Vous êtes sur la page 1sur 146

BIOLOGIE GENERALE

Bachelier en Sciences Biologiques


Bachelier en Sciences Chimiques

Premire anne

Fascicule I

Elments de Biochimie

DAVID C. GILLAN

Anne acadmique 2017 - 2018


Table des matires

1. Rappels de chimie ....................................................................................................................... 4


1.1. Le tableau de Mendeleev .............................................................................................................. 4
1.2. Quantit de matire ......................................................................................................................... 5
1.3. Isotopes ................................................................................................................................................ 7
1.4. Les niveaux nergtiques .............................................................................................................. 7
1.5. Les orbitales atomiques ................................................................................................................. 8
1.6. Formation de molcules et de composs ioniques. ............................................................. 10
1.7. La thorie des orbitales molculaires (MO theory) ............................................................ 11
1.8. La thorie de lhybridation des orbitales atomiques ......................................................... 16
1.9. Forme molculaire et fonction biologique ............................................................................. 19
1.10. Electrongativit (c) ................................................................................................................... 19
1.11. Les liaisons covalentes ............................................................................................................... 20
1.12. Les liaisons ioniques ................................................................................................................... 20
1.13. Les liaisons chimiques faibles .................................................................................................. 21
1.14. Les ractions chimiques ............................................................................................................. 22
2. La molcule d'eau .................................................................................................................... 22
2.1. Structure, liaisons hydrogne et chaleur spcifique .......................................................... 22
2.2. Dissociation des molcules deau et pH .................................................................................. 24
2.3. Importance du pH en biologie : .................................................................................................. 25
3. Le carbone et les hydrocarbures ........................................................................................ 27
3.1. Exemples de molcules comportant 1 atome de C. ............................................................. 27
3.2. Exemples de molcules comportant 2 atome de C. ............................................................. 27
3.3. Les hydrocarbures .......................................................................................................................... 28
3.4. Les isomres ..................................................................................................................................... 31
4. Les groupements fonctionnels ............................................................................................ 35
4.1. Le groupement hydroxyle ............................................................................................................ 35
4.2. Le groupement carbonyle ............................................................................................................ 36
4.3. Le groupement carboxyle ............................................................................................................ 36
4.4. Le groupement amine ................................................................................................................... 37
4.5. Le groupement thiol ou sulfhydryle ......................................................................................... 38
4.6. Le groupement phosphate ........................................................................................................... 38
5. Les macromolcules organiques ........................................................................................ 39
5.1. Les glucides monosaccharides ................................................................................................... 40
5.2. Les drivs des glucides monosaccharides ............................................................................ 55
5.2.1. Le fucose (C6H12O5). .................................................................................................................................. 55
5.2.2. La glucosamine (C6H13NO5). .................................................................................................................. 56
5.2.3. Le N-actyl-a-D-glucosamine (GlcNac ou a-NAG). ..................................................................... 56
5.2.4. L'acide N-actyl-b-D-muramique (b-NAM). ................................................................................... 57
5.2.5. Les acides uroniques. ............................................................................................................................... 58
5.2.6. Les acides sialiques. .................................................................................................................................. 60
5.3. Les diholosides et triholosides ................................................................................................... 61
5.4. Les polysaccharides ....................................................................................................................... 66
5.4.1. Amylose .......................................................................................................................................................... 66
5.4.4. Le glycogne ................................................................................................................................................. 68
5.4.5. L'inuline ......................................................................................................................................................... 68
5.4.6. La cellulose ................................................................................................................................................... 68
5.4.9. Les glycosaminoglycanes (GAGs) ou mucopolysaccharides ................................................... 71
5.5. Les lipides .......................................................................................................................................... 74

2
5.5.1. Les lipides de stockage. ........................................................................................................................... 74
5.5.2. Les lipides de structure membranaires. .......................................................................................... 78
5.6. Les drivs des lipides .................................................................................................................. 91
5.6.1. Les drivs des acides gras .................................................................................................................... 91
5.6.2. Les drivs des strodes. ....................................................................................................................... 94
5.7. Les terpnes ...................................................................................................................................... 97
5.7.1. Les monoterpnes. .................................................................................................................................... 97
5.7.2. Les sesquiterpnes. ................................................................................................................................... 98
5.7.3. Les diterpnes. ............................................................................................................................................ 99
5.7.4. Les triterpnes. ........................................................................................................................................ 101
5.7.5. Les ttraterpnes. ................................................................................................................................... 102
5.8. Les protines ou polypeptides. ............................................................................................... 103
5.8.1. Les 20 aminoacides. ............................................................................................................................... 103
5.8.2. Les aminoacides et l'alimentation humaine. ............................................................................... 111
5.8.3. Les aminoacides rares. ......................................................................................................................... 111
5.8.4. Les aminoacides modifis au sein de la protine. ..................................................................... 112
5.8.5. Les aminoacides non associs des protines. ......................................................................... 112
5.8.6. Principales proprits physiques des aminoacides. ................................................................ 112
5.8.7. La liaison peptidique. ............................................................................................................................ 114
5.8.8. Les polypeptides et leur squenage. ............................................................................................. 115
5.8.9. La structure tridimensionnelle des protines ............................................................................ 120
5.8.10. Classification des protines. ............................................................................................................ 126
5.9. Les acides nucliques ................................................................................................................. 130
5.9.1. Les nuclotides ........................................................................................................................................ 130
5.9.2. Les nuclosides. ....................................................................................................................................... 134
5.9.3. La structure primaire des acides nucliques. ............................................................................. 138
5.9.4. La structure secondaire des acides nucliques. ......................................................................... 140
6. Rfrences .......................................................................... Erreur ! Le signet nest pas dfini.

3
1. Rappels de chimie

1.1. Le tableau de Mendeleev

Le tableau priodique des lments, ou tableau de Mendeleev, comporte les 118 lments
chimiques connus, ordonns par numro atomique croissant et organiss en fonction de leur
configuration lectronique1. Chaque ligne du tableau est appele "priode" et correspond
une couche lectronique (c'est le nombre quantique principal, not n). Il y a sept couches
lectroniques connues l'tat fondamental, donc sept priodes dans le tableau priodique,
numrotes de 1 7. Chaque priode comporte diffrentes orbitales atomiques, identifies par
leur nombre quantique secondaire (not l). Quatre types d'orbitales atomiques sont connues
l'tat fondamental (notes s, p, d et f et pouvant contenir chacune respectivement 2, 6, 10 et 14
lectrons).

A partir du numro atomique 104 on trouve les lments chimiques synthtiques. Ce sont des
lments instables avec une dure de vie si courte (de la microseconde au million d'annes),
par rapport l'ge de la Terre, que tous les atomes de ces lments se sont dsintgrs. Ils
peuvent cependant tre recrs dans des acclrateurs de particules et dans les racteurs
nuclaires.

Les colonnes du tableau priodique sont appeles "groupes". Il y a 18 groupes dans le tableau
priodique standard. A cela il faut ajouter les lanthanides et les actinides. Chaque groupe
constitue un ensemble d'lments aux proprits souvent bien distinctes des autres groupes.

Certains groupes ont des noms bien prcis :

Groupe 1 : les mtaux alcalins (except l'hydrogne)


Groupe 2 : les mtaux alcalino-terreux
Groupe 17 : les halognes
Groupe 18 : les gaz nobles (ou rares)

On utilise galement d'autres noms pour regrouper les lments dans le tableau de
Mendeleev. Par exemple :

Mtaux de transition : Il s'agit des lments des priodes 4 7 et des groupes 3 12 (Sc, Ti,
V, Cr, Mn, Fe, etc.).

Mtaux pauvres : Al, Ga, In, Sn, Tl, Pb, Bi. Ces mtaux sont souvent mous (except Al), et
ont une temprature de fusion (et d'bullition) infrieure celles des mtaux de transition.
Leur lectrongativit est galement plus leve. Il n'existe pas de dfinition stricte d'un mtal
pauvre.

1
Au-del du numro atomique 92, qui correspond l'uranium, on entre dans le monde des
lments artificiels instables ( courte dure de vie).

4
Mtallodes : B, Si, Ge, As, Sb, Te, Po. Leurs proprits physiques et chimiques sont
intermdiaires entre celles des mtaux et des non-mtaux. Il n'existe pas de dfinition stricte
d'un mtallode.

Non-mtaux : H, C, N, O, P, S, Se.

Les organismes vivants sont composs essentiellement de non-mtaux (C, H, O, N, P, S).


Cependant, certains mtaux alcalins (Na, K), certains alcalino-terreux (Ca, Mg) et certains
mtaux de transition (Fe, Mn, Cu, Zn) sont indispensables au bon fonctionnement des
organismes. Pour les halognes, Cl et F sont galement retrouvs dans les organismes.

Les lments chimiques sont identifis dans le tableau priodique par leur numro atomique,
qui reprsente le nombre de protons que contient leur noyau. Pour un mme lment
chimique, et donc un mme nombre de protons, le nombre de neutrons peut varier. Ces
atomes, qui occupent la mme case dans le tableau priodique, sont appels "isotopes".

Numro atomique (Z) = Nombre de protons du noyau = Nombre dlectrons orbitant autour
du noyau (atome neutre).

Masse atomique (A) = Nombre de protons et de neutrons dans le noyau.

A=Z+N
N = Nombre de neutrons
Masse dun atome A (lectrons ngligeables)

1.2. Quantit de matire

Pour calculer une quantit prcise de matire on utilise la masse atomique (A).
Exemple : si on pse 55,847 g de fer on obtiendra exactement 1 mole, cest--dire 6,022 x
1023 atomes (nombre dAvogadro).

Une mole de n'importe quel lment contient toujours le mme nombre datomes.

Reprsentation habituelle : 12C et 56


Fe

5
6
1.3. Isotopes

Tous les atomes dun lment donn possdent le mme nombre de protons (sinon, il ne
sagirait pas du mme lment). Cependant, le nombre de neutrons peut varier lgrement. La
masse d'un atome peut donc varier dans certaines proportions.

Les diffrentes formes atomiques dun lment sappellent des isotopes.

La masse atomique indique dans le tableau de Mendeleev est toujours la moyenne pondre
par labondance des diffrents isotopes.

A Abondance
12
C 12,0000 g 98,89 %
13
C 13,0033 g 1,11 %
14
C 14,0032 g 0,00000001 %

A moyen = 12,011 g
12
C et 13C sont des isotopes stables.
14
C est un isotope radioactif.

Le noyau des isotopes radioactifs se dsintgre spontanment, ce qui libre des particules et
de lnergie. Llment se transforme alors en un lment plus stable (ici, le 14C met un
lectron et un antineutrino ne et se transforme en 14N).
14
6C 147N + e- + ne

Les radio-isotopes ont de nombreuses applications en biologie :

- datation de fossiles;
- traceurs : utiliss pour suivre le cheminement des atomes dans le mtabolisme (le
mtabolisme est ensemble des ractions chimiques dun organisme);
- diagnostic de maladies : par exemple, maladies rnales (injection de radio-isotopes dans le
sang suivit d'un dosage de l'isotope dans lurine);
- imagerie mdicale : par exemple, la tomographie par mission de positrons (TEP), qui relve
les sites dactivit chimique intense.

1.4. Les niveaux nergtiques

Les lectrons possdent diffrents niveaux nergtiques. Plus llectron est loign du noyau
plus son nergie potentielle est leve. Les niveaux nergtiques sont quantifis (il n'y a pas
dlectrons entre deux niveaux). On parle de couches lectroniques.

Un lectron qui descend de niveau va mettre de lnergie. Pour monter de niveau, un


lectron besoin dabsorber de lnergie. Exemple : la lumire peut faire passer un lectron
vers un niveau suprieur. C'est le cas pour la chlorophylle : il s'agit d'une molcule prsente

7
dans les plantes, qui absorbe la lumire (les photons), et qui est importante dans le processus
de photosynthse. Formule brute de la chlorophylle : C55H72O5N4Mg.

Le dernier niveau nergtique comporte les lectrons de valence :

La proprit chimique des atomes dpend principalement du nombre dlectrons prsents


dans la couche de valence. Le comportement chimique est semblable pour deux atomes ayant
le mme nombre dlectrons de valence. Un niveau nergtique est satur quand il comporte 8
lectrons (sauf le premier : 2 lectrons).

1.5. Les orbitales atomiques

En ralit les couches lectroniques ne sont pas des trajectoires concentriques (modle de
Bohr). Une couche lectronique est la distance moyenne dun lectron par rapport au noyau.
Llectron est parfois plus loign, parfois plus prs.

Lespace tridimensionnel o llectron passe 90% de son temps sappelle une orbitale. On les
nomme s, p, d, f. Elles ont gnralement une forme multilobe. Pour chaque forme dorbitale

8
il existe diffrents niveaux nergtiques. Chaque orbitale peut tre considre comme une
boite ne pouvant renfermer quun nombre bien prcis dlectrons. Chaque lobe (ou double
lobe) dune orbitale peut contenir un maximum de deux lectrons : on parle alors d'lectrons
apparis.

Forme des 5 orbitales d (4 quadruples lobes, 1 triple)

Le remplissage des orbitales avec des lectrons se fait selon un ordre bien prcis : 1s, 2s, 2p,
3s, 3p, 4s, 3d, 4p, 5s, 4d, 5p, 6s, 4f, 5d, 6p, 7s, 5f, 6d, and 7p.

9
Configuration lectronique des atomes

Exemples : le lithium (Li) possde 3 lectrons : 1s2 2s1


le phosphore (P) possde 15 lectrons : 1s2 2s2 2p6 3s2 3p3

Lithium (Li) : 1s2 2s1 valence = 1

dernier niveau nergtique

Phosphore (P) : 1s2 2s2 2p6 3s2 3p3 valence = 5

dernier niveau nergtique

Un atome est stable quand toutes ses orbitales sont remplies. Par exemple le Non (Ne), gaz
rare : 1s2 2s2 2p6 3s2 3p6.

La ractivit dun atome dpend de la prsence dlectrons non apparis (clibataires) dans
une ou plusieurs orbitales de son dernier niveau nergtique, ainsi que de la prsence
d'orbitales vides. Pour le Li, un lectron non appari est prsent dans l'orbitale 2s (il reste
donc une place dans cette orbitale). Pour le phosphore (P) un lectron non appari est prsent
dans une des orbitales 3p (il reste une place dans cette orbitale) et une des orbitales 3p est vide
(il y a donc 2 places libres dans cette orbitale vide). Le phosphore peut donc accepter 3
lectrons supplmentaires.

1.6. Formation de molcules et de composs ioniques.

Les atomes dont le dernier niveau nergtique est incomplet interagissent avec certains autres
atomes de manire remplir leur dernire couche lectronique. Par exemple, lhydrogne
possde la configuration 1s1. Son orbitale s peut encore contenir un lectron. Donc, si deux
atomes dhydrogne sapprochent une liaison covalente va se former : il y a partage dune
paire dlectrons.

10
Il y a partage dlectrons. Chaque atome dhydrogne a ainsi complt son orbitale 1s. Une
grande orbitale commune est forme. Il y a liaison covalente simple.

1.7. La thorie des orbitales molculaires (MO theory)

En se rapprochant, les orbitales atomiques 1s vont en fait se combiner pour former deux
nouveaux types dorbitales : les orbitales molculaires. Au niveau mathmatique ces orbitales
sont simplement une combinaison linaire des orbitales atomiques. Les orbitales molculaires
peuvent tre de type "liantes" (orbitales sigma, s) ou "antiliantes" (orbitales s*). Les orbitales
liantes possdent un plus bas niveau nergtique que les orbitales antiliantes. La thorie des
orbitales atomiques est importante en biochimie car elle explique pourquoi certaines
molcules comme l'oxygne sont capables de transporter des lectrons. Voici le cas du H2 :

orbitales s1s*
antiliantes

orbitale s1s
H H liante

Formation d'un lien sigma.

Lorsque deux lectrons sont placs dans une orbitale s liante, la molcule forme (H2) est
stable. Ceci vient du fait que l'nergie de cette orbitale est plus basse que l'nergie des
orbitales des atomes isols. La formation de H2 est donc favorise lorsque deux atomes
d'hydrogne se rencontrent (et que chacun possde un lectron non appari).

Les flches reprsentent les lectrons

11
La molcule He2 nexiste donc pas car il y a 4 lectrons rpartir dans les orbitales. Si une
molcule de He2 se formait, il y aurait deux lectrons localiss dans les orbitales molculaires
antiliantes s1s* ce qui provoquerait la sparation les atomes. Les atomes dHe restent donc
isols.

Les seules orbitales qui interviennent dans la formation des liaisons chimiques sont les
orbitales atomiques de valence. Par exemple, pour l'atome d'oxygne (1s2 2s2 2p4), 6 lectrons
de valence sont prsents et une des orbitales 2p est vide (la 2px dans le dessin ci-dessous).
L'orbitale 2px peut donc accepter deux lectrons.

Lorsque deux atomes doxygne se rapprochent, des orbitales molculaires vont se former.
Voici les orbitales molculaires pour les orbitales atomiques 2s :

s*2s
2s 2s

s2s

12
Voici les orbitales molculaires se formant lorsque les orbitales atomiques 2pz se rencontrent :

orbitales s2p* antiliantes

orbitales s2p liantes

Comme les orbitales 2pz de chaque atome se font face sur un mme axe une orbitale
molculaire de type s pourra se former (une s2p liante et une s2p* antiliante).

Voici les orbitales molculaires qui se forment lorsque des orbitales atomiques 2px se
rencontrent :

orbitales px* antiliantes

orbitales px liantes

Dans ce cas-ci il y a formation dorbitales atomiques de type p ( pi ) car les axes des
orbitales 2px sont parallles (une orbitale px liante et une orbitale px* antiliante). Il en va de
mme pour les orbitales 2py.

En rsum, la molcule de dioxygne (O2) possde un total de 8 orbitales molculaires :

s2s s2s* s2p s2p* px px* py et py*

Un total de 6 + 6 = 12 lectrons sont distribus dans ces orbitales.

13
Le dioxygne est un bon accepteur dlectrons car les orbitales px* et py* peuvent accepter
des lectrons supplmentaires.

Les diffrentes formes du dioxygne

Oxygne triplet : 3O2. Il s'agit de l'tat de base du dioxygne, prsent dans l'atmosphre. La
longueur du lien O-O est de 1.21. Les orbitales px* et py* contiennent chacune un lectron
de spin identique, il s'agit donc d'un diradical2. Le spin total S = 1 (tat triplet) et la molcule
est paramagntique (attire par un aimant). L'oxygne triplet est un bon accepteur d'lectrons.

Oxygne singulet : 1O2. Il s'agit d'une forme diamagntique, moins stable que loxygne
triplet. Ce type de dioxygne est toxique et trs ractif (il oxyde spontanment diffrentes
substances organiques). Il s'agit d'un driv ractif de l'oxygne ou "ROS" ("Reactive Oxygen
Species"). Ce type de dioxygne est produit pendant la photosynthse (par la chlorophylle) et
pendant certaines ractions biochimiques (par les peroxydases). Les organismes se protgent
de l'oxygne singulet grce aux carotnodes.

Oxygne singulet

2
Un radical (souvent appel radical libre) possde un lectron non appari dans sa couche
externe. Un diradical en possde deux.

14
Le dioxygne singulet possde une dure de vie "longue" ( 1h temprature ambiante)
lorsque deux lectrons sont apparis dans une seule orbitale p*, par exemple l'orbitale px*.
Cette forme est symbolise par le sigle 1g. La dure de vie du dioxygne singulet est plus
courte si chaque orbitale p* possde un lectron isol. Cette forme est symbolise par le sigle
1
g+.

Anion superoxyde : O2- (longueur lien O-O : 1.33). Il s'agit d'une forme paramagntique
produite lors de la rduction du dioxygne singulet ou du dioxygne triplet avec un lectron.
Il s'agit d'un radical libre (un lectron est non appari). L'anion superoxyde est trs toxique car
il est un oxydant puissant des molcules organiques. Par exemple, il est capable dinactiver
les protines fer-soufre essentielles au mtabolisme arobie (par libration d'un atome de Fe
ce qui gnre des radicaux hydroxyles par la raction de Fenton). L'anion superoxyde est
galement dploy par le systme immunitaire des organismes suprieurs pour tuer les micro-
organismes infectants. Les cellules se protgent avec leur superoxyde dismutase (la SOD).

Anion peroxyde : O22-. Il s'agit d'une forme diamagntique produite lors de la rduction de
l'anion superoxyde avec un lectron. Les deux orbitales p* sont remplies. En consquence, le
lien O-O encore plus faible et donc plus long (longueur : 1.49). Il s'agit d'une forme toxique
du dioxygne (un ROS), et galement un oxydant puissant (le peroxyde d'hydrogne ou H2O2
est d'ailleurs utilis comme dsinfectant : il s'agit de "l'eau oxygne").

En conclusion, comme il vient d'tre montr pour le dioxygne, la thorie des orbitales
molculaires explique le transport des lectrons, explique lallongement des distances inter-
atomiques ainsi que les proprits magntiques des molcules.

15
1.8. La thorie de lhybridation des orbitales atomiques

Un autre thorie explique bien les liens entre les atomes. Dans cette thorie, on considre que
les orbitales atomiques vont se combiner avant de former un lien avec un autre atome. Il y
aura formation d'orbitales atomiques hybrides. Cette thorie rend bien compte des angles
entre les atomes dans une molcule et est donc d'une importance capitale en biochimie car elle
permet de prdire la forme des macromolcules (protines, les lipides, ADN, etc.).

Hybridation sp3

Dans ce type d'hybridation les 3 orbitales p vont se combiner l'orbitale s. Il en rsultera une
orbitale hybride 4 lobes, chaque lobe pouvant possder un lectron. Les orbitales hybrides
ont toutes la mme nergie et les 4 lobes de l'hybridation sp3 forment un ttradre. Dans le cas
du carbone (C) les 4 lectrons de valence (1s2 2s2 2p2) sont chacun dans un des 4 lobes. Les
angles entre les lobes sont de 109,5.

Les 4 lobes sp3 du carbone peuvent chacun se faire recouvrir par lorbitale 1s de 4 atomes
dhydrogne, ce qui formera 4 liaisons s (4 liaisons covalentes simples). La molcule ainsi
forme est le mthane CH4.

Diffrentes reprsentations du mthane

16
Hybridation sp2

Dans ce type d'hybridation seulement 2 orbitales p vont se combiner l'orbitale s. Il en


rsultera une orbitale hybride sp2 possdant 3 lobes, chaque lobe pouvant possder un
lectron. Les trois lobes forment un plan et les angles entre les lobes sont de 120.

Hybridation sp2 du carbone

L'hybridation sp2 explique la forme de certaines molcules ainsi que la prsence d'une double
liaison. Par exemple, l'thne : C2H4. Dans cette molcule une liaison s se forme par
recouvrement de deux lobes sp2. Les orbitales 2pz qui n'ont pas particip l'hybridation vont
se recouvrir partiellement et former une liaison p. Toutes les orbitales sp2 de l'thne sont
dans le mme plan. Quatre atomes d'hydrogne peuvent se fixer aux lobes sp2 restants et tous
les atomes sont alors dans le mme plan.

p
H sp2 sp2
H
sp2 sp2
sp2 s sp2

H p
H

Reprsentation de l'thne

17
Hybridation sp

Dans ce cas-ci une seule orbitale atomique 2p s'hybride avec l'orbitale atomique 2s :

2px 2py 2pz


2s2
1s2

2py 2pz
sp sp
1s2
Hybridation sp du carbone

Seulement deux orbitales hybrides sont formes, les lobes tant opposs l'un l'autre (angle
de 180). Ce type d'hybridation explique la forme linaire de certaines molcules et explique
la prsence d'un triple lien. Par exemple, lthyne (ou actylne) : C2H2. Dans cette molcule
une liaison s se forme par recouvrement de deux orbitales hybrides sp, et deux liaisons p se
forment par recouvrement des orbitales py et pz.

Reprsentation de l'thyne

18
1.9. Forme molculaire et fonction biologique

L'hybridation des orbitales atomiques va donner une forme bien prcise aux molcules et cette
forme permettra diffrentes fonctions biologiques. C'est le cas par exemple des enzymes dont
l'activit dpend de leur structure tridimensionnelle ainsi que des rcepteurs protiques la
surface de la cellule. Le matriel gntique, l'ADN, possde galement une forme
tridimensionnelle particulire.

Molcules messagers se fixant un rcepteur de la surface cellulaire

1.10. Electrongativit (c)

L'lectrongativit est la capacit dun atome participant une liaison chimique attirer vers
lui les lectrons de l'autre atome participant la liaison. La diffrence d'lectrongativit entre
les deux atomes dtermine la nature de la liaison chimique : covalente lorsque la diffrence
est faible (infrieure 1,7) ou ionique lorsque cette diffrence est plus importante. Par
exemple, dans le cas du fluorure d'hydrogne (HF) l'atome de fluor attire plus les lectrons
vers lui. La liaison est donc polarise et la molcule est dite polaire : une charge partielle
positive est localise au niveau de l'hydrogne (d+) et une charge partielle ngative au niveau
du fluor (d-). La rpartition des charges partielles sur une distance donne peut tre
reprsente par un vecteur appel le moment dipolaire.

d+ d
-

H F Molcule de HF

Dans le tableau priodique, llectrongativit augmente de gauche droite le long dune


priode et de bas en haut le long dune famille. Ainsi le fluor, en haut droite du tableau
priodique, est l'lment le plus lectrongatif avec une valeur de 4,0 tandis que le francium,
en bas gauche, est le moins lectrongatif avec une valeur de 0,7.

19
1.11. Les liaisons covalentes

Il y a trois types de liaisons covalentes. Le premier type est la liaison covalente non polaire
(diffrence dlectrongativit 0,4) qui possde un nuage lectronique relativement
symtrique. Dans ce cas, lattraction des lectrons vers les noyaux des deux atomes en
question est gale. Le deuxime type est la liaison covalente polaire. Dans ce cas-ci la
distribution de charges est ingale entre les deux atomes en raison de la diffrence
dlectrongativit des atomes (la diffrence dlectrongativit a une valeur comprise entre
0,4 et 1,7). La molcule possde un moment dipolaire reprsent par un vecteur dont la flche
part de latome le moins lectrongatif vers latome le plus lectrongatif. Le dernier type de
liaison covalente est celui de coordinence. Dans ce type de liaison covalente, il y a un partage
dlectrons entre deux atomes, par contre le doublet dlectrons formant la liaison provient
dun seul des deux atomes. Autrement dit, les deux lectrons partags viennent du mme
atome.

Exemple de liaison covalente polaire : le trifluorure de bore (BF3). La molcule est plane car
le bore possde une hybridation sp2 et sa polarit nette est gale zro.

Trifluorure de bore

1.12. Les liaisons ioniques

Une liaison ionique se forme entre des atomes qui possdent une grande diffrence
d'lectrongativit, typiquement entre un non-mtal (H, C, N, O, P, S, Se) et un mtal. La
liaison rsulte de l'attraction entre le cation drivant du mtal et l'anion drivant du non-
mtal. Par exemple, dans le sel de cuisine (NaCl ou halite) il y a attraction lectrostatique
entre ions Na+ et Cl-. Les cristaux de NaCl sont cubiques. Les solides ainsi forms sont
appels composs ioniques ou sels et sont souvent solubles dans l'eau.

La halite

20
1.13. Les liaisons chimiques faibles

Les liaisons les plus fortes sont les liaisons covalentes. A ct de ces liaisons fortes on trouve
des liaisons plus faibles comme la liaison hydrogne et les forces de van der Waals.

Liaison hydrogne. La liaison hydrogne, ou pont hydrogne, est une liaison de faible
intensit qui relie les molcules entre-elles. Elle implique un atome d'hydrogne et un atome
assez lectrongatif (comme l'oxygne par exemple). Les liaisons H ont une intensit environ
vingt fois plus faible que les liaisons covalentes simples. Elles ont une grande importance en
biochimie. Par exemple les structures secondaires des protines, comme lhlice alpha et le
feuillet beta, sont formes grce un agencement spcifique de ponts H. Les proprits de
l'eau rsultent en grande partie des liaisons hydrognes (voir plus loin).

R-H ||||||||| R-
-
d+ d

Formation de liaisons H entre deux molcules d'eau :

Les liaisons de van der Waals

Les liaisons de van der Waals sont des interactions de faible intensit entre atomes ou
molcules. Leur intensit est dix fois plus faible que pour la liaison hydrogne. Les forces de
van der Waals sont dues aux interactions entre les moments dipolaires lectriques (parfois
transitoires) de deux atomes ou molcules. Aucun lectron n'est mis en commun dans ce type
de liaison. Les forces agissent faible distance. On retrouve les effets de ces liaisons dans le
graphite (liaisons entre feuillets hexagonaux) ainsi qu' l'extrmit des pattes du gecko,
assurant ainsi leur forte adhsion sur du verre.

+ -
+ -
+ -

Structure du graphite. Interaction de van der Waals entre deux


molcules diffrentes.

21
1.14. Les ractions chimiques

Classiquement, les ractions chimiques impliquent des changements qui concernent le


mouvement des lectrons, la formation et la rupture des liaisons chimiques. Les ractifs sont
les substances de dpart (par exemple H2 et O2) et les produits sont les nouvelles substances
(par exemple H2O).
v1
2H2 + O2 2H2O
v2
Les ractions chimiques se font une certaine vitesse (v) et dans les deux sens. Lorsque les
vitesses sont les mmes dans les deux sens il y a quilibre chimique. Au cours d'une raction
chimique il y a conservation de la matire ("rien ne se perd, rien ne se cre", Lavoisier).
Certaines ractions ncessitent ou sont facilites par la prsence d'une substance chimique
appele catalyseur. En biochimie, de nombreuses ractions chimiques sont catalyses par des
catalyseurs appels enzymes.

2. La molcule d'eau

2.1. Structure, liaisons hydrogne et chaleur spcifique

L'eau, de formule chimique H2O, est essentielle la vie. Prs de 70 % de la surface de la


Terre est recouverte deau (97 % deau sale et 3 % deau douce) et les cellules sont
constitues de 70 95% deau. L'eau a des proprits singulires car chaque molcule d'eau
est polaire et est donc capable de former des liaisons hydrogne avec les molcules d'eau
voisines. En moyenne on compte 3,59 liaisons hydrogne par molcule 25C. La dure
dune liaison hydrogne est de 10-12 s; ces liaisons sont donc transitoires.

Les liaisons hydrogne maintiennent toutes les molcules d'eau ensemble. C'est ce que l'on
appelle la cohsion. La cohsion contribue au transport de l'eau dans les plantes. La cohsion
se manifeste aussi par le phnomne de tension superficielle. Il s'agit d'une force qui se
manifeste par la difficult de briser ou dtirer la surface dun liquide. La tension superficielle
est plus grande dans l'eau que dans la plupart des autres liquides.

Les liaisons hydrognes font que l'eau possde une chaleur spcifique leve. La chaleur
spcifique est la quantit de chaleur ncessaire pour lever le 1C une quantit de 1 g deau. Il
faut 4,184 Joules/g d'eau, c'est--dire 1 calorie (cal). La chaleur spcifique des autres

22
substances est gnralement moins leve. Par exemple, pour l'thanol il faut 2,51 J/g. Pour le
fer, 0,4 J/g.

Deux reprsentations de l'thanol :

Quand chaleur spcifique dune substance est leve, sa temprature varie moins quand elle
absorbe ou libre une certaine quantit de chaleur. Leau rsiste donc bien aux variations
de temprature. En consquence, le climat des rgions ctires est plus doux car l'eau stabilise
la temprature de l'atmosphre. De mme, les organismes composs de beaucoup d'eau
rsistent mieux aux variations de temprature.

La chaleur de vaporisation est la quantit de chaleur que 1 g de liquide doit absorber pour
passer de ltat liquide ltat gazeux. En raison des liaisons hydrogne la valeur est leve
pour leau : 2,26 kJ 25C. Par comparaison, voici la chaleur de vaporisation d'autres
substances :

thanol : 0,86 kJ
actone : 0,52 kJ
ammoniac : 1,39 kJ
essence automobile : 0,33 kJ

Cette chaleur de vaporisation leve pour l'eau contribue temprer le climat de la Terre. En
se vaporisant au niveau des tropiques l'eau refroidit la surface des masses ocaniques et
transfert de la chaleur l'air. En se dplaant vers le nord l'air tropical humide apporte de la
chaleur aux rgions nordiques en se condensant et en formant de la pluie. De mme, la
vaporisation de la sueur sur la peau permet de rguler la temprature du corps. La masse
volumique (MV) de l'eau solide est plus petite que celle de l'eau liquide. Leau se dilate en se
solidifiant (alors que beaucoup de substances se contractent). En consquence, la glace flotte
sur leau. Si la glace ne flottait pas le benthos (les animaux vivant sur le fond) serait dtruit
lorsque leau gle. La glace au niveau des ples permet galement la rflexion d'une partie des
rayons solaires.

H2 O

Structure hexagonale de la glace d'eau

23
L'eau est le solvant fondamental de la vie et de nombreuses substances se dissolvent dans
leau (sucres, sels, protines, etc... ). Un liquide contenant plusieurs substances est une
solution. L'agent dissolvant est le solvant et la substance dissoute le solut. L'eau est capable
de dissoudre les composs ioniques comme le NaCl. En entourant chaque ion les molcules
d'eau dissolvent le cristal de sel. C'est le processus dhydratation.

2.2. Dissociation des molcules deau et pH

En formant une liaison hydrogne une molcule d'eau peut perdre un atome d'hydrogne.
Lorsque cela se produit la molcule d'eau devient un ion hydroxyde OH- car elle garde
l'lectron de l'hydrogne (ce qui lui confre une charge ngative) et ne perd qu'un proton (H+).
Cette raction peut s'crire de la manire suivante :

+ -
H2 O H + OH

+
Le H+ va alors sassocier une autre molcule deau et former H3O : l'ion hydronium.

+
H 2 O + H+ H3 O

Dans l'eau pure, pH 7.0 (neutre), la concentration de l'ion hydronium est trs faible et est
gale la concentration de l'ion hydroxyde :

[H3O+] = [OH-] = 10-7 moles/L

Une concentration de 10-7 moles/L signifie qu'il y a 1 H+ pour 555 106 molcules deau.

Le pH, ou potentiel hydrogne, est dfinit par l'expression suivante :

pH = - log [H+]

24
Dans l'eau pure, lorsque [H3O+] = [OH-] = 10-7 moles/L on voit que pH = 7.0 (25C). On dit
que le pH est neutre.

Lorsque [H+] est plus leve que 10-7 moles/L, on dit que le pH est acide. Par exemple si [H+]
= 10-5 moles/L le pH est gal 5.0.

Lorsque [H+] est moins leve que 10-7 moles/L, on dit que le pH est basique. Par exemple si
[H+] = 10-9 moles/L le pH est gal 9.0.

Remarques :

Les variations de pH se font de 10 en 10 (il s'agit d'une chelle logarithmique) :

pH 7 : [H+] = 0,0000001 mole/L


pH 6 : [H+] = 0,000001 mole/L

Un pH peut tre ngatif (cas des acides ou des bases trs fortes, avec [H+] ou [OH-] > 1
mole/L.

Dans toute solution aqueuse 25C :

[H+] [OH-] = 10-14 (mol/L)2

En consquence, lorsque [H+] augmente, [OH-] diminue. Autrement dit, si la [H+] augmente
les ions [H+] surnumraires vont consommer des [OH-] pour former de leau; avec pour
rsultat une diminution de la concentration des OH-.

Si un acide fort comme l'HCl (le chlorure dhydrogne) est ajout leau, l'HCl va se
dissocier compltement :
HCl H+ + Cl-

La [H+] va augmenter ainsi que lacidit de leau.

Si une base forte comme du NaOH (hydroxyde de sodium) est ajoute leau, la base va se
dissocier compltement :

NaOH Na+ + OH-

Les ions OH- surnumraires vont ragir avec les H+ de l'eau. La [H+] va chuter ainsi que
lacidit de leau.

2.3. Importance du pH en biologie :

Au niveau cellulaire le pH influence directement la conformation de nombreuses


macromolcules comme les protines et lADN. Au niveau de l'organisme il est important au
niveau physiologique (par exemple le pH est acide dans l'estomac ce qui permet la digestion).
Au niveau des cosystmes aquatiques chaque espce ne peut vivre que dans une gamme bien
prcise de pH. Certaines bactries par exemple sont acidophiles et ne vivent qu' pH acide.

25
La pluie normale est lgrement acide (pH 5,6) car du CO2 se dissout dans l'eau de
l'atmosphre pour former de l'acide carbonique H2CO3 :

CO2 (g) + H2O (l) H2CO3 (aq) H+ + HCO3-

Une pluie est dite acide lorsque son pH est infrieur 5,6. La cause des pluies acides est la
prsence de SO2 et NOx dans latmosphre. Ces substances sont mises par les voitures, les
centrales lectriques et celles au charbon. Dans latmosphre le SO2 (g) sera transform en
SO3 (g). Celui-ci se dissoudra dans l'eau de pluie pour former de l'acide sulfurique (H2SO4)
qui provoquera une diminution du pH :

SO3 (g) + H2O (l) H2SO4 (aq)

Les NOx comme le NO2 participent aussi aux pluies acides : le NO2 peut se combiner au
radical hydroxyle3 de l'atmosphre (OH) pour former de l'acide nitrique :

NO2 + OH HNO3 (aq)

L'acide nitrique provoquera une diminution du pH de l'eau.

Les pluies acides auront des effets sur les organismes (plantes, animaux) ainsi que des effets
sur les sols : les bactries essentielles pourront tre affectes et les lments chimiques
essentiels aux plantes pourront tre lessivs. En effet, de nombreux mtaux comme le Mg2+
sont associs aux argiles. Lors d'une pluie acide ils seront lessivs :

Mg2+ (argiles) Mg2+ (aq)

Les lments toxiques (mtaux : Cd, Cr, etc...) seront galement mobiliss par les pluies
acides.

Sensibilit diffrentielle des espces aquatiques lacidit :

Comme mentionn ci-dessus, chaque espce ne peut vivre que dans une gamme bien prcise
de pH :

3
Le radical hydroxyle (OH) est neutre, trs ractif et possde une courte dure de vie (10-9
s.). C'est un radical car il possde un lectron clibataire.

26
3. Le carbone et les hydrocarbures

Le carbone est un lment majeur en biologie. En effet, les organismes sont composs en
grande partie de carbone. Les substances comportant du C sont trs varies. La "chimie
organique" est la branche de la chimie ddie entirement l'tude des composs carbons.

3.1. Exemples de molcules comportant 1 atome de C.

Le mthane : CH4

Le mthane, ou gaz naturel, peut tre produit par des arches mthanognes ou consomm par
des bactries mthanotrophes. Les cellules eucaryotes ne sont pas capables de produire du
mthane par elles-mmes (si elles en produisent c'est qu'elles contiennent des arches).

Le dioxyde de carbone : CO2

Les organismes autotrophes comme les plantes vertes "fixent" le CO2 pour synthtiser de la
matire organique complexe alors que les organismes htrotrophes dgradent la matire
organique complexe et produisent du CO2.

L'ure : CO(NH2)2

L'ure est un compos important dans le mtabolisme de lazote


chez les tres vivants. Elle est prsente dans lurine chez les mammifres.

3.2. Exemples de molcules comportant 2 atome de C.

L'thane : C2H6

Il s'agit d'un gaz inodore et incolore que l'on peut trouver dans le gaz naturel. Les deux
carbones de l'thane sont relis par une liaison covalente simple.

L'thne (ou thylne) : C2H4

Il s'agit d'un gaz incolore et trs ractif qui est la source d'un grand nombre de polymres et
de matires plastiques (le polythylne). En biologie il est principalement connu comme
hormone vgtale4. Les deux atomes de C sont relis par une double liaison.

L'thyne (ou actylne) : C2H2

Il s'agit d'un gaz incolore et trs inflammable. Les deux atomes de carbone sont relis par une
triple liaison.

Ethane, thne et thyne sont des gaz pouvant tre produits par des bactries mthanognes5.

4
Lin et al. (2009) J. Exp. Botany 60:3311-3336.
5
Belay & Daniels (1987) Appl. Environ. Microbiol. 53:1604-1610.

27
Ethane Ethne Ethyne

3.3. Les hydrocarbures

Ce sont des molcules composes uniquement de C et de H. Les gaz thane, ethne et thyne
dont il tait question ci-dessus sont des hydrocarbures.

Les alcanes sont des hydrocarbures saturs : il possdent uniquement des liaisons simples.
Les alcnes sont des hydrocarbures insaturs : ils possdent au moins une double liaison.
Les alcynes sont des hydrocarbures insaturs : ils possdent au moins une triple liaison.

Les hydrocarbures linaires :

Les hydrocarbures peuvent tre linaires comme l'octane C8H18. Cet alcane est trouv dans
l'essence automobile. Tous les carbones de l'octane ont une configuration sp3.

Les hydrocarbures ramifis :

Au moins un C est reli 3 autres atomes de C.

Exemple : l'isooctane, C8H18, qui est un isomre de l'octane.

Les hydrocarbures cycliques :

Ces hydrocarbures prsentent un cycle de carbones

Le cyclohexane : C6H12

Les C du cyclohexane ont une configuration sp3. En consquence, le cyclohexane nest pas
une molcule plane. Dans la conformation chaise du cyclohexane 6 atomes d'hydrogne
sont dits quatoriaux (dans le "plan" du cycle) alors que les 6 autres atomes d'hydrogne sont
axiaux (perpendiculaires au "plan" du cycle). Cette conformation est la plus stable.

28
Le cyclohexane peut galement prendre une conformation bateau , moins stable.

Le cyclopentane : C5H10

La forme plane du C5H10 nest pas stable. La molcule adopte une forme enveloppe ou une
forme croise.

Forme enveloppe Forme croise

Les hydrocarbures aromatiques :

Un hydrocarbure est dit aromatique s'il est plan et s'il possde 4n + 2 lectrons dlocalisables
dans un systme cyclique (o n est un entier naturel). C'est la rgle de Hckel. A titre
d'exemple, le benzne est un hydrocarbure aromatique qui comporte un seul cycle et 6
lectrons dlocaliss.

Le benzne : C6H6

Les 6 carbones du benzne ont une configuration sp2. La molcule est donc plane. Il s'agit
d'un liquide incolore issu du ptrole brut. C'est un solvant trs utilis dans l'industrie
chimique, et un prcurseur important pour la synthse chimique de mdicaments, de
plastiques, de caoutchouc synthtique ou encore de colorants.

29
Chaque atome du cycle benznique comporte une orbitale p (avec un lobe infrieur et
postrieur) et ces orbitales p se recouvrent. Les 6 lectrons du benzne sont donc
dlocaliss dans ces orbitales. Pour reprsenter le caractre dlocalis des lectrons, le
benzne est gnralement reprsent par un cercle contenu dans un hexagone.

Les hydrocarbures en biologie

Les alcanes linaires et ramifis sont peu importants dans les organismes. Ils sont prsents
dans les cuticules des feuilles chez les plantes et le requin plerin (Cetorhinus maximus)
comporte beaucoup de pristane dans son foie (C19H40).

Le pristane

Les cycloalcanes sont par contre trs importants en biologie : des cycles hexaniques sont
rencontrs dans les terpnes (b-carotne, rsines des conifres, etc.), les strodes (hormones)
et un grand nombre de sucres (glucose, galactose, etc.). Le lindane est un cyclohexane
insecticide dont les 6 atomes d'hydrogne ont t substitus par 6 atomes de chlore.

Le b-carotne

Le lindane ou g 1,2,3,4,5,6-hexachlorocyclohexane (HCH)

30
Le cyclopentane est un cycloalcane qui est rencontr dans des hormones comme la
testostrone et loestradiol (voir plus loin).

3.4. Les isomres

Les isomres sont des molcules qui ont la mme formule brute. Ils possdent donc le mme
nombre et le mme type d'atomes. Cependant ces atomes sont arrangs dans l'espace de faon
diffrente. En consquence, deux isomres peuvent prsenter des proprits physiques,
chimiques et biologiques trs diffrentes. On distingue les isomres de structure et les
stroisomres.

Les isomres de structure :

Les isomres de structure n'ont que la formule brute en commun. Ces isomres ont
gnralement des proprits physiques et/ou chimiques diffrentes. On parle d'isomrie de
chane lorsque la disposition des liaisons covalentes dans lespace varie. C'est le cas par
exemple de l'octane et de l'isooctane, ou du butane et du mthylpropane. L'isomrie de
position de fonction est un autre type d'isomrie de structure. Dans ce cas, un groupement
fonctionnel est plac sur des carbones diffrents de la chane carbone. L'isomrie de nature
de fonction caractrise les isomres dont les groupes fonctionnels sont diffrents, donc de
proprits physiques et chimiques diffrentes. Par exemple l'thanol et le mthoxymthane.

Octane Isooctane
Temprature d'bullition : 126C Temprature d'bullition : 99C

Pour les alcanes, le nombre disomres de structure possible augmente avec le nombre
datomes de C. Par exemple le C20H42 comporte 366 319 isomres de structure.

Nombre de carbones Nombre d'isomres


13 1
4 2
5 3
6 5
7 9
8 18
9 35
10 75
15 4 347
20 366 319

31
L'octane (C8H18) possde 18 isomres de structure et plusieurs stroisomres :

Les stroisomres (isomres gomtriques ou isomres de configuration) :

Deux molcules sont des stroisomres lorsque la disposition des liaisons covalentes dans
lespace est identique mais la disposition de certains atomes ou groupes est diffrente. On
classe les stroisomres en deux grands groupes : les nantiomres et les diastroisomres.

Les nantiomres, ou isomres optiques, sont deux molcules qui sont l'image l'une de l'autre
dans un miroir. Ces molcules ne sont pas superposables : elles prsentent en effet une
chiralit. Un mlange des deux nantiomres en quantits gales est appel mlange
racmique. Les nantiomres ont des proprits physiques et chimiques identiques sauf pour
le sens de rotation du plan de polarisation de la lumire (+ ou -). Un mlange racmique a un
pouvoir rotatoire gal zro.

Les molcules ci-dessus prsentent un carbone asymtrique (C*) : il s'agit d'un carbone
possdant 4 groupes ou atomes diffrents. Les cellules sont capables de diffrencier deux
isomres optiques. Par exemple, les acides amins L et D (voir plus loin), la L-dopa

32
(mdicament efficace contre maladie de Parkinson alors que la D-dopa est biologiquement
inactive), et la R-thalidomide (qui protge les femmes enceintes contre les nauses alors que
la S-thalidomide a des effets tratognes!).

R-talidomide S-talidomide

Les diastroisomres sont les stroisomres qui ne sont pas nantiomres. Par exemple,
lorsque, sur chacun des deux cts d'une double liaison, on trouve deux groupes diffrents, on
distingue deux configurations : Z et E. La libre rotation autour de la double liaison n'est pas
possible, du fait de la prsence d'une liaison p. Il en rsulte une molcule plane ayant deux
configurations possibles.

configuration Z configuration E
cis-2-butne trans-2-butne
tbullition : 4C tbullition : 1C

En utilisant l'ordre de priorit (d'aprs la convention CIP - Cahn, Ingold, Prelog -) on dfinit
les deux isomries ainsi :

La configuration Z caractrise les diastroisomres dont les groupes prioritaires sont


du mme ct du plan form par la double liaison (et perpendiculaire au plan de la
molcule). L'abrviation Z vient de l'allemand zusammen qui signifie ensemble .
La configuration E caractrise les diastroisomres dont les groupes prioritaires sont
du ct oppos l'un de l'autre par le plan form par la double liaison. Le terme E vient
de l'allemand entgegen qui signifie oppos .

Les termes cis et trans qualifient des positions relatives de groupements sans tenir compte de
leur priorit. Les priorits sont par exemple COOH > H et NH2 > CH3.

33
Application la biologie :

Le rtinal est un driv de la vitamine A important pour le processus de vision. Cest la


lumire qui le fait passer dune forme cis la forme trans.

cis-rtinal

trans-rtinal
Autres types d'isomres :

Les pimres :

Deux pimres ne diffrent entre eux que par la configuration absolue d'un seul carbone
asymtrique, comme par exemple le D-mannose et le D-glucose ou encore le D-glucose et le
D-galactose (voir plus loin).

Les anomres :

Cest un cas particulier dpimrie pour le carbone n1 des oses (voir plus loin). Si la fonction
hydroxyle du carbone n1 est en dessous du plan (en reprsentation de Haworth), lose est dit
(alpha) alors que si lhydroxyle du carbone n1 est au-dessus du plan, lose est dit (bta).
Cette nomenclature est trs importante pour dcrire les liaisons chimiques contractes dans les
disaccharides et les polysaccharides (voir plus loin).

Les conformres :

Ils ne se diffrencient que par rotation autour d'une ou plusieurs liaisons simples (liaisons
sigma), sans les rompre. Les rotamres sont des conformres qui ne se diffrencient que par
rotation d'une seule liaison sigma.

Conformres du butane

34
4. Les groupements fonctionnels

Les composants des molcules organiques qui participent le plus souvent aux ractions
chimiques sont les groupements fonctionnels. Ce sont des regroupements datomes qui
remplacent un ou plusieurs atomes dhydrogne lis un squelette carbon. Certains
groupements fonctionnels incluent des atomes de la chane carbone.

Les 6 groupements fonctionnels les plus importants en biologie sont les suivants :

Groupement hydroxyle
Groupement carbonyle
Groupement carboxyle
Groupement amine
Groupement thiol
Groupement phosphate

Ces groupements sont hydrophiles et augmentent donc la solubilit des composs organiques
dans leau.

4.1. Le groupement hydroxyle

Structure : -OH

Nom des composs : alcools

Exemple : thanol

Attention, ne pas confondre ce groupement avec lanion hydroxyde et le radical hydroxyle :

-
Anion hydroxyde : OH

Charg ngativement;
Provient par exemple de la dissociation de leau ou du NaOH.

Radical hydroxyle : OH

Neutre (forme neutre de lanion hydroxide);


C'est un radical car il possde un lectron non appari;
Il est trs ractif (possde une courte dure de vie);
Toxique pour les cellules.

35
4.2. Le groupement carbonyle

Structure : >C=O

Nom des composs : aldhydes ou ctones.

Aldhydes : le groupement carbonyle est lextrmit d'une chane carbone.


Ctones : le groupement carbonyle est lintrieur dune chane carbone.

Exemples :

Propanal (aldhyde) Actone (ctone)

O O
R C R C
H R
4.3. Le groupement carboxyle

Structure : -COOH

Nom des composs : acides carboxyliques

Exemple : acide actique

d- d+
L'atome d'hydrogne du groupement carboxyle tendance se dtacher.
Le carboxyle donc des proprits acides car il est une source de H+.

36
Formation de l'ion actate :
O
+ H+

O
La forme ionise (appele carboxylate) prdomine dans les cellules.

4.4. Le groupement amine

Structure : -NH2

Nom des composs : amines

Exemple : la glycine

La glycine est un acide amin (prsence galement dun -COOH).

Amine primaire :

Amine secondaire :

Amine tertiaire :

Le groupement amine possde des proprits basiques car l'atome d'azote possde une paire
dlectrons pouvant fixer un H+ :

+ H+

Ammoniac Ammonium

37
Dans les cellules, le groupement amine porte gnralement une charge de +1 (fixation de 1
atome dH).

4.5. Le groupement thiol ou sulfhydryle

Structure : -SH

Nom des composs : thiols

Exemple : l'thanthiol

Le lien entre S et H est moins fort que celui entre O et H.


Importance dans la stabilisation des protines.

4.6. Le groupement phosphate


P
2-
Structure : -OPO3

Nom des composs : phosphates organiques

Exemple : le glycrophosphate :

Rem : pH neutre le groupement phosphate est ionis.

La principale molcule de transfert dnergie dans la cellule comporte des phosphates : c'est
l'adenosine-5'-triphosphate ou ATP :

L'ATP avec ses trois groupements phosphate ioniss

38
5. Les macromolcules organiques

Des molcules organiques complexes se forment dans les cellules partir de molcules
organiques simples. Il y a quatre classes principales de macromolcules organiques :

- Les glucides
- Les lipides (incluant les terpnes)
- Les protines
- Les acides nucliques

Ces macromolcules organiques peuvent possder des milliers datomes.

La plupart des macromolcules (glucides, protines, acides nucliques) sont des polymres
synthtiss partir de monomres :
Liaison covalente

Les mcanismes chimiques par lesquels les cellules synthtisent ou dgradent les
macromolcules sont toujours les mmes : suite l'association de deux monomres il y a
production dune molcule deau. C'est ce que l'on appelle une raction de condensation, ou
de dshydratation. Lorsque le polymre se dgrade il y a rupture des liaisons entre
monomres et addition de molcules deau. C'est la raction dhydrolyse.

39
5.1. Les glucides monosaccharides

Les monomres constituant l'unit de base des glucides (sucres ou oses) sont les
monosaccharides ou sucres simples. Les monosaccharides possdent un groupement
carbonyle (>C=O) et des groupements hydroxyles (-OH). Leur formule brute est souvent de
type Cn(H2O)n. Certains sucres contiennent aussi de l'azote, du soufre ou du phosphore.

Selon le nombre d'atomes de carbone prsents dans le monosaccharide on distingue :

Les trioses (3 atomes de C)


Les ttroses (4 atomes de C)
Les pentoses (5 atomes de C)
Les hexoses (6 atomes de C)
Les heptoses (7 atomes de C)

Selon le nombre d'units monosaccharidiques prsentes dans le sucre on distingue :

Les monosaccharides (1 monomre)


Les disaccharides ou diholosides (2 monomres)
Les trisaccharides ou triholosides (3 monomres)
Les oligosaccharides (>3 monomres)
Les polysaccharides (>20 monomres)

Selon la position du groupement carbonyle on distingue :

Les aldoses Les ctoses


Carbonyle terminal Carbonyle interne

Ces deux sucres sont des trioses

40
Les deux trioses reprsents ci-dessus sont des isomres; ils peuvent galement tre
reprsents en tenant compte des angles entre les liaisons6 :

isomres

C3H6O3 C3H6O3
Glycraldhyde Dihydroxyactone

Les noms de ces deux trioses sont les suivants : le glycraldhyde ou dihydroxy-2,3-propanal
(un aldotriose) et le dihydroxyactone ou dihydroxy-1,3-propanone (un ctotriose). Le
glycraldhyde est le plus petit aldose (il n'existe pas d'ose deux atomes de carbone).

La projection de Fischer :

Il s'agit d'une reprsentation plane dune molcule organique tridimensionnelle :

Les liaisons chimiques horizontales sortent en avant du plan de la feuille.

La reprsentation de Cram :

= dans le plan de la feuille

= en avant du plan

= en arrire du plan Exemple : le mthane

6
Tous les atomes d'hydrogne ne sont pas reprsents.

41
Projection de Fischer des aldotrioses :

Il existe deux nantiomres pour le glycraldhyde : le D-glycraldhyde, dont le groupement


hydroxyle est situ droite en reprsentation de Fischer, et le L-glycraldhyde dont le
groupement hydroxyle est situ gauche en reprsentation de Fischer. La chaine carbone
principale se situe sur la ligne verticale.

CHO CHO

H OH HO H

CH2OH CH2OH

D-glycraldhyde L-glycraldhyde
Miroir

Un seul carbone asymtrique (C*) est prsent dans le glycraldhyde. Il y a donc 21 = 2


stroisomres (des nantiomres dans ce cas). En gnral, une molcule possdant n C* peut
possder 2n stroisomres.

Projection de Fischer simplifie des aldotrioses :

D-glycraldhyde L-glyceraldhyde

Intrt biologique du D-glycraldhyde :

Le glycraldhyde-3-phosphate (G3P) est un intermdiaire de la glycolyse (production


dnergie par les cellules htrotrophes).

42
Projection de Fischer des ctotrioses :

dihydroxy-1,3-propanone
ou dihydroxyactone

Le dihydroxyactone ne possde pas de C*; il est non chiral. Le dihydroxyactone phosphate


(DHAP) est un compos qui intervient dans la glycolyse ainsi que dans le cycle de Calvin.

Les ttroses :

Ces sucres possdent deux C*. Ils prsentent donc 22 stroisomres.

CHO CHO

H OH HO H

H OH HO H

CH2OH CH2OH
nantiomres
D-rythrose L-rythrose

CHO CHO

H H OH
HO diastroisomres
H OH HO H

CH2OH CH2OH
nantiomres L-throse
D-throse

43
L'rythrose et le throse sont des aldottroses. Pour tous les sucres, la nomenclature officielle
est la nomenclature IUPAC (International Union of Pure and Applied Chemistry). Le nom
IUPAC de ces sucres est le 2,3,4-trihydroxybutanal7. L'rythrose est un intermdiaire dans la
voie des pentoses phosphates (voir cours de mtabolisme).

Le centre chiral le plus distant du carbonyle est utilis pour nommer le sucre. Si sa
configuration est identique celle du D-glycraldhyde le sucre est un isomre D. Dans le cas
contraire il s'agit de l'isomre L.

Les pentoses :

Ces sucres possdent trois C*. Ils prsentent donc 23 stroisomres. Un des sucres les plus
importants au niveau biologique est un aldopentose appel D-ribose.
CHO

H OH
D-ribose :
H OH
H OH

CH2OH

En effet, le D-ribose est lose prsent dans lacide ribonuclique (ARN). Il est dans ce cas
sous sa forme cyclique rsultant de la formation dun hmiactal (voir plus loin). Une forme
modifie du D-ribose se trouve galement dans lADN (l'acide dsoxyribonuclique).

Formes cycliques des pentoses :

En solution aqueuse, les monosaccharides possdant au moins 5 atomes de carbone forment


des structures cycliques dans lesquelles le groupement carbonyle forme une liaison covalente
avec l'oxygne d'un groupement hydroxyle. Il y a alors formation d'un hmiactal. Ces formes
cycliques comportent un carbone asymtrique additionnel : le carbone anomrique.

7
Les nantiomres sont distingus par les lettres R et S.

44
La formation d'un hmiactal peut tre explique par la prsence d'une charge partielle
positive sur le carbone du groupement carbonyle. Ce carbone a alors tendance former un
lien avec l'oxygne d'un groupement hydroxyle qui possde une charge partielle ngative.

R1 R1
C=O C O
R2 R2
d+ d-

R1 R1
C O C O

R2 R2

La raction globale se rsume en deux tapes : H


-
R1 R1 O
+
1. + R-O-H C R
C=O
R2 R2 O-

H
-
R1 O R1 OR
+
2. R transfert de
C C
H interne
R2 - R2 OH
O

Lorsqu'un hmiactal se forme entre le premier carbone (C1) et le quatrime carbone (C4) d'un
monosaccharide un cycle compos de 5 atomes apparat. C'est la forme furanique qui l'allure
d'un pentagone. Ce cycle fait rfrence au furane, liquide incolore trs volatil.

CHO
1

O H OH
H H 2
H OH
3
H OH
4
H H
Furane CH2OH

D-ribose

45
Suite la cyclisation du D-ribose un carbone asymtrique supplmentaire apparat (le carbone
anomrique). Deux diastroisomres de cyclisation sont possibles :

OH devenu C*
CHO
H C
H OH
H OH
H OH O
H OH
H OH
H

CH2OH H CH2OH diastroisomre n1

HO C

H OH
O
H OH
H

diastroisomre n2
CH2OH

Pour reprsenter le diastroisomre n2 en projection de Haworth il suffit de raliser un


nombre pair de permutations au niveau de C1 et de C4 :

46
La projection de Haworth est un moyen pratique de reprsenter la structure cyclique des
monosaccharides avec une simple perspective tridimensionnelle. Les atomes de carbone et
d'hydrogne ne sont pas reprsents explicitement. Un trait plus pais indique que les atomes
et les liaisons chimiques sont en avant du plan de la feuille.

La nomenclature a ou b se fait en fonction du carbone anomrique et du carbone asymtrique


le plus loign du cycle :

- Anomre a : les deux positions ont la mme configuration strochimique (ou OH le plus
droite dessin vers le bas).
- Anomre b : les deux positions ont des configurations strochimiques diffrentes (ou OH le
plus droite dessin vers le haut)

4 1
4 1

configuration b configuration a
b-D-ribose a-D-ribose
ou b-D-ribofuranose ou a-D-ribofuranose
(forme prsente dans l'ARN)

Les anomres a et b peuvent s'interconvertir en solution aqueuse. C'est le phnomne de


mutarotation (un quilibre s'tablit alors entre les deux formes).

Formation dun hmiactal entre C1 et C5 : la forme pyranique :

Lorsqu'un hmiactal se forme entre le premier carbone (C1) et le cinquime carbone (C5)
d'un monosaccharide un cycle compos de 6 atomes apparat. C'est la forme pyranique qui
l'allure d'un hexagone. Ce cycle fait rfrence au pyrane.

CHO O
1

H OH
2
H OH
3
H OH
4 Pyrane

5 CH2OH
D-ribose

47
Le D-ribose se prsente donc sous plusieurs formes selon l'endroit de formation de
l'hmiactal. En milieu aqueux, un quilibre s'tablit entre toutes les formes. La forme
prpondrante 20C dans l'eau pure est le b-D-ribopyranose (58,5%). Cependant, c'est la
forme b-D-ribofuranose (13,5%) qui est utilise par la cellule pour former l'ARN.

Le dsoxyribose est un ribose ou le groupement OH du C2 est manquant. C'est la forme qui


est utilise dans l'ADN.

Dsoxyribose :

il manque un OH

2-dsoxy-b-D-ribofuranose
(dans lADN)

48
Les hexoses :

Les aldohexoses sont des monosaccharides 6 atomes de carbones. Ils peuvent galement
former des hmiactals. Les formes linaires possdent 4 carbones asymtriques (il y a donc
24 = 16 stroisomres : 8 isomres D et 8 isomres L).

Formation dun hmiactal entre C1 et C5 :

La nomenclature des hexoses se fait par analogie au pyrane :

49
Les cycles comportant 6 atomes dans les hexoses ne sont pas plans. Ils adoptent gnralement
une conformation de type chaise :

OH de C1 axial et donc OH de C1 dans le "plan"


moins stable (35%) plus stable (65%)

Les formes a et b sinterconvertissent (phnomne de mutarotation). La proportion


lquilibre est de 35% - 65%.

Projections de Haworth
a-D-Glucofuranose b-D-Glucofuranose

hmiactal
1-4

< 0,5% < 0,5%

hmiactal
1-5
D-Glucose
linaire
< 0,5%
35% 65%
a-D-Glucopyranose b-D-Glucopyranose 20C
eau

50
Filiation des aldoses de la srie D

Quelques aldohexoses dintrt biologique :

D-Glucose (Glu) (C6H1206) (dextrose) : mtabolis par les cellules htrotrophes dans un
processus appel glycolyse. Source dnergie importante pour la cellule. La cellule ne peut
pas utiliser le L-Glucose.

D-Galactose (Gal) (C6H1206) : les glandes mammaires des mammifres scrtent du lactose,
un disaccharide compos de glucose et de galactose (lactose = Glu-Gal).

D-mannose (Man) (C6H1206) : hexose important dans les glycoconjugs (glycoprotines,


glycolipides). Impliqus dans les interactions entre cellules (reconnaissance intercellulaire).

51
Projections de Haworth
D-galactose :
a-D-Galactofuranose b-D-Galactofuranose

3,5%

D-Galactose 30C
linaire 30% 64% eau

a-D-Galactopyranose b-D-Galactopyranose

D-mannose : Projections de Haworth

a-D-Mannofuranose b-D-Mannofuranose

< 1% < 1%

Formes linaires
20C
67% 33% eau

a-D-Mannopyranose b-D-Mannopyranose

52
Filiation des ctoses de la srie D

ctotriose

ctottrose

ctopentoses

ctohexoses

53
Fructose :

D-fructose L-fructose

Formation dun hmiactal entre C2 et C6 (forme pyranique) :

D-fructose a-D-fructopyranose

Formation dun hmiactal entre C2 et C5 (forme furanique) :

D-fructose a-D-fructofuranose

54
D-fructose : Projections de Haworth

a-D-Fructofuranose b-D-Fructofuranose

5% 20%

D-fructose
linaire 20C
2% 73% eau

a-D-Fructopyranose b-D-Fructopyranose

Intrt biologique du D-fructose :

D-fructose (Fru) (C6H1206) (lvulose) : trouv en abondance dans les fruits et le miel. Trouv
dans le sucre de table (sucrose) et dans linuline produite par les plantes. Peut entrer dans la
glycolyse et tre une source dnergie pour les cellules htrotrophes.

5.2. Les drivs des glucides monosaccharides

5.2.1. Le L-fucose (C6H12O5).

Il s'agit de L-galactose sans groupement hydroxyle en C6 (remplac par un H) :

55
Le fucose est aussi appel 6-doxy-L-galactopyranose ou b-L-fucopyranose :

Le L-fucose est trouv dans les polyosides ou celui-ci sert terminer le polymre ou bien
comme point dattachement pour l'attachement dautres oses. On le trouve galement la
surface des cellules (ex : globules rouges).

5.2.2. La glucosamine (C6H13NO5).

Il s'agit d'un sucre amin qui est un composant essentiel de la chitine des insectes et des
crustacs. On le trouve aussi dans la paroi des Fungi et des bactries. Cest un des
monosaccharides les plus abondants sur Terre. Il se forme partir d' a-D-glucopyranose.

NH2
a-D-glucosamine
= 2-Amino-2-deoxy-D-glucose

5.2.3. Le N-actyl-a-D-glucosamine (GlcNac ou a-NAG).

56
La forme actyle de la glucosamine est trs abondante dans la nature. Par exemple, les parois
des bactries contiennent du N-actyl-b-D-glucosamine (ou b-NAG).

5.2.4. L'acide N-actyl-b-D-muramique (b-NAM).

Ce sucre rsulte de la liaison entre de l'acide lactique et du b-NAG :

Le NAM est galement trs abondant dans la biosphre car c'est un des deux sucres de la
paroi des bactries (l'autre tant le b-NAG).

57
5.2.5. Les acides uroniques.

Ce sont des sucres acides car ils possdent un acide carboxylique (une des fonctions
hydroxyle a t oxyde en acide carboxylique).

Acide a-D-glucuronique :

Acide a-D-glucuronique

Lacide glucuronique est trs soluble dans leau. Chez les animaux, elle est utilise pour
mtaboliser diverses substances (drogues, polluants, bilirubine, andrognes, strognes,
corticodes, glucocorticodes, drivs dacides gras, rtinodes, acides biliaires. Le processus
est appel la glucuronidation. La glucuronidation lieu principalement dans le foie.

Formation de glucuronides solubles (limination par les urines).

Acide L-iduronique (IdoA) :

C'est l'acide uronique majeur du dermatan sulfate et de l'hparine (tous deux des
glycosaminoglycanes - GAGs).

58
Acide neuraminique (Neu) :

Ce sucre est un composant des glycoprotines de la membrane cellulaire, du mucus, ainsi que
des des glycolipides (les gangliosides, composants importants des neurones). Il est charg
ngativement. Il se forme partir d'acide pyruvique et de D-mannosamine :

59
5.2.6. Les acides sialiques.

Ce terme est utilis pour dsigner des drivs N- ou O-substitus de lacide neuraminique. Par
exemple par adjonction dun groupement actyl. Les acides sialiques sont trs rpandus dans
les tissus des animaux (dans les glycoprotines et les gangliosides). Ils sont trouvs galement
chez les plantes, les Fungi et les bactries.

60
5.3. Les diholosides et triholosides

5.3.1. Le maltose. Il s'agit de di-glucose (a-D-glucopyranose + a-D-glucopyranose)8 :

La liaison des deux monosaccharides est une raction de condensation (formation d'eau).

La liaison O-glycosidique est une liaison covalente entre le groupement OH du C anomrique


et lhydrogne libre dune autre molcule (par exemple un autre hydroxyle).

8
Une fois la liaison forme, le rsidu glucose possdant le carbone anomrique libre est
capable d'exister sous forme a ou b. Il s'agit de l'extrmit rductrice d'un sucre rducteur,
capable de rduire du Cu2+ dans la raction de Fehling. Cette extrmit est gnralement
reprsente droite.

61
Autre exemple de liaison O-glycosidique :

thanol
thyl glucoside

Remarques :

Liaisons S-glycosidiques : le C anomrique possde un groupement soufr

Liaisons N-glycosidiques : le C anomrique possde un groupement NH2

Importance biologique du maltose : ce sucre rducteur apparat dans les grains d'orge en
germination par action des amylases sur l'amidon (c'est le processus de maltage utilis en
brasserie). Le maltose est un sucre pouvant tre ferment par les levures.

5.3.2. Le lactose. Il s'agit d'un diholoside de b-D-Galactopyranose et de D-Glucopyranose


(forme a ou b).

62
Importance biologique du lactose :

Le lactose est un sucre rducteur naturellement prsent dans le lait des mammifres. Le
lactose est dgrad dans le tube digestif par une enzyme appele b-galactosidase qui
l'hydrolyse en glucose et galactose. La b-galactosidase est prsente chez tout le monde, durant
le sevrage et lenfance, mais chez certaines populations (asiatiques et africaines), la
production d'enzyme disparait avec lge (intolrance au lactose).

5.3.3. Le cellobiose. Il s'agit d'un diholoside (deux units b-D-Glucopyranose)


La liaison est de type b(1 4)

Importance biologique du cellobiose :

Il peut tre obtenu par hydrolyse enzymatique de la cellulose (polysaccharide des parois des
plantes, voir plus loin) et des matriaux riches en cellulose (coton, papier). Certaines bactries
sont capables de lhydrolyser (formation de glucose).

63
5.3.4. Le saccharose. Ce diholoside est aussi appel sucrose. Il s'agit du sucre commercial.
Il est constitu de glucose (a-D-Glucopyranose) et de fructose (b-D-Fructofuranose). Le
sucrose est form par les plantes et non par les animaux (extrait de la betterave sucrire ou de
la canne sucre). Il s'agit d'un intermdiaire majeur de la photosynthse. Ce sucre ne
comporte pas de carbone anomrique libre (les carbones anomriques des deux units sont
impliqus dans la liaison glycosidique). Ce diholoside est donc non rducteur et une double
flche est utilise dans sa nomenclature : Glc(a12b)Fru.

Le sucrose peut aussi tre reprsent de la faon suivante :

1a 2b

Le nom abrg du sucrose est Glc(a1b2)Fru ou Fru(b2a1)Glc

5.3.5. Le trehalose. De formule Glc(a11a)Glc, il s'agit d'un diholoside non rducteur qui
est un lment majeur du fluide circulant chez les insectes (l'hmolymphe).

64
5.3.6. Le raffinose. Ce triholoside est compos de galactose, de glucose et de fructose. Ce
n'est pas un sucre rducteur car tous les carbones anomriques sont impliqus dans des
liaisons glycosidiques.

Importance du raffinose :

On trouve le raffinose dans un nombre important de lgumes (haricots, choux communs,


choux de Bruxelles, brocoli, asperge, graine de soja, etc.). Les humains et autres animaux
monogastriques (cochon et poule) ne possdent pas l'enzyme a-galactosidase, ainsi cet
oligoside n'est pas digr par l'estomac et l'intestin grle. Par contre il est partiellement
ferment par les bactries prsentes dans le gros intestin ce qui produit du dioxyde de
carbone, du mthane et de l'hydrogne.

65
5.4. Les polysaccharides

Les polysaccharides sont constitus de nombreuses units monosaccharidiques associes par


des liaisons glycosidiques. Ils se diffrencient les uns des autres par le type de
monosaccharide, le type de liaison, la longueur des chanes et la prsence de ramifications.
Les homopolysaccharides ne contiennent qu'un seul type de monosaccharide, les
htropolysaccharides sont composs d'au moins deux monosaccharides diffrents. Les
polysaccharides n'ont pas de poids molculaire dfini.

5.4.1. Amylose

Il s'agit de chanes linaires da-D-glucopyranose (600 - 1000 units).

(a-D-glucopyranosyl-(1 4)-a-D-glucopyranoside)n

Lamylose forme des hlices a six glucoses par tour et est trs abondant dans le monde
vgtal (bl, pomme de terre, riz, sorgho, seigle, etc.). L'amylose peut tre digr par l'homme
contrairement la cellulose. L'amylose se dissocie en glucose assimilable sous l'action
d'enzymes, les amylases.

66
5.4.2. Amylopectine. Il s'agit d'amylose avec des ramifications. L'amylopectine est trouv
chez les plantes. L'amylopectine est digr plus facilement que l'amylose car la formation
hlicodale de l'amylose ne favorise pas l'accessibilit aux enzymes d'hydrolyse.

Ramification tous les 25-30 glucoses


Chanes : liaisons a(1 4)
Ramifications : liaisons a(1 6)

a(1 4)

a(1 6)

5.4.3. L'amidon. Il est constitu d'amylose (25%) et d'amylopectine (75%). L'amidon est
trouv dans les organes de rserves de nombreuses plantes :

graines : crales [mas, froment] et lgumineuses


racines
tubercules et rhizomes (pomme de terre, patate douce, etc.)
fruits (banane)

67
5.4.4. Le glycogne

Il possde une structure similaire lamylopectine. Il s'agit donc de chanes linaires da-D-
glucopyranose. Cependant, les branchements se font tous les 8 12 rsidus glucose. Le
glycogne est utilis par les animaux pour stocker de l'nergie sous forme de granules dans les
cellules (principalement dans le foie et dans les cellules musculaires) au mme titre que
l'amidon chez les vgtaux.

5.4.5. L'inuline

Il s'agit d'un polymre de b-D-fructofuranose.


Les chanes sont termines par un glucose. Les liaisons
glycosidiques sont de type b(21).

On trouve l'inuline chez les plantes, souvent


dans les racines et les rhizomes
(stockage dnergie).

Les humains ne possdent pas l'enzyme pour digrer


ce polysaccharide (ferment par bactries dans le colon).

5.4.6. La cellulose

Il s'agit de chanes linaires de b-D-glucopyranose (200 14 000 monomres). La cellulose


est trouve dans la paroi des cellules vgtales. C'est le principal constituant du bois. La
cellulose constitue la matire organique la plus abondante sur la Terre (plus de 50 % de la
biomasse). Elle n'est pas digre par lhomme.

liaisons b (1 4)

b-D-glucopyranose

68
Les chanes linaires de cellulose s'associent entre elles par des liaisons hydrogne, confrant
ainsi une structure fibrillaire la cellulose.

La cellulose peut galement tre considre comme un polymre de cellobiose (diholoside) :

69
5.4.7. La chitine. C'est un polymre de N-actyl-b-D-glucosamine qui est trs abondant sur
Terre car on la retrouve dans la paroi des Fungi et les exosquelettes darthropodes (insectes,
crustacs). La chitinase est une enzyme capable de dgrader la chitine. Les liaisons
glycosidiques sont de type b(1 4).

5.4.8. Le peptidoglycane ou murine. Il s'agit d'un htropolysaccharide unique au groupe


Bacteria. Il est compos de longues chanes linaires ou alternent la N-actyl-b-D-
glucosamine (b-NAG) et l'acide N-actyl-b-D-muramique (b-NAM). De multiples
ttrapepides relient ces chanes entre-elles. Les units b-NAG et b-NAM sont relies par des
liaisons b(1,4). Le lysozyme est capable de cliver ces liaisons.

70
5.4.9. Les glycosaminoglycanes (GAGs) ou mucopolysaccharides

Ce sont des htropolysaccharides linaires et non ramifis. Ils consistent en la rptition dun
disaccharide. Un des deux monosaccharides est toujours la N-actyl-glucosamine ou la N-
actyl-galactosamine; l'autre est dans la plupart des cas un acide uronique, habituellement
l'acide D-glucuronique ou l'acide L-iduronique. Dans certains GAGs un ou plusieurs
hydroxyles du sucre amin est estrifi avec du sulfate. La combinaison des groupes sulfats
et des groupes carboxyles des acides uroniques donne aux GAGs une grande densit de
charges ngatives. Pour minimiser les forces rpulsives entre les chanes les GAGs adoptent
une conformation tendue en solution. Les GAGs sont attachs des protines
extracellulaires pour former des protoglycanes.

Exemples :

L'acide hyaluronique (ou hyaluronate au pH physiologique). Le disaccharide est du GlcA


(acide D-glucuronique) et du GlcNAc (N-actyl-glucosamine) relis par une liaison b13.
Les units disaccharidiques sont relies entre-elles par des liaisons b14. Le nombre d'units
est gnralement trs lev, jusqu' 50 000. L'hyaluronate forme une solution trs visqueuse
que l'on retrouve dans le fluide synovial des articulations ainsi que dans l'humeur vitre des
yeux des Vertbrs. On retrouve aussi ce GAG dans le cartilage et les tendons.
L'hyaluronidase est une enzyme scrte par certaines bactries pathognes qui est capable
d'hydrolyser les liaisons glycosidiques de l'hyaluronate. Les autres GAGs diffrent de
l'hyaluronate par deux caractristiques : les chanes sont beaucoup plus courtes et elles sont
associes de manire covalente des protines spcifiques (les protoglycanes).

-
H

H
HO

GlcA
GlcUA GlcNAc
GalNAc

La chondrotine sulfate. Il s'agit d'un GAGs prsent en grandes concentrations dans le


cartilage (Gr. "chondros", cartilage). Le disaccharide est du GlcA (acide D-glucuronique) et
du GalNAc (N-actyl-galactosamine) relis par une liaison b13. Les units
disaccharidiques sont relies entre-elles par des liaisons b14. Le nombre d'units est de 20
60. Les chanes peuvent tre sulfates en diffrentes positions (il existe donc diffrents types
de chondrotine sulfate). On le retrouve dans les cartilages, les tendons, les ligaments et dans
les parois de l'aorte.

71
-

GlcA
GlcUA GalNAc
GalNAc

Chondrotine-4-sulfate : R1 = H
(chondrotine sulfate A) R2 = SO3-
R3 = H
Chondrotine-6-sulfate : R1 = SO3-
(chondrotine sulfate C) R2 = H
R3 = H

Le dermatan sulfate. Du grec "derma", peau. On le retrouve dans la peau, les vaisseaux
sanguins, et les valves cardiaques. Dans ce polymre, beaucoup des rsidus GlcA prsents
dans la chondrotine sulfate sont remplacs par leur pimre, l'iduronate (IdoA).

IdoA GalNAc4S
Acide iduronique N-actyl-galactosamine

72
Les keratane sulfate. Ce GAG ne contient pas d'acides uroniques et le contenu en sulfate est
variable. Il est compos de galactose et de GlcNAc6S. Environ 25 units disaccharidiques. On
les retrouve dans la corne, le cartilage, les os, et diffrentes structures cornes composes de
cellules mortes : cornes, cheveux, ongles, griffes.

L'hparine. Du grec "hepar", foie. Anticoagulant naturel fabriqu par les mastocytes (type de
globule blanc) et relargu dans le sang ou elle inhibe la coagulation sanguine en se liant
l'antithrombine. L'antithrombine se lie alors la thrombine (protase essentielle la formation
d'un caillot) et l'inhibe. L'interaction est fortement lectrostatique; l'hparine possde la plus
grande densit de charges ngatives de toutes les macromolcules biologiques (il s'agit d'un
GAG hautement sulfat). L'hparine est ajoute en routine aux chantillons sanguins pour
l'analyse clinique et au sang donn pour les transfusions pour viter la coagulation. Environ
15 90 units disaccharidiques. Compos de GlcA2S ou IdoA2S et de GlcNAcS2(S3)S6.
Tous les sucres sont relis par des liaisons a14.

IdoA2S GlcNAc2S6S

73
5.5. Les lipides

Les lipides biologiques forment un groupe trs htrogne dont le trait commun est
l'insolubilit dans l'eau (hydrophobicit). De plus, il ne s'agit pas de polymres contrairement
aux sucres, aux acides nucliques ou aux protines. Les fonctions des lipides sont trs varies
ainsi que leur structure. Les graisses et les huiles sont gnralement des formes de stockage
d'nergie, les phospholipides et les strols sont des lments de structure majeurs des
membranes plasmiques. Les autres lipides, en plus faible concentration, ont souvent des rles
de cofacteur enzymatique, de transporteur d'lectron, de pigments absorbant la lumire,
d'ancre hydrophobe pour les protines, d'agents mulsifiants dans le tube digestif, d'hormones,
ou de messagers intracellulaires. Les cires sont des lipides qui servent l'impermabilisation
des feuilles chez les plantes. Les terpnes, pigments retrouvs chez les vgtaux et les
animaux, sont parfois classifis en dehors des lipides.

5.5.1. Les lipides de stockage.

Les graisses et les huiles sont utiliss chez les organismes vivants pour stocker de l'nergie.
Ce sont des drivs d'acides gras. Les acides gras sont des drivs des hydrocarbures (ils
comportent une longue chane carbone de 4 36 carbones) et comme eux ils fournissent
beaucoup d'nergie lorsqu'ils sont oxyds en CO2 et H2O. Dans certains acides gras la chane
carbone est linaire et sature (pas de double liaison). On parle alors d'acide gras satur.
C'est le cas par exemple de l'acide laurique (ou acide n-dodcanoque CH3(CH2)10COOH. La
nomenclature des acides gras spcifie d'abord la longueur de la chane carbone puis le
nombre de doubles liaisons. Dans le cas de l'acide laurique on notera 12:0 car il n'y a pas de
double liaison.

Acide laurique (12:0)

Acide starique (18:0)

Voici d'autres acides gras saturs : acide myristique (14:0), acide palmitique (16:0), acide
starique (18:0), acide arachidique (20:0), acide lignocrique (24:0). La temprature de fusion
de ces acides gras augmente avec le nombre de carbones : 44,2C pour l'acide gras 12:0 et
86,1 pour l'acide gras 24:0.

Lorsqu'une double liaison est prsente l'acide gras est dit insatur. Le nombre, la position et la
configuration (cis ou trans) des doubles liaisons sont indiqus dans la nomenclature. Par
exemple, pour l'acide olique C18H34O2, on notera 18:1 cis-D9 ou 18:1 trans-D9. Il s'agit d'un
acide gras monoinsatur. On peut aussi le nommer 18:1 w9.

74
Acide olique :

Acide linolique ou LA (C18H32O2) : Il s'agit d'un acide gras polyinsatur comportant deux
doubles liaisons cis.

18:2 cis,cis-D9,12 ou 18:2 w 6,9


Acide linolique

Citons encore l'acide palmitolique (16:1 cis-D9), l'acide a-linolnique (18:3 cis,cis,cis-
D9,12,15) et l'acide arachidonique (20:4 cis,cis,cis,cis-D5,8,11,14). Les acides gras les plus
communs sont linaires (pas de branchements) et ont des nombres pairs de carbones (de 12
24). Ceci provient de leur mode de synthse qui implique la condensation d'units deux
carbones (actate). Les acides gras monoinsaturs ont gnralement la double liaison en D9 ou
en D10. Les autres doubles liaisons des acides gras polyinsaturs sont souvent en D12 et en D15.
Les doubles liaisons des acides gras polyinsaturs ne sont presque jamais conjugues (pas
d'alternance de simples et doubles liaisons comme -CH=CH-CH=CH- ) mais sont spars par
un groupe CH2 : -CH=CH-CH2-CH=CH-. La plupart des acides gras insaturs naturels ont
une configuration cis. Les acides gras trans sont produits par fermentation dans le rumen des
animaux producteurs de lait, dans les produits laitiers et la viande. Ils sont galement produits
durant l'hydrognation du poisson ou des huiles vgtales. La consommation d'acides gras
trans en trop grande quantit est mauvaise pour la sant.

A temprature ambiante (25C) les acides gras saturs de 12:0 24:0 ont une consistance
cireuse alors que les acides gras insaturs de la mme longueur sont des liquides visqueux
(huile). Ceci vient du fait que les double liaisons cis forment des coudes dans les chanes
carbones. Les molcules d'acides gras ont alors plus de difficults pour s'associer ensemble.

Les longues chanes hydrocarbones font que les acides gras sont peu solubles dans l'eau.
L'acide laurique (masse molaire : 200) a une solubilit de 0,063 mg/g dans l'eau alors que le
glucose (masse molaire : 180) a une solubilit de 1,100 mg/g. La prsence du groupe
carboxyle polaire fait que les acides gras sont lgrement solubles.

Chez les Vertbrs des acides gras libres (non estrifis, avec un carboxyle libre) circulent
dans le sang, lis de manire non covalente un transporteur protique (la srum albumine).
Mais la plupart des acides gras sanguins forment des esters ou des amides.

75
Graisses ou triglycrides :

Les lipides les plus simples construits avec des acides gras sont les triacylglycrols, galement
appels triglycrides ou graisses. Les triglycrides sont composs de trois acides gras relis
par liaison ester un glycrol.

1 glycrol + 3 acides gras = triglycride

H2 O
H

H C OH

H C OH

H C OH
Raction de condensation (formation de liaisons ester)
H

liaison ester
Triglycrides

Les triglycrides qui comportent trois acides gras identiques sont des triglycrides simples. Ils
sont nomms d'aprs l'acide gras qu'il contiennent. Par exemple la tristarine (18:0), la
tripalmitine (16:0) et la trioline (18:1). La plupart des triglycrides comportent 2 ou 3 acides
gras diffrents. Ce sont des triglycrides mixtes. Il y a une trs grande diversit de
triglycrides.

Triglycride mixte

Les triglycrides sont non polaires et hydrophobes; ils sont galement moins denses que l'eau
(l'huile flotte sur l'eau). Les triglycrides forment des gouttelettes dans le cytoplasme des
cellules. Chez les Vertbrs, des cellules spcialises (les adipocytes) stockent de grandes
quantits de triglycrides. Les triglycrides sont galement trouvs dans les graines de
certaines plantes (permettant la croissance des plantules). Les adipocytes et les graines

76
contiennent des lipases, enzymes clivant les triglycrides et librant les acides gras. A poids
quivalent l'oxydation des triglycrides donne plus de deux fois plus d'nergie que l'oxydation
des polysaccharides. Et comme ils sont trs hydrophobes ils n'emmagasinent pas d'eau et
prennent donc peu de place (2 g d'eau s'associent 1 g de polysaccharide). Il est donc trs
avantageux de les stocker pour une cellule. Le glucose et le glycogne sont par contre
beaucoup plus rapidement disponibles en raison de leur solubilit leve.

Certains animaux stockent des triglycrides sous la peau pour se protger des basses
tempratures en plus du stockage d'nergie. C'est le cas galement chez les animaux qui
hibernent. Les cachalots stockent des triglycrides dans une poche (le spermaceti) pour rgler
leur flottabilit. Le spermaceti est un organe de plusieurs tonnes situ dans le crne des
cachalots.

La plupart des graisses naturelles (huiles vgtales, produits laitiers, graisse animale) sont des
mlanges complexes de triglycrides simples et mixtes. L'huile de mas et d'olive sont
composes essentiellement de triglycrides avec des acides gras insaturs (et sont donc
liquides temprature ambiante). On peut les convertir en graisse solide par hydrognation
catalytique ce qui rduit certaines de leurs doubles liaisons en simples liaisons et provoque
l'apparition de doubles liaisons trans. Les triglycrides contenant seulement des acides gras
saturs, comme la tristarine, le composant majeur du gras de la viande, sont des solides
blanchtres temprature ambiante.

Formule gnrale d'un triglycride :

Les cires :

Les cires (wax) sont des lipides o des acides gras sont estrifis sur autre chose que du
glycrol. Ce sont des acide gras longue chane (C14 C36), saturs ou non, estrifis sur des
alcools longue chane (C16 C30). Leur point de fusion est gnralement plus lev que celui
des triglycrides. Dans le plancton microbien, les cires sont des produits de stockage trs
frquents. Le triacontanoylpalmitate, composant majeur de la cire d'abeille, est un ester
d'acide palmitique et de l'alcool triacontanol.

77
Les glandes de certains vertbrs produisent des cires destines protger les poils (les garder
flexibles, lubrifis et hydrophobes) ainsi que la peau. Des cires recouvrent les plumes de
certains oiseaux pour les garder hydrophobes et les feuilles de certaines plantes pour viter
l'vaporation et se protger des parasites.

5.5.2. Les lipides de structure membranaires.

Les lipides de structure membranaires sont dits amphipathiques ou amphiphiles : une


extrmit de la molcule est hydrophobe, l'autre est hydrophile. Ils interagissent les uns avec
les autres (interactions hydrophobes) ainsi qu'avec l'eau (interactions hydrophiles) pour
former des bicouches lipidiques (voir plus loin). Il y a 5 types de lipides membranaires : (1)
les glycrophospholipides, (2) les galactolipides et sulfolipides; (3) les lipides
archaebactriens; (4) les sphingolipides; (5) les strols.

5.5.2.1. Les glycrophospholipides.

Les glycrophospholipides (phosphoglycrides ou phospholipides) sont des lipides


membranaires. Deux acides gras sont relis par liaison ester aux deux premiers carbones du
glycrol. Un groupement polaire, charg, est li par liaison phosphodiester au troisime
carbone du glycrol.

acides gras

rgion hydrophile rgion hydrophobe

78
Formule gnrale dun glycrophospholipide :

R1 R2

C=O C=O

O O H O

H C1 C2 C3 O P O X

H H H OH

Les glycrophospholipides comportent deux acides gras lis de faon covalente en C1 et C2


dun radical L-glycrol-3-phosphate. Le groupement phosphate peut tre li dautres
composs (X).

Glycrophospholipide Radical X

Acide phosphatidique - H (charge nette de -1 pH 7)

Phosphatidylthanolamine thanolamine - CH2 - CH2 - NH3+ (charg positivement)

Phosphatidylcholine choline - CH2 - CH2 - N+(CH3)3 (charg positivement)

Phosphatidylsrine srine - CH2 - CH(NH3)+- COO- (neutre)

Phosphatidylinositol myo-inositol
OH
O OH
1
OH HO OH
2
Si un phosphate se fixe en position 4 et 5 du myo-inositol
on obtient du myo-inositol 4,5-bisphosphate. Le radical X est
alors charg ngativement (phosphates).

Phosphatidylglycrol glycrol - CH2 - CHOH - CH2 - OH (neutre)

79
Il existe une grande varit de glycrophospholipides :

Radical R1 Radical R2

Le plus souvent satur Le plus souvent insatur (=)

Exemples : Exemples

14:0 acide myristique 16:1 cis-D9 acide palmitolique


16:0 acide palmitique 18:1 cis-D9 acide olique
18:0 acide starique 18:2 cis-cis-D9,12 acide linolique
20:0 acide arachidique 20:4 cis-cis-cis-cis-D5,8,11,14 acide arachidonique
... ...

Phosphatidyl choline :

80
Certains phospholipides animaux ont un des deux acides gras li au glycrol par une liaison
ther. Cet acide gras peut tre satur ou bien contenir une double liaison entre C1 et C2 comme
dans les plasmalognes.

Phospholipide plasmalogne prsentant une insaturation

Les phospholipides plasmalognes sont abondants dans la membrane des cellules musculaires
et nerveuses (50% du phosphatidylcholine du cur). Les membranes des bactries halophiles,
des protistes cilis et de certains invertbrs contiennent de grandes proportions de lipides
possdant des liaisons ther. Leur fonctionnalit est inconnue; ils rsistent peut-tre mieux
certaines phospholipases. Le facteur d'activation des plaquettes (Platelet-activating factor,
PAF) est un phospholipide prsentant un alcane li via une liaison ther en C1, un acide
actique en C2 (liaison ester), et une choline en C3 (sur le phosphate). Le PAF sert de signal
molculaire. Il est produit par les basophiles (type de globule blanc). Il stimule l'agrgation
des plaquettes sanguines et la production de srotonine (vasoconstricteur) par celles-ci.

1
2
3

Facteur d'activation des plaquettes (PAF)

81
5.5.2.2. Les galactolipides et les sulfolipides.

Les galactolipides sont des lipides membranaires qui prdominent chez les plantes. Ils
possdent un ou deux rsidus galactose attachs par liaison glycosidique au C3 d'un 1,2-
diacylglycrol. Ils font partie du groupe des glycolipides.

CH2

CH

CH2

Monogalactosyldiacylglycrol (MGDG)

CH2

CH

CH2

Digalactosyldiacylglycrol (DGDG)

Les galactolipides sont localiss dans la membrane des thylakodes des chloroplastes. Ils
constituent 70 80% des lipides totaux d'une plante vasculaire. Ce sont donc des lipides
membranaires trs abondants dans la biosphre. Ces lipides membranaires sans phosphate
sont probablement avantageux dans les sols souvent limitants en phosphore.

Les membranes des plantes comportent galement des sulfolipides, dans lesquels un glucose
sulfat est attach un diacylglycrol par une liaison glycosidique. La tte du lipide porte
donc une charge ngative (comme pour les phospholipides).

82
-
O

O = S CH2

O CH

CH2

6-sulfo-6-deoxy-a-D-glucopyranosyldiacylglycrol (sulfolipide)

5.5.2.3. Les lipides archaebactriens.

De faon gnrale ces lipides contiennent des liaisons ther (et non des liaisons ester).
Certains lipides archaebactriens sont composs de longues chanes d'hydrocarbures (32
carbones) lies de chaque ct du glycrol (par des liaisons ther). Un lipide de type dialkyl
glycrol ttrather est alors form. Les liaisons ther sont plus stables l'hydrolyse lorsque le
pH est bas et la temprature est leve (certaines arches vivent bas pH et d'autres haute
temprature). A chaque extrmit, les rsidus glycrol fixent des sucres ou du phosphate ce
qui les rend hydrophiles. Lorsqu'ils forment une membrane ces lipides forment une
monocouche lipidique. Les chanes hydrocarbones sont souvent des polymres d'isoprne :
les chanes phytanyl. Le glycrol des lipides archaebactriens n'est pas le mme stroisomre
que celui des bactries et des eucaryotes; le carbone central est dans la configuration R chez
les arches et dans la configuration S chez les autres.

Dialkyl glycrol ttrather

Diphytanyl glycrol dither

83
5.5.2.4. Les sphingolipides.

Ces lipides possdent une tte polaire et deux queues hydrophobes mais contrairement aux
prcdents, ils ne contiennent pas de glycrol. Ils se forment partir de la sphingosine
(C18H37NO2), un alcool amin, sur laquelle vient se fixer un acide gras.

L'acide gras (18 26 carbones; satur ou mono insatur) se lie la sphingosine par une liaison
amide pour former un rsidu cramide.

Le rsidu cramide fixera par aprs une tte polaire pouvant tre de la phosphorylcholine, du
glucose, un di-, tri- ou tetrasaccharide, ou alors un oligosaccharide plus complexe.

La sphingomyline comporte de la phosphorylcholine comme tte hydrophile. C'est un


sphingolipide trs abondant chez les animaux suprieurs.

phosphorylcholine

84
La tte hydrophile peut galement tre de la phosphorylthanolamine :

La sphingomyline est trouve dans la membrane cellulaire des cellules animales,


particulirement dans la gaine de myline qui entoure les axones des cellules nerveuses.
Gnralement avec de la phosphorylcholine. Les sphingomylines n'ont pas de charge nette
(charge + sur l'azote et charge ngative sur le phosphate).

Il y a donc trois sous-classes de sphingolipides qui diffrent dans les ttes hydrophiles : les
sphingomylines, les glycolipides neutres et les gangliosides.

Les glycosphingolipides, que l'on retrouve principalement dans le feuillet externe des
membranes cytoplasmiques, possdent une tte hydrophile qui consiste en un sucre (ou des
sucres) fix directement sur le cramide; ils ne contiennent pas de phosphate. Ce sont les
crbrosides, qui ne comportent que un seul sucre (glucose dans les cellules non neuronales,
ou galactose dans les cellules neuronales).

Crbrosides et globosides :

Le cramide est coupl un ou plusieurs sucres neutres (liaison ther) :

Les crbrosides sont abondants dans les cellules du systme nerveux central, dans les
cellules du rein, du foie et de la rate. Le sucre est le plus souvent du glucose ou du galactose.

85
Les globosides sont des glycosphingolipides neutres comportant une tte hydrophile de deux
ou plusieurs sucres, habituellement le D-glucose, le D-galactose, ou le N-actyl-D-
galactosamine. Les crbrosides et les globosides sont parfois appels glycolipides neutres (ils
n'ont pas de charge pH 7).

Gangliosides :

Les gangliosides sont les sphingolipides les plus complexes. La tte polaire comporte un
oligosaccharide ainsi qu'un ou plusieurs rsidus acides N-actyl-neuraminique (Neu5Ac).

Neu5Ac

Les acides sialiques comme le Neu5Ac donnent une charge ngative au sphingolipide pH 7
ce qui les distingue des crbrosides et globosides.

Ganglioside GM1 (C73H131N3O31)

86
bDGalp(1-3) bDGalNAc[aNeu5Ac(2-3)] bDGalp(1-4) bDGlcp(1-1)Cer

Lorsque les sphingolipides ont t dcouverts leur rle biologique tait nigmatique (comme
le Sphinx, d'ou leur nom!). Chez l'homme environ 60 sphingolipides ont t isols et leur
fonction n'est pas toujours connue. Beaucoup sont prsents dans la membrane plasmique des
neurones et certains sont clairement des sites de reconnaissance de la surface cellulaire. Ce
sont donc des lments de la transduction du signal (communication vers lintrieur de la
cellule). Les sucres de certains sphingolipides dfinissent les groupes sanguins humains et
sont des motifs antigniques importants en immunologie (reconnaissance intercellulaire).

87
5.5.2.5. Les strodes ou strols.

Les strols sont des lipides de structure prsents dans les membranes de la plupart des cellules
eucaryotes. Ces molcules possdent un noyau cyclopentanophnanthrnique hydrophobe,
compos de 4 cycles fusionns. Ce noyau est quasi plan et est relativement rigide.

Le noyau cyclopentanophnanthrnique

Numrotation des carbones

Le strol majeur des tissus animaux est le cholestrol. Il s'agit d'une molcule amphipathique
possdant une tte polaire (groupement hydroxyle sur le C3) et un corps hydrophobe. Il peut
reprsenter jusque 50% des lipides membranaires.

Le cholestrol (C27H46O) :

Le cholestrol possde 8 carbones asymtriques. Il y a donc 28 = 256 stroisomres possibles


(carbones n3, 8, 9, 10, 13, 14, 17 et 20).

88
Des strols semblables au cholestrol sont trouvs chez les plantes (stigmastrol) et les Fungi
(ergostrol). La plupart des bactries ne savent pas synthtiser de strols9. Les bactries qui
ont des strols dans leur membrane semblent les incorporer depuis l'environnement.

Ergostrol (C28H44O) :

L'ergostrol est synthtis par des levures (Fungi unicellulaires) partir de sucres ou de
drivs de l'ergot (Fungi pluricellulaire parasite du seigle). C'est un composant des
membranes des cellules de Fungi, remplissant la mme fonction que le cholestrol chez les
cellules animales. La prsence de l'ergostrol dans les membranes des cellules de Fungi
couple son absence dans les membranes des cellules animales en fait une cible pour des
fongicides.

Le stigmastrol

Les strols de tous les eucaryotes sont synthtiss partir de sous-units d'isoprne, tout
comme les vitamines liposolubles, les quinones et les dolichols.

Le cholestrol possde une grande importance fonctionnelle car c'est un prcurseur de


nombreuses hormones et vitamines chez les invertbrs et les vertbrs :

- Vitamine D (calcifrol)
- Ecdysone
- Hormones de la corticosurrnale (cortisol, cortisone, aldostrone)
- Hormones strodes sexuelles (progestrone, strognes,
testostrone)

Voir plus loin, les drivs des lipides.

9
La Proteobactrie Methylococcus capsulatus, ainsi que le planctomycete Gemmata
obscuriglobus sont capables de produire des strols. Pearson et al. 2003. PNAS 100:15352
15357.

89
5.5.2.6. Formation des bicouches lipidiques.

Les lipides de structure membranaires s'associent pour former des bicouches lipidiques. La
membrane des cellules animales et vgtales, ainsi que celle des bactries, est une bicouche
lipidique.

EAU

EAU

Des acides gras saturs et insaturs sont prsents dans les bicouches lipidiques. En fonction de
leurs proportions respectives les bicouches seront plus ou moins fluides.

Les bicouches lipidiques peuvent se replier sur elles-mmes pour former des vsicules
(liposomes ou micelles).

90
5.5.2.7. Proportion des divers lipides membranaires.

Il y a de grandes variations selon les cellules et les espces considres. Par exemple, voici la
composition de la membrane des hmaties chez 4 espces de Mammifres.

PC PC
S PC S S S
PC
PE C
PE
C C C PE
PE
Rat Porc Boeuf Mouton

PC : phosphatidylcholine PE : phosphatidyltanolamine
S : sphingomyline C : cholestrol

5.6. Les drivs des lipides

5.6.1. Les drivs des acides gras

Les drivs de lacide arachidonique sont les ecosanodes (grec ecos, 20) comportant 20
atomes de carbone. Ils se subdivisent en leucotrines et en prostanodes. Les prostanodes
comportent les prostaglandines, les thromboxanes et les prostacyclines.

Acide arachidonique (C20H32O2) 20:4 cis-cis-cis-cis-D5,8,11,14

L'acide arachidonique est trouve dans les membranes cellulaires, surtout dans le
phosphatidylthanolamine, le phosphatidylcholine et phosphatidylinositol.

Les leucotrines :

Les leucotrines ont d'abord t trouvs dans les leucocytes; ils contiennent galement trois
doubles liaisons conjugues (d'ou le nom "leuko" et "trines"). Ce sont des signaux
biologiques puissants. Par exemple, le leucotrine D4, driv du leucotrine A4, induit la
contraction des muscles de la paroi des bronches. Une surproduction de ces leucotrines peut
donc provoquer une crise d'asthme. Ils sont galement responsables de la contraction des
muscles lisses des poumons qui a lieu durant un choc anaphylactique.

91
Les trois doubles liaisons des leucotrines sont gnralement les suivantes : D7-8, D9-10 et
D11-12.

Les prostaglandines :

Les prostaglandines (PG) comportent un cycle 5 atomes de carbone qui provient de la


chane de l'acide arachidonique. Ils ont t isols pour la premire fois partir de la prostate
(d'ou leur nom). A l'origine, deux groupes de prostaglandines ont t dfinis : les PGE
(prostaglandines solubles dans l'ther) et les PGF (solubles dans un tampon phosphate).

Ce sont des mdiateurs chimiques qui agissent sur divers tissus en rgulant la synthse de
cAMP intracellulaire. Certaines PG stimulent la contraction des muscles lisses de l'utrus,
d'autres affectent le flux sanguin de certains organes, ou le cycle veil-sommeil. Certaines PG
sont responsables de la fivre, de l'inflammation ou de la douleur.

Prostaglandine E1 (PGE1)

92
Les thromboxanes :

Les thromboxanes (TX) possdent un cycle 6 atomes et comportent un ther. Ils sont
produits par les plaquettes sanguines (les thrombocytes) et agissent dans la formation des
caillots et la rduction du flux sanguin. Les composs anti-inflammatoires non strodiens
comme l'aspirine, l'ibuprofne et le meclofenamate inhibent la synthse de prostaglandines
(inhibition de la prostaglandin synthase H2).

Thromboxane A2 Thromboxane B2

93
Les prostacyclines (PGI) :

Ce sont galement des drivs de l'acide arachidonique. La principale action des


prostacyclines est d'empcher l'agrgation des plaquettes. Elles ont galement une action
vasodilatatrice. La prostacycline a des effets opposs aux thromboxanes.

PGI2

5.6.2. Les drivs des strodes.

- Vitamine D (= calcifrol)
- Ecdysone
- Hormones de la corticosurrnale (cortisol, cortisone, aldostrone)
- Hormones strodes sexuelles (progestrone, strognes,
testostrone)
- Acides ou sels biliaires (acide cholique)

Vitamine D2 : Vitamine D3 :

94
Ecdysone :

Implique dans le
processus de la mue
des arthropodes et dans
le contrle de leur
reproduction.

Hormones de la corticosurrnale :

Cortisol Cortisone Aldostrone

Secrtes par le cortex des glandes surrnales (corticosurrnales).

95
Hormones strodes sexuelles :

strognes :

estradiol estriol estrone

Progestrone Testostrone

Acides ou sels biliaires (acide cholique) :

Strodes acides se trouvant principalement dans la bile des mammifres.

Acide cholique :

Chez lhomme, c'est l'acide taurocholique et l'acide glycocholique (drivs de l'acide


cholique) qui composent 80% de tous les acides biliaires. Ils sont produits dans le foie par
oxydation du cholestrol et conjugus avec de la taurine ou de la glycine. Les acides biliaires
sont stocks dans la vsicule biliaire. Ils ont pour fonction de faciliter la formation de micelles
(mulsification des graisses lors de la digestion).

Acide taurocholique

Taurine :
(driv de cystine)

96
5.7. Les terpnes

Les terpnes sont des hydrocarbures drivs de l'isoprne C5H8 et ont pour formule de base
des multiples de celle-ci, c'est--dire (C5H8)n.

Leur squelette de carbone est constitu d'units d'isoprne relies la queue-leu-leu. Ces
squelettes peuvent tre arrangs de faon linaire ou bien former des cycles.

Deux proprits fondamentales :

* Proprits odorifrantes chez les vgtaux. Ex : granium.


* Alternance de simples et doubles liaisons (liaisons conjugues)
interaction avec la lumire.

En fonction du nombre n (entier) d'units pentacarbons (C5) on distingue :

* n = 2 : les monoterpnes (C10). Ce sont les plus communs. Ils ont pour formule C10H16
et comptent de nombreux isomres. Ex : le graniol.
* n = 3 : les sesquiterpnes (C15). Ex : le farnesol.
* n = 4 : les diterpnes (C20). Ex : le phytol (cf. chlorophylle)
* n = 5 : les sesterpnes (C25).
* n = 6 : les triterpnes (C30). Ex : le squalne
* n = 8 : les ttraterpnes (C40). Ex : le b-carotne

* n = : caoutchouc naturel : les polyterpnes.

5.7.1. Les monoterpnes.

Ils comportent deux isoprnes. Formule de base (C5H8)2. Ce sont les lments principaux des
essences vgtales aromatiques appeles huiles essentielles. Par exemple : le camphre, le
graniol, le menthol, le limonne, le citral. On peut trouver des monoterpnes dans plus de
2000 plantes de soixante familles diffrentes.

97
Granyl pyrophosphate

En plus de ces formes linaires, l'isopropne peut s'arranger de manire former des cycles :
les plus communs ont un cycle six carbones. L'exemple classique est celui du limonne,
compos cyclique form partir du granyl-pyrophosphate.

odeur dorange
Menthol :

5.7.2. Les sesquiterpnes.

Ils comportent trois isoprnes. Formule de base (C5H8)3 = C15H24.

Le farnsol est trouv dans l'huile essentielle de citronelle. C'est un pesticide naturel, et une
phromone pour certains insectes.

Il existe des sesquiterpnes cycliques :

Humulne Cadinne
Sesquiterpne Sesquiterpne
monocyclique bicyclique

98
5.7.3. Les diterpnes.

Ils comportent quatre isoprnes. Formule de base (C5H8)4 = C20H32.

Ils drivent du granylgranyl pyrophosphate

Le cafestol : (C20H28O3)

Le kahweol (C20H26O3)

On les trouve dans les grains de caf (estrifi des acides gras).

Le rtinol (C20H30O) ou vitamine A est un diterpne.

Forme alcool

Rtinal : forme aldhyde


Rtinodes Acide rtinoque : forme acide
Rtinyl ester : forme ester

99
Lisomerisation du 11-cis-retinal en all-trans-retinal par la lumire qui induit un changement
conformationnel de lopsine et produit le phnomne de vision. L'opsine est une protine qui
comporte du rtinal. L'ensemble est appel rhodopsine.

11-cis retinal

all-trans retinal

Le phytol (C20H40O) est galement un diterpne. Chez les plantes, il est estrifi la
chlorophylle.

La chlorophylle :

Noyau tetrapyrrole

Ion Mg(II)
au centre

Liaison ester

Chane phytol

Htrocycle pyrrole

100
5.7.4. Les triterpnes.

Ils comportent six isoprnes. Formule de base (C5H8)6 = C30H48.

Le squalne

Le squalne est un hydrocarbure retrouv dans lhuile de foie de requin (il serait synthtis
pour reduire leur densit; en effet, la densit du squalne est de 0,855). On le retrouve aussi
dans certaines plantes (les olives). Beaucoup dorganismes suprieurs en produisent. Le
squalne est en fait un prcurseur de tous les strodes : par cyclisation il se forme du
lanostrol, prcurseur du cholestrol.

cyclisation

101
5.7.5. Les ttraterpnes.

Ils comportent huit isoprnes. Formule de base (C40H64)8.

anneau b anneau b
b-carotne (C40H56)

Le b-carotne est un pigment rouge-orange, abondant dans les plantes et les fruits (carottes).
Ce pigment est important pour la photosynthse. C'est galement un prcurseur de la vitamine
A (dimre de la vitamine A). Les pigments apparents sont appels pigments carotnodes.

L'astaxanthine (C40H52O4) :

Il s'agit d'un pigment rouge, prsent chez les crustacs (crabes, crevettes, homard, crevisses,
langoustes), le saumon, la daurade rose et dans les plumes de certains oiseaux.

102
5.8. Les protines ou polypeptides.

Les polypeptides ont une grande importance car environ 50% de la masse sche de la plupart
des cellules est compose de polypeptides. Les polypeptides ont plusieurs fonctions :

(1) Fonction enzymatique : les enzymes sont des protines qui acclrent slectivement la
vitesse de certaines ractions chimiques; les enzymes agissent donc comme catalyseurs;
(2) Les protines soutiennent les tissus; elles ont donc un rle structural (par exemple le
collagne);
(3) Les protines transportent des substances (par exemple l'hmoglobine transporte l'O2);
(4) Les protines participent la communication intercellulaire;
(5) Les protines participent la production dnergie cellulaire;

D'autres fonctions sont galement possibles. Chaque animal possde des dizaines de milliers
de protines diffrentes, chaque protine ayant une structure et une fonction spcifique.

Les polypeptides sont des polymres dacides amins.

Les acides amins sont galement appels aminoacides (aa). La formule gnrale dun
aminoacide est la suivante :

radical R ( pour chaque aa)

Groupement amine Groupement carboxyle Forme pH 7.0

Carbone a : asymtrique

5.8.1. Les 20 aminoacides.

Aminoacides aliphatiques :

5 aminoacides chane hydrocarbone


2 aminoacides hydroxyls
2 aminoacides soufrs
2 aminoacides dicarboxyliques et leurs 2 amides correspondants
2 aminoacides basiques

103
Aminoacides cycliques :

2 aminoacides aromatiques
3 aminoacides htrocycliques

Aminoacides chane hydrocarbone, non polaires (5)10

1. Glycine (Gly ou G)
Glycocolle ou acide a-amino-actique.

R = H (la glycine nest donc pas chirale).

Nom dans un peptide : glycyl.

Trs rpandue dans les protines, particulirement dans la glatine (25% des aa), le collagne
(35% des aa) et la fibrone (protine du ver soie dont 40% des aa sont de la glycine). La
glycine entre galement dans la composition des acides biliaires et participe aux processus de
dtoxication au niveau du foie (limination de lacide benzoque par conjugaison avec la
glycine : formation d'acide hippurique).

2. Alanine (Ala ou A)
Acide a-amino-propionique.

R = CH3

Nom dans un peptide : alanyl.

Il s'agit d'un aminoacide trs rpandu. Il existe galement la b-alanine : le groupe amine est
alors en position b (cet aminoacide nest pas utilise dans la biosynthse des protines).

a
b-alanine

3. Valine (Val ou V)
Acide a-amino-isovalrique

R = (CH3)2 CH

Nom dans un peptide : valyl.

10
Tous les aminoacides sont reprsents ici pH 7.0.

104
4. Leucine (Leu ou L)
Acide a-amino-isocaproque

R = (CH3)2 CH CH2

Nom dans un peptide : leucyl.

5. Lisoleucine (Ile ou I)
Acide a-amino-b-mthyl-valrique

R = (CH3)2 CH CH2

Nom dans un peptide : isoleucyl.

Leu : C6H13NO2
Ile : C6H13NO2

Leu et Ile sont des isomres de structure

Aminoacides hydroxyls (2)

Ces acides amins sont polaires (avec un R non charg).

6. Srine (Ser ou S)
Acide a-amino-b-hydroxy-propionique

R = CH2 OH

Nom dans un peptide : seryl.

Lhydroxyle peut tre estrifi


par lacide phosphorique; on obtient
alors la phosphosrine, caractristique
des phosphoprotines (ex: vitelline
du jaune doeuf)

105
7. La thronine (Thr ou T)
Acide a-amino-b-hydroxy-butyrique

R = CH3 CH OH

Nom dans un peptide : threonyl.

Aminoacides soufrs (2)

8. Cystine (Cys ou C)
Acide a-amino-b-mercapto-propionique

R = CH2 SH

Nom dans un peptide : cysteinyl.

Cet acide amin est polaire (avec un R non charg).

La cystine est proche de la srine (SH vs. OH). Dans les protines, deux cystines peuvent
former un pont disulfure :

106
9. Mthionine (Met ou M)
Acide a-amino-g-mthyl-mercapto-butyrique

R = CH3 (CH2)2 S

Nom dans un peptide : methionyl.

Cet acide amin est non polaire.

La mthionine est aussi un donneur de groupement mthyle


dans diverses ractions biosynthtiques.

Aminoacides dicarboxyliques et leurs amides (4)

Ils ont deux fonctions acides

10. Acide aspartique (Asp ou D) ou aspartate


Acide a-amino-succinique

R = COO CH2

Nom dans un peptide : aspartyl.

Cet acide amin possde un R charg ngativement ( pH 7).

11. Asparagine (Asn ou N)

R = CONH2 CH2

Nom dans un peptide : asparaginyl.

Cet acide amin est polaire (R non charg).

Grande concentration dans les asperges!

12. Acide glutamique (Glu ou E) ou glutamate


Acide a-amino-glutarique

R = COO (CH2)2

Nom dans un peptide : glutamyl.

Cet acide amin possde un R charg ngativement ( pH 7).

107
13. Glutamine (Gln ou Q)

R = CONH2 (CH2)2

Nom dans un peptide : glutaminyl.

Cet acide amin est polaire


(R non charg).

Aminoacides basiques (2) : possdent un groupement NH2+ ou NH3+ supplmentaire. Leur


groupe R est donc charg positivement pH 7.

14. Lysine (Lys ou K)


Acide a-e-diamino-caproque

R = NH3+ (CH2)4 e

Nom dans un peptide : lysyl.

Certaines protines contiennent


de lhydroxylysine (un hydroxyle en d) a

15. Larginine (Arg ou R)


Acide a-amino-d-guanidino-valrique
Groupement guanidique
R = NH2 C(NH2) NH (CH2)3

Nom dans un peptide : arginyl.

108
L'arginine est trs abondante dans les protines basiques des noyaux cellulaires (histones et
protamines).

Une charge positive est


porte par le groupement
guanidique pH 7.

Il y a dlocalisation
de la charge positive
et de la double liaison.

Aminoacides aromatiques (2)

16. La phnylalanine (Phe ou F)


Acide a-amino-b-phnyl-propionique

R = C6H5 CH2

Nom dans un peptide : phenylalanyl.

Rem : tous les H ne sont


pas reprsents.

17. Tyrosine (Tyr ou Y)


Acide a-amino-b-parahydroxyphnyl-propionique

R = C6H4 CH2 OH

Nom dans un peptide : tyrosinyl.

Rem : tous les H ne sont


pas reprsents.

109
Aminoacides htrocycliques (3)

18. Histidine (His ou H)


Acide a-amino-b-imidazole-propionique Groupement imidazole
pH > 6.02
R = C3H3N2 CH2

Nom dans un peptide : histidyl.

Le groupement R de l'histidine
est non charg si le pH > 6.02
A pH < 6.02 un atome de H+
supplmentaire se fixe sur l'azote
portant le doublet libre (confrant une
charge + globale l'imidazole).

L'histidine est trs rpandue dans les globines.


19. Tryptophane (Trp ou W)
Acide a-amino-b-indole-propionique

R = C8H6N CH2

Nom dans un peptide : tryptyl.

Rem : tous les H ne sont


pas reprsents.

20. La proline (Pro ou P)


Acide pyrolidine-2-carboxilique

R = (CH2)3

Nom dans un peptide : prolyl.

Lhydroxyproline est un driv hydroxyl de la proline (13% des aa dans le collagne).

110
Hydroxyproline

5.8.2. Les aminoacides et l'alimentation humaine.

Certains aminoacides ne peuvent tre synthtiss par l'organisme et doivent donc tre trouvs
dans la nourriture. Ce sont les acides amins essentiels.

aa essentiels aa non essentiels

Leucine Alanine
Isoleucine Asparagine
Lysine Aspartate
Mthionine Cystine (*)
Phnylalanine Glutamate
Thronine Glutamine
Tryptophane Glycine
Valine Proline
Srine
Tyrosine (*)
Arginine (*)
Histidine (*)

(*) sauf chez enfants (car les voies de synthse ne sont compltement dveloppes).

5.8.3. Les aminoacides rares.

La slnocystine (Sec ou U)
Comme la cystine, mais avec du slnium (Se).

Cet acide amin est trouv dans certaines enzymes :

- glutathione peroxidases
- tetraiodothyronine 5' deiodinases
- thioredoxin reductases
- formate dehydrogenases
- glycine reductases
- certaines hydrogenases

111
Rem : La slnocystine correspond au codon UGA ( stop ), dans certaines conditions (voir
plus loin).

La pyrrolysine (Pyl ou O)

Cet acide amin est rouv chez les Arches mthanognes11.

Rem : Correspond au codon UAG ( stop ), dans certaines conditions (voir plus loin).

5.8.4. Les aminoacides modifis au sein de la protine.

Certains acides amins sont parfois modifis une fois qu'ils ont t incorpors dans un
polypeptide. Par exemple :

- Carboxylation du glutamate
- Hydroxylation de la proline
- Formation de lhypusine partir de la lysine. L'hypusine est trouve chez les arches et les
eucaryotes, mais pas chez les bactries.

5.8.5. Les aminoacides non associs des protines.

Tous les acides amins ne sont pas utiliss pour fabriquer des protines. C'est le cas par
exemple pour :

- La lanthionine
- L'acide 2-amino-isobutyrique
- La dehydroalanine
- L'acide g-aminobutyrique, ou GABA (un neurotransmetteur)

5.8.6. Principales proprits physiques des aminoacides.

1. Isomrie optique

Tous les acides amins ont un carbone a asymtrique (sauf la glycine).


Il y a donc (au moins) deux isomres optiques (nantiomres).

11
Hao et al. 2002. Science 296:1492-1466.

112
L-alanine D-alanine
S-alanine R-alanine
(sinistrum) (rectum)

Les acides amins constitutifs des protines sont tous de la srie L.

Exceptions :

- Paroi des bactries


- Certains peptides antibiotiques
2. Absorption dans lultra-violet

Absorption importante aux longueurs d'onde infrieures 230 nm (UVc).


Certains absorbent entre 250 et 300 nm (UVb et c) cause du radical phnyle (Tyr) ou du
noyau indole (Trp)

Le dosage spectrophotomtrique des acides amins est donc possible.

3. Ionisation

Le groupement carboxyle et lamine sont ionisables. Les acides amins sont des amphotres :

113
5.8.7. La liaison peptidique.

Les acides amins s'associent pour former des protines. Les liaisons entre les acides amins
s'appellent les liens peptidiques.

Lorsque plusieurs acides amins s'associent un polypeptide est form. Un petit polypeptide de
quelques acides amins est appel un oligopeptide. Dans les conditions physico-chimiques
habituelles de la biosphre les liens peptidiques ne se forment pas spontanment car c'est la
raction dhydrolyse qui est favorise. Ils ne se forment que dans le cytoplasme des cellules
(grce aux ribosomes).

Exemple d'oligopeptide : le pentapeptide seryl-glutamyl-arginyl-histidyl-tyrosine :

Remarque : la liaison peptidique avec une proline induit une courbure dans le polypeptide :

114
La liaison peptidique est rigide et plane :

5.8.8. Les polypeptides et leur squenage.

Les polypeptides ont une direction :

La plupart des polypeptides ont entre 50 et 2000 acides amins.

Lenchanement des acides amins est la structure primaire des protines. Chaque protine
possde une squence caractristique dacides amins. Cette squence est dtermine par les
gnes (lADN) comme nous le verrons plus loin.

115
Frederick Sanger (1918 - ) est un biochimiste anglais, deux fois prix Nobel, qui fut le premier
avoir dtermin la squence dun polypeptide : linsuline, en 1955) (son premier prix Nobel
lui fut dcern en 1958). L'insuline est une hormone polypeptidique produite par le pancras.
Pour la premire fois il fut dmontr quune protine possde une squence prcise
daminoacides.

chane A : 21 aa
chane B : 30 aa

La dtermination de la squence des acides amins de l'insuline a t ralise par la mthode


des dinitrophnyl-aminoacides. Cette mthode porte dsormais le nom de "mthode de
Sanger". Cette mthode est la suivante. Le groupement NH3+ libre dun polypeptide ragit
avec du dinitrofluorobenzne. On obtient ainsi un dinitrophnyl-polypeptide (DNP-
polypeptide) :

116
Le DNP-polypeptide est ensuite hydrolys compltement avec de l'HCl (6M; 110C; 24h) et
le DNP-aminoacide terminal est spar par chromatographie sur papier.

H
O2 N N
H
NO2
Sparation du DNP-aminoacide terminal

En combinant la mthode des DNP-aminoacides avec lemploi denzymes protolytiques


(capables de scinder les polypeptides des endroits spcifiques) Sanger coupa linsuline en de
multiples fragments, puis dtermina la squence complte de linsuline par la mthode du
chevauchement :

Le squenage d'un polypeptide est galement possible par la mthode de la dgradation


rcurrente dEdman (1950). Cette mthode ne ncessite plus de cliver le peptide au
pralable. Cette mthode utilise du phenylisothiocyanate (PIT) qui se fixera l'extrmit N-
terminale du polypeptide pH 8.0 :

117
On passe ensuite en conditions acide et on chauffe. Un seul acide amin, celui de lextrmit
N-terminale, se dtachera en laissant les autres liaisons peptidiques intactes. C'est ce que l'on
appelle une dgradation rcurrente, qui est efficace pour les 30 premiers acides amins. Le
phnylthiohydantoine (PTH) gnr est spar et identifi par chromatographie.

Actuellement le squenage des protines se fait par spectromtrie de masse en tandem


(MS/MS). On appelle galement cela le squenage de novo. Dans cette mthode de courtes
squences sont obtenues (1020 acides amins). Pour cela la protine est d'abord clive en
fragments avec un enzyme (la trypsine). Les peptides obtenus sont ensuite spars les uns des
autres en fonction de leur taille et/ou proprits physico-chimiques. Pour cela la
chromatographie est utilise (voir cours de chimie analytique). Chaque peptide est ensuite
envoy dans un spectromtre de masse pour qu'il soit analys. Cette analyse comporte une
fragmentation en divers sous-fragments. La fragmentation se fait par collision avec des
atomes d'hlium ou d'argon, ou des molcules d'azote (N2). Les sous-fragments portent
gnralement une charge (+ ou ) et ont une certaine masse. Le spectromtre de masse spare

118
ensuite tous les sous-fragments les uns des autres en fonction de leur rapport masse/charge.
Tous ces fragments arriveront jusqu' un dtecteur o ils produiront un certain signal en
fonction de leur abondance. Un peptide d'une squence donne produira donc un "pattern de
pics" dans un graphique intensit vs rapport masse/charge. Ce pattern de pics est
caractristique du peptide introduit dans le spectromtre de masse. Il suffit de changer un seul
acide amin dans un peptide pour que le pattern soit diffrent. Les ordinateurs coupls aux
spectromtres de masse possdent une base de donne contenant des milliers de patterns
correspondant chacun une squence. Il suffit de comparer le pattern de pics obtenu avec les
patterns de la base de donne pour identifier la squence du peptide. Un logiciel informatique
reconstruit ensuite la protine de dpart en employant la mthode du chevauchement.

La spectromtrie de masse en tandem porte ce nom car elle consiste slectionner un ion par
une premire spectromtrie de masse (MS), le fragmenter, puis effectuer une deuxime
spectromtrie de masse (MS) sur les fragments ainsi gnrs. On va donc parler de la mthode
MS/MS.

119
5.8.9. La structure tridimensionnelle des protines

Les polypeptides se replient spontanment sur eux-mmes pour former des structures
tridimensionnelles dont la forme finale dpendra de la squence. Un polypeptide non repli
sur lui-mme est gnralement inactif.

Il y a 4 niveaux dorganisation structurale des protines :

- la structure primaire
- la structure secondaire
- la structure tertiaire
- la structure quaternaire

La structure primaire d'un polypeptide est simplement la squence des aminoacides. Si nous
considrons le lysozyme (protine prsente dans les larmes et la salive) nous constatons qu'il
comporte 130 aminoacides. Si les aminoacides du lysozyme s'associaient au hasard il y aurait
20130 polypeptides possibles (pour chacune des 130 positions il y a 20 aminoacides possibles).
Cependant, lordre des aminoacides de chaque polypeptide est prcis et dtermin de manire
gntique (voir plus loin). Actuellement, on connait la squence d'environ 875 000
polypeptides et ce chiffre augmente sans cesse.

Le lysozyme

120
La structure secondaire d'un polypeptide est la forme que prend la chane des acides amins
dans l'espace. On constate ainsi que certains segments d'une chane polypeptidique sont
enrouls ou plis de faon rptitive; ils forment ainsi des motifs qui contribuent la
conformation globale de la protine. Ces motifs sont de deux types : les hlices a et les
feuillets plisss b. L'hlice a est un enroulement dlicat maintenu en place par des liaisons H
intra-chanes, tous les 4 aminoacides. Les groupes R des acides amins sont vers l'extrieur.

La plupart des hlices a ont une longueur infrieure 40 . Les aminoacides loigns lun de
lautre de 3 4 positions sont en fait cte cte dans une hlice a (ou l'un sur l'autre). Le
pas de lhlice est de 5,4 (3,7 rsidus pour faire un tour). Les plans des liaisons peptidiques
forment des angles de 80. Les hlices a des protines sont des hlices droites (horlogiques).

Le contenu dune protine en hlices a est trs variable. Dans la myoglobine et l'hmoglobine
il y a beaucoup dhlices a . La chymotrypsine ne contient pas dhlices a . Certaines
protines ont des hlices a trs longues, jusque 1000 . Ces longues hlices a peuvent
sassocier et former une super hlice (ex : kratine des cheveux, myosine des muscles).

Les feuillets plisss b sont des structures stabilises par des liens hydrognes entre les groupes
NH et C=O de diffrentes chanes polypeptidiques. Les feuillets b peuvent se replier pour
former des cylindres. Ce sont les barils b.

121
122
La structure tertiaire d'un polypeptide est le reploiement tridimensionnel de la protine. La
structure tertiaire une importance capitale pour lactivit biologique des protines. Suite au
reploiement, des aminoacides trs loigns dans la structure primaire peuvent se trouver trs
proches lun de lautre.

123
Diffrents types dinteractions contribuent au maintien de la forme tridimensionnelle :

Interactions faibles : - Liaison H


- Interactions de Van der Waals
- Liaisons ioniques
Liaisons covalentes : - Ponts disulfures

Forces de Van
der Waals
CH2 CH
O CH3 CH3
H CH3 CH3
Liaisons H CH
O

CH2
CH2
S
NH3+
-
S
O
CH2
CH2

Pont disulfure
Liaison ionique

La structure quaternaire est l'association de plusieurs chanes polypeptidiques, en utilisant les


mmes types de liaisons que dans la structure tertiaire. Les sous-units peptidiques peuvent
tre identiques ou diffrentes. Par exemple, lhmoglobine possde 4 sous-units (2 chanes
a et 2 chanes b).

124
La conformation 3D est le propre dune protine native. Lorsque cette conformation est
bouleverse on dit que la protine est dnature. Divers agents chimiques ou physiques
peuvent dnaturer une protine, sans rompre les liens peptidiques :

- Chaleur (ex : coagulation albumine du blanc duf)


- Rayons UV et radiations ionisantes
- Variations de pH
- Dtergents
- Solvants organiques
- Solutions dure ou de guanidine
- Simple dilution ou agitation

La dnaturation est rversible ou irrversible (blanc duf).

Comme pour la structure primaire, la conformation 3D des protines est dtermine par la
squence des aminoacides. Par exemple, la ribonuclase est une enzyme de 124 aminoacides.
La conformation 3D de cet enzyme est maintenue par 4 ponts disulfures. Si un agent
rducteur est ajout une solution de ribonuclase les 4 ponts disulfure seront coups, et
lactivit de l'enzyme deviendra nulle. Cependant, ds que l'agent rducteur est enlev les 4
ponts disulfures se reforment de la mme manire et lenzyme est nouveau active.

Les chaperonines sont des complexes de protines facilitant le reploiement 3D des protines.
Ces complexes sont souvent produits par les cellules en rponse des variations de
temprature. Beaucoup de protines nont pas besoin des chaperonines et adoptent une
conformation 3D par elles-mmes. Certaines protines ne savent pas se replier sans
chaperonine. Par exemple, chez les bactries, le complexe Hsp60 (complexe GroEL/GroES)
est une chaperonine.

La substitution dun seul aminoacide par un autre peut modifier compltement la structure 3D
de la protine et donc son activit. Par exemple, lanmie hmaties falciformes est une
maladie dans laquelle une hmoglobine anormale se forme dans les hmaties suite au
remplacement d'un acide amin par un autre :

Hmoglobine normale : Val-His-Leu-Thr-Pro-Glu-Glu- (chane b). Ne cristallise pas.

Hmoglobine anormale : Val-His-Leu-Thr-Pro-Val-Glu- (chane b). Un aminoacide diffrent


en position n6. Cristallise et forme des fibres : dformation des hmaties.

La cristallographie par dispersion de rayons X permet de dterminer la structure 3D des


protines. Un cristal d'une protine est bombard avec des rayons X. Un pattern de points
(rflexions) est obtenu pour un angle donn. Les diffrents patterns sont enregistrs sur 180,
et sur au moins 2 axes. La reconstruction 3D est ensuite effectue en employant les
transformations de Fourier.

125
5.8.10. Classification des protines.

A. Classification des protines en fonction de la forme.

Protines fibreuses = sclroprotines

Constitues de fibres ou fibrilles. Pratiquement insolubles. Fibrone (soie), les collagnes


(tissus conjonctifs, cartilages, tendons), les kratines (dans la peau et les phanres)

Protines globulaires = sphroprotines

Forme sphrique ou ovode. Gnralement solubles. Ex : albumines, globulines, etc...

B. Classification des protines en fonction de la solubilit.

Les albumines. Solubles dans leau distille. Caractre acide.

Les globulines. Insolubles dans leau distille mais solubles dans des solutions faiblement
salines (p.ex. NaCl 5%). Ce sont souvent des glycoprotines et des lipoprotines.

Les protamines et les histones. Petites protines solubles. Caractre basique (forte proportion
de lysine et arginine). Peuvent se combiner divers composs acides (ADN, protines acides)

Les globines. Teneur leve en histidine (jusque 10%). Dans lhmoglobine.

Les prolamines et glutlines. Protines vgtales, insolubles dans leau mais solubles dans les
acides et les bases dilues.

Les sclroprotines. Insolubles dans leau et dans les solutions salines, acides ou alcalines
dilues.

Les protines fibrillaires solubles. Constituent les fibrilles des cellules musculaires et le
cytosquelette des cellules. Ex : lactine : protine globulaire qui polymrise en longs filaments
de 2 m de long.

126
C. Classification des protines en fonction de la composition.

Les holoprotines. Ne sont constitues que daminoacides.

Les htroprotines :

- Une ou plusieurs chanes polypeptidique


- Un ou plusieurs groupement prosthtique
li de manire covalente au polypeptide.

Phosphoprotines
Glycoprotines
Chromoprotines
Lipoprotines
Nucloprotines

Phosphoprotines

Comportent de lacide phosphorique estrifiant les fonctions alcool de la srine et de la


thronine.

Exemples :

Les casines du lait


La vitelline, la vitellnine, la phosvitine du jaune duf.

Glycoprotines

Polypeptide + groupement glucidique (= glycane)

Les monosaccharides des plus courants sont :

oses neutres : D-galactose, D-mannose, L-fucose, L-rhamnose


osamines (sous forme N-actyle) : D-glucoamine,
D-galactosamine, acide D-muramique
acides uroniques : acide D-glucuronique, acide L-iduronique
acides sialiques : acide N-actylneuraminique, acide
N-glycolyl-neuraminique.

Les glycanes peuvent tre linaires : les n-glycanes


Glycosaminoglycanes (GAGs) = mucopolysaccharides
Les glycanes peuvent tre ramifis : les isoglycanes

127
Exemple de glycoprotine avec n-glycane (glycosaminoglycanes : GAGs) :

polypeptide
Mucines sous-maxillaires

NeuAc + GalNAc chez le mouton : 800 units


disaccharidiques
disaccharide

Exemple disoglycane

La transferrine : polypeptide de 679 aminoacides, trouv dans le plasma sanguin (transport du


fer).

Importance des glycoprotines

- Substance fondamentale du tissu conjonctif


- Nombreuses hormones : gonoadotrophines hypophysaires
(LH, FSH), thyroglobuline, etc...
- Membranes cellulaires. Ex : les antignes spcifiques des
groupes sanguins ABO
- Liquides biologiques (salive, urine, bile, lait, larmes, sang)

128
Chromoprotines

Protines colores dont le groupement prosthtique


contient souvent un lment mtallique (Fe, Cu, Mg)

groupement prosthtique structure ttrapyrrolique Anneau porphyrine

- hmoglobines (pigment respiratoire; Fe)


- cytochromes (transporteurs dlectrons; Fe)
- enzymes hminiques (catalases et peroxidases; Fe)
- chloroplastines (gr. prosth. : chlorophylle; Mg)
- phycobilines (pigments algues)

groupement prosthtique structure non ttrapyrrolique

- Hmocyanine (pigment respiratoire bleu, mollusques et crustacs; Cu). Dans lhmocyanine


ce sont des rsidus histidine qui complexent le Cu :
- Flavoprotines (transporteur dlectrons)
- Mtalloprotines :
* Ferritine (Fe)
* Hmocuprine (Cu) His

129
5.9. Les acides nucliques

Les acides nucliques sont des polymres de nuclotides. Ce sont des polynuclotides. On les
retrouve dans toutes les cellules vivantes ainsi que les virus, libres ou associs des protines.
Ils sont le support de linformation gntique ou les agents permettant lexpression de cette
information.

5.9.1. Les nuclotides

Certains nuclotides n'ont pas de rle gntique et jouent un rle dans le stockage de lnergie
(ATP) ou en tant que coenzymes (NAD+, FAD, ...).

Chaque nuclotide peut tre hydrolys en 3 constituants :

une base htrocyclique azote


nuclotide un pentose
un acide phosphorique

5.9.1.1. Les deux types de pentose.

Selon le type de pentose on distingue 2 types dacides nucliques :

Les acides dsoxyribonucliques (ADN ou DNA) : le pentose est du 2-dsoxy-b-D-


ribofuranose.

Ces acides nucliques sont les constituants des chromosomes (situs dans le cytoplasme des
bactries et dans le noyau des cellules eucaryotes). On les retrouve galement dans certains
organites (mitochondrie, chloroplaste) et dans les virus.

Les acides ribonucliques (ARN ou RNA) : le pentose est du b-D-ribofuranose.

Ces acides nucliques sont trouvs dans le cytoplasme des bactries, dans le noyau et le
cytoplasme des eucaryotes, dans certains organites (mitochondrie, chloroplaste) et dans les
virus.

130
5.9.1.2. Les bases htrocycliques azotes.

Il existe deux types de bases azotes dans les nuclotides :

Les bases puriques ou purines substitues. L'lment de dpart est la purine :

(C5H4N4)

Les bases pyrimidiques ou pyrimidines substitues. L'lment de dpart est la pyrimidine :

pyrimidine
(C4H4N2)

En fonction des groupements ports par les carbones 2 et 6 de la purine on obtient les deux
principales bases puriques de lADN et lARN :

6-amino-purine 2-amino-6-oxy-purine
Adnine (A) Guanine (G)
(C5H5N5) (C5H5N5O)

131
En fonction des groupements ports par les carbones 2, 4 et 5 de la pyrimidine on obtient les
trois principales bases pyrimidiques :

2-oxy-4-amino- 2,4-dioxy- 2,4-dioxy-5-mthyle


pyrimidine pyrimidine pyrimidine
Cytosine (C) Uracile (U) Thymine (T)
(C4H5N3O) (C4H4N2O2) (C5H6N2O2)

L'ADN ne comporte que deux bases pyrimidiques : la cytosine (C) et la thymine (T). L'ARN
ne comporte galement que deux bases pyrimidiques. Cependant il s'agit ici de la cytosine (C)
et de l'uracile (U). L'uracile dans l'ARN est donc l'quivalent de la thymine dans l'ADN.

5.9.1.3. Les bases htrocycliques azotes mineures.

Il existe une cinquantaine de bases azotes mineures (ou rares) rencontres en faibles
proportions et dans certaines conditions.

Exemples de bases puriques mineures :

L'hypoxanthine est obtenue par dsamination de la guanine. Cette base azote, de formule
brute C5H4N4O, est prsente en trs petites quantits dans les acides nucliques. On peut en
retrouver dans les anticodons des tRNA (voir plus loin). La 1-mthyl-guanine peut tre
trouve dans diffrents acides ribonucliques.

Hypoxanthine 1-mthyl-guanine

132
Exemples de bases pyrimidiques mineures :

5-mthyl-cytosine 5-hydroxymthyl-cytosine

5.9.1.4. Le tautomrisme des bases

Les tautomres sont des isomres de composs organiques qui s'interconvertissent par
une raction chimique appele tautomrisation. Il est commun que cette raction ne concerne
que trois atomes de la molcule et rsulte (1) en une migration d'un atome d'hydrogne, et (2)
une migration d'une double liaison. Le tautomrisme est un cas spcial d'isomrisme de
structure et peut jouer un rle important dans l'appariement des bases dans les acides
nucliques. En solution, un quilibre chimique s'tablit entre les tautomres. Les rapports
entre les formes dpendent de divers facteurs comme la temprature, le solvant et le pH.
Les quatre bases de l'ADN peuvent exister dans au moins deux formes tautomres
comme montr ci-dessous. L'adnine et la cytosine peuvent exister sous forme amino ou
imino, et la guanine, la thymine, et l'uracile peuvent exister sous forme lactame (keto) ou
lactime (nol). Bien qu'il existe un quilibre entre les tautomres les formes amino et lactame
sont plus stables et prdominent en conditions physiologiques. Les cycles restent insaturs et
plans dans chaque tautomre.

133
5.9.2. Les nuclosides.

Un nucloside est compos d'une base azote relie un pentose (ribose ou dsoxyribose) par
une liaison covalente (raction de condensation). La liaison implique le carbone 1' du pentose,
l'azote n9 des bases puriques et l'azote n1 des bases pyrimidiques. Pour ne pas confondre les
atomes de la base et ceux du sucre les atomes du sucre portent la numrotation 1' 5'.

Adnosine ou Dsoxycytidine ou
Adnine ribonucloside Cytosine dsoxyribonucloside

Nomenclature des principaux nuclosides :

Base Ribonucloside Dsoxyribonucloside

Adnine Adnosine Dsoxyadnosine


Guanine Guanosine Dsoxyguanosine
Uracile Uridine Dsoxyuridine
Cytosine Cytidine Dsoxycytidine
Thymine Thymine ribonucloside Dsoxythymidine
ou ribothymidine (rare)

Les nuclosides monophosphates :

Un nuclotide est un nucloside reli au moins un groupement phosphate (raction de


condensation). Les nuclotides sont des esters phosphoriques des nuclosides. Il y a les
ribonuclotides (sucre = ribose) et les dsoxyribonuclotides (sucre = dsoxyribose). Le
groupement phosphate peut se lier l'un des trois groupements OH du ribonucloside (2, 3,
et 5) et l'un des deux groupements OH du dsoxyribonucloside (3 et 5) :

134
Dsoxycytidine5monophosphate (dCMP)

Adnosine 5-monophosphate (AMP)

Il faut remarquer que les groupements OH du phosphate peuvent perdre leur hydrogne pH
physiologique. Les groupements phosphate pourront alors porter une ou deux charges
ngatives.

135
Adnosine 3-monophosphate

Adnosine 3, 5 monophosphate cyclique (cAMP)

Le cAMP est un nuclotide important dans divers processus cellulaires car il agit comme
messager secondaire. Le cAMP est produit partir dATP par lenzyme adnylate cyclase. Il
existe aussi du cGMP.

Nomenclature des principaux nuclosides-5'-monophosphates :

Base Ribonucloside 5-monophosphate


Adnine Adnosine 5-monophosphate = AMP
Guanine Guanosine 5-monophosphate = GMP
Uracile Uridine 5-monophosphate = UMP
Cytosine Cytidine 5-monophosphate = CMP
Thymine Thymine ribonucloside 5-monophosphate (rare)

136
Base Dsoxyribonucloside 5-monophosphate
Adnine Dsoxyadnosine 5-monophosphate = dAMP
Guanine Dsoxyguanosine 5-monophosphate = dGMP
Uracile Dsoxyuridine 5-monophosphate = dUMP
Cytosine Dsoxycytidine 5-monophosphate = dCMP
Thymine Dsoxythymidine 5-monophosphate = dTMP

Les nuclosides di- et tri-phosphates :

Adnosine 5-diphosphate (ADP) Adnosine 5-triphosphate (ATP)

Dsoxyadnosine 5-triphosphate (dATP)

Guanosine 5-triphosphate (GTP)

137
5.9.3. La structure primaire des acides nucliques.

C'est le biochimiste russe Phoebus Levene (1869-1940) qui a pour la premire fois caractris
les diffrentes formes d'acides nucliques (ADN et ARN). Il trouva que lADN comportait de
l'adnine, de la guanine, de la thymine, de la cytosine, du dsoxyribose, et du phosphate. Le
ribose a t dcouvert en 1909 et le dsoxyribose en 1929. Levene dcouvre qu'il y a des
units phosphate-sucre-base (les nuclotides) et suggre que l'ADN est un polymre de
nuclotides. Cependant, Levene ne pense pas que lADN soit le support de linformation
gntique. Il pense plutt que ce sont les protines qui lentourent (il s'est bien entendu
tromp comme nous le verrons plus loin). En 1910 il forme lhypothse des
ttranuclotides selon laquelle les quantits de A, T, C, G sont gales dans lADN (ce qui
est galement faux).

Dans lADN et lARN les nuclotides sont relis entre eux par des liaisons 3-5
phosphodiester. Ce sont donc des polymres de nuclotides. Lordre des bases (la squence) a
une grande importance. C'est la structure primaire. Cest dans la squence des bases de la
structure primaire que rside linformation gntique.

Exemple de structure primaire : ATTGCTTAAGTACGTACGAAAATTTAGAGATGCCCA.

C'est Erwin Chargaff (1905-2002), un biochimiste autrichien, qui dcouvre deux rgles (les
rgles de Chargaff) qui allaient lencontre de lhypothse des ttranuclotides :

1) La quantit de G la quantit de C; et la quantit de A la quantit de T. Par exemple,


dans l'ADN humain : A=30.9% et T=29.4%; G=19.9% et C=19.8%.

2) La composition de lADN varie dune espce lautre. L'ADN est donc un bon candidat
pour tre le support de linformation gntique car toutes les espces sont diffrentes les unes
des autres.

La cellule utilise des nuclosides triphosphate pour synthtiser son ADN. Cependant, dans
l'ADN les sucres ne sont relis entre eux que par une seul phosphate :

138
Exemple du ttraribonuclotide 5'-GTCA-3

139
L'ADN et l'ARN comportent donc une chane de pentoses-phosphates et les bases azotes ne
sont jamais directement relies entre-elles :

Les chanes de nuclotides possdent deux extrmits diffrentes : une extrmit 3'OH et
une extrmit 5'phosphate. Ces chanes possdent donc un sens.

5.9.4. La structure secondaire des acides nucliques.

Les analyses d'ADN de Chargaff montrent qu'il y a autant dadnine (A) que de thymine (T).
De mme, il y a autant de guanine (G) que de cytosine (C).

Cependant, le rapport (A+T) / (G+C) varie beaucoup dune espce lautre.

Le biochimiste anglais William Astbury (18981961) fut le premier tudier la structure de


lADN avec des rayons X. En 1937, il vit que lADN produisait un pattern de diffraction.
L'ADN est donc fait de structures rptes (il trouve 2,7 nm). Il remarque aussi que cest le
mme espacement que pour les aminoacides dans une protine. Les anglais Rosalind Franklin
(19201958) et Maurice Wilkins (19162004) poursuivirent les tudes de diffraction des R.X.
au dbut des annes 1950. Ces travaux suggrrent une structure hlicodale pour l'ADN. Sur
base de ces rsultats, une structure secondaire fut propose pour lADN en 1953 par James D.
Watson (1928- ) et Francis Crick (19162004). Pour cette dcouverte, ces deux chercheurs
amricains reurent le Prix Nobel en 1962 avec Maurice Wilkins (Rosalind Franklin tant
dcde entre-temps). La molcule dADN est faite de deux chanes
polydsoxyribonuclotidiques (deux chanes de pentoses-phosphates) enroules l'une autour
de l'autre pour former une double hlice. LADN est donc double brin. Les bases de chaque
chane de pentoses-phosphates se font face et sont localises entre les deux chanes.

140
Les atomes des bases azotes forment des plans parallles les uns aux autres, spars de 3,4
, et perpendiculaires laxe de la double hlice. Il y a 10 plans par tour d'hlice. Le pas de
l'hlice est donc de 34 . Chaque plan est form de deux bases : une appartenant la chane
n1, lautre la chane n2. Ces bases sont lies entre-elles par des liaisons hydrogne. Dans
ces liaisons hydrogne, chaque base est la fois donneuse (fonction amine) et receveuse
(doublet lectronique libre d'un atome d'azote ou d'un atome d'oxygne).

Nous voyons que A et T sont des bases complmentaires, capables de former deux liaisons
hydrogne entre-elles :

141
Nous voyons galement que G et C sont des bases complmentaires, capables de former trois
liaisons hydrogne entre-elles :

Lorsque les bases sont sous une autre forme tautomrique la complmentarit est affecte. Par
exemple, l'adnine sous sa forme imino n'a plus de site accepteur (le N n1 possde un
hydrogne). Lorsque l'adnine se trouve dans l'ADN la base sous sa forme amino est
stabilise.

La complmentarit entre bases peut se reprsenter de la faon suivante :

La complmentarit des bases explique donc les rapports G/C =1 et A/T = 1 observs par
Chargaff. Les deux chanes de l'ADN sont toujours antiparallles : chaque extrmit de la
double-hlice comporte un 3'OH et un 5'phosphate :

La squence des bases dune des chanes dtermine automatiquement la squence des bases
de lautre chane. Les deux chanes sont donc complmentaires (et non pas identiques).

142
Reprsentation schmatique der deux brins d'ADN

La configuration bicatnaire hlicodale est une caractristique gnrale des ADN et le


modle de Watson-Crick-Wilkins est valable pour les virus, les bactries, les vgtaux et les
animaux. La structure de lADN est universelle.

L'ARN ne forme pas de structure secondaire homologue l'ADN car cette macromolcule est
gnralement simple brin et les chanes de ribonuclotides sont souvent beaucoup plus
courtes. L'ARN peut cependant adopter une conformation en double hlice dans les zones
double brin de certaines molcules (et chez les virus ARN).
Il existe plusieurs sortes dARN :

- ARN ribosomial (rRNA)


- ARN messager (mRNA)
- ARN de transfert (tRNA)
- petits ARN (pRNA) et micro ARN (miRNA)

Voici par exemple la squence complte de l'ARN ribosomial 5S de la bactrie Escherichia


coli K12 :

UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAA
GUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGG
GAACUGCCAGGCAU

143
Ce rRNA 5S est localis dans les ribosomes des bactries. Il se replie sur lui-mme et adopte
une conformation tridimensionelle avec des zones simple-brin et des zones double-brin
complmentaires :

La squence du rRNA 5S est diffrente dans chaque espce de bactrie. Certaines zones sont
cependant bien conserves entre les espces. Dans le schma ci-dessus, les pyrimidines (C, U)
sont reprsentes par la lettre Y et les purines (G, A) par la lettre R (voir plus haut le code des
nuclotides).

L'acide ribonuclique messager (ARN messager, ARNm ou mRNA), simple brin, est une
copie transitoire d'une portion de l'ADN correspondant un ou plusieurs gnes. L'ARNm est
utilis comme intermdiaire par les cellules pour la synthse des protines. Le processus de
formation de l'ARNm est la transcription.

L'acide ribonuclique de transfert (ARN de transfert, ARNt ou tRNA), simple brin, est un
court ARN long de 70 100 nuclotides, qui intervient lors de la synthse des protines dans
la cellule. L'ARNt est un intermdiaire cl dans la traduction du message gntique et dans la
lecture du code gntique. Ils apportent les acides amins au ribosome.

144
Les petits ARN (pRNA) et les micro ARN (miRNA) sont des petits fragments d'ARN qui ont
diverses fonctions dans la cellule. Par exemple, les particules ribonucloprotiques ou snRNP
( snurp en anglais) qui sont trouves dans le noyau des cellules.

145
C
Fe
ede
1santiliante
4atome
liante
Gln-Leu
dans
ne
Gln-Leu-
Asn
se
71 O
H
COO
=
on
2-
condensati
2s*
Gln-Asn s
orbitales
2-amino-
A
B

hybrides
antiliantes
2-deoxy-
sp3
mannose

Rfrences

Nelson DL & Cox MM (2004) Lehninger Principles of Biochemistry, fourth edition. WH


Freeman and Company, New York, 1119 pp.

Berg JM (2006) Biochemistry, sixth edition. WH Freeman, New York.

Alberts B et al. (2007) Molecular biology of the cell, fifth edition. Garland Science, New
York, 1728 pp.

146

Vous aimerez peut-être aussi