2,15 2,23 0,092 0,208
Da 3 2,08xy 2,35 2,18 0,675 0,210
Da 5 2,58xy 2,65 2,54 0,960 0,258
Da 7 2,46xy 2,51 2,68 0,642 0,167
Da 9 3,01y 2,99 2,40 0,460 0,371
P 0,009 0,097 0,781
PSI (log10 UFC/ cm2)
Da 1 1,57x 1,65x 2,01x 0,348 0,207
Da 3 2,43xy 2,30y 2,77xy 0,255 0,182
y z y
Da 5 2,90 2,85 2,99 0,805 0,156
Da 7 2,01xy 2,21y 3,15y 0,064 0,286
Da 9 3,19y 3,40z 3,02y 0,474 0,206
P 0,015 0,000 0,016
GT: Grupo testigo (sin EAA aadido), tratamiento 1 (0,9 % EEA) y tratamiento 2 (1,8 %
EAA). P<0,05 indica diferencias significativas, MA: Mesfilos Aerobios, PSI: Psicrfilos,
EEM: Error Estndar de la Media. x,y,z. Medias con diferente letra en la misma columna
son estadsticamente diferentes (P<0,05).

No existi crecimiento de Coliformes Fecales en ninguno de los tratamientos. La carga


inicial es proporcional a la poblacin final que se alcance en una carne durante su vida
til. Las bacterias se reproducen exponencialmente, por lo que una poblacin inicial alta,
resultar en menor tiempo para alcanzar los niveles en que la carne se descomponga. El
T2 se asemeja a los resultados de (5), quienes evaluaron la capacidad antimicrobiana de
extractos de ajo obtenidos por solventes adicionados a medallones de carne molida de
cerdo. Los resultados mostraron que todos los extractos inhiban el crecimiento de Listeria
monocytogenes y Escherichia coli 0157:H7. De igual forma, se investig el potencial
antimicrobiano, de algunos compuestos azufrados presentes en el ajo contra el
crecimiento microbiano de carne de res. Se inhibi a cinco cepas inoculadas
intencionalmente (Salmonella typhimurium, Escherichia coli, Listeria monocytogenes,
Staphylococcus aureus y Campylobacter jejuni). As el crecimiento microbiano se

48
Investigaciones en Ciencia e Inocuidad de Alimentos

comport semejante a los resultados de (3), con ajo fresco y en polvo y que tambin
reportaron un retardo en crecimiento microbiano en la conservacin de carne de camello.
Otros estudios han probado la efectividad de extractos de ajo en la conservacin de
canales de aves frescas almacenadas en refrigeracin y han obtenido una reduccin
significativa en la contaminacin microbiana, inhibiendo el crecimiento de
microorganismos Mesfilos y reduciendo el crecimiento de Coliformes Totales y Fecales
(2), mismos que concuerdan con la inhibicin de Coliformes Fecales en este estudio. As
la solucin acuosa de 1,2 mL de ajo adicionada a los conejos, se sugiere como un
presunto paso prometedor para el presente experimento.

Conclusiones
La adicin del extracto acuoso de ajo en la dieta de conejos, tiene un efecto positivo en la
vida de anaquel ya que se mantiene la calidad microbiolgica de la carne a travs del
tiempo y aumenta dos das (total de 9 das), al disminuir la cuenta de Psicrfilos.

Bibliografa

1. Briens C, Arturo-Schaan M, Grenet L, Robert F (2005). Effect of plant extracts on antioxidant


status of fattening rabbits. Proc. 11mes Journes de la Recherche Cunicole, 2005 November,
Paris, France. 217-220.
2. De Moura K, Santo R, De Miranda L, Vanetti M (2005). Aqueous garlic extract and
microbiological quality of refrigerated poultry meat. Journal of Food Processing and
Preservation. 29: 98-108.
3. Gheisari HR, Ranjbar VR (2012). Antioxidative and antimicrobial effects of garlic in ground
camel meat. Turkish Journal of Veterinary and Animal Sciences. 36: 13-20.
4. Margenda I, Martn NN, Rebollar PG, Robinson MV, Fernndez LS, Machota SV, Nakyinsige
K, Fatimah AB, Aghwan ZA, Zulkifli I, Goh YM, Sazili AQ (2014). Bleeding efficiency and meat
oxidative stability and microbiological quality of New Zealand White rabbits subjected to halal
slaughter without stunning and gas stun-killing. Asian-Australasian Journal of Animal Sciences.
27(3): 406.
5. Park SY, Chin KB (2010). Evaluation of preheating and extraction solvents in antioxidant and
antimicrobial activities of garlic, and their application in fresh pork patties. International Journal
of Food Science and Technology. 45: 365-373.
6. Pereira M, Malfeito M (2015). A simple method to evaluate the shelf life of refrigerated rabbit
meat. Food Control. 49: 70-74.
7. Rodrguez-Calleja JM, Santos JA, Otero A, Garca-Lpez ML (2004). Microbiological quality of
rabbit meat. Journal of Food Protection. 67(5), 966-971.
8. Salem AZ, Ryena AC, Elghandour MM, Camacho LM, Kholif AE, Salazar MC, Mariezcurrena
MA (2014). Influence of Salix babylonica extract in combination or not with increasing levels of
minerals mixture on in vitro rumen gas production kinetics of a total mixed ration. Italian Journal
of Animal Science.13 (4): 3110.

49
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto del pretratamiento por fermentacin en medio slido en la


purificacin qumica de quitina en exoesqueletos de chapuln (Sphenarium
purpurascens)

1 2 3 4
Adolfo Amador Mendoza, Erasmo Herman y Lara, Sergio Huerta Ochoa, Isabel Membrillo
2 4
Venegas, Maria de los ngeles Vivar Vera y Laura Patricia Ramrez Coutio
.
1 2
Instituto Tecnolgico Superior de Juan Rodrguez Clara, Instituto Tecnolgico de Tuxtepec,
3 4
Departamento de Biotecnologa, UAM-Iztapalapa, Tecnolgico de Estudios Superiores de
4
Ecatepec y Instituto de Biotecnologa, UNPA-Tuxtepec.

Palabras clave: Fermentacin, quitina, chapuln.

Introduccin
Debido a la similitud en el contenido de quitina de los exoesqueletos de crustceos
(camarn 13.1-23.2%) en comparacin con los de insectos sobre todo con los que son
considerados plaga se decidi realizar un estudio sobre la implementacin de
fermentaciones cido lcticas e hidrolisis qumica en una fuente quitinosa poco reportada
como el Chapuln (Sphenarium purpurascens). Esta fuente en particular en el estado de
Oaxaca, es considerada como una plaga en los cultivos de maz, frijol, soya y alfalfa,
donde la poblacin en diferentes municipios o localidades todos los das comienzan la
cosecha entre 400-500 h, lo que facilita la captura debido a la disminucin del
metabolismo de los insectos a temperaturas ms fras. Permitiendo a cada familia de la
localidad obtener alrededor de 50-70 kg de saltamontes semanal. Se estima que al menos
se extraen 75-100 toneladas (peso fresco) por ao en este valle. Sin embargo, la
demanda nacional es baja con respecto a la produccin, por lo que las ventas son lentas
quedando material sin aprovecharse. Por tal motivo, esta investigacin consiste en
establecer nuevas fuentes de quitina y estudiar el proceso biolgico para la extraccin de
quitina por fermentacin en medio slido para la desproteinizacin y descalcificacin del
material obtenindose quitina como producto final.

Metodologa
Muestras: se utilizaron exoesqueletos de Chapuln (Sphenarium purpurascens) que fueron
adquiridos en la comunidad de Ocotln en la ciudad de Oaxaca. Fuente de Carbono: Se
utiliz melaza de caa de azcar, que se adicion en una proporcin de 18% (p/p)
(Ramrez-Ramrez et al., 2009). Microorganismos. Los microorganismos probados para la
fermentacin fueron 3 cepas de bacterias cido lcticas comerciales (L. plantarum BG-
112, L. acidophilus LA-3, y L. rhamnosus SP-1). Fermentacin cido lctica: Los desechos
quitinosos se mezclaron con la melaza, posteriormente, se inocularon al 5% (p/v base
hmeda) cepas cido lcticas reactivadas previamente. Anlisis de los fermentados: Se
tomaron muestras por triplicado (3 a 5 g por determinacin) a diferentes tiempos (0, 24,
48, 74, 96 y 120 hrs) de los microfermentados de exoesqueletos de chapuln para sus
respectivos anlisis: % Humedad (H), Actividad de Agua (Aw), % Cenizas, % Acidez Total
Titulable (ATT), Potencial de Hidrgeno (pH), % Protenas, Anlisis microbiolgicos y
Anlisis de color. Hidrlisis Alcalina (Desproteinizacin): Se realiz en una solucin
acuosa de Hidrxido de Sodio (NaOH) a 0.4 M, con una relacin (1/15) peso volumen
(p/v). Hidrlisis cida (Desmineralizacin): Esta se efectu en una solucin de cido
clorhdrico (HCl) a 0.6 N en una relacin (1/15) (p/v). Despigmentacin: Consisti en
resuspender los residuos en una solucin de Hipoclorito de Sodio (NaClO). Anlisis de las
muestras: Se cuantific el contenido de protenas (Kjeldahl), minerales (cenizas) y en las
muestras quitinosas resultantes.

50
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin
En la figura1-(a) se observa la mayor disminucin del porcentaje de Humedad (en ambos
sustratos) se obtuvo con L. plantarum BG-112 (13.18%) en comparacin con L.
acidophilus LA-3 (12.19%) y L. rhamnosus SP-1 (11.11%) respectivamente, presentando
diferencias estadsticamente significativas para ambos sustratos (P<0.05). En la figura 1-
(b) se observ que existi una prdida del porcentaje de cenizas en los microfermentados
de chapuln, presentando una mayor prdida del porcentaje de desmineralizacin
(13.56%) y un menor tiempo de desmineralizacin (161.76 h) con la cepa L. plantarum
BG-112 en comparacin con L. acidophilus LA-3 (14.32%) y (257.19 h); y L. rhamnosus
SP-1 (16.091%) y (255.04 h) respectivamente, presentando diferencias estadsticamente
significativas (p<0.05). Una vez transcurridos los 5 das de fermentacin, los fermentados
presentaron un aumento en la produccin de cido lctico y por lo tanto una disminucin
en el pH, lo cual fue observado cuando estos fueron analizados a los diferentes tiempos
Figura 1-(c). Las FMS presentaron un aumento en el porcentaje de ATT (2.95%) con la
cepa L. plantarum BG-112, en comparacin con L. acidophilus LA-3 (2.42%); y L.
rhamnosus SP-1 (2.1%) y (102.542h); presentando diferencias estadsticamente
significativas (p<0.05) respectivamente. En la Figura 1-(d) se observa que existi una
mayor disminucin en el pH con Lactobacillus plantarum BG-112 (36.39%) en
comparacin con L. acidophilus LA-3 (33.2%) y L. rhamnosus SP-1 (30.95 %)
presentando diferencias estadsticamente significativas respectivamente, (p<0.05). La
actividad de agua disminuy considerablemente durante el proceso de 0.97 al inicio hasta
un valor de 0.93 a los 5 das para los fermentados con las tres cepas comerciales. Por
otra parte, se observ que existi una desproteinizacin, lo cual se evidenci por el
contenido de protena soluble y remanente en la fraccin lquida Figura 1-(e) y slida
Figura 1-(f) en los fermentados de chapuln, siendo mayor con L. plantarum BG-112
(32.26 g/mL de protena soluble) y (22.27 g/mL de protena remanente) en comparacin
con L. acidophilus LA-3 (27.39 g/mL de proteina soluble) y por ltimo el L. rhamnosus
SP1 con (23.69 g/mL de proteina soluble) presentando diferencias estadsticamente
significativas respectivamente, (p<0.05). En la Tabla 1 se observa que los fermentados
presentaron valores hasta de 281 103 UFC/g de bacterias mesfilas aerobias y 517
103 UFC/g de bacterias cido lcticas. Por otra parte, no se present crecimiento de
coliformes totales, hongos ni levaduras.

51
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 1. Cambios del porcentaje de humedad (a), % Cenizas (b), % Acidez Total
Titulable (c), Potencial de Hidrgeno (d), % Protenas soluble (e) y remanente (f), durante
la fermentacin utilizando ( ) L. rhamnosus SP-1, ( ) L. acidophilus LA-3 y ( )
L. plantarum BG-112 y ( ) Blanco.

Tabla 1.- Resultados de los anlisis microbiolgicos en los ensilados biolgicos de los
exoesqueletos de Chapuln.
Aerobias Mohos y
BAL Coliformes
Muestras Mesfilas Levaduras
(UFC/g) Totales (UFC/g)
(UFC/g) (UFC/g)
3 3
SP1 251 10 315 10 Ausente Ausente
3 3
Ensilados LA3 268 10 395 10 Ausente Ausente
3 3
Chapuln BG 112 285 10 517 10 Ausente Ausente
BLANCO Ausente Ausente Ausente Ausente

En la tabla 2 se presenta el anlisis colorimtrico donde se present un ligero aumento en


la coloracin representados con valores medios de H, S* L. Es decir, de Naranja muy
oscuro (Tono caf) (#553D2A) a Naranja oscuro (#EADEDE) respectivamente, estos
valores presentaron diferencias estadsticamente significativas (p<0.05).

52
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2.-Resultados del anlisis colorimtrico en los ensilados biolgicos de los


exoesqueletos de chapuln.1
COLORIMETRA CARTILLA
TIPO DE TIEMPO
#COLOR DE
MUESTRA (h) H *S *L COLOR
15.3 18.6 45.3
FMS 0 d d c #553D2A
0.02 0.01 0.01
Chapuln
26.3 26.2 42.5
120 a b d #EADEDE
0.01 0.01 0.02
1
Promedio de tres repeticiones error estndar. Valores promedio que no comparten una letra
son significativamente diferentes (P > 0.05).

En el tratamiento FMS-Hidrlisis qumica (Tabla 3) se obtuvo un porcentaje de protena


residual de 10.1860.09% y un porcentaje de cenizas residual de 4.5370.05%,
existiendo un aumento de 37.85% de desproteinizacin; y un 43.79% de
desmineralizacin respectivamente en comparacin con el tratamiento de FMS.
Alcanzando un mayor porcentaje desproteinizacin y desmineralizacin con el sustrato de
exoesqueletos de chapuln de 92.04 y 96.37% respectivamente.

Tabla 3.- Porcentajes de protenas, cenizas y descripcin del color obtenidos mediante el
mtodo qumico en los exoesqueletos de chapuln.1
CARTILLA
TIPO DE
%P %DP %M % DM #COLOR COLORIMETRA DE
MUESTRA
H S* L* COLOR
Chapuln Sin 52.97 h 19.21 h 26.5 33.9 24.9
e 0.00 a 0.00 #553D2A g g h
Tratamientos 0.02 0.02 0.01 0.02 0.01
Hidrlisis Alcalina 5.73 89.17 4.66 75.72 28 38.9 37.8
g f f g #865E3B f f g
Chapuln 0.02 0.04 0.02 0.03 0.01 0.04 0.02
Hidrlisis Acida 51.27 3.20 1.57 91.82 31.1 55.1 38.4
f g g f #98642C e e f
Chapuln 0.01 0.02 0.04 0.02 0.01 0.03 0.01
Despigmentacin 3.89 92.66 0.62 96.75 h 22.2 89.4
h e h e #EADEDE 0 h e
Chapuln 0.02 0.01 0.02 0.06 0.02 0.02
1
Promedio de tres repeticiones error estndar. Valores promedio que no comparten una letra son
significativamente diferentes (P > 0.05).
Conclusiones
Se ha demostrado que la metodologa a base del tratamiento combinado de FMS +
Qumico, nos permiti obtener quitina de chapuln siendo esta la que obtuvo mayor
porcentaje de Desproteinizacin y Desmineralizacin. El camarn fue el sustrato que
mejor se desproteiniz (94.04%) y el chapuln el sustrato que mejor desmineraliz
(96.37%). Sin embargo, cabe mencionar que para la eliminacin de los residuos qumicos
se efectu lavados continuos con un gasto de 18-20 litros/130 g de muestra.

Bibliografa
1. AOAC. (1990). Methods of Analysis (15th ed.). Association of Official Analytical Chemist.
Washington, D.C
2. Cira L, Huerta S, Hall G, Shirai K. 2002. Pilot scale lactic acid fermentation of shrimp wastes for
chitin recovery. Process Biochemistry. 37:1359-1366.
3. Ramrez-Ramrez, J. C. (2009). Aprovechamiento de fauna de acompaamiento del camarn y
subproductos pesqueros mediante la elaboracin de ensilado de pescado .

53
Investigaciones en Ciencia e Inocuidad de Alimentos

Cuantificacin de plomo por complejometra en muestras de atn


Martnez Chvez C. G., Alor Chvez M. J., Morales Bautista C. M.

Universidad Jurez Autnoma de Tabasco, Divisin Acadmica de Ciencias Bsicas. Km. 1


carretera Cunduacn-Jalpa de Mndez, Col. Esmeralda. Cunduacn, Tabasco. CP 86690. Tel.
(914) 3360928

lupitachavez94@hotmail.com

Palabras clave: plomo, complejometra, atn

Introduccin

El plomo y sus derivados se encuentran en todas partes del medio ambiente, como por
ejemplo, en el aire, en las plantas y animales de uso alimentario, en el agua potable, en
los ros, ocanos y lagos, en el polvo, en el suelo, etc. (1-2). El agua de mar contiene
entre 0,003 y 0,20 mg/L de plomo por lo que las concentraciones de este metal en aguas
marinas contribuyen a la contaminacin de los peces que habitan en ellas (3). De acuerdo
a la organizacin mundial de salud (OMS) los alimentos no deben presentar plomo; sin
embargo, se tienen en productos del mar, hortalizas, frutas y verduras por las actividades
industriales y a veces por la falta de conciencia de las personas al desechar residuos a los
mares, lagunas y ros. Recientemente se han encontrado trazas de metales txicos en
peces y mariscos del mar y ros, los metales traza como plomo, cadmio, arsnico,
mercurio son absorbidos y posteriormente acumulados por organismos tanto de fuentes
naturales como de los afluentes contaminados que entran en el medio acutico mediante
descargas directas, lo cual resulta preocupante por los riesgos a la salud de los
consumidores (4). Los nios y personas de la tercera edad son especialmente vulnerables
a los efectos txicos del plomo, que pueden tener consecuencias graves y permanentes
en su salud, afectando en particular al desarrollo del cerebro y del sistema nervioso. El
plomo tambin causa daos duraderos en los jvenes y adultos, por ejemplo, aumentando
el riesgo de hipertensin arterial y de lesiones renales. El paso de plomo de la madre al
feto se produce por un mecanismo de difusin simple, aunque algunos autores lo
relacionan con fenmenos de transporte de calcio. Las concentraciones de plomo
encontradas en el cordn umbilical son entre un 5 y un 10% inferiores a las plumbemias
maternas, existiendo una buena correlacin entre ambas (5) lo que puede ser causa de
aborto natural, muerte fetal, parto prematuro y bajo peso al nacer, y provocar
malformaciones leves en el feto (6),

El enlatado de los alimentos se define como la conservacin de los alimentos en


recipientes cerrados, donde se usa generalmente un tratamiento trmico como factor
primordial para prevenir las alteraciones, por lo tanto se cuenta con estndares de calidad
descritas en la NOM-242-SSA1 (7), que tiene por objeto establecer los requisitos
sanitarios para: las reas de captura de moluscos bivalvos; los establecimientos que
procesan productos de la pesca frescos, refrigerados, congelados y procesados,
incluyendo de igual manera las embarcaciones de pesca y recoleccin, as como
las especificaciones sanitarias que deben cumplir dichos productos.

El objetivo del presente trabajo fue cuantificar la concentracin de plomo en diversas


marcas comerciales de atn utilizando el mtodo por complejometra.

54
Investigaciones en Ciencia e Inocuidad de Alimentos

Metodologa

Las reacciones de formacin de complejos pueden utilizarse en anlisis volumtrico para


la determinacin de casi todos los iones metlicos. Como agentes complejantes se
utilizan con asiduidad algunas aminas con grupos de cido carboxlico. El cido
etilendiamino-tetraactico (por sus siglas EDTA) es el ms ampliamente utilizado en esta
clase de compuestos, por ello se trabaj con EDTA para la determinacin de plomo en las
3 marcas comerciales de atn, seleccionadas totalmente al azar en presentaciones en
aceite y en agua; para lo cual se analizaron pulpa de atn y los medios: agua y aceite,
cabe mencionar que todas las muestras fueron analizadas por triplicado, tambin se
consideraron precios econmico, moderado y alto.

Inicialmente el plomo presente en las muestras, es precipitado al estado de sulfato; el


producto disponible se manej por separado, ya que se filtr la pulpa, del medio, la cual
se coloc en un vidrio de reloj y se procedi a pesar en una balanza analtica para obtener
50 g de muestra, mismas que se les fue aadiendo unas gotas de cido actico, un ligero
exceso de cido sulfrico diluido y etanol hasta triplicar el volumen de la muestra.
Las muestras se dejaron reposar durante 24 h, para as obtener la mayor cantidad de
precipitado de sulfato de plomo. Posteriormente el precipitado se filtr y fue lavado con
una mezcla de alcohol-agua (1:1) por triplicado, al finalizar se dej secar en la estufa a
una temperatura de 60C durante 1 h.
El precipitado anteriormente lavado y secado se coloc en un matraz Erlenmeyer de 250
mL y se le adicion 50 mL de solucin EDTA 0.1 M, con el fin de lograr una disolucin
completa del complejo.
Para proceder a la valoracin, al matraz donde se coloc la muestra se le agregaron 30
mL de solucin buffer pH de 10.0 y de igual manera se le adicionaron 0.2 g de indicador
negro de Eriocromo T. Finalmente, se procedi a valorar con solucin de zinc 0.1 M y se
esper hasta obtener el viraje de azul a rojo.

Resultados y discusin

Para determinar la concentracin de plomo en las muestras se utiliz la siguiente frmula:

Donde V1 corresponde a volumen en exceso del EDTA (50 mL), M1 es la molaridad del
EDTA (0.1 M), V2 es el volumen de la solucin de cinc para valorar al EDTA, M2 es la
molaridad de la solucin del cinc (0.1 M), mM es el peso molecular del plomo y Vm es el
volumen de la muestra problema.

En la figura 1, se presentan los resultados obtenidos de la muestra A (menor costo)


tratada por triplicado para la determinacin del contenido de ion Pb. La concentracin es
mayor en el medio oleoso al igual que en la pulpa inmersa en este medio, por el contrario,
la pulpa inmersa en el medio acuoso presento menor concentracin considerando el
promedio en el triplicado.

55
Investigaciones en Ciencia e Inocuidad de Alimentos

Fig. 1. Concentraciones de ion Pb (plomo) en la marca comercial con menor costo.

Las concentraciones obtenidas en la marca comercial B (costo medio) presento


concentraciones menores en comparacin con la muestra A, donde nuevamente las
concentraciones mayores de ion Pb se presentaron en la pulpa de atn en medio oleoso y
a la cual le subsigui las concentraciones el medio acuoso, as como se muestra en la
figura 2.

Fig. 2. Concentraciones de plomo en la muestra de costo medio

La muestra C (mayor costo), presento las concentraciones ms bajas en comparacin a


las dos anteriores las cuales podemos observar en la figura 3. En donde la concentracin
mnima se encontr en el medio acuoso y respectivamente en la pulpa inmersa en dicho
medio.

Fig. 3. Muestra C presentando las concentraciones ms bajas de ion plomo

56
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones

Despus de haber analizado las tres muestras de atn comercial en sus dos medios:
agua y aceite; as como tambin tomando el criterio de costos al adquirirlo por el
consumidor; se concluye que las muestras analizadas de marca comercial econmica,
present mayor contenido de plomo en comparacin con las otras dos marcas. Cabe
destacar que tanto en el medio acuoso y oleoso presentaron concentraciones elevadas.

La concentracin de plomo en alimentos enlatados como en el caso del atn analizado


por Voegborlo et al.,(8) la concentracin fue de 0.28 g/kg, cada vez es ms evidente el
aumento de la concentracin de plomo, a pesar de que existen normas oficiales para el
control de calidad en productos de pesca como las que se estipula en la NOM-242-SSA1-
2009. De acuerdo a los resultados obtenidos y bibliografa consultada, siguen las
incidencias en cuanto a la concentracin elevada de plomo, reflejados en los resultados
obtenidos en las muestras atn enlatadas, las cuales son alarmantes ya que son las
preferentes entre los consumidores, encontrndose concentraciones mayores a los 14.5
ppm de plomo en la muestra con menor costo y que por dicho costo su consumo es
mayor, ya que resulta ms accesible para su compra, provocando un dao silencioso a
las familias mexicanas siendo los nios y ancianos los ms afectados. Finalmente, cabe
destacar que el mtodo por complejometra es un mtodo eficaz para la cuantificacin de
plomo en alimentos.

Bibliografa

1. ARTSDR (Agency for Toxic Substances and Disease Registry) (1993).


Toxicological profile for lead. U.S. Department of Health and Human Services.
Atlanta.
2. Llobet JM, Granero S, Schuhmacher M, Corbella J, Domingo JL (1998). Biological
monitoring of environmental pollution and human exposure to metals in Tarragona,
Spain. IV. Estimation of the dietary intake. Trace Elem Electroly. 15 (3). 136- 141.
3. Prez-Lpez M, Nvoa MC, Alonso J, Garca Fernndez MA, Melgar MJ. (2003).
Niveles de plomo y cadmio en agua marina y lapas (Patella vulgata L.) de la Ra
de Vigo. Rev Toxicol 20: 19-22.
4. Amal H. & Azza K. Determination of metals in tuna species and bivalves from
Alexandria, Egypt. Egyptian Journal of Aquatic Research (2014) 40, 9-17.
5. Torres-Snchez L, Lpez-Carrillo L, Ros C (1999). Eliminacin del plomo por
curado casero. Salud Pblica Mex 41: 106- 108.
6. Organizacin Mundial de la Salud. (2016). Intoxicacin por plomo y salud. [Fecha
de consulta 20/04/2017/,http://www.who.int/mediacentre/factsheets/fs379/es/].
7. Norma Oficial Mexicana NOM-242-SSA1-2009, Productos y servicios. Productos
de la pesca frescos, refrigerados, congelados y procesados. Especificaciones
sanitarias y mtodos de prueba.
8. Voegborlo RB, El-Methnani AM and Abedin MZ (1999). Mercury, cadmium and
lead content of canned tuna fish. Food Chemistry. 67: 341-345.

57
Investigaciones en Ciencia e Inocuidad de Alimentos

Determinacin de residuos de antimicrobianos en msculo y rin de cerdos


sacrificados en dos rastros municipales de la zona metropolitana de
Guadalajara
Magalln Carrizales, K.B., Pacheco Gallardo C., Noa Prez, M., Gonzlez Aguilar, D.G., Sigarroa
Reynoso, M.A.

Centro Universitario de Ciencias Biolgicas y Agropecuarias, Divisin de Ciencias Veterinarias,


Departamento de Salud Pblica, Camino Ramn Padilla Snchez No. 2100 Nextipac, Zapopan,
Jalisco. c.pacheco@academicos.udg.mx

Palabras clave: antibitico, resistencia bacteriana.

Introduccin

La regulacin de medicamentos veterinarios se orienta a controlar el uso y residualidad de


estas sustancias en las especies de produccin en las cuales son administradas; estos
aspectos son mundialmente vigilados por diferentes organizaciones, dentro de las cuales
se destacan la Organizacin de las Naciones Unidas para la Alimentacin y la Agricultura
(FAO) y la Organizacin Mundial de Salud (OMS) (3). En Mxico, existen programas,
normas oficiales y acuerdos que tienen como propsito controlar la presencia de
sustancias antimicrobianas en tejidos y otros productos de origen animal. La Modificacin
a la Norma Oficial Mexicana NOM-004-ZOO-1994 tiene por objeto establecer los lmites
mximos de residuos txicos (4). Algunos estudios en Mxico han demostrado la
diseminacin de la resistencia bacteriana, provocada por el uso indiscriminado de
antimicrobianos utilizados como promotores de crecimiento, pero hay escasa vigilancia
mediante la implementacin de monitoreos regulares por parte de las autoridades
correspondientes, o por la no implementacin de Buenas Prcticas Agropecuarias (BPA)
obteniendo como resultado resistencia bacteriana en el humano (6). Por lo tanto, el
objetivo de este estudio fue determinar la presencia de residuos de antimicrobianos en
msculo y rin de cerdos sacrificados en dos rastros municipales de la Zona
Metropolitana de Guadalajara durante el periodo de junio a diciembre de 2016.

Metodologa

La presente investigacin se elabor en el laboratorio de Residuos Txicos II del


departamento de Salud Pbica del Centro Universitario de Ciencias Biolgicas y
Agropecuarias. Se estableci un tamao de muestra de 203 cerdos en base a un nivel de
confianza del 99.9% y una frecuencia esperada del 5%; obteniendo porciones de rin y
msculo aproximadamente de 3 cm2 provenientes de 2 Rastros municipales de la ZMG en
el periodo de junio a diciembre de 2016. El total de las muestras obtenidas fueron 100
para el rastro 1 y 99 para el rastro 2, las muestras se sometieron a un anlisis cualitativo
mediante el mtodo microbiolgico de difusin en placa, preparando un medio de cultivo
para vaciar en cajas Petri con los siguiente componentes: Peptona de carne, Peptona de
casena, Cloruro de sodio, Agar bacteriolgico y Agua destilada. Los ingredientes se
disolvieron y se prepararon en las mismas concentraciones para tres matraces diferentes,
ajustando posteriormente el pH a 6, 7 y 8 con HCL o NaOH, segn sea el caso utilizando
un potencimetro. Seguidamente se colocaron los matraces en autoclave para su

58
Investigaciones en Ciencia e Inocuidad de Alimentos

esterilizacin a 120C por 15 minutos, y una vez estril, se inocularon con Bacillus subtillis
BGA a 106 UFC/ml (1).

Recoleccin, Preparacin y Procesamiento de Muestras.

Las muestras recolectadas de ambos rastros fueron previamente identificadas y


separadas en bolsas de polipropileno; para su transporte se utiliz una hielera para
mantener las muestras hasta su llegada al laboratorio a una temperatura de 4 a 7 C.
Posteriormente las muestras fueron congeladas durante 2 horas a una temperatura de -18
C con el fin de conservar tanto el tejido como el residuo antimicrobiano; las muestras de
msculo eran provenientes del diafragma, mientras que para rin se tom mdula renal.
Se obtuvo de cada muestra una porcin de 8 mm de dimetro y 2 mm de alto por medio
de un sacabocados previamente esterilizado; cortando de esta forma las porciones en
forma de cilindros.

En cada caja de Petri se colocaron, adems de las muestras, un disco testigo con los
antimicrobianos de referencia en papel filtro de 6 mm de dimetro: para pH 6 se utiliz
como control positivo 0.01 UI de Penicilina, para pH 7, 0.5 g/ml de Sulfonamidas y para
pH 8 a 0.5 g/ml de estreptomicina. Las cajas de Petri se incubaron durante 24 horas a
35C, midiendo los halos de inhibicin obtenido y registrando los resultados. Se clasific
la interpretacin de los resultados para cada muestra segn el tamao del halo de
inhibicin <1mm se consider negativo, de 1-2 mm sospechoso, mientras que halos >2
mm se consideran positivos (1).

Resultados y discusin

De las 100 muestras analizadas del rastro 1; de las 32 muestras analizadas de rin, 32
resultaron positivas (32%), 47 muestras fueron sospechosas (47%) y 21 resultaron
negativas (21%). En el caso de las muestras de msculo para el rastro 1; tan solo 2
muestras resultaron positivas (2 %), 10 muestras fueron sospechosas (10 %) y 88
resultaron negativas (88%).

De los 99 cerdos analizados en el rastro 2; 25 muestras de rin resultaron positivas


(25%), 38 fueron sospechosas (38%) y 36 muestras resultaron negativas (36%). En el
caso de las muestras de msculo para el rastro No. 2; 4 resultaron positivas (4%), tan slo
2 muestras fueron sospechosas (2%) y 93 muestras resultaron negativas (93%) (Figura
1).

En base a los resultados, segn el pH de la placa, se puede asumir que el residuo


detectado pertenecen a un tipo de antimicrobiano determinando que en el pH6 la difusin
de residuos del grupo de -lactmicos y tetraciclinas, para el pH7 del grupo de
sulfonamidas y para pH 8 del grupo de aminoglucsidos. Por lo tanto las muestras
tuvieron una frecuencia de resultados como lo muestra el cuadro N 1 para el rastro 1 y
para el rastro 2 en el cuadro N 2 en los diferentes pH.

59
Investigaciones en Ciencia e Inocuidad de Alimentos

Cuadro 1. Frecuencia de muestras de msculo y rin del rastro 1

Tejido pH 6 pH7 pH8

P N S P N S P N S

Msculo 2 98 0 0 100 0 0 90 10

Rin 32 21 47 19 26 55 16 27 57

P: Positivo N: Negativo S: Sospechoso

Cuadro 2. Frecuencia de muestras de msculo y rin del rastro 2

Tejido pH 6 pH7 pH8

P N S P N S P N S

Msculo 4 93 2 0 99 0 0 99 0

Rin 25 36 38 21 37 41 6 45 48

P: Positivo N: Negativo S: Sospechoso

La mayora de los xenobiticos son eliminados rpidamente del tejido muscular, por lo
que las muestras de msculo positivas evidencian ms de un nivel farmacolgico, que de
un nivel de residuos. La causa de la presencia de residuos en las muestras positivas
podr atribuirse al uso indiscriminado de antibiticos en las granjas de cerdo y se podr
suponer que el envo de animales al rastro se realiz son respetar los tiempos de espera
para la eliminacin de esos medicamentos. (5). Gimeno, 2005 menciona que cuando se
realiza un tratamiento con antimicrobianos, ste va a persistir en el organismo del animal
durante un tiempo en forma de residuo, quedando como portadores de stos, por lo que
es necesario cumplir con los tiempos de espera que permitan una completa eliminacin
del organismo del animal. Los resultados obtenidos demuestran que se estn enviando al
sacrificio cerdos que no han cumplido con el periodo de eliminacin marcado para el
medicamento.

Se asume que las muestras son positivas a -lactmicos en el rastro 1 por su presencia
en las placas de pH 6 y en el rastro 2 hay mayor nmero de resultados positivos a pH 7
alusivo a residuos de sulfonamidas. Debido a la mayor presencia de residuos en tejido
renal, se le atribuye a que no se estn respetando los periodos de restriccin establecidos
requiriendo mayor vigilancia por parte de las autoridades a la presencia de estos residuos
en carne de cerdo.

Conclusiones

Se detectaron residuos de antibiticos en 32 muestras en rin (32 %) en el rastro 1 y 25


25% en el rastro 2, con diferentes familias qumicas, siendo preponderante para ambos
casos los - lactmicos.

60
Investigaciones en Ciencia e Inocuidad de Alimentos

Bibliografa

1. Bogaerts R; Wolff F; Brussels.(1985) A standardized method for the detection of residues of


antibacterial substances in fresh meat, Fleischwirtsch, 60 4.
2. Gimeno O., Ortega C. (2005). Antibioterapia y Salud Pblica veterinaria: Desarrollo de
microorganismos resistentes, mecanismo de resistencia y estrategias para el uso prudente
de antibiticos. http://es.slideshare.net/Aurammm3/resistencia-bacteriana-34551106.
consultada 9-11-2016
3. Lozano M.C. y Arias D.C. (2008). Residuos de Frmacos en Alimentos de Origen Animal:
Panorama Actual en Colombia. Revista Colombiana de Ciencias Pecuarias. Vol. 21 No.14.
Bogot, Colombia.
4. Secretara de Agricultura, Ganadera, Desarrollo Rural, Pesca y Alimentacin. SAGARPA.
(2011). PROYECTO de Modificacin a la Norma Oficial Mexicana NOM-004-ZOO-1994,
Grasa, hgado, msculo y rin en aves, bovinos, caprinos, crvidos, equinos, ovinos y
porcinos. Residuos txicos. Lmites mximos permisibles y procedimientos de muestreo.
Diario Oficial de la Federacin. Mxico, D.F. Web:
http://dof.gob.mx/nota_detalle.php?codigo=5189138&fecha=12/05/2011. consultada 9-11-2016
5. .Sumano, L. H. y Ocampo, C. (2003) Farmacologa Veterinaria. 2da ed. Mcgraw-Hill
lnteramericana, Mxico. 117-205.
6. Witte W.(1999). Uso de antibiticos en la produccin animal y desarrollo de la resistencia
en las infecciones humanas. Enfermedades infecciosas y Microbiologa. Vol. 19, Nm. 2.
Pg. 83 86

61
Investigaciones en Ciencia e Inocuidad de Alimentos

Comparativo analtico de la nata (crema) de rancho vs procesada de origen


animal
Gonzlez Rodrguez, M., Ramirez Noriega, R., y Garca Domnguez, E.
Tecnolgico de Estudios Superiores de San Felipe del Progreso. Divisin de Ingeniera Qumica.
Av. Instituto Tecnolgico S/N, Ejido de San Felipe del Progreso. San Felipe del Progreso, Estado
de Mxico C.P. 50640, Mxico. Tel.: 7121725240, erik_gdominguez@yahoo.com.mx

Palabras clave: nata lctea, leche bronca,

Introduccin

Dentro de los productos alimenticios bsicos se encuentra la leche de animal vacuno, de


la se derivan varios productos como lo es la nata (crema), estas aportan al humano un
contenido de grasas y adems ayudan a la asimilacin de vitaminas liposolubles. Sin
embargo un alto consumo de estos productos lcteos pueden llegar a causar
enfermedades de obesidad, cardiovasculares, principalmente cuando se consumen este
tipo de cremas lcteas. Como todo producto alimenticio debe cumplir con anlisis
fisicoqumicos; la nata (crema) de la leche bronca tambin se define como una emulsin
tipo "grasa en agua", que puede llegar a contener aproximadamente 27% de slidos
totales, 19% de grasa, 2,9% de protenas, 4% de lactosa, 0,6% de cenizas y 73% de
agua; encontrando en el comercio cremas con diferentes contenidos composicionales (4)
y de acuerdo a la norma CODEX STAN 288-1976, la define como un producto lcteo que
se obtiene por fermentacin de la nata (crema), nata (crema) reconstituida o nata (crema)
recombinada por la accin de microorganismos adecuados, lo cual resulta en una
reduccin del pH con o sin coagulacin. Existen una gran variedad de cremas lcteas
desde procesadas y no procesadas, como las que se obtienen directamente de la leche
bronca. Para la elaboracin de este tipo de productos deben cumplir con la Norma
General para los Contaminantes y las Toxinas presentes en los Alimentos y Piensos
(CODEX STAN 193-1995); as como de higiene se recomienda que los productos
abarcados por las disposiciones de esta norma se preparen y manipulen de conformidad
con las secciones pertinentes de los Principios Generales de Higiene de los Alimentos
(CAC/RCP 1-1969). Por lo que en la presente investigacin se evalu una nata de rancho
que se consume en el municipio de San Felipe del Progreso (centro), Edo. de Mxico
comparndola con una procesada (industrialmente) mediante anlisis analticos como
densidad, viscosidad, pH, ndice de Refraccin y contenido de acidez a nivel in vitro.

Metodologa

Se realizarn los anlisis analticos de la nata de rancho asi como de una procesada
industrialmente.

Determinacin de pH:
Primero se calibro el potenciometr con soluciones buffer pH 4.0, 7.0 y 10.0; despus se
midiern 10 mL de la muestra en un vaso de precipitado de 10 mL a una temperatura de
22 C 2. El anlisis se realiz por triplicado para cada muestra respectivamente.

62
Investigaciones en Ciencia e Inocuidad de Alimentos

Determinacin de viscosidad:
Para la medicin de viscosidad se midiern 250 mL de cada una las mustra
respectivamente, utilizando un viscosimetro BROOKFIELD-SPEED a 12 rpm a una
temperatura de 22 C 2. El anlisis se realiz por triplicado de cada una de las
muestras.

Determinacin de densidad:
Se midiern 10 mL de la muestra en un vaso de precipitado y se pesarn en una balanza
analtica a una temperatura de 22 C 2. El calculo se realiz mediante la siguiente
ecuacin:
= m/V
= densidad (g/mL)
m = masa (g)
V = volumen (mL)

Determinacin del ndice de Refraccin (IR):


Se calibro el refractomtro con agua destilada, despus se coloc una gota de la muestra.
El anlisis se realiz por triplicado de cada una de las muestras.

Determinacin de contenido de acidez (cido lctico) (2).


Se colocaron 20 mL de nata en un vaso de precipitado y se le midi su pH inicial, despus
se le aadi NaOH 0.1 N hasta alcanzar un pH de 8.3.
Calculos
V = mL de NaOH 0.1 gastados en la titulacin
N = Normalidad del NaOH
M = Volumen de la Muestra (mL)
90 = equivalente del cido lctico
Acidez (g/mL) = (V)(N)(0.09)(100)
(M)
NOTA: 1 mL de NaOH 0.1 N equivale a 0.09 g de acidez

Determinacin de cenizas:
Se midiern 10 mL de la muestra en una capsula se porcelana previamente a peso
constante, la capsula se introdujo en una mufla a 500 C durante 1 hora. El calculo se
realizo por diferencias de pesos. La prueba se realiz por triplicado de cada una de las
muestras.

% cenizas = (P p) X100
M+p
P = Masa de la capsula con cenizas (g)
p = Masa de la capsula vaca (g)
M = Masa de la muestra (g)

Resultados y discusin

En la figura 1, se muestran imgenes de la realizacin de los anlisis de las natas de: pH,
densidad, viscosidad, ndice de Refraccin y cenizas, respectivamente tanto para la nata
de rancho como la procesada industrialmente.

63
Investigaciones en Ciencia e Inocuidad de Alimentos

d
a

e
b

c
Fig. 1. Imgenes de anlisis: a) cenizas, b) acidez, c) viscosidad, d) ndice de Refraccin,
e) pH. (Fuente propia).

En cuadro 1, se presentan los resultados de los anlisis de las tres repeticiones para cada
variable de la nata evaluada; para el pH se muestra que la nata de rancho es ms cida
que la procesada, se consideran que las cremas de leche de origen animal (vacuno)
procesadas industrialmente se pueden clasificar como alimento semi-cidos con un pH
menores de 3.7 son considerados como alimentos fuertemente cidos y como cidos,
aquellos que se encuentren en un rango de pH de 3,7 a 4,6 (1). La densidad de la nata
de rancho fue de 1.02 y la comercial de 1.03 g/mL con una diferencia mnima de 0.01 de
acuerdo con la NMX-F-737-COFOCALEC-2010, establece que la densidad es de 1.029
g/mL, por lo que la nata de rancho est dentro de especificaciones. Para los valores de
viscosidad el porcentaje de diferencia entre los dos tipos de natas fue de 1.1%; los
porcentajes de cenizas fueron entre 2.16% y 2.68 esto puede atribuirse del contenido de
minerales, en una investigacin en cremas procesadas en agroindustrias mostraron
resultados entre 0.81-1.77% de cenizas (3), para ndice de Refraccin ndice de acidez

Cuadro 1. Resultados comparativos de los dos tipos de natas.

Tipo de nata pH Densidad Viscosidad Cenizas ndice de ndice de


(g/mL) (cp) (%) Refraccin acidez
(Brix) (cido
Tipo de lctico)(%)
anlisis
Rancho 4.57 1.02 7.5 2.16 7.0 0.22

Procesada 5.0 1.03 6.4 2.68 8.0 0.31


(industria)

Conclusiones
La nata de leche de rancho en el municipio de San Felipe del Progreso (centro) Edo. De
Mxico, presento especificaciones similares con la nata procesada industrialmente,
considerndola de acuerdo a la CODEX ALIMENTARIUS. 2000. Nata (crema) como una
crema semi-acida que se encuentra dentro de los parmetros de las cremas lcteas para
consumo.

64
Investigaciones en Ciencia e Inocuidad de Alimentos

Bibliografa
1. Banwart, G. 1982. Microbiologa Bsica de los Alimentos. Editorial Del Hombre. Espaa. 646
p.

2. NMX-F-206-1986. Alimentos. Lcteos. Determinacin de Acidez Expresada como cido


Lctico en Leche en Polvo. Foods. Lacteous. Acidity Expressed as Lactic Acid in Powder Milk
Determination. Normas Mexicanas. Direccin General de Normas.

3. Pacheco, D. E., Rojas, A., Salinas, N. 2008. Caracterizacin fsico qumica de cremas de
leche. Revista de la Facultad de Agronoma. ISSN 0378-7818. Vol. 25, Nm. 2.
http://www.scielo.org.ve/scielo.php?script=sci_arttext&pid=S0378-78182008000200007

4. Tamsut, L. y E. Garca. 1999. Calidad microbiolgica de las cremas de leche pasteurizadas


elaboradas en Venezuela. Archivos Latino-americanos d de Nutricin 49(1):76-80.

65
Investigaciones en Ciencia e Inocuidad de Alimentos

Evaluacin de la aceptacin y caracterizacin de una barra de Cereales y


leguminosa adicionada con Pleurotus ostreatus

Lpez-Rivera, D.J., y Canale-Guerrero, A.*


Departamento de Salud Pblica, CUCBA, Universidad de Guadalajara.
Km 15.5 Carretera Guadalajara a Nogales, Camino Ing. Ramn Padilla Snchez # 2100, ejido de
Nextipac, Zapopan, Jalisco. CP. 45110. Tel. 37771150, ext. 33107.
* Corresponding author: alejandro.cguerrero@academicos.udg.mx

Palabras clave: Barra, Protena, Pleurotus ostreatus.

Introduccin
La posibilidad de desarrollar alimentos con menos carga calrica y mayor contenido
protenico es cada vez mayor, si se considera que pueden formularse con ingredientes
naturales que intensifiquen los atributos sensoriales del producto de manera positiva, tales
como los productos fermentados y alimentos alternativos de origen natural, como las
setas, debido a la liberacin de compuestos funcionales (-glucanas, glicoprotenas,
terpenos, lectinas) (1). El consumo en Mxico de setas frescas es bajo, comparativamente
con la demanda observada en otros pases (5). Los estudios respecto de los beneficios
que las setas proporcionan a la salud, estn ampliamente documentados aunque esta
informacin es desconocida por el gran pblico. Segn algunos investigadores (3),
Pleurotus ostreatus tiene propiedades antidiabticas, antibacterianas,
anticolesterolmicas, antiartrticas, antioxidantes, anticancergenas y antivirales, adems,
se ha encontrado que una fraccin soluble de un extracto alcohlico-agua, del micelio de
Pleurotus ostreatus, crecido en medio lquido, mostr una accin antiproliferativa y pro-
apoptsica significativa, contra clulas cancerosas (4). Para lograr un mayor consumo de
setas entre la poblacin mexicana, es necesario incluirlas en alimentos de mayor
consumo. Los hbitos alimenticios de las personas han cambiado debido al acelerado
estilo de vida que llevan, convirtiendo las barras en una opcin prctica de alimento
rpido (2). Los objetivos de este trabajo fueron el conocer de manera preliminar la
aceptacin entre el pblico, de una barra de cereales, leguminosa, y miel adicionada con
Pleurotus ostreatus mediante una evaluacin sensorial y analizar su composicin qumica
nutrimental y calidad microbiolgica.

Metodologa
Formulacin y elaboracin del producto.
Los carpforos del hongo Pleurotus ostreatus se lavaron, desinfectaron y deshidrataron a
45C durante 24 h. Posteriormente, se molieron e incorporaron al resto de los ingredientes
troceados (avena, cacahuate, amaranto, miel de abeja). La mezcla se horne durante 20
min a 180C y se enfri a temperatura ambiente para despus cortar las barras.

Evaluacin sensorial
Se aplicaron 100 encuestas estructuradas a hombres y mujeres entre 18 y 42 aos de
edad, en las instalaciones del CUCBA para evaluar la barra mediante una prueba
hednica de 5 puntos, donde 1 significa, me desagrada mucho y 5 significa me gusta
mucho, en la que se evaluaron los atributos de sabor, color, olor y textura, ms la
instruccin de indicar por escrito observaciones a su respuestas.
Para reportar los datos, se realiz un anlisis estadstico descriptivo utilizando una base
de datos en Excel para los diferentes atributos evaluados (se aplicaron medidas como la
media, y la desviacin estndar), usando escala hednica del 1(no me gusta) al 5 (me
gusta mucho).

66
Investigaciones en Ciencia e Inocuidad de Alimentos

Anlisis fisicoqumicos
Se realizaron por duplicado (2n) en las instalaciones del laboratorio de Fisicoqumica
Alimentaria del CUCBA-UdeG, El contenido de grasa etrea se determin con el mtodo
Soxhlet . El contenido proteico se midi por el mtodo de Kjeldhal y la determinacin de
cenizas por el mtodo gravimtrico.

Anlisis microbiolgicos
Se aplic la Norma Oficial Mexicana, recomendada para el anlisis de alimentos a base
de cereales (6), a las muestras de la barra, por duplicado (2n) con el propsito de evaluar:
mesfilos aerobios, hongos, coliformes totales y Salmonella spp.

Resultados y discusin
Se obtuvo una barra de color amarillo oscuro, con sabor dulce, de consistencia crujiente,
fibrosa y desmoronable, con olor y sabor a cereal y miel, un toque caracterstico a seta y
de buen aspecto.

De acuerdo con los resultados de la evaluacin sensorial, la barra obtuvo una calificacin
promedio de 4,28 que la ubican entre me gusta y me gusta mucho. El atributo con
mayor puntuacin en la barra, fue la textura (4,39) la cual segn las opiniones de los
jueces era crujiente y de consistencia fibrosa, mientras que el menor puntaje correspondi
al olor con un puntaje de 4, correspondiente al descriptor me gusta (figura 1).

En cuanto a las evaluaciones fisicoqumicas, la barra en estudio present un alto


contenido de protena (19.28%), comparativamente con otras barras ya existentes en el
mercado (tabla 1), debido a los ingredientes utilizados en la formulacin, tales como el
Pleurotus ostreatus y el cacahuate que contribuyeron al principal aporte de protena. Si
comparamos la barra 2 que representa el mayor contenido de protena de las barras
comerciales (8.82%), con respecto de la barra 4 (19.29%), se observa que sta, contiene
45.75% ms de protena.

Los resultados del anlisis microbiolgico practicado a la barra, en base a la Norma


correspondiente (5), se observan en la Tabla 2, que muestran que la barra es
microbiolgicamente inocua, lo cual se explica por el proceso de horneado y la baja
actividad de agua del producto.

67
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 1. Media y desviacin estndar de la evaluacin sensorial de la barra.

Tabla 1. Composicin qumica nutrimental de 3 barras encontradas en el mercado, con


respecto al DESARROLLO (barra 4*).

Barra 1 Barra 2 Barra 3


DESARROLLO*
Parmetros g /100 g de producto g /100 g de prod. g /100 g de prod. g /100 g de
producto

Carbohidratos 59,06 26,5 59,26 50,51


Grasa 13,13 2,0 40,74 26,39
Protena 7,81 8,82 7,41 19,28
Fibra 9,38 5,88 14,81 1,009
Ceniza -- --- --- 2,81
________________________________________________________________________
Contenido de las Barras: Barra 1: avena, cacahuate y miel de abeja entre otros
ingredientes como pasas, papaya deshidratada, almendra y arroz inflado. Barra 2:
Multigrano, nuez, trigo, cebada, avena y almendra. Barra 3: Avena entera, aceite de
canola, harina de arroz, miel, azcar morena y sal. *DESARROLLO (barra 4): Avena,
amaranto, cacahuate, miel de abeja y P. ostreatus.

68
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2. Resultados del examen microbiolgico practicado a la barra en estudio.


________________________________________________________________________
____
Determinacin Resultado (UFC/g) Lmite mximo segn la Norma (5)
(UFC/g)
Mesfilos aerobios < 10 10 000
Hongos < 10 300
Coliformes totales < 10 < 30
Salmonella spp Ausencia en 25 g Ausencia en 25 g
________________________________________________________________________
____

Conclusiones
El desarrollo de la barra de cereales y leguminosa adicionado de setas mostr aceptacin
del pblico. Los atributos de olor, sabor, color y textura presentan promedios cercanos al
me gusta mucho, quedando en la aceptacin de me gusta y me gusta mucho,
hacindolo un producto potencialmente viable para su venta. Respecto del aporte
nutrimental, la barra en estudio contiene una cantidad significativamente mayor de
protena comparativamente con otras barras del mercado aunque un aporte de grasa
intermedio entre las comerciales. El anlisis microbiolgico de la barra mostr que es
inocua y apta para el consumo humano.
Los resultados indicaron el potencial de las setas en su incorporacin en nuevos
conceptos alimentarios como son las barras. La presente investigacin sienta las bases
para estudiar su efecto funcional que se ha probado en modelos celulares, in vitro y en
modelos animales.

Bibliografa
1. Ayala-Snchez, N.E., Portillo-Lpez, A., Villarreal-Gmez, L.J., Rico-Mora, R.,
Soria-Mercado, J.E. (2016). Los hongos como fuente de recursos farmacolgicos:
Ganoderma lucidum, Grifola frondosa y Pleurotus ostreatus. Temas de Ciencia y
Tecnologa (20)58:25-36.
2. Bartelme, M. (2015). No Holds Barred. Food Technology: Advancing Food &
Health Through Sound Science. 2(15): 27- 29.
3. Deepalakshmi K., Mirunalini S. (2014) Pleurotus ostreatus an oyster mushroom
with nutritional and medicinal properties. Journal of Biochemistry and Technology.
5(2):718-726
4. Lavi, I., Friesem D., Geresh S. Hadar Y., Schwartz B. (2006). An aqueous
Polysaccharide extract from the edible mushroom Pleurotus ostreatus induces anti-
proliferative and pro-apoptopic effects on HT-29 colon cancer cells. Cancer letters.
244:61-70
5. Snchez, J.E. y Royse, D. 2001. La Biologa y el Cultivo de Pleurotus spp. 1. Ed.
El Colegio de la Frontera sur Ecosur. Uthea-Noriega, Editores.
6. SS. Secretara de Salud. Norma Oficial Mexicana NOM-247-SSAI-2008. Productos
y Servicios. Cereales y sus Productos. Alimentos a base de: cereales, semillas
comestibles, smolas o sus mezclas. Diario Oficial de la Federacin, 27 de julio de
2009. Mxico, D.F.

69
Investigaciones en Ciencia e Inocuidad de Alimentos

Estudio de la crema como producto de la leche bronca durante su


almacenamiento

Ramrez Noriega, R., Garca Domnguez, E., y Gonzlez Rodrguez, M.


Tecnolgico de Estudios Superiores de San Felipe del Progreso. Divisin de Ingeniera Qumica.
Av. Instituto Tecnolgico S/N, Ejido de San Felipe del Progreso. San Felipe del Progreso, Estado
de Mxico C.P. 50640, Mxico. Tel.: 7121722136, rosalbar_no@hotmail.com

Palabras clave: Almacenamiento, estudio, crema.

Introduccin

Los estudios estn realizados en base a las normas referenciadas, en donde se


establecen las especificaciones fisicoqumicas que deben reunir los productos; en este
caso la crema se define como el alimento en el que se ha reunido una fraccin
determinada de la grasa de la leche, ya sea por reposo o por centrifugacin, sometida a
pasteurizacin, esterilizacin o cualquier otro tratamiento que asegure su inocuidad (2).
Los factores identificados en la posible contaminacin del producto son:

No aplicacin de las buenas prcticas de fabricacin


Variacin de las temperaturas durante el almacenamiento
Empaque roto
Higiene del lugar de refrigeracin
Contaminacin cruzada
As como las buenas prcticas de fabricacin que por normatividad se define como el
conjunto de lineamientos y actividades relacionadas entre s, destinadas a garantizar que
los productos tengan y mantengan las especificaciones sanitarias requeridas para su uso,
o consumo. Con respecto al anlisis sensorial se realiza a travs de los sentidos (1) en
donde la sensacin dar motivo al rechazo o aceptacin del producto.
De acuerdo a la importancia de este producto alimenticio el objetivo desarrollado fue
realizar estudios a la crema artesanal durante el periodo de almacenamiento, para
garantizar la inocuidad y estabilidad del producto.

Por lo tanto el estudio est comprendido en analizar la crema como producto artesanal
durante su almacenamiento, obteniendo muestras aleatorias y verificando principalmente
la refrigeracin y el empaque.
Adems de llevar a cabo los anlisis de acidez de la crema, considerando que el exceso
de este la hace muy espesa, otro de los anlisis realizados es el ndice de refraccin, con
esto se requiere asegurar que el producto sea apto para el consumo y que cumpla con las
caractersticas y composicin que se espera de ellos.
Tener una actitud responsable al manipular los alimentos, ser definitivo para evitar
enfermedades a la salud de las personas que consumen el producto.

Metodologa

En el cuadro 1, se presenta la metodologa desarrollada en esta investigacin, donde


cada anlisis se realiz por triplicado.

70
Investigaciones en Ciencia e Inocuidad de Alimentos

Cuadro 1. Desarrollo de los anlisis de la crema.


Metodologa Imagen

1. Muestreo aleatorio simple de las


cremas artesanales en
almacenamiento.

De los nmeros asignados al


producto se eligen al azar, ya que el
tamao de la poblacin no es muy
grande.

2. Estudio sensorial.

Se realiza determinando olor, color,


y sabor de las cremas muestreadas.

3. Determinacin de acidez.

Se mide en base a una titulacin


alcalimtrica con NaOH 0.1N
utilizando fenolftalena como
indicador de acuerdo a la NOM-
243-SSA1-2010 (3).

4. Determinacin del ndice de


refraccin, permitir conocer la
composicin o pureza del producto.
Se llevara a cabo este estudio con
un refractmetro de mano porttil.

5. Pruebas microbiolgicas para


determinar la ausencia de
microorganismos con tres
repeticiones. Por vertido en placa
durante 48 horas, seguido del
recuento de colonias, finalmente el
resultado en UFC

71
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin

La obtencin de la crema es de forma artesanal, durante el almacenamiento el producto


se mantiene a temperatura constante de 5C; el lugar de refrigeracin muestra higiene,
evitando contaminacin cruzada durante la manipulacin y envasado, aplicando las
buenas prcticas de fabricacin.

Se realiz un muestreo aleatorio simple a tres envases que estaban en almacenamiento


para su estudio, de los cuales se les realizaron las pruebas sensoriales registrando color,
olor y sabor (tabla 1).

Tabla 1. Estudios realizados a la crema durante el almacenamiento.

Pruebas ndice de ndice de Microbiolgicos


Muestra sensoriales refraccin acidez UFC/gr
Brix % de cido
lctico
Color: blanco de
textura uniforme 7.0 0.22 0
1 Olor: caracterstico
Sabor: acido

Color: blanco de
textura uniforme 6.9 0.21 0
2 Olor: caracterstico
Sabor: acido

Color: blanco de
textura uniforme 7.0 0.22 0
3 Olor: caracterstico
Sabor: acido

Tambin de la tabla 1 se observan los resultados de ndice de refraccin obteniendo un


promedio de 7 Brix e ndice de acidez de 0.2166% de cido lctico, as mismo en los
estudios microbiolgicos realizados no hubo presencia alguna de microorganismos,
despus de cuarenta y ocho horas de observacin. En la grfica 1, muestra la estabilidad
de los estudios ndice de refraccin e ndice de acidez.

72
Investigaciones en Ciencia e Inocuidad de Alimentos

Grfica 1. Resultados del estudio realizado a las muestras seleccionadas.

Conclusiones

Se comprob a travs de un estudio las condiciones de almacenamiento y el


estado del producto sin anomalas, ya que se mantuvo bajo refrigeracin de 5C.

Las buenas prcticas de laboratorio fueron aplicadas durante el proceso de


anlisis.

Durante el almacenamiento se mantuvo la estabilidad e inocuidad del producto.

Bibliografa

1. Carpenter Roland, P. (2002). Anlisis sensorial en el desarrollo y control de la calidad de


alimentos. Ed. Acribia
2. Norma Oficial Mexicana NOM-193-SCFI-2014, Crema-Denominaciones, especificaciones,
informacin comercial y mtodos de prueba. Recuperado el 05 de junio 2017 de
http://dof.gob.mx/nota_detalle.php?codigo=5378010&fecha=05/01/2015
3. Norma Oficial Mexicana NOM-243-SSA1-2010, Productos y servicios. Leche, frmula
lctea, producto lcteo combinado y derivados lcteos. Disposiciones y especificaciones
sanitarias. Mtodos de prueba. Recuperado el 06 de junio 2017 de
http://dof.gob.mx/normasOficiales/4156/salud2a/salud2a.htm

73
Investigaciones en Ciencia e Inocuidad de Alimentos

Identificacin por el mtodo de vaciado en placa de Coliformes, Hongos y


Levaduras en muestras de comida obtenidas en la cafetera de la Unidad
Acadmica de Fsica de la Universidad Autnoma de Zacatecas
Aguilar Sandoval L.D, Muoz Carrillo, O., y Escamilla Hernndez, J.M.
Estudiantes. Qumico Farmacutico Bilogo-Universidad Autnoma de Zacatecas, Campus UAZ
Siglo XXI, Km 6 Carretera Zacatecas-Guadalajara S-N Ejido La Escondida 98160 Zacatecas,
Zacatecas, 492-544-49-14, whiskas_aguilar@hotmail.com
Palabras clave: Cafetera, vaciado en placa, UAZ.

Introduccin
La sana alimentacin es un factor importante a cualquier edad y para cualquier persona.
Cuando se est cursando los estudios universitarios a veces es muy difcil procurar una
comida balanceada y con las proporciones adecuadas, es por eso que algunas escuelas
como es el caso de la Unidad de Fsica de la Universidad Autnoma de Zacatecas
cuentan con una cafetera para solucionar este tipo de problemas. Aun as es necesario
tener en cuenta que la comida que se vende ah debe de cumplir con lo establecido en las
normas oficiales.
El vaciado en placa es un mtodo en el que se logra una estimacin del nmero de
bacterias viables en una poblacin. Despus de inocular una bacteria u hongo en un
medio adecuado e incubar en condiciones ptimas estas originan una colonia, de tal
manera que al realizar la cuenta y hacer los clculos correspondientes se debe de
reportar como Unidades Formadoras de Colonias por mililitro (UFC/ml).
Dentro de las ventajas de este mtodo es que se puede cuantificar en muestras slidas,
liquidas, polvos y en forma de gel.
Cuantificacin de bacterias mesoflicas:
Bacterias que se desarrollan en un medio de eleccin como es el medio AME (Agar de
Mtodos Estndar) despus de un cierto tiempo y temperatura de incubacin,
presuponiendo que cada colonia proviene de un microorganismo de la muestra bajo
estudio. La de deteccin de bacterias mesoflicas aerobias o mesfilos aerobios son un
indicador general de la poblacin que puede estar presente en una muestra y, por lo
tanto, de la higiene con que ha sido manejado el producto alimenticio. (1)
Cuantificacin de hongos y levaduras:
Las levaduras y los mohos crecen ms lentamente que las bacterias en los alimentos no
cidos que conservan humedad y por ello pocas veces determinan problemas en los
alimentos. Sin embargo, en los alimentos cidos y en los de baja actividad de agua,
crecen con mayor rapidez que las bacterias, determinando por ello importantes prdidas
por alteracin de frutas frescas y zumos, vegetales, quesos, alimentos sazonados,
cereales y encurtidos, as como en los alimentos congelados y en los deshidratados, cuyo
almacenamiento se realiza en condiciones no adecuadas.
Los mohos y levaduras se pueden encontrar como contaminantes en los equipos
sanitizados inadecuadamente, provocando el deterioro fisicoqumico de estos, debido a la
utilizacin en su metabolismo de los carbohidratos, cidos orgnicos, protenas y lpidos,
originando mal olor, alterando el sabor y el color en la superficie de los productos
alimenticios contaminados.(2)
El medio de eleccin a utilizar en el que se pueden desarrollar los hongos es el PDA (Agar
de Dextrosa y Papa).
Como objetivo se busca cuantificar la UFC/ml tanto para bacterias mesoflicas como para
hongos y levaduras en los alimentos por el mtodo de vaciado en placa.

74
Investigaciones en Ciencia e Inocuidad de Alimentos

Metodologa
Se realiz el mtodo de vaciado en placa para la cuantificacin de UFC/ml para las
bacterias Mesoflicas aerobias y para hongos y levaduras. En el que se utiliz dos
diluciones seriadas de las muestras, en el que se tom 1g de las muestras alimenticias, y
se deposit en 9ml de agua estril para obtener una dilucin 1:10, enseguida se tom 1ml
de la dilucin 1:10 y se deposit en 9ml de agua estril en el que se obtuvo la dilucin
1:100.
Para cada muestra alimenticia con su respectiva dilucin se tomo 1ml de las diluciones
1:10 y 1:100 y se deposit en su respectiva caja Petri y enseguida se les deposito el
medio en el que se incubo para el estudio que se requiri, como es el AME para mefilos
y el PDA para hongos y levaduras.
Para el estudio de las UFC/ml para los mesfilos se incubo 24 horas a 37C, y para el
estudio de las UFC/ml en hongos y levaduras se incubo 48 horas a 28C.

Resultados y discusin

Carne
Tras verificar el desarrollo de unidades formadoras de colonia, en las cajas Petri, tanto
para hongos y levaduras (figura 1) como para coliformes (figura 2), se observ una
produccin nula en ambas cajas. La NOM-213-SSA1-2002 (tabla1), indica que para
crnicos cocidos los lmites permitidos de coliformes son < 3 UFC, lo que nos indica que
la muestra est dentro de los lmites permisibles.

Figura 1. Hongos y levaduras. Dilucin 1:100 Figura 2. Coliformes. Dilucin 1:10

Jugo:

Para jugo esterilizado y envasado comercialmente, se examinaron las cajas Petri sin
diluciones, tanto para coliformes (figura 3) y hongos y levaduras (figura 4), donde la
produccin de colonias fue nula, los lmites que indica la NOM-130-SSA1-1995 necesarios
para este anlisis son <100 UFC/g para mesfilos aerobios y para coliformes no aplica.
Esto nos indica que el jugo s cumple con las especificaciones sanitarias necesarias para
consumo humano.

75
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 3. Coliformes. Sin dilucin Figura 4. Hongos y levaduras. Sin dilucin

Pan:

Al verificar la produccin de colonias en las cajas Petri que se trabajaron con las
diluciones de muestra de pan, tanto para coliformes (figura 5) y hongos y levaduras (figura
6) stas s mostraron existencia de UFC, a diferencia de los dems productos trabajados,
sin embargo, estas muestras estn dentro de los lmites establecidos segn la norma
NOM-247-SSA1-2008. Los lmites enunciados son: Coliformes <10UFC/g, Hongos y
levaduras mximo 300 UFC/g.

Figura 5. Coliformes. 1:10 Figura 6. Hongos y levaduras. 1:100

Chile:
Al examinar la produccin de colonias tanto para coliformes (figura 7) como para hongos y
levaduras (figura 8) en las cajas Petri que se trabajaron con chile jalapeo, hubo
produccin nula de unidades formadoras de colonias, por lo que se establece que los
valores estn dentro de los lmites enunciados en la de la norma NMX-F-121-1982. El
producto objeto de esta norma no debe contener microorganismos patgenos, toxinas
microbianas, ni otras sustancias txicas que puedan afectar la salud del consumidor o
provocar deterioro del producto

76
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 7. Coliformes. 1:10 Figura 8. Hongos y levaduras. 1:100

Solamente las muestras de pan mostraron formacin de UFC esto se podra deber a la
higiene del establecimiento, a la hora en que se tomaron las muestras o probablemente a
algn error en la marcha analtica, es iportante tomar en cuenta todos estos factores.

Conclusiones
La higiene en los establecimientos que venden comida es obligatoria y debe de ser muy
rigurosa. La higiene de la cafetera de la unidad de Fsica de la UAZ, aparentemente es la
adecuada, y con los resultados obtenidos, se puede confirmar lo anterior.
Es necesario hacer monitoreos constantemente para procurar que la comida siga
cumpliendo con los lmites permisibles por las normas oficiales mexicanas.
Es necesario realizar todos los pasos del procedimiento para obtener ptimos resultados.

Bibliografa

1. Secretara de Salud. NOM-092-SSA1-1994. Bienes y Servicios. Mtodo para la


cuenta de Bacterias Aerobias en Placa. Norma Oficial Mexicana. Mxico.

2. Secretara de Salud, NOM-213-SSA1-2002 Lmites mximos permisibles para


crnicos microbiolgicos.
3.
NOM-130-SSA1-1995 Lmites mximos permisibles para productos esterilizados
comercialmente microbiolgicos.

4. NOM-247-SSA1-2008 Lmites mximos permisibles para cereales

5. NMX-F-121-1982 ALIMENTOS PARA HUMANOS - ENVASADOS CHILES


JALAPEOS O SERRANOS EN VINAGRE O ESCABECHE

77
Investigaciones en Ciencia e Inocuidad de Alimentos

Frecuencia y nmero ms probable de Clostridium perfringens en chorizo de


pollo comercializado en Guadalajara y Zapopan, Jalisco, Mxico
Luis Juan Morales, A., Alaniz de la O, R., Madrid Moreno, I.A., Rosas Barbosa, B.T., Magaa
lvarez, M.A.
Departamento de Salud Pblica, Centro Universitario de Ciencias Biolgicas y Agropecuarias,
Universidad de Guadalajara. Camino Ing. Ramn Padilla Snchez # 2100, La Venta del Astillero,
Zapopan, Jalisco, Mxico. C.P. 45110. Tel. (33) 37 77 11 51, Correo: angelicaljm@gmail.com
Palabras clave: Frecuencia, Clostridium perfringens, chorizo de pollo

Introduccin
Clostridium perfringens es un bacilo gram positivo, inmvil, esporulado, anaerobio,
termfilo, que est ampliamente distribuido en el medio ambiente y es un habitante normal
del tracto intestinal del hombre y de animales de sangre caliente (4, 5). Esta bacteria
produce un cuadro gastrointestinal cuyos sntomas predominantes y con frecuencia
nicos, son diarrea profusa y calambres abdominales (5). El perodo de incubacin de la
enfermedad es de 8 a 24 h y los sntomas agudos comnmente duran menos de 24 h.
Normalmente la duracin de la enfermedad es de 24 a 48 h, y los casos fatales son raros
en personas sanas (5). Su mecanismo de patogenicidad es mediante una toxina que es
liberada durante la fase de esporulacin. Una persona presenta este cuadro cuando
consume un alimento contaminado con un alto contenido de clulas vegetativas de C.
perfringens enterotoxignico (> 106), las que sobreviven al paso por el estmago,
esporulan estando en el intestino delgado y liberan la toxina (5). Se considera que C.
perfringens es uno de los agentes comnmente causantes de enfermedades transmitidas
por alimentos (ETA). En Estados Unidos de Amrica se estima que causa un milln de
casos anualmente y en pases como Australia, Japn, Inglaterra y Gales, se encuentra
entre los agentes que encabezan la lista de patgenos productores de brotes de ETA (4).
En Mxico son pocos los reportes de brotes ocasionados por este patgeno. En Agosto
de 1991, ocurri un brote de gastroenteritis causado por Clostridium perfringens en la
poblacin de Ciudad Guzmn, Jalisco, donde la birria fue el alimento involucrado y un
lapso de ms de 12 h entre preparar y servir el alimento e incorrecto enfriamiento del
mismo (12 h a temperatura ambiente), fueron factores contribuyentes en el brote (1). Los
brotes de intoxicacin causada por C. perfringens estn asociados principalmente al
consumo de productos crnicos y derivados del pollo, los cuales poseen un alto contenido
proteico (4, 5). Estudios realizados en diversas partes del mundo han encontrado que la
carne de pollo est frecuentemente contaminada con la bacteria (8), aunque en pases
como el nuestro, hay poca informacin sobre la frecuencia de la enfermedad y la
distribucin del patgeno en los alimentos. Un estudio para determinar la frecuencia y
nmero ms probable (NMP) de C. perfringens realizado en platillos tpicamente
mexicanos como son los tamales, pozole y birria recolectados de restaurantes de la
ciudad de Guadalajara, Jalisco, report una frecuencia del 52 % y niveles de 2,3 a 5,4 log
NMP/g en las 151 muestras estudiadas (6). Alaniz y col., (2004) por su parte, consignaron
un 57 % de positividad al patgeno en muestras de chorizo de cerdo y niveles de 3 a 200
NMP/g (2). Un alimento que se consume en nuestra poblacin es el chorizo de pollo, el
cual es preparado con carne cruda de pollo molida, vinagre, sal, chiles y otras especias
(ajo, clavo, comino, etc.) que se mezclan y se colocan en tripas artificiales para luego
conservarse, durante su venta, a temperatura ambiente o refrigeracin. Previo a su
consumo el chorizo es sometido a algn tratamiento de coccin, procedimiento que
generalmente deja porciones insuficientemente cocidas. El alimento generalmente se
sirve acompaado con otros platillos o es un ingrediente de ellos. A saber, no existen
estudios realizados en este producto con el propsito de conocer la frecuencia y niveles
de C. perfringens. El objetivo del presente trabajo fue conocer la frecuencia y los niveles

78
Investigaciones en Ciencia e Inocuidad de Alimentos

de C. perfringens en el chorizo de pollo que se comercializa en Guadalajara y Zapopan,


Jalisco, Mxico.

Metodologa
Se recolectaron 80 muestras de chorizo de pollo a partir de expendios localizados en
mercados, supermercados, tianguis y polleras de Guadalajara y Zapopan, Jalisco. Las
muestras fueron tomadas aspticamente, transportadas al laboratorio a temperatura de
refrigeracin y analizadas dentro de las 3 h posteriores a su obtencin. Se realiz el
recuento de C. perfringens mediante la tcnica del nmero ms probable (NMP)
empleando para ello el medio de Caldo Lactosa Sulfito (CLS) con campana de Durham
(7). Veinte gramos de cada muestra fueron colocados en 180 mL de solucin de Ringer
cisteinizada y homogenizadas en stomacher durante 2 min a 260 rpm. Tres porciones de
10 mL de los homogenizados fueron transferidos a 3 tubos con 20 mL de CLS, 3
porciones de 1 mL y 3 porciones de 0,1 mL fueron colocadas en 3 tubos con 9 mL y 10
mL de CLS, respectivamente. Los tubos fueron incubados a 46 C en bao Mara por 24-
48 h. Alcuotas de los tubos que mostraron enturbiamiento (crecimiento), gas en las
campanas (fermentacin de lactosa) y sedimento obscuro (reduccin de sulfito) fueron
sembradas en placas con agar sangre de ovino e incubadas en anaerobiosis a 35 C por
24 h. Las colonias sospechosas ( hemolticas, frecuentemente con doble hemlisis) de
cada placa fueron probadas para la fermentacin de lactosa (medio gelatina lactosa),
licuacin de la gelatina (medio gelatina lactosa), movilidad (medio movilidad nitrato),
reduccin de nitratos a nitritos (medio movilidad nitrato), morfologa celular y reaccin de
Gram (7). La cantidad de tubos positivos a las pruebas confirmatorias por cada dilucin se
compararon con la tabla de NMP correspondiente para obtener el resultado final.

Resultados y discusin

Clostridium perfringens fue aislado de 65 muestras de chorizo de pollo (81,2 % de


positividad), con un mnimo y mximo de 30 y 2 400 NMP/100 g (figura 1) y una mediana
de 405 NMP/ 100 g. Aunque no se encontraron otros estudios sobre la presencia y
recuento de C. perfringens realizados en este producto, hay trabajos en carne cruda de
pollo que podran ayudarnos a entender la alta frecuencia del agente encontrada en el
chorizo, que como antes sealamos, es elaborado con carne de pollo cruda y molida.
Cakmak y col., (2006) (3) en una investigacin realizada en carne de pollo molida
congelada obtenida de 6 plantas procesadoras de pollo localizadas en Turqua,
encontraron un 70 % de positividad al agente, un valor alto, pero por abajo del reportado
en el presente trabajo. Los niveles mnimo y mximo de contaminacin reportados en ese
estudio, fueron de 30 y 930 NMP/100 g, valores tambin por debajo a los encontrados en
el presente trabajo. Otros estudios sobre la contaminacin de la carne de pollo con C.
perfringens reportan frecuencias altas, en algunos casos, hasta del 84 % (8). Esta cifra no
debe extraarnos ya que durante la obtencin de la carne, se pueden dar condiciones
para que sta se contamine con el contenido intestinal de las aves, en el cual, como lo
sealan algunos autores, se ha encontrado la bacteria en el 75 % al 95 % de muestras
analizadas (8). Otros investigadores sugieren que tal prevalencia de C. perfringens en el
contenido intestinal del pollo, puede deberse a una colonizacin del tracto gastrointestinal
del pollo en una etapa muy temprana de su vida y que puede diseminarse durante su
crianza y faenado (8).

79
Investigaciones en Ciencia e Inocuidad de Alimentos

De las 80 muestras estudiadas, 75, no mostraban etiqueta y marca del fabricante y a decir
de los vendedores, son chorizos elaborados artesanalmente. De stas, 64 (85,3%)
resultaron positivas al agente estudiado.

18

16
Nmero de muestras positivas

14

12

10

0
36 40 70 90 110 150 210 230 390 430 750 930 2100 2400
Va l ores de NMP/ 100 g

Figura 1. Frecuencia y NMP de Clostridium perfringens en chorizo de pollo (n = 80).

La elaboracin de alimentos en forma artesanal, favorece la contaminacin y


multiplicacin de agentes microbianos debido a la falta de control de calidad de las
materias primas, a las pobres condiciones de higiene que prevalecen en esos sitios y a la
falta de infraestructura sanitaria. Solo 5 de las muestras investigadas presentaban
etiqueta con marca del fabricante y una result positiva. La distribucin de las muestras
segn sitio de recoleccin y su positividad a C. perfringens se presentan en la tabla 1. Se
pudo constatar que este producto es comnmente comercializado en mercados, tianguis y
polleras y que es conservado tanto a temperatura ambiente como en refrigeracin. Fue
notorio tambin, que la venta del chorizo de pollo en supermercados fuera muy baja ya
que solo se logr conseguir una muestra en este sitio y corresponda a un producto de
marca que result negativa al patgeno (tabla 1).

Tabla 1. Distribucin y positividad de muestras de chorizo de pollo analizadas para C.


perfringens

_______Muestras______ %
Establecimientos Estudiadas Positivas positivas
Mercados 46 39 84,7
Tianguis 20 15 75
Supermercados 1 0 0
Polleras 13 11 84,6

Total 80 65 81,2

80
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones

El chorizo de pollo que se expende en Guadalajara y Zapopan, presenta una frecuencia


alta de positividad a Clostridium perfringens, aunque sus niveles de contaminacin fueron
bajos. Aun as, su presencia en este producto debe ser controlado mediante buenas
prcticas pecuarias, buenas prcticas de elaboracin, una correcta coccin y
conservacin, de tal forma que su desarrollo se vea obstaculizado y con ello se reduzca el
peligro de adquirir la enfermedad que produce.

Bibliografa

1. Alaniz de la O, R., J.L. Vzquez Castellanos, A. Luis Juan Morales y B.T. Rosas Barbosa.
1992. Brote de gastroenteritis por Clostridium perfringens asociado al consumo de birria.
En: XXIII Congreso Nacional de Microbiologa. Asociacin Mexicana de Microbiologa,
Acapulco Guerrero, Mxico.

2. Alaniz de la O, R., A. Luis Juan Morales, B.T. Rosas Barbosa, J.P., Gonzlez Reyes. 2004.
Frecuencia y nmero ms probable de Clostridium perfringens en chorizo obtenidos de
expendios de Guadalajara y Zapopan, Jalisco, Mxico. Memorias del IX Taller Internacional
sobre Calidad Sanitaria, Evaluacin y Conservacin de Alimentos. Varadero, Matanzas,
Cuba.

3. Cakmak, O., F.S. Ormanc, M. Tayfur, I. Erol. 2006. Presence and contamination level of
Clostridium perfringens in raw frozen ground poultry and poultry burgers. Turk J Vet Anim
Sci. 30:101-105.

4. Grass, J. E., L.H. Gould and B.E. Mahon. 2013. Epidemiology of foodborne disease
outbreaks caused by Clostridium perfringens, United States, 19982010. Foodborne
Pathog Dis. 10: 131136.

5. Juneja, V.K., Novak and R.J. Labbe. 2010. Clostridium perfringens. Pp. 53-70. En:
Pathogens and Toxins in Foods: Challenges and Interventions. V. K. Juneja and J. N.
Sofos. ASM Press, Washington, DC.

6. Navarro-Hidalgo, V., E. Cabrera-Daz, H. Zepeda, L. Mota de la Garza, A. Castillo and R.


Torres-Vitela. 2005. Levels and enterotoxigenicity of Clostridium perfringens in pozole,
tamales, and birria. J. Food Prot. 68:331335.

7. Neut, C., J. Pathak, C. Romond, H. Beerens. 1985. Rapid detection of Clostridium


perfringens: comparison of lactose sulfite broth with tryptosesulfite cycloserine agar.
J Assoc Off Anal Chem. 68:881883.

8. Van Immerseel, F., J. De Buck, F. Pasmans, G. Huyghebaert, F. Haesebrouck and R.


Ducatelle. 2004. Clostridium perfringens in poultry: an emerging threat for animal and public
health. Avian Pathology. 33:537-549.

81
Investigaciones en Ciencia e Inocuidad de Alimentos

Influencia del pelado termoqumico sobre la carga de Enterobacterias y


Staphylococcus aureus en pulpa de chirimoya
1 2,3 3 1
Farfn Rodrguez, L . Ramos Guerrero, F.G. , Noa Barrientos, L.A. , Silva Jaimes, M.I. y
4
Guevara Prez, Amrico
1
Departamento de Ingeniera de Alimentos y Productos Agropecuarios, Facultad de Industrias
Alimentarias, Universidad Nacional Agraria La Molina. Av. La Molina s/n, Lima 12, Per.
2
Centro Latinoamericano de Enseanza e Investigacin de Bacteriologa Alimentaria (CLEIBA),
Facultad de Farmacia y Bioqumica, Universidad Nacional Mayor de San Marcos. Jirn Puno 1002,
Lima 1. Per. (felix.ramos@unmsm.edu.pe)
3
SELVA INDUSTRIAL S.A. Av. Vctor Andrs Belande 801-803, Callao 03, Per.
4
Departamento de Tecnologa de Alimentos y Productos Agropecuarios, Facultad de Industrias
Alimentarias, Universidad Nacional Agraria La Molina. Av. La Molina s/n, Lima 12, Per.

Palabras clave: Pulpa de chirimoya, calidad microbiolgica, pelado termoqumico

Introduccin
La produccin industrial de pulpa de chirimoya (Annona cherimola) congelada en el Per
se ve limitada principalmente por tres factores: pardeamiento enzimtico, deterioro
microbiolgico y uso de cadena de fro durante su procesamiento. Tratamientos trmicos
aplicados en la pulpa de chirimoya buscando reducir la carga microbiolgica y la accin
de la enzima polifenoloxidasa (responsable del proceso de oxidacin) generan
indirectamente cambios indeseables en el sabor, aportndole un amargor intenso
caracterstico. Debido a ello, la incorporacin de antioxidantes como el cido eritrbico o
sus sales, cido ascrbico slo o combinado con cido ctrico o con cloruro de sodio, en la
pulpa de chirimoya y la fabricacin sin el uso de tratamientos trmicos se volvi una regla
para los fabricantes (3). Por otro lado, los procesadores de jugos, pulpas y concentrados
de frutas (pH < 4.6), por temas de inocuidad, deben demostrar que su proceso llega a
cumplir con una reduccin mnima de 5 Log de un microorganismo patgeno de
importancia en la salud pblica y que es muy probable que est presente en el producto
(4). Los laboratorios instalados en las plantas de fabricacin usualmente no tienen la
capacidad de analizar patgenos, en contraparte analizan grupos de microorganismos
indicadores como Enterobacterias, en donde se encuentran Escherichia coli patgena y
Salmonella enteritidis (7). Adicionalmente, la obtencin de la pulpa de chirimoya requiere
de un pelado manual, pudiendo generar una contaminacin cruzada de tipo
microbiolgico a travs de los operadores, especficamente con Staphylococcus aureus y
Escherichia coli. Con el fin de ayudar a la industria procesadora de pulpas de frutas, este
trabajo presenta una nueva etapa de proceso llamada pelado termoqumico, la cual es
incorporada al proceso de fabricacin convencional de pulpa de chirimoya congelada para
obtener una pulpa con mejor calidad e inocuidad. As mismo, el presente trabajo evala el
efecto que tiene el pelado termoqumico sobre la carga microbiolgica de Enterobacterias
y Staphylococcus aureus.

Metodologa
Las muestras de pulpa de chirimoya fueron elaboradas a partir de Annona cherimola
variedad Cumbe provenientes de la zona de Chachapoyas (Per). Todas las muestras
fueron tomadas en una fbrica procesadora de pulpas de frutas ubicadas en el Callao
(Per) y fueron obtenidas a partir del siguiente proceso de produccin: recepcin y
pesado, almacenamiento, maduracin, seleccin y clasificacin, lavado, desinfeccin,
enjuague, pelado termoqumico, pulpeado, refinado, homogenizado, envasado y
congelamiento. De forma esquemtica, la Fig. 1 muestra en detalle las 3 fases que
componen el pelado termoqumico, as como sus parmetros y condiciones de operacin.

82
Investigaciones en Ciencia e Inocuidad de Alimentos

PELADO TERMOQUMICO

Blanqueado Enjuague Pelado


Parmetros: Condiciones:

Concentracin de NaOH (%) Uso de agua potable Uso de duchas con agua
acidificada (cido ctrico
Tiempo de residencia del fruto y cido ascrbico)

Temperatura (C) Friccin manual sobre


los frutos para conseguir
el pelado

Fig 1. Fases del pelado termoqumico en el proceso de obtencin de pulpa de chirimoya.

Una gran diferencia de este proceso con pelado termoqumico respecto a los
convencionales, es que no necesita de un ambiente refrigerado durante la produccin de
pulpa de chirimoya, permitiendo el ahorro energtico y mejorando las condiciones de
operacin para los manipuladores de alimentos.

Ocho tratamientos (T1 al T8), mostrados en la tabla 1, fueron usados para determinar la
influencia del pelado termoqumico sobre la carga de Enterobacterias y Staphylococcus
aureus en pulpa de chirimoya. Estos tratamientos, basados en cambios de los parmetros
de operacin de la fase de blanqueado, fueron determinados siguiendo un diseo
experimental factorial completo (23).

Tabla 1. Tratamientos aplicados en pulpa de chirimoya, focalizados en cambios de


temperatura, concentracin de NaOH (%) y tiempo de residencia en la fase de
blanqueado de la etapa de pelado termoqumico
Tratamiento Temperatura Concentracin de NaOH Tiempo de residencia*
T1 90 C 0% 3 minutos 5 segundos
T2 90 C 0% 2 minutos 20 segundos
T3 90 C 6% 3 minutos 5 segundos
T4 90 C 6% 2 minutos 20 segundos
T5 100 C 0% 3 minutos 5 segundos
T6 100 C 0% 2 minutos 20 segundos
T7 100 C 6% 3 minutos 5 segundos
T8 100 C 6% 2 minutos 20 segundos
* Los tiempos de retencin de 3 minutos 5 segundos y 2 minutos 20 segundos
corresponden a 50 y 70 Hz ejercidos en el equipo de calentamiento

El anlisis de Enterobacterias fue realizado siguiendo la tcnica de incorporacin en placa


de la International Commission on Microbiological Specifications for Foods (ICSMF, 1988)
(2), mientras que el recuento de Staphylococcus aureus fue realizado de acuerdo al
mtodo AOAC 2003.07 (2006) (1), usando placas PetrifilmTM Staph Express.

Con la ayuda del software Minitab 16 los resultados de los recuentos microbiolgicos
fueron evaluados estadsticamente y grficos de superficie de respuesta fueron
desarrollados para observar la influencia de los parmetros de operacin sobre los
recuentos microbiolgicos.

83
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin
Los tratamientos 3, 4, 7 y 8 fueron capaces de reducir totalmente la carga de
Enterobacterias (Tabla 2), mientras que el tratamiento 6 fue dentro de todos el que obtuvo
mayor conteo microbiolgico (3.52 + 0.25 Log UFC/g), demostrando su poca capacidad
de inactivacin contra ese grupo de microorganismos. El conteo de Enterobacterias para
el tratamiento 1 no fue significativamente diferente con los obtenidos en los tratamientos 2
y 5, presentando valores menores que 1.67 Log UFC/g en promedio. El grupo de
Enterobacterias, es usado como indicador global de Buenas Prcticas de Manufactura
(BPM), y su presencia usualmente indica que un potencial problema ha sucedido en el
proceso de fabricacin. El conteo de Enterobacterias sirve tambin para detectar lugares
en donde la multiplicacin de bacterias, como Salmonella spp., puede ocurrir y tambin
para identificar puntos crticos en la lnea de produccin donde la contaminacin del
producto con el polvo del medio ambiente es posible (7). Las fbricas procesadoras de
frutas, al no obtener recuentos de Enterobacterias en el producto final, estn reduciendo
indirectamente la posible presencia de microorganismos como Escherichia coli patgeno y
Salmonella enteritidis, bacterias que forman parte de este grupo indicador y que han
estado relacionado con brotes de enfermedades en humanos a travs del consumo de
jugos de frutas (8). Un estudio llevado a cabo en una planta procesadora de sub-
productos provenientes del beneficio de animales (rendering plants) pudo demostrar que
las medidas tomadas para reducir el nmero de Enterobacterias en muestras ambientales
y su ocurrencia en muestras de producto final fueron tambin efectivas para reducir la
frecuencia de Salmonella spp. en el ambiente y en el producto final, obteniendo una
correlacin directa, por lo que la determinacin de Enterobacterias sirve como
herramienta para evaluar el mejoramiento de las BPM (7).

Tabla 2. Carga de Enterobacterias y Staphylococcus aureus obtenidos en pulpa de


chirimoya despus de los tratamientos en el pelado termoqumico
Conteos promedios + desviacin estndar (Log UFC/g)
Tratamiento Enterobacterias Staphylococcus aureus
T1 1.11 + 0.98a,b ND
T2 0.33 + 0.58b ND
T3 ND ND
T4 ND ND
T5 1.67 + 0.19a ND
T6 3.52 + 0.25c ND
T7 ND ND
T8 ND ND
a,b,c
Los promedios dentro de una columna con la misma letra no son significativamente
diferentes de acuerdo al Test de Tukey (P>0.05). ND significa no detectado (< 10 UFC/g)

Recuentos de Staphylococcus aureus no fueron detectados (< 10 UFC/g) en las muestras


provenientes de los ocho tratamientos (Tabla 2), evidenciado su efectividad para inactivar
esta bacteria. Esto es de gran inters por temas de inocuidad, debido a que si S. aureus
sobreviviera a los tratamientos aplicados, podra desarrollarse en la pulpa de chirimoya
porque sta no posee algn efecto antimicrobiano frente a esta bacteria (5), pudiendo
formar posteriormente la enterotoxina estafiloccica dentro del producto y permanecer
latente durante el congelamiento.

Independientemente del tiempo de residencia de la chirimoya en el equipo rotatorio y de la


temperatura aplicada, el aumento de la concentracin de NaOH hacia 6 % redujo

84
Investigaciones en Ciencia e Inocuidad de Alimentos

significativamente el recuento de Enterobacterias (< 10 UFC/g) en la pulpa de chirimoya


(Fig. 2).
A) Tiempo de residencia: 3 minutos 5 segundos B) Tiempo de residencia: 2 minutos 20 segundos

100 100
T (C)
95 95

90 T (C)
90
0
1.5
0
2
1.0 3
2
4 2
4 0.5 Log UFC/g [NaOH] (%)
1
[NaOH] (%) 6 Log UFC/g
6 0.0 0

Fig. 2. Influencia de la temperatura y la concentracin de NaOH (%) sobre el recuento de


Enterobacterias, a tiempo de residencia constante.

Este estudio demuestra que la incorporacin de NaOH en la etapa de blanqueado mejora


la calidad microbiolgica de la pulpa de chirimoya y aunque las soluciones con soda
custica estn diseadas principalmente para eliminar la tierra adherida a la fruta y para
ablandar la cscara de los frutos (6), indirectamente la carga microbiolgica proveniente
de la superficie de la fruta (microbiota epiftica) se ve reducida, ya que es arrastrada junto
con la suciedad.

Conclusiones
El pelado termoqumico mejor la calidad microbiolgica de la pulpa de chirimoya, siendo
la concentracin de NaOH (%) el factor ms importante dentro de la fase de blanqueado.
Esta etapa incorporada al proceso de fabricacin convencional de pulpa de chirimoya
ayuda a reducir la probabilidad de presencia de patgenos, asegurando su inocuidad.

Bibliografa
1. AOAC International. 2006. AOAC Official Method 2003.07 Enumeration of Staphylococcus
TM TM
aureus in selected types of processed and prepared foods. 3M Petrifilm Staph Express
Count Plate Method.
2. International Commission on Microbiological Specifications for Foods (ICMSF). 1988.
nd
Microorganisms in foods 1. Their significance and methods of enumeration. 2 ed. University of
Toronto Press, Toronto.
3. Manzocco, L., D. Mastrocola and M. Poiana. 1998. Control of browning in frozen puree of
cherimoya (Annona cherimola, mill.) fruit. Sci Aliments. 18(1):101-107.
4. Mazzotta, A.S. 2001. Thermal inactivation of stationary-phase and acid-adapted Escherichia
coli O157:H7, Salmonella, and Listeria monocytogenes in fruit juices. J Food Protect.
64(3):315-320.
5. Ramos, F., P. Snchez, L. Noa, J.C. Ramos y T. Agurto. 2016. Comparando el efecto
antimicrobiano de jugos y pulpas de frutas industriales producidos en Per, frente a bacterias
patgenas. Estudio preliminar. Rev Vitae. 23(supl.2):S71-S72.
6. Tzia, C., P. Sfakianakis and V. Giannou. 2016. Raw materials of foods: Handling and
management. pp. 1-40. In: Handbook of Food processing. Food Safety, Quality, and
Manufacturing Processes. Varzakas, T., and C. Tzia. Taylor & Francis Group, Boca Raton.
7. Van Schothorst, M. and J. Oosterom. 1984. Enterobacteriaceae as indicators of good
manufacturing practices in rendering plants. Antonie van Leeuwenhoek. 50(1):1-6.
8. Vojdani, J.D., L.R. Beuchat and R.V. Tauxe. 2008. Juice-associated outbreaks of human illness
in the United States, 1995 through 2005. J Food Protect. 71(2):356-364.

85
Investigaciones en Ciencia e Inocuidad de Alimentos

Comparacin de la carga de microorganismos indicadores de la alteracin


en mangos frescos de venta en mercados y supermercados de Lima, Per
1 1 1
Gutirrez Escajadillo, M.I.R , Ramos Guerrero, F.G. , y Lpez Flores, B.C.
1
Centro Latinoamericano de Enseanza e Investigacin de Bacteriologa Alimentaria (CLEIBA),
Facultad de Farmacia y Bioqumica, Universidad Nacional Mayor de San Marcos. Jirn Puno 1002,
Lima 1. Per. (felix.ramos@unmsm.edu.pe)

Palabras clave: Mango, calidad microbiolgica, puntos de venta

Introduccin
El mango (Mangifera indica L.) es un fruto tropical climatrico, estacional y de corta vida
til, caracterizado por presentar un distintivo olor y sabor que es muy agradable cuando
se consume directamente o cuando es usado como materia prima en la fabricacin de
jugos, nctares, helados, yogurt, mermeladas, conservas y postres en general. Este fruto
es fuente de vitaminas (A, B1, B2 y C), carotenoides y otros antioxidantes fitoqumicos (8).
Aunque la variedad ms comercializada en el mundo es Alfonso, cultivada en la India,
en el Per se consume y exporta variedades como Chato, Criollo, Haden, Kent y
Kafro, que son cultivadas principalmente en las zonas de San Lorenzo, Chulucanas,
Tambogrande y Sullana, ubicadas en el departamento de Piura.

Cuando el mango es comercializado para consumo directo como fruta fresca, debe
cumplir con las siguientes caractersticas: estar fisiolgicamente maduro, mostrar su color
desarrollado entre 30 50 %, estar firme, ser uniforme en tamao, estar libre de insectos
y enfermedades (antracnosis u otros), no presentar daos fsicos, estar libre de exudados
de ltex y cumplir con las especificaciones de tamao y peso requeridos (8). En Lima
(Per), el mango es mayormente comercializado como fruta fresca, tanto en mercados
como supermercados, pudiendo presentar diferentes caractersticas microbiolgicas
dependiendo de sus condiciones de transporte, tratamiento y expendio. Como otras frutas
tropicales, el mango es muy susceptible al deterioro ocasionado por microorganismos, y la
carga superficial que presenta en la cscara (microbiota epiftica) influir directamente
sobre su vida til en los puntos de venta.

El objetivo del presente trabajo fue evaluar y comparar las cargas microbiolgicas de
mangos frescos listos para el consumo, comercializados en mercados y supermercados
de la ciudad de Lima con el fin de evidenciar cul de ellos presenta la mejor la calidad
microbiolgica en relacin a los microorganismos indicadores de la alteracin: aerobios
mesfilos, mohos y levaduras, Lactobacillus sp., y Bacillus sp.

Metodologa
Tanto en mercados como en supermercados de la ciudad de Lima (Per), se tomaron
aleatoriamente 15 muestras de mango fresco, cada uno por 1 Kg., los cuales estaban
libres de lesiones, golpes u otro dao que pudiera afectar el fruto desde el punto de vista
microbiolgico. Entre las variedades muestreadas se encuentran Haden, Kent y Kafro.
Inmediatamente despus del muestreo, todas las muestras fueron trasladadas bajo
refrigeracin al laboratorio del Centro Latinoamericano de Enseanza e Investigacin de
Bacteriologa Alimentaria (CLEIBA), en donde se llevaron a cabo los anlisis
microbiolgicos.
Los recuentos de aerobios mesfilos, mohos y levaduras, fueron llevados a cabo de
acuerdo al mtodo por incorporacin en placa recomendado por la International

86
Investigaciones en Ciencia e Inocuidad de Alimentos

Commission on Microbiological Specifications for Foods (ICSMF, 1988) (2), mientras que
Lactobacillus sp. y Bacillus sp. fueron determinados siguiendo los mtodos ISO 15214
(1998) (4) e ISO 7932 (1993) (3) respectivamente.

Todos los recuentos microbiolgicos fueron transformados a Log10 antes de aplicar un


anlisis de varianza de 1 factor (ANOVA) con el fin de determinar si las diferencias entre
el conjunto de datos fueron estadsticamente significantes. Con el fin de comparar los
promedios entre los conteos obtenidos en cada uno de los grupos indicadores para las
muestras de mercados y supermercados, el Test de Tukey (P = 0.05) y diagramas de
cajas fueron usados.
Todos los grficos y anlisis estadsticos fueron generados usando el software Minitab
16.

Resultados y discusin
El tipo y nmero de microorganismos que se encuentran presentes sobre la superficie de
la fruta influencian directamente sobre sus propiedades sensoriales y tambin sobre su
vida til (7). As mismo, existe un grado de especificidad entre una fruta en particular y el
grupo de microorganismo que sobrepasa sus barreras fsicas o qumicas y que
posteriormente produce el deterioro (5).

En esta investigacin, cuatro grupos importantes de microorganismos indicadores de la


alteracin fueron evaluados en mangos listos para el consumo. Los resultados mostraron
que todos los recuentos microbiolgicos promedios en cada uno de los grupos de
microorganismos evaluados fueron diferentes entre s, tanto en las muestras de mercado
como en las de supermercado (Tabla 1).

La mayor carga microbiolgica se obtuvo para mohos y levaduras en ambos lugares de


venta en la ciudad de Lima, obtenindose conteos promedios de 4.09 + 0.49 y 2.83 + 0.49
Log UFC/g para las muestras de mercados y supermercados respectivamente. Mohos y
levaduras son los principales agentes de deterioro microbiolgico en frutas y sus
derivados, ocasionando cambios indeseables en el olor, sabor y en la apariencia
(ablandamiento por enzimas pectinolticas, presencia de micelio visible, oscurecimiento de
algunas partes del fruto por formacin de pigmentos o por pudricin, hinchamiento en
bebidas por produccin de CO2, entre otros). La gran ventaja de estos microorganismos
frente a las bacterias es su gran tolerancia al pH < 4.6 (aunque Alicyclobacillus spp.,
bacterias cido lcticas y acticas tambin poseen sta caracterstica), facilitando su
desarrollo y posteriormente la produccin de metabolitos secundarios, entre los cuales se
encuentran las micotoxinas (5,6).

Tabla 1. Recuentos promedios obtenidos para los grupos de microorganismos


indicadores de la alteracin en mangos listos para consumo
Recuento promedio + desviacin estndar (Log UFC/g)
Grupo de microorganismo Mercados Supermercados
Aerobios mesfilos 3.31 + 0.56A 2.20 + 0.31B
C
Mohos y levaduras 4.09 + 0.49 2.83 + 0.49D
E
Lactobacillus sp. 2.20 + 0.20 1.44 + 0.26F
Bacillus sp. 3.19 + 0.15G 2.07 + 1.10H
A,B,C,D,E,F,G,H
Los promedios dentro de una misma lnea que no comparten la misma letra
son significativamente diferentes de acuerdo al Test de Tukey (P<0.05)

87
Investigaciones en Ciencia e Inocuidad de Alimentos

Para el caso del grupo de aerobios mesfilos, que representan de manera global un
indicador de buenas prcticas de manufactura y de higienizacin en la industria
alimentaria (7), se obtuvieron conteos promedios menores de 3.31 Log UFC/g en
muestras de mercados y menores de 2.20 Log UFC/g en muestras de supermercados.
Ambos conteos se encuentran dentro de los lmites indicados en la literatura cientfica
relacionada a frutas y vegetales, cuyos valores normalmente se encuentran entre 3 9
Log UFC/g (6).

Lactobacillus sp. es un grupo de bacterias cido lcticas tolerantes a la acidez, y que en


frutas y sus derivados genera deterioro sensorial y qumico a travs de sus metabolitos
como cido lctico, cido actico y etanol (6). Dentro de esta investigacin, fue el grupo
de microorganismo que obtuvo la menor carga microbiolgica en ambos puntos de venta,
debido probablemente a la gran competencia que tiene con mohos y levaduras.

Los recuentos de Bacillus sp. fueron muy similares a los obtenidos en los de aerobios
mesfilos, y cuando se compar la diferencia entre las cargas microbianas de muestras
de mercados y supermercados en los grupos de aerobios mesfilos y Bacillus sp., se
obtuvo en promedio 1.11 Log UFC/g, en ambos casos.

4
Log UFC/g

AM Bacillus sp. LB MyL AM Bacillus sp. LB MyL


Mercados Supermercados

Fig. 1. Diagrama de cajas para los recuentos de aerobios mesfilos (AM), Bacillus sp.,
Lactobacillus sp. (LB), y mohos y levaduras (M y L) obtenidos en las muestras de mango
fresco proveniente de mercados y supermercados.

La Fig. 1 muestra que los recuentos microbiolgicos obtenidos en las muestras de


supermercados fueron inferiores a las de los mercados en todos los grupos de
microorganismos evaluados. Estos mismos resultados fueron obtenidos por Gutirrez y
col. (1) cuando evaluaron la carga de Enterobacterias y Escherichia coli en mangos
comercializados en mercados y supermercados de Lima.

88
Investigaciones en Ciencia e Inocuidad de Alimentos

Los supermercados manejan especificaciones de compra dentro de su sistema de gestin


de calidad e inocuidad, en donde uno de los requisitos bsicos es la ausencia de
microorganismos patgenos como Salmonella spp., para ello los proveedores aplican
tratamientos previos como seleccin, lavado, desinfeccin y en algunos casos
aplicaciones de pelculas como ceras para protegerlos y darles una mejor apariencia (8).
Adicionalmente, hay una aprobacin de proveedores previa a la entrega, y el
cumplimiento de requisitos organolpticos como aspecto, color, olor y sabor son
estrictamente vigilados. A diferencia de los supermercados, los mercados reciben la fruta
desde los acopiadores y/o agricultores de forma global (sin aprobacin previa), y en
muchos de los casos no se respeta las condiciones mnimas de higiene ni la seleccin del
estado de madurez de los frutos, pudiendo llegar frutos sobre maduros muy susceptibles
al dao mecnico.

Durante la venta en los supermercados, los mangos son colocados en anaqueles limpios
y en ambientes previamente higienizados, cuidando que los frutos estn alejados de
cualquier contaminacin cruzada. Por el contrario, en los mercados, los mangos estn
expuestos a ambientes no controlados y hay una gran probabilidad de contaminacin
cruzada que puede generarse por el vendedor y los propios clientes durante la
comercializacin.

Conclusiones
La calidad microbiolgica de los mangos comercializados en supermercados fue superior
a las de los mercados en la ciudad de Lima, demostrando que todos los controles y
estndares implementados por los supermercados disminuyen la probabilidad del
desarrollo microbiolgico y evitan posteriormente la reduccin de la vida til. Por otro lado,
es necesario mencionar que cambios a corto plazo deben ser establecidos en la forma de
comercializacin de mangos frescos en los mercados, buscando reducir los riesgos
microbiolgicos en cuanto a deterioro y prdidas de productos.

Bibliografa
1. Gutirrez, M.I.R., F. Ramos y B.C. Lpez. 2016. Calidad microbiolgica de mangos
comercializados en mercados y supermercados de la ciudad de Lima, Per. Rev Vitae. 23
(supl.2): S89-S90.
2. International Commission on Microbiological Specifications for Foods (ICMSF). 1988.
nd
Microorganisms in foods 1. Their significance and methods of enumeration. 2 ed.
University of Toronto Press, Toronto.
3. International Organization for Standardization (ISO). 1993. ISO 7932. Microbiology
General guidance for the enumeration of Bacillus cereus Colony-count technique at 30
C.
4. International Organization for Standardization (ISO). 1998. ISO 15214. Microbiology of food
and animal feeding stuffs Horizontal method for the enumeration of mesophilic lactic acid
bacteria Colony-count technique at 30 C.
5. Moss, M.O. 2008. Fungi, quality and safety issues in fresh fruits and vegetables. J Appl
Microbiol. 104(5): 1239-1243.
6. Nguyen-the, C., and F. Carlin. 1994. The microbiology of minimally processed fresh fruits
and vegetables. Crit. Rev. Food Sci. Nutr. 34(4): 371-401.
7. Tortorello, M.L. 2003. Indicator organisms for safety and quality Uses and methods for
detection: Minireview. J AOAC Int. 86(6): 1208-1217.
8. Yahia, E.M. 2011. Mango (Mangifera indica L.). pp. 492-565, 566e-567e. In: Postharvest
Biology and Technology of Tropical and Subtropical Fruits. Vol. 3. Cocona to Mango. Yahia,
E.M. Woodhead Publishing Limited, Cambridge.

89
Investigaciones en Ciencia e Inocuidad de Alimentos

Cronobacter sakazakii y parmetros microbiolgicos en alimentos lcteos


asociados a la alerta alimentaria nacional en Chile 2017
1 1 1 1
Parra-Flores, J., Cerda Leal, F., Contreras Fernndez , A., Rodriguez Fernndez, A.,
1 2
Valenzuela Riffo, N., Aguirre Garca, J.
1
Laboratorio de Epidemiologa y Microbiologa Molecular, Universidad del Bo-Bo, Andrs Bello
2
720, Chilln, Chile, (56)422463167, juparra@ubiobio.cl; Departamento de Agroindustria y
Enologa, Facultad de Ciencias Agronmicas, Universidad de Chile, Av. Sta. Rosa 11315, La
Pintana, Santiago, Chile.
Palabras clave: Cronobacter sakazakii, alimentos lcteos, alerta alimentaria

Introduccin
El 02 de Junio del 2017, el Ministerio de Salud de Chile decret una alerta
alimentaria por la presencia de Cronobacter sakazakii en 2 lotes de productos lcteos
destinado al consumo de nios menores de 10 aos, como resultado de un estudio
realizado por investigadores de la Universidad del Bo-Bo y que fue informado a las
autoridades de salud.
Este patgeno Gram negativo perteneciente a la familia Enterobacteriaceae fue
inicialmente definido como Enterobacter sakazakii para ser clasificado recientemente
como Cronobacter spp. con 7 especies: C. sakazakii, C. malonaticus, C. universalis, C.
turicensis, C. muytjensii, C. dublinensis, C. condimenti (1). Cronobacter sakazakii es
considerada la especie ms agresiva en individuos hipersensibles, siendo los grupos de
poblacin ms afectados recin nacidos, nios y adultos mayores, pero con mayor
incidencia y gravedad en nios prematuros. El cuadro clnico consiste principalmente en
meningitis, septicemia o enteritis necrozante en lactantes, aunque tambin se han
observado cuadros diarreicos, infecciones urinarias y septicemia con niveles de letalidad
asociadas a infeccin general de 26,9%, con 42% y 20% en meningitis neonatal y
septicemia respectivamente (2).
La enfermedad est asociada al consumo de leches en polvo rehidratadas (LP-R)
como vehculo del patgeno con eventual participacin de los utensilios y superficies
como reservorios. Dado el carcter ubicuo del patgeno puede ser aislado de leche en
polvo (LP) y rehidratada (LP-R), cereales infantiles, alimentos diversos, agua, superficies,
hogares y hospitales (3).
A partir del ao 2006 la OMS recomienda la vigilancia de Cronobacter spp., sin
embargo, en Chile an no se considera en el Reglamento Sanitario de los Alimentos
(RSA), el que ser actualizado en el segundo semestre 2017. Este trabajo tiene por
objetivo evaluar la presencia de Cronobacter sakazakii y conocer los parmetros
microbiolgicos en alimentos lcteos de diferentes orgenes asociados a la alerta
alimentaria nacional en Chile en junio del ao 2017.

Metodologa
Se analizaron 85 muestras de productos lcteos de 4 pases (USA, Singapur, Chile
y Holanda), 7 marcas comerciales de lcteos (A, B, C, D, E, F, G) y 2 tipos de producto
(polvo y lquidas) comercializadas en farmacias y supermercados de Chilln, Chile. Como
referencia se utilizaron los criterios de muestreo de la norma del RSA de Chile y
CAC/RPC 66 del Codex Alimentarius.

Parmetros microbiolgicos
Se utiliz el recuento de microorganismos mesfilos aerobios (RAM) y recuento de
Enterobacteriaceae (ENT). La cuantificacin de ambos grupos microbianos se realiz con
la metodologa descrita en las Normas Chilenas: NCh 2659 (2002) para RAM y NCh 2676
(2002) para ENT.

90
Investigaciones en Ciencia e Inocuidad de Alimentos

Aislamiento de Cronobacter spp


Se utiliz la tcnica descrita por Parra y cols. (3) utilizando agua peptonada buffer
(BPW, Oxoid, England) para productos lcteos en polvo y los productos lcteos lquidos
incubados en su envase original. Se enriqueci en Caldo EE (BD Difco, Sparks, MD, USA)
y posteriormente se estri en Agar Cromognico DFI (CM 1055, Oxoid Termo-Fisher, UK).
Las colonias presuntivas de Cronobacter spp. (color verde-azul) se purificaron en agar
soya tripticasena (BD Difco, Sparks, MD, USA). Las cepas aisladas fueron mantenidas en
cepario y almacenadas a -80C.

Identificacin de Cronobacter sakazakii


El ADN genmico de las cepas sospechosas fue extrado y purificado utilizando
UltraClean Microbial DNA Isolation Kit (Mobio, Qiagen, USA). Posteriormente fueron
identificadas mediante la amplificacin del gen rpoB (4) y cgcA (5) mediante PCR en
tiempo real en el equipo Stratagene Mx3000P QPCR System (Agilent Technologies).

Secuenciacin de gen fusA para identificacin de especies de Cronobacter spp.


Se utiliz la metodologa descrita por Parra y cols. (3). Los productos amplificados
fueron enviados a secuenciar a MACROGEN, Korea. Posteriormente, analizados en
software Gentle y ensamblados con PRABI-Doua (Francia). La identificacin se realiz
con la base de datos libre https://pubmlst.org/cronobacter/ y de BLASTn (NCBI).

Anlisis bioinformtico y estadstico


Los productos de la secuenciacin fueron analizados mediante el software Gentle
y posteriormente alineados con ClustalW. Se construy el rbol filogentico mediante el
mtodo de mxima verosimilitud utilizando el software MEGA7. Para describir
estadsticamente se usaron medidas de tendencia central, dispersin y posicin en el
caso de variables cuantitativas, y frecuencias absolutas y porcentajes para variables
cualitativas. Para comparar se utiliz la prueba de Mann- Whitney y Kruskall- Wallis
utilizando el software STATA 14 con un nivel de significancia =0,05.

Resultados y discusin
De las 85 muestras analizadas chilenas y extranjeras, el recuento de RAM fue
positivo en el 88% de ellas. Al analizar el RAM por marca comercial de lcteos no se
encontraron diferencias estadsticamente significativas (p>0.05). Sin embargo, en las
marcas comerciales lquidas el 50% de ellas contenan en la marca A 160 UFC/ mL, C 50
UFC/mL, E 4,600 UFC/mL y G 3,000 UFC/mL. Para la marca comercial en polvo B se
encontr 750 UFC/g, D 810 UFC/g y F 900 UFC/g. El recuento mximo se encontr en el
lcteo tipo F elaborado en Chile con 5,800,000 UFC/g. Segn pas de origen, no hubo
diferencias estadsticamente significativas entre los recuentos (p>0.05). Si comparamos
estos valores con los mximos permitidos en el RSA de Chile (< 50,000 UFC/g) solo 7
muestras (8.2%) seran consideradas rechazables, de las cuales una corresponde a
Holanda, cuatro a USA y tres a Chile. Estos valores son ms altos que los encontrados
por Parra y cols. (3) que en 2015 al analizar 72 muestras de leches en polvo no
encontraron valores de rechazo. Por otra parte, por Chap y cols. (6) en un estudio de
carcter internacional encontraron que solo el 5.1% de sus muestras contenan ms de
50,000 UFC/g. Estos valores evidencian la necesidad de un mayor control de las
probables fuentes de contaminacin de estos alimentos debido al amplio rango de
microorganismos presentes en el RAM y por la mayor susceptibilidad asociada a los
grupos de poblacin a quienes estn dirigidos estos productos.
Con respecto a los recuentos de ENT, se encontr en el 55% del total de las
muestras analizadas, con un 64% en marcas lquidas y un 51% en polvo. Hubo positividad

91
Investigaciones en Ciencia e Inocuidad de Alimentos

en todas las marcas comerciales con diversos recuentos, no siendo diferentes


estadsticamente (p>0.05). En las marcas B, D y E se encontr que el 50% de las
muestras contenan 5, 51 y 6,400 UFC/g respectivamente. De las marcas lquidas solo la
elaborada en USA tena ENT con valores de entre 1 a 35,000 UFC/mL. Estos valores
estn por sobre lo permitido segn norma internacional del Codex CAC RPC 66, que
exige ausencia de este indicador en 10 g de LP. Sin embargo, estos resultados no se
pueden comparar con el estndar de Chile ya que el RSA vigente no considera valores
para este grupo indicador. Aun cuando, no existen diferencias significativas por tipo,
marca comercial o pas de origen de los productos analizados (p>0.05), la sola presencia
de Enterobacteriaceae en estos alimentos es un factor de riesgo. Esta situacin no es del
todo excepcional, Reich y cols. (7) en una planta de proceso de LP en Alemania,
encontraron ENT en todas las muestras analizadas, y en siete lugares con valores sobre
500 UFC/g. Enfatizando la necesidad del monitoreo en el proceso de elaboracin y de
medidas de inocuidad e higiene durante su produccin. La alta positividad a ENT en
nuestro estudio, es compatible con la presencia de microorganismos oportunistas y
patgenos que han estado asociados a enfermedad en grupos de riesgo (3). Por lo que
estos hallazgos deben ser analizados nuevamente en trminos del riesgo asociado a su
consumo, del poco control que estaran realizando empresas elaboradoras y de la
autoridad de salud responsable en nuestro pas.
Del total de muestras analizadas, se aislaron 17 cepas sospechosas desde agar
cromognico. De ellas, 13 fueron identificadas como Enterobacter cloacae, Klebsiella
pneumoniae, Enterobacter hormaechei y Enterobacter spp. Solo 4 cepas sospechosas
provenientes de 4 productos en polvo (Chile y Singapur), fueron confirmadas como
Cronobacter sakazakii a travs de la amplificacin de los productos gnicos para rpoB y
cgcA a travs de PCR en tiempo real. En Chile, uno de los productos es destinado a nios
menores de 2 aos (CH84) y otros dos al consumo de adultos mayores los cuales no
fueron parte de la alerta alimentaria por su fecha de vencimiento (CH50 y CH85). El
restante, proveniente de Singapur, es destinado a nios mayores de 1 ao (CH65) (Figura
1).
La prevalencia de C. sakazakii en las muestras analizadas fue de 4,7%, superior a
lo encontrado en 2014 por Parra y cols. (3) en un estudio en 72 muestras de leches en
polvo que encontraron una prevalencia de 2,7% y con presencia de este patgeno solo en
muestras elaboradas en Chile.

Figura 1. rbol filogentico del gen fusA de cepas identificadas como Cronobacter
sakazakii mediante mtodo de mxima verosimilitud utilizando MEGA7.

En resumen, en este estudio encontramos una inadecuada calidad microbiolgica


de los alimentos lcteos analizados destinados al consumo de poblacin hipersensible.

92
Investigaciones en Ciencia e Inocuidad de Alimentos

Adems, se identific la presencia de Cronobacter sakazakii, lo que es un llamado de


alerta a los fabricantes y autoridades reguladoras en la salud pblica en Chile. Por ello, es
necesario establecer un mejor control de las condiciones higinicas en la elaboracin de
estos alimentos y de su vigilancia microbiolgica, con el fin de evitar riesgos innecesarios
para la salud en la poblacin que consume masivamente estos alimentos.

Conclusiones
El 8,2% de los productos lquidos y en polvo analizados contenan niveles de rechazo de
acuerdo al RAM segn la normativa chilena vigente y el 55% contenan ENT. La
prevalencia de C. sakazakii fue de 4.7% siendo detectado el patgeno en 4 productos
lcteos, tres de ellos elaborados en Chile y uno en Singapur. Producto de esta
informacin, el Ministerio de Salud de Chile decret una alerta alimentaria nacional
retirando del comercio todos los lotes de los productos que resultaron positivos en el
estudio destinados a nios menores de 10 aos.. Posteriormente el Instituto de Salud
Pblica de Chile, confirm la presencia de C. sakazakii en muestras de los mismos lotes.

Bibliografa

1. Joseph, S., E Cetinkaya. H Drahovska. A Levican. M Figueras. S Forsythe. 2012.


Cronobacter condimenti sp. Nov., isolated from spiced meat, and Cronobacter universalis
sp. Nov., a species designation for Cronobacter sp. Geneomoespecies 1, recovered from a
leg infection, water and food ingredients. Int J Syst Evol Microbiol. 62:1277-1283.
2. Hol, O., S Forsythe. 2014. Cronobacter spp. as emerging causes of healthcare-associated
infection. J. Hosp. Infect. 86(3): 169-177
3. Parra, J., L Oliveras, A Rodriguez, F Riffo, E Jackson, S Forsythe. 2015. Riesgo por
Cronobacter sakazakii en leches en polvo para la nutricin de lactantes. Rev. Chil. Nut. 42
(1): 83-89.
4. Stoop, B., A Lenher, C Iversen, S Fanning. 2009. Development and evaluation of rpoB
based PCR systems to differentiate the six proposed species within the genus Cronobacter.
Int. J. Food Microbiol. 136:165168.
5. Carter L, LA Lindsey, C Grim, V Sathyamoorthy, KG Jarvis, G Gopinath, C Lee, JA
Sadowski, L Trach, M Pava-Ripoll, BA McCardell, BD Tall, L. Hu. 2013. Multiplex PCR
Assay Targeting a Diguanylate Cyclase-Encoding Gene, cgcA, To Differentiate Species
within the Genus Cronobacter. J. Appl. Environ. Microbiol. 79(2):734-737.
6. Chap J., P Jackson, R Siqueira, N Gaspar, C Quintas, J Park, T Osaili, R Shaker, Z
Jaradat, S Hartantyo, N Abdullah Sani, S Estuningsih, S Forsythe. 2009. International
survey of Cronobacter sakazakii and other Cronobacter spp. in follow up formulas and
infant foods. Int J Food Microbiol. 136:185-188
7. Reich, F., R Knig, W von Wiese, G Klein. 2010. Prevalence of Cronobacter spp. in a
powdered infant formula processing environment. Int. J. Food Microbiol. 140:214217
8. Corli Witthuhn R., F Kemp, TJ Britz. 2007. Isolation and PCR detection of Enterobacter
sakazakii in South African food products, specifically infant formula milks. World J.
Microbiol. Biotechnol. 23:151157

93
Investigaciones en Ciencia e Inocuidad de Alimentos

Desarrollo de un producto alimentario extruido, similar a papa frita en base a


subproductos de papa y arroz. Evaluacin fsico-qumica, microbiolgica
Almendares Caldern. L., Romn Miranda, J.M., Lozano Silva, M.J., Ramirez Rojas, M.A.

Depto. Ciencias y Tecnologa de los Alimentos. Facultad Tecnolgica, Universidad de Santiago de


Chile. Av. Ecuador 3769. Santiago, Chile. laura.almendares@usach.cl

Palabras clave: Extrusin, papa, arroz

Introduccin
El presente trabajo forma parte del proyecto FIA-USACH PYT-2015-0206, el cual busca
desarrollar un producto alimentario extruido, similar a papas fritas en configuracin,
caractersticas y usos, con baja capacidad de absorcin de aceite en la fritura, fabricado a
base de materias primas chilenas de bajo valor comercial.
La necesidad de un alimento como el planteado se origina en el alto consumo de papas
fritas que muestra la poblacin chilena, especialmente los estratos etreos infantiles y
juveniles y los elevados ndices de sobrepeso y obesidad que conllevan susceptibilidad a
otras enfermedades tales como hipercolesterolemia, resistencia insulnica que determina,
a futuro, riesgos de adquirir diabetes mellitus tipo 2, hipertensin arterial, ateroesclerosis,
as como muerte prematura por enfermedades cardiovasculares isqumicas. (1)
Cifras oficiales muestran un alarmante aumento de la obesidad en escolares y el
incremento de la obesidad infantil. En Chile, entre el ao 2011 y 2012, la obesidad en
octavo ao bsico, segn IMC, subi de un 16 a un 18%; el sobrepeso de un 25 a un 26%
y slo un 8% de los escolares logr un nivel satisfactorio en actividad fsica, lo cual hizo
plantear a la Ministra de Educacin de la poca que estos resultados eran enormemente
preocupantes.(6)
Recientes estudios realizados por el The American Journal of Clinical Nutrition advierten
un riesgo de muerte prematura para quienes consumen al menos 2 veces por semanas
las papas fritas. (5)
El consumo de papas fritas est firmemente arraigado en la poblacin, es un elemento de
connotacin social y existen procesos bioqumicos que llevan a una dependencia del
consumo: al ingerir materias grasas se activa una respuesta adictiva vinculada a la
sensacin de placer de recompensa, similar a las drogas.
La idea central entonces no es tratar de prohibir el consumo de papas fritas, lo que sera
impracticable, sino que hacerlas menos nocivas, disminuyendo las materias grasas que
contienen.(2),(3). La via de materializar lo anterior es formular un simil de papas fritas,
aceptable por el consumidor en el que se haya disminuido la capacidad de absorcin de
aceite en la fritura, reemplazando un porcentaje de papa por otro alimento de menor
capacidad de retener aceite, en este caso, harina de arroz. La forma de estructurar este
alimento es mediante extrusin.
El objetivo general de esta investigacin es lograr la obtencin de un producto extruido
que sea similar a las papas fritas tradicionales, con forma de bastn, existentes en el
comercio, con la particularidad que absorba menos aceite al ser sometido a fritura.

Metodologa
Se inici el estudio considerando caractersticas de papas de variedades cultivadas en
Chile y catalogadas como aptas para el proceso de fritura, para lo cual se tuvo presente
la clasificacin de variedades hecha por el Servicio Agrcola y Ganadero (4). Se estudi
mtodo de pelado, molienda, prensado para obtener pulpa de papas, la que se estabiliz
desde el punto de vista enzimtico, mediante metabisulfito de sodio. Esta pasta de papas
se mezcl con harina de arroz y se investig el comportamiento de distintas relaciones

94
Investigaciones en Ciencia e Inocuidad de Alimentos

papas arroz al proceso de extrusin, fritura y evaluacin fsico qumica, microbiolgica y


sensorial.
Se formularon 3 prototipos principales, para ser sometidos a extrusin, los cuales se
diferenciaron en los porcentajes de composicin.
Una vez obtenidas las tres mezclas, los ensayos finales se realizaron mediante
procedimientos ms industrializados con la utilizacin de una batidora semi- industrial
(MAIGAS, mod. FAVB20F capacidad 20 Litros) para lograr la homogenizacin de los
ingredientes. Finalmente estas mezclas fueron sometidas al proceso de extrusin. Los
porcentajes de composicin obtenidos en las pruebas preliminares fueron los siguientes:

Resultados y discusin
Tabla 1. Composicin porcentual de ingredientes de los prototipos elegidos.

Materias primas Prototipo 1 Prototipo 2 Prototipo 3

Pasta de papa Presente Presente Presente

Papa Ausente Presente Ausente


deshidratada

Harina de arroz Presente Presente Presente

Tabla 2. Anlisis fsico qumico proximal. Prototipos sin extrusin.

Prototipo 1 Prototipo 2 Prototipo 3

Humedad (g/100g) 53.9 53.8 48.6

Protenas (%Nx5.95) 2.7 2.7 3.2

Lpidos (g/100g) *no detectado *no detectado *no detectado

Cenizas (g/100g) 0.6 0.6 0.8

Fibra Cruda (g/100g) **no **no detectado **no detectado


detectado

Extracto no Nitrogenado 42.8 42.9 47.4


(g/100g)

Energa (kcal/100g) 182 182 202

Estos tres prototipos mostraron un mejor comportamiento en la configuracin y


constitucin de los bastones, as como en caractersticas de pegajosidad, textura e
integralidad. Entre ellos existan an diferenciaciones importantes, por lo cual se
caracterizaron desde el punto de vista fsico qumico para reducir el universo de opciones

95
Investigaciones en Ciencia e Inocuidad de Alimentos

solo al mejor, buscando la mezcla ptima. A este propsito en primera instancia, se


configuraron bastones en forma manual, sin extruir.

Tabla 2. Anlisis fsico qumico proximal. Prototipos sin extrusin.

Se consider, adems, la necesidad de una mayor similitud del bastn obtenido con las
papas fritas tradicionales. Para ello se tom en cuenta la firmeza del bastn,
adherencia al tacto, dureza, enmascaramiento del sabor a arroz, y otros. Con este fin se
procedi a freir las muestras confeccionadas, y someterlas a evaluacin sensorial. En
esta etapa se consideraron aditivos para optimizar el producto. En base a los avances
enunciados se estudi la etapa de extrusin, considerando dos tipos de extrusor, de
tornillo simple y tornillo doble. Se investig temperaturas, presin de proceso y el efecto
de la humedad. Este ltimo factor result relevante en las caractersticas del bastn
extruido, obtenindose un producto firme, de baja adherencia al tacto, y de alta similitud a
bastones de papas comunes, antes de freir.

Tabla 3. Resultados de humedad de los prototipos antes y despus de la extrusin

Extrusin tornillo simple Extrusin doble tornillo

Prototipo % % % % % %
Humedad Humedad Prdida Humedad Humedad Prdida
entrada salida de entrada salida de
extrusor extrusor humedad extrusor extrusor humedad

1 50.9 44.75 6.15 51.44 36.9 14.54

2 44.81 42.03 2.78 45.79 40.3 5.49

3 56.71 50.43 6.07 56.09 47.16 8.93

35
% DE Absorcion de aceite

29,36
30 26,72
25
19,86 19,96
20 16,43 17,02
14,43
15 11,07
10,16
10 7,47
5,21 4,81
5
0
Muestra A Muestra A Muestra B Muestra B Muestra C Muestra C
Control Goma Control Goma Control Goma
Xantan Xantan Xantan

Serie1 Serie2

Figura 1. Comportamiento de los prototipos a la absorcin de aceite

96
Investigaciones en Ciencia e Inocuidad de Alimentos

Se consigui una significativa reduccin de la absorcin de aceite, lo que se consolid


en una segunda serie de productos elaborados, como se muestra en la figura anterior.

Figura 2. Recuentos Microbiolgicos

Todas las muestras tratadas cumplen con los requisitos establecidos por el Reglamento
Sanitario de los Alimentos.

Conclusiones
Se obtuvo un simil de papas fritas de menor contenido de aceite que las tradicionales y
nivel satisfactorio de aceptacin en evaluacin sensorial.
El producto presenta caractersticas diferenciadoras especialmente en sabor que se
enmascaran cuando se le integran algunos saborizantes naturales.
La humedad es un parmetro fundamental de medicin en el proceso, ya que es un
determinante para los resultados de extrusin, y absorcin de aceite; sta debe ser
evaluada en todas las etapas del procesos.
Los recuentos microbiolgicos se encuentran dentro de lo permitido por el Reglamento
Sanitario de los Alimentos de Chile (RSA), por lo que el producto cumple con los
requerimientos microbiolgicos establecidos para ser consumido.
El Prototipo 1, que contiene 70 % papa y 30 % arroz es el mejor evaluado sensorialmente,
el cual no presenta diferencias significativas con la muestra control utilizada (papa frita
tradicional).
Bibliografa
1. Araya L, Hctor, Atalah S, Eduardo, Benavides M, Xenia et al. Prioridades de intervencin
en alimentacin y nutricin en Chile. Rev. chil. nutr. [online]. dic. 2006, vol.33, no.3 [citado
12 Mayo 2007], p.458-463. Disponible en a World WideWeb: . ISSN 0717-7518.
2. Pedreschi F., Cocio C., Moyano P., Troncoso E. (2008) Oil distribution in potato slice during
frying. Journal of Food Engineering (87). 200-2012
3. Rimac-Brncic, S., Lelas, V., Rade, V. (2004) Decreasing of oil absorption in potato strip
during deep fat frying. Journal of Food Engineering 64: 237-241
4. Servicio Agrcola y Ganadero, Edicin Divisin Semillas. Variedades certificadas de papas.
Depto. de Clientes y Comunicaciones, SAG. Noviembre 2012, Chile
5. Veronese. N et al Fried potato consumption is associated with elevated mortality. The
American Journal of clinical nutrition 106 (!) 162 -167. 2017 Jun 07
6. Vio Del Rio, F. El preocupante incremento de la obesidad infantil en Chile. Universidad de
Chile, Instituto de Nutricin y Tecnologa de los Alimentos. 2013

97
Investigaciones en Ciencia e Inocuidad de Alimentos

Nanopartculas de Quitosano con aceite esencial de Pirul (Schinus molle L):


Efecto antifngico y anti-aflatoxignico
1 1 1
Lpez-Meneses, A.K. , Plascencia-Jatomea, M. , Rodrguez-Flix, F. , Lizardi-Mendoza,
2 3 1
J. , Mourio-Perez, R.R. , y Cortez-Rocha, M.O.
1
Departamento de Investigacin y Posgrado en Alimentos, Universidad de Sonora, Hermosillo,
2
Sonora. C.P. 83000, Mxico; Centro de Investigacin en Alimentacin y Desarrollo (CIAD, A.C.)
3
unidad Hermosillo, Sonora. C.P. 83304; Centro de Educacin Cientfica y de Educacin Superior
de Ensenada (CICESE), Ensenada, B.C. C.P. 22860.

Palabras clave: Aspergillus parasiticus, aflatoxinas, nanopartculas

Introduccin
Los hongos son clulas eucariotas con un nivel biolgico de complejidad ms elevado que
las bacterias y considerados bicuos por su capacidad de proliferar en diversos sustratos,
causando prdidas econmicas en la agricultura y en la industra alimentaria. Dentro de
este grupo estn los hongos micotoxignicos, que como su nombre lo dice, tienen
capacidad de producir metabolitos secundarios con efectos txicos. Entre los principales
est el gnero Aspergillus. Este es de los ms estudiados por producir toxinas que
afectan la salud, conocidas como aflatoxinas (AFs). Existen ms de 20 tipos de AFs, pero
las ms estudiadas son la AFB1, AFB2, AFG1 y AFG2. Estas son reconocidos por sus
efectos cancergenos, mutgenicos y teratognicos, e incluso, la AFB1 est clasificada por
la Agencia Internacional de Investigacin en Cncer (IARC) dentro del grupo 1 como
compuesto reconocido como cancergeno para humanos (4).
Para el control de estos hongos se ha recurrido a diversos mtodos, siendo el qumico el
ms empleado por su alta efectividad. Sin embargo, el uso excesivo de estos compuestos
ha ocasionado problemas en el medio ambiente, resistencia por parte de los
microorganismos, acumulacin en alimentos, y afectaciones a la salud de seres vivos. Por
tal motivo, nuevas alternativas se estn buscando para reemplazar el uso de fungicidas
sintticos. Existen estudios que reportan el efecto antifngico y antimicotoxignico de
extractos de origen animal y vegetal, entre los cuales destacan los aceites esenciales
(AE) extrados de hojas, tallos, flores y frutos de diversas plantas, lo cuales inhiben el
desarrollo de varios hongos micotoxignicos. Por ejemplo, el AE de Schinus molle L.
presenta propiedades antimicrobianas entre otras. Pero este efecto y al igual que en el
caso de muchos otros AE, se ve afectado por la naturaleza qumica de la mezcla de sus
compuestos, los cuales son termolbiles y fotosensibles, lo que provoca que se degraden
(7). Sin embargo, para mantener estas propiedades es que se ha recurrido a la
nanotecnologa que ayude a potencializar y mejorar el efecto de los compuestos
bioactivos (2). Esto se puede lograr sintetizando nanopartculas (Nps) con algn polmero
que actue en sinerga con el AE e interactue con la membrana del microorganismo en
estudio. Existen polmeros que se han utilizado para obtencin de estos materiales como
el quitosano (QT), que es utilizado en la industria farmacutica y alimentaria, por ser
biocompatible, biodegradable y no presentar toxicidad. Por ello, el objetivo de este estudio
fue sintetizar Nps de quitosano con AE de pirul (Schinus molle L.) por gelificacin inica y
evaluar su efecto en el crecimiento radial, germinacin y viabilidad de esporas de
Aspergillus parasiticus, as como en la produccin de aflatoxinas.

Metodologa
La extraccin del aceite esencial de pirul (AEP) se hizo por hidrodestilacin como lo
reporta (5) utilizando hojas de pirul (Schinus molle L.) que fueron colectadas en el

98
Investigaciones en Ciencia e Inocuidad de Alimentos

municipio de Hermosillo, Sonora (28 96 14 N y 111 04 40 W). Los compuestos


voltiles del AEP se detectaron por cromatografa de gases acoplado a masas (1).
La sntesis de nanopoartculas fue por gelificacin inica de acuerdo a la metodologa de
(3,8) con ligeras modificaciones. Se prepar quitosano al 0.2% (p/v) (QT, mediano peso
molecular y 78% de grado de desacetilacin) en cido lctico al 1% (v/v), que se dej en
agitacin toda la noche. Posteriormente, a 40 mL de la solucin de QT se le agregaron
0.45 g de Tween 80 y se agit 2 h a 50 C. Se tomaron 20 mL de esta solucin y se
agregaron 0.04 g de AEP y se agit una h y obtener la emulsin. Para las nanopartculas
de quitosano puro (Np-QT), a 3 mL de la solucin de QT con Tween 80 (en agitacin
constante) se le gotearon 3 mL tripolifosfato de sodio al 0.02% (v/v) (TPP, como
entrecruzante) y se agit por 15 min. El proceso se repiti para las nanopartculas de QT
con AEP (Np-QT-AEP) pero tomando 3 mL de la emulsin elaborada, para proceder a la
dialisis de las Nps con metanol 10%. Parte de la caracterizacin consisti en anlisis de
morfologa por microscopa electrnica de barrido (SEM), distribucin de tamao y
potencial Z utilizando dispersin de luz dinmica (DLS).
En los ensayos in vitro se evaluaron tres etapas de desarrollo del hongo Aspergillus
parasiticus (ATCC 16992) con cuatro concentraciones de Nps (500, 250, 125 y 62.5
g/mL). El crecimiento radial por la inoculacin en pozo propuesto por (5), germinacin
de esporas que consisti en colocar portaobjetos circulares en el fondo del pozo de
microplacas de 12 pozos, se agreg 500 L de medio Czapek, 500 L de cada NPs y una
suspensin de 1x105 esporas mL-1. El conteo de esporas germinadas y no germinadas se
realiz cada 6 h durante 24 h con un microscopio ptico. Se calcul la inhibicin de
esporas germinadas con la ecuacin propuesta por (5). Finalmente se evalu la viabilidad
de esporas del hongo mediante la tcnica reportada por (6) utilizando sal de tretazolio
(XTT).
La evaluacin del efecto de las Nps sobre la produccin de aflatoxinas totales (AFTs)
consisti en tres pasos: produccin, extraccin y cuantificacin de AFTs siguiendo el
protocolo reportado por (5) y la casa comercial VICAM.
Se utiliz un diseo experimental completamente al azar y tres controles: medio Czapek
(Cz), TPP y AEP. El anlisis estadstico se realiz con anlisis de varianza a un nivel de
significancia = 0.05. La comparacin de grupos se hizo con la prueba de Tukey a un
intervalo de confianza de 95 % con el programa estadstico JMP versin 5.0.1.

Resultados y discusin
El rendimiento de extraccin del aceite esencial de pirul (AEP) fue de 1.2% en base seca.
En el anlisis de la composicin qumica se identificaron monoterpenos y sesquiterpenos
principalmente. Algunos de los componentes mayoritarios fueron D-limoneno (17.8%), o-
cimeno (16.4%), -felandreno (12.6%), -cadineno (7.5%) y cariofileno (6.5%).
En el anlisis de la morfologa por microscopa electrnica de barrido (SEM), las
micrografas muestran que las Np-QT y Np-QT-AEP son esfricas y la distribucin del
tamao para las Np-QT est en un rango de 200 350 nm, y las Np-QT-AEP1 de 225
363 nm (Figura 1). El dimetro de la Np-QT-AEP1 aument ligeramente con la
incorporacin del AEP, aunque algunos autores han reportado ya este comportamiento.

99
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 1. Micrografa de SEM de A (Np-QT) y B (Np-QT-AEP1)


Asimismo, se presenta una distribucin bimodal para las Np-QT, la cual oscila entre las
poblaciones de <20 nm y >300 nm. Sin embargo, las Np-QT-AEP1 mostraron un
comportamiento diferente, ya que se observaron tres poblaciones diferentes <20 nm, <80
nm y >500 nm (Figura 2). Los valores del potencial Z obtenidos fueron de +43.8 11.25 y
+40.1 7.5 mV para Np-QT y Np-QT-AE, respectivamente. En la tabla 1 se muestra los
promedios de los dimetros mayoritarios para cada tipo de nanopartculas, como tambin
el ndice de polidispersidad y el potencial Z. La carga positiva de la superficie resulta de la
protonacin de los grupos amino del QT; no obstante, el potencial disminuye cuando los
componentes del AEP interactuan con los grupos amino del QT. Este comportamiento
concuerda con lo reportado por (3), que observaron una disminucin del potencial Z al
agregar el AEP a bionanocompositos de quitosano sintetizados por nanoprecipitacin.

Figura 2. Distribucin de las Nps por porcentaje de intensidad

Por otra parte, se observ que las Np-QT disminuyeron significativamente el radio de la
colonia, mientras que algunas concentraciones de Np-QT-AE y AEP no inhibieron con
respecto al control Cz (p > 0.05). El efecto que presentaron las Nps fue fungisttico, ya
que el desarrollo de las hifas fue retrasado al estar en contacto con los compuestos que
conforman a las Nps. Se calcul el porcentaje de inhibicin del crecimiento radial, siendo
las Np-QT las que inhibieron en mayor proporcin (80 90%). Las AEP y Np-QT-AE
inhibieron cerca del 50%, y no se encontr diferencia significativa entre las
concentraciones. En la prueba de germinacin de esporas, los controles (TPP y AEP)
retardaron la germinacin de esporas las primeras 12 h con respecto al control Cz,
aunque todas alcanzaron el 100% a las 24 h. Se encontr diferencia significativa (P <
0.05) en el porcentaje de esporas germinadas entre controles y las Nps en cada uno de
los tiempos. Las Nps redujeron significativamente la germinacin de esporas (P < 0.05),
logrando las Np-QT-AE a las 18 h, un porcentaje de inhibicin superior al 40 %, mientras
que con las Np-QT se ocasion menos del 40% de inhibicin.
n la figura 3 se observa el efecto de los tratamientos sobre la viabilidad de esporas. Las
Np-QT-AE presentaron diferencia significativa (P < 0.05) entre sus concentraciones,
siendo las de 500 y 250 g/mL las que afectaron la viabilidad por debajo de 70%. Se
observ un efecto en la viabilidad directamente proporcional a la concentracin del Np-
QT-AE. Por el contrario, las Np-QT solo en 250 g/mL redujo la viabilidad con respecto al
control (P < 0.05).
En el efecto de las Nps en la produccin de AFTs, se observ que las Np-QT-AE a 500 y
250 g/mL inhibieron la produccin en un 59.14 y 16.12%, respectivamente. Mientras que
la concentracin ms baja de las Np-QT solo inhibi en un 21.5%. Como anteriormente se
mencion, es de suma importancia encontrar una alternativa la cual ayude a inhibir o
disminuir la produccin de estas toxinas, las cuales generan diversos y graves

100
Investigaciones en Ciencia e Inocuidad de Alimentos

padecimientos en humanos y animales, por lo que de acuerdo a estos resultados,


podemos considerar a las Np-QT-AE como una alternativa para su control, solo
mejorando la formulacin y las concentraciones utilizadas.

Figura 3. Efecto de las Nps en la viabilidad de esporas de A. parasiticus. Las barras


representan la media error estndar. * o ** indica diferencia significativa entre
concentraciones del mismo tratamiento (P < 0.05).

Conclusiones
Las nanopartculas de quitosano con aceite esencial de pirul a ciertas concentraciones
retrasaron el desarrollo normal de A. parasiticus y afectaron la viabilidad de sus esporas.
La produccin de aflatoxinas totales fue inhibida por las nanopartculas considerndose
una alternativa natural efectiva para el control del este microorganismo y sus toxinas.

Bibliografa
1. Ayala-Zavala, J.F., H. Soto-Valdez, A. Gonzlez-Len, E. lvarez-Parrilla, O. Martn-Belloso, G.A.
Gonzlez-Aguilar. 2008. Microencapsulation of cinnamon leaf (Cinnamomum zeylanicum) and garlic
(Allium sativum) oils in B-cyclodextrin. J Incl Phenom Macrocyl Chem. 60:359-368.
2. El Asbahani, A., K. Miladi, W. Badri, M. Sala, E.H. At Addi, H. Casabianca, A. El Mousadik, D. Hartmann,
A. Jilale, F.N.R. Renaud, and A. Elaissari. 2015. Essential oils: From extraction to encapsulation. Int J
Pharm. 483:220-243.
3. Hosseini, S.F., M. Zandi, M. Rezaei, and F. Farahmandghavi. 2013. Two-step method for encapsulation of
oregano essential oil in chitosan nanoparticles: Preparation, characterization and in vitro release study.
Carbohydr Polym. 95:50-56.
4. IARC (International Agency for Research on Cancer). 2002. Some traditional herbal medicines, some
mycotoxins, naphtalene and styrene. Volume 82.
5. Lpez-Meneses, A.K., M. Plascencia-Jatomea, J. Lizardi-Mendoza, E.C. Rosas-Burgos, A.G. Luque-
Alcaraz, and M.O. Cortez-Rocha. 2015. Antifungal and antimycotoxigenic activity of essential oils from
Eucalyptus globulus, Thymus capitatus and Schinus molle. Food Sci Technol (Campinas): 35:664-671.
6. Luque-Alcaraz, A.G., M.O. Cortez-Rocha, C.A. Velzquez-Contreras, A.L. Acosta-Silva, H. Santacruz-
Ortega, A. Burgos-Hernndez, W-M. Argelles-Monal, and M. Plascencia-Jatomea. 2016. Enhanced
antifungal effect of chitosan/pepper tree (Schinus molle) essential oil bionanocomposites on the viability of
Aspergillus parasiticus spores. J Nanomater. 2016:1-10.
7. Turek, C. and F.C. Stintzing. 2013. Stability of essential oils: A review. Compr Rev Food Sci Food Saf.
12:40-53.
8. Yoksan, R., J. Jirawutthiwongchai, and K. Arpo. 2010. Encapsulation of ascorbyl palmitate in chitosan
nanoparticles by oil-in-water emulsion and ionic gelation processes. Colloids Surf., B. 76:292-297.

101
Investigaciones en Ciencia e Inocuidad de Alimentos

Aislamiento de bacterifagos especficos contra cepas de Escherichia coli


formadoras de biopelculas
Gonzlez-Gmez J. P., Iiguez-Moreno M., Ibarra-Rodrguez J. R., vila-Novoa M. G., Guerrero-
Medina P. J., y Gutirrez-Lomel M.

Centro Universitario de la Cinega, Universidad de Guadalajara, Laboratorio de Alimentos. Av.


Universidad 1115, Col. Linda Vista, C.P. 47810, Ocotln, Jalisco. Tel. (392)9259400.
jeanpierregg@hotmail.com

Palabras clave: Bacterifagos, biopelculas, Escherichia coli.

Introduccin
Las bacterias formadoras de biopelculas son de gran preocupacin para la industria
alimentaria por la capacidad que tienen de adherirse a las superficies y desarrollar esta
compleja matriz, sirviendo como reservorio de patgenos y daando las superficies sobre
las que se desarrollan (3,8). Estos microorganismos pueden llegar a la industria
alimentaria mediante diversas fuentes como agua, materias primas o alimento crudo, y
pueden sobrevivir en los equipos por periodos largos de tiempo, principalmente en forma
de biopelculas. Los productos alimenticios pueden contaminarse en cualquier etapa del
proceso a pesar de que se hayan aplicado los protocolos de limpieza establecidos, ya que
es frecuente que en la industria alimentaria los procedimientos de limpieza y desinfeccin
sean inefectivos para la remocin de biopelculas. Esto se debe a que la matriz de la
biopelcula acta como una barrera de difusin, evitando que el agente biocida entre en
contacto con las bacterias que la forman (2,8).
Para la industria crnica, en especfico, el patgeno que representa mayor riesgo de
contaminacin es Escherichia coli productora de toxina Shiga (STEC). En 2016 se
reportaron 1 399 casos, 326 hospitalizaciones y 3 muertes por este patgeno en Estados
Unidos (7), observndose un aumento en el nmero de casos con respecto a aos
anteriores.
Los mtodos de biocontrol (bacteriocinas, enzimas, bacterifagos) han sido recientemente
estudiados para el tratamiento de las biopelculas, debido a las desventajas que
presentan los mtodos qumicos y fsicos (4). El uso de bacterifagos como aditivo en
carne de res y productos avcolas, fue aprobado por la FDA en el 2006 a peticin de la
empresa Intralytics, Inc., la cual fabrica una mezcla de 6 bacterifagos con actividad
especfica contra L. monocytogenes (6). A partir de este hecho se comenz a expandir el
campo del uso de bacterifagos como mtodo de biocontrol, dando lugar a mltiples
estudios tratando a las bacterias patgenas y deterioradoras que se pueden encontrar en
la industria alimentaria (3).
Los bacterifagos son virus que infectan clulas procariotas y se encuentran ampliamente
distribuidos en todos los hbitats donde se encuentran sus hospederos. Se pueden
clasificar segn su forma, tamao y tipo de cido nucleico. Estos pueden infectar a la
bacteria siguiendo dos ciclos de vida: ltico y lisognico. En la mayora de los
bacterifagos, el ciclo ltico termina con la lisis de la bacteria hospedera y la liberacin de
la progenie fgica. Entonces, las propiedades antimicrobianas de los bacterifagos estn
ligadas al ciclo ltico (fago ltico), porque la bacteria que ha sido infectada est destinada a
morir. Por otro lado, el ciclo lisognico implica la supervivencia y establecimiento del
genoma del fago en el cromosoma bacteriano (profago), hasta que las seales
ambientales disparen el ciclo ltico, de este modo solo se lisa una parte de la poblacin
infectada. Adems, una bacteria que lleva un profago es resistente a ser infectada por
otro fago relacionado (3).

102
Investigaciones en Ciencia e Inocuidad de Alimentos

Existe un gran inters por parte de las industrias que se dedican a la inocuidad de
alimentos en desarrollar nuevos desinfectantes no txicos para los humanos y amigables
con el medio ambiente. Debido a la problemtica que existe con la resistencia de las
bacterias a los desinfectantes actuales y la tendencia global que se dirige a los mtodos
de control biolgicos, los bacterifagos son un excelente prospecto al cumplir con todos
los requerimientos. El uso de un desinfectante a base de bacterifagos tendr un impacto
positivo en la industria al lograr la remocin de biopelculas y evitando las prdidas
econmicas que se dan por la contaminacin de productos y el reemplazo de equipo, o
partes de l, en el que se ha logrado establecer la biopelcula.

Metodologa
La metodologa se realiz siguiendo lo descrito por Jamalludeen y col. en 2007 (5).
Muestreo: Se recolectaron 4 muestras: 2 de hgado de res (HR-1 y HR-2) y 2 de hgado
de pollo (HP-1 y HP-2), en supermercados de la ciudad de Culiacn, Sinaloa. Cada
muestra consisti de piezas empaquetadas en dichos establecimientos y exhibidos en
anaqueles con sistemas de refrigeracin. Se identificaron con su respectivo cdigo y
fueron transportadas inmediatamente al laboratorio para ser procesadas.
Aislamiento de bacterifagos: Se reactivaron en 20 mL de caldo soya tripticasena (CST)
10 cepas de Escherichia coli (EC-02, EC-08, EC-21, EC-22, EC-23, EC-25, EC-26, EC-27,
EC-28, EC-30) formadoras de biopelculas aisladas de la industria alimentaria
proporcionadas por el Laboratorio de Microbiologa del CUCinega, UDG; incubndose 24
h a 37 C. Se transfirieron 3 mL de cada una de las cepas a un tubo cnico estril de 50
mL y se le aadieron 5 g muestra. Este procedimiento se repiti para cada muestra y los
tubos se incubaron 24 h a 37 C y 70 rpm en un bao mara. Se centrifugaron los tubos a
10 000 x g, 10 min a 4C, se recuper el sobrenadante y se repiti este procedimiento dos
veces ms. El sobrenadante del tercer centrifugado fue filtrado a travs de una membrana
de 0.45 m de dimetro de poro, utilizando embudos de filtracin estriles acoplados a un
matraz Kitasato estril y a una bomba de vaco. El filtrado se recuper en un tubo cnico
estril de 50 mL.
Determinacin de la presencia de bacterifagos: Se reactivaron en CST las 10 cepas de
Escherichia coli usadas en el aislamiento de los bacterifagos, incubndose 24 h a 37 C.
Se esterilizaron tubos con 3 mL de agar soya tripticasena suave (ASTs: CST + 0.4 % de
agar bacteriolgico) y se mantuvieron a 45 C en bao mara. A cada tubo se le agreg 1
mL de cultivo, se agit suavemente y se distribuy el agar suave sobre una placa de agar
soya tripticasena (AST) previamente preparada, identificada y con 4 divisiones. Se dej
solidificar el ASTs y se coloc una gota de 5 L de cada filtrado fgico para evidenciar la
presencia de lisis bacteriana en caso de que haya presencia de bacterifagos especficos
contra esa cepa. Se dej que la gota se absorbiera y se incub 24 h a 37 C.
Purificacin de bacterifagos: Se reactiv en CST la cepa en la que se observaron zonas
de lisis ms grandes y cristalinas para cada filtrado fgico, incubndose 24 h a 37 C. Se
realiz la tcnica del doble agar: se prepararon tubos con 3 mL de ASTs y se mantuvieron
a 45 C en bao mara, se les aadi 1 mL de cultivo y 100 L del filtrado fgico, se dej
solidificar y se incub 24 h a 37 C. Se repiti este procedimiento con las diluciones 101 y
103 del filtrado fgico con el fin de obtener zonas de lisis aisladas y bien diferenciadas.
Despus de las 24 h de incubacin se revisaron las cajas y se recuperaron las zonas de
lisis con una punta de micropipeta estril y se depositaron en un tubo Eppendorf con 1 mL
de agua estril inyectable, se homogeniz suavemente y se procedi a realizar
nuevamente la tcnica del doble agar agregando 100 L de la mezcla fgica contenida en
el tubo Eppendorf. Despus de realizar 3 veces esta tcnica podemos asumir que
tenemos un solo tipo de bacterifago aislado.

103
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin
En la Tabla 1 se muestran los resultados de la determinacin de presencia de
bacterifagos en la que observamos que las muestras HP-1 y HP-2 contenan
bacterifagos que formaron zonas de lisis cristalinas hasta con 4 cepas diferentes, lo que
indica actividad ltica contra dichas cepas, por lo que son idneas para seguir con el
procedimiento de purificacin. Las muestras HR-1 y HR-2 formaron zonas de lisis opacas
en un par de cepas, lo que nos indica actividad de ciclo lisognico del bacterifago. No se
continu con el proceso de purificacin de estas muestras, ya que un bacterifago que
muestra actividad lisognica no es adecuado para el fin del proyecto (1,5).

Tabla 1. Determinacin de la presencia de bacterifagos especficos contra cepas de


Escherichia coli formadoras de biopelculas en muestras de alimentos.
Muestra Cepa
EC-02 EC-08 EC-21 EC-22 EC-23 EC-25 EC-26 EC-27 EC-28 EC-30
HR-1 - - - - - - + - -
HR-2 - - - - - - - -
HP-1 - - - + + - + + -
HP-2 - - - + - + - + + -
+ = presencia de zonas de lisis cristalinas
= presencia de zonas de lisis opacas
- = ausencia de zonas de lisis

En la Figura 1 se muestra un ejemplo de las zonas de lisis cristalinas y aisladas una de


otras. Tanto en HP-1 como HP-2, se obtuvieron zonas de lisis con estas caractersticas en
la dilucin 103.

Figura 1. Zonas de lisis formadas por los bacterifagos presentes en la dilucin 103 de la
muestra HP-1.

Se registr el dimetro y la apariencia de estas zonas de lisis, ya que diferencias en estas


caractersticas son indicador de que en cada una hay diferentes tipos de bacterifagos.
Se obtuvieron 3 morfologas diferentes en las zonas de lisis de cada muestra y fueron

104
Investigaciones en Ciencia e Inocuidad de Alimentos

procesadas como muestras diferentes para los siguientes pasos de purificacin,


obteniendo 6 bacterifagos purificados: HP-1.1, HP-1.2, HP-1.3, HP-2.1, HP-2.2 y HP-2.3.
A pesar de que se ha cumplido con el objetivo primario del estudio, es necesario seguir
con la caracterizacin de los bacterifagos mediante microscopa electrnica para poder
clasificarlos en sus respectivas familias, as como evaluar la ausencia de genes de
lisogenia, ausencia de genes de virulencia y comprobar la estabilidad de su genoma
(1,5). Estas son las principales caractersticas que pueden darnos la certeza de que son
bacterifagos aptos para ser usados como mtodo de biocontrol para la remocin de
biopelculas.

Conclusiones
Se lograron aislar 6 bacterifagos especficos contra cepas de Escherichia coli
formadoras de biopelculas a partir de muestras de alimentos.

Bibliografa
1. Amarillas, L., C. Chaidez, A. Gonzlez-Robles, and J. Len-Flix. 2016. Complete
genome sequence of new bacteriophage phiE142, which causes simultaneously
lysis of multidrug-resistant Escherichia coli O157:H7 and Salmonella enterica. Stand.
Genomic Sci. 11:89.
2. Anand, S. and A. Singh. 2013. Resistance of the constitutive microflora of biofilms
formed on whey reverse-osmosis membranes to individual cleaning steps of a typical
clean-in-place protocol. J. Dairy Sci. 96:6213-6222.
3. Gutirrez, D., L. Rodrguez-Rubio, B. Martnez, A. Rodrguez, and P. Garca. 2016.
Bacteriophages as weapons against bacterial biofilms in the food industry. Front.
Microbiol. 7:825.
4. Jahid, I.K. and S.-D. Ha. 2012. A review of microbial biofilms of produce: Future
challenge to food safety. Food Sci. Biotechnol. 21:299-316.
5. Jamalludeen, N., R.P. Johnson, R. Friendship, A.M. Kropinski, E.J. Lingohr, and C.L.
Gyles. 2007. Isolation and characterization of nine bacteriophages that lyse O149
enterotoxigenic Escherichia coli. Vet. Microbiol. 124:47-57.
6. Lang, L.H. 2006. FDA approves use of bacteriophages to be added to meat and
poultry products. Gastroenterology. 131:1370.
7. Marder, E.P., P.R. Cieslak, A.B. Cronquist, J. Dunn, S. Lathrop, T. Rabatsky-Ehr, P.
Ryan, K. Smith, M. Tobin-DAngelo, D.J. Vugia, S. Zansky, K.G. Holt, B.J. Wolpert,
M. Lynch, R. Tauxe, and A.L. Geissler. 2017. Incidence and trends of infections with
pathogens transmitted commonly through food and the effect of increasing use of
culture-independent diagnostic tests on surveillance Foodborne Diseases Active
Surveillance Network, 10 U.S. Sites, 20132016. Morb. Mortal. Weekly Rep. 66:397-
403.
8. Myszka, K. and K. Czaczyk. 2011. Bacterial biofilms on food contact surfaces a
review. Pol. J. Food Nutr. Sci. 61:173-180.

105
Investigaciones en Ciencia e Inocuidad de Alimentos

Deteccin de antibiticos en quesos utilizando la prueba Trisensor


1, 1 1 1
Noa Prez M. Pacheco Gallardo C. , Magalln Carrizales K.B , Torres Ramrez M.A. , Mario
2 1
Guerrero I. E. y Gonzlez Aguilar D.G.
1
: Departamento de Salud Pblica, CUCBA, Universidad de Guadalajara. Carretera Guadalajara-
2.
Nogales, Predio Las Agujas Zapopan, Jal. , Facultad de Ciencias Agropecuarias y Recursos
Naturales, Programa de Medicina Veterinaria y Zootecnia, Universidad de los Llanos, Colombia.
Tel: (33) 37771151; mario.noa@academicos.udg.mx
Palabras clave: residuos, antibiticos, queso palabras

Introduccin
Los antibiticos estn incluidos dentro del grupo de sustancias capaces de inhibir el
crecimiento bacteriano, conocidos comnmente como inhibidores. En este campo, los
antibiticos se han usado por ms de tres dcadas en el tratamiento de la mastitis de
vacas lecheras, una infeccin de la ubre causada por microrganismos patgenos. Es por
ello que los mtodos de anlisis se utilizan para el control sistemtico de la leche cruda
acopiada por la industria lctea para la deteccin de inhibidores, cuyo peso fundamental
recae en los antibiticos (6). La presencia de inhibidores en leches crudas y pasteurizadas
no est permitida.
Los principales estados productores de quesos en Mxico son Jalisco, Chihuahua,
Quertaro, Oaxaca, Aguascalientes, Guanajuato, San Luis Potos, Michoacn, Puebla,
Tlaxcala, Toluca y Chiapas, y con su desempeo ocupa el noveno lugar en el mundo en
produccin de queso y octavo en consumo. En cuanto a consumo de queso en Mxico,
ste ha crecido a una tasa promedio del 8 %, pasando en el quinquenio 2006-2010 a 320
mil toneladas. Por todo lo anterior, el objetivo del presente trabajo fue determinar la
presencia de residuos de antibiticos en quesos artesanales e industrializados, que se
comercializan en el Estado de Jalisco.

Metodologa
El sistema de deteccin para antibiticos Trisensor proporciona una prueba de tira
reactiva mltiple de flujo que utiliza receptores especficos y genricos de anticuerpos
monoclonales. Los resultados se visualizan en las 3 lneas de captura especficas por el
uso de los conjugados de oro coloidal, mientras que una cuarta lnea reactiva es la lnea
de control dinmico.
Para determinar la presencia de -lactmicos, sulfonamidas y tetraciclinas en queso
panela, se elabor queso panela a partir de leche pasteurizada libre de antibiticos,
siguiendo el procedimiento previamente descrito (1). A la leche se le adicionaron
antibiticos individuales, hasta obtener respuestas positivas utilizando Trisensor, para
determinar as los lmites de deteccin. Igualmente se procedi para determinar los
niveles de transferencia de leche a queso panela para cada antibitico utilizando el mismo
procedimiento para inferir los niveles presentes en la leche que originaron la
contaminacin.
El procesamiento de los quesos consisti en extraer porciones de 25 g y los extractos de
las mismas se analizaron mediante el juego de reactivos Trisensor. El monitoreo
consisti en analizar quesos adobera, panela, Cotija, tipo Manchego y Aejo tipo Sierra,
obtenidos de expendios formales (supermercados) de la Zona Metropolitana de
Guadalajara y otros municipios del Estado de Jalisco, as como queso panela procedente
de mercados informales (tianguis) durante los meses de Julio de 2016 hasta mayo de
2017, para un total de 125 muestras.

106
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin
En Los Lmites de deteccin de antibiticos detectados en los quesos panela procesados
en el laboratorio se muestran en la Tabla 1:

Tabla 1. Lmites de deteccin para leche y queso panela utilizando el juego de reactivos
Trisensor

Inhibidor Leche1 Queso LMR (g/l)2


- lactmicos (g/kg)
2
Benzilpenicilina 2.5 .5 8 4
4
Ampicilina 3- 4 6 4
3
Amoxicilina 3- 4 4 4
3
Dicloxacilina 4- 6 3 30
3
Fenoximetil 2- 3 4 4
penicilina
Quinolonas (g/kg)
Enrofloxacina 5- 10 10 100
Sulfonamidas (g/kg)
Sulfadiazina 8- 10 8
Sulfatiazol 7.5- 8.5 14 100 (residuo total para
Sulfamerazina 2- 3 1 sulfonamidas)
Sulfamonometoxina 8- 12 6
Sulfacloropiridazina 5- 10 12
Sulfametoxazol 320- 360 400
Tetraciclinas (g/kg)
3
Oxitetraciclina 60- 70 70 100 (residuo total para
tetraciclinas)
Leyendas: 1: Valor de concentracin reportado por el fabricante, 2: Codex Alimentarius, 2017 (4),
3: Codex Alimentarius, 2015 (3), N.E.: No establecido
Los lmites de deteccin de antibiticos obtenidos en queso fueron inferiores en casi todos
los casos, a excepcin de la benzilpenicilina y el Sulfametoxazol.
Los factores de transferencia de cada antibitico de leche a queso panela se muestran en
la Tabla 2.

Tabla 2. Factores de transferencia de antibiticos de leche a queso panela utilizando la


prueba Trisensor

- lactmicos (g/kg)
Inhibidor Leche Queso Factor de transferencia
queso/ leche
Benzilpenicilina 8 20 2.5
Ampicilina 6 10 1.6
Amoxicilina 3 3 1
Dicloxacilina 3 4 1.3
Quinolonas
Enrofloxacina 5 - 10 10 1
Sulfonamidas (g/kg)
Sulfadiazina 8 15 1.87
Sulfamerazina 6 10 1.66
Sulfacloropiridazina 100 12 0.12
Tetraciclinas (g/kg)
Oxitetraciclina 60 60 1

107
Investigaciones en Ciencia e Inocuidad de Alimentos

Teniendo en cuenta los factores de transferencia obtenidos de leche a queso, se podra


inferir en casi todos los casos valores cercanos al LMR para leche, si se tiene en cuenta
que los quesos no tienen valor de dicho parmetro. Estos resultados demuestran la
utilidad de la prueba Trisensor para su uso en quesos para fines de vigilancia.
Los resultados del monitoreo en los quesos muestreados utilizando Trisensor fueron los
siguientes: de las 125 muestras analizadas, slo 4 resultaron negativas, para un 96% de
deteccin. La mayora (90 % de las muestras) present residuos mltiples (dos o ms
antibiticos). Hubo alta frecuencia de muestras positivas tanto en los quesos
industrializados (59%), como artesanales (41%).

Fig. 1. Frecuencia de residuos de antibiticos por familia qumica en las muestras


analizadas (n=125)
Los resultados por meses difirieron significativamente, con un mximo de 71.2% en
marzo. Las frecuencias de antibiticos encontradas por familia qumica se muestran en la
Figura 2.

Fig. 2. Frecuencia de los residuos de antibiticos encontrados por familia qumica

Segn el Codex Alimentarius (CODEX, 2015), debido al abuso potencial de la


oxitetraciclina, los LMR se recomiendan slo cuando se asocian con un uso teraputico
aprobado, por lo que la elevada frecuencia encontrada en este trabajo slo puede ser
debida justamente al abuso en la utilizacin de dicho medicamento.
Los resultados del presente monitoreo justifican lo reportado (2) con respecto a la
problemtica de los quesos mexicanos genuinos, donde se afirma que stos presentan

108
Investigaciones en Ciencia e Inocuidad de Alimentos

calidad variable desde el punto de vista de composicin, sanidad y atributos sensoriales y


falta de cumplimiento con la normatividad, sobre todo con la legislacin sanitaria. El
objetivo planteado por SAGARPA (2015)(8) de producir quesos de calidad a partir de los
excedentes lecheros no se cumplen, debido justamente al no cumplimiento en los
parmetros higinico- sanitarios, entre los cules se encuentra la prohibicin de
inhibidores de cualquier tipo (5, 7).

Conclusiones
Se adapt exitosamente el juego de reactivos Trisensor para su utilizacin en quesos,
obteniendo lmites de deteccin adecuados para fines de monitoreo. Se encontraron
factores de transferencia cercanos a 1 en casi todos los casos, entre leche y queso
panela, lo que permite inferir con facilidad los niveles de residuos en la leche utilizada
para la fabricacin del queso.
Se encontraron altos niveles de frecuencia de residuos de antibiticos en las 125
muestras de queso analizadas, incluyendo artesanales e industrializados, lo que
representa un elevado riesgo para la salud debido a su contribucin a la aparicin de
cepas de patgenos resistentes, especialmente debida a la amplitud del consumo de
queso.

Bibliografa
1. Amaro Gutirrez, R., Daz Snchez G. (2002). SAGARPA-INIFAP-CIRCE. Manual de
Referencia Nivel I Y II. Taller para productores del estado de Morelos sobre la elaboracin de
quesos y subproductos lcteos. Publicacin Especial Nmero 35. Disponible en la pgina
http://biblioteca.inifap.gob.mx:8080/jspui/bitstream/handle/123456789/2855/quesocompleto.pdf
?sequence=1 Consultado 03/07/2017.
2. Cesn- Vargas, A. (2014): Resea: La leche y los quesos artesanales en Mxico. Fernando
Cervantes Escoto, y Abraham Villegas de Gante (coord). 2012. AGRICULTURA, SOCIEDAD Y
DESARROLLO, 11 (2) Pp. 243- 248.
3. CODEX ALIMENTARIUS (2015): MAXIMUM RESIDUE LIMITS (MRLs) AND RISK
MANAGEMENT RECOMMENDATIONS (RMRs) FOR RESIDUES OF VETERINARY DRUGS
IN FOODS. CAC/MRL 2-2015.
4. CODEX ALIMENTARIUS (2017): Residuos de Medicamentos veterinarios en los alimentos.
Base de datos en lnea del Codex sobre los residuos de medicamentos veterinarios en los
alimentos. Disponible en http://www.fao.org/fao-who-codexalimentarius/standards/vetdrugs/es/
5. NMX-F-700 (2012). PROYECTO DE NORMA MEXICANA PROY-NMX-F-700-COFOCALEC-
2012. SISTEMA PRODUCTO LECHE - ALIMENTO LCTEO LECHE CRUDA DE VACA
ESPECIFICACIONES FISICOQUMICAS, SANITARIAS Y MTODOS DE PRUEBA.
Disponible en http://www.canilec.org.mx/Circulares%202012/93del12/PROY-NMX-F-
700-COFOCALEC-2012%20110212.pdf
6. Noa Prez, M., Prez Flores, N., Gutirrez Tolentino, R., Escobar Medina, A. (2001). Los
residuos qumicos en la leche: importancia y problemtica actual en Mxico y en el mundo.
Serie Acadmicos CBS N 57, Editorial Universitaria Universidad Autnoma Metropolitana,
Mxico D.F.
7. NORMA Oficial Mexicana NOM-243-SSA1-2010, Productos y servicios. Leche, frmula lctea,
producto lcteo combinado y derivados lcteos. Disposiciones y especificaciones sanitarias.
Mtodos de prueba. Disponible en la pgina
http://dof.gob.mx/nota_detalle.php?codigo=5160755&fecha=27/09/2010
8. SAGARPA (2015). Comunicado de prensa Nm. 031 del 25 de marzo de 2015. Excedentes de
la produccin de leche sern utilizados para la elaboracin de quesos de alta calidad.
Disponible en la pgina
http://www.sagarpa.gob.mx/Delegaciones/aguascalientes/boletines/2015/marzo/Documents/B0
312015.PDF.

109
Investigaciones en Ciencia e Inocuidad de Alimentos

Resistencia y susceptibilidad de seis bacterias aplicables para recuperar


suelos contaminados con TPH
1 1 1 1
Reynaga Delgado E. , Gonzlez Reynoso O. , Macas Rodrguez M.E. , Parra Rodrguez F.J. ,
2 1
Robledo Ortiz J.R. , Gmez Hermosillo C.M.
1 2
Departamento de Ingeniera Qumica. Departamento de Madera, Celulosa y Papel. Centro
Universitario de Ciencias Exactas e Ingenieras. Universidad de Guadalajara. Blvd. General
Marcelino Garca Barragn 1421, CP 44430 Guadalajara, Jalisco. eire.rd@gmail.com
Palabras clave: TPH, BTEX, Cultivos, Recuperacin de suelos

Introduccin
Los hidrocarburos totales de petrleo (TPH) son contaminantes para suelos y agua
cuando son derramados accidental o intencionalmente. La Agency for Toxic Substances
and Disease Registry (1)(ATSDR 1999) describe a los TPH como una mezcla de
compuestos que incluyen al hexano, combustibles, aceites minerales, benceno, tolueno,
xilenos, naftalina y fluoreno. En los agrosistemas, los TPH afectan la capacidad del suelo
para sostener la biocenosis natural o la agricultura (2) y en los mamferos los TPH se
absorben en el tracto gastrointestinal, resultando eventualmente en la acumulacin del
txico en las cadenas trficas (2,3). Entre los TPH ms comnmente encontrados como
contaminantes en los suelos se incluyen el disel y compuestos orgnicos voltiles
(VOCs) de la gasolina tales como benceno, tolueno, etilbenceno e ismeros de xileno
(BTEXs). En Mxico, la concentracin de BTEXs en el suelo est regulada por la NOM-
138-SEMARNAT/SSA1-2012, y de acuerdo al uso de suelo los lmites mximos
permisibles de los BTEXs (en mg/kg) son de 6 para uso agrcola.
La atenuacin natural en suelos y aguas contaminados con TPH es un proceso de
remediacin de remediacin in situ y es de estos sitios de donde se toman consorcios de
microorganismos para biodegradar otros sitios contaminados y as para recuperar la
productividad del suelo (3). Para la biorremediacin de suelos contaminados con TPH es
importante considerar el tipo de suelo, temperatura, pH, la presencia de oxgeno o de
otros receptores de electrones, nutrientes, etc. (4). Por lo anterior los suelos
contaminados con hidrocarburos y sus derivados han sido tema de numerosas
investigaciones que involucran aspectos fsicos, qumicos, cinticos y moleculares. Sin
embargo se requiere mayor conocimiento de los integrantes de los consorcios, as como
la forma de supervivencia y resistencia a diferentes tipos de ambientes (5).
Se presenta en este estudio la generacin de conocimientos referentes al crecimiento,
resistencia, susceptibilidad y capacidad de crecimiento en presencia de los xenobiticos
BTEXs, de seis cepas aisladas del agua del subsuelo contaminado con hidrocarburos,
provenientes de la antigua estacin de ferrocarril de la ciudad de Guadalajara, Jalisco,
Mxico

Metodologa
Se utilizaron las tcnicas microbiolgicas tradicionales para el aislamiento e identificacin
microbiana, tales como el enriquecimiento no selectivo, cultivo selectivo y diferencial,
identificacin presuntiva e identificacin confirmatoria (API20E). El medio de cultivo
slido seleccionado para todas las pruebas fue el Mller-Hinton (MH), dado que permite el
crecimiento de cepas exigentes o aisladas de matrices ambientales. El control de calidad
del medio se realiz de acuerdo al mtodo ecomtrico (6), utlizando la cepa Pseudomona
putida F1 ATCC 70007, cepa que adems se utiliz como control de crecimiento en todos
los ensayos. Se realizaron curvas de crecimiento en las cepas aisladas en caldo soya
tripticasena (CST) a 25 C y una agitacin de 120 rpm durante 16 h (con dos rplicas).
Estas condiciones fueron denominadas como condiciones de referencia (RC). Las cepas

110
Investigaciones en Ciencia e Inocuidad de Alimentos

aisladas fueron sometidas a las siguientes pruebas de resistencia ambiental: incubacin a


una temperatura de 45 C y 10 C. Choque trmico (10-45 C y 45-10 C, por 2 h
respectivamente). Choque de pH a partir de neutro (pH 7), a pH cido (4), y a alcalino
(8.5). Desecacin a dos temperaturas distintas: 25 C y 35 C. El diseo fue de nx3x2x2,
donde n fue el nmero de bacterias a ensayar, con tres factores ambientales en dos
niveles y con dos rplicas. Para el crecimiento en CST adicionado con BTEXs, se
utilizaron viales I-Chem con septa de tefln/silicn de 60 mL de capacidad, en cada uno
de los cuales se depositaron 25 mL de CST, ms 5 mL de inculo ajustado a la turbiedad
del tubo 0.5 de la escala de McFarland. Se tomaron 14.5, 29, 44, 58 y 73 L de cada uno
de los BTEXs (medidos con una jeringa de cristal con capacidad de 10 L). Las
concentraciones finales en mg L-1 fueron calculadas de acuerdo la ley de Henry. Las
condiciones de incubacin fueron de 25 C/120 rpm/16 h.
El crecimiento en las cinticas se report como incrementos (log10UFCmL-1). La
comparacin del crecimiento con los diferentes factores de T, pH, desecacin y BTEXs,
se realiz a partir del inculo inicial. Los datos generados fueron tratados en SigmaPlot.

Resultados y discusin
Se aislaron e identificaron dos cepas de bacilos Gram positivos (B. cereus y B. coagulans)
y cuatro cepas de bacilos Gram negativos (Agrobacterium sp., Chromobacterium sp.
Exiguobacterium aureantiacum y Pseudomonas fluorescens). El medio Mller Hinton (MH)
seleccionado para la cuantificacin de biomasa result con crecimiento en todas las lneas
inoculadas (5-5-5).

Como resultado de la diversidad de gneros de las cepas aisladas, la cintica fue


diferente para cada cepa en RC (Figuras 1a, 1b y 1c). Al cabo de 16 h de tiempo de
incubacin, los crecimientos (promedio desviacin estndar como log10UFCmL-1) y los
incrementos (log) fueron: Agrobacterium sp. 8.440.04 (0.56), B. coagulans 7.390.45
(2.21), B. cereus 7.850.14 (2.67), Chromobacterium sp. 8.420.06 (0.58), E.
aureantiacum 8.030.07 (3.51), P. fluorescens 8.590.08 (0.76), y P. putida 8.060.16
(0.51). Comparando las cepas Gram positivas, ambos Bacillus mostraron cinticas
similares. Contrariamente, las curvas de crecimiento para las bacterias Gram negativas
mostraron mayor dispersin. La estrategia de Gram positivos para el crecimiento es
mucho ms simple que la de las Gram negativas, por este motivo se observaron
incrementos mayores en las primeras (7). E. aureantiacum, que es Gram variable, mostr
un comportamiento diferente, mostrando una fase lag de 6 h y un aumento sbito al final
de la cintica.

Fig. 1a: Cintica de Fig. 1b: Cintica de Fig. 1c: Cintica de


crecimiento de Gram crecimiento de Gram crecimiento de E.
positivos negativos aureantiacum

111
Investigaciones en Ciencia e Inocuidad de Alimentos

Bajo condiciones de referencia (RC), los incrementos promedio de crecimiento bacteriano


en total fueron de 0.51 hasta 3.51 log10CFUmL-1 al final de 16 h.

Cuando las cepas se incubaron a 10 C, todas mostraron un crecimiento muy limitado,


pero mantuvieron su cultivabilidad. A 45 C el crecimiento no fue cuantificable, excepto en
B. coagulans y B. cereus, con un conteo <30 colonias/placa. Las cepas resistieron mejor
el choque de caliente a fro que de fro a caliente (Figuras 2a y 2b, la lnea superior en
estas figuras indica el inculo inicial). Estos choques trmicos pueden ocurrir cuando las
bacterias son transferidas de un suelo a otro en diferentes zonas geogrficas. De acuerdo
con Margesin y Schinner (2001) las cepas con capacidad de adaptacin a los ambientes
fros o clidos, se desempean mejor en la recuperacin de un suelo contaminado. En la
prueba de desecacin a 25 C, los dos bacilos, Chromobacterium sp. y P. fluorescens
fueron capaces de crecer, y a 45 C nicamente los dos bacillos mostraron cultivabilidad.
La tolerancia a la desecacin es importante para la supervivencia del microorganismo en
suelos contaminados en las zonas ridas [35]. Las cepas incubadas durante 15 min a pH
4.0 perdieron su capacidad para ser cultivables en medio slido. De forma similar, cuando
las cepas se cambiaron de pH 7 a pH 8.5, solo tres de las cepas crecieron y mostraron
incrementos, en comparacin con el inculo inicial (Figura 2c).

Fig. 2c: Resultados en la


Fig. 2a: Incubacin en dos Fig. 2b: Resultados en la
prueba de pH por 15
temperaturas diferentes. prueba de choque trmico.
minutos.

La prueba de susceptibilidad a BTEX se realiz sin pre-adaptacin y eso afecto la


cultivabilidad de las cepas. Los BTEX en altas concentraciones pueden ser txicos para
las bacterias, pero es posible que estos compuestos tambin afecten el crecimiento
cuando las bacterias se hayan mantenido mucho tiempo sin contacto previo,
constituyendo esto ltimo un factor para que la bioaumentacin fracase (8). Solo se
cuantific crecimiento (UFC) en los medios en placa en las concentraciones de 0.42 y
0.84 mgL-1 de cada BTEX. En etilbenceno, la susceptibilidad de las cepas fue ms
evidente. En trminos de incrementos en el crecimiento, las cuantificaciones mximas
fueron en B: Chromobacterium sp. y Agrobacterium sp., en T: P. fluorescens y E.
aureantiacum, en E: E. aureantiacum y los bacilos, y finalmente en X: P. fluorescens y los
bacilos. En los cuatro compuestos, B. cereus fue capaz de crecer y mostrar incrementos,
resultando ser la cepa menos susceptible a los BTEX con concentraciones inferiores a
0.84 mgL-1.
Conclusiones
El xito en la recuperacin de la biocenosis de un suelo contaminado con TPH depende
de la capacidad de optimizar diversas condiciones fsicas, qumicas y biolgicas en esta
matriz ambiental. Los consorcios bacterianos aislados de sitios contaminados se han
utilizado con frecuencia para remediar otros sitios, sin embargo, el comportamiento e

112
Investigaciones en Ciencia e Inocuidad de Alimentos

integrantes individuales del consorcio es generalmente desconocido. Las cepas


recuperadas en este estudio, mostraron un comportamiento diferente en las cinticas de
crecimiento, y se observaron diferencias en la resistencia a dos temperaturas de
incubacin, choque trmico, variaciones de pH y susceptibilidad en CST con BTEX. Los
bacilos Gram positivos fueron los mejores candidatos para tolerar cambios sbitos de
temperatura, as como a las condiciones de desecacin, los cambios en el pH y mostraron
menos susceptibilidad al BTEX aadido a los medios de cultivo.
Nuestros resultados in vitro pueden ser tiles como gua para continuar y mejorar el
conocimiento de cepas aisladas de sitios contaminados y para apoyar una mejor
seleccin de gneros de bacterias para procesos de biorremediacin y recuperacin de
suelos contaminados con TPH y hacerlos aptos para el cultivo.

Bibliografa
1. Agency for Toxic Substances and Disease Registry, ATSDR. Interaction profile for
benzene, toluene, ethylbenzene, and xylenes (BTEX). 2004. Atlanta, GA: U.S.
Department of Health and Human Services, Public Health Service.
2. Maliszewska-Kordybach B. y Smreczak B. 2000 Ecotoxicological Activity of Soils
Polluted with Polycyclic Aromatic Hydrocarbons (PAHs) - Effect on Plants. Environ.
Tech. 21(10): 1099-1110.
3. Gomare K.S. y Lahane M.N. 2011 Degradation of polyaromatic hydrocarbons by
isolated cultures from contaminated soils at petroleum pump stations. IJRTST.
1(1): 9-13.
4. Sharma S. 2012. Bioremediation: Features, Strategies and applications. AJPLS.
2(2): 202-213.
5. Coccia A.M., Gucci P.M.B., Lacchetti I., Beccaloni E., Paradiso R., Beccaloni M.,
Musmeci L. 2009. Hydrocarbon contaminated soil treated by bioremediation
technology: microbiological and toxicological preliminary findings. Environ. Biotech.
5(2): 61-72.
6. Mossel, D. A., M. Trees, A. Bonats, M. Ligtenberg y M. Werdler (1983) Quality
assurence of selective culture media for bacteria, moulds and yeast: an attempt at
standardization at the international level. J. Appl. Microbiol. 54: 313-327.
7. Koch Arthur L. 2003. Were Gram-positive rods the first bacteria?. Trends Microbiol.
11:4.
8. Sabzali A., Gholami M., Sadati M.A. (2009) Enhancement of benzene
biodegradation by variation of culture medium constituents. Afr. J. Microbiol. Res.
3(2): 077-081.

113
Investigaciones en Ciencia e Inocuidad de Alimentos

Caracterizacin y elaboracin de biopeliculas a base de almidn de


chayotextle y mucilago de cha Salvia hispanica
1 1 2 1
Mendoza Mendoza, B., Aguilar Caldern, M. G., Vargas Torres A., Gmez Hernndez, E.,
1
Domnguez Hernndez, E.M.
1
Instituto Tecnolgico Superior del Oriente del Estado de Hidalgo, Carretera Apan-Tepeapulco, Km
2
3.1, Colonia las Peitas, C.P. 43900, Tel. 071489123489. Instituto de Ciencias Agropecuarias
Rancho Universitario, Av. Universidad Km. 1, Ex-Hda. de Aquetzalpa, C.P. 43600, Tulancingo.
Hidalgo. bmendoza@itesa.edu.mx o bethmen2@hotmail.com
Palabras clave: Biopeliculas, Chayotextle y Mucilago

Introduccin
El deterioro de alimentos durante el almacenamiento puede ser retardado al mejorar los
empaques. Se requiere de dicho empaque que proteja al producto de medio ambiente,
principalmente de los gases y de la humedad; adems es deseable que ste funcione
como barrera contra microorganismos que puedan contaminar el alimento. De igual
manera, existe una creciente preocupacin por reducir la contaminacin generada por el
uso y la produccin de envases alimenticios hechos con plstico. Como posible solucin a
esto, se han buscado diversas alternativas; entre ellas y una de las ms estudiadas es el
desarrollo de pelculas comestibles (1); stas deben funcionar como barrera selectiva a la
transferencia de humedad y gases, adems de evitar la oxidacin de lpidos y la perdida
de compuestos voltiles responsables de aromas y sabores de ciertos alimentos (2).
Deben estar formuladas con compuestos de grado alimenticio y adems cumplir con
costos relativamente bajos de produccin (3).
El almidn, se encuentran en los cereales, los tubrculos y en algunas frutas como
polisacrido de reserva energtica. Su concentracin vara segn el estado de madurez
de la fuente (4). El almidn de chayotextle presenta un contenido de slidos del 25.8% de
los cuales un 59.4% de estos es almidn, por lo tanto, de 10 kilogramos de chayotextle se
obtienen 1.5 kilogramos de almidn potencialmente extrable con una pureza del 89.1%
(5). La Salvia hispanica L. es una semilla oleaginosa conocida comnmente como chis.
Posee una cantidad importante de fibra y tiene una interesante propiedad de generar un
polisacrido mucilaginoso que la rodea. Este mucilago posee interesantes propiedades
para la industria alimentaria, ya que puede ser incorporado en diferentes alimentos y
formulaciones, adems tiene la capacidad de formar pelculas comestibles mejorando las
propiedades mecnicas y funcionales de las mismas. Es por esto que el presente trabajo
propone la combinacin de estos dos polisacridos con el fin de evaluar su efecto en las
propiedades mecnicas y de barrera de las pelculas, y de esta forma ofrecer una
alternativa funcional como empaque de alimentos.
Metodologa
Extraccin del almidn de chayotextle.
El aislamiento de almidn fue realizado, siguiendo la metodologa propuesta por (6)
Extraccin de mucilago de cha. La extraccin del mucilago de cha se obtuvo en base
a la metodologa propuesta por (7).

Elaboracin de la pelcula
Se realizaron 4 tratamientos, el control y con diferentes concentraciones de mucilago de
chia (Tabla 1), mediante la tcnica de vaciado en placa (casting).

114
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 1. Formulaciones para la elaboracin de biopeliculas a base de almidn de


chayotextle y mucilago de cha.
Reactivo Control Tratamiento 1 Tratamiento 2 Tratamiento 3
Almidn 4g 4g 4g 4g
Glicerol 2g 2g 2g 2g
Agua destilada 180 ml 200 ml 200 ml 200 ml
Mucilago de cha.
0g 0.5 g 1 g 2 g

Pruebas mecnicas.
Las pruebas mecnicas se realizaron utilizando el mtodo estndar ASTM D882-10 en un
texturometro marca Texture Analyzer, modelo CT3 25K.

Prueba de calorimetra.
El equipo utilizado fue el calormetro diferencial serie Q2000 Instrumentos TA, equipado
con un sistema de enfriamiento refrigerado RCS 90 y el software de anlisis universal TA,
ubicado en el laboratorio de anlisis especiales de la Universidad Autnoma del Estado
de Hidalgo, campus Tulancingo.

Prueba de permeabilidad al vapor de agua.


La permeabilidad al vapor de agua de determino gravimtricamente utilizando el mtodo
estndar de la ASTM E96-80 1989.

Porcentaje de solubilidad.
El porcentaje de solubilidad se realiz segn la tcnica de (8).

Prueba de permeabilidad al oxgeno.


Las pelculas se cortaron en crculos de 9.3 cm de dimetro y se mido su espesor. Las
pelculas fueron acondicionadas durante 48 horas en un desecador el cual contena una
solucin saturada de NaBr con una humedad relativa de 57%. Posteriormente se
colocaron en las cmaras del equipo de medicin de permeabilidad. Este equipo mide la
transferencia de un gas permeante a travs de una pelcula (principio manomtrico ASTM
D1434-32, 1998).
Resultados
Pruebas mecnicas.
Con respecto a las pruebas mecnicas en el esfuerzo a la fractura las pelculas que
contenan mucilago de cha resultaron ser significativamente diferentes al tratamiento
control, aunque, el incremento de la concentracin de mucilago de cha causa un aumento
en el esfuerzo a la fractura. Este suceso ocurre igualmente en el mdulo de Young, en
concentraciones mayores al 1% el mdulo de Young incrementa significativamente y es
por ello que la deformacin disminuye. En el porcentaje de elongacin los tratamientos
que contenan mucilago de cha resultaron ser inferiores al tratamiento control (Tabla 1).
Prueba de calorimetra.
En el estudio de calorimetra no se observ alguna diferencia y se cree que el fenmeno
ocurre porque existe unin intermolecular entre los componentes que contiene la pelcula
(Tabla 2).

115
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 1. Propiedades mecnicas de pelculas biopolimricas de almidn de chayotextle y


diferentes concentraciones de mucilago de cha.
Tratamientos max(Mpa) % Elongacin Mdulo de Young
(Mpa)
Control (Almidn) 0.184 (0.0126) 54.100 2.82a 0.298 0.0217a
T1 (0.5% MC) 0.118 0.0328b 24.750 1.708b 0.398 0.143ab
T2 (1.0% MC) 0.113 0.00770b 18.625 1.031c 0.515 0.0392b
T3 (1.5% MC) 0.150 0.016b 18.400 0.327c 0.760 0.115c
abc en columnas significa que hay diferencias estadsticamente significativas con un nivel de confiabilidad de 95% P
(<0.05). Anlisis de varianza de una sola va seguido de comparacin de medias por Tukey. Desviacin estndar entre
parntesis

Tabla 2. Resultados de la calorimetra diferencial de barrido de pelculas biopolimricas de almidn


de chayotextle y diferentes concentraciones de mucilago de cha.
Tratamiento Temperatura C Entalpia J/g
Control (Almidon) 103.10 0.5944
T1 (0.5% MC) 104.92 0.6389
T2 (1% MC) 103.29 0.3484
T3 (1.5% MC) 103.26 0.5382

Prueba de permeabilidad al vapor de agua.


Se determina que la concentracin de mucilago de cha no afecta la permeabilidad al
vapor de agua, sin embargo, los valores en T1 (1.623x10-12) son mayores con respecto al
tratamiento control (1.317x10-12). Por lo tanto, podemos decir que la permeabilidad
depende de la composicin de la biopelcula, en este caso la permeabilidad al vapor de
agua increment al mezclar dos compuestos hidroflicos
Permeabilidad al oxgeno.
En permeabilidad al oxgeno, no hubo diferencias significativas entre los diferentes
tratamientos, es decir que en la comparacin con el tratamiento control, la permeabilidad
del vapor de agua no cambio, obtenindose valores de 4.444x10-14, 4.943x10-14, 1.954x10-
14
, 4.379x10-14 gmol m Pa-1s-1m-2 para el control, T1, T2 y T3 respectivamente.
Prueba de solubilidad.
En los resultados de la prueba de solubilidad en agua se puede observar que si existe una
diferencia significativa en el tratamiento control ( 29.2%) con respecto a los tres
tratamientos que contienen mucilago de cha, pero como el mucilago de cha tiene
propiedades de absorcin de agua, al realizar la prueba con los tratamientos T1, T2 y T3
(33, 32, 33 % respectivamente), sucedi un efecto de hidratacin, por lo que se present
una modificacin en su estructura, dando como resultado porcentajes de solubilidad altos.
Conclusin
Al unir dos polisacridos como el almidn y el mucilago de cha se pueden formar
biopeliculas con caractersticas similares a las biopeliculas elaboradas solamente de
almidn, aunque mediante la prueba de solubilidad se cree que las biopeliculas que
contengan mucilago de cha tendrn una mayor y mejor biodegradabilidad.
Bibliografa

1. Rawdkuen, S., Sai-Ut, S., y Benjakul, S. 2010. Properties of gelatin films from giant
catfish skin and bovine bone: a comparative study. European Food Research &
Technology. 231(6):907-916.

116
Investigaciones en Ciencia e Inocuidad de Alimentos

2. Espino-Daz, M., Ornelas-Paz, J., Martnez-Tllez, M. A., Santilln, C., Barbosa-


Cnovas, G. V., Zamudio- Flores, P. B. y Olivas, G. I. 2010. Development and
characterization of edible films based on mucilage of opuntia ficus-indica (L.).
Journal of Food Science. 75(6):347-352.
3. Vargas, M., Pastor, C., Chiralt, A., McClements, D. y Gonzalez Martinez, C. 2008.
Recent advances in edible coatings for fresh and minimally processed fruits.
Critical Reviews In Food Science &amp; Nutrition, 48(6):495-511.
4. Badui, S. 2006. Qumica de los alimentos. 4 edicin. Edit. Pearson. Mxico. Pp.
81.
5. Hernndez-Uribe J. P., Agama-Acevedo E., Gonzlez-Soto R. A., Bello-Prez L. A.
y Vargas-Torres A. 2011. Isolation and characterization of Mexican chayote tuber
(Sechium edule Sw.) starch. Starch/Strke. 63:3241.
6. Flores-Gorosquera E., Garca-Surez F. J., Flores-Huicochea E., Nez-Santiago
M.C., Gonzlez-Soto R. A. y Bello-Prez L. A. 2004. Rendimiento del proceso de
extraccin de almidn a partir de frutos de pltano (Musa paradisiaca). Estudio en
planta piloto. Acta Cientfica Venezolana. 55:86- 90.
7. Capitani M., Ixtaina V., Nolasco S., Toms M. 2013. Microstructure, chermical
composition and mucilage exudation of chia (Salvia hispanica L.) nutlets from
Argentina. J. Sci. Food Agric. 93 (15):3856-3862.
8. Garca, M. A., Pinotti, A., Martino, M. N. y Zaritzky N. E. 2009.Characterization of
composite hydrocolloid films. Carbohydrate Polymers. 56:339-345.

117
Investigaciones en Ciencia e Inocuidad de Alimentos

Antagonistas de Bacillus aisladas de costas del estado de Sonora en contra del


agente etiolgico del sndrome de mortalidad temprana en cultivos de camarn

Iracheta Villarreal J. M., Molina Garza Z. J., Galaviz Silva L.


Universidad Autnoma de Nuevo Len, Facultad de Ciencias Biolgicas. Laboratorio de
Patologa Molecular y Experimental. San Nicols de los Garza, Nuevo Len, Mxico.
Palabras clave: Antagonismo, Camarn, EMS

Introduccin
La implementacin de sistemas de produccin altamente eficientes y su constante mantenimiento y
mejoramiento ao con ao, han hecho del estado de Sonora el ms importante para la
camaronicultura del pas, teniendo una contribucin aproximada del 70% de la produccin nacional,
siendo esta desarrollada de manera extraordinaria en la ltima dcada (3)

A pesar de su creciente desarrollo, el mayor riesgo que presentan son las epizootias causadas por
virus y/o bacterias. La ms reciente es la enfermedad, conocida como sndrome de la mortalidad
temprana (EMS, por sus iniciales en ingls), tambin llamada como enfermedad de la necrosis
hepatopancretica aguda (AHPND), la cual provoc la mortandad masiva en las regiones acucolas
en varios pases de Asia, en donde se depende del cultivo de camarones para su sustento.
Apareci inicialmente en el 2009, siendo la causante de esta enfermedad una cepa de Vibrio
parahaemolyticus asociada a fagos. Despus, en 2011, las regiones acucolas de China sufrieron
casi un 80% de prdidas. El EMS afect a dos especies de camarones que se cran habitualmente
en todo el mundo, el langostino jumbo (Penaeus monodon) y el camarn blanco (Penaeus
vannamei) (4). En Mxico se han reportado cepas de V. parahaemolyticus (6) causando
mortalidades masivas desde el 2013, por lo que es necesario un control inminente para evitar ms
prdidas econmicas por la enfermedad en las granjas camaroneras del pas, por ejemplo, durante
el 2010, el estado de Sonora produjo 89,000 toneladas de camarn, mientras que, en el 2014, su
produccin se redujo a 35,000 toneladas (3). El uso de microorganismos antagonistas en forma de
probiticos contra esta cepa de Vibrio parahaemolyticus podra ser una opcin para evitar la
propagacin del EMS (1).

El objetivo de este trabajo fue el aislar, evaluar e identificar cepas microbianas de origen marino, las
cuales presentan actividad antagonista contra cepas de la bacteria V. parahaemolyticus, causante
del EMS en los cultivos de camarn a nivel mundial y actual problema en la zona noroeste de
Mxico.

Metodologa

Obtencin de los aislados microbianos y caracterizacin morfolgica.


Se realizaron muestreos en los siguientes puntos: Baha de Lobos (2725'28.1" N; 11030'29.0" W),
Mlagos (2709'44.0" N; 11015'58.6" W), Atanasia (278'10.1436" N; 11011'22.6998" W), Riito
(2647'02.6" N 10948'48.2" W) y Yavros (2642'33.7" N; 10934'35.2" W). Se aislaron diferentes
bacterias de moluscos, algas y minas de sal seleccionndose en base a la morfologa colonial, la
coloracin y su origen en placas de Agar Soya Tripticasa (TSA) suplementado con 2% de NaCl. A
los aislados candidatos se les realiz una tincin de Gram y se observ al microscopio en 100x para
diferenciar su morfologa adems de pruebas de bioqumicas.

Evaluacin de la actividad antagnica de los aislados microbianos.


Se evalu la respuesta antagnica por medio del mtodo de la estra cruzada (5) frente a tres cepas
de Vibrio parahaemolyticus: V. parahaemolyticus ATCC, MC32 (patgena causante del EMS) y una

118
Investigaciones en Ciencia e Inocuidad de Alimentos

cepa de V. parahaemolyticus aislada de camarones procedentes de granja. Se realiz triplicado a


cada evaluacin.

Extraccin de ADN y ensayo de PCR a los aislados con actividad antagonista.


Para la extraccin de ADN se utiliz el mtodo de ebullicin en presencia de PBS 1X + Tween 20
0.05% (8) con varias modificaciones para su uso segn las cepas a utilizar. Primero se seleccion
una colonia microbiana fresca colocndose en un microtubo de 1.5 ml, posteriormente se le agreg
100 l de PBS 1X y se centrifugo a 65,000 g por 10 min. El precipitado obtenido fue lavado dos
veces con 100 l de PBS 1X (pH 7.4 posteriormente fue resuspendido en 50 l de PBS + Tween 20
0.05%, se incub a 100C por 10 min y centrifug a 6,000 g por 10 min. El sobrenadante se
recuper y almacen a -20C. El material gentico obtenido se someti a una amplificacin del ADN
ribosomal 16S con el protocolo descrito por Cetina et al. (2). Se utiliz un termociclador iCycler de
Bio-Rad.

Purificacin y secuenciacin de los productos de PCR.


El producto amplificado se purific mediante un estuche de extraccin de ADN (Qiagen, Germany).
Se llev a cabo la reaccin de secuencia en un secuenciador gentico por el mtodo Sanger en el
CINVESTAV, IPN. Los primers utilizados fueron los mismos empleados en la amplificacin por
PCR. Las secuencias obtenidas se compararon con los bases de datos del GeneBank
(www.ncbi.nlm.nih.gov) por medio de un BLAST (Basic Local Alignment Search Tool).

Resultados
Obtencin de las cepas microbianas.
Cuatro cepas aisladas de almejas y algas marinas de las bahas del estado de Sonora
fueron las estudiadas para esta investigacin. En la Tabla 1 y Figura 1 se pueden apreciar
las caractersticas generales y aspecto colonial de los aislados.

Tabla 1. Caractersticas generales de las cepas microbianas proporcionadas.


Cepa Localidad Espcimen Colonia en Placa
30R Atanasia Alga Grande circular ligeramente irregular, color
blanca, opaca, forma de crter
35 Riito Almeja comn Chica definida, color blanca, cncava
42 Lobos Banco salino Grande circular ligeramente irregular, color
blanca, opaca, forma de crter
44 Lobos Alga Chica definida, color blanca opaca, cncava

Caracterizacin morfolgica y bioqumica de los aislados microbianos.


Se realiz una caracterizacin morfolgica y bioqumica, donde se us medio TSI y LIA,
adems de la realizacin de pruebas de catalasa y oxidasa. Los resultados se pueden
apreciar en la Tabla 2, en donde dos aislados resultaron bacilos Gram positivos
esporulados y los otros dos cocos Gram positivos. Los cuatro obtuvieron los mismos
resultados en medio TSI y LIA, donde fermentaron los tres azucares y realizaron la
desaminacin de la lisina, respectivamente.

119
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2. Caracterizacin morfolgica y bioqumica de las cepas microbianas.


TSI LIA
Cepa Morfologa Gram Oxid Cat Glu GLS NF Desc Desm H2S
30R Bacilo + - + + + - - + -
35 Coco + - + + + - - + -
42 Bacilo + - + + + - - + -
44 Coco + - + + + - - + -
TSI: agar hierro triple azcar (GLS: glucosa, lactosa, sacarosa; NF: no fermenta ningn
azcar); LIA: agar lisina hierro (Desc: descarboxilacin de la lisina; Desm: desaminacin
de la lisina); H2S: Produccin de cido sulfrico.

Evaluacin de la actividad antagnica.


La evaluacion antagonista result positiva para los cuatro aislados, como se puede
observar en la Figura 3. Los cuatro aislados mostraron actividad antagonista frente a la
cepa ATCC de V. parahaemolyticus, mientras que los aislados 30R y 42 inhibieron las
cepas patgena y silvestre. El aislado 42 demostr la mayor inhibicion contra la cepa
patgena, con un resultado de 19 milimetros, seguido por el aislado 30R, con un promedio
de inhibicion de 15 milimetros.

Figura 3. Evaluacin de la actividad antagnica en milmetros de las cepas marinas contra


V. parahaemolyticus por medio del mtodo de la estra cruzada
Identificacin de los aislados.
Las secuencias obtenidas de los productos de PCR fueron sometidas a un anlisis
comparativo con el programa BLAST del NCBI y se obtuvo la identificacin de los cuatros
aislados como bacterias del genero Bacillus y Staphylococcus, con un porcentaje de
similitud entre el 98 y 99%:

Tabla 5. Aislados identificados.


Cepa Genero Porcentaje de similitud con el NCBI
30R Bacillus sp. 98-99%
35 Staphylococcus sp. 98%
42 Bacillus sp. 98%
44 Staphylococcus sp. 98%

120
Investigaciones en Ciencia e Inocuidad de Alimentos

Discusin
Reportes sobre antagonismo (2, 7, 8) mencionan el aislamiento de Staphylococcus, Micrococcus,
Bacillus, Streptomyces y actinobacterias en ecosistemas marinos mexicanos.
La actividad antagnica observada en las cepas puede deberse a que ciertos microorganismos son
capaces de producir enzimas extracelulares las cuales sirven como sustancias antibacterianas.
Diversos trabajos (2, 5) mencionan que, al momento de realizar una evaluacin antagnica por
estra cruzada, es conveniente incubar por un periodo de tiempo prolongado la estra del
microorganismo a evaluar, esto para darle tiempo para que desarrolle las sustancias
antimicrobianas y se difundan en el medio.

Los trabajos de Cetina (2) con aislados marinos de Pseudoalteromonas contra Staphylococcus
aureus y Pseudomonas aeroginosa, as como el de Villarreal-Gmez et al. (8), con actividad
antagonista frente a una cepa patgena de Proteus mirabilis por aislados microbianos de algas y
Torres-Beltrn et al. (7) sobre actividad antibitica de Streptomyces, Micromonospora y Salinospora,
provenientes del Golfo de California frente a Staphylococcus aureus resistente a la meticilina,
demuestran la presencia de microorganismos con propiedades antimicrobianas provenientes de
ecosistemas marinos mexicanos. El uso de estos aislados como probiticos al camarn, podran
conferirle la capacidad de resistir las infecciones por el V. parahaemolyticus causante del EMS (1).

Conclusiones
La obtencin de aislamientos de especies de Bacillus con la capacidad de detener el crecimiento de
las cepas de V. parahaemolyticus utilizadas abre las puertas a una alternativa para el tratamiento de
la enfermedad del EMS, sin embargo, es necesaria la realizacin de bioensayos en acuarios que
involucren la presencia del camarn para determinar la eficiencia del antagonismo in vivo. Estas
cepas marinas podran tener alto potencial industrial para la lucha contra esta enfermedad.

Bibliografa
1. Aguilera-Rivera, D., Prieto-Dav, A., Escalante, K., Chvez, C., Cuzon, G., y Gaxiola, G. 2014.
Probiotic effect of FLOC on Vibrios in the pacific white shrimp Litopenaeus vannamei.
Aquaculture, 424, 215-219.
2. Cetina, A., Matos, A., Garma, G., Barba, H., Vzquez, R., Zepeda-Rodrguez, A., Lpez-A, R.
2010. Antimicrobial activity of marine bacteria isolated from Gulf of Mexico. Rev. Peru. Biol.,
17(2), 231-236.
3. Comisin Nacional de Acuacultura y Pesca (CONAPESCA). Tabla de la produccin pesquera
por oficina de pesca https://datos.gob.mx/busca/dataset/produccion-
pesquera/resource/376a0a22-69f5-43eb-bcd8-a74163d11118 [Consulta: 06/07/2017].
4. FAO (Food and Agriculture Organization of the United Nations), 2013. Desenmascarado el
culpable de la muerte masiva de camarones en Asia [en lnea].
http://www.fao.org/news/story/es/item/175495/icode/ [Consultado: 21/06/2017].
5. Saha A., Santra S.C. 2014. Isolation and characterization of bacteria isolated from municipal
solid waste for production of industrial enzymes and waste degradation. J. Microbiol. Exp.; 1(1):
03.
6. Reantaso M.B., Gmez Gil B., 2013. Early Mortality Syndrome (EMS) in Shrimp. Tercer Foro
Econmico de Pesca y Acuacultura. SAGARPA, CONAPESCA. Nov. 25 y 26, 2013. Mxico.
7. Villarreal-Gmez L.J., Soria-Mercado I.E., Guerra-Rivas G., Ayala-Snchez N.E. 2010.
Actividad anticancergena y antibacteriana de macroalgas y bacterias asociadas a su
superficie. Rev. Biol. Mar. Oce., Agosto Vol. 45, 2: 267-275.
8. Torres-Beltrn M., Cardoso-Martnez F., Milln-Aguiaga N., Becerril-Espinosa A., Soria-
Mercado I.E., 2012. Evaluacin del golfo de California como una fuente potencial de
actinobacterias marinas bioactivas Cien. Mar., 38(4): 609624.

121
Investigaciones en Ciencia e Inocuidad de Alimentos

Anlisis de la incidencia de Escherichia coli enteropatgena en productos


crnicos en el sur de Sonora
1 2 1 1
*Anduro Jordan, J.A., Maldonado Mendoza I.E., Cant Soto E.U., Figueroa Lpez A.M.,
1 1
Campas Baypoli O.N., Flix Fuentes, A.
1
Instituto Tecnolgico de Sonora. Departamento de Biotecnologa y Ciencias Alimentarias.
Doctorado en Ciencias Especialidad en Biotecnologa.
2
Instituto Politcnico Nacional. Centro Interdisciplinario de Investigacin para el Desarrollo Integral
Regional (CIIDIR). Unidad Sinaloa.
*Autor de correspondencia: julioanduro@gmail.com, (644) 4100900 ext. 2133
Palabras claves: E. coli, verocitotoxignica, carne
Introduccin
Escherichia coli O157:H7 productora de toxina Shiga (E. coli STEC) se relaciona a una
gran cantidad de brotes de enfermedades transmitidas por alimentos (ETAs) asociados al
consumo de productos crnicos[8]. Es capaz de causar infeccin en humanos con una
baja dosis infectiva (10100 clulas) provocando diarrea con sangre, colitis hemorrgica
(CH) y sndrome urmico hemoltico (SUH); las infecciones suelen ser severas en nios
pequeos, adultos mayores y personas inmuno-suprimidas [2]. El serotipo O157:H7
produce las toxinas Stx1 y Stx2 identificadas como sus principales factores de virulencia;
sin embargo, se han identificado otros serotipos no O157 asociados con enfermedades
humanas, incluyendo SUH; este grupo est conformado por los serotipos O26:H11,
O45:H2, O111:H8/NM, O103:H2, O145:NM, O121:H19 y O104:H4 los cuales se estima
provocan 112,752 casos cada ao, mientras que O157:H7 causa 63,153 casos por ao en
pases como Alemania, Japn, Asia y Estados unidos [1]. En Mxico, no se ha registrado
incidencia del patgeno E. coli O157:H7 en casos clnicos y se cuenta con escasos
estudios del patgeno en productos alimentarios [3-5]. La tcnica de PCR multiplex
(MPCR) es utilizada para la identificacin rpida de diferentes aislados sospechosos y
representa una tcnica que no depende de mtodos tradicionales para la deteccin de
cepas especficas en matrices complejas. La MPCR se basa en la amplificacin
simultnea de varios genes blanco empleando mltiples pares de oligonucletidos. De
esta forma se pueden detectar genes especficos de una especie e incluso determinar el
serotipo al cual pertenecen. El xito de la tcnica se basa en el correcto diseo de los
oligonucletidos, seleccionando fragmentos de diferentes tamaos y optimizando la
reaccin [7]. El objetivo del presente estudio es identificar mediante MPCR Escherichia
coli enteropatgena a partir de productos crnicos en Sonora, Mxico.

Metodologa
Se recolectaron 160 muestras de rastros TIF, rastros No TIF y centros de distribucin de
productos crnicos en el sur de Sonora, Mxico. El aislamiento de E. coli O157:H7 y no
O157 se realiz acorde a la metodologa descrita por Jimnez et al.[4], y las clonas se
criopreservaron a -70C.
La extraccin de ADN se realiz utilizando el DNA Blood and Tissue kit de Qiagen (Cat-
569504) siguiendo el protocolo para bacterias Gram negativas. Se cuantific la
concentracin y pureza del ADN (Nanodrop 2000c), y la integridad se verific en geles de
agarosa al 1%.
Para la estandarizacin del MPCR en los genes de virulencia Stx1, Stx2, eaeA y rfB se
utilizaron los oligonucletidos especficos descritos en la Tabla 1. La MPCR se realiz en
un volumen final de 25 l: 1X de Buffer de PCR, 3 mM de MgCl2, un par de
oligonucletidos para cada gen: Stx1, Stx2, eaeA, rfB (0.2 M de cada uno), 0.6 M de
dNTPs, 10-15 ng de ADN, 1.25 U de Taq ADN Polimerasa (Invitrogen) y H 2O para 25 l.
Las condiciones de amplificacin fueron desnaturalizacin a 94C por 4 min, 35 ciclos de

122
Investigaciones en Ciencia e Inocuidad de Alimentos

94C por 30 seg, 1 min a 56C para hibridacin y 60 seg a 72C de extensin, y un paso
de extensin final de 72C por 7min. El tamao de los fragmentos se observaron en un gel
de agarosa al 2% en un fotodocumentador Minibispro DNr (Bio-imaging Systems). Los
productos de PCR se purificaron con el Qiaquick PCR Purification Kit de Qiagen (Cat. No.
28106) y se realiz una secuenciacin bidireccional (Langebio, CINVESTAV Unidad
Irapuato) empleando un equipo ABI Prism 3100. El anlisis filogentico se realiz en el
software MEGA 6 y FigTree v14.0 con el fin de establecer unidades taxonmicas
funcionales con serotipos de E. coli STEC para una identificacin definitiva de los genes
de virulencia.

Resultados y discusin
Se estandariz el MPCR para los genes de virulencia Stx1, Stx2, eaeA, rfB (Figura 1). Se
obtuvieron 224 aislados de E. coli de las 160 muestras analizadas (Tabla 2) y dos
muestras (aislados 31 y 50) amplificaron un fragmento de 255 pb correspondiente al gen
Stx2 (Figura 2). La toxina Stx2 tiene un potencial toxignico 400 veces mayor que Stx1
[6]; los aislados se obtuvieron de corte de lomo y corte cercano al recto de la canal. La
identificacin definitiva del factor de virulencia Stx2 de los aislados se obtuvo de un
anlisis filogentico de las secuencias de este gen (Figura 3). Los aislados 31 (Stx2) y 50
(Stx2) se ubican en un clado con las secuencias CP014314.1, CP008957.1,
NZJHNR01000078.1, AP010960.1, NZAGSG01000174.1, NZCDLB01000033.1,
KJ158456.1, pertenecientes a cepas que han sido reportadas en otras regiones por su
potencial txico-infeccioso.

Tabla 1. Set de oligonucletidos utilizados en el MPCR y longitud de los fragmentos.


fragmento
Oligonucletido Secuencias (5-3)
(bp)
F ATAAATCGCCATTCGTTGACTAC
Stx1
R 180
Stx1 AGAACGCCCACTGAGATCATC
F GGCACTGTCTGAAACTGCTCC
Stx2
R 255
Stx2 TCGCCAGTTATCTGACATTCTG
F GACCCGGCACAAGCATAAGC
eaeA
R 384
eaeA CCACCTGCAGCAACAAGAGG
F TAAGTAATGGAACGGTTGCTCT
**rfB
R 1000
**rfB CCCCACTCGTAAAATCCATC
F
=Forward; R=Reverse; **solo para O157:H7

123
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 1. PCR Multiplex utilizando como control positivo ADN de E. coli O157:H7. Carril 1
y 8 marcador molecular 1Kb plus DNA Ladder; carril 2 control negativo (E. coli atcc
25922), carril 3 (gen eaeA 384pb); carril 4 (gen Stx2 255pb); carril 5 (gen stx1 180pb);
carril 6 (gen rfB 1000pb); carril 7 multiplex.

Figura 2. Amplificacin del gen de virulencia Stx2 en cepas de E. coli aisladas a partir de
productos crnicos del sur de Sonora. Carril 1 control negativo (atcc 25922), carril 2
marcador molecular 1Kb plus DNA Ladder, carril 3 control positivo (E. coli O157:H7), carril
4 aislado 31 y carril 5 aislado 50.

Tabla 2. Aislados de E. coli y genes de virulencia a partir de productos crnicos.


Aislados
Origen producto
No. de muestras de Genes de virulencia
crnico
E. coli
rfB Stx1 Stx2 eaeA Total*
E. coli
-- -- -- + + + +
O157:H7
Cerdo RF 9 4 - - - - 0
Cerdo RA 9 17 - - - - 0
Cerdo CF 8 5 - - - - 0
Cerdo CA 8 0 - - - - 0
Cerdo LF 10 26 - - - - 0
Cerdo LA 10 23 - - - - 0
Res RF 8 5 - - + - 1
Res RA 12 20 - - - - 0
Res CF 10 10 - - - - 0
Res CA 10 23 - - - - 0
Res LF 15 35 - - + - 1
Res LA 15 22 - - - - 0
Res Carne molida 36 34 - - - - 0
Total 160 224 2
Origen de las muestras: RF= Recto cuarto Frio; RA= Recto Ambiente; CF=Costillar cuarto
Frio; CA= Costillar Ambiente; LF= Lomo cuarto Frio; LA= Lomo Ambiente. (- y +)=
Negativo y Positivo respectivamente a portador del gen, * total de aislados que
amplificaron positivo para Stx2.

124
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 3. rbol filogentico construido con Mxima verosimilitud, modelo Kimura 2 con
secuencias del gen Stx2. El nmero en la rama de filogenia indica el valor (%) por 1000
replicaciones y la escala indica una distancia gentica de 0.05 por cada sustitucin de
nucletidos de la secuencia del gen Stx2.

Conclusiones
La MPCR fue estandarizada para detectar la presencia de los genes de virulencia
relacionados a E. coli enteropatgena. Estos resultados constituyen el primer reporte de
aislados de E. coli provenientes de productos crnicos que presentan genes de virulencia
para esta regin de Mxico y puede conducir a un mayor entendimiento de este patgeno
y su asociacin con brotes alimentarios por el consumo de productos crnicos.

Bibliografa

1. Bettelheim KA. 2007. The Non-O157 shiga-toxigenic (verocytotoxigenic) Escherichia coli; under-rated
pathogens. Crit Rev Microbiol 33:67-87.
2. Franco Anaya PA, Ramrez Medina LM, Orozco Ugarriza ME, Lpez Gutirrez LA. 2013.
Determinacin de Escherichia coli e identificacin del serotipo O157:H7 en carne de cerdo
comercializada en los principales supermercados de la ciudad de Cartagena. Revista Lasallista de
Investigacin 10:91-100.
3. Gallegos M, Morales A, lvarez G, Vsquez J, Morales L, Martnez I, Maldonado J. 2009.
Caracterizacin de aislados de Escherichia coli O157:H7 en canales de bovinos y porcinos mediante
PCR. Revista Cientfica, FCV-LUZ XIX:139 - 46.
4. Jimnez Edeza M, Chaidez Quiroz C, Len Flix J. 2012. Calidad microbiolgica de carne de res
comercializada en el mercado municipal de Culiacn, Sinaloa. Veterinaria Mxico 43:273-84.
5. Lpez RAT, Tijerina VM, Mata AE, Vzquez IOM, Loredo AM, Ojeda GA, Robles MAG. 2009.
Deteccin de Escherichia coli O157:H7 en carne fresca de res mediante PCR multiplex. RESPYN. 10
No.2
6. Navarro-Garcia F. 2014. Escherichia coli O104:H4 Pathogenesis: an Enteroaggregative E. coli /
Shiga Toxin-Producing E. coli Explosive Cocktail of High Virulence. Microbiol Spectr 2.
7. Settanni L, Corsetti A. 2007. The use of multiplex PCR to detect and differentiate food- and beverage-
associated microorganisms: a review. J Microbiol Methods 69:1-22.
8. Son I, Binet R, Maounounen-Laasri A, Lin A, Hammack TS, Kase JA. 2014. Detection of five Shiga
toxin-producing Escherichia coli genes with multiplex PCR. Food Microbiol 40:31-40.

125
Investigaciones en Ciencia e Inocuidad de Alimentos

Aprovisionamiento de leche cruda en el departamento de Sucre Colombia


1 2 3
Vergara Suarez , G., Ruiz Meza , J. L., Gomezcaceres Perez, L .
1,2,3
Corporacin Universitaria del Caribe CECAR, Carretera Troncal de occidente kilmetro 1, va
1
Corozal, Sincelejo, Sucre, Colombia, 3146350167, Luty.gomezcaceres@cecar.edu.co
Palabras clave: Aprovisionamiento, Leche, Higiene.

Introduccin
La leche es un alimento de gran importancia para el hombre desde la domesticacin de
los animales y el comienzo de la agricultura de pastoreo (1). Su aporte nutricional, no ha
sido superado por ningn otro alimento conocido por el ser humano, siendo considerada,
gracias a estas caractersticas como el alimento ms completo e insustituible para el ser
humano en el mundo, (2)(3). Lo que hace necesario establecer las medidas de proteccin
alimentarias durante toda la cadena, que permitan mantener la calidad del producto para
que conserve sus propiedades de acuerdo al uso que ser sometido, (4).

En tal sentido, la calidad de la leche cruda se resume en dos aspectos: el carcter


composicional y el higinico-sanitario. Que se refieren respectivamente al contenido de
slidos totales, grasa y protena, para determinar su valor nutricional y su aptitud para la
comercializacin cruda y/o como materia prima para el procesamiento de derivados
lcteos y al contenido microbiano,(5).

Dentro de las cadenas de suministros lcteos, la logstica de aprovisionamiento que


comprende la planificacin, ejecucin y control del flujo eficiente y rentable de la leche
cruda para su posterior procesamiento y comercializacin directa o por intermediarios
mediante la logstica de distribucin, (6). Es fundamental garantizar tanto la inocuidad
como el valor nutricional del alimento para poder decir que el producto cumple con los
parmetros de calidad establecida; parmetros que contemplan desde la infraestructura,
los procesos operativos y los sistemas de aseguramiento de calidad implementados en
todos los eslabones de la cadena.

Este estudio busco conocer la realidad del proceso de aprovisionamiento de la leche


cruda del departamento de Sucre, identificando las fortalezas y las debilidades del sector
que incidan en la clidad del producto.

Metodologa

El presente estudio es de tipo descriptivo, y tuvo como escenario el departamento de


Sucre Colombia. Se dividi en tres fases: una fase de bsqueda y recoleccin de
informacin, una segunda fase de diseo, validacin de instrumentos guiados por el
decreto 3075 de 1993 de buenas prcticas manufactureras (BPM), basado en el Codex
Alimentarius y aplicados a una muestra conformada por los principales actores del
proceso de aprovisionamiento de la cadena de suministros de lcteos del departamento,
quienes son productores, transportadores y acopiadores-procesadores; Se tom como
punto de partida las empresas matriculadas ante cmara de comercio de Sincelejo 2016,
con registro sanitario del INVIMA 2016 y pertenecientes a los municipios que representan

126
Investigaciones en Ciencia e Inocuidad de Alimentos

el 80% de la produccin de leche del departamento. A partir de all, se aplicaron los


instrumentos de medicin a los transportadores y unidades productoras asociados a estas
empresas.

Resultados y discusin

En la logstica de aprovisionamiento de la leche cruda en el en el departamento de Sucre,


se evidencian tres procesos especficos que inciden directamente en la inocuidad del
producto: produccin, transporte y acopiado-procesamiento, los cuales se detallan a
continuacin.

Proceso de Produccin: en Sucre, el eslabn de produccin de la cadena lctea est


conformado por pequeos, medianos y grandes ganaderos los cuales basan su
produccin en un 89,39% bajo el sistema doble propsito (obtencin de carne y leche),
mientras que solo el 0,61% utiliza un sistema especializado. El 9,98% restante se dedican
a la obtencin de carne.

Existe un total de 17.296 unidades productivas que generaron una produccin anual de
170.994.379 litros de leche a 2016, (7). Estas unidades presentan un desconocimiento
generalizado acerca de la normatividad que los regula y la falta de asistencia tcnica para
alcanzar las certificaciones de buenas prcticas ganaderas. La produccin de leche diaria
tiene un promedio departamental de 2,7 Lt/dia por cada vaca en ordeo; la raza
predominante en la zona es el ganado cruzado Cebuino, siendo a 2015 e municipio de
San Marcos el mayor productor de los 26 municipios con 54.513 Lt/da y en ltimo lugar
est Chaln 1.346 Lt/da.

En cuanto a los utensilios de recoleccin, el 55% de los productores recolecta la leche en


tanques de aluminio, el 25% en tanques de acero inoxidable y el resto utiliza tanques
plsticos para la recoleccin. El ordeo se realiza de forma manual. El 80 % de los
encuestados vende la leche a la industria, el 15% a la venta informal y sola el 5% la utiliza
para el consumo. En cuanto a los aspectos higinicos - sanitarios, solo el 30% manifest
tener conocimiento de las buenas prcticas de manufactura y el 15% conoce las buenas
prcticas ganaderas.

Transportadores: en Sucre, la recoleccin de la leche cruda se realiza a travs de


vehculos rgidos entre ellos, camionetas de estaca, camiones sencillo de un eje, adems
se emplean con mucha frecuencia el transporte en motos, hasta en vehculos de traccin
animal, utilizando recipientes inadecuados tales como, tanques plsticos de 200 litros,
tanques plsticos de 5 galones fabricados para el empaque de aceite, recipientes de
acero inoxidable o aluminio de 40 litros y 20 litros. Incumpliendo generalmente con lo
establecido en el Decreto 3075 de 1997 del ministerio de Salud de Colombia y atentando
contra la calidad del producto.

127
Investigaciones en Ciencia e Inocuidad de Alimentos

El tiempo de recoleccin de los vehculos vara de acuerdo a la cantidad de leche


recolectada y puede tardar entre 1 a 20 minutos en cada punto, demorando la ruta entre 5
y 6 horas. Lo que afecta la calidad del producto al no estar debidamente refrigerado.

El 100% de los transportadores que utilizan moto, transportan la leche en su mayora en


recipientes de plstico tipo pimpina de aceite, aproximadamente cargan entre 3 y 4 de
estos tanques, los cuales tienen una capacidad de 30 litros. En cuanto a los
trasportadores de carro, el 70% utiliza recipientes de plstico, el 25% de aluminio y el 5%
de acero.

Un actor fundamental en este proceso, son los intermediarios, quienes a 2012 obtenan el
62% del total de la leche dedicada a la venta, (8). Los intermediarios sirven directamente
a muchas empresas procesadoras de lcteos en los diferentes municipios encargndose
de recoger la leche en las fincas, con sus propios vehculos, transportarla y venderla a los
procesadores.

Centros de acopio y empresas procesadoras: las empresas procesadoras del


departamento, funcionan tambin como centros de acopio, los cuales reciben
aproximadamente 1500 litros de leche en verano y de 60000 litros en pocas de lluvias,
utilizada para la elaboracin de una amplia gama de productos, tales como queso doble
crema, queso costeo, queso fresco graso semiduro, queso doble crema tipo mozzarella,
queso semigraso, queso fresco, leche entera en polvo azucarada, yogurt, leche entera
pasteurizada, crema de leche, crema para untar, bolitas de leche y suero costeo.

Actualmente segn datos del INVIMA, los productores localizados en el departamento de


Sucre, que se encuentran inscritos con permisos sanitarios y cuyos datos reposan en la
base de datos a enero 25 de 2016, son 46 empresas procesadoras pertenecientes a 14
municipios de los 26 del departamento, tales municipios son: Buenavista, Caimito,
Corozal, Galeras, Los Palmitos, Majagual, Ovejas, Sampus, San Juan de Betulia, San
Luis de Sinc, San Marcos, San Pedro, Sincelejo y Toluviejo.

En la evaluacin del grado de cumplimiento de las BPM aplicable a todas las actividades
que puedan generar factores de riesgo por el consumo humano de alimentos, se
evidenci que las plantas procesadoras evaluadas no poseen una infraestructura fsica
que cumpla al 100% con lo que estable el decreto 3075 de 1993. Sin embargo, las
condiciones de saneamiento, el manejo de los residuos lquidos dentro de las plantas, los
utensilios y superficies, no presenta riesgo de contaminacin para los alimentos ni para
las superficies en contacto con stos, y no existe evidencia o huellas de la presencia o
daos por plagas.

Conclusiones

Dentro de la logstica de aprovisionamiento de la leche cruda en el departamento de


Sucre, se hace evidente el alto grado de procesos artesanales sin controles de calidad
estandarizados que distan del cumplimiento de las normas que regulan las condiciones de

128
Investigaciones en Ciencia e Inocuidad de Alimentos

manipulacin de este tipo de productos. Existe un cumplimiento promedio del 60% de las
BPM por parte de las empresas procesadoras, quienes tambin cumplen el roll de
acopiadoras.

Los factores que pueden atentar contra la calidad de la leche cruda inician desde la propia
obtencin en las fincas, debido al desconocimiento de las buenas prcticas ganaderas,
seguido del deficiente sistema de transporte en donde no existe, ni se mantiene la cadena
de frio, lo que genera una alta probabilidad de proliferacin de microorganismos y en
consecuencia se conlleva a prdidas econmicas o en el peor de los casos se crea la
posibilidad de que un consumidor pueda contraer una enfermedad transmitida por
alimentos.

Bibliografa

1. Alais, C., (1985), Ciencias de la Leche; Principios de la Tcnica Lechera, Bogot D.C: Editorial
Reverte S.A.

2. Jaramillo, A., & Areiza, A. (2012). Market Analysis of Milk and Dairy Products in Colombia (2008-
2012). Bogot: Superintendencia de Industria y Comercio.

3. FAO & FEPALE. (2012). Situacin de la Lechera en Amrica Latina y el Caribe en 2011,
Observatorio de la Cadena Lechera. Oficina Regional de la FAO para Amrica Latina y el Caribe,
Divisin de Produccin y Sanidad Animal. Chile.

4. Grocery Manufacturers Asocciations. (2005). Manual de la Cadena de Abastecimiento de


Productos Alimenticios. Washington.

5. Martnez, M. Serpa, J. Gmez, C. (2009). Diagnstico de la calidad Composicional e Higinico


sanitarias de la Leche Cruda en Centros de Acopio y Plantas Procesadoras del Departamento de
Sucre. Sincelejo, Colombia. Ed Hipertexto Ltda.

6. Govindan, K., Soleimani, H., & Kannan, D. (2014). Reverse logistics and closed-loop supply
chain: A comprehensive review to explore the future. European Journal of Operational Research, 1
- 57.

7. (DANE. (31 de marzo de 2016). Tercer Censo Nacional Agropecuario. Dcimo segunda entrega
de resultados 2014. Bogot, Colombia: Departamento Administrativo Nacional de Estadstica.

8. Red Nacional de Agencias de Desarrollo Local. (2013). Plan Estratgico Departamental de


Ciencia, Tecnologa e Innovacin de Sucre. Sucre Innova, Sucre Transforma - PEDCTI. Convenio
0592-2012. Sincelejo: Gobernacin de Sucre.

129
Investigaciones en Ciencia e Inocuidad de Alimentos

Dinmica de internalizacin Salmonella Newport en tomates cherry (Solanum


lycopersicum var. cerasiforme) y cuantificacin del gen rpoS.
1 1 1 1
Orozco Garca A. G., Barba Len J., Cabrera Daz E., Snchez Hernndez C. V., Martnez
2 2 3 4
Chvez L., Martnez Gonzles N. E., Castillo Ayala A., Ballen Parada M.
1
Centro Universitario de Ciencias Biolgicas y Agropecuarias, Universidad de Guadalajara, Camino
2
Ramn Padilla Snchez 2100, Nextipac, Zapopan, Jal. (33)37771151. Centro Universitario de
3
Ciencias Exactas e Ingenieras, Universidad de Guadalajara, Department of Animal Science,
4
Texas A&M University, USA, Pontifica Universidad Javeriana Cra. 7 #40, Bogot, Colombia.
jeannette.barba@academicos.udg.mx

Palabras clave: Salmonella Newport; Internalizacin; Tomate cherry

Introduccin

La adaptacin de Salmonella al ecosistema del tomate es un tema de investigacin


reciente debido a que su hbitat principal es el tracto gastrointestinal de los animales (3).
Entre 1996 y 2006, el tomate caus el 17.1% de las enfermedades causadas por el
consumo de alimentos, las cuales fueron ocasionadas por algn serotipo de Salmonella
enterica (4). Salmonella es capaz de internalizarse en el tomate a travs de la infiltracin
del agua durante el lavado del fruto, cuando la presin del agua sobre la superficie del
tomate supera tanto la presin de gas interna como la hidrofobicidad de la superficie del
fruto (1). Otro mecanismo implica la succin del agua contaminada cuando se contraen
las clulas dilatadas de la superficie del tomate, provocada por su exposicin al agua fra
del lavado. As mismo, la bacteria tambin puede internalizarse a travs de la cicatriz del
pednculo y las fisuras en el fruto causadas por insectos o daos mecnicos (5).
Se ha reportado que algunas condiciones ambientales, tales como el agotamiento de
nutrientes (especialmente Mg2 +) y el pH bajo inducen la expresin de factores de
virulencia de Salmonella. Los cuales participan en la invasin y colonizacin intestinal del
hombre y animales (3). Lo anterior sugiere que la capacidad de Salmonella para
internalizarse en los tomates puede depender de las caractersticas intrnsecas del fruto
(pH, contenido de slidos y azcar) y los atributos fisiolgicos del serotipo. Se ha
reportado que el factor sigma S (tambin conocido como RpoS, KatF o sigma 38)
desempea un papel clave en la supervivencia de las bacterias bajo condiciones de
hambre o estrs (2). Es por ello que el objetivo de esta investigacin fue determinar la
dinmica de internalizacin de Salmonella Newport en tomates cherry (Solanum
lycopersicum var. cerasiforme) y cuantificar la transcripcin del gen rpoS.

Metodologa

Se utilizaron tomates de la variedad cherry libres de daos fsicos, de color rosado, firmes
con un peso aproximado de 7 g, pH 4 y 7 Brix. Con el objetivo de promover la
internalizacin de la bacteria en el tomate se conservaron los frutos a 25 C/24h previo a
los experimentos de inoculacin, para establecer un gradiente de temperatura de 12C
entre los tomates y la suspensin bacteriana (inculo). Para la preparacin del inculo se
reactiv Salmonella Newport resistente a rifampicina en medio Luria Bertani (LB) y se
incub a 37 C durante 24 h. Posteriormente se tomaron 670 L del cultivo previo y se
inocularon 10 mL de LB, para incubarse por 4 horas. Despus se hizo una segunda
transferencia de 670 L a un tubo con 35 mL de LB para incubarse por 18-24 h/37 C. Lo
anterior permiti obtener una concentracin bacteriana de 108 UFC. Las clulas
bacterianas del ltimo crecimiento se recuperaron por centrifugacin a 6,000 rpm/10

130
Investigaciones en Ciencia e Inocuidad de Alimentos

min/12 1 C y se lavaron dos veces con solucin salina fisiolgica (SSF) al 0.85 %
almacenada a 12 C. Para la inoculacin de los tomates S. Newport se resuspendi en
200 mL de SSF y la suspensin bacteriana fue transferida a una bolsa plstica estril. Los
tomates fueron sumergidos en la suspensin bacteriana durante 30 min a 12 1 C para
promover la internalizacin. Los frutos se dejaron secar por una hora y despus fueron
transferidos a una incubadora ajustada a 25 C para tomar una muestra de 2 tomates en
diferentes intervalos de tiempo (0 h, 30 min, 1 h, 2 h, 4 h, 8 h, 24 h, 32 h, 3 d, 6 d y 12 d)
para evaluar la internalizacin. En los tiempos indicados se removi de la incubadora la
muestra para procesarla y realizar recuentos del patgeno en la parte interna del fruto.
Brevemente, en los tiempos establecidos los tomates se desinfectaron de manera externa
por inmersin en etanol al 96 % por 2 min para eliminar clulas debilmente adheridas.
Despus se colocaron en 50 mL de agua peptonada amortiguada (BPW) para someterlos
a un bao ultrasnico durante 1 min para desprender las clulas fuertemente adheridas.
Una vez desinfectada la superficie del fruto, los tomates se transfirieron a una bolsa con
50 ml de BPW para romper los frutos en un agitador peristltico durante 1 min y recuperar
las bacterias internalizadas en el fruto. Se tom 1 mL de la suspensin obtenida para
cuantificar la concentracin bacteriana de Salmonella Newport en placas de agar soya
tripticasena con extracto de levadura suplementadas con rifampicina. Las placas se
incubaron a 37 1 C durante 18-24 horas y se cuantificaron las UFC de cada palca
reportndose como log/50 ml. La cuantificacin de rpoS se llev a cabo por qRT-PCR de
clulas recuperadas del interior del tomate a las 0 h y 3 d. Para retirar la pulpa y semillas
del fruto, la suspensin obtenida del rompimiento del tomate se filtr dos veces con papel
filtro estril de 10 cm2, colocado en un embudo y este a su vez en un tubo cnico estril
de 50 mL. Del ltimo procedimiento se recuperaron aproximadamente 35 mL de la
suspensin y se centrifug a 6,000 rpm/15 min/16 C, se decantaron aproximadamente 30
mL del sobrenadante y los 5 mL restantes se centrifugaron a 11 000 rpm/15 min/16 C,
para obtener el paquete celular el cual se protegi con RNA protect (QIAGEN) de acuerdo
a las especificaciones del fabricante. El paquete celular protegido se almacen a 20 C
hasta la purificacin de RNA. La purificacin del RNA fue con el kit RNeasy Mini kit
(QIAGEN) siguiendo las indicaciones del fabricante. 0.5 g/L de RNA fueron tratados
con 1 U/L de DNAsa (Promega) siguiendo las especificaciones del fabricante. La pureza
del RNA fue verificada por la amplificacin del gen rpoS mediante el empleo de la tcnica
PCR. La retrotranscripcin se realiz empleando el kit GoScript Reverse Transcription
System (Promega) siguiendo las indicaciones del proveedor. El qRT-PCR mltiple se llev
a cabo utilizando el termociclador StepOne Plus (Applied Biosystems Life Tecnologies),
cuantificando la fluorescencia de rpoS (FAM) y 16 S (VIC). Todos los experimentos
realizados se llevaron a cabo por triplicado con dos repeticiones independientes. El
anlisis de la expresin se realiz a travs de la determinacin del Ct mediante el
empleo de la frmula Ct= Ct gen inters Ct gen endgeno. Los resultados obtenidos de las
clulas internalizadas en tomate y la transcripcin del gen rpoS, se analizaron
estadsticamente utilizando el programa Statgraphics Centurion XVII mediante el empleo
de las pruebas de anlisis de varianza simple (ANOVA) y de rangos mltiples (LSD por
sus siglas en ingls) con un nivel de confianza del 95 % para la evaluacin de grupos
homogneos.

Resultados y discusin

Nuestros resultados indican que Salmonella Newport, logr internalizarse en el tomate en


diferentes concentraciones bacterianas en todos los tiempos evaluados (Fig. 1). No
obstante, al tiempo de 4 h y 6 d se observa una disminucin en la recuperacin en placa
de las clulas internalizadas, en contraste al tiempo de 8 h se observa una recuperacin

131
Investigaciones en Ciencia e Inocuidad de Alimentos

de clulas bacterianas similar a las observadas en el tiempo de 2 h, y a los 12 d se


observa una recuperacin de aproximadamente 1.5 Log/50 mL (P < 0.05). Los resultados
observados sugieren que S. Newport podra estar en un estado viable no cultivable en los
tiempos 4 h y 6 d, estado que se revierte en los tiempos evaluados posteriormente (8 h y
12 d) (Fig. 1). As mismo, nuestros resultados de qRT-PCR muestran que la transcripcin
del gen rpoS en Salmonella Newport internalizada en tomate en los tiempos de 0h y 3d
fue cuatro veces menor con respecto a las condiciones de induccin del gen (S. Newport
inoculada en caldo LB incubado a 18C). Lo anterior sugiere que el interior del fruto no
representa una situacin de estrs para Salmonella Newport (Fig. 2).

Fig. 1.- Supervivencia de clulas de Salmonella Newport internalizadas en el tomate


cherry. Los tringulos representan los Log UFC/50mL de clulas internalizadas. Los
cuadrados representan las clulas fuertemente adheridas en la superficie del tomate.
Cada valor graficado representa el promedio de tres experimentos independientes con
dos repeticiones cada uno. Las barras verticales representan el error estndar, h: horas y
d: das.

132
Investigaciones en Ciencia e Inocuidad de Alimentos

S. Newport en LB

S. Newport internalizada en
tomate cherry

Fig. 2.- Expresin relativa de rpoS de Salmonella Newport cultivada en medio LB a


18 C o internalizadas en tomate cherry. Cada valor representa el promedio de tres
experimentos independientes con dos replicas tcnicas cada uno. Letras iguales indican p
> 0.05% y letras diferentes indican p < 0.05%. Las barras verticales representan el error
estndar, h: horas y d: das

Conclusiones

Los resultados mostrados evidencian la capacidad de Salmonella Newport para sobrevivir


en el interior del fruto. La transcripcin de rpoS de Salmonella Newport es reducida en el
interior del tomate en comparacin a la observada in vitro. Nuestros resultados enfatizan
la importancia de evitar la internalizacin de Salmonella en el fruto, ya que los tomates
contaminados de manera interna con Salmonella son una fuente potencial de
enfermedad.

Bibliografa

1. Bartz, J. A., Yuk, H., Mahovic, M. J., Warren, B. R., Sreedharan, A., & Schneider,
K. R. 2015. Internalization of Salmonella enterica by tomato fruit. Food Control, 55,
141150.
2. Ibanez-Ruiz, M., Robbe-Saule, V., Hermant, D., Labrude, S., & Norel, F. 2000.
Identification of RpoS (sS)-regulated genes in Salmonella enterica serovar
typhimurium. J Bacteriol, 182(20), 57495756.
3. Jofr, M. R., Rodrguez, L. M., Villagra, N. a, Hidalgo, A. a, Mora, G. C., & Fuentes,
J. a. 2014. RpoS integrates CRP, Fis, and PhoP signaling pathways to control
Salmonella Typhi hlyE expression. BMC Microbiology, 14(1), 139.
4. Li, R., Baysal-gurel, F., Abdo, Z., Miller, S. A., & Ling, K. 2015. Evaluation of
disinfectants to prevent mechanical transmission of viruses and a viroid in
greenhouse tomato production. J Virology 12:5
5. Wang, H., Gill, V. S., Irvin, K. A., Byrd, M., Bolger, C. M., Zheng, J., Hammack, T.
S. 2012. Recovery of Salmonella from internally and externally contaminated whole
tomatoes using several different sample preparation procedures. J of AOAC
International, 95(5), 14521456.

133
Investigaciones en Ciencia e Inocuidad de Alimentos

Identificacin de los agentes patgenos causantes de mastitis caprina


en el municipio de Yurecuaro Michoacn
1 1 1 1
Bedolla Cedeo, C. , Meja Alfaro, R. , Lucio Domnguez, R. , Garca Cedeo, E. ,
1 2 2
Bedolla Garca, J.C. , Valladares Carranza, B. , Velzquez Ordoez, V.

1
Facultad de Medicina Veterinaria y Zootecnia. Universidad Michoacana de San Nicols de
2
Hidalgo. CIESA. Universidad Autnoma del Estado de Mxico.

Palabras Clave: Mastitis | Staphylococcus aureus | Patgenos | Estafilococos coagulasa negativos

Introduccin
La mastitis caprina es una de las enfermedades infecciosas ms importantes en el rebao
lechero a nivel mundial, provocando una disminucin tanto en la calidad, como en
cantidad de la leche producida, lo que genera prdidas econmicas considerables. Su
complejidad se debe a los numerosos y variados agentes patgenos que pueden causarla
(Staphylococcus aureus, Streptococcus agalactiae, Mycoplasma sp, Streptococcus
dysgalactiae, Streptococcus uberis, Streptococcus faecalis, Estafilococos Coagulasa
Negativos, la variedad y magnitud de la respuesta que puede producirse en el animal
infectado, los mltiples factores que influyen en su ocurrencia y los resultados
encontrados en las medidas de control (1).
Debido a lo anterior, un gran nmero de microorganismos han sido asociados con la
mastitis subclnicas y clnicas en las cabras en diferentes partes del mundo. Entre ellos
estn los estafilococos, tanto coagulasa positivos como coagulasa negativos, los
estreptococos: (Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus
uberis), Mannheimia haemolytica, Escherichia coli, Klebsiella, Pseudomonas aeruginosa,
Arcanobacterium pyogenes, Corynebacterium spp., Bacillus spp., Mycoplasmas (M.
agalactiae, M. mycoides, M. putrefaciens y M. capricolum), Clostridium spp, el virus del
ectima contagioso, el virus de la artritis-encefalitis caprina, e incluso levaduras y hongos
(2, 3).
El Staphylococcus aureus (S. aureus), es uno de los ms importantes agentes etiolgicos
causante de mastitis contagiosa en cabras, vacas y ovejas. La especie aislada con mayor
frecuencia en los casos clnicos y subclnicos y es de manera consistente una de las
cuatro causas principales de infecciones nosocomiales, junto con Escherichia coli,
Enterococcus fecalis y Pseudomona aeruginosa (4, 5, 1, 3). En base a lo anterior, el
objetivo del presente trabajo fue identificar los agentes patgenos causantes de mastitis
caprina en el municipio de Yurecuaro, Michoacn.

Metodologa
El presente estudio se realiz de Agosto 2016 a Enero 2017, en el Municipio de
Yurecuaro, Michoacn. Su superficie es de 173.88Km y representa el 0.29 por ciento del
total del Estado. Con una altitud sobre el nivel del mar de 1530 metros. Su clima es
templado con lluvias en verano. Tiene una precipitacin pluvial anual de 700 milmetros
con temperaturas mnima de 13C y de 38C en verano (6). Las muestras se tomaron en
el municipio de Yurecuaro, Michoacn

134
Investigaciones en Ciencia e Inocuidad de Alimentos

El estudio contemplo el muestreo de 51 hatos lecheros caprinos de la raza Sannen,


explotados a pequea escala bajo un sistema de produccin semi-intensivo.
El nmero de unidades de muestreo (n=51 establos) se calcul con un modelo aleatorio
con distribucin proporcional en funcin de la caracterizacin del sistema de lechera a
pequea escala. El muestreo al interior de los rebaos fue por conglomerado, es decir, se
tomaron una muestra de leche del bote contenedor de cada unidad de produccin.
En seguida, se continu con la toma de muestras de leche utilizando para ello tubos de
ensayo esterilizados con tapn hermtico en los cuales previamente se anot la
identificacin necesaria del establo. El tubo de ensayo se coloc inclinado para evitar la
entrada de suciedad. La toma de muestra se hizo directamente de los contenedores de
almacenamiento de leche. El tubo de muestra fue llenado con los dos tercios como
mximo. Finalmente los tubos con la muestra se colocaron en una gradilla puesta en una
hielera cerrada hermticamente para posteriormente transportarlas al laboratorio de
bacteriologa de la USAD de la Facultad de Medicina Veterinaria y Zootecnia para su
procesamiento inmediato o refrigeracin a 4C (7).
Procesamiento de las muestras de leche y aislamiento de los patgenos
El procesamiento de las muestras de leche obtenidas se realiz el da del muestreo o al
da siguiente. Las muestras fueron sembradas en agar 110 estafilococos, agar sangre con
azida y agar Mc Conkey. Enseguida, las placas de agar fueron incubadas a 37C y
examinadas despus de 24 y 48 horas. Los aislamientos fueron identificados a travs de
su morfologa colonial, la tincin de Gram, la prueba de catalasa, la prueba de coagulasa,
as como la prueba de manitol y gelatina. A los aislamientos de agar Mc Conkey, se les
realizaron las pruebas bioqumicas correspondientes para su identificacin. Las pruebas
utilizadas fueron: Urea, Citrato, Prueba SIM (sulfuro indol motilidad), Agar-hierro-triple
azcar por sus siglas en ingles TSI, Medio MRPV (Rojo de metilo Voges-Proskauer).
Resultados y discusin
Se recolectaron 51 muestras del bote de recepcin de igual nmero de hatos caprinos
lecheros, de los cuales se aislaron un total de 102 cepas bacterianas (100%). De estas,
48 (47.06%) corresponden a patgenos Gram-positivos mientras que 54 (52.94%) a
patgenos Gram-negativos (Cuadro 1).

Cuadro 1. Agentes patgenos aislados de muestras de leche del contenedor de recepcin


del ganado caprino del municipio de Yurcuaro, Michoacn.
Microorganismos No. % Microorganismos No. %
Gram-positivos Gram-negativos
___________________________________________________________________________________________________

Estafilococos Coagulasa Positivos Enterobacter aerogenes 7 6.86


Citrobacter intermedius 2 1.97
Staphylococcus aureus 31 30.40 Acinetobacter spp 1 .98
Serratia liquefaciens 4 3.92
Estafilococos Coagulasa Negativos Alcaligenes faecalis 17 16.67
Citrobacter fecalis 10 9.80
Staphylococcus epidermidis 6 5.88 Citrobacter diversus 1 .98
Staphylococcus hyicus 11 10.78 Enterobacter cloacae 12 11.76

48 47.06 54 52.94
_______________________________________________________________________________

En los resultados del anlisis bacteriolgico de las muestras de leche obtenidas en este
estudio (Cuadro 1), se identificaron a los estafilococos como los principales agentes
etiolgicos Gram-positivos causantes de mastitis, entre los que destaca el S. aureus como

135
Investigaciones en Ciencia e Inocuidad de Alimentos

principal agente causal en 31 aislamientos, equivalente al 30.40%, as como a los


Estafilococos Coagulasa Negativos cuyo agente patgeno principalmente encontrado fue
el Staphylococcus hyicus con 11 aislamientos representando un 10.78%, estos resultados
se encuentran por arriba de lo encontrado en una investigacin realizada por (8), quienes
obtuvieron 12 aislamientos, equivalente al 11.5% de S. aureus y 46 aislamientos
equivalentes a 44% de Estafilococos Coagulasa Negativos, muy por encima de lo
encontrado en este trabajo (16.66%). Sin embargo, coincide con lo reportado por (9), el
cual identific tambin a los estafilococos (S. aureus y ECN) como los principales agentes
patgenos encontrados en su investigacin (34.43% S. aureus y 13.11% de ECN).
Dichos resultados coinciden con lo encontrado por (10,11 y 2), los cuales reportaron al S.
aureus y a los Estafilococos Coagulasa Negativos (ECN) como los principales agentes
etiolgicos causantes de mastitis tanto subclnica como clnica, en bovinos y caprinos.
Bergonier et al. (4), afirman que los Estafilococos son los principales agentes causales de
infeccin intramamaria en pequeos rumiantes, y que la especie ms aislada en casos de
mastitis clnica es el S. aureus, mientras que en los casos de mastitis subclnica son los
ECN. En Venezuela se han encontrado resultados similares a estos en cuanto a los
principales agentes causantes de mastitis en cabras (12).
S. aureus ha sido reconocido en el pas como el principal agente etiolgico involucrado en
casos de intoxicaciones alimentarias, producidas por consumo de queso elaborado a
partir de leche bovina cruda. Puede producir hasta 5 enterotoxinas reconocidas
serolgicamente (A-E), siendo la A la ms involucrada en intoxicaciones. Las cepas de S.
aureus son destruidas por la pasteurizacin y la coccin, pero la enterotoxina A es
destruida solo parcialmente a 100C por 30 minutos, y puede sobrevivir a cortas y largas
cocciones (13).
La presencia de bacterias causantes de infeccin intramamaria, y la consecuente
produccin de mastitis en cabras, puede inducir cambios importantes en la composicin
de la leche, alterando su aptitud para la coagulacin en el proceso de elaboracin de
queso, disminuyendo el rendimiento del mismo. Adems de provocar un impacto negativo
en su calidad microbiolgica, por lo que algunos estafilococos pueden ser patgenos para
el hombre. Aunado a esto, se ha reconocido que puede inducir prdidas de 15 a 20% en
la produccin de leche diaria por cabra. Aspectos que reflejan la importancia de controlar
la presencia de bacterias causantes de infeccin intramamaria en el rebao caprino (13).
Los ECN son reconocidos como oportunistas por el incremento de su predominio
provocado por la disminucin de prcticas de higiene. Aunque son menos patgenos que
el S. aureus tambin pueden provocar mastitis subclnica persistente y hasta mastitis
clnica, as como producir enterotoxinas termoestables. Las principales especies de ECN
que causan la infeccin intramamaria en cabras residen en la piel de la ubre y pezn, por
lo que la limpieza apropiada de los pezones podra disminuir la incidencia. Tambin se
reconoce que una dieta balanceada mejora la resistencia de las cabras a las infecciones
intramamarias y a la aparicin de mastitis (13).
Por otra parte, como se puede observar en el cuadro 1, los agentes etiolgicos Gram-
negativos causantes de mastitis encontrados en este estudio, fueron los siguientes:
Alcaligenes faecalis (14.75%), Enterobacter cloacae (11.76%), Citrobacter faecalis
(9.80%), Enterobacter aerogenes (6.86%), Serratia liquefaciens (3.92%), Citrobacter
intermedius (1.97%), Citrobacter diversus (0.98%) y Acinetobacter spp (0.98%). En
comparacin con el trabajo de (14), en el cul tambin se identific el agente Alcaligenes
faecalis si bien en poco porcentaje, cabe resaltar su prevalencia ya que es el nico que se
identific en dicho trabajo en distintos municipios.
La presencia de este tipo de patgenos constituye una evidencia del inadecuado manejo
higinico sanitario del producto, adems de ser indicativo de la probable presencia de
cepas patgenas

136
Investigaciones en Ciencia e Inocuidad de Alimentos

Finalmente cabe mencionar que en un estudio realizado por (15), stos afirman que el
origen de la infeccin intramamaria en cabras ha sido estudiado muy poco, pero es
comnmente reconocido que muchas de las infecciones bacterianas ocurren durante el
ordeo, asimismo, por lo que la aplicacin de un tratamiento preventivo durante el perodo
seco debera ser considerado como una medida eficaz para reducir el nmero de
infecciones intramamarias.

Conclusin
Se concluye que el Staphylococcus aureus, fue el principal agente patgeno encontrado
en las muestras de leche del bote de recepcin del ganado caprino del municipio de
Yurecuaro, Michoacn, seguido por los Estafilococos Coagulasa Negativos
(Staphylococcus hyicus y Staphylococcus epidermidis), as como los agentes patgenos
Gram negativos, dentro de los cuales destacan principalmente Alcaligenes faecalis,
Enterobacter cloacae, Citrobacter faecalis, Enterobacter aerogenes

Bibliografa
1. Aires, de S.M., Parente, C.E.S.R., Vieira, da M.O, Bonna, I.C.F., Silva D.A., Lencastre,
H. 2007. Characterization of Staphylococcus aureus Isolates from Buffalo, Bovine, Ovine,
and Caprine Milk Samples Collected in Rio de Janeiro State, Brazil. Applied and
environmental microbiology. 73(12): 3845-3849.
2. Sticotti E.E, Giraudo, J.A., Maci, M.N., Brgamo, E.G., Schneider, M.O., Magnano,
G.G., Macias, A. 2013. Agentes Bacterianos Presentes en Leche de Cabras con Mastitis
Clnicas en Sistemas de Cra Extensivos. Bacterial agents present at goats milk mastitic
clinics in extensive farming systems. Primer Congreso Caprino. Universidad Nacional de
Ro Cuarto. Facultad de Agronoma y Veterinaria. Grupo Sanidad en Rumiantes.
3. Bedolla, C.C., Castaeda, H., Velzquez, V., Castaeda, M., Bedolla, E., Kloppert, B.,
Wolter, Wilfried. 2015. La Mastitis Caprina. Talleres grficos de Groppe Libros.
Guadalajara, Mxico. 93 pp.
4. Bergonier, D. 2003. Mastitis of dairy small ruminants. Vet. Res. pp 34(5): 689 716.
5. Zecconi, A., Cesaris, L., Liandris, E., Dapra, V., Piccinini, R. 2006. Role of several
Staphylococcus aureus virulence factors on the inflammatory response in bovine
mammary gland. Microbial Phatogenesis. pp. 1-7.
6. INEGI. (Instituto Nacional de Estadstica Geogrfica e Informtica). 2002. Anuario
Estadstico del Estado de Michoacn. Censo General de Poblacin y Vivienda.
7. Wolter, W., Castaeda, H., Kloppert, B., Zschck, M. 2004. Mastitis bovina. Prevencin
diagnstico y tratamiento. Editorial Universitaria. Universidad de Guadalajara. Mxico. 146
pp.
8. Ferrer, O., Real, F., Acosta, B. 1993. Estudio de la Mastitis Clnicas en la cabra y
sensibilidad IN VITRO de los organismos aislados. Departamento de Patologa Animal.
Universidad de las Palmas de Gran Canaria.
9. Villar M.J. 2015. Patgenos de la ubre aislados de leche de cabras del municipio de
Tanhuato Michoacn. Tesis de Licenciatura. Facultad de Medicina Veterinaria y
Zootecnia. Universidad Michoacana de San Nicols de Hidalgo. Morelia, Michoacn.
10. Bedolla, G.E.A. 2011. Resistencia antibitica de Staphylococcus aureus aislados de
leche de vacas con mastitis de Tjaro, Michoacn. Tesis de Licenciatura. Facultad de
Medicina Veterinaria y Zootecnia. Universidad Michoacana de San Nicols de Hidalgo.
Morelia, Michoacn.

137
Investigaciones en Ciencia e Inocuidad de Alimentos

Determinacin de la calidad de la leche del ganado bovino de Campo


Hermoso Municipio de Maravatio Michoacn
1 1 1 1
Bedolla Cedeo, C. , Meja Alfaro, R. , Lucio Domnguez, R. , Cruz Hernndez, A. R. , Garca
1 1 2 3
Cedeo, E. , Bedolla Garca, J.C. , Castaeda Vzquez, H. , Cordova Izquierdo, A.
1
Facultad de Medicina Veterinaria y Zootecnia. Universidad Michoacana de San Nicols de
2
Hidalgo. Centro Universitario de Ciencias Biolgicas y Agropecuarias. Universidad de Guadalajara.
3
Universidad Autnoma Metropolitana-Xochimilco.

Palabras claves: Agentes patgenos | leche | Pruebas bacteriolgicas| componentes fisicoqumicos.

Introduccin
La leche es un alimento primordial segregado por las glndulas mamarias de los mamferos
con la finalidad de nutrir las cras en su primera fase de vida. Pero para que la leche cumpla
con esas expectativas nutricionales debe reunir una serie de requisitos que definen su
calidad: su composicin fisicoqumica, cualidades organolpticas y nmero de
microorganismos presentes (1, 2).
La calidad de la leche significa, para el consumidor productos de buena calidad y, de buena
presentacin y para el ganadero mayor produccin al tener su hato sano y por lo tanto,
mayores ingresos por venta de la leche (3).
La composicin de la leche vara con la especie, raza, tipo de alimentacin, estado sanitario
y fisiolgico del animal, poca del ao y el nmero de ordeos. En la composicin de la
leche, encontramos protenas, lactosa, grasas, vitaminas, minerales y enzimas (4).
El ltimo factor que influye en la calidad qumica de la leche es su composicin. La
composicin es importante porque influye en el rendimiento de los diversos productos
lcteos (5)
El aumento de microorganismos contaminantes, representa grandes prdidas en las
ganaderas lecheras; en consecuencia, la proliferacin de microorganismos en la glndula
mamaria de las vacas es la causa de la presentacin de mastitis y, por tanto, de la
disminucin en la calidad de la leche producida, que se refleja en los beneficios econmicos
en cuanto a bonificaciones o penalizaciones para el productor.
La calidad de la leche es afectada cuando no se llevan los estndares de higiene
determinados, por las malas prcticas durante el ordeo. La leche inoculada se puede
constituir en un vehculo de transmisin de enfermedades contagiosas de animales a
personas, causadas por los microorganismos patgenos o sus toxinas, siendo las vacas o
los ganaderos, y personas que manipulen la leche, la fuente de contaminacin ms
importante (6).
Debido a la gran importancia de la leche como elemento nutricional, las autoridades deben
ser exigentes en lo que respecta a su obtencin, composicin, pruebas de calidad y
procesamiento industrial, ya que su calidad es de vital inters para la salud pblica obligando
a una constante atencin y control de estos aspectos.
E objetivo del presente estudio fue determinar la calidad de la leche a travs del anlisis
fisicoqumico y microbiolgico en el ganado lechero de la comunidad de Campo Hermoso
municipio de Maravato, Michoacn.

Metodologa

138
Investigaciones en Ciencia e Inocuidad de Alimentos

El presente estudio se realiz durante los meses de mayo y junio de 2016, en el municipio
de Maravato, Michoacn, el cual se localiza al noreste del estado, en las coordenadas
1954 de latitud norte y 10027 de longitud oeste, a una altura de 2,020 metros sobre el
nivel del mar. Su clima es templado con lluvias en verano, tiene una precipitacin pluvial
anual de 897.7 milmetros y temperaturas que oscilan de 14.1 a 29.9C (7).
Se analizaron 53 muestras homogneas de leche, extradas de los botes de recepcin de
53 hatos lecheros con un promedio de 6 vacas por unidad de produccin. Utilizando para
ello tubos de ensayo esterilizados con tapn hermtico en los cuales previamente se
anot la identificacin necesaria del hato. El tubo de ensayo se coloc inclinado para
evitar la contaminacin del mismo. La toma de muestra se hizo directamente de los
tanques de almacenamiento de leche. El tubo de muestra fue llenado con
aproximadamente 15 ml de la muestra con la ayuda de un cucharon de aluminio que fue
previamente esterilizado, previo a la toma de muestra en cada hato, los tubos con la
muestra se colocaron en una gradilla dentro de una hielera cerrada, aproximadamente a
4C, para posteriormente trasportar la muestras al taller de lcteos y laboratorio de
bacteriologa de la USAD de la Facultad de Medicina Veterinaria y Zootecnia de la
Universidad Michoacana de San Nicols de Hidalgo para su procesamiento al da
siguiente (8).

Procesamiento de muestras y aislamiento de patgenos


El procesamiento de las muestras de leche obtenidas se realiz al da siguiente. Para
determinar la calidad de leche se realizaron pruebas mediante el aparato de lactoscan, el
cual mide las propiedades fisicoqumicas de la leche (grasa, slidos no grasos, densidad,
lactosa, slidos totales, protenas, agua adicional en %) en el taller de lcteos.
Para la identificacin de agentes patgenos en la leche, las muestras fueron sembradas
en agar 110, agar sangre, y agar Mc Conkey. Enseguida las cajas de agar fueron
incubadas a 37C y examinadas despus de 24 a 48 hrs. Los aislamientos de las
bacterias Gram-positivas fueron identificados a travs de su morfologa colonial, la tincin
de Gram, la prueba de catalasa, coagulasa, manitol, gelatina. A los aislamientos de agar
McConkey, se les realizaron las pruebas bioqumicas correspondientes para su
identificacin de bacterias Gam-negativas. Las pruebas utilizadas fueron TSI, urea, citrato,
zinc, y gelatina.

Resultados y discusin
En el presente trabajo se analizaron un total de 53 muestras de leche obtenida del mismo
nmero de unidades de produccin en la comunidad de Campo Hermoso, en el municipio
de Maravato, Michoacn. El muestreo se realiz al azar, considerando la disposicin de
los propietarios en cuanto a la colaboracin para el muestreo.

Anlisis Fisicoqumico a travs del Aparato de Lactoscan Se analizaron los siguientes


componentes: grasa, slidos no grasos, lactosa, slidos totales y protenas. Para los
cuales, los resultados obtenidos fueron representados en unidades porcentuales (Tabla
1).

Grasa. Se encontr que el contenido de grasa entre las diferentes muestras fue en
promedio de 3.41%, con una mnima de 2.61% y un mximo de 4.98%.
Slidos no grasos. Se encontraron en un valor mnimo de 7.53% y un mximo de 9.62%,
con un promedio de 8.85%.
Lactosa. El contenido de lactosa se encontr en un promedio de 4.95%, con un mnimo
4.23% y un mximo de 5.38%.

139
Investigaciones en Ciencia e Inocuidad de Alimentos

Slidos Totales. Los slidos totales por su parte, se encontraron con un promedio de
0.68%, con un mnima de 0.59% y un valor mximo de 0.59%.
Protenas. El contenido de protenas se obtuvo en un promedio de 0.68%, con un mnimo
de 0.59% y un mximo de 0.75%.

Tabla 1. Promedios de cada uno de los componentes de la leche, obtenidos por la


prueba de lactoscan.

Componente % Grasa % Slidos No % Lactosa % Protenas


Grasos
Promedio 3.41 8.85 4.95 3.23

Anlisis Microbiolgico
En cuanto al anlisis microbiolgico, se recolectaron 53 muestras de leche del bote de
recepcin de igual nmero de hatos bovinos lecheros, de los cuales se aislaron 73 cepas
bacterianas (100%). De estas, 49 (67.12%) correspondieron a patgenos Gram-positivos,
mientras 24 (32.90%) a patgenos Gram-negativos (Tabla 2).
Tabla 2. Agentes patgenos aislados de muestras de leche del bote de recepcin
del ganado bovino de la comunidad de Campo Hermosos municipio de Maravato,
Michoacn.
Microorganismos Gram positivo Frecuencia % Microorganismos Gram Negativo Frecuencia %
Citrobacter intermedius 3 4.11
Estafilococos Coagulasa Negativos Alcaligenes fecalis 7 9.59
Staphylococcus epidermidis 1 1.37 Enterobacter Cloacae 1 1.37
Staphylococcus hycus 6 8.22 Serratia Liquefaciens 4 5.48
Estafilococos Coagulasa Positivos Edwarssella tarda 2 2.74
Staphylococcus aureus 42 57.53 Enterobacter aerogenes 5 6.85
Moraxella 2 2.74
Total 49 67.12 24 32.88

Los resultados de los anlisis fisicoqumicos de las muestras de leche obtenidas en este
estudio (Tabla 1), fueron comparados con los valores establecidos por (9), quienes
establecieron los siguientes promedios en las propiedades fisicoqumicas de la leche:
grasa (3.4%), slidos no grasos (8.86%), lactosa (4.87%) y protenas (3.32%).
En este estudio se encontr que el promedio de grasa fue de (3.41%) donde se obtuvo un
(50.94 %) de muestras por debajo del porcentaje normal de grasa y un (49.06 %) se
encuentra dentro del porcentaje normal, slidos no grasos con un promedio de (8.85%)
donde un porcentaje de (41.50%) de muestras se encontr por debajo del valor normal y
un (58.49%) se encontr dentro de los parmetro normal de solidos no grasos, Lactosa
con un promedio de (4.95%) de estas muestras un (39.62%) est por debajo de los
valores establecidos y un (60.38%) de las muestras estn dentro de los valores normales
de lactosa, protenas con un promedio de (3.23%) del total de las muestras un (37.74%)
se encuentra fuera del promedio normal y un (62.26%) se apega a los valores normales
de protenas.
Uno de los principales factores que intervienen en la calidad del producto final es la
composicin de las materias primas utilizadas, por lo que es de vital importancia llevar a
cabo un control eficiente, el cual asegura que la leche cruda rena los requisitos para ser
considerada leche de calidad (10).

140
Investigaciones en Ciencia e Inocuidad de Alimentos

Con estos resultados se puede afirmar que la leche analizada est dentro de los criterios
que manejan los diferentes autores para considerarla como una leche de calidad apta
para la elaboracin de sus derivados y el consumo humano.
En los resultados de los anlisis bacteriolgicos de las muestras de leche obtenidas en
este estudio (tabla 2), se identificaron a los estafilococos como los principales agentes
etiolgicos Gram-positivos, entre los cuales destaca el Staphylococcus aureus como el
principal agente presente en 42 aislamientos equivalente al 57.53%, as como a los
agentes patgenos Gram-negativos, cuyos agentes patgenos principalmente
encontrados fueron Alcaligenes fecalis, con 7 aislamientos representando un 9.59%.
Dichos resultados coinciden con lo planteado por (11), los cuales report que el
Staphylococcus aureus son los principales agentes patgenos encontrados en la leche.
Tambin dichos resultados coinciden con lo planteado por (12) quienes en su estudio
encontraron una mayor frecuencia de Staphylococcus aureus.
EL Staphylococcus aureus ha sido reconocido en el pas como el principal agente
etiolgico involucrado en casos de intoxicaciones alimentarias producidas por el consumo
de queso elaborado a partir de leche bovina cruda (13).

Conclusin
De acuerdo al anlisis fisicoqumico se concluye que la leche de Campo Hermoso,
municipio de Maravato, Michoacn es de buena calidad ya que se apega a los rangos
establecidos por distintos autores, para ser considerada como leche de calidad. Por otra
parte, de acuerdo a los resultados bacteriolgicos el patgeno que predomino fue el
Staphylococcus aureus, el cual es el principal causante de enfermedades en ganado
bovino lechero.

Bibliografa
1. Sarn, A. y Chaffer, M. 2000. Mastitis y Calidad de la leche. Edit. Inter-medica. Buenos
Aires, Argentina. 196 pp.
2. Tapia, C. M. J. 2010. Determinacin de la calidad de la leche de bote de depsito de los
hatos lecheros del municipio de Tarmbaro, Michoacn (Tesis de licenciatura). Facultad de
Medicina Veterinaria y Zootecnia. Universidad Michoacana de San Nicols de Hidalgo.
Morelia, Michoacn.
3. Hernndez, R. J. M. y Bedolla, C. J. L. C. 2008. Importancia del conteo de clulas
somticas en la calidad de la leche. Redvet. Revista electrnica de Veterinaria. Vol. IX, N
8. Agosto.
4. Zavala Pope Jos Mauricio. 2005. Aspectos Nutricionales y Tecnolgicos de la leche.
Direccion General de Promocin Agraria.
5. Tornadijo M. E., Marra A. I., Garca Frontn M. C., Prieto B., Caraballo J. 1998. La
calidad de la leche destinada a la fabricacin de queso. Calidad y Tecnologa Alimentaria.
Vol.2 No. 2. Mxico. pp. 79 91.
6. Gonzlez, R. 2001. Los riesgos microbiolgicos. Consulta diciembre de 2016.
Disponible en.http://www.monografias.com/trabajos53/leche-cubana/leche-2.shtml
7. INEGI. (Instituto Nacional de Estadstica Geogrfica e Informtica). 2002. Anuario
Estadstico del Estado de Michoacn. Censo General de Poblacin y Vivienda
8. Wolter, W., Castaeda, H., Kloppert, B., Zschck, M. 2004. Mastitis bovina. Prevencin
diagnstico y tratamiento. Editorial Universitaria. Universidad de Guadalajara. Mxico. 146
pp.

141
Investigaciones en Ciencia e Inocuidad de Alimentos

Mejoramiento de la calidad sanitaria de conchas de abanico (Argopecten


purpuratus) a travs del efecto combinado de cido lctico y nisina
1 2 3 1
Ramos Gorbea, J.C. , Silva Jaimes, M.I. , Ramos Guerrero, F.G. , y Agurto Senz, T.
1
Instituto de Control y Certificacin de la Calidad e Inocuidad Alimentaria ICCCIA URP,
Universidad Ricardo Palma. Av. Benavides 5440, Lima 33, Per. (carlos.ramosg@urp.pe)
2
Departamento de Ingeniera de Alimentos y Productos Agropecuarios, Facultad de Industrias
Alimentarias, Universidad Nacional Agraria La Molina. Av. La Molina s/n, Lima 12. Per.
3
Centro Latinoamericano de Enseanza e Investigacin de Bacteriologa Alimentaria (CLEIBA),
Facultad de Farmacia y Bioqumica, Universidad Nacional Mayor de San Marcos. Jirn Puno 1002,
Lima 1. Per.

Palabras clave: Conchas de abanico, cido lctico, nisina

Introduccin
Las conchas de abanico (Argopecten purpuratus) son productos de origen marino
pertenecientes a la categora de moluscos bivalvos que habitan en las zonas costeras del
Per, siendo extradas principalmente en las bahas de Sechura (Piura), Paracas (Ica) y
en Ancash. Estos productos son de gran importancia en el comercio exterior y en la
gastronoma peruana, siendo un ingrediente clave en platos tpicos marinos como el arroz
con mariscos, cebiche mixto y parihuela. Actualmente son comercializados en terminales
pesqueros y en mercados bajo congelacin, pudiendo degradarse muy rpidamente sino
se respetan estas condiciones.
La necesidad de ofrecer alimentos mnimamente procesados y el creciente rechazo de los
consumidores hacia el uso de aditivos han llevado a la industria a reconsiderar el uso de
cidos orgnicos y bacteriocinas, tal como la nisina, como una nueva estrategia de
biopreservacin alimentaria. Nisina, es un pptido antimicrobiano de amplio espectro
producido por Lactococcus lactis, perteneciente a la clase de lantibiticos y que
actualmente es usado en la preservacin de alimentos tales como productos lcteos,
cereales, productos de panadera, carnes y derivados, principalmente contra bacterias
patgenas (5). El cido lctico es un cido orgnico producido a travs de la fermentacin
lctica y es usado comnmente en la preservacin de carnes, frutas y vegetales. La
capacidad inhibitoria de este cido radica en la reduccin del pH a niveles por debajo de
los cuales las bacterias no pueden iniciar su crecimiento (4). Actualmente la nisina y el
cido lctico se encuentran dentro de la categora de sustancias GRAS (generalmente
reconocidos como seguros) por lo que podran ser usados en el control de la microflora
bacteriana en las conchas abanico.
Con la finalidad de mejorar la calidad sanitaria de las conchas de abanico que son
comercializadas en Lima (Per), el objetivo del presente trabajo fue evaluar el efecto
combinado del cido lctico y la nisina sobre la carga de aerobios mesfilos, coliformes
totales y Staphylococcus sp., presentes en conchas de abanico.

Metodologa
Las muestras de conchas de abanico frescas, desvalvadas y lavadas fueron obtenidas en
el terminal pesquero de Villa Mara del Triunfo (Lima), las cuales fueron extradas en la
Baha de Paracas (Ica). Inmediatamente despus del muestreo, las muestras fueron
transportadas en condiciones de refrigeracin hacia el Laboratorio de Microbiologa de la
Facultad de Ciencias Biolgicas de la Universidad Ricardo Palma, para su posterior
anlisis microbiolgico.
Las conchas de abanico se distribuyeron y enfrentaron a 3 soluciones conservadoras
mixtas de cido lctico y nisina: 0.5, 1.0 y 1.5 % durante 4 tiempos: 0, 24, 48 y 72 horas
de contacto, a una temperatura de almacenamiento de 6 + 1 C. Cada solucin fue

142
Investigaciones en Ciencia e Inocuidad de Alimentos

preparada en ratio de 1:1 en referencia a la concentracin de cido lctico y nisina, a


partir de cido Lctico (Montana) y NISAPLIN (Danisco). Adicionalmente se incorpor
una muestra control (0.0 % de concentracin mixta de cido lctico y nisina) en todos los
tratamientos. Durante el tiempo que duraron los tratamientos, las conchas de abanico
permanecieron sumergidas en la solucin conservadora o agua peptonada al 0.1 %
(control), segn sea el caso.
Los anlisis microbiolgicos fueron llevados a cabo por triplicado en cada una de las
concentraciones y tiempos evaluados, incluyendo las muestras control. Para la
cuantificacin de aerobios mesfilos, coliformes totales y Staphylococcus sp. se usaron
los mtodos 990.12, 991.14 y 2003.11 de la AOAC International (1,2,3), usando placas
Petrifilm y agua peptonada al 0.1 % como solucin diluyente. Los resultados de los
conteos microbiolgicos fueron transformados a Log10, y los promedios obtenidos entre
rplicas fueron graficados a travs del tiempo en cada tratamiento, usando el software

Minitab 16 .

Resultados y discusin
La carga microbiolgica de aerobios mesfilos (AM) se vio influenciada por la
concentracin de cido lctico y nisina (Fig. 1A). Las soluciones conservadoras a 0.5, 1.0
y 1.5 % de concentracin disminuyeron la carga de AM durante las primeras 48 horas de
contacto, alcanzado reducciones de 0.80, 1.40 y 1.66 Log UFC/g respectivamente. Sin
embargo, las soluciones no fueron efectivas a la hora 72, debido a que se registraron
aumentos de carga microbiolgica en todos los tratamientos evaluados. Aunque los
valores aumentaron en la hora 72, ninguno de ellos logr alcanzar el valor de la muestra
control (6.34 Log UFC/g), permaneciendo por debajo. Diferencias significativas de 0.92,
1.27 y 1.64 Log UFC/g en la carga de AM respecto al valor control se evidenciaron a la
hora 72 para las concentraciones de 0.5, 1.0 y 1.5 %.

El mismo comportamiento se obtuvo cuando las conchas de abanico fueron enfrentadas a


soluciones de nisina (7), sin embargo en ese estudio las reducciones en la carga de AM
no fueron de significancia prctica, registrando reducciones solo de 0.20, 0.24 y 0.37 Log
UFC/g a concentraciones de 0.5, 1.0 y 1.5 % respectivamente. Esto demuestra que el
cido lctico mejora la eficiencia de la nisina en la reduccin de la carga microbiolgica de
AM, actuando sinergsticamente. Por otro lado, Ramos y col. (2016a) mostraron que
cuando las conchas de abanico fueron enfrentadas solo a soluciones de cido lctico
todas las concentraciones (0.5, 1.0 y 1.5 %) causaron una reduccin estadsticamente
significante en los conteos de AM, pero incrementaron a la hora 72 con excepcin de la
concentracin ms alta donde la inhibicin de la carga microbiolgica continu,
alcanzando una reduccin total de 1.76 Log UFC/g (6).

La combinacin de cido lctico y nisina tuvo un efecto ms pronunciado sobre los niveles
de AM que las soluciones individuales de ambos qumicos. Los conteos fueron reducidos
entre 0.98 1.22 Log UFC/g despus de 24 horas y entre 1.14 2.00 Log UFC/g despus
de 48 horas respecto al valor control. Esos cambios pueden ser explicados debido al dao
primario que ocasiona el cido lctico a la membrana celular de las bacterias a travs de
la disminucin en el pH, para posteriormente ocasionar un dao secundario (otra ruptura
en la membrana), debido a la accin de la nisina (4,5). El efecto observado a la hora 72
(aumento de la carga microbiolgica) puede deberse a la presencia de clulas resistentes
a la nisina y al cido lctico, las cuales crecen despus de que las clulas sensibles han
muerto. Los conteos en las muestras control (sin tratamientos) incrementaron alrededor
de solo 0.1 Log UFC/g entre las 48 y 72 horas, pero aumentaron en promedio desde
1824,000 a 2198,000 UFC/g, obteniendo una diferencia de 374,000 UFC/g, un

143
Investigaciones en Ciencia e Inocuidad de Alimentos

incremento del 20 %. En contraparte, el incremento obtenido en las muestras con


tratamiento entre las 48 y 72 horas de contacto, fue de 32,000 UFC/g (176 %) sobre un
conteo inicial de 18,200 UFC/g. Esto muestra que mientras la carga de AM se redujo
significativamente sobre las primeras 48 horas, la carga residual creci rpidamente.

7.0
A) C
T1
6.5 T2
T3
6.0
Log UFC/g

5.5

5.0

4.5

4.0
0 12 24 36 48 60 72
Hora

7
B) C
6 T1
T2
5 T3
Log UFC/g

0
0 12 24 36 48 60 72
Hora
Fig. 1. Comportamiento de las cargas microbiolgicas de aerobios mesfilos (A) y
coliformes totales (B) en conchas de abanico frente a concentraciones mixtas de cido
lctico y nisina (T1: 0.5 %, T2: 1.0 % y T3: 1.5 %). C representa la muestra control.

Los coliformes totales (CT) fueron muy sensibles frente a las soluciones conservadoras
mixtas de cido lctico y nisina a 1.0 y 1.5 %, siendo inactivados totalmente (< 10 UFC/g)
despus de las primeras 48 y 24 horas respectivamente (Fig. 1B). Aunque el conteo de
CT no se vio reducido significativamente durante el tiempo total (72 horas) que dur el
tratamiento con 0.5 %, el valor final fue menor que el valor de la muestra control en 0.95
Log UFC/g.

En un estudio realizado por Ramos y col. (2016b) se demostr que los CT en conchas de
abanico no fueron afectados significativamente por la nisina (concentraciones entre 0.5
1.5 %) durante las primeras 48 horas de tratamiento (7). Por otro lado, cuando las
conchas de abanico se enfrentaron a soluciones conservadoras de cido lctico, cuyas

144
Investigaciones en Ciencia e Inocuidad de Alimentos

concentraciones estaban entre 1.0 1.5 %, la carga de CT disminuy y se inactiv


totalmente (< 10 UFC/g) a las 48 horas (6). En ningn caso, ambas soluciones
individuales lograron inactivar el grupo de CT a las 24 horas de tratamiento, a diferencia
de la solucin mixta de cido lctico y nisina a 1.5 %.

Tabla 1. Conteos de Staphylococcus sp. en conchas de abanico frente a tres


concentraciones mixtas de cido lctico y nisina
Log UFC/g
Tiempo (horas) Control T1 T2 T3
0 4.52 4.46 4.46 4.46
24 5.13 ND ND ND
48 5.48 ND ND ND
72 5.67 ND ND ND
Donde T1, T2, y T3 son las concentraciones de la solucin conservadora a 0.5, 1.0 y 1.5
% de cido lctico y nisina. ND: no detectado (< 1UFC/g).

En todos los tratamientos con cido lctico y nisina los conteos viables de Staphylococcus
sp. no fueron detectados (< 1 UFC/g) desde las 24 horas de contacto (Tabla 1). Esto
tambin ocurri cuando las conchas de abanico fueron enfrentadas a soluciones de nisina
desde una concentracin mnima de 0.5 % (7) y soluciones de cido lctico con una
concentracin mnima de 1.0 % (6). Al ser tratadas las conchas de abanico con una
solucin de cido lctico al 0.5 % la carga bajo en 0.1 Log UFC/g durante las primeras 24
horas, siendo inactivados totalmente a partir de la hora 48 (6).

Conclusiones
El uso combinado de cido lctico y nisina mejora la calidad sanitaria de las conchas de
abanico (CA), pudiendo reducir y controlar la carga de aerobios mesfilos, coliformes
totales y Staphylococcus sp. durante su almacenamiento en refrigeracin (< 6 C). Ambos
productos, que actan sinergsticamente, podran ser incorporados en el hielo usado para
la conservacin de CA o ser aplicados directamente sobre las mismas por aspersin o por
inmersin.

Bibliografa
1. AOAC International. 2002. AOAC Official Method 990.12 Aerobic Plate Count in Foods. Dry
TM
Rehydratable Film (Petrifilm Aerobic Count Plate) Method.
2. AOAC International. 2002. AOAC Official Method 991.14 Coliform and Escherichia coli counts
TM TM TM
in foods. Dry Rehydratable Film (Petrifilm E. coli/ Coliform Count Plate and Petrifilm
TM
Coliform Count Plate ) Methods.
3. AOAC International. 2003. AOAC Official Method 2003.11 Enumeration of Staphylococcus
TM TM
aureus in selected meat, seafood, and poultry. 3M Petrifilm Staph Express Count Plate
Method.
4. Doores, S. 2005. Organic acids. pp. 91-142. In: Antimicrobials in Food. Davidson, P.M., J.N.
Sofos and A.L. Branen. Taylor & Francis Group, Boca Raton.
5. Norman Hansen, J. and W.E. Sandine. 1994. Nisin as a model food preservative. Crit. Rev.
Food Sci. Nutr. 34(1):69-93.
6. Ramos, J.C., M. Silva, F. Ramos y T. Agurto. 2016a. Uso de cido lctico para mejorar la
calidad sanitaria de las conchas de abanico (Argopecten purpuratus) comercializadas en Lima,
Per. Rev Vitae. 23(Supl.2): S116-S117.
7. Ramos, J.C., M. Silva, F. Ramos y T. Agurto. 2016b. Efecto de la nisina sobre la calidad
sanitaria de conchas de abanico (Argopecten purpuratus) extradas de la baha de Paracas,
Per. Rev Vitae. 23(Supl.2): S120-S121.

145
Investigaciones en Ciencia e Inocuidad de Alimentos

Cremas de aj de la casa listas para consumir y el monitoreo de su calidad


microbiolgica en los puntos de venta de Lima y Callao, Per
1,3 2 3 3
Ramos Guerrero, F.G. , Alba Luna, J.R. , Noa Barrientos, L.A. , Ramos Gorbea, J.C. , y Agurto
3
Senz, T .
1
Centro Latinoamericano de Enseanza e Investigacin de Bacteriologa Alimentaria (CLEIBA),
Facultad de Farmacia y Bioqumica, Universidad Nacional Mayor de San Marcos. Jirn Puno 1002,
Lima 1. Per (felix.ramos@unmsm.edu.pe)
2
Departamento Acadmico de Microbiologa y Parasitologa, Facultad de Ciencias Biolgicas,
Universidad Nacional Mayor de San Marcos. Av. Venezuela s/n cuadra 34, Lima 1, Per.
3
Instituto de Control y Certificacin de la Calidad e Inocuidad Alimentaria ICCCIA URP,
Universidad Ricardo Palma. Av. Benavides 5440, Lima 33, Per. (carlos.ramosg@urp.pe)

Palabras clave: Crema de aj de la casa, calidad microbiolgica, supermercados

Introduccin
Las cremas y salsas son un complemento importante en la gastronoma peruana, siendo
la combinacin perfecta con la mayora de platos tpicos en las diferentes regiones del
Per. Dentro de esa categora de alimentos se encuentra la crema de aj de la casa, una
crema muy particular en cuanto a sabor, olor y textura, que es muy consumida con papa o
choclo sancochado y siempre acompaa a un plato tpico del Per llamado el Pollo a la
Brasa (3). Ese producto listo para el consumo es vendido al peso en los supermercados,
y est compuesto principalmente de aj amarillo (Capsicum baccatum), cebolla roja, leche,
aceite vegetal, ajo (Allium sativum), huacatay (Tagetes minuta), mostaza, organo
(Origanum vulgare), pimienta, sal y puede contener realzadores del sabor como glutamato
monosdico, estabilizantes y conservantes como el sorbato de potasio. Su forma de
comercializacin dentro de los supermercados es en grandes bandejas, las cuales se
encuentran bajo refrigeracin pero expuestas al medio ambiente. Debido a que ese
producto se encuentra expuesto por mucho tiempo al ambiente no estril del
supermercado y est condicionado a la manipulacin del consumidor, que en muchos
casos no son las ms higinicas, puede no llegar adecuadamente al final de su vida til y
no cumplir con la legislacin peruana vigente para esta categora de productos en
trminos microbiolgicos. El objetivo de este trabajo fue evaluar la calidad microbiolgica
de las cremas de aj de la casa comercializadas en los supermercados de Lima y Callao
en Per, a travs del anlisis de aerobios mesfilos, coliformes totales, Staphylococcus
aureus, Escherichia coli y Salmonella spp. Estos anlisis servirn para establecer el
cumplimiento o no con los criterios microbiolgicos del punto XV.1. Alimentos preparados
sin tratamiento trmico (ensaladas crudas, mayonesas, salsa de papa a la huancana,
ocopa, aderezos, postres, jugos, yogurt de fabricacin casera, otros), alimentos
preparados que llevan ingredientes con y sin tratamiento trmico (ensaladas mixtas, palta
rellena, sndwich, cebiche, postres, refrescos, otros) de la R.M. N 591-2008/MINSA (5)
a la cual pertenece este producto.

Metodologa
Las muestras de crema de aj de la casa fueron tomadas en 20 supermercados ubicados
en la ciudad de Lima y Callao (Per) durante los meses de noviembre y diciembre de
2016. En cada supermercado se tom una muestra de 500 gramos bajo las condiciones
de un consumidor normal, siendo despus sellada en envases plsticos de primer uso y
transportada bajo refrigeracin hacia el laboratorio para su correspondiente anlisis. Los
distritos de Lima Metropolitana involucrados en el muestreo fueron: Lima Cercado, San
Miguel, Lince, San Borja, Surco, Brea, y Chorrillos, mientras que el distrito perteneciente
a la Provincia Constitucional del Callao elegido para el muestreo fue Bellavista.

146
Investigaciones en Ciencia e Inocuidad de Alimentos

Siguiendo los mtodos de la International Commission on Microbiological Specifications


for Foods (ICSMF, 1988) (4), las muestras fueron analizadas en duplicado para
determinar el conteo de aerobios mesfilos, coliformes totales, Escherichia coli y la
presencia/ausencia de Salmonella spp. en cremas de aj de la casa. El anlisis
microbiolgico de aerobios mesfilos fue determinado por la tcnica de incorporacin en
placa, mientras que los coliformes totales y E. coli fueron evaluados mediante la tcnica
del nmero ms probable (NMP). En el caso especfico de Salmonella spp., se detect la
presencia o ausencia de este microorganismo en 25 gramos de muestra. Por otro lado, el
recuento de Staphylococcus aureus fue realizado de acuerdo al mtodo AOAC 2003.07
(2006) (1), usando placas PetrifilmTM Staph Express.
Como complemento al anlisis microbiolgico, se realizaron mediciones de pH a 20 C en
las muestras usando un pH-metro Hanna Instruments modelo pH-211.
Los resultados de los conteos microbiolgicos fueron evaluados estadsticamente usando

Minitab 16 y Microsoft Excel , en donde tambin se generaron los grficos.

Resultados y discusin
El 100 % de las muestras de cremas de aj de la casa presentaron conteos de aerobios
mesfilos, mientras que slo el 5 y 20 % presentaron conteos de Staphylococcus aureus y
coliformes totales respectivamente (Fig. 1). Es importante resaltar que el conteo de
aerobios mesfilos es usado para obtener informacin general de la calidad sanitaria de
los productos, las prcticas de manufactura aplicadas, la calidad de las materias primas
usadas, la vida til y las condiciones de manipulacin (2), siendo ste ltimo de gran
importancia en este tipo de productos, ya que el consumidor final ejerce malas prcticas
durante la compra en el supermercado, dejando por ejemplo los cucharones fuera de las
bandejas, probando el producto con el utensilio de pesado, entre otros.

Salmonella spp.

Escherichia coli
Negativo
Positivo
Staphylococcus aureus

Coliformes totales

Aerobios mesfilos

0 20 40 60 80 100 %

Fig. 1. Porcentaje de muestras positivas y negativas en relacin a los microorganismos


evaluados en cremas de aj de la casa segn lo indicado en la R.M. N 591-2008/MINSA.

En relacin al grupo de aerobios mesfilos, de las 20 muestras evaluadas, 3 de ellas (15


%) presentaron conteos superiores a 5 Log UFC/g (Fig. 2). La R.M. 591-2008/MINSA (5)
contiene planes de muestreo microbiolgicos para diferentes grupos de alimentos que son
comercializados en Per. Las cremas de aj de la casa se encuentran dentro del grupo
XV.1. Alimentos preparados sin tratamiento trmico y alimentos preparados que llevan
ingredientes con y sin tratamiento trmico. Teniendo en cuenta lo anterior, el criterio

147
Investigaciones en Ciencia e Inocuidad de Alimentos

microbiolgico para esta categora de productos, indica que de 5 muestras evaluadas,


solo 2 de ellas podran estar entre 5 y 6 Log UFC/g, sin embargo y para fines de
fiscalizacin o vigilancia sanitaria la norma indica que el nmero de muestras considerado
a ser vlido es slo 1, usando el criterio microbiolgico ms exigente, en este caso el
valor de m = 5 Log UFC/g, por lo que cada una de las muestras se evalu de forma
individual, obteniendo 3 muestras que no cumplen con lo exigido por la autoridad sanitaria
por presentar valores de 5.01, 5.04 y 5.16 Log UFC/g.

Fig. 2. Valores de pH y conteos microbiolgicos (Log UFC/g) de aerobios mesfilos (AM)


obtenidos en muestras individuales de cremas de aj de la casa (M1 - M20)

Las cremas de aj de la casa, as como la mayora de salsas y cremas alimentarias, son


emulsiones de agua en aceite, donde el ajuste de pH en la fase acuosa es el factor ms
importante para inhibir el crecimiento de microorganismos patgenos (7,8). La Fig. 2,
muestra los valores individuales de pH para las cremas de aj de la casa evaluadas. En
promedio se obtuvo un valor de pH de 5.35 + 0.48, con un mnimo de 4.20 y un mximo
de 6.50. El 90 % de las muestras presentaron valores superiores a 4.5, generando un
medio donde es muy probable el crecimiento y la sobrevivencia de microorganismos
patgenos. Sin embargo, en ninguna de las muestras evaluadas se presentaron conteos
de E. coli ni presencia de Salmonella spp. (Fig. 1). La ausencia de estos microorganismos
patgenos es de suma importancia ya que asegura la inocuidad del producto en el punto
de consumo. La formulacin de la crema de aj de la casa contiene sorbato de potasio, el
cual podra inhibir el crecimiento de microorganismos, sin embargo su capacidad
bactericida es ms adecuada en muestras con un pH cido, no siendo el caso de las
muestras evaluadas, por lo que el aj amarillo, la cebolla, el ajo, el huacatay, la mostaza y
el organo podran estar ejerciendo un efecto antimicrobiano de manera individual o
combinado contra Salmonella spp. y E. coli.

Conteos entre 3 y 9.4 NMP/g se presentaron dentro del 20 % de muestras positivas para
coliformes totales (Tabla 1), en cuanto que en el 80 % restante no fueron detectadas (< 3
NMP/g), cumpliendo con el estndar de la R.M. 591-2008/MINSA (5). Un estudio similar
realizado en salsas a base de aj (tucupi con aj) tambin comercializados en
supermercados (Belm, Brasil), mostraron que el 6.67 % de las muestras evaluadas
estuvieron fuera del estndar regulado por la RDC 12 (02 de janeiro de 2001) para

148
Investigaciones en Ciencia e Inocuidad de Alimentos

coliformes a 35 y 44.5C, un resultado inesperado cuando compararon los resultados con


aquellos obtenidos en los mismos productos pero comercializados en ferias libres (6).

Tabla 1. Ratios y porcentajes de muestras de cremas de aj de la casa ubicados dentro de


intervalos especficos de acuerdo al conteo de coliformes totales y Staphylococcus aureus
Intervalo Muestras positivas
Microorganismo Desde Hasta Ratio %
Coliformes - < 3 NMP/g 16/20 80
totales 3 NMP/g 9.4 NMP/g 4/20 20
Staphylococcus - < 10 UFC/g 19/20 95
2
aureus 10 UFC/g 10 UFC/g 1/20 5
Donde NMP: Nmero ms probable y UFC: Unidades formadoras de colonias

De todas las muestras evaluadas solo 1 (5%) present conteo de Staphylococcus aureus,
con un valor de 102 UFC/g (Tabla 1). Esa muestra, por temas de vigilancia sanitaria,
queda fuera de los lmites permitidos (mximo 10 UFC/g) para esa categora de productos
de acuerdo a la R.M. N 591-2008/MINSA (5).

Conclusiones
Las condiciones actuales en la que se expenden las cremas de aj de la casa en los
supermercados de Lima y Callao influyen sobre su calidad microbiolgica, obteniendo
slo un 85 % de muestras conformes en cuanto a la carga permitida para aerobios
mesfilos y 95 % para Staphylococcus aureus, mientras que el 100 % de las muestras
cumplen respecto a las especificaciones para E. coli y Salmonella spp. de acuerdo a la
R.M. N 591-2008/MINSA. Modificaciones en el punto de venta deben ser realizadas, para
evitar la manipulacin directa del producto por parte de los consumidores.

Bibliografa
1. AOAC International. 2006. AOAC Official Method 2003.07 Enumeration of Staphylococcus
TM TM
aureus in selected types of processed and prepared foods. 3M Petrifilm Staph Express
Count Plate Method.
2. Da Silva, N., M.H. Taniwaki, V.C.A Junqueira, N.F. de A. Silveira, M. Da S. do Nascimento and
R.A.R. Gomes. 2013. Microbiological Examination Methods of Food and Water. A Laboratory
Manual. Taylor & Francis Group, London.
3. Instituto Nacional de Estadstica e Informtica (INEI). 2012. Per: Consumo per cpita de los
principales alimentos 2008 2009. INEI, Lima.
4. International Commission on Microbiological Specifications for Foods (ICMSF). 1988.
nd
Microorganisms in foods 1. Their significance and methods of enumeration. 2 ed. University of
Toronto Press, Toronto.
5. Ministerio de Salud del Per (MINSA). 2008. Resolucin Ministerial N 591-2008/MINSA
Aprueban Norma Sanitaria que establece los criterios microbiolgicos de calidad sanitaria e
inocuidad para los alimentos y bebidas de consumo humano.
6. Oliveira, S.P., L. do S.N. dos S. Brasil, S.M.R da Silva e D. do S.B. Brasil. 2009. Anlise
microbiolgica de molhos de pimenta (tucupi com pimenta) comercializados em redes de
supermercados e feiras livres na cidade de Belm, PA. Rev. Hig. Alim. 23(178/179): 154-158.
7. Sagdic, O., F. Tornuk, S. Karasu, M.Z. Durak, and M. Arici. 2017. Microbial ecology of
mayonnaise, margarine, and sauces. pp. 519-532. In: Quantitative Microbiology in Food
Processing: Modeling the Microbial Ecology. SantAna, A.S. John Wiley & Sons, Ltd.,
Chichester.
8. Sikora, M., N. Badrie, A.K Deisingh and S. Kowalski. 2008. Sauces and dressings: A review of
properties and applications. Crit. Rev. Food Sci. Nutr. 48(1):50-77.

149
Investigaciones en Ciencia e Inocuidad de Alimentos

Propuesta de un anlisis alternativo para determinar compuestos


nitrogenados en embutidos

Soto Lpez I., Solano Ramrez N., Cruz Hernndez M., Aguilar Carrasco L. ., Abrego Maldonado
J.A, Melndez Balbuena L., Lpez Olivares G., Castro Lino A.
1
Benemrita Universidad Autnoma de Puebla, Departamento de Qumica Inorgnica Ext 7376.
Avenida San Claudio No. 105H., Puebla, Puebla. C.P. 72540.
Email: issolo2015@yahoo.com

Palabras clave: nitratos, nitritos, cromforo.

Introduccin
La sal de nitrito se ha empleado como conservador alimentario especialmente en carnes
curadas. Es aadido en ocasiones junto con el nitrato, ya que este ltimo sirve como
reserva al ir transformndose lentamente en nitrito (1). Este trabajo presenta un mtodo
alternativo, basado en la formacin de un compuesto color rojo caracterstico formado
entre el ion cobalto (II) y el nitrgeno de iones como nitrito (NO-2) y nitrato (NO-3) de las
sales empleadas en el proceso de elaboracin de embutidos. Es un mtodo no indicativo
de estabilidad, pero muy favorable para la cuantificacin rpida y fiable del principio activo
del producto en proceso (2).

Se presenta un mtodo que pretende ser innovador, basndose en la formacin de un


complejo rojo-celeste entre cobalto (II) y la parte nitrogenada que en este caso seran los
iones nitrito y nitrato agregados como conservadores en carnes y embutidos, los cuales
son cuantificados por espectroscopia visible, donde se espera sea suficientemente exacto
y barato, y desde luego, apto para cuantificaciones inmediatas de monitoreo en el control
del proceso, principalmente para empresas que no disponen de grandes recursos(3).

El Co (II) forma compuestos de coordinacin con diferentes ligantes, mayoritariamente en


estructuras octadricas o tetradricas con una diferencia en la estabilidad entre estas tan
pequeas que incluso existe un equilibrio para el agua como ligante:

rojo celeste

El color de estos compuestos cambia con la coordinacin (y el tipo de disolvente); los


compuestos octadricos son de color rosado y los complejos tetradricos son de color
azul, estos cambios en las estructuras moleculares pueden observarse en espectroscopia
visible y por ende a simple vista (4).

De acuerdo a la norma NOM-213-SA1-2002 el contenido de nitritos es de 156 ppm en 1


Kg de carne (7), en 100 g de carne equivalen a 15.6 ppm o bien a 0.7176 mol/L, y de la
norma NMX-F-097-S-1978 (8). Determinacin de nitritos en embutidos, cuyo fundamento
se basa que el mtodo de prueba que genere una reaccin colorida entre los nitritos y el
colorante con un grupo funcional azo a un pH entre 2.0 y 2.5, por la copulacin del cido
sulfanlico diazoado con clorhidrato de naftilamina; donde se observa la utilizacin qumica

150
Investigaciones en Ciencia e Inocuidad de Alimentos

alternativa en la que solo sea necesario el uso de un espectrofotmetro UV-Visible y una


sal como CoCl2.

Entre los aditivos que constituyen txicos intencionales importantes, se encuentra el


conservador nitrito de sodio, que es prcticamente imprescindible para garantizar la
inocuidad microbiana, para dar buen aspecto y fijar el color caracterstico de los
ahumados y embutidos dando un sabor especial al producto (5, 6).

El uso de nitratos y nitritos como aditivos presenta incuestionablemente ciertos riesgos. El


primero es el de la toxicidad aguda. El nitrito es txico al ser capaz de unirse a la
hemoglobina de la sangre formndose metahemoglina (2).

Metodologa
Para la determinacin de nitritos se escogieron diferentes tipos de embutidos ha analizar,
evitando que estn prximos a caducar ya que esto podra interferir con el anlisis.

Preparacin de la muestra

Se cortan 100g de los diferentes embutidos en trozos pequeos y se agregan en


diferentes vasos de precipitados con 200 mL de agua aproximadamente. Esto con el fin
de que no flocule demasiado. Posteriormente se pesan 0.03g de Acetato de Mercurio y se
adicionan a los vasos de precipitados, con la finalidad de desproteinizar la muestra. Se
calienta con agitacin, empezando a ebullir se deja por 8 minutos. Despus se deja
reposar por un da, se filtra y se pasa a un embudo de separacin.

Preparacin de la curva de comparacin

Se realiza una curva de calibracin con diferentes soluciones patrn de nitrito de sodio a
0.0025M, 0.005M, 0.0075M y 0.01M. Tambin se prepara la solucin del cromforo
correspondiente: CoCl2.6H2O a una concentracin 1M. Posteriormente se toma 1 mL de
cada una de las soluciones preparadas de nitrito de sodio y a cada una se le agrega 0.2
mL de la solucin del cromforo. Enseguida se procede a realizar la lectura en el equipo.

Mtodo de anlisis

Una vez echa la separacin de fase de las muestras se toman alcuotas de


aproximadamente 1 mL, se agrega 0.2 mL de CoCl2.6H2O 1M dnde se observa un
cambio de coloracin que va de rosa a naranja que indica la presencia de nitritos o de
algn compuesto nitrado, si no presenta coloracin indica que no hay presencia. Se
contina con la medicin de la absorbancia mxima de cada muestra para conocer la
cantidad de nitritos a una longitud de onda de 520 nm.

Para determinar las concentraciones de nitritos de sodio que contiene cada una de las
muestras se toma en cuenta la ecuacin que se obtiene de la curva de comparacin,
tomando en cuenta la siguiente ecuacin.

Dnde:

151
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin

Curva de calibracin y concentraciones

Para la obtencin de la curva de calibracin, se tienen las siguientes absorbancias.

Concentracin Absorbancia
Molar (520 nm)
0.0025 0.004
0.005 0.013
0.0075 0.025
0.01 0.037
Tabla 1. Absorbancias obtenidas de las soluciones patrn utilizadas. .

Las concentraciones que resultaron del estudio en los diferentes embutidos se muestran
en las tablas siguientes.

Jamn Absorbancia Concentracin


(520 nm) ppm
1 0.039 0.006981982
2 0.038 0.006756757
3 0.018 0.002252252
4 0.027 0.004279279
5 0.031 0.00518018
Tabla 2. Concentraciones determinadas en anlisis de jamn

De acuerdo a los resultados obtenidos en la tabla 2, se observa que la marca de jamn


con mayor contenido de nitrito de sodio es la muestra 1, mientras que la de menor
concentracin es la muestra 3.

Concentracin
Salchicha Absorbancia
(520 nm) ppm
1 0.018 0.002252252
2 0.044 0.008108108
3 0.013 0.001126126
4 0.035 0.006081081
5 0.04 0.007207207
Tabla 3. Concentraciones determinadas en anlisis de Salchicha.

De acuerdo a los resultados en la tabla 3, se observa que la muestra de salchichas con


mayor concentracin de nitritos es la muestra 2, mientras que para la de menor
concentracin el estudio arroja que es la muestra 3.

152
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones

El mtodo usado nos da la ventaja por el uso de menos reactivos y de fcil acceso por lo
que se podra abaratar el costo, ya que aunque es utilizado el mtodo espectrofotomtrico
para el anlisis de nitritos, el usar el CoCl2 6H2O como cromforo nos ahorra tiempo de
trabajo.

En los resultados que se obtienen del anlisis nos muestra que no se excede el lmite
permitido de nitritos, sin embargo se detecta la presencia de dicha sustancia en los
embutidos estudiados.

Por esto, se puede sugerir que el mtodo espectrofotomtrico usado resulta adecuado
para la determinacin de micro y semimicro cantidades de nitritos.

Bibliografa

1. Almudena A., Lizaso J. (2001). Nitritos y Nitrosaminas. FUNDACIN IBRICA PARA LA


SEGURIDAD ALIMENTARIA.
2. Gmez S. J. A. (2013). Modelizacin de las cinticas de difusin de nitrato de sodio y nitrito
de sodio durante el salado de carne. Tesis Doctoral, Universidad Politcnica de Valencia.
Espaa.
3. Jacksyn P. (2006). Nitrosaminas y Riesgo de Cncer Gstrico. Tesis de Doctorado,
Instituto Cataln de Oncologa, Barcelona, Espaa.
4. Jakszyn P. y Gnzalez C. A. (2006). Las nitrosaminas y la ingesta de alimentos relacionada
y el riesgo de cncer gstrico y esofgico: una revisin sistemtica de la evidencia
epidemiolgica. WJG., 12: 4296: 303.
5. Loera G. R. (1985). Nitratos, Nitritos y Compuestos N.nitrosos. Metepec, Mxico. Ed. ECO,
p.276-303.
6. NMX-F-065-1984. ALIMENTOS. SALCHICHAS. ESPECIFICACIONES
7. NOM-213-SSA1-2002. Productos y servicios. Productos crnicos procesados.
Especificaciones sanitarias. Mtodos de prueba.
8. NOM-122-SSA1-1994. BIENES Y SERVICIOS. PRODUCTOS DE LA CARNE.
PRODUCTOS CARNICOS, CURADOS Y COCIDOS, Y CURADOS EMULSIONADOS Y
COCIDOS. ESPECIFICACIONES SANITARIAS.

153
Investigaciones en Ciencia e Inocuidad de Alimentos

Propiedades antioxidantes de una bebida de jamaica (Hibiscus sabdariffa L.)


y perejil (Petroselinum hortense)
1 1 1
Reyes-Mungua, A. , Hernndez Ramos S. , Carrillo Inungaray M. L.
1
Unidad Acadmica Multidisciplinaria Zona Huasteca, Universidad Autnoma de San Luis potos,
Romualdo del campo No. 501, Fracc. Rafael Curiel, Ciudad Valles, S.L.P. C.P. 79060, Mxico
E-mail: abigail.reyes@uaslp.mx

Palabras clave: Infusin, estrs oxidativo, polifenoles

Introduccin

En las ltimas dcadas, los consumidores han comenzado a ver sus dietas desde un
punto de vista radicalmente diferente, la comida ya no se considera simplemente como un
medio para satisfacer el hambre; sino que se ha convertido en el principal vehculo para
tener una salud ptima y de bienestar. En Mxico, durante los ltimos aos se ha
incrementado el consumo de hierbas aromticas y medicinales, tanto en la
condimentacin de alimentos como en forma de infusiones o bebidas con fines
teraputicos; recientemente han sido identificadas como valiosa fuente de diversos
fitoqumicos, en algunos casos actan como agentes antioxidantes neutralizando los
radicales libres [1].

El presente trabajo, se enfoca en el estudio de la capacidad antioxidante de dos plantas


aromticas; jamaica (Hibiscus sabdariffa) y perejil (Petroselinum hortense). En las flores
de jamaica (Hibiscus sabdariffa L) se han identificado una gran cantidad de compuestos
bioactivos como los fitoesteroles (que inhiben la absorcin intestinal de colesterol) tales
como el -sitoesterol y ergoesterol; flavonoides como el gosipetin hibiscetn y sus
respectivos glucsidos as como cido protocateico, todos ellos se caracterizan por
presentar actividad antioxidante [2]. Con los clices deshidratados de jamaica se preparan
infusiones a las que tradicionalmente se les han atribuido propiedades antipirticas;
antibacterianas; diurticas, entre otras; las cuales se han asociado a la presencia de
molculas con actividad antioxidante tales como polifenoles, quercetina, cido L-ascrbico
y antocianinas. Los extractos de jamaica exhiben efectos anticancergenos promoviendo
la apoptosis in vivo de clulas cancergenas en prstata y seno [3].

Por otro lado el perejil (Petroselinum hortense), es una hortaliza muy importante debido a
su valor nutricional, caracterizndose por tener un alto contenido de -caroteno, vitamina
C, tiamina, riboflavina, y vitamina E. Es empleado como diurtico, urolgico,
espasmoltico, carminativo, aperitivo, antisptico, expectorante, antirreumtico, sedante,
estimulante uterino, para combatir la halitosis entre otros.

Por lo anterior, este trabajo tuvo como objetivo desarrollar y evaluar las propiedades
antioxidantes de una infusin a base de flor de jamaica (Hibiscus sabdariffa L) y perejil
(Petroselinum hortense), as como evaluar la aceptacin y preferencia del consumidor.

154
Investigaciones en Ciencia e Inocuidad de Alimentos

Metodologa

Las flores de jamaica (Hibiscus sabdarifa L.) y las hojas de perejil (Petroselinum hortense)
se compraron en el mercado de Cd. Valles estado de San Luis Potos, Mxico. Se realiz
una seleccin de las hojas y tallos del perejil, excluyendo aquellas que presentaban color
amarillento. Las infusiones de Hibiscus sabdarifa L. y de Petroselinum hortense se
obtuvieron por extraccin slido-lquido usando agua purificada, el tiempo de extraccin
fue de 10 min a 90 C, posteriormente se filtraron con papel filtro whatman No.2.
Obtenindose tres formulaciones de extractos frescos: 124, 589, 785. Para muestras
deshidratadas se realizaron los extractos acuosos correspondientes a una infusin slido-
lquido usando una proporcin de polvo de jamaica y perejil 1:250 (p/v), a 90 C por 10
min, las infusiones se filtraron a travs de papel filtro Whatman No. 2, y se guardaron en
frascos color mbar, para su posterior anlisis. Se hicieron dos infusiones con muestras
deshidratadas 454 y 632 a distintas proporciones de jamaica y perejil.

Contenido de fenoles totales (Folin-Ciocalteau)

El anlisis se realiz conforme a la metodologa de Folin-Ciocalteau. La lectura se realiz


a una absorbancia de 740 nm (espectrofotmetro UV/visible de mono haz
ThermoScientificAquaMate Plus). Los resultados fueron expresados como
miliequivalentes de cido glico sobre litro (mEAG)/L y realizados por triplicado.

% de inhibicin de radicales libres (DPPH)

La actividad del extracto se midi de acuerdo con la metodologa descrita por Brand
Williams [4] a travs de la inhibicin del radical estable 2,2 difenil-1-pricrilhidracilo (DPPH)
a una longitud de onda de 515 nm. La mezcla se dej reaccionar en oscuridad y se
monitore el cambio en la absorbancia (espectrofotmetro UV/visible de mono haz
ThermoScientificAquaMate Plus).

Flavonoides

Fue realizado conforme a la metodologa de Wolfe [5]. Los datos de este anlisis fueron
expresados en meq. de catequina por litro de muestra, realizando por triplicado.

Antocianinas

Se determin conforme a la metodologa de Abdel-Aal y Hucl [6]. Se midi la absorbancia


a 535 nm frente a un blanco de reactivo el cianidina-3-glucosido usado como pigmento
estndar.

Vitamina C

La vitamina C fue cuantificada mediante el mtodo volumtrico del 2,6 dicloro indofenol.

155
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin

El contenido de humedad en las hojas perejil fue de 10.93 % (b.s.) y para flor de
jamaica fue de 12.74 % (b.s).

En la prueba de preferencia pareada se encontr que los panelistas prefieren la


infusin en fresco 124 e infusin deshidratada 454.

Los compuestos fenlicos como flavonoides y antocianinas, son sustancias


naturales en frutas, verduras, nueces, semillas, flores, y algunas bebidas de hierbas, son
una parte integral de la dieta humana. El pH que oscilo entre todas las bebidas fue de
3.35-3.48. El anlisis de resultados mostr un contenido de polifenoles, flavonoides,
antocianinas e inhibicin de radicales libres en las infusiones 124>589>785 (Tabla 1).
Colina et al. (2012)[7] reportan en una bebida de limn y panela (piloncillo) un contenido
de polifenoles que vara de 78126 mg EAG/L, mandarina 76101 mg EAG/L y durazno
8496 mg/ EAG/L; en este estudio se observ un contenido mayor en las infusiones 124 y
589, las dems estn por debajo de las reportadas por dichos autores. En esta
investigacin se obtuvo un contenido de antocianinas: infusin 124: 1036.38 mg/Kg;
infusin 589: 376.57 mg/Kg; infusin 785: 201.88 mg/Kg. Para vitamina C los resultados
fueron de la siguiente manera: infusin 454>632>124>589>785.
El anlisis de correlacin de la actividad antioxidante en extractos frescos y secos indic
que existe una asociacin directa entre polifenoles y la capacidad antioxidante, pues su
coeficiente de correlacin fue de R=0.95, lo que indica que la concentracin de polifenoles
en los extractos frescos y secos de jamaica y perejil a distintas combinaciones constituyen
una fuente importante de actividad antioxidante.

Tabla 1. Propiedades antioxidantes en extractos de jamaica (Hibiscus sabdariffa) y perejil


(Petroselinum hortense).

Polifenoles Flavonoides(m Antocianina % Inhibicin


(mg EAG/L g de catequina s (mg /Kg) radicales
Infusin
/ gr de libres
extracto)
Extracto Fresco
124 151.58 + 0.1 116.0 + 0.03 1036.38 + 78.51+ 0.08
0.08
589 129.83 + 0.01 111.15 + 0.01 376.57 + 72.03 + 0.1
0.01
785 48.67+ 0.1 95.63 + 0.01 201.88 + 48.00+ 0.03
0.02
Extracto seco
454 14.76 + 0.14 64.01 + 0.07 335.27 + 0.007 34.27 + 0.05
632 7.64 + 0.12 21.68 + 0.15 283.47 + 0.009 31.25 + 0.03

156
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones

Al comparar resultados con otros autores, se observa que utilizar una temperatura de
50C+ 5 para el secado de las hojas se obtiene un olor y color agradable, atractivo a la
vista y gusto del consumidor. De las infusiones en fresco la bebida 124 es la que contiene
valores ms altos de propiedades antioxidantes: vitamina C, polifenoles, flavonoides,
antocianinas; y la ms preferida por los panelistas. En extracto seco la infusin 454 es la
de mayor preferencia y la cual muestra una mejor capacidad antioxidante en cuanto a
cantidad de polifenoles, flavonoides, antocianinas, y vitamina C.

Bibliografa

1. Rodrguez J. L., Valds O. y Alemn A. (2006), Evaluacin de la actividad


antioxidante de cinco hierbas aromticas. Ciencia y Tecnologa de Alimentos.16
(1): 30-36.

2. Syago-Ayerdi, Sonia G, & Goi, Isabel. (2010). Hibiscus sabdariffa L: Fuente de


fibra antioxidante. Archivos Latinoamericanos de Nutricin, 60(1), 79-84.

3. Sumaya Martnez, Ma. Teresa; Medina Carrillo, Raquel E.; Machuca Snchez, Ma.
Luisa; Jimnez Ruiz, Edgar; Balois Morales, Rosendo; Snchez Herrera, Leticia
Mnica. (2014). Potencial de la jamaica (hibiscus sabdariffa l.) En la elaboracin
de alimentos funcionales con actividad antioxidante. Revista Mexicana de
Agronegocios, Jul-Dic, 1082-1088.

4. Brand-Williams, W., Cuvelier, M.E., & Berset, C. (1995). Use of a free radical
method to evaluate antioxidant activity. Lebensmittel Wissenschaft und
Technologie, 28, 2530.

5. Wolfe, K., X. Wu and R.H. Liu. 2003. Antioxidant activity of apple peels. J. Agric.
Food Chem., 51: 609-614.

6. Abdel-Aal ESM & Hucl, P. (1999). A rapid method for quantifying total anthocyanins
in blue aleurone and purple pericarp wheats. Cereal Chemistry 76:350-354.

7. Colina, J., Guerra, M., Guilarte, D., Alvarado, C. (2012). Contenido de polifenoles y
capacidad antioxidante de bebidas elaboradas con panela, Archivos
Latinoamericanos De Nutricin. 62 (3), 303- 310.

157
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto de la aplicacin de elicitores sobre el contenido de esteviosidos y


fenlicos en stevia (Stevia rebaudiana)

Guzman-Maldonado, S.H., Gonzlez-Chavira, M.M., Daz-Huacuz, S. R. y Pons-Hernndez, J.L.


Campo Eexperimental Bajo (INIFAP). Km. 6.5, Carretera Celaya-San Miguel Allende s/n. Celaya,
Gto. 800 088 2222 Ext, 85 233. guzman.horacio@inifap.gob.mx
Palabras clave: stevia, esteviosidos, elicitores

Introduccin
La stevia es una especie originaria del Paraguay, que produce varios edulcorantes
conocidos como glucosidos de esteviol (1). De estos, los principales son el esteviosido y
los rebaudiosidos A, B y C. Se sabe que la capacidad edulcorante de estos compuestos
es 210, 242, 30 y 30 veces mayor que el azcar, respectivamente (1). Los glicsidos de
estevil no son txicos y son consumidos por pacientes diabticos debido a que reducen
los niveles de glucosa en sangre y protegen contra el dao renal y heptico (2).
La estevia tambin ha atrado la atencin como fuente de otros metabolitos con actividad
biolgica como los flavonoides, antocianinas, taninos y cidos hidroxcinamicos e
hidroxibenzoicos, entre otros (3). Se desea que estos compuestos estn presentes en
cantidades suficiente para lograr un efecto significativo. A la fecha, no hay estudios sobre
posibles efectos txicos por la ingestin de altas concentraciones de estos compuestos.
Existen varios factores que pueden incrementar los niveles de compuestos con actividad
biolgica incluyendo los nutrientes del suelo, la temperatura, las condiciones de luz y la
presencia de CO2. Otra estrategia para lograr su incremento es la aplicacin de elicitores
que mimetizan un estrs en la planta provocando la sobre produccin de estos
compuestos (4). Ejemplo de elicitores son el jasmonato, salicilatos y los carbohidratos
como el quitosan; su efecto est en funcin de la concentracin y la fecha de aplicacin.
El objetivo del presente trabajo fue evaluar el efecto de la aplicacin de un coctel de
elicitores sobre el nivel de compuestos edulcorantes y compuestos fenlicos en la stevia.
Bajo nuestro conocimiento, esta es la primera vez que se aplican elicitores a la stevia para
evaluar su efecto sobre metabolitos con actividad biolgica.
Metodologa
Estrategia experimental. Se formaron seis grupos de seis plantas de stevia criolla.
Todas las plantas tenan el mismo tiempo de crecimiento y fueron cultivadas bajo
condiciones de invernadero con el mismo manejo agronmico y condiciones ambientales.
A tres grupos de plantas no se le aplicaron los elicitores, a los otros tres se les aplic un
coctel acuoso de elicitores que consisti de cido jasmnico, perxido de hidrogeno y
quitosano (10:10:10%, v:v:v). Se analizaron los compuestos de inters a cada planta por
separado de cada grupo a los 0, 7 y 21 das. A los grupos a los que no se les aplicaron los
elicitores se les denomin S1, S2 y S3, mientras que a los que si se les aplicaron, se les
denomin C1, C2 y C3. En todos los anlisis, se report el promedio del contenido de
cada compuestos de todas las plantas en cada grupos (n=18).
Composicin qumica. Los esteviosidos fueron determinados con cromatografa liquida
de alta resolucin y detector de diodos (HPLC-DAD). Se utiliz una columna C18 y una
CN (2.1 x 50 mm, tamao de partcula de 5 m, 35C, flujo de 0.1 ml/min). Con elusin
isocrtica con dos sistemas de solventes: metanol:agua para la columna C18 y
acetonitrilo:agua para la columna CN. La identificacin y cuantificacin de los
edulcorantes se determin comparando el tiempo de retencin y el espectro de los picos
de la muestra con los picos de estndares comerciales (SIGMA) (5).

158
Investigaciones en Ciencia e Inocuidad de Alimentos

Los compuestos fenlicos se fueron determinados con un equipo de cromatografa liquida


de alta resolucin (HPLC) con bomba de gradiente cuaternario 1100, auto-muestreador,
desgasificador, detector de longitud de onda UV/VIS, sistema de adquisicin (Agilent
ChemStation Plus Software A.09.xx, Santa Clara, CA, EE.UU.) y una columna de 15 cm x
4.6 mm (ABC Instrumentacin, Distrito Federal, Mxico) en fase reversa con tamao de
partcula 5 m Zorbax octadecilsilano (ODS-C18). La dentificacin y cuantificacin se
realiz comparando los tiempos de retencin y el espectro de absorcin de los siguientes
estndares comerciales (SIGMA, Ciudad de Mxico): cidos protocateico, p-
hidroxibenzoico, clorognico, glico, cafico, elgico, cinmico, 2-hidroxicinamico y
vanlico as como el kaemferol, catequina, miricetina, epicatequina, naringenina, naringina,
eriocitrina, hesperidina y quercetina (6).
Anlisis estadstico. Se realiz una ANOVA multifactorial y un anlisis de variables
mltiples en los resultados. Sobre el contenido de cidos fenlicos simples se realiz una
ANOVA y una comparacin de medias Apor el mtodo de Tukey (0.05).
Resultados y discusin
El contenido de esteviosido en los grupos de plantas al tiempo 0 (S1 y C1) fue mayor al
nivel detectado en las plantas analizadas a los 7 y 21 das (Figura 1). Adems, se observ
que el contenido de esteviosido en el grupo S1 es 25% mayor que en el grupo C1 (Figura
1). Estos resultados sugieren que existen diferencias en la tasa de sntesis de este
compuesto entre plantas de la misma especie manejadas de la misma forma. Por otro
lado, como resultado de la aplicacin de los elicitores el contenido de esteviosido se
redujo en un 45% a los 7 das despus de la aplicacin (C2) y en 11% a los 21 das (C3).

(X 1000)
15

12

0
S1 S2 S3 C1 C2 C3

Figura 1. Contenido de esteviosido (mg/100 g) en plantas de estevia sin (S) y con (C)
elicitor a los 0 das (S1 y C1) y a los 7 (S2 y C 2) y 21 (S3 y C3) das despus de la
aplicacin.

Con respecto al contenido de rebaudiosido A, se presentaron diferencias al inicio del


experimento (0 das) (S1 y C1) (Figura 2) que fueron menores si se comparan con el
esteviosido (Figura 1). A los siete das despus de aplicar el coctel de elicitores se
observ un incremento del 17% en el contenido de rebaudiosido A (C2) con respecto al
tiempo inicial (C1). A los 21 das de aplicados los elicitores, el contenido de este

159
Investigaciones en Ciencia e Inocuidad de Alimentos

compuesto se disminuy notablemente (~150 mg/100g) lo que sugiere que para mantener
el incremento en la concentracion del rabaudiosido A, es necesario continuar aplicando
los elicitores. El rebaudiocido C no presento cambios en su concentracin a lo largo del
experimento (datos no mostrados).

800

600

400

200

0
S1 S2 S3 C1 C2 C3

Figura 2. Contenido de rebaudiosido A (mg/100 g) en plantas de estevia sin (S) y con (C)
elicitor a los 0 das (S1 y C1) y a los 7 (S2 y C 2) y 21 (S3 y C3) das despus de la
aplicacin.

Se identificaron los cidos clorognico, cafico y ferllico en las plantas de stevia (Cuadro
1). En todos los grupos, los cidos mayoritarios fueron el cloroginico y el ferlico. En las
plantas donde no se aplicaron los elicitores, el cido clorognico se increment en 1000
mg a los 7 das y luego disminuyo a los 21 das observndose el mismo comportamiento
que tuvieron el esteviosido y el rebaudiosido A (Figuras 1 y 2). El cido cafico en las
muestras S1 y S2 present el mismo comportamiento, pero a los 21 el contenido fue
mayor.
Como resultado de la aplicacin de los elicitores, el cido clorognico se increment un 20
% a los 7 das de la aplicacin y un 29% a los 21 das despus de aplicados los elicitores
(Cuadro 1). Mientras que el cido cafico se increment un 37% y a los 21 das disminuyo
su sntesis. Por su parte, el cido ferlico no sufri ningn cambio a los 7 das pero se
increment un 32% a los 21 das despus de la aplicacin.
Debido a que no hay reportes en la literatura sobre el efecto de la aplicacin de elicitores
en estevia, no es posible hacer una discusin comparativa de estos resultados. Sin
embargo, se ha reportado que la aplicacin de jasmonato en albacar incrementa el
contenido de compuestos fenlicos (7).

160
Investigaciones en Ciencia e Inocuidad de Alimentos

Cuadro 1. cidos fenlicos (mg/100 g, bs) en stevia no elicitada (S) y elicitada (C).

Das Tratamiento Clorogenico Cafeico Ferulico

0 S1 3909.9 182.1 d 264.6 14.9 b 4724.9 85.2 b

C1 3847.9 129.4 d 195.0 30.3 d 4730.7 172.7 b

7 S2 4680.8 298.7 b 305.5 23.1 a 3685.2 157.1 d

C2 4599.3 272.5 bc 267.7 30.5 bc 4719.1 174.4 b

21 S3 4131.0 202.1 c 333.7 28.1 a 4426.3 40.3 c

C3 5027.2 283.9 a 217.7 12.9 c 6235.3 132.0 a

Conclusiones
La sntesis de esteviosidos y compuestos fenlicos difiere dentro de un mismo lote de
plantas de stevia. Por otro lado, La aplicacin de elicitores disminuye el contenido del
esteviosido pero incrementa los niveles de rebaudiosido A y de tres cidos fenlicos
detectados. Sin embargo, es necesario no suspender la aplicacin de elcitiores si se
desea mantener el nivel alto del rebaudiosido A. En resuman, la aplicacin de elcitores
parece ser una estrategia promisoria para incrementar metabolitos de inters para la
salud humana.

Bibliografa
1. Yadav, A.K., Singh, S. Dhyani, D. and Ahuja, P.S. 2011. A review on the improvement
of stevia [Stevia rebaudiana (Bertoni)] Can. J. Plant Sci. 91: 1-27.
2. Momtazi-Borojeni AA, Esmaeili SA, Abdollahi E, Sahebkar. 2016. A Review on the
pharmacology and toxicology of steviol glycosides extracted from Stevia rebaudiana.
Curr. Pharm. Des. 23(11):1616-1622.
3. Sytar, O., Borankulova, A., Shevchenko, Y., Wendt, A. and Smetanska, I. 2016.
Antoxidant activity and phenolics composition in Stevia rebaudiana plants of different
orgin. J Microbiol. Biotechnol. Food Sci. 5(3):221-224.
4. Garcia-Mier, L., Jimenez-Garcia, S.N., Guevara-Gonzlez, R.G., Feregrino-Perez, A.A.,
Contreras-Medina, L.M. and Torres-Pacheco, I. 2015. Elicitor mixtures significantly
increase bioactive compounds, antioxidant activity, and quality parameters in sweet bell
pepper. J Chem. ID 269296, 8 pages. Open access.
5. Giraldo, C. E., Deisy-Martin, P. L. y Habeych, N. D. I. 2005. Obtencion de edulcorantes
de stevia rebaudiana Bertoni. Rev. CENIC Ciencias Biol. 36.No. Especial, 1-9.
6. Ramamurthy, M.S., Maiti, B., Thomas, P.Y. and Nair, M. 1992. High preformance liquid
chromatography determination of phenolic acids in potato tubers (Solanum tuberosum)
during wound healing. J. Agric. Food Chem, 40(4): 569-572.
7. Malekpoor, F., Salimi, A. and Ghasemi-Pirbalouti, A. 2016. Effect of jasmonic acid on
total phenolic content and antioxidant activity of extract from the green and purple
landraces of sweet basil. Acta Ploniae Pharm. Drug Res. 73(5):1229-1234.

161
Investigaciones en Ciencia e Inocuidad de Alimentos

Efecto del ultrasonido de alta intensidad en las propiedades emulsificantes y


gelificantes de un aislado protenico de canola (Brassica napus L)

a a,b c b
Flores Jimnez, N.T. , Ulloa J.A. , Ramrez Ramrez, J.C. , Rosas Ulloa P. , Bautista Rosales,
b a c
P.U. , Silva Carrillo, Y. , y Gutirrez Leyva, R.
a
Posgrado en Ciencias Biolgico Agropecuarias, Universidad Autnoma de Nayarit, Carretera
Tepic-Compostela Km 9, Xalisco 63780, Nayarit, Mexico
b
Centro de Tecnologa de Alimentos, Universidad Autnoma de Nayarit, Ciudad de la Cultura
Amado Nervo, Tepic 63155, Nayarit, Mexico
c
Unidad Acadmica de Medicina Veterinaria y Zootecnia, Universidad Autnoma de Nayarit,
Carretera Compostela-Chapalilla Km 3.5, Compostela 63700, Nayarit, Mexico

Correo electrnico: nta_018@hotmail.com (N.T. Flores Jimnez)


Nmero telefnico: 311-191-76-02
Palabras clave: aislado protenico de canola, ultrasonido, propiedades gelificantes-
emulsificantes
Introduccin

Con la finalidad de ofrecer alternativas a la demanda creciente de protenas en el mundo,


continuamente se exploran fuentes alternativas a las tradicionales, dentro de las que
destacan las de plantas, bacterias y levaduras (1). Por otra parte, tambin se estudian las
pastas generadas del procesamiento de oleaginosas como fuentes ricas en proteinas. Al
respecto, a nivel mundial la canola (Brassica napus L.) es el cultivo oleaginoso que ocupa
el segundo lugar en produccin despus de la soya (2), del cual se obtiene aceite
comestible de excelente calidad (3), y como subproducto una pasta con alto contenido de
protena (35-36%), que podra utilizarse para la elaboracin de aislados proteicos con uso
potencial en alimentacin humana.

Por otra parte, diversos tratamientos fsicos, qumicos y enzimticos han sido
ampliamente utilizados para modificar la estructura de las protenas, y con ello mejorar su
calidad y diversificar sus aplicaciones y usos, destacando dentro de ellos la energa de
ultrasonido de alta intensidad, ya que dicha tecnologa es segura, no txica y amigable
con el medio ambiente (4).

Considerando lo anterior, los objetivos del presente trabajo fueron producir un aislado
protenico de pasta de canola (APC) y evaluar el efecto de tiempo de exposicin al
ultrasonido (US) en sus propiedades gelificantes y emulsificantes.

Metodologa

Obtencin del aislado protenico y tratamiento de US

Se prepar una suspensin mezclando pasta de canola en agua destilada en una relacin
(1:20; p/v), ajustando el pH a 12 con NaOH 1 N. La suspensin se agit durante 30 min a
temperatura ambiente utilizando un agitador de hlice RW 28 BASIC IKA (Staufen,
Alemania), y enseguida se filtr con una manta para separar los residuos insolubles. El
extracto protenico obtenido se ajust a un pH de 4 con HCl 1 N, agitando el medio por 5
min a temperatura ambiente, para propiciar la precipitacin isoelctrica de las protenas.
Posteriormente el precipitado protenico se separ por sedimentacin despus de 45 min
de reposo a temperatura ambiente, se centrifug a 8 010 g durante 5 min a 4C y

162
Investigaciones en Ciencia e Inocuidad de Alimentos

enseguida se ajust el pH a 7. A continuacin, con el precipitado obtenido se prepar un


suspensin acuosa (10% p/v), se agit suavemente durante 15 min y se dividi en tres
partes para aplicar el ultrasonido (US) usando un bao ultrasnico BRANSON 3510R-MT
(Danbury, E.U.A.) que opera a una potencia de 130 W y una frecuencia de 42 kHz
(densidad acstica de 0.26 W/cm3). El diseo experimental consisti en los siguientes
tratamientos : (A) exposicin al US por 15 min, (B) exposicin al US por 30 min, (C)
tratamiento control sin exposicin al US. Enseguida las tres suspensiones protenicas se
liofilizaron en un equipo Labconco Modelo FreeZone 20 L (Kansas, E.U.A) para obtener
los aislados protenicos (APC).

Propiedades gelificantes y emulsificantes

La concentracin mnima gelificante (CMG), la actividad emulsificante (AE) y estabilidad


emulsificante (EE) de los aislados protenicos de canola se determinaron a valores de pH
entre 2 y 10, de acuerdo los mtodos descritos por Joshi et al. (5) y Ulloa et al. (6),
respectivamente.

Anlisis estadstico

Los resultados obtenidos se sometieron a un anlisis de varianza de una va usando el


paquete estadstico Statgraphics Centurion Software versin XV (Statpoint Technologies,
Inc. Virginia, EE.UU.). La comparacin de medias se hizo con la prueba de Fisher a un
nivel de significancia (p<0.05).
Resultados y discusin

En la figura 1 se muestran los resultados del efecto de tiempo de exposicin al US en la


CMG de los APC. Como se observa, solamente se detect una mejora en las
propiedades gelificantes por efecto del ultrasonido en los APC a valores de pH 6 y 8. Para
el pH de 6, la CMG disminuy de 12 g/100 g a 10 g/100 g para el APC expuesto a 15 y 30
min de US, mientras que para el pH de 8, la CMG disminuy de 14 g/100 g a 12 g/100 g
nicamente para el APC expuesto a 30 min de US. Por lo tanto, este efecto podra
atribuirse a la desnaturalizacin parcial de las protenas por US, lo cual provoc una
mayor exposicin de las regiones hidrofbicas hacia la superficie, as como la agregacin
proteica que mejora la capacidad de retencin de agua en la estructura de la red
tridimensional. El comportamiento de la CMG por el efecto de pH fue evaluado por otros
autores en aislados protenicos de garbanzo (7) con una CMG entre 14-18 g/100 g, por
tanto, el pH influye en las propiedades funcionales de una protena, de igual forma el tipo
de protena, tipo de aminocidos y de interacciones posibles.

Actividad emulsificante (AE) y estabilidad emulsionante (EE)

En la tabla 1 se muestra el efecto de tiempo de exposicin al US en AE y EE de los APC.


En base a los resultados obtenidos, la AE se increment significativamente (p<0.05) por
efecto del ultrasonido en los APC, a valores de pH 4, 8 y 10. A pH de 4 el control (0 min)
no present AE, en cambio los APC expuestos al US durante 15 y 30 min mostraron
32.79% y 55.39% de AE, respectivamente. Del mismo modo, a pH de 8 la AE aument
obtenindose 37.68% para el control y 47.63% para los APC tratados con US (30 min).

163
Investigaciones en Ciencia e Inocuidad de Alimentos

Fig.1. Efecto del tiempo de exposicin al US y pH sobre la capacidad mnima gelificante


(CMG) de APC. Diferentes letras entre barras a cada valor de pH indican diferencia
significativa entre tratamientos (p<0.05).

La mxima AE fue de 64.39% a pH de 10 para el APC tratado con US durante 30 min. El


aumento de la AE puede atribuirse a la desnaturalizacin parcial y a la formacin de una
estructura ms desordenada de las protenas despus del tratamiento con US, lo que
permite una mejor adsorcin en la interfase aceite-agua.

De igual forma la exposicin de los APC al US durante 30 min a pH 2, 6, 8 y 10


increment la EE comparado con el control (p<0.05). La mxima EE (55.71%) se present
a pH 10 en los APC expuestos al US durante 30 min. Sin embargo, a pH 4 no se mostr
EE en ninguno de los tratamientos.

El aumento en la EE pudo deberse a una reorientacin ms favorable de las protenas por


la influencia del comportamiento turbulento producido por el US. Xiong et al.(8) reportaron
que el US aument la AE y EE de la ovoalbmina, lo cual concuerda con los resultados
del presente estudio para los APC tratados con US durante 15 y 30 min.

Conclusiones

El ultrasonido de alta intensidad modific las propiedades funcionales del APC. La


exposicin de los APC al US durante 15 y 30 min mejor la CMG, AE y EE a diferentes
valores de pH. Los APC obtenidos podran utilizarse para la elaboracin de diversos
productos alimenticios tales como postres congelados, aderezos y sopas.

164
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 1. Efecto del tiempo de exposicin al ultrasonido sobre actividad emulsionante (AE) y
estabilidad emulsionante (EE) de aislados protenicos de pasta de canola.
Tiempo de exposicin al
pH AE (%) EE (%)
ultrasonido
b
2 0 (Control) 46.96 0.12 37.42 2.02
b
15 min 44.30 2.20 35.42 0.99
30 min 43.90 3.57 44.88 2.18
4 0 (Control) ND ND
a
15 min 32.79 0.76 ND
30 min 55.39 1.20 ND
b
6 0 (Control) 29.67 1.55 22.64 0.60
b
15 min 29.80 1.74 21.95 1.58
a
30 min 30.95 3.36 29.00 1.41
b b
8 0 (Control) 37.68 1.44 36.85 0.26
ab
15 min 41.66 2.35 50.92 1.30
b
30 min 47.63 1.06 37.29 0.89
c b
10 0 (Control) 43.32 2.88 46.77 0.14
b
15 min 55.54 2.18 54.76 2.81
30 min 64.39 2.28 55.71 2.02
Los valores son promedios (n = 2) desviacin estndar. Diferentes superndices por columna a
cada valor de pH indican diferencia significativa (p<0.05). ND, no detectado.

Bibliografa

1. Gerzhova, A., M. Mondor, M. Benali and M. Aider. 2016. Study of total dry matter and protein
extraction from canola meal as affected by the pH, salt addition and use of zeta-
potential/turbidimetry analysis to optimize the extraction conditions. Food Chem. 201: 243-252.
2. Organisation For Economic Co-Operation and Development .2015. Disponible en la pgina:
https://stats.oecd.org/Index.aspx?DataSetCode=HIGH_AGLINK_2015. Fecha de acceso: Abril
de 2017.
3. Xu, L. and L.L. Diosady. 2012. Processing of canola proteins: a review. Pp. 59-78 In: Thiyam
Hollaender, U., Eskin, N.A.M., Matthaus, B. (Eds.), Canola and Rapeseed: Production,
Processing, Food Quality, and Nutrition. CRC Press, Boca Raton.
4. Jambrak, A.R., T.J. Mason, V. Lelas, L. Paniwnyk and Z. Herceg. 2014. Effect of ultrasound
treatment on particle size and molecular weight of whey proteins. J. Food Sci.121:1523.
5. Joshi, A.U., C. Liu and S.K. Sathe. 2015. Functional properties of select seed flours, Lebensm.
Wiss. Technol. 60: 325331.
6. Ulloa, J.A., P. Rosas Ulloa and B.E. Ulloa Rangel. 2011. Physicochemical and functional
properties of a protein isolate produced from safflower (Carthamus tinctorius L.) meal by
ultrafiltration. J. Sci. Food Agric. 91: 572577.
7. Kaur, M. and N. Singh. 2007. Characterization of protein isolates from different Indian chickpea
(Cicer arietinum L.) cultivars, Food Chem. 102: 366374.
8. W. Xiong, Y. Wang, C. Zhang, J. Wan, B.R. Shah, Y. Pei, B. Zhou, J. Li and B. Li. 2016. High
intensity ultrasound modified ovalbumin: Structure, interface and gelation properties. Ultrason.
Sonochem. 31:302309.

165
Investigaciones en Ciencia e Inocuidad de Alimentos

Inhibicin de hongos fitopatgenos de Guanbana (Annona muricata.L)


mediante metabolitos secundarios de bacterias del gnero Pseudomonas
Aguiar Tirado, E.A., Bueno Durn, A.Y., y Barcelos Garca, R.G.
Universidad Autnoma de Nayarit- centro Nayarita de Innovacin y Transferencia de
Tecnologa, A.C. Av. Emilio M. Gonzlez S/N. Ciudad del Conocimiento. Col. Ciudad
Industrial. C.P. 63173. Tepic, Nayarit. Mxico. Telf.3112496084. e-mail:
eliasqfb93@gmail.com
Palabras clave: inhibicin, fitopatgeno, metabolitos secundarios

Introduccin
Las cosechas de guanbana (Annona muricata. L) son severamente afectadas por la
presencia de patgenos durante la maduracin de este, los cuales pueden causar daos
significativos en la produccin y prdida econmica. La guanbana es un fruto el cual ha
tenido una demanda significativa en el pas, con mayor produccin ao tras ao. De
acuerdo con el Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias
(INIFAP) (2), Mxico es el principal productor de guanbana en el mundo, con una oferta
que alcanza las 19.841 toneladas al ao y un valor comercial de alrededor de MXN 104
millones. Una estrategia empleada desde hace mucho tiempo para contender contra las
enfermedades de frutas y hortalizas postcosecha es el uso de compuestos qumicos; sin
embargo, se ha comprobado que estos tienen diversas consecuencias negativas en el
ambiente, as como en la salud humana (3). Es por eso que se busca implementar una
estrategia biolgica para controlar dichas plagas con el uso de microorganismos que
tengan la capacidad de inhibir o retardar el crecimiento de fitopatgenos. Un ejemplo, son
los microorganismos que se desarrollan bajo condiciones aerbicas los cuales necesitan
del hierro para llevar a cabo una gran variedad de funciones, entre ellas la reduccin del
oxgeno para la sntesis de ATP (1). Por lo cul el objetivo de este trabajo fue evaluar el
efecto inhibitorio de tres especies del gnero Pseudomonas frente a hongos fitopatgenos
aislados del fruto de la guanbana, causantes de enfermedades postcosecha.

Metodologa

Cepas Bacterianas
Se utilizaron cepas de las especie aeruginosa, fluorescens y diminuta, del gnero
Pseudomonas, las cuales fueron aisladas de frutos de guanbana en madurez fisiolgica
obtenidos del Tonino, Compostela Nayarit (Vzquez Pulido, 2015), las cepas fueron
activadas en caldo Soya Tripticasa de soya y agar Cetrimida e incubadas a 37C/24 h.

Hongos Fitopatgenos
Se utilizaron los hongos fitopatgenos Rhizopus spp., Aspergillus nger y Aspergillus
ochraceus los cuales fueron aislados de frutos de guanbana en post cosecha, (Lpez
Castaeda, 2015). Se activaron las cepas en medio PDA (Papa Dextrosa Agar) e
incubados a temperatura ambiente/7 das. Despus de 7 das de crecimiento se les
realiz una tincin con azul de lactofenol para observar sus caractersticas microscpicas
y confirmar gnero de Rhizopus spp., Aspergillus nger, y Aspergillus ochraceus.

166
Investigaciones en Ciencia e Inocuidad de Alimentos

Determinacin del efecto inhibitorio.


Se utiliz el mtodo dual para determinar el efecto inhibitorio de las especies de
Pseudomonas frente a los hongos fitopatgenos. En un primer experimento se inocul
con 24 horas de anterioridad cada especie de las bacterias Pseudomonas por sembrado
masivo la caja Petri con medio Agar papa Dextrosa (PDA) y sembrando al centro el hongo
fitopatgeno haciendo un orificio de 0.5 cm de dimetro, midiendo por 7 das el
crecimiento del hongo, contando con un control del hongo fitopatgeno. En un segundo
experimento se inocul al mismo tiempo las bacterias por sembrado masivo y al centro el
hongo fitopatgeno en medio PDA en un orificio de 0.5 cm de dimetro y midiendo por 7
das el crecimiento del hongo, de igual manera se cont con una caja control del
fitopatgeno. En un tercer experimento las cepas de Pseudomonas se inocul en medio
PDA, formando un tringulo equiltero (Fig. 1), en el centro se coloc un orificio de 0.5 cm
de dimetro de un cultivo de 7 das del hongo fitopatgeno. La actividad inhibitoria de los
tres experimentos se determin por la medicin con un pie de rey por 7 das, del
crecimiento micelial o la ausencia del mismo por el efecto inhibitorio de metabolitos
secundarios producidos por P.diminuta, P.fluorescens y P.aeruginosa.

Fig. 1. Mtodo de enfrentamiento de bacterias Pseudomonas frente a hongos


fitopatgenos aislados de guanbana.

Resultados y discusin
Observamos en nuestros resultados un alto porcentaje de inhibicin del crecimiento
micelial de los hongos fitopatgenos, en especial por P. fluorescens, ya que en los tres
experimentos se present un 100% de inhibicin frente a los hongos Aspergillus
ochraceus, Rhizopus spp y un 69% de inhibicin frente Aspergillus Nger (Fig. 2), el % de
inhibicin se obtuvo en base al crecimiento micelial de los controles de los hongos
fitopatgenos. Al igual P. aeruginosa mostr un 100% de inhibicin frente a los hongos
fitopatgenos Aspergillus ochraceus y Rhizopus spp, y un 47% de inhibicin frente
Aspergillus nger (Fig. 3), por P.diminuta el efecto inhibitorio fue menor, observndose un
48% frente Aspergillus ochraceus, un 20% frente a Rhizopus spp y un 65% frente
Aspergillus nger (Fig. 4). Estas especies de Pseudomonas producen ciertos metabolitos
secundarios antifngicos entre ellos siderforos, pioverdina los cuales en condiciones

167
Investigaciones en Ciencia e Inocuidad de Alimentos

estrictas forman parte de los mecanismos de control de las enfermedades causadas por
hongos y bacterias fitopatgenas por la competicin con el in frrico donde forman
quelatos con stos y causan inhibicin al patgeno por no disponer de ste, segn se
reporta por diversos autores (5). Lo cual da lugar al objetivo del presente trabajo de
evaluacin de cepas antagonistas de hongos fitopatgenos para la obtencin de un
producto biolgico con fines fitosanitarios.
Numerosas investigaciones de diferentes pases reportan el empleo de diferentes cepas
de Pseudomonas, en el biocontrol de hongos fitopatgenos, como por ejemplo, el Pythium
que infecta diferentes cultivos y el Gaeumannomyces graminis var tritici que produce
enfermedades en el trigo (4).

Fig. 2 Enfrentamiento in vitro entre Pseudomona fluorescens y hongos fitopatgenos.

Fig. 3 Enfrentamiento in vitro entre Pseudomona aeruginosa y hongos fitopatgenos.

168
Investigaciones en Ciencia e Inocuidad de Alimentos

Fig. 4 Enfrentamiento in vitro entre Pseudomona diminuta y hongos fitopatgenos.

Conclusiones
De acuerdo a los resultados las bacterias P. fluorescens y P.aeruginosa son una opcin
prometedora para combatir ciertas enfermedades fngicas en frutas postcosecha, debido
a la produccin de ciertos metabolitos el cual retardan e inhiben el crecimiento micelial de
estos hongos fitopatgenos.

Bibliografa
1. Bangera, M. G. and L. S. Tomashow. 1996. Characterization of a genomic locus required
for synthesis of the antibiotic 2,4- diacetylphloglucinol by the biological control agent of
Pseudomonas fluorescens Q2-87.Mol. PlantMicrobe Interact. 9: 83-90.
2. Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP), 2015.
3. Kah, M. and C. D. Brown. 2006. Adsorption of ionizable pesticides in soils. Rev. Environ
Contam. Toxicol. 188: 149-217
4. McMorran, B. J., Merriman, M. E., Rombel, I. T. & Lamont, I. L.(1996). Characterisation of
the pvdE gene which is required for pyoverdine synthesis in Pseudomonas aeruginosa.
Gene 176, 55-59.
5. Santoyo G, Valencia-Cantero E, Orozco-Mosqueda M d C, Pea-Cabriales J J, Faras-
Rodrguez R, PAPEL DE LOS SIDERFOROS EN LA ACTIVIDAD ANTAGNICA DE
Pseudomonas fluorescens ZUM80 HACIA HONGOS FITOPATGENOS.

169
Investigaciones en Ciencia e Inocuidad de Alimentos

Evaluacin de la capacidad de formacin de biopelcula de los aislamientos


de Staphylococcus aureus provenientes de manipuladores de alimentos que
intervienen en la industria lctea

Solis Velzquez, O.A, Estrada Ochoa, P., Iiguez Moreno, M., Iiguez Moreno, E., Guerrero
Medina, P.J.,Gutierrez-Lomel M., Avila Novoa M.G.
Divisin de Desarrollo Biotecnolgico. Laboratorio de Microbiologa, Universidad de Guadalajara,
Centro Universitario de la Cinega. Av. Universidad No. 1115. Col. Linda Vista, CP. 47820,
Ocotln, Jalisco, Mxico. Tel (392) 92 59400 Ext 48462
avilanovoa@hotmail.com /avila.novoa@cuci.udg.mx

Palabras clave: Staphylococcus aureus, manipulador de alimentos, biopelculas

Introduccin

Staphylococcus aureus es un microorganismo que forma parte de la microbiota de la piel


y mucosas del humano, estimndose que de 20-30% es persistente y un 60% produce
una colonizacin intermitente (2). Investigaciones argumentan que Staphylococcus aureus
tiene la capacidad de adherirse y formar biopelculas en superficies slidas, proliferando y
acumulando capas de clulas envueltos de una matriz polimrica orgnica facilitando la
formacin de micro colonias para la maduracin de la biopelculas, donde la fase de
acumulacin de la biopelcula est ligada a la produccin del polisacrido de adherencia
intracelular (PIA). PIA es responsable de la adhesin intercelular en Staphylococcus
aureus, llamado tambin poli-N-acetilglucosamina (PNAG), que es un polmero acetilado
de -1-16 el cual es sintetizado por los genes del opern icaADBC y el gen regulatorio
icaR el cual transcribe en direccin opuesta al opern ica). IcaR se une al promotor
icaADBC, especficamente 5 del inicio del codn icaA, regulado negativamente la
expresin de ica (3,8).

Por lo tanto, la habilidad de Staphylococcus aureus por adherirse a una superficie abitica
y formar una biopelcula puede ser una ventaja para ingresar al alimento y causar
posteriormente una intoxicacin alimentaria (3). La formacin de una biopelcula puede
proteger a la comunidad bacteriana frente al estrs ambiental, sistema inmune del
husped, desinfectantes qumicos o enzimticos, mecanismos de accin de antibiticos
en comparacin con clulas planctnicas. Se ha demostrado que la interaccin entre
clula-clula, juega un papel en la adhesin y desprendimiento de las clulas que
conforman a la biopelcula, as como en la resistencia de las clulas que la conforman
contra tratamientos antimicrobianos (6).

La biopelcula en la industria lctea representa una de las principales fuentes de


contaminacin a los productos lcteos de una manera directa o indirecta y
subsecuentemente constituyen serios problemas a la salud pblica. El proyecto de
investigacin tiene como objetivo evaluar la capacidad de formacin de biopelculas de los
aislamientos de Staphylococcus aureus provenientes de manipuladores de alimentos que
intervienen en la industria lctea.

Metodologa

Deteccin de Staphylococcus aureus en muestras.- Se colectaron 18 muestras de


manipuladores de alimentos (pliegues de manos) y se detecto S. aureus segn el

170
Investigaciones en Ciencia e Inocuidad de Alimentos

Bacteriological Analytical Manual (BAM, 2016). Para la confirmacin de la especie se


utiliz el protocolo de Straub et al. (1999), los iniciadores empleados para detectar el gen
23S rDNA fueron staur 4 (5 ACGGAGTTACAAAGGACGAC 3) y staur6 (5
AGCTCAGCCTTAACGAGTAC 3). Las condiciones de PCR eran pre- calentamiento
(94C/5min), 30 ciclos (desnaturalizacin 94C /30 s, alineacin 58C / 30 s, extensin
72C/75 s) y una extensin final de 72 C/5 min. Los controles positivos que se utilizaron
fueron Staphylococcus aureus ATCC 25923.

Deteccin de genes icaADBC.- Se detectaron los genes de adhesin intracelular mediante


PCR utilizando el protocolo de Diemond-Hernndez et al. (2010) teniendo como referencia
a Staphylococcus aureus ATCC 27543, 6538, 25923. Cada mezcla de reaccin tena un
volumen final de 25 L (1x PCR buffer, 0.2 mM DNTP's, 2.5 mM de MgCl 2, 0.625 U de
Taq polimerasa (Taq platinum, Invitrogen), 0.3 M de cada iniciador y ADN molde). La
separacin de los productos de PCR se realiz por electroforesis en geles de agarosa al
1.2% p/v (Ultrapure agarose, Invitrogen) teidos con bromuro de etidio (0.5 g / mL,
Sigma-Aldrich). Los productos amplificados se observaron en presencia de luz UV sobre
un transluminador 2UV (UVP).

Ensayo fenotpico cualitativo para determinar la habilidad de los aislamientos de


Staphylococcus aureus para producir biopelculas mediante el mtodo sobre Rojo Congo
Agar (RCA).- Para realizar esta tcnica se utiliz el protocolo de Freeman et al. 1989 y
Arciola et al. 2001. Previamente se inocul cada una de las cepas de Staphylococcus
aureus en caldo soya tripticasena (TSB + 0.25% glucosa) e incub a 37C/24 h.
Posteriormente se inocul cada cultivo axnico en el medio RCA e incub a 37C/24-48 h.
La formulacin del medio RCA est integrada por base de agar sangre, 36 g de sacarosa
y 0.8 g de rojo congo por cada litro del medio de cultivo. Se establecieron los criterios
descritos por Arciola et al. 2001 en base a las caractersticas macroscpicas que se
reflejan en el medio RCA para determinar la capacidad de produccin de biopelculas de
las cepas de Staphylococcus aureus. Las caractersticas macroscpicas de los
aislamientos de Staphylococcus aureus en el medio RCA, que presentaron colonias
negras o puntiformes con centro negro y periferia rojiza, ambas con consistencia spera,
seca y cristalina se consideran como cepas productoras de biopelcula (PB). Los
aislamientos de Staphylococcus aureus en el medio RCA, que presenten colonias rojas y
lisas se consideraron como cepas no productoras de biopelculas (NPB).

Ensayo de adherencia cuantitativo para determinar la habilidad de los aislamientos de


Staphylococcus aureus para producir biopelculas por el mtodo sobre micro placas de
poliestireno. -Se utiliz el protocolo de Christensen et al. 1985 y Kouidhi et al. 2010 en el
cual se inocularon cada una de los aislamientos de Staphylococcus aureus en caldo
infusin cerebro corazn (BHI) (BD Diagnostic Systems) suplementado con 0.25%
glucosa (p/v) y se incubaron a 37C / 24 h. Se realiz una dilucin 1:100 en BHI (BD
Diagnostic Systems) + 0.25% glucosa (p/v) y se inocularon 200 L de esta suspensin
celular bacteriana en micro placas de poliestireno. Cada una de las cepas se evalu por
triplicado, incorporando a su vez controles negativos y positivos (Staphylococcus aureus
ATCC 6538 y 25923). Los criterios de interpretacin de esta tcnica eran: el ndice de
adhesin bacteriana es alto, significa que la DO570 1, el ndice de adhesin bacteriana es
moderado significa que la DO570 1, por lo tanto, la cepa de Staphylococcus aureus
tendra una habilidad moderada para formar biopelcula y por ltimo, cuando
Staphylococcus aureus no tiene la capacidad de formar biopelculas el ndice de adhesin
es nulo significa que la DO570 0.1

171
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin

En esta investigacin se desarrollaron metodologas genotpica y fenotpicas asociadas a


la formacin de biopelcula, donde se encontr que el 59% (13/22) de las cepas de
Staphylococcus aureus por lo menos presentaron un gen de adhesin intercelular
implicados en la formacin de PIA. Cabe resaltar que el 54.5% (12/22) de los aislamientos
de Staphylococcus aureus presentaron los cuatro genes icaADBC y el gen icaD en un
4.5% (1/22). Al ser evaluados los Staphylococcus aureus en el medio de RCA, se
encontr que el 59% (13/22) mostraron los fenotipos caractersticos de cepas productores
de biopelculas (PB), 13.6% (3/22) cepas no productas de biopelculas (NPB) y el 27.2%
(6/22) presentaron una morfologa atpica (FA) en RCA (Tabla 1).

Tabla 1. Factores genotpicos y fenotpicos determinados en los


aislamientos de Staphylococcus aureus provenientes de
manipuladores de alimentos
Caractersticas implicadas en la
formacin de Biopelculas
Genes de adhesin
RCA
intercelular
Aislamientos de
icaADBC icaD FA PB NPB
Staphylococcus aureus

n= 22 n=12 n=1 n=6 n=13 n=3

Estos resultados concuerdan con los datos generados por las investigaciones
relacionadas a la formacin de biopelculas de Staphylococcus aureus, ejemplo de estas:
Dhanawade et al. (2010), realizaron la caracterizacin genotpica de 102 cepas de
Staphylococcus aureus aislados de ganado bovino con mastitis sub-clnica de las granjas
del centro y sur de la India, considerando los diferentes mtodos para evaluar la
produccin de biopelculas, en estos se detect que el 35.25% (36/102) eran positivos al
icaA e icaD mediante PCR y el 48.03% (49/102) eran positivos mediante el RCA
teniendo una sensibilidad del 61% y especificidad de un 77 %, mediante el mtodo de
tubo (Christensen et al. 1982) 29.4% (30/102) con una sensibilidad del 58.33% y
especificidad del 86.36%. Oliveira et al. (2006) analizaron la expresin fenotpica de la
formacin de la biopelcula mediante RCA e hibridacin in situ (FISH), obteniendo que el
37.5% (12/32) de las cepas de Staphylococcus aureus producen biopelculas
concordando con los resultados en ambas tcnicas.

Tang et al. (2013) detectaron genes de adhesin y mtodos fenotpicos para evaluar la
formacin de biopelculas en 57 aislamientos de Staphylococcus aureus provenientes de
pollo (30 cepas SC-1 al SC-30), de brotes de intoxicacin estafilocccica (8 cepas S-F1 al
S-F8) y de rastros de cabras (19 cepas SG-1 al SG-19). En los 16 aislamientos se
detectaron los genes clfB y sasG en un 100% (16/16); can, ebpS, eno, fnbA y fib en un
93.75% (15/16); icaAD y icaBC en un 87.5% (14/16); fnbB en un 68.75 % (11/16); sasC en
un 31.25% (5/16); clfA en un 25% (4/16); pls en un 12.5% (2/16) no detectando bap
respectivamente.

172
Investigaciones en Ciencia e Inocuidad de Alimentos

Por lo que podramos deducir que el desarrollo de la biopelcula de Staphylococcus


aurues est regulado por ica, bap, agr, SarAm SigB,IcaR, TcaR, Ar1RS, SrrAb, MgrA y
Rbfb y sar, los cuales responden a estmulos del husped y del medio ambiente como;
consecuencia de glucosa, hierro, Ca2+, Mn2+, pH, niveles de CO2, anaerobiosis , a travs
del mecanismo de qurum sensing para coordinar la adherencia Al determinar la
habilidad para producir biopelculas mediante la prueba de adherencia en aislamientos de
Staphylococcus aureus (n=22). Se encontr que el 86.3% (19/22) de los aislamientos
presentaron una adherencia moderada y el 13.6% (3/22) no present adherencia. Se
present por lo menos un gen de adhesin intercelular en el 59% (13/22) de los
aislamientos de Staphylococcus aureus con AM. Estos hallazgos concuerdan con la
capacidad de adhesin de Staphylococcus aureus a superficies de acero inoxidable,
poliestireno, polipropileno y vidrio que son utilizadas dentro de la industria alimentaria con
el fin de mostrar la contaminacin cruzada entre los equipos y materiales que mantienen
contacto con alimentos durante su procesamiento.

Por lo tanto, las biopelculas representan una fuente persistente de contaminacin


microbiana. Estas se encuentran asociadas al deterioro y a la generacin de
enfermedades transmitidas por alimentos (ETAs) que no solo repercuten en grandes
prdidas econmicas; sino que ponen en riesgo la inocuidad alimentaria.

Conclusiones
Los Staphylococcus aureus aislados de los manipuladores de alimentos tienen la
capacidad de desarrollar biopelculas.

Bibliografa

1. Alhede, M. Qvortrup, k. Liebrechts, R. Hoiby, N. Givskov, M and Bjarnsholt, T. 2012. Combination


of microscopic techniques reveals a comprehensive visual impression of biofilm structure and
composition. FEMS Inmmunol. Med. Microbial. 65 (2): 335-342.
2. Argudn, M.A. Mendoza, M.C. and Rodicion, M.R. 2010. Food Poisoning and Staphylococcus
aureus Enterotoxins. Toxins. 2 (7):1751-1773.
3. Brooks, J.D. and Flint, S.H. 2008. Biofilms in the food industry: problems and potential solutions. Int.
J. Food Sci. Technol. 43 (12):2163-2176.
4. Dhanawade, N.B. Kalorey, D.R. Srinivasan, R. Barbuddhe, S.B. and Kurkure, N.V. (2010).
Detection of intercellular adhesion genes and biofilm production in Staphylococus aureus isolated
from bovine subclinical mastitis. Vet. Res. Commun. 34 (1):81-89.
5. Diemond-Hernndez, B. Slorzano-Santos, F. Leaos-Miranda, B. Peregrino-Bejarano, L. and
Miranda-Novales, G. 2010. Production of icaADBC-encoded polysaccharide intercellular adhesin
and therapeutic failure in pediatric patients with staphylococcal device-related infections. BMC
Infect. Dis.10 (68):1-6.
6. Kostaki, M. Chorianopoulos, N. Braxou, E. Nychas, G.J. and Giaouris, E. 2012. Differential Biofilm
Formation and Chemical Disinfection Resistance of Sessile Cells of Listeria monocytogenes Strains
under Monospecies and Dual-Species (with Salmonella enterica) Conditions. Appl. Environ.
Microbiol. 78 (8):25862595.
7. Oliveira, M. Bexiga, R. Nunes, S.F. Carneiro, C. Cavaco, L. Bernardo, F. and Vilela, C.L. 2006.
Biofilm-forming ability profiling of Staphylococcus aureus and Staphylococcus epidermidis mastitis
isolates. Vet. Microbiol. 118 (1-2):133-140.
8. Tang, J. Chen, J. Li, H. Zeng, P. and Li, J. 2013. Characterization of adhesion genes,
Staphylococcal nucleased, hemolysis, and biofilm formation among Staphylococcus aureus strain
isolated from different source. Foodborn. Pathog. Dis. 10 (9):757-763.

173
Investigaciones en Ciencia e Inocuidad de Alimentos

Bioaccesibilidad in vitro de compuestos fenlicos de


chiltepn (Capsicum annuum L. var. glabriusculum)
Ovando-Martnez, M., Medina-Jurez L.A., Molina-Domnguez C.C. y Gmez-Meza N.
Departamento de Investigaciones Cientficas y Tecnolgicas de la Universidad de Sonora
(DICTUS), Blvd. Luis Donaldo Colosio s/n, entre Reforma y Sahuaripa, Edificio 7G, Colonia Centro,
C.P. 83000, Hermosillo, Sonora. Telfono: (662) 2592195 ext. 1681.
Correo electrnico: maribel.ovando@unison.mx
Palabras clave: compuestos fenlicos, capacidad antioxidante, bioaccesibilidad

Introduccin
Los metabolitos secundarios sintetizados por las plantas, aunque no son considerados
nutrientes esenciales para el humano, ejercen funciones biolgicas como
anticancergenos, antimutagnicos, antimicrobianos y antioxidantes. Las diversas
variedades de chile Capsicum annuum que existen en Mxico han sido estudiadas por su
contenido de compuestos bioactivos y capacidad antioxidante. Entre los compuestos
bioactivos sintetizados por estas plantas se encuentran compuestos hidroflicos (vitamina
C y polifenoles) y lipoflicos (vitamina E, carotenoides y capsaicinoides, stos ltimos
responsables del sabor pungente de este fruto) (3). De acuerdo a Hayano-Kanashiro y
col. (3), Capsicum annuum L. var. glabriusculum conocido como chiltepn representa una
fuente importante de polifenoles con propiedades antioxidantes. La evaluacin de la
capacidad antioxidante de los compuestos presentes en el chiltepn es de gran
importancia debido a que podran relacionarse con la reduccin y/o prevencin de
enfermedades crnico-degenerativas y cncer. Para que los compuestos fenlicos
presentes en chiltepn ejerzan las propiedades antes mencionadas, necesitan ser
liberados de la matriz alimentaria (bioaccesibilidad) y absorbidos a lo largo del tracto
gastrointestinal (biodisponibilidad), para distribuirse en diferentes tejidos diana y cumplan
su accin biolgica (4). Por lo tanto, el objetivo del presente trabajo fue determinar el
contenido de fraccin indigestible (FI), as como la capacidad antioxidante y
bioaccesibilidad de los compuestos fenlicos de chiltepn bajo condiciones de digestin in
vitro para dilucidar el porcentaje de estos liberados de la matriz alimentaria del fruto.

Metodologa
Material: Se utiliz fruto de chiltepn rojo seco, cosecha 2016, el cual se adquiri en el
comercio local de la ciudad de Hermosillo, Sonora, Mxico. El fruto entero se moli y
almacen a 4 C para posteriores anlisis.
Extraccin y determinacin de fenoles y flavonoides totales: La extraccin de
compuestos fenlicos se realiz con metanol: agua (70:30, v/v), a partir del cual se
determin el contenido de fenoles (FT) y flavonoides totales (FLT) mediante mtodos ya
reportados, utilizando una curva de cido glico y quercetina, respectivamente (1).
Capacidad antioxidante: La capacidad antioxidante (CAOX) de los extractos se
determin con los mtodos de ABTS y DPPH descritos por Hervert-Hernndez y col. (4),
utilizando trolox como estndar de referencia.
Perfil de fenoles mediante HPLC-DAD: El perfil de compuestos fenlicos en los
extractos de chiltepn se obtuvo con un HPLC acoplado a un arreglo de diodos, donde la
muestra filtrada se inyect (20 L) y analiz de acuerdo al mtodo de Cantos y col. (2).
Para identificar el perfil de compuestos fenlicos se inyectaron estndares de cido glico,
cido 4-hidroxibenzoico, cido clorognico, cido cafico, cido p-cumrico, resveratrol,
quercetina y luteolina.
Digestin in vitro: La bioaccesibilidad de los compuestos fenlicos de chiltepn se evalu
de acuerdo al mtodo de digestin in vitro reportado Hervert-Hernndez y col. (4). El
mtodo consisti en la simulacin de las etapas de digestin estomacal, intestinal, y

174
Investigaciones en Ciencia e Inocuidad de Alimentos

simulacin de difusin pasiva mediante dilisis de las muestras contra agua. Para el
anlisis de bioaccesibilidad en las distintas etapas de digestin, se llev a cabo la
determinacin del contenido de FT, FLT, CAOX (DPPH y ABTS) y anlisis del perfil de
compuestos fenlicos mediante tcnicas antes mencionadas. Por otro lado, tambin se
determin el contenido de fraccin FI soluble (FIS), insoluble (FII) y total (FIT), como una
alternativa a la determinacin de fibra diettica.
La bioaccesibilidad de los FT y FLT se estim como la fraccin del compuesto bioactivo
liberada de la muestra en cada etapa de digestin, respecto al contenido de compuesto
bioactivo en la muestra original sin proceso de digestin, la cual se expres en porcentaje.
Perfil de fenoles en muestras de digestin in vitro: De las muestras obtenidas de la
digestin in vitro, se realiz una extraccin lquido-lquido de los compuestos fenlicos con
dietil ter:acetato de etilo (50:50, v/v). La fase orgnica se retir y coloc en un tubo de
ensaye, repitiendo el procedimiento 2 veces. La fase orgnica se llev a sequedad con
nitrgeno, se reconstituy en metanol puro y se filtr (6). El perfil de compuestos fenlicos
se determin mediante HPLC-DAD de acuerdo a la metodologa descrita anteriormente.
Anlisis estadstico: Cada determinacin se realiz por triplicado. Los resultados se
expresaron como la media desviacin estndar. Se realiz un ANOVA de una va
utilizando el paquete estadstico JPM, versin 7.0. Las diferencias estadsticas
significativas (p0.05) entre medias se realizaron con una prueba de Tukey.

Resultados y discusin
Se determin el contenido de FIS, FII y FIT en fruto de chiltepn para conocer la fraccin
de matriz alimentaria que no fue hidrolizada por las enzimas digestivas, y que, por lo
tanto, no es biodisponible en el intestino delgado. Se observ que el chiltepn present un
valor de FIT de 39.814.56 g/100g, del cual 37.033.92 g/100g corresponde a la FII,
mientras que el 2.780.75 g/100g corresponde a la FIS. La cantidad de FII y FIS result
similar a la reportada en variedades de chile de rbol y Morita, colectados en Acapulco,
Mxico (4). De acuerdo a estos datos, el valor de FII en chiltepn indican que este fruto
representa una fuente de fibra diettica que puede ser sustrato para la microbiota durante
el proceso de fermentacin colnica. Por otro lado, la FII y FIS de chiltepn podran
contener compuestos fenlicos asociados, los cuales pueden ser 1) fermentados,
metabolizados, absorbidos mediante el epitelio intestinal y distribuidos a diferentes tejidos
diana mediante circulacin sistmica, o 2) no ser absorbidos, pero pueden crear un
ambiente antioxidante en el colon, contrarrestando los radicales libres generados durante
el metabolismo bacteriano (8).
El contenido de FT, FLT, CAOX y perfil de compuestos fenlicos en fruto entero de
chiltepn sin y con proceso de digestin in vitro se muestra en la Tabla 1. Se observ que
el contenido de FT en la fase intestinal fue similar al fruto entero, mientras que el
contenido de FLT en la misma fase de digestin fue menor respecto al fruto entero. Sin
embargo, durante la fase de difusin pasiva, en la cual se cuantificaron los polifenoles
retenidos en la membrana de dilisis, se encontraron valores de FT:0.31 mg EAG/g y
FLT:2.97 mg EQ/g, los cuales fueron bajos en comparacin con los valores iniciales del
fruto entero. Cabe mencionar que en la difusin pasiva se evalu la simulacin de la
absorcin de los compuestos fenlicos a travs de la barrera intestinal. Dicha fraccin de
compuestos fenlicos retenidos en la difusin pasiva indica que los valores observados
corresponden a la fraccin de compuestos fenlicos asociada a la FIS que no lograron ser
absorbidos, los cuales pasarn al coln en donde pueden ser hidrolizados por la
microbiota colnica y generar un ambiente antioxidante, benfico para la salud intestinal.
Por otro lado, esto indica que la mayor parte de los FT y FLT son liberados de la matriz
del fruto entero de chiltepn, es decir, presentan valores de 96% y 80% de
bioaccesibilidad, respectivamente (Figura 1). Los valores de bioaccesibilidad de FT

175
Investigaciones en Ciencia e Inocuidad de Alimentos

encontrados en este trabajo fueron mayores a los reportados para chile de rbol, chipotle,
guajillo y morita colectados en Acapulco, Mxico, con un valor de ~75% (4). De acuerdo a
Hervert-Hernndez y col. (4), esto podra atribuirse a que los compuestos fenlicos
presentes en el chiltepin son de bajo peso molecular y por tanto presentan una mayor
bioaccesibilidad comparados con aquellos de otras frutas y vegetales; adems, dichos
valores de bioaccesibilidad podran deberse a la ausencia de proantocianidinas,
resistentes a la accin de las enzimas digestivas (4).

Tabla 1. Contenido de FT, FLT, CAOX y perfil de compuestos fenlicos en chiltepn antes
y despus del proceso de digestin in vitro*.
Fase Fase Difusin
Parmetro Fruto entero
estomacal intestinal pasiva**
FT (mg EAG/g) 8.310.44a 6.680.26b 7.980.60a 0.310.01c
a c b
FLT (mg EQ/g) 15.451.52 3.820.20b 4.630.37 2.970.69c
DPPH (mol ET/g) 27.431.11b 12.863.57c 39.601.52a 6.172.45d
a c
ABTS (mol ET/g) 105.1911.18 14.421.72 ND 25.577.46b
cido 4-hidroxibenzoico
0.110.03a 0.0350.003b 0.0750.068ab ND
(mg/g)
a b b
cido clorognico (mg/g) 0.090.03 0.0010.000 0.0030.005 ND
a b c
cido cafeico (mg/g) 0.610.04 0.1200.024 0.0090.008 ND
cido p-cumrico (mg/g) 0.070.02a 0.0390.007b 0.0150.014c ND
Resveratrol (mg/g) 0.010.00a 0.0020.001c 0.0070.004b ND
Quercetina (mg/g) 0.050.01a 0.0070.003b 0.0160.013b ND
a b b
Luteolina (mg/g) Col 8
0.120.01 0.0120.001 0.0110.012 ND
*Media desviacin estndar, Coln=3.
9 Valores en cada rengln con diferente subndice (a-d) indican diferencias
Col 10 Prueba de Tukey. mg EAG/g: miligramos equivalentes de cido glico/g de
estadsticas significativas (p<0.05),
Col 11
muestra. mg EQ/g: miligramos equivalentes de quercetina/g de muestra. mol ET/g: micromol equivalentes
trolox/g de muestra. ND: no detectado. **Polifenoles no bioaccesibles, retenidos en membrana de dilisis.

110
a
100 a
Fruto entero (100%)
90 Fase estomacal
b a
80 Fase intestinal
% Bioaccesibilidad

Difusin pasiva
70

60

50

40
b
30 c
20

10

0
FT FLT

Fig. 1. Bioaccesibilidad de FT y FLT de chiltepn en diferentes fases de digestin in vitro.


Media desviacin estndar, n=3.

En fruto entero el compuesto fenlico mayoritario fue cido cafeico, seguido de luteolina, y
cido 4-hidroxibenzoico (Tabla 1). Este perfil fue similar al reportado por Rochin-Wong y
col. (7) en muestras de chiltepn de lamos, Sonora. Por otro lado, la presencia de
quercetina y luteolina tambin ha sido reportada en diferentes variedades de Capsicum

176
Investigaciones en Ciencia e Inocuidad de Alimentos

annuum L. (5). Despus del proceso de digestin in vitro, se observ una disminucin de
los compuestos fenlicos de chiltepn tanto en fase estomacal e intestinal. Esto podra
estar relacionado con la estabilidad de los compuestos fenlicos bajo las diferentes
condiciones de pH, lo cual pudiera estar ocasionando cambios en la molcula, as como la
interaccin de estos con la FIS y FII. En el caso de la difusin pasiva, el que no se haya
detectado la presencia de ningn compuesto fenlico coindice con los valores de
bioaccesibilidad, tanto para fenoles y flavonoides totales. Sin embargo, se cuantificaron
FT y FLT no bioaccesibles, lo que indica que una pequea porcin de fenoles form
interacciones con la FIS evitando su paso a travs de la membrana de dilisis, que hubo
cambios en la estructura de los compuestos fenlicos que no fue posible identificarlos
mediante HPLC-DAD. A pesar de que hubo una disminucin en el perfil de compuestos
fenlicos de chiltepn despus del proceso de digestin in vitro, se observ CAOX en cada
una de las fases de digestin. Esto podra deberse a la presencia de carotenoides,
capsaicinoides, vitamina C, entre otros, los cuales pudieran contribuir con estos valores
de CAOX.

Conclusiones
Los valores de FII, FIS y FIT en chiltepn indican que este fruto es una fuente de
carbohidratos indigestibles, los cuales podran tener asociados compuestos fenlicos y
causar efectos benficos a nivel colon. Por otro lado, las condiciones simuladas del tracto
gastrointestinal ejercieron un efecto sobre el contenido de compuestos fenlicos de
chiltepn en las diferentes fases de digestin, no obstante, estos compuestos fenlicos
mostraron un valor alto de bioaccesibilidad y capacidad antioxidante durante la simulacin
de absorcin por difusin pasiva. Se recomienda el uso de HPLC-MS para corroborar el
perfil de compuestos fenlicos, as como tambin simular 1) el proceso de absorcin de
dichos compuestos mediante clulas Caco-2 y 2) estudios de fermentacin in vitro de los
fenoles asociados a la FII y FIS de chiltepn.

Bibliografa
1. Blanco-Ros, A. K., Medina-Jurez, L. ., Gonzlez-Aguilar, G. A., and Gmez-Meza, N. 2013.
Antioxidant activity of the phenolic and oily fractions of different sweet bell peppers. J. Mex.
Chem. Soc. 57(2):137-143.
2. Cantos, E., Garca-Viguera, C., de Pascual-Teresa, S., and Toms-Barbern, F.A. 2000. Effect
of postharvest ultraviolet irradiation on resveratrol and other phenolic compounds of Cv.
Napoleon table grapes. J. Agric Food Chem. 48:4606-4612.
3. Hayano-Kanashiro, C., Gmez-Meza, N., and Medina-Jurez, L. . 2016. Wild pepper L. var.:
taxonomy, plant morphology, distribution, genetic diversity, genome sequencing, and
phytochemical compounds. Crop Sci. 56(1):1-11.
4. Hervert-Hernndez, D., Syago-Ayerdi, S. G., and Goi, I. 2010. Bioactive compounds of four
hot pepper varieties (Capsicum annuum L.), antioxidant capacity, and intestinal bioaccessibility.
J. Agric. Food Chem. 58(6):3399-3406.
5. Materska, M., and Perucka, I. 2005. Antioxidant activity of the main phenolic compounds
isolated from hot pepper fruit (Capsicum annuum L.). J. Agric. Food Chem. 53(5):1750-1756.
6. Mattila, P., and Kumpulainen, J. 2002. Determination of free and total phenolic acids in plant-
derived foods by HPLC with diode-array detection. J. Agric. Food Chem. 50(13):3660-3667.
7. Rochn-Wong, C., Gmez-Meza, N., Montoya-Ballesteros, L., and Medina-Jurez, L. (2013).
Efecto de los procesos de secado y encurtido sobre la capacidad antioxidante de los
fitoqumicos del chiltepn (Capsicum annuum L. var. glabriusculum). Rev. Mex. Ing. Quim.
12(2):227-239.
8. Saura-Calixto, F., Garca-Alonso, A., Goi, I., and Bravo, L. 2000. In vitro determination of the
indigestible fraction in foods: an alternative to dietary fiber analysis. J. Agric. Food Chem.
48(8):3342-3347.

177
Investigaciones en Ciencia e Inocuidad de Alimentos

Glicacin de protenas del tejido conectivo de calamar (Dosidicus gigas) va


reaccin de Maillard y su potencial antihipertensivo in vitro
1 1 1 2
Mondaca-Navarro B.A. ; Rodrguez-Ramrez R. , Valle-Sanchez S.L. , Torres-Arreola W. ; Lpez-
1 3 4
Cervantes J. ; Hernndez- Mendoza A. y vila-Villa L.A.
1
Laboratorio de Biotecnologa y Trazabilidad Molecular de los Alimentos. Instituto Tecnolgico de
Sonora, 5 de Febrero 818 Sur, 85000 Ciudad Obregn, Sonora, Mxico. Tel: +52644-4100900.Fax:
+52-644-4109001.
2
Departamento de Investigacin y Posgrado en Alimentos (DIPA), Universidad de Sonora,
Hermosillo, Sonora, Mxico
3
Laboratorio de Qumica y Biotecnologa de Productos Lcteos, Coordinacin de Tecnologa de
Alimentos de Origen Animal, Centro de Investigacin en Alimentacin y Desarrollo, A.C. (CIAD),
Carretera a La Victoria Km. 0.6, Apartado 1735, Hermosillo, Sonora, Mxico 83304
4
Departamento de Ciencias de la Salud, Universidad de Sonora, Campus Cajeme, Blvd. Bordo
Nuevo s/n Ejido Providencia, Ciudad Obregn, Sonora, Mxico

Palabras clave: Capacidad Antihipertensiva, Reaccin de Maillard, Glicacin.

Introduccin
Durante los ltimos aos, se ha creado conciencia sobre la importancia de correlacionar la
salud-alimento y lograr conjugar el valor nutricional, bioactividad y propiedades
organolpticas mejoradas a las ya existentes en los alimentos, as como su interaccin en
los sistemas biolgicos, mismos que ayuden a la prevencin de enfermedades, por lo que
la bsqueda de propiedades bioactivas utilizando modificaciones qumicas o enzimticas
en protenas es de inters para la industria alimentaria. Sin embargo algunos mtodos
para este fin son costosos y/o txicos. hoy en da la glicosilacin de protenas va
reaccin de Maillard (RM) representa una alternativa segura debido a que este mtodo no
utiliza reactivos qumicos que pudieran ser perjudiciales para la salud, donde a su vez
esta modificacin postraduccional est relacionada con el incremento de la bioactividad
en algunas protenas. Actualmente se desconoce la caracterizacin y bioactividad de las
protenas de los desechos de calamar glicosiladas va RM. Por lo que el objetivo del
presente trabajo es desarrollar las condiciones de glicacin, su caracterizacin parcial y
determinar su potencial antipertensivo in vitro en protenas de tejido conectivo del calamar
(Dosidicus gigas).
Materiales y mtodos
Obtencin de protenas del tejido conectivo de calamar (PTC). La obtencin de PTC
fue de acuerdo a Ando et al 2006 (1) con algunas modificaciones la cual consisti en tomar
250 gr de tejido conectivo los cuales fueron troceados, lavados y homogenizados en 0.1
M de NaOH, dejndolos en reposo 24h. Posteriormente se centrifugo a 8800 g (40min), y
el precipitado fue centrifugado nuevamente a 8800 g (30min) con agua desionizada (1:3
p/v), esta etapa se repiti 3 veces. Despus se dej en reposo 24 h con pepsina (10mg/g
de PTC en cido actico 0.5 M). El sobrenadante fue dializado frente cido actico 0.05 M
en una membrana de celulosa de 12-14 kDa. Todo el proceso se realiz de 5-8C.
Preparacin de Glicoconjugados va RM. Las PTC fueron glicadas va RM con
Dextrano (Leuconostoc sp) 10 kDa y Glucosa; PTC-carbohidrato 1:3 (m/m). La mezcla fue
homogenizada a (5-8C, 12h). Despus el extracto fue calentado (6h a 50 C) en una
estufa de precisin, pasado el tiempo se detuvo la RM en un bao de inmersin en hielo.
Los glicoconjugados se realizaron por duplicado.

178
Investigaciones en Ciencia e Inocuidad de Alimentos

Anlisis del porcentaje de glicacin. Fue determinado indirectamente por el anlisis del
contenido de grupos amino libres por el mtodo OPA (o-ftaldialdehdo) con algunas
modificaciones(4). El reactivo OPA se preparo mezclando 40 mg de OPA (disuelto en 1 ml
de metanol), 25 ml de tetraborato de sodio 100 mM, 2,5 ml de 20% (p/v) de Dodecil
sulfato de sodio (SDS), y 100 L de -mercaptoetanol, seguido de la dilucin a un
volumen final de 50 ml con agua destilada. 25 L de la solucin de la muestra fueron
mezclados con 500 l de reactivo OPA. Despus se incub a 35C, durante 2 min y se
analizo en un espectrofotmetro UV/VIS Multiskan GO, Thermo Scientific a una 340
nm. Para medir el porcentaje de glicacin de los glicoconjugados se utiliz la siguiente
frmula:
Donde Ao es la absorbancia del blanco (extracto proteico calentado/Sin azcar) y Am es
la absorbancia de la muestra.
Espectroscopia de infrarrojo utilizando transformada de Fourier (FT-IR). El extracto
proteico as como los glicoconjugados formados fueron liofilizados. Las muestras fueron
analizadas a temperatura ambiente utilizando un NICOLET iS50 FT-IR de Thermo
Scientific equipado con ATR. Donde 25 mg de cada liofilizado fueron colocados en una
superficie de cristal ATR y se presionaron con mbolo de punta plana. Para cada espectro
se hicieron un promedio de 64 escaneos, a una resolucin de 4 cm-1 en un rango
espectral de 4000 a 500 cm-1
Actividad Inhibidora de la Enzima Convertidora de Angiotensina (ECA). La actividad
antihipertensiva se determin en base a Cushman y Cheung (1971)(2) con algunas
modificaciones. La cual consisti en utilizar un buffer sustrato Hipuril-L-Histidina-L-
Leucina (Hip-His-Leu) (HHL) 5 mM, en 100 Mm de borato de sodio y cloruro de sodio 300
mM a pH 8,3. La concentracin utilizada de la ECA fue de (0.1 U/mL) La inhibicin de la
ECA para Los glicoconjugados y enalaprilato (control+) fue colocandon 2 L de las
soluciones en una Drop Plate y fue medida a 228 nm en un espectrofotmetro UV/VIS.
Resultados y discusin
El porcentaje de glicacin para PTC-dextrano y PTC-glucosa fue de 17.20% y 13.06%,
respectivamente. Dichos porcentajes se muestran en la tabla 1.
Tabla 1. Porcentaje de Glicacin
Glicoconjugados (1:3, 6h) Porcentaje de Glicacin
a
PTC-Dextrano 17.20 0.95 (5.54)
b
PTC-Glucosa 13.06 0.40 (3.06)
Cifras con letras diferentes en cada columna muestran diferencias estadsticamente
significativas (Duncan, p 0.05) (n = 3). Porcentaje de glicacin SD (CV).

Otros trabajos(7), utilizando casena-dextrano (1:8, 60C y 6 h) se obtuvieron porcentajes


de glicacin del 13% . En este trabajo los glicoconjugados obtenidos tuvieron un
porcentaje de glicacion muy similar a pesar de ser una fuente proteica distinta, En la Fig 1
se muestra un espectro por FTRI tpico de los glicoconjugados obtenidos, como del
extracto proteico crudo de calamar.
Los espectros de FTIR de A: PTC as como de B: PTC-Dextrano (50 C- 6h) y C: PTC-
Glucosa (50 C- 6h) se muestran en la figuras 1.

179
Investigaciones en Ciencia e Inocuidad de Alimentos

En el espectro tpico se observa que entre el PTC y los glicoconjugados existe una
diferencia en la amida A (3269-3280 cm-1), dichas bandas en los glicoconjugados
incrementan en comparacin con las PTC y esto es debido a una mayor presencia de
enlaces OH proveniente de los carbohidratos y las interacciones de enlaces de hidrgeno.
Por otra parte, en la banda de 1058 -1022 cm-1, el cual es atribuido a los enlaces C-O y C-
O-C de los carbohidratos se visualiza mayor intensidad de vibracin en los
glicoconjugados que en las PTC, debido a la conjugacin con los carbohidratos. Por
ltimo, el enlace amida I (1636-1644 cm-1) presenta menos absorcin en los
glicoconjugados comparado PTC, esto es debido a la primera etapa de la RM, donde se
condensa el grupo carbonilo con aminas primarias.
Los porcentajes de inhibicin de la ECA de los glicoconjugados a diferentes
concentraciones (0.1 mg/mL y 0.05 mg/mL) se visualizan en la tabla 2; y la curva de
calibracin del logaritmo de la concentracin de enalaprilato (control +) en contra del
porcentaje de inhibicin en la figura 2.

Figura 2. Curva de calibracin del logaritmo de la concentracin de enalaprilato en contra


del porcentaje de inhibicin.
Tabla 2. Porcentajes de Inhibicin de la ECA
Concentracin
Muestra
0.1 mg/mL 0.05 mg/mL
a a
PTC 0h 111.25 7.8 (7.01) 87.35 3.77 (4.32)
ab b
PTC 6h 122.22 11.07 (9.06) 61.08 3.97 (5.92)
c a
PTC-Dextrano 6h 139.30 5.37 (3.85) 77.91 4.23 (5.42)
a c
PTC-Dextrano 0h 112.08 3.55 (3.17) 101.01 7.74 (7.66)
bc c
PTC-Glucosa 6h 134.55 11.50 (8.54) 109.58 3.81 (3.48)
a c
PTC-Glucosa 0h 109.58 6.29 (5.74) 105.83 3.81 (3.60)

180
Investigaciones en Ciencia e Inocuidad de Alimentos

Cifras con letras diferentes en cada columna muestran diferencias estadsticamente significativas
(Duncan, p 0.05) (n = 3). Porcentaje de inhibicin de la ECA SD (CV).

Respecto a la capacidad antipertensiva in vitro, esta resulto mayor al 100 % en cuanto a


la inhibicin de la ECA para las concentraciones de 0.1 mg/mL y 0.05 mg/mL en los
tratamientos PTC-(dextrano, glucosa) 0h, y PTC-glucosa 6h. Sin embargo, valores de
inhibicin del 87.35, 61.08 y 77.91% se encontraron en los tratamientos PTC 0h, PTC 6h y
PTC-Dextrano 6h respectivamente. Dicho valores pudiera deberse a la posible formacin
de pptidos provenientes de los glicoconjugados como a los productos formados por la
RM los cuales estn relacionados con el aumento de la inhibicin de la ECA5. Ejemplo de
esto fue demostrado en sistema en caseina-xilosa3. Es importante mencionar que la
actividad de la ECA est relacionada con la concentracin de Zn, y con la quelacin de
metales de transicin o su actividad antioxidante; que pudieran presentar las
glicoprotenas y los productos de la RM presentes, sin embargo otros autores expresan
que el mecanismo de accin de los productos formados en la RM sobre la ECA es
desconocido. Por lo tanto, son necesarios ms estudios para entender el mecanismo de
inhibicin de la ECA en la glicosilacin de protenas 4.
Conclusiones
El mayor grado de glicacion en la proteinas del tejido conectivo de calamar fue mediante
el uso de Dextrano. El anlisis de los espectros de FT-IR indicaron que las bandas de
amida I, II y III de los glicoconjugados se modificaron mediante la glicacin con respecto al
extracto crudo, donde dichos glicoconjugados a la concentracin de 0.1mg/m presentaron
porcentajes de inhibicin de la ECA mayores al 100%. En base a los resultados obtenidos
en el presente estudio, se puede inferir que las protenas de calamar gigante (Dosidicus
gigas) glicosiladas va RM puede ayudar al desarrollo de nuevos alimentos o ingredientes
con propiedades bioactivas. Sin embargo, para la aplicacin de la protena modificada va
RM de origen alimentario, se necesita ms investigacin respecto a otras bioactividades
que pudieran presentar los gliconjugados.

Bibliografa
1. Ando M., Nakagishi Y., Yoshida K., Nakao M., Nakagawa., Makinodan Y., Tsukamasa &
Kawasaki Y., (2006). Pyridinoline concentrations in muscular and skin collagen of sh and
relationship between collagen solubility and pyridinoline concentration in sh muscular
collagen. Fisheries Scienc,; 72: 11041108.
2. Cushman, D.W., & Cheung, H.S. (1971). Spectrophotometric assay and properties of the
angiotensin-converting enzyme of rabbit lung. Biochemistry and Pharmacology, 20, 1637
1648.
3. Hong Xu., Meng Jun& Rong-Rong Lu., (2014). Improvement of ACE inhibitory activity of
casein hydrolysate byMaillard reaction with xylose. J Sci Food Agric; 95: 6671.
4. Hwang G,I., Kim Y,H., Woo S,K., Lee ,J., Jeon S,H. (2011) Biological activities of Maillard
reaction products (MRPs) in a sugaraminoacid model system. Food Chemistry 126:221
227.
5. Jiang Z., Wang L., Wua W. and Wang Y. (2013). Biological activities and physicochemical
properties of Maillard reaction products in sugarbovine casein peptide model systems.
Food Chemistry 141, 38373845.
6. Mu L., Zhao H., Zhao M., Cui Ch., Liu L. (2011): Physicochemical properties of soy protein
isolates- acacia gum conjugates. Czech J. Food Sci., 29: 129136.
7. Xiaoyun P., Minfang M., Bin H., Ping Y. and Ming J. (2005). Micellization of Casein-graft-
Dextran Copolymer Prepared through Maillard Reaction. Byopolimers, Vol. 81, 29-38.
Wiley, Periodicals, Inc.sun

181
Investigaciones en Ciencia e Inocuidad de Alimentos

Estudio del potencial antimicrobiano de plantas medicinales y comestibles


1 2 2 1
Carrillo Inungaray, M.L. , Aguirre Aguirre E.A. , Cueto Wong, C. , y Reyes Mungua, A.
1
Unidad Acadmica Multidisciplinaria Zona Huasteca. Universidad Autnoma de San Luis Potos,
2
Romualdo del Campo No. 501, Fracc. Rafael Curiel, C.P. 79060. Cd. Valles, S.L.P. Universidad
Autnoma de Coahuila. Carretera Torren Matamoros Km. 7.5, Ejido el guila, 27275 Torren,
Coah. E-mail: abigail.reyes@uaslp.mx
Palabras clave: extractos naturales, difusin en disco, concentracin mnima inhibitoria

Introduccin
Los compuestos antimicrobianos provenientes de plantas han sido utilizados para el
tratamiento de enfermedades infecciosas [4]. De las 21,000 plantas que son usadas con
propsitos medicinales alrededor del mundo [5], en Mxico solo se utilizan 5000 especies
para el uso teraputico [1]. Por su parte en algunos tratamientos con plantas se ha
demostrado que tienen actividad antimicrobiana y pueden utilizarse como conservadores
en los alimentos. En la Huasteca Potosina se cuenta con una amplia diversidad de plantas
que los pobladores consumen y usan con fines medicinales y que no han sido estudiadas
en relacin a sus propiedades biolgicas [1]. Una de ellas es la actividad antimicrobiana,
la cual se debe principalmente a los metabolitos secundarios como fenoles, flavonoides,
alcaloides y terpenoides que no son esenciales para las plantas, pero que desempean
un papel importante en el sistema de defensa contra la proteccin de patgenos [6]. Por lo
que el objetivo de este trabajo fue estudiar la actividad antibacteriana de mohuite (Justicia
spicigera), quelite (Amaranthus hybridus), frijol sarabando (Vigna unguiculata),
maduraplatano (Hamelia patens), soyo (Ipomoea puga), chaya (Cnidoscolus aconitifolius),
hoja santa (Piper auritum), flor de cempaschil (Tagetes erecta), hoja de (Moringa
oleifera), semilla de M. oleifera y caf (Coffea sp.) que comnmente se usan con fines
medicinales y comestibles en la regin de la Huasteca Potosina.

Metodologa
Obtencin del extracto
Para obtener el extracto de las diferentes plantas se utiliz el mtodo de maceracin. El
extracto se filtr en papel filtro de poro mediano (0.19 mm con retencin de partculas de
8-12 m), se esteriliz por filtracin en membrana Whatman de 2 m y se almacenaron a
4C hasta su uso.

Preparacin del inculo


Las cepas bacterianas (Staphylococcus aureus, Escherichia coli y Salmonella
typhimurium) fueron proporcionadas por el Laboratorio de Investigacin en Alimentos de
la U.A.S.L.P. Para revitalizar las cepas, stas se inocularon en 5 mL de caldo nutritivo y
se incubaron a 35C durante 24 h. Pasado el tiempo de incubacin se inoculo en agar
Mueller-Hinton. A partir de este cultivo se prepararon suspensiones bacterianas,
transfirindolas a tubos con 10 mL de solucin salina al 0.85% w/v hasta alcanzar una
turbidez similar al estndar 0.5 de la escala de McFarland equivalente a 1-2 x 108 UFC/mL
(absorbancia de 0.08-0.13 a 625 nm) [3].

Tamiz fitoqumico
Los compuestos presentes en los extractos de las 11 plantas se identificaron mediante
ensayos fitoqumicos usando reacciones de color. Alcaloides (pruebas de Mayer y de

182
Investigaciones en Ciencia e Inocuidad de Alimentos

Wagner), esteroles (reaccin de Liebermann-Burchard), flavonoides (prueba del H2SO4),


saponinas (prueba de Salkowski) y oxidrilos fenlicos (prueba del FeCl3).

Actividad antibacteriana
La actividad antimicrobiana se midi a partir de los halos de inhibicin observados al usar
la tcnica de difusin en disco, mtodo de Kirby Bauer. Se inocularon 3 L de las cepas
bacterianas en la superficie del agar Muller Hinton, se colocaron seis discos de papel filtro
(Whatman) de 6.0 mm de dimetro y se impregnaron con 20 L de cada uno de los
extractos a diferentes concentraciones y con las sustancias usadas como control. Como
control negativo se us agua destilada y como control positivo azitromicina, un antibitico
de amplio espectro. Las pruebas se efectuaron por triplicado.

Concentracin Mnima Inhibitoria (CMI)


La CMI de los extractos hidroalcohlicos sobre las diferentes bacterianas, se realiz por el
mtodo de microdilucin.

Resultados y discusin
Se realizaron estudios preliminares a las 11 plantas, y al realizar el tamiz fitoqumico se
encontr que los extractos de hojas de M. oleifera, semillas de M. oleifera, flor de T.
erecta y H. patens, contienen compuestos fenlicos, flavonoides y alcaloides a los cuales
se les atribuye la actividad antimicrobiana. De los cuatro extractos estudiados slo el
extracto de T. erecta present efecto inhibitorio sobre las tres bacterias utilizadas, las
semillas de M. oleifera slo presentaron actividad sobre la S. thypimurium, mientras que la
H. patens solo en S. aureus. Sin embargo, las hojas de la M. oleifera no presentaron
actividad inhibitoria sobre ninguna de las bacterias. La Tabla 1 muestra los halos de
inhibicin de los microorganismos con los diferentes extractos, as como el efecto
inhibitorio del antibitico usado como control positivo.

Tabla 1. Zona de inhibicin (mm) de microorganismos utilizados en los diferentes extractos curdos.
Extractos Bacterias

E. coli S. aureus S. thypimurium

Hojas de M. oleifera - - -

Semillas de M. oleifera - - 10.3 0.6

Flor de Tagetes erecta 10 0.9 11.7 1.5 18.7 2.1

Hojas de H. patens - 9.7 1.2 -

Azitromicina (control positivo) 22.3 1.2 24 1.0 26.7 0.6

-= sin actividad

183
Investigaciones en Ciencia e Inocuidad de Alimentos

En la Figura 1 se muestran los halos de inhibicin del extracto etanlico de T. erecta para
las diferentes bacterias utilizadas. Se observ que el extracto difundi en el medio de
cultivo, sin embargo, los halos de inhibicin fueron menores en comparacin con el control
positivo, lo que se atribuy a que ste es ya el compuesto con actividad antibacteriana
comprobada mientras que en el extracto hay una mezcla de compuestos bioactivos.

a) b) c)

Figura 1. Efecto inhibitorio del extracto de la flor de cempaschil en diferentes bacterias. a) S. aureus. b)
E.coli. c) S. thypimurium

Como una confirmacin de su actividad antibacteriana se obtuvo la CMI para los cuatro
extractos. Se comprob que T. erecta tiene un comportamiento similar a la Azitromicina
en E. coli inhibiendo la bacteria a una concentracin de 0.93 y 0.39 respectivamente. As
como la actividad antibacteriana de los otros extractos, que en el mtodo de difusin en
disco no se pudo apreciar. En la Tabla 2 se muestra la CMI de cada extracto para las
bacterias de E. coli y S. aureus.

La comparacin de resultados de investigaciones realizados en plantas suele ser difcil,


debido al uso de tcnicas no estandarizadas, la preparacin y el tamao del inculo,
medio de cultivo y las condiciones de incubacin [2]. En relacin a H. patens los
resultados obtenidos en la actividad antibacteriana difieren de los reportados por [7]
quienes comprobaron la actividad antimicrobiana en diferentes bacterias, lo cual
atribuyeron al contenido de compuestos fenlicos especialmente a los taninos, sin
embargo, coinciden en la CMI ya que reportaron 12.5 mg/mL y 25 mg/mL para E. coli y S.
aureus respectivamente. Esto se debe principalmente a la tcnica de obtencin del
extracto, as como a la concentracin del solvente y su proporcin con la planta utilizada.

Por otro lado, evaluaron el extracto de flor de T. erecta donde obtuvieron halos de
inhibicin que oscilaban entre los 10 y 25 mm para diferentes bacterias, los cuales
coinciden con los resultados reportados en este trabajo.

184
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2. Concentracin mnima inhibitoria de los diferentes extractos.

Extractos CMI (mg/mL)

E. coli S. aureus

T. erecta 0.93 7.5

H. patens 10.62 21.25

M. oleifera 31.25 31.25

Semilla de M. oleifera 13.75 55.0

Azitromicina (control positivo) 0.39 0.78

Conclusiones
De las plantas estudiadas, la flor cempaschil (T. erecta) fue la que tiene mayor potencial
antimicrobiano que las dems; de las bacterias estudiadas E. coli fue ms susceptible que
S. aureus. El hecho que las otras plantas no tengan actividad antimicrobiana puede
considerarse benfico para su consumo. Los resultados de este trabajo abren un campo
de estudio en el uso de esta flor tradicional de Mxico para la obtencin de compuestos
con actividad biolgica.

Bibliografa
1. Alonso-Castro, A. J., Maldonado-Miranda, J. J., Zarate Martinez, A., Jacobo-
Salcedo, M. R., Fernndez-Garcia, C., Figueroa-Zuiga, L. A., Rios-Reyes, N. A.,
len-Rubio, M. A., Medelln-Castillo, N. A., Reyes-Munguia, A., Mndez-Martinez,
R., Carranza-Alvarez, C. (2012). Medicinal plants used in the Huasteca Potosina,
Mxico. Journal of Ethnopharmacology. 143, 292-298.
2. Balouiri, M., Sadiki, M., & Ibnsouda, S. M. (2016). Methods for in vitro evaluating
antimicrobial activity: A review. Journal of Pharmaceutical Analysis. 6, 71-79.
3. Cockerill, R., Wikler, A., & Alder, J. (2012). Methods for Dilution Antimicrobial
susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard. USA:
Clinical and laboratory standards institute. 32(2), 12.
4. Domingo, D. & Lopez-Brea, M. (2003). Plantas con accin microbiana. REV ESP
QUIMIOTERAP. 16 (04), 386-393.
5. Garg, N., & Vijaya, P. (2016). Potencial of Herbal Medicines: A review. 6(4), 48-49.
6. Geetha., & Padal, S.B. (2014). Antibacterial Activity in Extract of Bauhinia. Vahlii.
BMR Microbiology. (1), 1-4.
7. Okoye, E. L., & Ezeogo, J. I. (2016). Antimicrobial Activity of the Crude Extracts of
Hamelia patens on Some Selected Clinical Samples. Journal of Complementary
and Alternative Medical Research. 1(1), 1-7.

185
Investigaciones en Ciencia e Inocuidad de Alimentos

Actividad antibacteriana de desinfectantes utilizados en la industria


alimentaria en Mxico
Iiguez Moreno, M., Iiguez Moreno, E., Sols Velzquez, O.A., Guerrero Medina P.J., Avila
Novoa, M.G y Gutirrez Lomel, M.
Laboratorio de Microbiologa. Departamento de Ciencias Mdicas y de la Vida. Centro Universitario
de la Cinega, Universidad de Guadalajara. Av. Universidad 1115 Col. Lindavista, Ocotln, Jal.
C.P. 47810. Tel. (392) 92 5 94 00 Ext. 48462. lun_mari@hotmail.com
Palabras clave: Desinfectantes, concentracin mnima inhibitoria, retos microbianos

Introduccin
Un desinfectante es un agente qumico que reduce a los microorganismos a niveles que
no daan la salud ni la calidad de los bienes perecederos (2). El proceso de desinfeccin
juega un rol vital en la industria de los alimentos (8). Actualmente, existen diferentes
mtodos de desinfeccin para las superficies de contacto y no contacto con los alimentos,
como los mtodos biolgicos, fsicos y qumicos, de los cuales estos ltimos son los ms
importantes (8). Los mtodos qumicos se utilizan comnmente para el control de
patgenos como Escherichia coli, Listeria monocytogenes, S. aureus y Salmonella, as
como microorganismos deterioradores como Pseudomonas (2). Al presente se dispone de
una amplia variedad de desinfectantes entre los cuales se encuentran los compuestos
cuaternario de amonio (QAC), agentes liberadores de halgenos, mezclas de cidos
orgnicos, perxido de hidrgeno (H2O2), extractos orgnicos, etc. La evaluacin de su
efectividad comprende tres etapas: i) evaluacin con clulas planctnicas, ii) evaluaciones
en clulas adheridas a superficies y iii) evaluaciones in situ. La evaluacin con clulas
planctnicas se basa principalmente en tres pruebas: i) concentracin mnima inhibitoria
(CMI), la cual es el estndar de oro para la determinacin de la susceptibilidad de un
organismo ante un antimicrobiano (3), ii) el coeficiente fenlico, que compara la
efectividad de los desinfectantes solubles en agua contra la efectividad del fenol, el cual
es considerado un buen desinfectante y iii) los retos microbianos, utilizados para evaluar
la efectividad de un desinfectante en 30 s (1). El objetivo de este estudio fue determinar la
efectividad y la CMI de 15 desinfectantes comnmente utilizados en la industria
alimentaria en Mxico.

Metodologa
Retos microbianos
La evaluacin de la efectividad de los desinfectantes (Tabla 1) se llev a cabo en funcin
a Association of Official Analytical Chemist (AOAC), Official Method 960.09 (1). Para lo
cual los microorganismos fueron cultivados en caldo soya tripticasa (TSB) por 24 h a 37
C (~108 UFC/mL). Las cepas de referencia para sta prueba son Escherichia coli ATCC
11229 y Staphylococcus aureus ATCC 6538, Pseudomonas aeruginosa ATCC 15442 y
Salmonella enterica serovar Choleraesius ATCC 10708; adems se incluyeron: S. aureus
ATCC 25923 y Listeria monocytogenes ATCC 19111. Los ensayos se realizaron por
triplicado. La temperatura promedio durante la prueba fue de 27 1.4 C.

Concentracin mnima inhibitoria (CMI)


Esta tcnica se realiz de acuerdo al protocolo del Clinical and Laboratory Standards
Institute (3) con breves modificaciones. Se realizaron diluciones de los diferentes
desinfectantes (se parti de la concentracin recomendada, Tabla 1) en tubos numerados
del 1-8; en seguida se adicion 1 mL de cultivo bacteriano (106 UFC/mL) en los tubos 1-8.
Al cabo de 5, 10 y 15 min de exposicin, se tomaron 20 L de cada dilucin y se
colocaron en 180 L de caldo Dey/Engley (D/E). En seguida se procedi a incubar 24 h/37

186
Investigaciones en Ciencia e Inocuidad de Alimentos

C y finalmente se realiz la interpretacin de los resultados como sigue: la concentracin


mnima inhibitoria fue la concentracin ms baja del biocida que inhibi el desarrollo
visible del microorganismo al cabo del periodo de incubacin. Cada ensayo se realiz por
triplicado, incorporando controles de inculo y de medio de cultivo. La temperatura
promedio durante la prueba fue de 26.3 0.8 C.

Tabla 1. Clasificacin de los desinfectantes


Concentraciones
Producto Agente activo recomendadas por
el fabricante (mg/L)
A QAC de tercera generacin 200
B QAC de quinta generacin 400
C QAC de tercera generacin ms cido fosfrico 200
D Hipoclorito de sodio 200
E Dixido de cloro 4000
F Iodo 25
G 80
cido peractico y perxido de hidrgeno
H 375
I cido peractico, cido actico y perxido de 53
J hidrgeno 200
K Perxido de hidrgeno 20000
L Perxido de hidrgeno y enzimas 1000 y 8000
M Extracto orgnico de semilla de toronja 2000
N Mezcla de surfactantes aninicos y cidos orgnicos 2000
O e inorgnicos 2000

Resultados y discusin
En Mxico, hay poca informacin sobre la regulacin y evaluacin de desinfectantes
utilizados en la industria alimentaria; slo existe una norma para la evaluacin de la
eficacia desinfectante la cual no es obligatoria (7). Mediante la tcnica de retos
microbianos se obtuvo que la mayora de los desinfectantes lograron reducir el 99.999%
de microorganismos en la suspensin; por lo que se obtuvo una alta eficacia in vitro. Para
el ensayo, las suspensiones bacterianas tenan una densidad celular de 7.720.56 Log10
UFC/mL, por lo que la tasa de reduccin obtenida permite clasificarlos como efectivos (1).
Los desinfectantes que mostraron diferencias en el nivel de eficacia fueron C para E. coli
ATCC 11229, S. aureus ATCC 25923 y L. monocytogenes ATCC 19111 y el K contra
ambas cepas de S. aureus. Slo para P. aeruginosa ATCC 15442, todos los
desinfectantes presentaron 99.999% de efectividad. En esta investigacin, los
desinfectantes tuvieron gran actividad tanto contra bacterias Gram-positivas como Gram-
negativas. Se ha recomendado que los desinfectantes para uso general deben ser
capaces de destruir una amplia gama de microorganismos comunes o patgenos (6).

La CMI se estim despus de 5, 10 y 15 min de contacto con el desinfectante (Tabla 1),


ya que el proceso de desinfeccin en la industria alimentaria no suele exceder los 15 min;
por lo tanto, los microorganismos en la industria alimentaria no estn en contacto con el
desinfectante durante 24 h, como ocurre en la prueba original (3). En este estudio, los
QAC de quinta generacin requirieron una menor concentracin para inhibir el crecimiento
de las bacterias Gram-negativas evaluadas, comparado con el desinfectante A (QAC de
tercera generacin) (p<0.05) despus de 5 min de exposicin (Fig. 1A). La eficacia de los
QAC aumenta segn la generacin; adems la longitud de la cadena alqulica es
importante en la actividad antimicrobiana de QAC, ya que la resistencia bacteriana

187
Investigaciones en Ciencia e Inocuidad de Alimentos

aumenta con su longitud (4). Adems, la resistencia de los microorganismos a los


desinfectantes est mediada por mltiples mecanismos de resistencia al mismo tiempo,
como los cambios en la pared celular, la adquisicin de genes, la presencia de bombas de
eflujo, entre otros (2). Cabe destacar que para el desinfectante C la CMI contra S. aureus
ATCC 25923 fue de cinco veces mayor a la concentracin recomendada por el fabricante
(Fig. 1A). Esto est relacionado con el hecho de que los QAC tienen una mayor eficacia a
pH bsico, que en un medio cido (4).
A

Fig. 1. CMI de los diferentes desinfectantes a tres tiempos de exposicin. Cada una
de las grficas representa la CMI de los 15 desinfectantes evaluados a tres tiempos de
exposicin A) CMI a los 5 min, B) CMI a los 10 min y C) CMI 15 min. Los
microorganismos utilizados en esta prueba fueron: E. coli ATCC 11229 , S.
Choleraesius ATCC 10708 , P. aeruginosa ATCC 15442 , S. aureus ATCC 25923 ,
S. aureus ATCC 6538 y L. monocytogenes ATCC 19111 .

188
Investigaciones en Ciencia e Inocuidad de Alimentos

Los agentes de liberadores de halgenos representan un importante grupo de


desinfectantes utilizados en la industria alimentaria; stos actan oxidando las protenas y
por lo tanto destruyen la actividad celular (6). La CMI de hipoclorito de sodio para los
microorganismos ensayados se situ entre 50 y 125 mg/L. Sin embargo, el agente
liberador halgeno ms eficaz fue el desinfectante F (basado en yodo) (p<0.05), cuyas
CMI oscilaron entre 1.56 y 6.25 mg/L (Figura 1). En consonancia con esto, se ha
reportado que 2.4x106 clulas/mL de S. Weltevreden fueron destruidas por exposicin a
10 mg/L de Cl2 durante 10 min; por otro lado, 1.9x106 clulas/mL fueron reducidas
despus de 5 minutos de exposicin a 10 mg/L de I2 (5).

El H2O2 es un potente agente oxidante, fcilmente manejable y no txico, pilar en el


tratamiento de superficies metlicas y en la desinfeccin de agua y alimentos (8). La CMI
del desinfectante K para S. aureus ATCC 25923 fue de 10000 y 7500 mg/L despus de 5
y 10 min de exposicin, respectivamente (p<0.05) (Fig. 1A-B). En general las CMI de los
desinfectantes a base de cido peractico fueron menores a las obtenidas con el H2O2
(p<0.05); debido a que las mezclas de H2O2 y cidos orgnicos, permiten estabilizar y
acelerar la actividad biolgica de H2O2, que tiene dbil y lenta actividad microbicida (6)

Conclusiones
Los 15 desinfectantes evaluados presentaron el 99.999% de efectividad para al
menos cuatro de los seis microorganismos de prueba.
nicamente contra P. aeruginosa ATCC todos los desinfectantes redujeron 5 Log 10
UFC/mL.
14 desinfectantes presentaron una CMI entre 1.14 y 128 veces inferior a la
concentracin recomendada por el fabricante.
Para todos los desinfectantes, la CIM a los 5 min fue de dos a cuatro veces mayor
que la concentracin con el mismo efecto a los 10 min; Adems, en la mayora de
los casos no hubo diferencias en la MIC a los 10 y 15 min.
Sin embargo, en las condiciones de prueba, no se consideraron los residuos orgnicos o
inorgnicos de los entornos de procesamiento de alimentos, el arns de agua, el efecto de
la superficie y otros factores que afectan la eficacia del desinfectante.

Bibliografa
1. AOAC International. Official Method 960.09 Germicidal and detergent sanitizing action of
th
disinfectants. In Horwitz W, ed. Official Methods of Analysis of AOAC INTERNATIONAL 18
ed. 2005. p. 1921. Arlington VA, USA.
st
2. Bal C., Hoffman P. and Rotter M. 2006. Disinfection: A view from the early 21 Century. Int. J.
Infect. Control 2:17.
3. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial
susceptibility testing; twenty-second informational supplement. Document M100-S22. Wayne,
PA: CLSI; 2012.
4. Ferreira JM. 2015. The quat advantage: Quaternary ammonium chloride and its advantages in
healthcare facilities. PDI Res. Dev. 15.
5. Joseph B., Otta S.K. and Karunasagar I. Biofilm formation by Salmonella spp. on food contact
surfaces and their sensitivity to sanitizers. Int. J. Food Microbiol. 64:367372.
6. McDonnell G. and Russell A.D. 1999. Antiseptics and disinfectants: activity, action, and
resistance. Clin. Microbiol. Rev. 12:147179.
7. NMX-BB-040-SCFI-1999. Mtodos generales de anlisis - Determinacin de la actividad
antimicrobiana en productos germicidas. Diario Oficial de la Federacin Mxico; 1999.
Disponible en: http://www.salud.gob.mx/unidades/cdi/nom/040ssa204.html Fecha de acceso:
enero de 2017.
8. Srey S., Jahid I.K. and Ha S-D. 2013. Biofilm formation in food industries: A food safety
concern. Food Control. 31:572585.

189
Investigaciones en Ciencia e Inocuidad de Alimentos

Aislamiento de agentes patgenos causantes de mastitis en hatos lecheros


caprinos del municipio de Venustiano Carranza, Michoacn
1 1 1 2
Iiguez Moreno, M., Gutirrez Lomel, M., Avila Novoa, M.G., Lpez Gmez, G., Mndez
2 2 2 2
Higareda, E.J., Flores Crisantos, R.A., Dvila Estrella, J.A., Nez Snchez, M., y Flores
2
Magalln, R.
1
Universidad de Guadalajara, Centro Universitario de la Cinega, Departamento de Ciencias
Mdicas y de la Vida, Laboratorio de Microbiologa. Av. Universidad 1115 Col. Lindavista, Ocotln,
Jalisco, C.P. 47810. Tel. (392) 92 5 94 00 Ext. 48462. lun_mari@hotmail.com
2
Instituto Politcnico Nacional. Centro Interdisciplinario de Investigacin para el Desarrollo Integral
Regional (CIIDIR), Unidad Michoacn, Laboratorio de Microbiologa. Justo Sierra 28 Col. Centro,
Jiquilpan Michoacn, C.P. 59510.

Palabras clave: Patgenos, mastitis, ganado caprino

Introduccin
La cabra es una de las especies que form parte de las primeras comunidades en la vida
de los humanos, desde los inicios de nuestra civilizacin. Para el ao 2007 la poblacin
de cabras a nivel mundial se estim en 850 millones de cabezas, de las cuales el 5 % se
encuentra en Amrica Latina, y de stas aproximadamente 9.5 millones estn en Mxico
(6,7). Mxico produce el 42.8 % del total de la leche de cabra en el continente Americano
con 155 millones de litros registrados durante el ao 2005, que con respecto a la
produccin de leche de vaca, representan el 1.6 % (7).

Existe una amplia variedad de factores que afectan la produccin leche en el ganado
caprino, uno de ellos es la mastitis, la cual es una enfermedad compleja que se refiere a
la inflamacin de la glndula mamaria, sea cual sea su etiologa, sta se puede presentar
mediante dos formas, la clnica, donde se pueden identificar los signos caractersticos de
la enfermedad como rubor, tumefaccin, dolor y cambios notables en la secrecin lctea
(1) y la mastitis subclnica, que es la ms importante debido a que no hay signos
caractersticos de la inflamacin, el animal se ve sano, la ubre no presenta inflamacin y
la leche parece normal (2); adems esta forma es de 15-40 veces ms prevalente que la
forma clnica y constituye un reservorio de microorganismos que pueden llevar a la
infeccin de del resto del rebao (2). Esta inflamacin es causada principalmente por
infeccin intramamaria con un patgeno, pero tambin puede ser causada por una lesin
(herida), menos frecuente por alergia y neoplasias (1). Actualmente, se han identificado
aproximadamente 130 especies causantes de mastitis, que se dividen en patgenos
contagiosos y ambientales; dentro de los primeros, los principales son Streptococcus
agalactiae, Staphylococcus aureus y Mycoplasmas; su principal va de entrada es el canal
del pezn. Los gneros ms frecuentes de patgenos ambientales, cuyo reservorio es el
lugar donde se encuentran las vacas y no las glndulas mamarias infectadas, son
Streptococcus ambientales y en menor medida los coliformes (6,8).

La mastitis es una de las enfermedades ms importantes en la industria lechera, debido a


que a nivel mundial causa prdidas de aproximadamente 35 mil millones de pesos
anuales y representa el 26% de los costos de las enfermedades en el ganado lechero (5).
En el trpico mexicano se reportan prdidas por mastitis subclnica que varan desde 2.8
a 42% que, adems de afectar la glndula mamaria, la leche contaminada pone en riesgo
la salud pblica, debido a que se encuentra una gran variedad de bacterias, que pueden
causar enfermedades (6).

190
Investigaciones en Ciencia e Inocuidad de Alimentos

La mastitis constituye un serio problema para la salud pblica en la industria de lacticinios,


ya que el uso indiscriminado de los antibiticos es evidente, estos contaminan la leche
con niveles cada da ms elevados e inhiben la fermentacin de los cultivos bacterianos
que se utilizan en la fabricacin de productos lcteos (5). En Mxico existe poca
informacin sobre la etiologa de que afecta a las cabras, lo cual dificulta brindar un
tratamiento apropiado, lo cual contribuye a la presencia de residuos de antibiticos en la
leche as como incrementar la resistencia bacteriana. Por lo tanto el objetivo del presente
trabajo fue aislar los agentes patgenos causantes de mastitis en hatos lecheros caprinos
del municipio de Venustiano Carranza, Michoacn.

Metodologa
La presente investigacin se realiz en el CIIDIR. Durante el periodo comprendido del 26
de junio al 11 de julio del 2017, se recolectaron un total de 556 muestras de leche de
ganado caprino procedentes de ocho hatos lecheros, en el municipio de Venustiano
Carranza, Michoacn, Mxico; localizado a 2006 de latitud norte, 102 de longitud oeste,
con una elevacin sobre el nivel del mar de 1525 m. Dichas muestras fueron tomadas de
ganado que dio positivo a la Prueba de California para Mastitis en los grados 1-3. Las
muestras se recolectaron en bolsas estriles, fueron identificadas con el nmero de la
cabra y el pezn muestreado (derecho o izquierdo, D o I, respectivamente), nombre del
productor y fecha de la toma de muestra.

Las muestras fueron transportadas a 4 C al Laboratorio de Microbiologa del CIIDIR, para


su procesamiento, el cual se llev a cabo en un periodo no mayor a 6 h. stas fueron
sembradas en agar sangre y se incubaron a 37 C por 24 h, aquellas que no presentaron
crecimiento se dejaron en la incubadora y se revisaron diariamente durante 5 das para
monitorear el crecimiento bacteriano. De aquellas muestras que obtuvo crecimiento se
registr el tipo de hemlisis y se realiz tincin de Gram; a continuacin se procedi a
realizar la prueba de la catalasa, coagulasa, lecitinasa, CAMP, KOH (3%) y siembra en
agar Mac Conkey (5,6).

Resultados y discusin
A partir de las 556 muestra recolectadas se lograron aislar 581 agentes etiolgicos; del
8.6% de los muestras no fue posible recuperar ningn microorganismo an despus de 5
das de incubacin. Lo cual puede estar relacionado con la presencia de residuos de
antibiticos en la leche o debido a la que la infeccin haya sido provocada por un
microorganismo exigente o incapaz de desarrollar en aerobiosis por lo tanto no pudieron
ser detectados mediante la metodologa empleada (6).

Por otro lado del 13.1% (73) de las muestras se lograron aislar dos microorganismos,
siendo S. aureus y Staphylococcus coagulasa negativo (SCN) los microorganismos en
asociacin. Muoz y col., (5) reportaron que en bovinos con mastitis el 26.7%, de las
muestras se encontraron microorganismos asociados: S. aureus con bacilos Gram-
negativos; S. aureus con bacilos Gram-positivos; SCN con bacilos Gram negativos y
bacilos Gram negativos con positivos; cada asociacin represent el 6.7 % de las
muestras. Estas asociaciones esta asociacin puede ser causada por que los
ordeadores, no se desinfectan las manos antes de ordear, ni entre cada vaca
ordeada; se utiliza la misma toalla durante todo el ordeo (en el caso de que se usen),
no utilizan ningn desinfectante para la limpieza de la ubre y no se utilizan selladores (5).

En general los diferentes agentes etiolgicos aislados fueron SCN, S. aureus,


Enterobacterias, Bacillus spp., Corinebacterias y Streptococcus spp. En mayor media se

191
Investigaciones en Ciencia e Inocuidad de Alimentos

recuperaron SCN 75% (453/581), mientras que los Streptococcus spp. representaron el
0.3% (2/581) de los aislamientos (Fig. 1). Ha sido reportado que el espectro de bacterias
causantes de la mastitis vara dependiendo del medio ambiente, sistema de produccin y
el fin zootcnico (3).

El gnero Staphylococcus es el responsable del 60-80% de los casos de mastitis (4), S.


aureus est catalogado como el patgeno ms aislado de la leche de cabras y puede
provocar casos aguados de mastitis gangrenosa, mastitis clnica y subclnica; esto debido
a la produccin de exotoxinas, algunas de las cuales tienen la capacidad de destruir
clulas del sistema inmunolgico (4). Adems ste patgeno es de gran inters debido
posibilidad de generacin de intoxicaciones alimentarias originadas por la presencia de
toxinas termoestables producidas por ste microorganismo (4,8).

En el presente estudio los SCN fueron el grupo principalmente aislado. stos son los
microorganismos prevalentes en los casos de mastitis subclnica; a este grupo pertenecen
S. epidermidis, S. xylosus, S. simulans, S. chromogenes S. caprae, S. lentus y S. warnei,
en un diagnstico rutinario de mastitis los SCN no son identificados a nivel de especie y
son tratados como un grupo uniforme (8).

Fig. 1 Aislamientos obtenidos de ganado caprino con mastitis. En el grfico se muestran los
porcentajes en los cuales se lograron aislar cada uno de los diferentes agentes identificados.

La participacin de las enterobacterias y los enterococos como agentes causales de


mastitis, se debe a que estos suelen penetrar a la ubre de los animales en los periodos
entre los ordeos cuando el animal reposa y entre en contacto con las heces; por lo tanto
pertenecen al grupo de patgenos ambientales (6). El porcentaje de enterobacterias

192
Investigaciones en Ciencia e Inocuidad de Alimentos

asociadas a mastitis en el presente estudio es menor al reportado por Muoz y col., (5) en
ganado bovino con mastitis subclnica (26.7%), estos autores reportan que los grupos
bacterianos causantes de esta enfermedad varan (adems de los factores ya
mencionados) de acuerdo a la edad del husped y la cantidad de leche que produce el
husped.

Conclusiones
A travs del anlisis bacteriolgico de muestras de leche de ganado caprino con mastitis
de hatos lechern del municipio de Venustiano Carranza, Michoacn se lograron aislar
seis grupos bacterianos de los cuales el gnero Staphylococcus fue el gnero ms
frecuentemente aislado. El siguiente paso a dar con estos resultados es realizar los
antibiogramas para determinar la susceptibilidad y/o resistencia de los diferentes
aislamientos a los antibiticos, adems de dar capacitacin a los productores en buenas
prcticas pecuarias as como de higiene.

Bibliografa
1. Bergonier D., De Cremoux R., Rupp R., Lagriffoul G. and Berthelot, X. 2003. Mastitis of dairy
small rumiants. Vet. Res. 34:689-716.
2. Castillo M., Suniaga J., Rojas G. and Hernndez J. 2007. Prevalencia de mastitis subclnica en
la Zona Alta del Estado de Mrida. Agr. Andina. 13:65-70.
3. Clavijo A.M., Melndez B., Clavijo M.L., Godoy, A. and Santander, J. 2002. Efecto del sistema
de explotacin sobre la aparicin de mastitis caprina en dos fincas del estado Falcn, sus
agentes etiolgicos y la resistencia a antimicrobianos. Zootec. Trop. 20:383395.
4. Isidro L., Tolentino C., Rodrguez J., Daz E. and Pastor F. 2011. Identificacin de
Staphylococcus spp. en muestras de leche de cabra en hatos lecheros de la Comarca
Lagunera. Prod. Pecuearia. 11:3138.
5. Muoz J., Hernndez L., Arrieta E., Camacho L. and Hernndez D. 2012. Aislamiento
bacteriano en bovinos de doble propsito con mastitis subclnica, en la costa de Guerrero,
Mxico. Rev. Electrnica Vet. 13:111.
6. Romero R.A., Cervantes R.A., Olivares A.E., Ducoing L., Hernndez D. and Martnez R. 2007.
Principales gneros bacterianos aislados de leche de cabra en dos granjas del municipio de
Tequisquiapan, Quertaro, Mxico. Rev. Mex. Ciencias Pecu. 4:1-9.
7. SAGARPA. Acta de la sexta sesin ordinaria, 2004, del consejo mexicano para el desarrollo
rural sustentable. Disponible en: http://www.sagarpa.gob.mx. Fecha de acceso: julio de 2017.
8. Shearer J.K. and Harris J.B. 2003. Mastitis of dairy goats. University of Florida, Institute of Food
and Agricultural Sciences. http://edis.ifas.ufl.edu/DS120 Fecha de acceso: julio 2017.

193
Investigaciones en Ciencia e Inocuidad de Alimentos

Anlisis comparativo y conductual entre una dieta restrictiva a dos


variedades de maz (MR y QPM) comparado con una dieta convencional en
un modelo murino

Minjarez, B., Buritica, J., Garca-Leal, O., Morales-Rivera, M.M., y Mena-Mungua, S.
Centro Universitario de Ciencias Biolgicas y Agropecuarias (CUCBA), Universidad de
Guadalajara, Camino Ramn Padilla Snchez No. 2100, Nextipac, Zapopan, Jalisco, Mxico.
Telfono (33) 3777-1150 Fax: (33) 3777- 1159
benito.minjarez@academicos.udg.mx
Palabras clave: Dieta, modelo murino, QPM
Introduccin
En muchos pases, incluyendo Mxico, el maz representa un importante alimento pues
aporta cantidades significativas de nutrientes, sobre todo caloras y protenas, ubicndolo
como el tercer cultivo ms importante en el mundo solo detrs del trigo y el arroz (1). De
esta manera, en gran parte de Amrica el consumo de protena proporcionado por el maz
es de 6.78 g/da y para Mxico el consumo per cpita de este grano es de 330 gramos por
da y proporciona hasta un 60% de la ingesta (25.4 g/da) de la protena necesaria,
convirtindolo en un producto fundamental en la dieta de la mayora de los mexicanos,
especialmente los de bajos ingresos, reforzando su relevancia tanto econmica como
social (2,3).

En el caso del maz, la gran parte de la protena se encuentra en el endospermo (del 75 al


85%); siendo las ms abundantes las prolaminas y las glutelinas con un 60 y 34%,
respectivamente; seguido por albminas y globulinas ambas con 3% (4). Mientras tanto,
las zenas son las protenas ms abundantes en el grano pues representan, hasta un 50%
del total de sus protenas (5). Desafortunadamente, muchos de los cereales tienen
protenas con bajo valor nutricional cuando se comparan con las protenas de la carne.
Suelen ser protenas deficientes especficamente en dos aminocidos esenciales, la lisina
y el triptfano, ambos de gran relevancia para la nutricin humana y animal (4). Adems,
se ha visto que este tipo de granos tambin es deficiente en Zn, Fe y algunas vitaminas
como la A, D, E y la B12. As, la deficiencia en estos residuos ha sido relacionada con
diversos padecimientos y enfermedades como la desnutricin, el desarrollo, estrs,
anemia, hgado graso, hipertensin, obesidad, diabetes y diversas enfermedades
neurodegenerativas y psiquitricas (1).

Por otro lado, Mertz et al., en 1964 (6) descubri un gen mutante en el maz capaz de
codificar para protenas con un mayor contenido de lisina y de triptfano llamado opaco-2
(o2). Este descubrimiento proporcion una nueva alternativa para desarrollar granos
mejorados ayudando a aumentar la calidad nutricional de este cereal. De esta manera, la
expresin del gen recesivo opaco-2 (o2) represent tambin un cambio en la composicin
de protenas del endospermo reduciendo los niveles de zena y aumentando los niveles
de protenas ricas en residuos de lisina y triptfano (7). Estos granos mejorados se han
denominado maces con alta calidad protenica (QPM por sus siglas en ingls), y se han
posicionado como una excelente va para hacer frente a la carencia energtica, pudiendo
elevar y mejorar los valores protenicos en la dieta diaria de la poblacin, principalmente
de aquellos en condiciones ms vulnerables (2).

El uso de diferentes variedades de maz QPM ha demostrado ser una herramienta eficaz
en el combate de deficiencia nutricional en las distintas etapas del desarrollo, lo que
finalmente repercute en la calidad de la salud y la vida de dichas poblaciones. Como se
ha mencionado previamente, los residuos de lisina y de triptfano impactan

194
Investigaciones en Ciencia e Inocuidad de Alimentos

favorablemente en el desarrollo fsico y en los procesos cognitivos del individuo,


permitiendo la prevencin, el retraso y/o revirtiendo el dao ocasionado durante el ciclo
patolgico natural de distintas enfermedades.

En el presente trabajo nos propusimos analizar el impacto sobre la conducta de una dieta
restrictiva de maz tanto convencional como QPM en un modelo murino, con el objetivo
final de avanzar en la identificacin de los mecanismos que permitan reducir procesos
neuropatolgicos iniciales en la ansiedad, el estrs y la depresin. Estos datos brindarn
informacin necesaria, no solo para la comprensin de estas patologas, sino para la de
otros padecimientos neuropsiquitricos, as como otros padecimientos relacionados a la
dieta, tales como la desnutricin, la hipertensin, el diabetes, la obesidad, entre otros.

Metodologa
Participaron en un estudio un total de nueve ratas de la cepa Wistar. En el momento del
destete (da 21 desde el nacimiento) las ratas fueron distribuidas en 3 grupos (n=3) en
funcin del tipo de alimentacin utilizado. El grupo C (convencional) fue alimentado
exclusivamente con pellets de Rodent LabChow, el grupo MR con maz convencional
(MR) y el grupo QPM con una variedad de maz QPM. La alimentacin exclusiva se
extendi desde el momento del destete (da 21 desde el momento de nacimiento) hasta el
inicio de la edad adulta (da 70 de vida). Vase Andersen 2003 para una revisin del ciclo
vital de la rata (8). Finalmente, se expuso a los dos grupos alimentados con maiz durante
un periodo de 8 das a una dieta convencional (Rodent LabChow) sin restriccin
alimentaria con la finalidad de observar la dinmica de recuperacin de peso.
Durante el ltimo mes se expuso a los tres grupos a tres tareas conductuales, con el
objetivo de evaluar el efecto de las dietas exclusivas utilizadas durante el ciclo vital de los
animales sobre dos factores: la respuesta de ansiedad asociada con la tendencia al riesgo
y la actividad general. Las ratas se expusieron individualmente.
Una prueba de campo abierto fue utilizada para evaluar las distancias recorridas, las rutas
trazadas y el tiempo de permanencia en zonas centrales. Las dos primeras medidas
permiten capturar la actividad general, en tanto que el tiempo de permanencia en la zona
central de una plataforma de campo abierto ha sido considerado como una medida de
riesgo. El test de campo abierto se desarroll durante un sesin de una duracin de 10
minutos.

Asimismo, las ratas de los tres grupos fueron expuestas a una nica sesin en la que
fueron introducidas en una caja operante donde el operando fue una rueda de actividad.
La cantidad de respuestas (i.e., giros de la rueda de actividad) fue considerada una
medida de activacin general.
Finalmente, las ratas fueron expuestas a una tarea de luz-oscuridad. Tras tres sesiones
de habituacin de 5 minutos de duracin cada una de ellas en una caja de preferencia
conformada por dos habitculos unidos mediante una zona central, las ratas fueron
introducidas durante una cuarta sesin de 10 minutos de duracin. En esta sesin uno de
los habitculos permaneci tapado y en completa oscuridad. El tiempo que la rata
permanece en el habitculo no tapado en relacin al que permanece en el de oscuridad
se ha considerado una medida de riesgo.

Resultados y discusin
En la Figura 1 se muestra el incremento promedio del peso para cada uno de los grupos
desde el momento del nacimiento. Antes del momento del destete (da 21) las curvas de
crecimiento de los tres grupos fueron comparables; sin embargo, desde ese momento se
observaron curvas de crecimiento claramente diferenciadas. En comparacin con el grupo

195
Investigaciones en Ciencia e Inocuidad de Alimentos

C (control) los grupos experimentales (MR y QPM) mostraron un crecimiento


significativamente ms lento. De manera general se observ que el grupo alimentado con
maz QPM alcanz aproximadamente 1/3 del esperado en relacin a la curva de
crecimiento del grupo C, en tanto que el grupo alimentado con maz convencional (MR)
alcanz la mitad del peso que el grupo alimentado con QPM y cercano a 1/6 del
alcanzado por el grupo C.
Nuestros datos muestran, en consecuencia, que la alimentacin exclusiva con maz, ya
sea MR o QPM) genera importantes carencias nutrimentales, si bien el maz QPM parece
ser significativamente ms rico en nutrientes que el maz MR.

Figura 1. Curvas de crecimiento para los tres grupos, con una dieta exclusiva de alimento
convencional, maz MR y maz QPM.

El objetivo de este trabajo fue evaluar, una vez caracterizadas las curvas de peso
obtenidas con alimentacin exclusiva, los efectos conductuales de las mismas. Si bien se
requiere de la realizacin de ms anlisis, los resultados disponibles hasta este momento,
no muestras diferencias entre los grupos alimentados con semillas de maz QPM y el
grupo control, independientemente de la diferencia de peso, pero s de estos grupos con
el grupo MR. En la Figura 2 se muestran el tiempo de permanencia en la zona central de
la prueba de campo abierto para cada uno de los grupos, as como el nmero de visitas a
esta zona.

Figura 2. Resultados de prueba de campo abierto: tiempo de permanencia en zona central


y frecuencia de visitas a zona central

Estas medidas han sido asociadas con respuestas de ansiedad asociadas con tendencia
al riesgo. En este sentido, los datos obtenidos muestran que una dieta deficitaria el lisinas
y triptfano (i.e,, alimentacin exclusiva con maz MR) est asociada con una mayor
respuesta de ansiedad. Por el contrario, no se encontraron diferencias significativas en
medidas de activacin general. Sin embargo, se requiere realizar ms anlisis con los
datos obtenidos. A modo de ejemplo se presentan los desplazamientos de una rata de
cada grupo como ejemplo de actividad general. Vase Figura 3.

196
Investigaciones en Ciencia e Inocuidad de Alimentos

Grupo C Grupo MR Grupo QPM

Figura 3. Trayectorias correspondientes a una rata de los grupos C, MR y QPM.

Queda pendiente el anlisis de la ejecucin de los grupos en la prueba de luz-oscuridad,


que se ha considerado un test de ansiedad. Los resultados iniciales sugieren que las ratas
alimentadas exclusivamente con MR permanecen ms tiempo en el habitculo oscuro, lo
que implicara una mayor respuesta de ansiedad. Este resultado es consistente con la
conducta de cada uno de los grupos en la prueba de campo abierto. Sin embargo, se
requiere de anlisis ms detallados.

Conclusiones
Los resultados obtenidos muestran que las dietas utilizadas de manera exclusiva para
cada uno de los grupos desde el momento del destete y hasta el inicio de la edad adulta
tuvieron un efecto directo sobre sus curvas de crecimiento. Sin embargo, si bien el grupo
alimentado exclusivamente con maz QPM tuvo un peso significativamente menor al
grupo al que se expuso a una dieta convencional, a nivel conductual no se observaron
diferencias significativas. Al menos en las dos medidas consideradas, activacin general y
respuestas de ansiedad, el uso de una dieta rica el lisinas y triptfano pareci
compensar el dficit de otros nutrientes. Estos resultados permiten defender las
bondades que para la poblacin tendra la introduccin de una variedad de maz rico en
lisinas y triptfanos en pases en los que el maz es la base de la dieta.

Bibliografa
1. Liu, L., Jeffers, D., Zhang, Y., Ding, M., Chen, W., Kang, M. S., & Fan, X. (2015).
Introgression of the crtRB1 gene into quality protein maize inbred lines using molecular
markers. Molecular Breeding, 35(8), 154. http://doi.org/10.1007/s11032-015-0349-7
2. Musila, R. N., Diallo, A. O., Makumbi, D., & Njoroge, K. (2010). Combining ability of early-
maturin quality protein maize inbred lines adapted to Eastern Africa. Field Crop Res 110 (2-
3), 231-23.https://doi.org/10.1016/j.fcr.2010.07.009
3. FAOSTAT2014/para protenas g/persona por da suministro alimentario/cultivos
equivalentes http://faostat3.fao.org/browse/FB/CC/S Consultado 11 de junio 2016
4. Huang, S., Adams, W. R., Zhou, Q., Malloy, K. P., Voyles, D. A., Anthony, J., Kriz, A. L.,
Luethy, M. H. (2004) Improving nutritional quality of maize proteins by expressing sense
and antisense zein genes. J Agric Food Chem 52(7), 1958-64. 10.1021/jf0342223
5. Esen, A (1987) Proposed nomenclature for the alcohol-soluble proteins (zeins) of maize
(Zea mays L.). J. Cereal Sci 5, 117- 128
6. Mertz, E. T., Bates, L. S., & Nelson, O. E. (1964). Mutant gene that changes protein
composition and increases lysine content of maize endosperm. Science, 145(3629), 279-
280
7. Hasjim, J., Srichuwong, S., Scott, M.P., Jane, J. L. (2009) Kernel composition, starch
structure, and enzyme digestibility of opaque-2 maize and quality protein maize. J Agric
Food Chem 57(5): 2049-55
8. Andersen, S.L. (2003). Trajectories of brain development: point of vulnerability or window of
opportunity? Neuroscience & Biobehavioral Reviews, 27, 3-18

197
Investigaciones en Ciencia e Inocuidad de Alimentos

Validacin del mtodo microbiolgico para la cuantificacin de


Staphylococcus aureus
Sierra Gmez Pedroso LC.*, Alczar Montaez C.*, Castro Martnez C.* y Nieto Ramrez R.*
*Facultad de Medicina Veterinaria y Zootecnia, Av. Universidad 3000, Coyoacan C.P. 04510 Tel.
56 22 58 58 y 56 22 59 99 E-mail: claudia_alcazar21@hotmail.com
Palabras clave: Validacin, mtodo microbiolgico, S. aureus

Introduccin
Los alimentos sujetos a contaminacin postproceso con tipos enterotoxignicos de S.
aureus representan un riesgo por la ausencia de flora competitiva que normalmente
restringe su crecimiento y la produccin de enterotoxinas (1).
Se estima que un alimento es de riesgo en la intoxicacin alimentaria por S. aureus,
cuando se confirma la presencia de alguna de sus enterotoxinas o tiene una carga del
microorganismo igual o superior a 105 UFC/g. Generalmente, la determinacin cuantitativa
de S. aureus en alimentos se realiza con la finalidad de establecer su potencialidad para
originar intoxicacin alimentaria y demostrar contaminacin post proceso (2, 3).
Para confirmar un brote de intoxicacin estafiloccica, es necesario ejecutar el mtodo de
cuantificacin de S. aureus, el cual permitir confirmar el alimento que lo origin y as
poder rastrear y corregir los errores ejecutados durante la elaboracin del alimento
contaminado. Para ello, se debe tener la certeza de que el mtodo ejecutado da los
resultados esperados, lo cual se demuestra mediante la evaluacin del desempeo de los
mtodos en los laboratorios (4).

Metodologa
El presente trabajo consta de varias etapas:
1. Planeacin de la validacin de la tcnica: Se elabor un protocolo donde se
detallan los insumos, equipos y materiales requeridos para llevar a cabo la
validacin de la muestra, se seleccion la muestra (queso panela), las condiciones
de almacenamiento y manejo de la misma, as como los criterios de evaluacin del
desempeo a aplicar conforme con el documento oficial Criterios de Validacin
de Mtodos Microbiolgicos (CCAYAC-P-062)(emitido y publicado en la pgina
de COFEPRIS, www.cofepris.gob.mx/TyS/Paginas/Terceros-Autorizados.aspx).
2. Realizacin de pruebas previas (estandarizacin del inculo y verificacin
de la muestra): antes de evaluar el mtodos se desarrollaron pruebas previas que
permitieron comprobar la ausencia de S. aureus y microrganismos interferentes en
la muestra a fortificar y se hicieron pruebas de conteo en placa para determinar el
rango de S. aureus a inocular en las muestras utilizando la tcnica descrita en la
Norma Oficial Mexicana NOM-092-SSA1-1994 y as poder fortificar las cuentas en
el rango de 50 UFC/g.
3. Ejecucin del mtodo: Una vez determinada la muestra a fortificar y que el
inculo fue estandarizado, se realizaron 20 repeticiones, 10 por cada responsable
de anlisis, conforme a lo descrito en el mtodo LSS-LMP-MV-001, Mtodo para la
cuantificacin de S. aureus en alimentos (5).
4. Anlisis de resultados: Una vez concluido el desarrollo de la metodologa
conforme al mtodo y al protocolo, se realizaron los clculos estadsticos conforme
al documento Criterios de Validacin de Mtodos Microbiolgicos (CCAYAC-
P-062) (4).
5. Evaluacin de los resultados. Los resultados fueron analizados, revisados y
documentados en un informe en extenso.

198
Investigaciones en Ciencia e Inocuidad de Alimentos

Resultados y discusin
Los resultados obtenidos durante la ejecucin del mtodo se describen en la tabla 1. Dos
responsables de anlisis, RA, quienes ejecutaron 10 veces cada una el mtodo, utilizando
como analito S. aureus ATCC 25923 y como controles positivo y negativos S. aureus
ATCC 6538 y S. epidermidis ATCC 12228, respectivamente. La muestra utilizada fue
queso panela marca Los Volcanes en unidades de 25 g y un nivel de fortificacin medio
(50 UFC/g) (6, 7).
A partir de estos resultados se calcularon los parmetros repetibilidad, reproducibilidad,
porcentaje de recuperacin, sesgo e incertidumbre (7). Los resultados del clculo, as
como sus frmulas y los criterios de aceptacin se muestran en la tabla 2.

Tabla 1. Resultados de la ejecucin del mtodo LSS-LMP-MV-001. Cuantificacin de S.


aureus en queso panela
Muestra (repeticin) Log de la Cuenta Log de la Cuenta
responsable de anlisis 1 responsable de anlisis 2

1 5,30103 5,1760913

2 5,39794 5

3 5,2552725 5,20412

4 5,2304489 5,39794

5 5,1760913 5,0791812

6 5,3424227 5,1139434

7 5,2304489 5,30103

8 5,146128 5

9 5,2552725 5,3802112

10 5,146128 5,0791812

= 0.156

SR= 0.125

199
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 2. Parmetros obtenidos y sus criterios de aceptacin.


PARMETRO CRITERIOS DE ACEPTACIN VALOR OBTENIDO

Repetibilidad (r) r< 3 0.025

RSD=s/xM
2
RSD = RSDxRSD

2
r= 2.8 X (RSD /1

Reproducibilidad (R) R< 3 0.064

2 2
RSDR= (RSDa +RSDb )/2

R= 2.8 X RSDR

Recuperacin (%) Entre el 90 % y el 110 % log 104 % log

% = media de la cuenta de los log


X 100

log de las UFC inoculadas

Sesgo La diferencia absoluta de lo 0.218 log


recuperado y lo inoculado es <
Sesgo = / Ve Vo/ 0.3 log

Incertidumbre a) Especificar el a) UFC/g


mensurando b)
b) Identificar las fuentes Muestra: distribucin
de incertidumbre aleatoria de los
microorganismos
Personal: Realizacin
de las diluciones,
volmenes,
homogeneizacin,
pesado y lectura de
UFC
Tiempo desde el
pesado hasta la
inoculacin
Equipo: Temperatura
de incubacin
SR=
2
/2 Medios y Reactivos:
Calidad del medio
c) Realizar clculos para Agar Baird Parker y
la incertidumbre global Buffer de fosfatos.
U= 2 x SR
c) 0.25

200
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones
El Mtodo para la cuantificacin de Staphylococcus aureus, LSS-LMP-MV-001 en
alimentos lcteos se ajusta al uso propuesto, tomado en cuenta las instalaciones, equipo
y personal del Servicio de Control Analtico de Agua y Alimentos, ya que cumple con los
parmetros de evaluacin del desempeo que exige la COFEPRIS en el documento
CCAYAC-P-062. Con la verificacin de este mtodo, el Departamento de Medicina
Preventiva y Salud Pblica de la FMVZ-UNAM demuestra tener la competencia para
ofrecer este anlisis, brindando confianza a sus usuarios.

Bibliografa
1. Campbell-Platt, G. Food Science and technology. Chichester, West Sussex (2009) UK: Wiley-
Blackwell-International Union of Food Science and Technology, 514 p.
2. International Commision on Microbiological Specifications for Foods (ICMSF) 1998.
Microorganismos de los Alimentos: Caractersticas de los Patgenos Microbianos. Ed. Acribia
Espaa. 349-385p
3. Cndida Daz-Rivero y Bedirva Gonzlez de Garca (2001) Staphylococcus aureus en queso
blanco fresco y su relacin con diferentes microorganismos indicadores de calidad Sanitaria.
Revista de Salud Pblica y Nutricin. Vol 2 No.3. Disponible en
http://www.respyn.uanl.mx/ii/3/articulos/saureus-1.html
4. CCAYAC-P-062. Gua para la evaluacin del desempeo de mtodos de prueba
microbiolgicos para el anlisis de alimentos. Comisin de Control Analtico y Ampliacin de
Cobertura. Rev 1. Vigente 2012-10-15.
5. Norma Oficial Mexicana NOM-115-SSA1-1994, bienes y servicios. Mtodo para la
determinacin de Staphylococcus aureus en alimentos. DOF 25-09-95.
6. Norma Oficial Mexicana NOM-092-SSA1-1994, bienes y servicios. Mtodo para la cuenta de
bacterias aerobias en placa. DOF 06-09-95.
7. FDS-LMP-MV-001 Informe para la Evaluacin del desempeo del mtodo para la cuantificacin
de Staphylococcus aureus, LDS-LMP-MV-001.

201
Investigaciones en Ciencia e Inocuidad de Alimentos

Desarrollo de un anlogo de cochinita pibil empleando el residuo de jamaica


(Hibiscus sabdariffa L.) y la prevalencia de patgenos especficos tras el
proceso
Cabrera-Pinto, J. E.*, Corral-Rojo, J.*, Cant-Soto, E. U.**, Chvez-Almanza A. F.**, Anduro-
Jordan, J.A.**, Figueroa-Lpez, A. M.**, Alcal-Rosas, R.I.**
* Universidad La Salle Noroeste, rea de Ciencias de la Salud, Veracruz s/n prolong. norte,
(644)4106058, jcabrera@ulsa-noroeste.edu.mx, ** Instituto Tecnolgico de Sonora, Laboratorio de
Investigacin en Microbiologa del Departamento de Biotecnologa y Ciencias Alimentarias.
Palabras clave: Jamaica, anlogo, microorganismos

Introduccin
Generar nuevos alimentos partiendo de residuos alimentarios es una tendencia mundial.
Segn SEDESOL (2017) en Mxico, se desperdicia el 37% de los alimentos producidos y
parte de ellos an tienen potencial de ser empleados en la produccin de nuevos
alimentos. Existiendo un grado de pobreza tan alto en Mxico, es una necesidad tratar de
aprovechar todos esos materiales residuales. Ese es el caso de la jamaica (Hibiscus
sabdiriffa L.). Es una planta herbcea de la familia Malvaceae cuyas hojas y tallo tienen
cierto uso, pero sus principales aplicaciones se dan del cliz deshidratado. Su extracto
acuoso se usa de manera artesanal e industrial en productos diversos, pero el cliz
normalmente se desecha una vez que se ha extractado. Mxico cultiva ms de 18,000 Ha
de jamaica (3) y de ellas las variedades de cliz rojo son las ms empleadas en el rea de
alimentos (1). Adicionalmente, cada da es mayor el mercado para alimentos
potencialmente funcionales, de fuentes alternativas, ricos en protenas, bajos en grasas y
con componentes nutracuticos. As y puesto que esta jamaica es rica en cidos
orgnicos que le dan un sabor agradable, posee aproximadamente entre 7.9 y 17.4% de
protena (base seca), entre 9.8 y 13.6% de fibra y entre 0.16 y 2.9 de extracto etreo y
que contiene una gran diversidad de componentes potencialmente nutracuticos (como
las antocianinas) (3)(1), se abre la posibilidad para su empleo en productos alimentarios
de bajo costo que pudieran tener impacto positivo en la comunidad. Por ello, se considera
atractivo generar un producto anlogo a la cochinita pibil, (guiso ampliamente consumido
en el pas), en el que se sustituya la carne de cerdo por el residuo de jamaica tras la
obtencin del extracto. Sin embargo, la jamaica disponible suele tener materiales
extraos. Por ello, es necesario evaluar la prevalencia de microorganismos patgenos de
alta importancia sanitaria que pudieran permanecer y generar problemas en la poblacin
consumidora tras el proceso.
En los ltimos 10 aos las Normas Oficiales Mexicanas (NOM) han realizado un
importante esfuerzo para incorporar metodologas de anlisis de microorganismos
patgenos y/ grupos indicadores ad hoc a dicho contexto; sin embargo an queda mucho
trabajo por realizar toda vez que an no se incorpora el estudio de patgenos de alta
importancia a nivel global (ej. serotipos patgenos de Escherichia coli) sobre todo en
agroalimentos que por su forma de produccin pudieran incorporar esta clase de
patgenos omnipresentes ambientalmente. El uso de variantes de la reaccin en cadena
de la polimerasa (PCR) es una opcin viable para identificar de una manera rpida y
econmica este tipo de patgenos, ya sea previa obtencin de cultivos puros
sospechosos o bien a partir de matrices complejas. En la NOM-210-SSA1-2014
apndices A y C se sugiere en los puntos A.7.3.5 (f) y C.7.8.2 respectivamente para
Salmonella spp., y L. monocytogenes el uso de mtodos de biologa molecular para su
identificacin, significando el primer esfuerzo en Mxico para incorporar estas
metodologas en la Normatividad Oficial.
El objetivo del presente trabajo fue desarrollar y caracterizar un producto anlogo de la
cochinita pibil por coccin al vapor sustituyendo la carne de cerdo por el residuo de la flor

202
Investigaciones en Ciencia e Inocuidad de Alimentos

de jamaica y evaluar la prevalencia de Escherichia coli, Staphyloccoccus aureus,


Staphylococcus epidermidis, Listeria Monocytogenes y Salmonella spp., en el producto
terminado.
Metodologa
Desarrollo del producto: Se prepar un total de diecisis muestras entre mayo y junio de
2017 con la receta tradicional de la zona poniente del Estado de Yucatn cumpliendo la
NOM-251-SSA1-2010 y siguiendo el proceso que se indica: (a) Se elimin toda impureza
evidente y se tamiz vigorosamente la flor seca a travs de colador de malla gruesa (2.4
mm) hasta que no hubo residuos. (b) Se pes la cantidad necesaria para cada
preparacin (74%) y se enjuag con abundante agua potable manteniendo agitacin
constante. (c) Se hizo una segunda eliminacin de impurezas visibles. (d) Se prepar del
extracto de jamaica empleando la proporcin 1:52 jamaica/agua y llevando a ebullicin
por 30 minutos, (2). (e) Se mezcl la pasta de achiote comercial (14.33%) con comino
(1.3%), pimienta (0.3%), sal (2.09%) y ajo en polvo (0.45%). (f) Se aadi concentrado de
consom de costilla de res (3.28%), agua y manteca (4.84%). (g) Se incorpor la flor de
jamaica escurrida tras la obtencin del extracto acuoso. (h) Se envolvi la mezcla en hoja
de pltano (previamente flameada por ambos lados). (i) El producto se coci en vaporera
a ebullicin durante 45 minutos.
Anlisis proximal: Anlisis por duplicado de acuerdo a los mtodos sealados: Humedad.
Mtodo de prueba NOM-116-SSA1-1994. Cenizas. Mtodo de prueba NMX-F-607-
NORMEX-2013 Extracto etreo. Mtodo oficial de prueba 920.39 de la AOAC (4.5.01)
2000, por extracto soluble en ter sobre la muestra seca en Goldfish. Fibra cruda. Mtodo
de prueba NMX-F-090-S-1978 Protena cruda. Mtodo de prueba 960.52 de la A.O.A.C.
(12.1.07), 2000. Factor 6.25.
Evaluacin sensorial. Se realiz prueba de aceptacin con panel no entrenado con n = 11
Costeo. Se determin el costo del producto considerando la materia prima como residuo
de un proceso previo. Este se contrast contra el producto original (artesanal) y dos
marcas comerciales para determinar el costo beneficio por comparacin directa.
Anlisis Microbiolgico. Para el estudio microbiano de las diecisis muestras se incluyeron
los siguientes patgenos: Salmonella spp., apndice A de la NOM-210-SSA1-2014,
Escherichia coli O157:H7 acorde a Jimnez et al., (2012) (4), Listeria monocytogenes
apndice C de la NOM-210-SSA1-2014 (5), Staphylococcus aureus y Staphylococcus
epidermidis mediante aislamiento en agar sal y manitol. Las cepas sospechosas de E. coli
O157:H7, L. monocytogenes, S. aureus y S. epidermidis aisladas en cultivos puros fueron
criopreservadas a -70C y analizadas por PCR punto final utilizando oligonucletidos
especficos para los genes rfB (1000 pb) (rfBf TAAGTAATGGAACGGTTGCTCT, rfBr
CCCCACTCGTAAAATCCATC), hlyA (234 pb) (LMAf CGGAGGTTCCGCAAAAGATG,
LMBr CCTCCAGAGTGATCGATCTT), Coa (674 pb) (Coaf ATAGAGCTGATGGTACAGG,
Coar GCTTCCGATTGTTCGATGC), se-124 (124 pb) (se-124f
ATCAAAAAGTTGGCGAACCTTTTCA, se-124r CAAAAGAGCGTGGAGAAAAGTATC)
respectivamente.
Resultados y discusin
El mtodo empelado favorece la extraccin de cidos orgnicos y vitamina C pero no de
las antocianinas ni otros flavonoides (2). El extracto debe su color rojo intenso a la
presencia de diversos compuestos en los que destacan la delfinidina-3-sambubisido y la
cianidina-3-sambubiosido. La apariencia del producto (Tabla 1) debe su tonalidad roja a
la presencia de antocianinas residuales despus de la extraccin acuosa que por
condiciones de acidez del propio cliz y el proceso de coccin se mantiene como ion
oxonio de color rojo intenso que es estable en estas condiciones y al cual se le ha
vinculado con beneficios nutracuticos en diversos estudios (3)(1). A su vez, la tonalidad
naranja es proporcionada por la bixina del achiote que es un cido carotnico insoluble en

203
Investigaciones en Ciencia e Inocuidad de Alimentos

agua. Esta diferencia en solubilidad es lo que impide la integracin de los colores. Los
flavonoides en el residuo se oxidan a tonalidad caf por calor, pero al maximizar su
extraccin se redujo la aparicin de estos.
La suavidad en el producto se debe al tratamiento trmico durante la generacin del
extracto y del producto. Se produce una hidrlisis parcial de las hemicelulosas y mayor
hidratacin de las fibras de celulosa como ocurre en el tratamiento trmico de otros
vegetales. Esto resulta en una prdida de fibra lo que concuerda con los resultados
obtenidos ya que para las variedades rojas se reporta fibra entre 32 y 38% en base seca
mientras que para el producto elaborado se obtuvo un 8.9% en base hmeda (Tabla 2)
equivalente a 30.2% en base seca.
Por su parte, la evaluacin sensorial (Tabla 1) seala una acidez excesiva que impide la
adecuada percepcin del sabor. Aun as, el producto muestra una aceptacin significativa.

Tabla 1. Caractersticas organolpticas de la jamaica pibil

Color Rojo intenso con tonos naranja


Textura Fibrosa-suave
Aroma A achiote y especias
Sabor Similar a la cochinita con menor intensidad y mayor acidez
Prueba de aceptacin 90.9%* *n=11

La Tabla 2 muestra 5.2% de protena cruda (equivalente a 15.1% en base seca). Valor en
el rango de lo reportado (3). Considerando que el producto original envasado
comercialmente contiene un 17% de protena y que el contenido de protena de la
cochinita casera se encuentra alrededor del 11% pudiera parecer bajo. Sin embargo,
tomando en cuenta el costo por gramo de protena (Tabla 3) se puede notar una
diferencia significativa. El costo por gramo de protena del anlogo menos de un cuarto
del producto original (no comercial) y ms bajo en el caso de los productos comerciales.
Esto representa un aporte nutricio adecuado (equivalente al de un yogurt, por ejemplo) de
bajo costo.
Un valor agregado adicional en el mercado actual es el bajo contenido de grasa del
anlogo (1.16%) contra 5.36 y 6.6 de las marcas comerciales. En varios productos la
grasa ayuda a la rpida elevacin de temperatura y a lograr la uniformidad de esta en el
alimento. En el anlogo el efecto se logra por el alto contenido de humedad, el contenido
de fibra y la baja compacidad.

Tabla 2. Anlisis proximal de la jamaica pibil


PARMETRO VALOR* (%)
HUMEDAD 70.37
CENIZAS 2.0
PROTENA 5.21
EXTRACTO ETREO 1.16
FIBRA CRUDA 8.90

Tabla 3. Costo en pesos mexicanos del producto y comparacin por gramo de protena

Parmetro Original Marca 1 Marca 2 Jamaica Pibil


%Protena 11 17.00 17.00 5.21
Costo/kg 89.70 187.60 174.00 56.60
Costo/g de protena 0.82 1.10 1.02 0.20
% Grasa ND 5.36 6.60 1.16

204
Investigaciones en Ciencia e Inocuidad de Alimentos

El total de las muestras estudiadas mostraron ausencia para los patgenos Salmonella
spp., Escherichia coli O157:H7, Listeria monocytogenes y Staphylococcus aureus lo que
demuestra la excelente calidad sanitaria del producto a base de Jamaica. En el muestreo
3 se logr el aislamiento e identificacin por PCR de una cepa de Staphylococcus
coagulasa negativo correspondiendo a S. epidermidis (Figura 1); la presencia de esta
bacteria en alimentos no significa un potencial riesgo a la salud por infeccin y/o
intoxicacin, sin embargo, si sugiere deficiencias en la manipulacin por parte del
personal de produccin durante el empaque, existiendo el riesgo de la posible
incorporacin de S. aureus.

Figura 1. Amplificacin especfica con oligonucletidos Coa (S. aureus) y se-124 (S. epidermidis).
M marcador de peso molecular; c+, ADN de S. aureus o S. epdiermidis; c- Control negativo sin
ADN; M1 muestra sospechosa a Staphylococcus.

Conclusiones
El empleo de la flor de jamaica (Hibiscus sabdiriffa L) residual de la obtencin del extracto
acuoso es til para la obtencin de un producto anlogo de la cochinita pibil que puede
elaborarse de manera artesanal, con caractersticas organolpticas y nutricias aceptables,
con una relacin costo beneficio favorable para el consumidor y libre de patgenos.

Bibliografa
1. Ariza-Flores, R.; Serrano-Altamirano, V.; Casimiro Michel-Aceves, A. 2017. Caractersticas
bioqumicas y calidad nutracutica de cinco variedades de jamaica. Instituto Nacional de
Investigaciones Forestales, Agrcolas y Pecuarias. Disponible en:
http://www.redalyc.org/articulo.oa?id=263150548002
2. Bolade, M. K.; Oluwalana, I.B. y Ojo, O. (2009). Commercial Practice of Roselle (Hibiscus
sabdariffa L.) Beverage Production: Optimization of Hot Water Extraction and Sweetness Level.
World Journal of Agricultural Sciences 5 (1): 126-131. Disponible en:
http://www.idosi.org/wjas/wjas5(1)/18.pdf
3. Cid-Ortega, S.; Guerrero-Beltrn, J. A. (2012). Propiedades Funcionales de la jamaica
(Hibiscus sabdariffa L.). Revista Temas Selectos de Ingeniera de Alimentos. Vol. 6-2 Pp 47-63.
Universidad de las Amricas, Puebla. Disponible en:
http://web.udlap.mx/tsia/files/2013/12/TSIA-62Cid-Ortega-et-al-2012.pdf
4. Jimnez Edeza M, Chaidez Quiroz C, Len Flix J. Calidad microbiolgica de carne de res
comercializada en el mercado municipal de Culiacn, Sinaloa. Veterinaria Mxico.
2012;43:273-84.
5. NORMA Oficial Mexicana NOM-210-SSA1-2014, Productos y servicios. Mtodos de prueba
microbiolgicos. Determinacin de microorganismos indicadores. Determinacin de
microorganismos patgenos.

205
Investigaciones en Ciencia e Inocuidad de Alimentos

Control de calidad higinica en la produccin artesanal de yogurt

Ramrez Guzmn J. A., Estrada Andrade L. F., Alor Chvez M. de J., Matas Martnez R. I.,
Universidad Jurez Autnoma de Tabasco. Km 1.0 carretera Cunduacn-Jalpa de Mndez,
Cunduacn, Tabasco, Mxico. CP. 86690. Mxico. Telfono: +52 (01) 916 110 65 61.
Email: fabest94@hotmail.com

Palabras clave: yogur, artesanal, calidad.

Introduccin
El yogur es obtenido de la fermentacin de la leche por especies de Lactobacillus
bulgaricus y Streptococcus thermophilus. Entre las caractersticas distintivas de yogur
esta su contenido de bacterias lcticas vivas y de cido lctico. Las bacterias probiticas
incrementan el valor teraputico y nutricional del alimento. Los probiticos presentan
efectos ms all del valor nutritivo del alimento, incluyendo la exclusin, antagonismo e
interferencia con microorganismos patgenos, la inmunoestimulacin e
inmunomodulacin, actividades anticarcinognicas y antimutagnicas, alivio de los
sntomas de intolerancia a la lactosa, reduccin de colesterol srico, reduccin de la
presin arterial, disminucin en la incidencia y duracin de diarrea, prevencin de vaginitis
y mantenimiento de la integridad de las mucosas entre otras. Otros beneficios incluyen la
estimulacin de la sntesis de vitaminas y produccin de enzimas, estabilizacin de la
microflora, y reduccin del riesgo de cncer de colon (3).
La produccin de yogurt est basada en la adicin de fermentos de Streptococcus
thermophilus y Lactobacillus bulgaricus a la leche. Sin embargo, actualmente se considera
que la introduccin de microorganismos probiticos ha permitido, no slo mejorar la
produccin del yogurt, por disminuir la postacidificacin, sino tambin porque actan como
agente teraputico, generando efectos beneficiosos en las personas que los ingieren (1).
Las bacterias acido-lcticas utilizadas en la produccin de yogur, son microorganismos
benignos que se encuentran en grandes cantidades en la naturaleza, as como tambin
en nuestro aparato digestivo. Estas bacterias utilizan como fuente de energa la lactosa y
liberan cido lctico que provoca un incremento de la acidez, de modo que las protenas
de la leche precipitan formando el yogur, el cual es considerado un alimento nutricional
teraputico ya que mejora la digestin, el sistema inmune y la reduccin del colesterol (3).
La elaboracin del yogur consta de cuatro etapas bsicas: pasterizacin, inoculacin,
fermentacin y refrigeracin. En la actualidad existen muchas industrias dedicadas a la
elaboracin del yogur, las cuales ofrecen muchas ventajas, en comparacin con el yogur
casero y una muy importante es la garanta que tenemos los consumidores, es su
inocuidad sanitaria, sin embargo se puede tener el inconveniente de que sea una bebida
que por causa del tratamiento que recibe pierda parte de sus beneficios o se alteren sus
caractersticas fisicoqumicos y/o sensoriales s de ser una bebida, que por causas del
tratamiento que recibe, de igual manera se puede presentar una disminucin de la flora
lctea, debido al tiempo que permanece en el mercado, lo que no sucede con el yogur
artesanal, ya que su distribucin y consumo es inmediato (2).
En el presente estudio, se efectu un anlisis de la calidad higinica de un yogur
elaborado de forma artesanal, empleando cultivos de Lactobacillus delbrueckii subsp
bulgaricus y pltano, de la especie Musa acuminata, (fruto de alto consumo y produccin,
en el estado de Tabasco), de manera que los resultados obtenidos coadyuven en la
verificacin sanitaria del producto y stos sirvan de plataforma en la continuidad del

206
Investigaciones en Ciencia e Inocuidad de Alimentos

estudio fisicoqumico y proximal, obteniendo as una evaluacin integral del alimento y


poder a futuro patentarlo y comercializarlo en el Estado.

Metodologa
Para la elaboracin del yogur se emplearon 3.0 litros de leche semidescremada comercial
a la cual de manera previa se le analiz el pH, acidez y calidad higinica. Posteriormente
se someti a calentamiento a 85 1C por 5 minutos. Una vez a temperatura ambiente,
sta fue inoculada con cultivos madre al 1 y 3% respectivamente de Lactobacillus
delbrueckii subsp bulgaricus y Lactobacillus acidophilus, incubndose a 451C por 5
horas, monitoreando que el pH oscilara entre 4.0 y 4.6 de acuerdo a lo establecido en la
NOM-181-SCFI-2010. Posteriormente se llev a cabo la separacin de cultivos lcticos y
la adicin de pltano Roatan (Musa paradisiaca), previamente licuado, para finalmente
conservarse en refrigeracin, en botellas de plstico estriles de 250 mL.
La calidad higinica del alimento se realiz en base al recuento de bacterias coliformes
totales, fecales y mesoflicas aerobias, de acuerdo a lo establecido en la NOM-113-SSA1-
1994; NOM-112-SSA1-1994 y la NOM-092-SSA1-1994 respectivamente. Para el anlisis
de coliformes fecales por la tcnica del NMP, se realiz en primera instancia la prueba
presuntiva correspondiente, empleando caldo lactosado como medio de enriquecimiento
en diluciones realizadas por triplicado de 10, 1.0 y 0.1 mL, bajo un periodo de incubacin
de 361C por 48 horas. Los tubos positivos se les efectu la prueba confirmativa en
caldo verde bilis brillante y medio EC para determinacin de E. coli. Para el recuento de
coliformes totales y mesoflicos aerobios se emple la tcnica de vaciado en placa, para lo
cual, las muestras en diluciones seriadas de, 10-3 a 10-5 en solucin buffer fosfatos pH 7.2,
se sembraron por triplicado en agar rojo violeta bilis y agar para mtodos estndar
respectivamente, bajo un periodo de incubacin de 35 2C por 24 horas. El recuento de
mohos y levaduras se realiz conforme a la NOM-111-SSA1-1994, empleando como
medio de cultivo agar papa dextrosa acidificado bajo incubacin de las muestras en
diluciones seriadas a 25 1C.

Resultados y discusin
El anlisis qumico y microbiolgico en base a coliformes totales (CT), coliformes fecales
(CF) y bacterias mesoflicas aerobias, de la leche semidescremada comercial, empleada
como materia prima en la elaboracin del yogur se muestran en la tabla 1.

Tabla 1. Anlisis qumico y microbiolgico de la leche semidescremada

Parmetros

pH Acidez CT CF Mesoflicos
aerobios
(mL NaOH 0,1 N/100 (UFC/100 mL) (NMP/mL) (UFC/100 mL)
mL de leche)

6.5 0,22 1,02 0,24 < 2.3 x 103 0 < 1.1 x 103

Los resultados obtenidos de los parmetros qumicos analizados, estn dentro de los
valores de referencia reportados en las normas correspondientes.

207
Investigaciones en Ciencia e Inocuidad de Alimentos

El yogur present una viscosidad y acidez adecuada con olor caracterstico a pltano, de
sabor agradable y una coloracin amarillenta claro. Las condiciones de elaboracin se
realizaron de manera ptima de acuerdo a lo establecido en la NOM-181-SCFI-2010.
Ambas muestras presentaron valores de acidez adecuados (1,43 0,15 y 1.3.3 0,10
respectivamente), as como valores de pH de 4.3 y 4.2 0,07 respectivamente.
En cuanto a la calidad higinica se observ que ambas muestras presentaron valores
aceptables para Coliformes Totales, mesoflicos aerobios, mohos y levaduras (< 1.1
UFC/100 mL , <100 UFC/100 mL y <10 UFC/mL, respectivamente), sin presencia de
coliformes fecales, como se muestra en la tabla 2.

Tabla 2. Anlisis microbiolgico del yogur


Muestra Parmetros analizados

CT CF Mesoflicos aerobios Mohos y


levaduras
(UFC/mL) (NMP/mL) (UFC/mL) (UFC/mL)
1 < 10 0 <100 <10
2 < 1.1 0 < 45 < 10

Los resultados denotaron que ambas muestras de yogur cumplieron con los requisitos
microbiolgicos establecidos en las normas respectivas. Lo anterior puede atribuirse a la
adecuada pasteurizacin de la leche y al uso de fermentos lcticos provenientes de un
cultivo madre, lo cual garantiza un producto de buena calidad. Los yogures formulados no
presentaron coliformes totales lo que indica la adecuada calidad higinica en el proceso
de elaboracin ya que los microorganismos coliformes no resisten pH bajos y altos
valores de cido lctico, condiciones que se producen los yogures comerciales durante su
periodo de almacenamiento, debido a que las bacterias acidolcticas se comportan como
inhibidoras de otros microorganismos y este comportamiento es la base de su capacidad
para mejorar la calidad y la inocuidad en diversos alimentos.
.
Conclusiones
Se elaboraron dos muestras de yogur afrutado sabor pltano a partir de cultivos madre de
Lactobacillus delbrueckii subsp bulgaricus y Lactobacillus acidophilus, los cuales
presentaron valores de acidez y pH ptimos de acuerdo a lo establecido en la NOM-181-
SCFI-2010. La adicin del pltano en el yogurt mejor el sabor y la viscosidad del
producto. Microbiolgicamente el yogurt cumpli con los requisitos establecidos en las
Normas correspondientes. El producto cumpli con los estndares de calidad adecuados
que le confieren confiabilidad para su consumo. Todo producto destinado al consumo
humano, debe tener un control y verificacin sanitaria en su elaboracin, ya que de ello
depender la calidad e inocuidad del alimento.

208
Investigaciones en Ciencia e Inocuidad de Alimentos

Bibliografa

[1] Barrante, X., D. Railey, M. Arias y C. Chaves. 2004. Evaluacin del efecto de cultivos
probiticos adicionados a yogurt comercial, sobre poblaciones conocidas de Listeria
monocytogenes y E. coli O157:H7. Arch. Latin. Nutr. 54(3):293-297.

[2] Castillo, Y; Andino, F. 2010. Microbiologa de los alimentos: Un enfoque prctico para la
inocuidad alimentaria. Universidad nacional de ingeniera.

[3] Ramrez, J.C., Rosas, P., Velzquez, M.Y., Armando, U.J., Arce, R.F. 2011. Bacterias lcticas:
importancia en alimentos y sus efectos en la salud. Revista fuente ao 2. 7: 1-16.

[4] Norma oficial mexicana NOM-181-SCFI-2010. Yogurt-denominacin, especificaciones


fisicoqumicas y microbiolgicas, informacin comercial y mtodos de prueba.

[5] Norma oficial mexicana NOM-112-SSA1-1994, bienes y servicios. Determinacin de bacterias


coliformes. Tcnica del nmero ms probable.

[6] Norma oficial Mexicana NOM-113-SSA1-1994, bienes y servicios. Mtodo para la cuenta de
microorganismos coliformes totales en placa.

[7] Norma oficial mexicana NOM-092-SSA1-1994, bienes y servicios. Mtodo para la cuenta de
bacterias aerobias en placa.

[8] Norma oficial mexicana NOM-111-SSA1-1994, bienes y servicios. Mtodo para la cuenta de
mohos y levaduras en alimentos.

209
Investigaciones en Ciencia e Inocuidad de Alimentos

Residuos de piretroides promueven oxidacin irreversible en principales


fracciones proteicas de leche bovina
Rodrguez Cavallo, E., Marrugo Padilla, A.M., Mndez Cuadro, D.M.
Universidad de Cartagena, Grupo de Qumica Analtica y Biomedicina. Edificio CREAD, segundo
piso, Campus de la Salud, Zaragocilla. Tel. 301-5588298
Correo: erodriguezc1@unicartagena.edu.co

Palabras clave: Carbonilacin, piretroides, protenas bovinas.

Introduccin.
Los piretroides son insecticidas sintticos, derivados de las piretrinas naturales
encontradas en las flores de Chrysanthemum cineraraefolum, su estructura qumica les
confiere actividad toxica frente a diversas plagas que atacan cultivos y emplean entre sus
hospedadores animales de cra intensiva como los bovinos, lo cual ha promovido su uso
en formulaciones tpicas para dichos animales (5). Estas molculas se encuentran entre
los plaguicidas ms utilizados en la ltima dcada a nivel mundial, reemplazando inclusive
los organofosforados y organoclorados en muchas aplicaciones (5). En la ganadera
lechera los piretroides son ampliamente usados para el control de plagas, incluidas las
garrapatas, aplicndolos directamente en el animal, en el sitio de cra o en las zonas de
procesamiento de la leche, promoviendo as la contaminacin de dicho fluido, ya sea por
absorcin drmica en el animal gracias a su elevada liposolubilidad, o por contaminacin
cruzada (2). La presencia de estos contaminantes en alimentos esenciales como la leche
representa una problemtica alarmante, debido a su alto consumo en etapas iniciales de
la vida y a las implicaciones fisiolgicas que acarreara.

En la actualidad se han caracterizado diferentes mecanismos de toxicidad asociado los


piretroides en sistemas biolgicos, que incluyen la disrupcin endocrina y alteraciones
neurolgicas (4), sin embargo, no se ha evaluado el posible efecto oxidativo de estos
compuestos sobre macromolculas como las protenas. El estudio de la carbonilacin
proteica como factor medible del dao oxidativo en la leche y sus derivados, ha tomado
auge en los ltimos aos, dada la importancia y el efecto biolgico que representa el
consumo de protenas lcteas (Casenas y protenas del lactosuero) oxidadas en las
propiedades organolpticas, funcionales y nutricionales de dicho fluido, lo cual repercute
en la economa lechera y en la salud del consumidor (6 y 7). Se ha demostrado que la
oxidacin de protenas disminuye su grado de digestibilidad, al promover la formacin de
agregados poco accesibles a las enzimas proteolticas, afectando as la calidad nutricional
de alimentos como la leche (1). Por lo anteriormente planteado, el objetivo del presente
trabajo fue evaluar el dao oxidativo in vitro inducido por la presencia individual de
residuos de cipermetrina (CIP), Fenvalerato (FEN) y Flumetrina (FLU), en las principales
fracciones proteicas de la leche bovina.

Metodologa Fue seleccionada aspticamente una muestra de leche cruda, proveniente


de una vaca de ordeo libre de la administracin de pesticidas, al menos tres meses
antes del desarrollo de los experimentos. Una vez obtenida la muestra, se transport
hasta el laboratorio manteniendo la cadena de frio, a una temperatura inferior a los 4C. El
volumen muestral fue alicuotado y almacenado a - 20C hasta su posterior anlisis.

Diseo experimental. Para el desarrollo de los experimentos las muestras se dividieron


en blancos (Controles negativo) y enriquecidas individualmente con los piretroides de
inters, empleando dos niveles de contaminacin, los cuales para el caso de cipermetrina

210
Investigaciones en Ciencia e Inocuidad de Alimentos

fueron 20 y 30 g L-1, para fenvalerato 40 y 60 g L-1 y para flumetrina 30 y 45 g L-1,


todos los ensayos se hicieron por triplicado. Posterior al proceso de contaminacin, las
muestras fueron incubadas a temperatura ambiente por espacio de una hora, tiempo
estipulado para que el pesticida ejerciera su efecto oxidativo.
Una vez concluida la incubacin se extrajeron las casenas y protenas del lactosuero,
principales fracciones proteicas de la leche bovina, empleando procesos continuos de
centrifugacin y modificaciones del pH lcteo. Las fracciones extradas se cuantificaron
por el mtodo de Bradford, y con el fin de verificar su integridad y perfil migratorio, fueron
realizadas electroforesis unidimensionales (SDS PAGE) al 15% de acrilamida. El dao
oxidativo proteico causado por los piretroides fue medido en trminos de carbonilacin,
empleado el mtodo alcalino del 2,4 dinitrofenilhidrazina (DNPH) (3). Para esto se
incubaron las protenas con el DNPH por 10 minutos, la mezcla obtenida se incubo
nuevamente con NaOH 6N y una vez transcurridos 10 minutos la mezcla fue leda en el
espectrofotmetro a 450nm. El contenido de carbonilos se calcul empleando el
coeficiente de extincin molar del 2,4 DNPH corregido (=11154 M-1cm-1) y expresado
en nanomoles de carbonilos mg-1 protena.

Resultados y discusin. La concentracin proteica de las fracciones arrojo un rango


para casenas que estuvo entre (16.0 16.7) mg mL-1, con un promedio de 16.3 0.28
mg mL-1 (CV: 1.7) y valor promedio porcentual de recuperacin de 80.0 0.013%,
calculado a partir de la concentracin total de protenas en la leche descremada,
reportada como del 78% para casenas. Por otro lado la concentracin del lactosuero,
present un rango de (3.4 3.5) mg mL-1, con un valor promedio de 3.5 0.04 mg mL-1
(CV:1.2) y porcentaje de recuperacin de 74.5 0.92%, basado en el valor porcentual de
17%, equivalente a la fraccin del lactosuero en el total de protenas de la leche
descremada .
El comportamiento electrofortico de cada fraccin proteica fue adecuado, mostrando una
buena separacin de las protenas y la integridad de las mismas. La figura 1 ilustra el
electroferograma obtenido. El anlisis del bandeado de casenas (carril 2) demuestra la
congruencia con lo reportado por la literatura, observndose las cuatro bandas
caractersticas de la fraccion ( s1, s2, y casena bovina). La comparacin de las
bandas obtenidas en el lactosuero (carril 3) respecto a las reportadas demostr ser a su
vez concordantes, sin embargo a su vez evidencia la presencia de casenas y protenas
de la membrana del glbulo graso.

1 2 3

Figura 1. Electroforegrama de las principales


fracciones proteicas de leche cruda bovina.
Se muestran los perfiles de Casenas y
s1 / s2 casenas Lactosuero obtenidos al emplear geles de
-casena poliacrilamida al 15%. Carriles: (1) marcador
k-casena de peso molecular, (2) fraccin de casenas, y
(3) fraccin del lactosuero.
-lactoglobulina

-lactalbmina

211
Investigaciones en Ciencia e Inocuidad de Alimentos

Oxidacin de casenas y protenas del lactosuero.


Todos los piretroides promovieron dao oxidativo en las fracciones proteicas evaluadas a
sus diferentes concentraciones de exposicin, exceptuando a CIP (30 g L-1) y FLU (30
g L-1) en la fraccin del lactosuero, en donde la carbonilacin inducida no fue
estadsticamente diferente a la mostrada por el blanco (p>0.05). No obstante, el mayor
impacto oxidativo se observ en casenas, protenas en las que los pesticidas
promovieron una carbonilacin que fue aproximadamente 3.5 veces mayor a la inducida
en el lactosuero. De esta manera en dicha fraccin, la carbonilacin promovida por los
piretroides fue 3.23 veces mayor a la del blanco en el caso particular de CIP (30gL-1),
4.84 veces mayor para FEN (40gL-1) y 8.59 veces mayor para FLU (45gL-1) (p<0.001)
(Figura 1), observndose un comportamiento oxidativo variable respecto a las
concentraciones de las molculas, en el que para CIP y FLU fue dependiente de la
concentracin en contraposicin con FEN.

Figura 1. Comportamiento de la carbonilacin inducida por los piretroides en la fraccin de casenas de la


leche bovina. - Blanco: Carbonilos de la muestra blanco empleada en los ensayos que evaluaron la oxidacin
promovida por cipermetrina y fenvalerato, CIP 20 y 30: Muestras contaminadas con cipermetrina a 20 y 30
-1 -1
g L respectivamente, FEN 40 y 60: Muestras contaminada con fenvalerato a 40 y 60 g L respectivamente,
BLANCO FLU: Carbonilos de la muestra blanco empleada en los ensayos que evaluaron la oxidacin
-1
promovida por flumetrina, FLU30 y 45: Muestras contaminada con flumetrina a 30 y 45 g L
respectivamente.

En lo que respecta a las protenas del lactosuero, la carbonilacin inducida por los
piretroides fue 2.62 veces mayor al blanco para para CIP (20gL-1), 3.29 veces para FEN
(40 gL-1) y 5.57 veces para FLU (45gL-1) (p<0.001), mostrando al igual que en casenas
un comportamiento oxidativo variable en funcin de las concentraciones de las molculas,
en el que para CIP y FLU fue independiente de la concentracin en contraposicin con
FEN (Figura 2). Los valores de carbonilacin ms bajos del lactosuero en comparacin
con los inducidos en casenas podran ser explicados por la concentracin de estas
protenas en la leche, aproximadamente el 80% del total de protenas lcteas esta
constituido por casenas, frente al 17% equivalente al lactosuero, una diferencia de casi 4
decenas, lo que las hace ms susceptibles, o con una mayor probabilidad de ser oxidadas
por agentes externos.

212
Investigaciones en Ciencia e Inocuidad de Alimentos

Figura 1. Comportamiento de la carbonilacin inducida por piretroides en la fraccin del lactosuero bovino.
- BLANCO: Carbonilos del blanco de muestra empleado en ensayos de oxidacin causados por cipermetrina y
fenvalerato; CIP 20 y 30; FEN 40 y 60; y FLU30 y 45: Muestras contaminadas con Cipermetrina, Fenvalerato o
-1
Flumetrina a concentraciones de 20, 30, 40, 45 y 60 g L , respectivamente. BLANCO FLU: Carbonilos del
blanco de muestra empleado en ensayos de oxidacin causados por flumetrina.

Los resultados obtenidos evidencian la capacidad que poseen los piretroides para generar
estrs oxidativo in vitro por mecanismos desconocidos en las fracciones proteicas
evaluadas. Adicionalmente soportan las bases de una problemtica existente, producto de
las implicaciones fisiolgicas que trae consigo el consumo de protenas lcteas
carboniladas.

Conclusiones. La presencia de residuos traza de piretroides indujeron dao oxidativo in


vitro sobre casenas y protenas del lactosuero a los niveles de contaminacin evaluados,
con valores de carbonilacin significativamente superiores al del blanco (p<0.001). Las
casenas fueron las fracciones ms susceptibles a experimentar carbonilacin por los
piretroides. Flumetrina fue el contaminante que indujo mayor oxidacin in-vitro en las
fracciones proteicas.

Bibliografa
1- Estvez, M. 2011. Protein carbonyls in meat systems: A review. Meat Science, 89(3), 259279.
2- Machado, S., De Queiroz, M., Neves, A., & De Queiroz, J. (2008). Low-temperature clean-up
method for the determination of pyrethroids in milk using gas chromatography with electron
capture detection. Talanta. Vol.75: 13201323.
3- Mesquita, C. Oliveira, R. Bento, F. Geraldo, D. Rodrigues & Marcos. 2014. Simplified 2,4-
dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized
proteins. Analytical Biochemistry. 458: 69-71.
4- Radwan, M., Jurewicz, J., Wielgomas, B., Piskunowicz, M., Sobala, W., Radwan, P., Jakubowski,
L., Hawua, W & Hanke, W. 2015. The association between environmental exposure to
pyrethroids and sperm aneuploidy. Chemosphere 128 (2015) 4248.
5- Saillenfait, A., Ndiaye, D & Sabat, P. 2015. Pyrethroids: Exposure and health effects An
update. International Journal of Hygiene and Environmental Health. Vol. 218:281292.
6- Scheidegger, D. Radici, P. Vergara, V. Bosio , N. Pesce, S. Pecora, R. Romano, J &amp;
Kivatinitz,J. 2013. Evaluation of milk powder quality by protein oxidative modifications. J. Dairy
Sci.
96:34143423.
7- Scheidegger, D. Pecora, R. Radici, P &amp; Kivatinitz, J. 2010. Protein oxidative changes in
whole and skim milk after ultraviolet or fluorescent light exposure. J. Dairy Sci. 93:51015109.

213
Investigaciones en Ciencia e Inocuidad de Alimentos

Optimizacin de un procedimiento de fraccionamiento de casenas y


protenas del lactosuero bovino

Marrugo Padilla, A.M., Acosta Delgado A., Mndez Cuadro, D.M.y Rodrguez Cavallo, E.
Universidad de Cartagena, Grupo de Qumica Analtica y Biomedicina. Edificio CREAD, segundo
piso, Campus de la Salud, Zaragocilla. Tel. 3015588298.
Correo: erodriguezc1@unicartagena.edu.co

Palabras clave: leche bovina, casenas, protenas, lactosuero

Introduccin.
La leche bovina es un fluido biolgico de vital importancia para los mamferos, al ser el
primer recurso nutricional y la fuente primaria de proteccin inmunolgica del nuevo
organismo, propiedades atribuibles a su elevado contenido de protenas (6), tales como
las casenas y protenas del lactosuero, que en conjunto constituyen sus principales
fracciones proteicas (5). Basados en la importancia fisiolgica de las protenas antes
descritas, diversos investigadores han desarrollado metodologas que permiten extraer y
analizar el complejo total, o en su defecto las fracciones individuales, en aras de evaluar
su calidad y/o posible alteracin por factores externos (fsicos, qumicos y biolgicos).
Sin embargo, dichas metodologas de extraccin requieren periodos de tiempo
prolongados, el uso de tecnologas poco accesibles (ultrafiltracin, ultra-centrifugacin,
osmosis inversa, micro-filtracin, cromatografa de intercambio inico (3), entre otros) y el
consumo de solventes orgnicos poco amigables con el ambiente (diclorometano,
acetona, hexano, etc.). Por ejemplo, para el caso particular de las casenas, la Unin
Europea recomienda el uso de diclorometano para su extraccin en muestras de queso,
empleando volmenes de hasta 40 mL (7).
En el caso de la extraccin del lactosuero se emplean ciclos elevados de centrifugacin
(16,000 g o 11,777 rpm, 15 min, 4C) (2), o adicin de tampones cidos (actico / acetato
de sodio, pH 4,6) con periodos de incubacin de 20 minutos y posterior centrifugacin
(10.000 rpm, 15 min), lo que repercute en un alto consumo energtico y tiempos elevados
de ensayo (8). Por lo anterior, el objetivo de este estudio fue desarrollar y optimizar un
protocolo de fraccionamiento de casenas y protenas del lactosuero, rpido, sencillo,
accesible y amigable con el medioambiente, el cual pueda ser implementado en ensayos
bioqumicos, toxicolgicos, microbiolgicos, entre otros, dirigidos al estudio de las dos
fracciones.

Metodologa. Se seleccion aspticamente una muestra de leche cruda, proveniente de


una vaca de ordeo del departamento de Bolvar, Colombia, esta fue transportada hasta
el laboratorio manteniendo la cadena de frio (4C). El volumen total de muestra fue
alicuotado y almacenado a - 20C hasta su posterior anlisis.

Protocolo de extraccin proteica: Inicialmente las muestras de leche cruda se


desengrasaron mediante centrifugacin por un periodo de 30 minutos, separando el
componente graso de la matriz lctea, el cual se descart por no ser objeto de estudio. La
leche descremada obtenida fue acidificada con una solucin de cido actico, para
promover la precipitacin de las casenas, la suspensin obtenida se someti
centrifugacin (4C, 5 min), obteniendo un precipitado equivalente a la fraccin de
casenas y un sobrenadante constituido por el lactosuero, componentes posteriormente
separados mecnicamente.
El pellet de casenas fue lavado con una solucin de cido actico para eliminar
impurezas co-precipitadas, la suspensin resultante fue centrifugada (4C, 5 min.)

214
Investigaciones en Ciencia e Inocuidad de Alimentos

obteniendo la fraccin lavada lista para su reconstitucin en un solvente apropiado. El


sobrenadante con la fraccin del lactosuero obtenido anteriormente se precipit
aadiendo una disolucin de cido tricloroactico, la mezcla resultante fue centrifugada
(4C y 5 min), generando un sobrenadante equivalente al lactosuero desproteinizado y el
pellet constituido por la fraccin proteica.
Una vez fraccionadas, las protenas se cuantificaron por el mtodo de Bradford,
aadiendo por triplicado 5L de disolucin de protenas en una micro-placa, a la que
secuencialmente se le agregaron 200 L del reactivo de Bradford, la mezcla final se llev
a un espectrofotmetro, determinando su absorbancia a 595nm. La concentracin de
protenas fue calculada a travs de la ecuacin lineal de una curva de calibracin,
construida con patrones de albumina srica bovina (BSA) (Quick StartTM, BSA Estndar
de BIO-RAD). Para medir la eficiencia del protocolo de fraccionamiento se realizaron
electroforesis unidimensionales en geles de poliacrilamida con dodecilsulfato de sodio
(SDS-PAGE), la separacin electrofortica fue realizada inicialmente a 90 voltios los
primeros 30 minutos y a 130 voltios el resto del ensayo (90 120 minutos).
Finalmente, como parmetro de aplicacin del protocolo optimizado y basado en el auge
investigativo de la temtica, se determin el grado de carbonilacin de las protenas
lcteas, adaptando la metodologa descrita por Mesquita et al. Para esto una vez
extradas las protenas, se incubaron a oscuridad por 10 minutos con el reactivo 2,4
dinitrofenilhidrazina (DNPH), posteriormente se le adiciono a la mezcla, NaOH 6N, con
incubacin por 10 minutos y lectura en el espectrofotmetro a 450nm. El contenido de
carbonilos se calcul empleando el coeficiente de extincin molar del 2,4 DNPH corregido
(=11154 M-1cm-1) y expresado en nmol carbonilos mg-1 protena (4).

Resultados y discusin. El protocolo de fraccionamiento obtenido resulto ser sencillo,


reproducible y amigable con el ambiente, desde el punto de vista de la reduccin del
consumo de solventes orgnicos, promocin de la accesibilidad y el uso racional de los
recursos, mejorando las metodologas descritas en la literatura cientfica para extraer las
principales fracciones proteicas lcteas, ya fuese en la reduccin de las velocidades de
centrifugacin y en el uso se agentes precipitantes.
En este orden de ideas, el proceso de desengrasado implementado en el protocolo,
reduce los tiempos y velocidades de centrifugacin a ms de la mitad de los reportados
en la literatura. En el caso particular de los procesos de extraccin de casenas y
lactosuero, el protocolo mostr la capacidad de evitar el uso de solventes orgnicos, como
si lo estipula el Reglamento (CE) N o 273/2008 propuesto por la Unin Europea, en el que
emplean particin liquida a base de solventes como diclorometano y acetona, superando
los 25mL (7), en aras de extraer las dos fracciones proteicas mencionadas.
En contraposicin, el protocolo diseado emplea soluciones de cidos inorgnicos como
agentes precipitantes, sumado a procesos de centrifugacin para extraer dichas
protenas, actividades mucho ms sostenibles y amigables con el ambiente. Finalmente,
el uso de tecnologas accesibles y econmicas promueve la accesibilidad a su
implementacin.

Cuantificacin de protenas. La concentracin proteica de las fracciones se desglosa en


la Tabla 1, resultados en los que se observa que el rango de concentraciones obtenidas
para casenas estuvo entre (17.4 19.8) mg mL-1, con un promedio de 18.2 0.61 mg mL-
1
, y valor promedio porcentual de recuperacin de 85.3 2.86%, calculado a partir de la
concentracin total de protenas en la leche descremada, reportada como del 78% para
casenas (6). Por otro lado la concentracin del lactosuero, present un rango de (3.1
4.3) mg mL-1, con un valor promedio de 3.7 0.37 mg mL-1 y porcentaje de recuperacin

215
Investigaciones en Ciencia e Inocuidad de Alimentos

de 80.7 7.89%, basado en el valor porcentual de 17%, equivalente a la fraccin del


lactosuero en el total de protenas de la leche descremada (6).

Tabla 1. Resumen de los valores de concentracin proteica obtenidos en casenas y lactosuero


bovino.

Fraccin de casenas Fraccin del lactosuero


a
Muestra Promedio b DE c CV d % e
Promedio DE CV %
1 18.8 0.09 0.5 88.1 3.6 0.02 0.6 77.0
2 17.9 0.05 0.3 83.8 3.5 0.04 1.1 75.9
3 17.6 0.42 2.4 82.6 3.5 0.02 0.7 74.2
4 17.9 0.04 0.2 83.8 3.5 0.12 3.5 74.7
5 18.3 0.56 3.0 85.7 3.7 0.10 2.8 79.9
6 19.2 0.72 3.7 90.1 3.5 0.67 19.0 75.7
7 17.7 0.13 0.8 82.8 4.3 0.01 0.2 92.3
8 18.4 0.05 0.3 86.0 4.2 0.09 2.1 90.7
a b -1 c d e
n=2 , Expresado como mg de protena mL de solucin , Desviacin estndar, Coeficiente de variacin, Porcentaje
de recuperacin.

El comportamiento electrofortico obtenido para cada fraccin proteica fue adecuado,


mostrando una buena separacin de las protenas por el protocolo de extraccin. La figura
1a ilustra el electroferograma obtenido. En anlisis del bandeado de casenas (carriles 3 y
4) demuestra su congruencia con lo reportado por la literatura (Figura 1b), pudindose
observarse sus cuatro bandas caractersticas ( s1, s2, y casena bovina). La
comparacin de las bandas obtenidas en el lactosuero (carriles 5 y 6) con respecto a la
reportada demuestra a su vez la eficiencia del protocolo, logrando una separacin
adecuada de las protenas constitutivas de la fraccin (-Lactoglobulina: PM: 18.0 Da y -
Lactalbumina de PM: 14.0).
a b
) )

Figura 1. a) Electroferograma de las fracciones obtenidas a partir de leche cruda. Carril 1


(marcador de peso molecular), carril 2 Bandas de protenas de la leche cruda desengrasada,
carriles 3 y 4 (fraccin de casenas) y en el carril 5 y 6 (protenas del lactosuero). (I) Banda de
casena, (II) Banda de -Lactoglobulina y (III) Banda de -Lactoalbumina. c) Electroferograma leche
bovina. Carril 1: kit de patrones de protenas. Carriles 2 y 4: leche estndar de casena. Carriles 3 y
5: leche cruda de bovina (1).

216
Investigaciones en Ciencia e Inocuidad de Alimentos

Aplicacin de protocolo de fraccionamiento: Cuantificacin de la carbonilacin


proteica. El fraccionamiento de las protenas lcteas permiti realizar un anlisis de
oxidacin dirigido, generando resultados atribuibles a grupos de protenas especficos,
superando los resultados genricos que actualmente se reportan en trminos de
oxidacin de la fraccin proteica total. El acoplamiento del mtodo propuesto por Mesquita
et al (4), para la cuantificacin de grupos carbonilos, permiti evaluar el grado de
oxidacin proteica mostrado por 4 muestras de leche cruda. La tabla 2 resume los
resultados obtenidos. Resultados muestran al protocolo como adecuado para su
implementacin en etapas previas de estudios oxidativos, debido a que no promueve una
carbonilacin considerable producto de la manipulacin, que altere los resultados finales.

Tabla 2. Resumen de los valores de carbonilacin proteica obtenidos en casenas y lactosuero


bovino.
Fraccin de casenas Fraccin del lactosuero
a
Muestra Media b DE c CV d
Media DE CV
1 4.3 0.16 3.7 10.7 0.24 2.3
2 5.5 0.02 0.3 6.4 0.24 3.8
3 5.1 0.11 2.2 13.5 0.29 2.2
4 8.7 0.27 3.1 13.1 0.65 4.9
a b -1 c d
n=2; Expresado como nmoles de carbonilos mg de protena; Desviacin estndar; Coeficiente de variacin.

Conclusiones. El protocolo de extraccin optimizado fue sencillo, reproducible, acceible


y amigable con el ambiente. Obtuvo porcentajes de recuperacin por encima del 80%
para las dos fracciones evaluadas, junto con un bandeado adecuado que evidencio un
buen proceso de fraccionamiento. Finalmente permiti desarrollar anlisis de
carbonilacin dirigida, generando resultados atribuibles a los grupos de protenas
especficos.

Bibliografa

1. Costa, F. Vasconcelos, M. Moreira M. Martins, M. Leal de Oliveira, M. Mendona de Castro.


Siqueira de Oliveira, A. 2014. Microfluidic chip electrophoresis investigation of major milk
proteins: study of buffer effects and quantitative approaching. Analytical Methods, 6(6), 1666.
2. Faustea, D. Andrsa, M. Iturraldea, M. Lampreavea, F. Gallartb, J & lavaa, M. 2011.
Proteomic characterization by 2-DE in bovine serum and whey from healthy and mastitis
affected farm animals. Journal of proteomics 75: 3015 3030.
3. Holland, B. Rahimi, S. Titapiccolo, G. Corredig, M. 2010. Short communication: Separation and
quantification of caseins and casein macropeptide using ion-exchange chromatography.
Journal of Diary Science. 93 (3): 893900.
4. Mesquita, C. Oliveira, R. Bento, F. Geraldo, D. Rodrigues & Marcos. (2014). Simplified 2,4-
dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized
proteins. Analytical Biochemistry. 458: 69-71.
5. Pisanu, S. Ghisaura, S. Pagnozzi, D. Biosa, G. Tanca, A. Roggio, T. Uzzau, S & Addis, M.
2011. The sheep milk fat globule membrane proteome. Journal of proteomics. 74. 350 358.
6. Roncada, P. Piras, C. Soggiu,A. Turk, R. Urbani, A & Bonizzi, L. Farm Animal Milk Proteomics.
2012. Journal of proteomics. 75. 4259 4274.
7. Reglamento (CE) N 1081 /96 de la comisin. (1996). Diario Oficial de las Comunidades
Europeas.
8. Ten-Domnech, I. Sim-Alfonso, E. & Herrero, J. 2017. Isolation of human milk whey proteins
by solid phase extraction with a polymeric material modified with gold nanoparticles.
Microchemical Journal. 133: 320-326.

217
Investigaciones en Ciencia e Inocuidad de Alimentos

Carbonilacin in vitro en protenas de pollo inducida por residuos de


sarafloxacina, clorpirifs y su combinacin

Mndez Cuadro D. M. Rodrguez Cavallo, E., Mrquez Lzaro, J.P.


Universidad de Cartagena, Grupo de Qumica Analtica y Biomedicina. Edificio CREAD, segundo
piso, Campus de la Salud, Zaragocilla, Cartagena-Colombia, Tel. 3015588298.
Correo: dmendezc@unicartagena.edu.co

Palabras clave: Sarafloxacina, Clorpirifs, Carbonilacin

Introduccin
Actualmente la carne de pollo es uno de los productos ms consumidos a nivel mundial,
debido principalmente, a su bajo costo en comparacin a la carne de cerdo o bovina y a
su alto valor nutricional, representado en su elevado contenido proteico (34.5 %) rico en
aminocidos esenciales, necesarios para el normal funcionamientos de los procesos
metablicos del ser humano en todas las etapas de su vida (7).
En aras de suplir la demanda generada el sector avcola ha implementado el modelo
productivo de cra intensiva de animales, usualmente afectado por el rpido esparcimiento
de enfermedades ocasionadas por microrganismo e insectos, hacindose necesario, por
tanto, el uso de sustancias como antimicrobianos y plaguicidas con fines, teraputicos,
profilcticos y metafilcticos. Destacndose en este aspecto fluoroquinolonas como
sarafloxacina y plaguicidas de tipo organofosforados como clorpirifs (3,5).
A pesar de los beneficios en la produccin, el uso excesivo y/o inadecuado de dichas
sustancias puede conllevar a residuos en los productos comestibles del pollo (carne,
viseras, huevos) afectndose de esta manera su inocuidad y por ende la salud de los
consumidores. Dentro de los posibles efectos del consumo de carne contaminada se
encuentran: a) resistencia antimicrobiana (reactividad cruzada), reacciones alrgicas, para
el caso sarafloxacina y b) disrupcin endocrina, genotoxicadad para clorpirifs (3,5).

No obstante, debido a la capacidad que tiene sarafloxacina y clorpirifs de promover


estrs oxidativo y la susceptibilidad de las protenas a ser oxidadas, hasta el momento se
desconoce si la presencia per se de residuos de dichas sustancias o combinacin tienen
un efecto negativo sobre la calidad nutricional de la carne de pollo. Teniendo en cuenta
que la carbonilacin es el marcador estndar para medir oxidacin proteica y en el campo
de los alimentos ha tomado alta relevancia por su implicacin en la prdida del valor
nutricional de la carne (2), el objetivo de este trabajo fue evaluar efecto oxidativo in vitro
de sarafloxacina, clorpirifs y combinacin, sobre las principales fracciones proteicas de la
carne de pollo.

Metodologa
Una pechuga de pollo se compr en el mercado local de la ciudad de Cartagena,
Colombia y se transport al laboratorio en una bolsa plstica sellada, manteniendo la
cadena de frio. Una vez en el laboratorio, se retir la grasa y tejido conectivo visible, y se
cort en pequeos cubos, los cuales se homogenizaron empleado un procesador de
alimentos. Muestras del homogenizado se contaminaron directamente con soluciones
individuales de sarafloxacina y clorpirifs, obteniendo concentraciones finales de 50,100 y
150 gKg-1. Una vez contaminadas las muestras, se incubaron en oscuridad. Cada
concentracin y el blanco se ensayaron por duplicado.
Transcurrido el tiempo de incubacin se precedi a realizar la extraccin de las protenas
sarcoplsmicas y miofibrilares de las muestras (contaminadas y blanco). Para esto se
emple el procedimiento reportado por Molette y Col. (7) con algunas modificaciones. A

218
Investigaciones en Ciencia e Inocuidad de Alimentos

cada muestra le fue adicionado buffer de baja fuerza inica (K3PO4 0.05 M, NaN31 mM,
EDTA 2 mM, pH 7.3). Seguido, se centrifugo por 10 min y el sobrenadante obtenido
(protenas sarcoplsmicas) fue colectado. El paso anterior se repiti una vez. El pellet
que se obtuvo fue resuspendido en buffer de alta fuerza inica (K3PO4 0.05M, NaN31 mM,
EDTA2 mM, KCl 0.15M, pH 7.3) y se centrifug por 10 min. El sobrenadante obtenido
(protenas miofibrilares) se colecto. La cuantificacin de las protenas se realiz con el
mtodo de Bradford.

El contenido de carbonilos en cada fraccin proteica se realiz empleado el mtodo


alcalino del 2,4-dinitrofenilhidrazina (2,4 DNPH) reportado por Mesquita y Col (6) con
algunas modificaciones. Para esto se tomaron 150 g de protena por cada fraccin
proteica y se adicion una solucin de 2,4 DNPH (10mM en 0.5M H3PO4), con posterior
incubacin en oscuridad. Seguido, a la solucin derivatizada se adicion NaOH 6N y se
incub en oscuridad. La lectura de los carbonilos se realiz a 450nm. El contenido de
carbonilos en la muestra se calcul empleando el coeficiente de extincin molar del 2,4
DNPH y se expres en nmol carbonilos mg-1 protena. El ensayo de combinacin
sarafloxacina-clorpirifs se realiz despus de tener los resultados individuales.

Resultados y discusin
Los resultados de carbonilacin inducida por sarafloxacina y clorpirifs se muestran en las
Figuras 1 y 2. Como se observa en la Figuras 1, sarafloxacina indujo carbonilacin a
todos los niveles de exposicin con respecto a blanco (p<0.05) en ambas fracciones. En
la fraccin sarcoplsmica, la mxima carbonilacin fue promovida a 100 (0.68 0.01 nmol
carbonilos mg-1 protena) y 150 gKg-1 (0.67 0.01 nmol carbonilos mg-1 protena), valores
que fueron aproximadamente 8 veces mayor al blanco. En cuanto a la fraccin miofibrilar,
la mxima oxidacin fue promovida a 200 gKg-1 (0.58 0.00 nmol carbonilos mg-1
protena), valor 5.4 veces mayor al blanco.

a)

Figura 1. Carbonilacin in vitro


inducida por sarafloxacina sobre
protenas: (a) sarcoplsmicas y
(b) Miofibrilares de pechuga de
pollo. Superndices a-d,
diferentes indican diferencias
significativas con respecto al
blanco y superndices x-y entre
b) las diferentes concentraciones.
Las barras muestran la media
desviacin estndar, n=2.

219
Investigaciones en Ciencia e Inocuidad de Alimentos

Clorpirifs, al igual que sarafloxacina tambin promovi oxidacin significativa (p<0.05)


con respecto al blanco a todas las concentraciones ensayadas, Figura 2. La mxima
carbonilacin en las protenas sarcoplsmicas fue inducida a 200 gKg-1 (1.41 0.01
nmol carbonilos mg-1 protena), y en miofibrilares a 100 gKg-1 (1.41 0.01 nmol
carbonilos mg-1 protena), siendo estas 17 y 22.3 veces mayor al blanco respectivamente.

a)

b)

Figura 2. Carbonilacin in vitro inducida por clorpirifs sobre protenas: (a) sarcoplsmicas y (b) Miofibrilares
de pechuga de pollo. Superndices a-d, diferentes indican diferencias significativas con respecto al blanco y
superndices x-y entre las diferentes concentraciones. Las barras muestran la media desviacin estndar,
n=2.

Al comparar la carbonilacin inducida por sarafloxacina y clorpirifs en las protenas


sarcoplsmicas y miofibrilares, se observa que este ltimo es quien mayor dao les
ocasiona, incluso a concentraciones por debajo de los 200 g Kg-1. La alta capacidad
oxidante del clorpirifs puede estar relacionada con su facilidad para difundir a travs del
sarcolema de la clula muscular, evento atribuible a su alta lipofilicidad (logow = 4.09) (4,5)
y relativo bajo peso molecular (350.6 g/mol). Una vez en el interior de la clula
(sarcoplasma), inducir oxidacin proteica sobre las protenas sarcoplsmicas por un
mecanismo an desconocido y continuar su difusin hacia la miofibrilar, donde segn los
resultados obtenidos, es donde mayor carbonilacin promueve. Adicionalmente, la
oxidacin promovida por clorpirifs tiende a ser independiente de la concentracin (Figura
2). En cuanto a sarafloxacina, su capacidad de atravesar el sarcolema, depender en
primera instancia de su estado inico y el pH del medio, as bien, en las condiciones
posmortem del musculo (pH acido), el nmero de molculas de sarafloxacina que
alcancen estado neutro o zwiterionico, va a ser limitado, hecho que podra estar

220
Investigaciones en Ciencia e Inocuidad de Alimentos

repercutiendo en su capacidad oxidante en contraste al clorpirifs, adems de su alto


peso molecular (385.4 g/mol) (1,7).

Teniendo en cuenta que en la prctica estas sustancias se pueden administrar de forma


simultnea en los pollos, se prob la combinacin sarafloxacina- clorpirifs a las
concentraciones 100 y 150 gKg-1 respectivamente. El resultado de este experimento,
evidenci que dicha combinacin promueve oxidacin significativa con respecto al blanco
(p<0.05). Sin embargo, la carbonilacin promovida en la fraccin sarcoplsmica y
miofibrilar solo fue 1.6 y 2.2 veces mayor al blanco, que en comparacin a las oxidaciones
individuales son muchas bajas, comportamiento que podra estar relacionado con la
lipoficidad y volumen dismil de ambas molculas. Debido a la innovacin de la temtica
presentada se hace difcil hacer comparativos con reportes de la literatura, de ah que se
requiera de ms estudios que exploren esta nueva rea de investigacin.

Conclusiones
Todas las concentraciones traza tanto de sarafloxacina como clorpirifs indujeron
oxidacin in vitro sobre las protenas sarcoplsmicas y miofibrilares de la carne de pollo,
evidencindose de esta manera que estas sustancias son capaces de inducir una
respuesta oxidativa a concentraciones del orden de los microgramos. La capacidad
oxidante de clorpirifs puede estar relacionada principalmente a su alta lipofilicidad y
relativo bajo peso molecular, sin embargo, en combinacin con sarafloxacina su efecto se
ve disminuido.
Adicionalmente estos hallazgos evidencian la necesidad de profundizar en investigaciones
concernientes al efecto oxidativo promovido por la presencia de sustancias de uso
veterinario en productos de origen animal, si se tiene en cuenta que la carbonilacin
proteica ha sido fuertemente relacionada con la prdida del valor nutricional y un posible
aumento en la susceptibilidad a padecer cncer de colon y gastritis ulcerosa (2).

Bibliografa
1. Blokhina, S., A. Olkhovich, M., Volkova, T., Perlovich, G. 2016. Solubility, lipophilicity and
membrane permeability of some fluoroquinolone antimicrobials. European Journal of
Pharmaceutical Sciences, 93: 2937.
2. Estvez, M. (2011). Protein carbonyls in meat systems: A review. Meat Science, 89(3): 259-
279.
th
3. Fink, J. 2014. Residues in meat and meat products | Feed and Drug Residues. 2 ed. Elsvier
Pp.214-220. In: Encyclopedia of Meat Sciences. Elsevier Ltd.
4. Kim, S., Thiessen, A., Bolton, E., Chen, J., Fu, G., Gindulyte, A.,Bryant, S. 2016. PubChem
Substance and Compound databases. Nucleic Acids Research. 44(D1): D120213.
5. Lukaszewicz-Hussain, A. 2010. Role of oxidative stress in organophosphate insecticide toxicity
Short review. Pesticide Biochemistry and Physiology, 98(2): 145150.
6. Mesquita, C. Oliveira, R. Bento, F. Geraldo, D. Rodrigues & Marcos. (2014). Simplified 2,4-
dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized
proteins. Analytical Biochemistry. 458: 69-71.
7. Molette, C., Rmignon, H., Babil, R.2003. Maintaining muscles at a high post-mortem
temperature induces PSE-like meat in turkey. Meat Science, 63(4): 525532.

221
Investigaciones en Ciencia e Inocuidad de Alimentos

Elaboracin de queso crema adicionado con Enterococcus faecium


1 1 1 2
Morales Ovando. M.A. , Aguilar Reyes, L.M. , Domnguez Espinosa, M. E. , Romero Cortes, T. ,
2 3 3
Cuervo Parra, J.A. , Ochoa Reyes, E. Tirado Gallegos, J.M.
1
Facultad de Ciencias de la Nutricin y Alimentos, Universidad de Ciencias y Artes de Chiapas,
Libramiento Norte- Poniente 1150, C.P. 29000.Tuxtla Gutirrez, Chiapas.
*
mario.morales@unicach.mx
2
Escuela Superior de Apan. Universidad Autnoma del Estado de Hidalgo. Chimalpa Tlaloyote,
C.P. 43920. Hgo, Mxico.
3
Unidad Fisiologa y Tecnologa de Alimentos de la Zona Templada, CIAD. Av. Ro Conchos S/N
Parque Industrial, C.P. 31570 Cd. Cuauhtmoc, Chihuahua.
Palabras clave: leche, queso crema, enterococos faecium.

Introduccin
La produccin de leche en Mxico es la tercera actividad ms importante en la industria
alimentaria. Sin embargo su produccin es muy heterognea desde el punto de vista
tecnolgico, agroecolgico y socioeconmico. En villa de Acapetahua, Chiapas el sistema
de produccin de bovinos es de doble propsito (carne y leche) y se lleva a cabo en
unidades de produccin extensivas con bajo nivel tecnolgico, agropecuario y
socioeconmico (5). La calidad de la leche de la mayora de los productores locales est
asociada al manejo, obtencin, almacenamiento y transporte, no existe control
fisicoqumico y microbiolgico en las etapas procedentes a la llegada a las queseras. De
acuerdo con los productores locales de queso crema la pasteurizacin de la leche afecta
las caractersticas organolpticas del producto debido a la eliminacin de las bacterias
cidos lcticos (BAL). Sin embargo, si este proceso trmico no se aplica mantiene viables
microorganismos patgenos como E. coli. El queso crema a partir de leche pasteurizada,
podra complementarse mediante un proceso de adicin de BAL como E. faecium. Cabe
mencionar que los probiticos deben permanecer viables y activos en el alimento y
durante su trnsito gastrointestinal para garantizar su potencial benfico en el husped (2).
El objetivo de esta investigacin fue elaborar queso crema con leche pasteurizada
adicionada con 5%, 10% y 15% del probitico E. faecium, para mejorar su calidad
fisicoqumica y sensorial.
Metodologa
Origen de las muestras. Las muestras de leche fueron proporcionadas por un productor
local en Villa de Acapetahua durante los meses de julio y octubre del 2016. Las muestras
se colocaron en frascos limpios y estriles, posteriormente se refrigeraron a 5C. El
anlisis fisicoqumico y microbiolgico de las muestras se realiz en el laboratorio de
alimentos y microbiologa de la UNICACH en Tuxtla Gutirrez.
Calidad fisicoqumica de la leche y queso. Los anlisis se realizaron por triplicado, se
determin el pH por la NMX-F-099-1970, para determinar acidez titulable g/L de cido
lctico, densidad y grasa por el mtodo de Gerber se utiliz la NOM-155-SFCI-2003,
Prueba de alcohol (PROY-NMX-F-COFOCALEC-2012), determinacin de slidos totales y
cenizas totales de acuerdo al (INEN 14, 1984), determinacin de protenas (NMX-F-513-
1988). La ceniza total de los quesos se llev a cabo bajo el mtodo presentado por la
NMX-F-111-1984. El porcentaje de protenas en queso fue determinado de acuerdo con la
NMX-F-098-1976.
Reactivacin de E. faecium. La cepa de E. faecium se obtuvo del aislamiento de quesos
crema del estado de Chiapas, la cual fue aislada en el laboratorio de microbiologa de la
Universidad Autnoma de Quertaro, se inocularon en 50 mL de caldo MRS, del caldo se
tomaron concentraciones de 5%, 10% y 15% del probitico v/v y se centrifugo en una
centrifuga Hettich EBA 21 a 4500 rpm por 15 min para separar el sobrenadante,
posteriormente el pellet se le adicion 50 mL de leche pasteurizada.

222
Investigaciones en Ciencia e Inocuidad de Alimentos

Elaboracin del queso crema. Se elabor siguiendo el proceso artesanal propuesto por
la asociacin de procesadores de queso Chiapas S.P.R. de R.L. entre los pasos
sealados se implement la pasteurizacin y la adicin del probitico E. faecium. El queso
se dej madurar por 14 das una temperatura de 10C para su posterior anlisis.
Registro de UFC de E. coli en la leche y Recuento de BAL en los quesos crema. Se
preparo la muestra de acuerdo a la NOM-243-SSA1-2010, utilizando las diluciones 104,
105 se tomaron 1000 L y se sembr en placas 3M petrifilm para recuento E. coli y placas
3M para BAL, se incubaron durante 483 h a 32C1C, las colonias se expresaron como
UFC/mL de E. coli en la leche y log UFC/g de BAL en el queso crema(6).
Calidad sensorial de los quesos crema. Se utilizo la prueba sensorial discriminativa con
prueba escalar de control facial con 20 penalistas elegidos al azar que valoraron el olor,
sabor, color y textura usando como parmetros (me gusta mucho 5 puntos, me gusta 4
puntos, me gusta poco 3 puntos, ni me gusta ni me disgusta 2 puntos y no me gusta 1
punto).
Descripcin del anlisis estadstico. El anlisis fisicoqumico y sensorial de los quesos
crema, se estableci bajo el diseo experimental bloques completamente al azar, de este
modo T1=5%, T2=10% y T3=15% con tres repeticiones, las variables se evaluaron a los
14 das de almacenamiento y los datos se analizaron con el paquete estadstico MINITAB
versin 17, mediante un anlisis de varianza de una va (ANOVA) y cuando existieron
diferencias entre las medias, estas se detectaron aplicando una prueba de Tukey con un
nivel de significancia de 0.05 (p0.05).

Resultados y discusin
Calidad fisicoqumica de la leche.
Los valores obtenidos de pH, acidez titulable (Dornic), densidad, grasa, slidos totales,
cenizas totales y protena cruda dentro de los valores establecidos por Bernal-Martnez et
al. (2007), Tabla 1.

Tabla 1. Valores fisicoqumicos encontrados en la leche


Variable Este trabajo Bernal-Martnez et al. (2007)
pH 6.920.03 6.63
Acidez titulable 0.200.00 0.17
Densidad 1.0330.00 1.0307
Grasa 3.450.07 3.73
Slidos totales 12.450.16 12.63
Cenizas totales 0.650.02 0.80
Protenas 3.870.93 3.07
Prueba de alcohol Positiva No determinada

El pH de la leche aumenta por la liberacin de iones de hidrgeno, un equilibrio entre el


aumento y disminucin previene cambios durante los tratamientos trmicos que es
sometida la leche (8). Factores como la raza, dieta, salud ruminal, poca del ao,
produccin de leche, etapa de lactancia y contenido de clulas somticas influyen
significativamente en las propiedades fisicoqumicas de la leche (3).

Registro de las UFC de E. coli en la leche. Se encontr valores <3.0 NMP (0 UFC) de
E. coli, lo que indic que fue aceptable para las especificaciones que seala la NOM-243-
SSA1-2010 para la leche utilizada en la elaboracin de quesos, ya que no existi
presencia de esta bacteria que es indicadora de contaminacin.

223
Investigaciones en Ciencia e Inocuidad de Alimentos

Calidad fisicoqumica del queso crema adicionado con E. faecium


Se encontr que el pH (5.770.30a) del queso crema con 10% del probitico tuvo
diferencias significativas con respecto a los quesos con 5 y 10% de E. faecium. La acidez
titulable (0.3540.025a) del queso con 15% del cultivo fue mayor (p<0.05) a los valores
encontrados en quesos con 5 y 10% de E. faecium. Por otra parte, no se observaron
diferencias significativas en el contenido de cenizas, grasa y protenas en los tres
tratamientos, tabla 2.

Tabla 2. Valores fisicoqumicos encontrados en los quesos crema


Concentraciones del probitico
Variable
5% 10% 15%
pH 5.400.20b 5.770.30a 5.230.15b
Acidez titulable 0.2280.005b 0.2340.009b 0.3540.025a
Ceniza 3.140.085a 3.050.041a 3.280.16a
Grasa 24.500.50a 27.502.50a 27.002.0a
Protenas 20.102.23a 20.542.67a 20.991.33a
Valores con letras iguales en la misma fila no presentaron diferencias significativas
(p>0.05)

Los valores de pH registrados en los quesos fueron inferiores a los observados en la


leche fresca. La presencia de cultivos lcticos en el queso y la consecuente produccin de
cido lctico por fermentacin de la lactosa, provoca el descenso normal del pH del
producto durante la fabricacin, alcanzando valores de 5 o 5.2 al final de su vida til (7). El
cido lctico originado depende del tipo y concentracin del cultivo iniciador, la
temperatura, adems, el cultivo iniciador contina produciendo cido lctico durante la
maduracin de los quesos.
El contenido de cenizas totales encontrado en los quesos crema estuvo dentro del valor
mnimo (0.5%) que establece la NMX-F-094-1984. El porcentaje normal de protena en
quesos crema es de 17.75% a 26.50%, la no heterogeneidad del proceso, el control de
temperatura, pH y tiempo provoca que no haya diferencias en la precipitacin de
protenas (4).

Cuantificacin de BAL en el queso crema


El contenido de BAL despus de 14 das de almacenamiento en quesos adicionados con
5,10 y 15% del cultivo iniciador fue de (5.20, 5.0 y 5.11 log UFC/g, respectivamente).
Estos valores estuvieron por debajo del valor mnimo (6.30 log UFC/g) sealado por la
NMX-F-444-1983. Por otra parte, Maldonado-Arreola y Valds-Trejo (2015), registraron
valores entre 4.65 y 6.58 log UFC/g de BAL en tres quesos crema, datos que concuerdan
con los encontrados en esta investigacin.

Calidad sensorial del queso crema probitico


Se observ que el sabor y color de los quesos crema probiticos no presentaron
diferencias significativas (p>0.05). Sin embrago el queso sin cultivo (queso control)
iniciador fue superior en dichos atributos. El olor de los quesos adicionados con E.
faecium fue mayor cuando la concentracin del cultivo iniciador fue de 10%, pero idntico
al queso control (p>0.05). Por otra parte, la textura de los quesos probiticos fue ms
aceptable en el queso con 5% de cultivo iniciador, la cual fue estadsticamente idntica a
la del queso control, tabla 3.

224
Investigaciones en Ciencia e Inocuidad de Alimentos

La acidificacin como resultado del metabolismo de las cepas lcticas es importante en la


elaboracin de quesos ya que ayuda a la coagulacin y la reduccin del crecimiento de
microflora no deseada, adems contribuye al producto final (1).

Tabla 3. Comparacin sensorial de los quesos crema


Concentraciones del probitico
variable Queso control
5% 10% 15%
Sabor 3.2381.670b 3.8101.167b 3.2381.446b 4.5240.928a
Olor 3.6671.494b 4.2380.625a 3.7141.056b 4.6190.669a
b b b
Color 4.4760.981 4.1430.793 4.0001.049 4.9040.300a
Textura 4.4760.512a 3.6671.017b 3.3811.284b 4.5240.750a
Valores con letras iguales en la misma fila no presentaron diferencias significativas
(p>0.05)

Conclusiones
La composicin fisicoqumica de la leche, particularmente los porcentajes composicin
nutrimental, indican que la leche usada en el estudio fue de buena calidad desde el punto
de vista nutricional. Al encontrarse E. coli en la leche usada como materia prima, se
puede asumir que no existi contaminacin microbiolgica y se puede consumir sin
tratamiento trmico previo.
La adicin de 5, 10 y 15% de E. faecium no influyo en los parmetros fisicoqumicos y
valor nutricional de los quesos. El poco crecimiento de BAL en los quesos crema se debe
al bajo pH requerido para el desarrollo de este cultivo. La incorporacin de E. faecium
para para obtener queso crema permiti obtener un producto final con atributos
sensoriales (sabor, olor, color y textura) aceptables, independientemente de la
concentracin del cultivo iniciador.

Bibliografa

1. Narvez-Guillen B. Aislamiento, identificacion y caracterizacin de Bacterias cido Lcticas


del queso de cabra artesanal del sureste de Coahuila para su uso como cultivos iniciadores
en quesos pasteurizados. Trabajo de titulacin (Ingeniero en Ciencia y Tecnologa de Alime.
Saltillo, Coahuila, Mxico: Universidad Autnoma Agraria Antonio Narro; 2015. p. 83.
2. Olagnero G, Abad A, Bendersky S, Genevois C, Granzella L, Montonati L. Alimentos
funcionales: fibra , prebiticos , probiticos y simbiticos. 2007;25(121):2033.
3. Reyes-Gonzlez G, Molina-Snchez B, Coca-Vzquez R. Calidad de la leche cruda.
Mxico; 2010.
4. Rosado-Zarrabal T, Corzo-Gonzlez H, Morales-fernndez S, Velzquez-Mndez A, Wong-
villarreal A. Caracterizacin fisicoqumica de quesos tnicos del estado de Chiapas.
CienciaUAT.
5. Secretara de Economa. ANLISIS DEL SECTOR LCTEO EN MXICO. MXICO; 2012.
www.economia.gob.mx/files/comunidad_negocios/industria_comercio/informacionSectorial/a
nalisis_sector_lacteo.pdf
6. Villegas-de Gante A, Santos-Moreno A. Calidad de leche cruda. Mxico: trillas; 2010. 96 p.
7. Zambrano-Dvalos M. Elaboracin de queso fresco con la utilizacin de un fermento
probitico (Lactobacillus acidophilus). Trabajo de titulacin (Ingeniera agroindustrial). Quito:
Escuela Politcnica Nacional; 2010. p. 159.
8. Zavala-Pope JM. Aspectos nutricionales y tecnolgicos de la leche [Internet]. Direccin
General de Promocin Agraria. Per; 2005. p. 160. Available from:
http://www2.congreso.gob.pe/sicr/cendocbib/con3_uibd.nsf/7AE7E7AB111562710525797D
00789424/$FILE/Aspectosnutricionalesytecnolgicosdelaleche.pdf

225
Investigaciones en Ciencia e Inocuidad de Alimentos

Diagnstico higinico-sanitario e identificacin de factores


de riesgo en servicios de restauracin alimenticia

Jimnez Ortega, L.A., Gonzlez Aguilar, D.G., y Campos Bravo, C.A.


Departamento de Salud Pblica, Centro Universitario de Ciencias Biolgicas y Agropecuarias.
Universidad de Guadalajara. Camino Ing. Ramn Padilla Snchez No. 2100 La Venta del Astillero,
Zapopan, Jalisco, Mxico. CP 45110. Tel: 37771151, ext: 33194. Correo-e: cacb21@hotmail.com
Palabras clave: Inocuidad, evaluacin sanitaria, servicio de alimentos

Introduccin
En todo el mundo, los servicios de alimentos han sido reportados como lugares de origen
de enfermedad, los ms frecuentemente sealados, son restaurantes, bares, escuelas,
guarderas, geritricos y comedores colectivos, asociados a condiciones indeseables en el
proceso de elaboracin (2, 8).

En restaurantes de Acapulco, Guerrero, Mxico, los factores de riesgo ms relevantes son


la infraestructura, el agua para uso y consumo humano, contaminacin directa y cruzada,
control de temperatura en las barras de servicio o buffet, y fauna nociva (8). En el estudio
realizado por di Pietro et al., se seala que por deficiencias en su preparacin, el mayor
nmero de casos se present por el consumo de alimentos provenientes de
establecimientos comerciales (23 %) y restaurantes de hoteles (8 %), 5 % fue en
comedores escolares (2).

Harris et al., concluyen que los restaurantes de cadena tienen menos desviaciones
crticas que los restaurantes independientes (4). La investigacin de Flrez et al., resea
que 8.3 % de los restaurantes no tenan una ubicacin adecuada, 37.7 % no contaban
con planes de saneamiento y slo 8.7 % realizaban prcticas apropiadas de
almacenamiento. En cuanto a los manipuladores, 60.7 % realizaron curso de
manipulacin de alimentos (3).

Con el propsito de reducir las tasas de enfermedad alimentaria es importante aplicar


procedimientos que contribuyan a mejorar los estndares de inocuidad, entre los cuales
se encuentran los programas pre-requisito (como las buenas prcticas de manufactura y
los POES), mismos que representan una de las mejores acciones para el control de la
transmisin de microorganismos patgenos al consumidor, las auditoras de los servicios
de alimentos son parte fundamental de dichos programas (2, 8).

La industria restaurantera es, la segunda que ms empleados tiene en Mxico, lo que


dimensiona el impacto potencial que los servicios de alimentos pueden tener en la salud
del consumidor final. Es innegable la trascendencia cultural y econmica de la industria
restaurantera en Mxico, el objetivo del presente estudio fue efectuar el diagnstico
higinico-sanitario e identificar factores de riesgo en servicios de restauracin alimenticia
ubicados en el estado de Jalisco, Mxico, a travs de actas de verificacin basadas en la
norma NOM-251-SSA1-2009.

Metodologa
Las evaluaciones se aplicaron en 81 establecimientos fijos de servicio de alimentos,
ubicados en el estado de Jalisco, Mxico, los cuales emitieron su autorizacin para
efectuarlas. Los datos se recolectaron por personas capacitadas, en una nica visita por
establecimiento, mediante el acta de verificacin sanitaria de prcticas de higiene,
expedida por la Comisin Federal para la Proteccin contra Riesgos Sanitarios

226
Investigaciones en Ciencia e Inocuidad de Alimentos

(COFEPRIS), basada en la NOM-251-SSA1-2009; se tomaron en cuenta las secciones I


(Disposiciones generales de establecimientos) y III (Disposiciones aplicables a
establecimientos de servicio de alimentos y bebidas). La calificacin de cada uno de los
incisos fue dada en base a los siguientes criterios: 2, cumple totalmente; 1, cumple
parcialmente; 0, no cumple; --, no aplica (7).

Se empleo la gua de autoevaluacin emitida por la COFEPRIS (1), para evaluar el


cumplimiento del acta de verificacin, en donde se categorizan los incisos como: punto
requerido de buenas prcticas (R); punto crtico de inocuidad (C); punto crtico de
inocuidad indispensable (C+). 85 % fue el mnimo para considerar aprobatoria la
evaluacin. Los establecimientos se clasificaron tomando en cuenta la clase de actividad
de acuerdo al Sistema de Clasificacin Industrial de Amrica del Norte (SCIAN) (5), as
como por su giro (6).

Resultados y discusin
26 de los 81 establecimientos aprobaron la evaluacin (tabla 1). En la clase de actividad
722511, las calificaciones de los 13 servicios de alimentos aprobados, variaron de 85.55 a
94.35. En SCIAN 722512, los dos aprobados obtuvieron 89.66 y 90.68. Un restaurante
que expende tortas calific con 90.91 (SCIAN 722514). En SCIAN 722515, los tres
lugares aprobados calificaron con 90.43, 90.83 y 91.6. Los tres restaurantes con venta de
hamburguesas (SCIAN 722517), presentaron las calificaciones ms elevadas de todo el
estudio (94.78, 95.3 y 98.74), los cuales pertenecen a franquicias que tienen bien
establecidos los programas pre-requisito. Las pizzerias aprobadas (4), fueron evaluadas
entre 85.47 y 93.5, una de las cuales tambin es franquicia.
55 de los lugares auditados fueron reprobados (tabla 1), si la verificacin la hubiera
efectuado la Secretara de Salud, resultaran suspendidos por incumplimiento. Abarcan a
todas las clases de actividad, los lmites de calificacin fueron: 31.40 (SCIAN 722511) y
84.87 (SCIAN 722512). Destaca que en la actividad SCIAN 722513, restaurantes con
servicio de preparacin de antojitos, los nueve establecimientos evaluados, no aprobaron
(calificados entre 43.1 y 81.25), as como los cinco restaurantes con venta de tacos
(SCIAN 722514), calificados entre 46.98 y 77.23, tanto los locales de antojitos como los
de tacos son lugares a los que los comensales recurren frecuentemente, por lo que el
riesgo potencial asociado a las deficiencias de estos y los dems lugares reprobados, es
elevado.
El promedio general de R fue de 69.75 puntos, de C fue de 73.55 y de C+ fue de 65.60, lo
cual revela que los mayores factores de riesgo estn asociados a los puntos crtico de
inocuidad indispensable, es decir, ausencia o deficiencia en: Mtodos que aseguren la
potabilidad del agua, evitando su contaminacin, as como en los registros para el
monitoreo de cloro residual libre y de organismos coliformes fecales y totales en agua;
Programas para el control y erradicacin de plagas; La transportacin de productos a las
temperaturas fras recomendadas; Instalaciones para mantener la temperatura de los
alimentos fros a 7 C o menos y los alimentos calientes a ms de 60 C; Los equipos de
refrigeracin y/o congelacin que en ocasiones no estn provistos de termmetros para el
registro de temperatura o no estn funcionando correctamente o en un lugar no accesible
para su monitoreo; Uso indiscriminado de trapos con deficiente lavado y desinfeccin;
Procedimientos inadecuados de limpieza y desinfeccin de loza, cubiertos, equipos y
utensilios; Inspeccin de las materias primas e insumos antes de la produccin o
elaboracin; Control de operaciones; Falta de desinfectante y toallas de un solo uso en
estaciones de lavado de manos, as como la ausencia de rtulos que promuevan el
lavado de manos despus de utilizar los sanitarios; Especificaciones para los sanitarios.
Cada establecimiento recibi una propuesta de mejoras, que an no han sido evaluadas.

227
Investigaciones en Ciencia e Inocuidad de Alimentos

Tabla 1. Resultados de 81 establecimientos evaluados por medio del acta de verificacin


de la NOM-251-SSA1-2009 y la gua de autoevaluacin del COFEPRIS
PROMEDIO DE APROBAR0
GIRO/NMERO DE CALIFICACIN N
CLASE DE ACTIVIDAD SCIAN ESTABLECIMIENTOS
EVALUADOS
R C C+ S NO

722310 Servicios de comedor Comedor escolar / 1 71.06 75.91 68.60 0 2


para empresas e instituciones
(2.5 %) Comedor industrial / 1

722412 Bares, cantinas y Bebidas alcohlicas y botanas / 2 66.41 74.55 75.58 0 2


similares (2.5 %)

722511 Restaurantes con Alitas, botanas, snacks / 4 70.94 75.94 67.89 2 2


servicio de preparacin de
alimentos a la carta o de Comida casera, jugos, caf, postres / 3 0 3
comida corrida (39.5 %)
Comida nacional e internacional / 7 2 5

Comida mexicana, cortes, mariscos / 8 5 3

Ensaladas / 2 0 2

Comida italiana / 1 0 1

Sushi, comida china y japonesa / 7 4 3

722512 Restaurantes con Pescados y mariscos / 6 69.53 72.12 67.44 2 4


servicio de preparacin de
pescados y mariscos (7.4 %)

722513 Restaurantes con Carne en su jugo / 1 67.19 66.57 58.40 0 9


servicio de preparacin de
antojitos (11.1 %) Comida mexicana, tacos, pozole,
tamales, cortes, quesadillas, sopes / 7

Carnes Asadas / 1

722514 Restaurantes con Tacos / 5 62.72 68.05 61.63 0 5


servicio de preparacin de
tacos y tortas (8.6 %) Tortas / 2 1 1

722515 Cafeteras, fuentes de Pasteles y postres / 1 72.22 74.65 65.63 0 1


sodas, neveras, refresqueras
y similares (11.1 %) Palomitas, refrescos, crepas / 2 0 2

Caf y bebidas / 3 1 2

Snacks y bebidas / 2 1 1

Jugos y caf / 1 1 0

722517 Restaurantes con Pizza / 11 70.87 75.52 64.12 4 7


servicio de preparacin de
pizzas, hamburguesas, hot Hamburguesas / 3 3 0
dogs y pollos rostizados para
llevar (17.3 %)

R= Punto Requerido de buenas prcticas; C= Punto crtico de Inocuidad;C+= Punto crtico de Inocuidad Indispensable

228
Investigaciones en Ciencia e Inocuidad de Alimentos

Conclusiones
En trminos generales, las condiciones y medidas aplicadas en la preparacin de los
alimentos no son suficientes para asegurar la calidad e inocuidad de los mismos, por lo
que representan un riesgo potencial para la presentacin de enfermedad en los
comensales. La mayora de los servicios de alimentos evaluados, no cuentan con un
sistema correcto que permita cumplir con la NOM-215-SSA1-2009.

Existe una suma de factores de riesgo en los procesos de preparacin y servicio de


alimentos como: la ausencia de control en la potabilidad del agua, Uso indiscriminado de
trapos con deficiente lavado y desinfeccin, control no adecuado de las temperaturas fras
o calientes, deficiencias en el control de plagas, procedimientos de limpieza y
desinfeccin inadecuados, ausencia en la inspeccin de materias primas, control de
operaciones deficiente, falta de desinfectante y toallas de un solo uso en estaciones de
lavado de manos, as como la ausencia de rtulos que lo promuevan.

Bibliografa
1. Comisin Federal para la Proteccin contra Riesgos Sanitarios. 2017. Marco normativo para
alimentos. Gua de autoevaluacin. Disponible en la pgina: https://www.gob.mx/
cofepris/acciones-y-programas/marco-normativo-para-alimentos. Fecha de publicacin: 25 de
octubre de 2016. ltima actualizacin: 14/02/2017. Fecha de acceso: junio de 2017.
2. Di Pietro, S., K. Haritchabaletk, G. Cantoni, L. Iglesias, S. Mancini, A. Temperoni, J.L. Labanchi,
N. Barbarossa, M.T. Garcia, M. Cofre, S. Rosales, E. Herrero, R. Bigatti, O. Orellana, E. Larrieu.
2004. Vigilancia epidemiolgica de enfermedades transmitidas por alimentos en la provincia de
Rio negro, Argentina, 1993-2001. Medicina (Buenos Aires); 64: 120-124.
3. Astrid Carolina Flrez1, Carmen Rincn1, Paola Garzn1, Nirley Vargas1, Catalina Enrquez.,
2008. Factores relacionados con enfermedades transmitidas por alimentos en restaurantes de
cinco ciudades de Colombia, 2007. ASOCIACIN COLOMBIANA DE INFECTOLOGA. Volumen
12 No 4 Diciembre. 255-266.
4 Harris, K.J., Robin B. Di Pietro , Kevin S. Murphy , Gretchen Rivera. (2014). Critical food safety
violations in Florida: Relationship to location and chain vs. non-chain restaurants. International
Journal of Hospitality Management. 38. 5764.
5. Instituto Nacional de Estadstica y Geografa. 2013. Sistema de clasificacin industrial de
Amrica del Norte, Mxico SCIAN 2013.
6. Instituto Nacional de Estadstica y Geografa. 2014. Estadsticas a propsito de la Reunin de la
Comisin Ejecutiva Nacional. Cmara Nacional de la Industria de Restaurantes y Alimentos
Condimentados.
7. Secretara de Salud. Norma Oficial Mexicana NOM-251-SSA1-2009, Prcticas de higiene para el
proceso de alimentos, bebidas o suplementos alimenticios. Diario Oficial de la Federacin. 01
marzo 2010.
8. Zavala, N.M., 2015. Inocuidad alimentaria en restaurantes de hoteles Acapulco, Guerrero: franja
de playa de la zona dorada. Revista Mexicana de Ciencias Agrcolas, vol. 1, pp. 517-522.

229
Investigaciones en Ciencia e Inocuidad de Alimentos

Agro-homeopata aplicada al mejoramiento del maz

Olmedo Snchez, J.A., de la Rosa Figueroa, A.

Universidad de Guadalajara, Centro Universitario de los Altos. Carr. Tepatitln Yahualica Km.
7.5, Tepatitln de Morelos, Jalisco. Tel. 3311524038. Email: adelarosa@cualtos.udg.mx