Overexpression, Solubilizing, Refolding and Purification of Interferon α 2-Thymosin α 1
Fusion Protein in E.coli
Abstract:
AIM: Interferon α2b (IFNα2b) and
thymosin α1 (Tα1) exhibit synergic effects
in the treatment of hepatitis B and hepatitis
C when used together. For developing a
fusion protein drug, fusion proteins of
IFNα2b and Tα1 linked by different lengths
of (G4S)n (n = 1-3) were constructed and
expressed in Pichia pastoris.
METHODS: Using PCR and molecular
clone techniques, the fusion genes of
IFN 2b-(G4S)n-T 1 (n = 1-3) were
constructed and subcloned into the
eukaryotic expression vector pPIC9. After
transformation of these plasmids into P.
pastoris, the expressed fusion proteins
IFN 2b-(G4S) n-T 1 (n = 1-3) were
obtained. These proteins were purified
through diethylaminoethyl (DEAE) affinity
chromatography and Superdex™ 75 gel
filtration and analyzed by SDSPAGE and
Western blot. Antiviral and E-rosette assays
were used to investigate the bioactivities of
these fusion proteins.
RESULTS: DNA sequencing confirmed
that the fusion genes of IFN 2b-(G4S)n-
T 1 (n = 1-3) were correctly cloned to the
pPIC9 vector. The recombinant IFN 2b-
(G4S)n-T 1 (n = 1-3) fusion proteins
expressed in
P. pastoris were purified with DEAE and
Superdex™ 75 gel filtration
chromatography. The fusion proteins could
be observed on sodium dodecylsulfate-
polyacrylamide gel electrophoresis with
molecular weight (MW) of 23.2, 22.9, and
22.6 ku, respectively, and reacted to the
IFN 2b monoclonal antibody and T 1
polyclonal antibody. The purified fusion
proteins exhibit antiviral activity and can
enhance the percentage of E-rosette-
forming-cell in E-rosette assay.
CONCLUSION: The recombinant
IFN 2b-(G4S)n-Tα1 (n = 1-3) fusion
proteins were successfully expressed in P.
pastoris. Purified fusion proteins exhibit
both antiviral activity of IFNα2b and
immunomodulatory activity of T 1 in vitro.
These results will be the basis for further
evaluation of the fusion proteins’ function in
vivo. Where I is IFN-alpha2b; T is TM-
alpha1; and L is a peptide linker. IFN-
alpha2b is fused to TM-alpha1 either
directly or through a peptide linker. In
preferred aspects, IFN-alpha2b and TM-
alpha1 are linked together via a linker to
produce a single protein Which retains the Kontsekova, 1997). Type I interferons
biological activity of IFN-alpha2b and TM- consist of Interferons alpha, beta and omega
alpha1. This invention also relates to while type II interferons consist of interferon
pharmaceutical compositions containing the gamma (Biron and Sen, 2001). Interferon
fusion molecules. The fusion proteins of the alpha 2 (IFN- 2) is a commonly used FDA
present invention may be characteriZed by approved protein and has become world’s
possessing both biological properties of leading therapeutic protein. Due to
IFN-alpha2b and TM-alpha1 or they may be prevalence of hepatitis infections and
further characterized by possessing carcinomas in developing countries its
advantageous antiviral, antiproliferative and demand is increasing very rapidly. In
immunomodulatory properties above their Pakistan, Hepatitis B and C virus are mostly
parental peptides combined. Such fusion linked to liver carcinomas. Therefore, there
proteins have the characteristics of being is great need for the availability of cheaper
unique to viral, neoplastic and and more effective recombinant human IFN-
immunodeciency diseases and are useful for  2 protein.
therapeutic purposes. Thymosin-α1 (Tα1) is a thymic
peptide that plays an important function in
Introduction: the maturation, differentiation and function
Interferons belong to a group of of lymphocytes (Billich, 2002). It can act on
cytokines which perform various biological both mature T cells and lymphoid cells to
functions such as antiviral activity, produce cytokines, induce cytokine
suppression of tumor cells proliferation and receptors, and stimulate the cytotoxic T
modulation of immune response. The lymphocytes mediated cytotoxic responses
attachment of interferons to specific (Romani et al., 2004; Garaci et al., 2012).
receptors on cell surface results in The expression of MHC class I is enhanced
stimulation of different signaling pathways in both lymphoid and non-lymphoid tissues
in the cell. (Nadeene and Andrew, 2004; by Tα1 (Kageshita et al., 1999). This up
Murashima et al., 2000; Romerio & Zella, regulation of expression of MHC class I
2002). There are two types of human explains the anti-tumor effect of Tα1
interferons on the basis of type of receptors (Shrivastava et al., 2004). It also modulates
through which they signal. (Kontsek and the expression of other cytokines such as IL-
2, IL-3, IL-6, IL-12, IL-15, IFN-α and IFN-γ
(Goldstein, 2009).
Both IFN-α 2 and Tα1 are widely
used proteins in the treatment of hepatitis B
and C (Molloy, et al., 1996; Arase et al.,
2003). A series of clinical trails show that,
when compared with standard therapeutic
regimens, combination therapy of IFNα and
Tα1 could significantly enhance antiviral
and biochemical response rates in patients
with hepatitis B and C, and is well tolerated
(Saruc., et al., 2002; Saruc et al., 2003).
Combination of Tα1 with IFN-α is
becoming one of the most promising options
in improving the response rate of chronic
hepatitis B virus and hepatitis C virus
infection and decreasing its probability of
developing into hepatocellular carcinoma.
Combination therapy of Tα1 with
pegylated interferon α 2 (peg-IFN-α2)
reduces the viral replication sufficiently in
patients who had difficulties in treating their
hepatitis C with an advantage of having not
too much side effects (Rustgi, 2004). As
many patients are non-responsive to
standard ribavarin and peg-IFN therapy
(Fried et al., 2002), a combinational therapy
including Tα1, ribavarin and peg-IFN-α2
has been devised which is safe (Camerini et
al., 2007). It is an effective therapy for those
patients who are non-responsive to
conventional therapies (Poo et al., 2008).
The goal of this study is to produce
pharmaceutically important interferon-α 2-
thymosin-α1 fusion protein for using as
substitute of interferon-α 2 and Tα1 used
separately in combination therapy to
decrease the cost and increase the
effectiveness therapy. The use of Tα1 as a
fusion partner with interferon therapy will
possibly stimulate the cells of immune
system, including NK, CD4, and CD8 cells
and will trigger dendritic cells (DC)
maturation through TLR activation (Romani
et al., 2004; Romani et al., 2006) as
impaired DC maturation is an issue in many
types of cancer (Wang et al., 2008; Kim et
al., 2009; Kirkwood et al., 2008) and
accumulation of immature DCs is also
considered to be a hallmark of tumor
patients (Nefedova et al., 2004). Tα1 will
stimulate a Th1-type immune response
(Peng et al., 2008; Yao et al., 2007; Loggi,
2008) as Th1-type response has therapeutic
value in treating tumors. It will also leads to
an increase in specific anti-tumor cytotoxic
T-cells (Rasi et al., 1998). It will increase
expression of proteins that mediate antigen
presentation, including major
histocompatibility (MHC) Class I, MHC
Class II, and beta-2 microglobulin (Liu et subsequent reverse transcription and
al., 2002). polymerase chain reaction (RT-PCR). For
This study involves construction of amplification of interferon alpha 2, gene-
interferon α 2-thymosin α 1 fusion gene and specific forward and reverse primers
a genetically stable expression system designed using online Oligonucleotide
leading to high level expression of Properties Calculator/Primer 3.0 computer
interferon-α2-thymosin-α1 fusion protein in software programs, will be used.
E.coli, its purification and refolding in Construction of Human Interferon Alpha
2-Thymosin alpha 1 (IFN α 2-Tα 1)
bioactive form, characterization and study of
Fusion Gene
its biological activity. This study also Amplified interferon alpha 2 gene
includes the targeted delivery of and Thymosin alpha 1 gene will be fused
pharmaceutically important recombinant together by polymerase chain reaction using
fusion protein as a result of which safety and a set of primers given below. INFα 2-Tα1
tolerability of therapeutic protein in non will be a recombinant fusion gene composed
target tissues will be improved. The antiviral of INFα 2 gene fused with Tα1 gene at its 3'
and anti-cancer efficacy will be increased by end with oligonucleotide encoding a linker
triggering localized immune response and peptide (Gly-Gly-Gly- Gly-Ser) inserted
side effects of systemic administration will between them.
be reduced. Th-F 5’-
CAAACTTGCAAGAAAGTTTACGTAGTAAAG
AAGGTGGAGGCGGAAGCGAC-3’
Materials and Methods
INF-R 5’-
Isolation and RT-PCR Amplification of
Gene Encoding Interferon alpha 2 GTCGCTTCCGCCTCCACCTTCTTTACT
Total RNA will be isolated from the ACGTAAACTTTCTTGCAAGTTTG-3’
human peripheral blood mononuclear cells Th-R 5’-
isolated from heparinized or citrate blood by CCGCGTCTCCGGTGGTTCTCGGCCTC
density gradient centrifugation over CTCCACC-3’
Histopaque (Sigma Aldrich, USA). Total IT-F1
RNA thereafter will be extracted from the 5’CCATGGGATGTGATCTGCCTCAA 3’
harvested cells by TriZol reagent (Rio et al., IT-R1
2010) and be used as template for 5’GGATCCTAGTTCTCGGCCTCCTC 3’
IT-F2 5’
CCATGGGATGTGATCTGCCTCAA3’
IT-R2 5’
CTCGAGGTTCTCGGCCTCCTC3’
Cloning and high level expression of
human IFN α 2-Tα1 Fusion Protein
IFN α 2-Tα 1 fusion gene will be
cloned and expressed in E. coli expression
systems separately. IFN α 2-Tα 1 will be
ligated in pTZ57R/T vector by TA cloning
method using TA cloning kit (Thermo).
After that, E.coli cells will be transformed
with pTZ57-IFN α 2-Tα 1 recombinant
vectors by using standard protocol
(Sambrook and Russel, 2001).
screening of white recombinant colonies
will be done by colony PCR to confirm the
presence of IFN α 2-Tα 1 gene sequences.
Plasmid DNA will be isolated
recombinant clones by using the standard
procedure (Sambrook and Russel, 2001) and
restriction analysis and Plasmid PCR of
recombinant cloning vectors pTZ57-IFN α
2-Tα 1 will be performed to check for the
presence of insert. The sequence analysis of
recombinant plasmids (pTZ57-IFN α 2-Tα
1) will also be performed.
Following cloning, both genes (IFN
α 2-Tα 1) will be sub-cloned in pET
expression plasmid according to
standard protocols (Sambrook and Russell,
2001) and recombinant vectors (pET57-IFN
α 2-Tα 1) will be proceed to transformation
and over expression in E. coli BL21 DE3
(Codon Plus) strain. The E. coli expression
systems will be optimized with respect to
cultivation media, inducer (IPTG, lactose)
concentration and time and duration of
induction in shake-flask cultures.
Purification, Refolding and
characterization of recombinant IFN α 2-
Tα 1 fusion protein
Different chromatographic
techniques such as nickel chromatography,
ion exchange chromatography will be used
The to purify and recover yield of fusion protein.
Before purification, recombinant Interferon
alpha 2–Thymosin α 1 fusion protein
expressed as inclusion bodies will be
from separated by centrifugations and then
washed with detergents to remove the
membrane proteins and other contaminants.
Following washing steps, the recombinant
Interferon alpha 2–Thymosin α fusion
protein will be solubilized either by using
strong chaotropic agents or by a
combination of alkaline pH and mild
concentration of denaturant.
Purified recombinant proteins will be
analyzed by SDS-PAGE, western blotting,
the RP-HPLC and MALDI-TOF mass
spectrometry. CD spectrometeric analysis interferon alpha 2b and Interferon alpha 2–
will be used for analyzing the biologically Thymosin α fusion protein.
active conformation of recombinant

References Billich A. (2002). Thymosin alpha1.

Andreone, P., Cursaro, C., Gramenzi, A., SciClone Pharmaceuticals. Curr Opin

Margotti, M., Ferri, E., Talarico, S., et Investig Drugs, 3, 698-707

al. (2001). In vitro effect of thymosin- Biron, C.A., Nguyen, K.B., Pien, G.C.,

a1 and interferon-a on Th1 and Th2 Cousens, L.P. and Salazar-Mather,

cytokine synthesis in patients with T.P. (1999). Natural killer cells in

chronic hepatitis C. Journal of Viral antiviral defense: Function and

Hepatitis, 8,194-201 regulation by innate cytokines. Annu.

Arase, Y., Tsubota, A., Suzuki, Y., Suzuki, Rev. Immunol., 17, 189–220.

F., Kobayashi, M., Someya, T., Akuta, Biron, CA. and Sen, GC. 2001. Interferons and

N., Hosaka, T., Saitoh, S., Ikeda, K., other cytokines, p. 321-351. In D. M.

Kobayashi, M. and Kumada, H. (2003) Knipe, P. M. Howley, D. E. Griffin,

A pilot study of thymosin alpha1 M. Martin, B. Roizman, and S. E.

therapy for chronic hepatitis B Straus (ed.), Fields virology, 4th ed.

patients. Intern Med, 42, 941-946 Lippincott-Raven, Philadelphia, Pa.

Bach, E.A., Aguet, M. and Schreiber, R.D. Camerini, R., Ciancio, A., De Rosa, A., and

(1997). The IFN gamma receptor: a Rizzetto, M. (2007). Studies of therapy

paradigm for cytokine receptor with thymosin alpha 1 in combination

signaling. Annu. Rev. Immunol., 15, with pegylated interferon alpha2a and

563-591. ribavirin in no responder patients with

Bekisz, J., Baron S., Balinsky, C., Morrow, chronic hepatitis C. Ann NY Acad Sci.,

A. and Zoon. K.C. (2010). 1112, 368–74.

Antiproliferative Properties of Type I Coulstock, E., Sosabowski, J., Ovecka1, M.,

and Type II Interferon. Rob, P., Laura, G., Clare, M., Armin

Pharmaceuticals, 3, 994-1015 S., Marie, D., Julie. F., Jerome, B.,

Grainne, D., Adam, W. (2013). Liver-
Targeting of Interferon-Alpha with
 Tissue-Specific Domain Antibodies. Matteucci, C., et al. 2003. Thymosin
PLoS ONE, 8. alpha 1 in combination with cytokines
Dieperink, E., Ho, S.B., Thuras, P., and chemotherapy for the treatment of
Willenbring, M.L. (2003). A cancer. Int Immunopharmacol., 3,
prospective study of neuropsychiatric 1145–50.
symptoms associated with interferon- George, C.X. and Samuel, C.E. (1999). Human
alpha-2b and ribavirin therapy for RNA specific adenosine deaminase
patients with chronic hepatitis C. ADAR1 transcripts possess alternative
Psychosomatics, 44, 104–112. exon 1 structures that initiate from
Dusheiko, G. (1997) Side effects of alpha different promoters, one constitutively
interferon in chronic hepatitis C. active and the other interferon-
Hepatology, 26, 112–121. inducible. Proc. Natl. Acad. Sci., 96,
Fried, M.W., Shiftman, M.X., Reddy, K.R., 4621-4626.
Smith, C., Marinos, G., GoncalesJr, Heim, M.H. (1999). The Jak-STAT pathway:
F.L., et al. (2002). Peginterferon alfa- cytokine signalling from the receptor
2a plus ribavirin for chronic hepatitis to the nucleus. J. Receptor Signal
C vious infection. N Engl J Med., 347, Transduction Res., 19, 75-120.
975–982. Iorio, R, Pensati, P, Botta, S, Moschella, S,
Goldstein, A.L. (2009). From lab to bedside: Impagliazzo, N, et al. (1997). Side
emerging clinical applications of effects of alpha-interferon therapy and
thymosin alpha 1. Expert Opin Biol impact on health-related quality of life
Ther. 9,593–608. in children with chronic viral hepatitis.
Garaci, E., Pica, F., Serafino, A., Balestrieri, Pediatr Infect Dis J., 16, 984–990.
E., Matteucci, C., Moroni, G., Iyer, U. and Kadambi, V.J. (2011). Antibody
Sorrentino, R., Zonfrillo, M. and drug conjugates - Trojan horses in the
Sinibaldi-Vallebona, P. (2012). war on cancer. J Pharmacol Toxicol
Thymosin α1 and cancer: action on Methods, 64, 207–212.
immune effector and tumor target Kageshita, T., Hirai, S., Ono, T., Hicklin,
cells. Ann. N.Y. Acad. Sci., 1269, 1–9 D.J. and Ferrone, S. (1999). Down-
Garaci, E., Pica, F., Sinibaldi-Vallebona, P., regulation of HLA class I antigen-
Pierimarchi, P., Mastino, A., processing molecules in malignant
 melanoma: association with disease
progression. American Journal
Pathology, 154,745-754.
Kim, H.A., Ko, H.M. and Hu, H.W. (2009).
CpG-ODN-based immunotherapy is
effective in controlling the growth of
metastasized tumor cells. Cancer
Letters, 274, 160-164.
Kirkwood, J.M., Tarhini, A.A. and Panelli,
M.C. (2008). Next generation of
immunotherapy for melanoma.
Journal of Clinical Oncology, 26,
3445-3455.
Knutsen, A.P., Freeman, J.J., Mueller, K.R.,
et al. (1999). Thymosin α1 stimulates
maturation of CD 34+ stem cells into
CD3+4+ cells in an in vitro thymic
epithelia organ coculture model. Int J
Immunopharmacol., 21, 15-6
Kontsek, P. and Kontsekova, E. (1998).
Present views on interferons. Bratisl
Lek Listy, 99, 226-30.
Kouttab, N.M., Goldstein, A.L. and Lu, M.
et al. (1988). Production of human B
and T cell growth factors is enhanced
by thymic hormones.
Immunopharmacology, 16, 97–105.
Leichtling, K.D., S.A. Serrate & M.B.
Sztein. 1990. Thymosin alpha
modulates the expression of high
affinity interleukin-2 receptors on
normal human lymphocytes. Int.J.
of Immunopharmacol. 12: 19–29.
Liu, C., Patel, A. and Zhu, H. (2002). In
vitro studies to identify host genes or
pathways involved in immune-
mediated response to thymosin alpha 1
and peginterferon. Hepatology and
Gastroenterology, 12, 23-29.
Loggi, E., Gramenzi, A., Margotti,
M., Cursaro, C., Galli, S., Vitale,
G., Grandini, E., Scuteri, A., Vukotic,
R., Andreone, P. and Bernardi M.
(2008). In vitro effect of thymosin
alpha 1 and interferon alpha on Th1
and Th2 cytokine synthesis in patients
with HbEAg-negative chronic hepatitis
B. J Viral Hepat., 15, 442-8
Lopez, M., Carpano, S., Cavaliere, R., Di
Lauro L., Ameglio, F., Vitelli G., et al.
Biochemotherapy with thymosin α 1,
interleukin-2 and dacarbazine in
patients with metastatic melanoma:
clinical and immunological effects.
(1994). Ann Oncol, 5, 741–6.
Maio, M., Andrzej, M, Alessandro, T, Uwe,
T, Virginia, F, Jacek, J, Claus, G,
Thierry, L, Bernard, G, Pere, G,
Katalin, G, Roberto, C, and Francesco,
1 C. (2010). Large Randomized Study
of Thymosin α 1, Interferon Alfa, or
Both in Combination With
 Dacarbazine in Patients
Metastatic Melanoma. J Clin Oncol,
28, 1780-1787.
Mastino, A., Favalli, C. and Grelli, S.
(1992). Combination therapy with
thymosin alpha 1 potentiates the
antitumor activity of interleukin-2 with
cyclophosphamide in the treatment of
the Lewis Lung carcinoma in mice.
International Journal of Cancer, 50,
493-499.
Mogensen, K.E., Lewerenz, M., Reboul, J.,
Lutfalla, G. and Uze, G. (1999). The
type I interferon receptor: structure,
function, and evolution of a family
business. J. Interferon Cytokine Res.,
19, 1069-1098.
Molloy, P.J., Azzouz, M. and Van, T.
(1996). Treatment of chronic hepatitis
B and hepatitis C with interferon alfa-
2b. Am Fam Physician, 54, 1598-1605
Murashima, S., Kumashiro, R., Ide, T.,
Miyajima, .I, Hino, T., Koga, Y., Ishii,
K., Ueno, T., Sakisaka, S. and Sata, M.
(2000). Effect of interferon treatment
on serum 2, 5’-oligoadenylate
synthetase levels in hepatitis
infected patients. J. Med. Virol., 62,
185–190.
Nadeene, P. and Andrew, C.G.P. (2004).
Identification of a novel gene family
With that includes the interferon-inducible
human genes 6–16 and ISG12. BMC
Genomics, 5, 8-19.
Naylor, P.H., Quadrini, K., Garaci, E., Rasi,
G., Hadden, J.W. (2007).
Immunopharmacology of thymosin
alpha 1 and cytokine synergy. Ann NY
Acad Sci., 1112, 235–44.
Nefedova, Y., Huang, M. and Kusmartsev,
S. (2004). Hyperactivation of STAT3
Is Involved in Abnormal
Differentiation of Dendritic Cells in
Cancer. Journal of Immunology, 172,
464-474
Nowak, A.K., Lake, R.A., Marzo, A.L., et
al. (2003). Induction of tumor cell
apoptosis in vivo increases tumor
antigen cross-presentation, cross-
priming rather than cross-tolerizing
host tumor-specific CD8 T cells. J
Immunol, 170, 4905-4913.
Pardridge, W.M. (2010). Biopharmaceutical
drug targeting to the brain. J Drug
Targeting, 18, 157–167.
Peng, Y., Chen, Z., Yu, W., Zhou, Q., Xu,
L., Mao, F.F., et al. (2008). Effects of
C- thymic polypeptides on the
thymopoiesis of mouse embryonic
stem cells. Cell Biol Int. 32, 1265–71.
Pestka, S. (2007). Purification and cloning Romani, L., Bistoni, F., Gaziano, R., Bozza,
of interferon alpha. Curr. Top. S., Montagnoli, C., et al. (2004).
Microbiol. Immunol., 316, 23-37. Thymosin α1 activates dendritic cells
Poo, J.L., Sánchez, A, F., Kershenobich, D., for antifungal Th1 resistance through
García Samper, X., Torress-Ibarra, R., toll-like receptor signaling. Blood, 103,
Góngora, J., et al. (2008). Efficacy of 4232-9
triple therapy with thymalfasin, Romani, L., Bistoni, F., Montagnoli, C., et
peginterferon alpha-2a, and ribavirin al. (2007). Thymosin alpha1: An
for the treatment of hispanic chronic endogenous regulator of inflammation,
HCV nonresponders. Ann Hepatol., 7, immunity, and tolerance. Ann N Y
369–75. Acad Sci., 1112, 326-338.
Rasi, G., Silecchia, G. and Sinibaldi- Romerio F, Zella D. (2002). MEK and ERK
Vallebona, P. (1994). Anti-tumor inhibitors enhance the anti-
effect of combined treatment with proliferative effect of interferon-alpha
thymosin alpha 1 and interleukin-2 2 b. FASEB J, 16, 1680-1682
after 5-fluorouracil in liver metastases Rustgi, V. (2004). Combination therapy of
from colorectal cancer in rats. thymalfasin (thymosin-alpha 1) and
International Journal of Cancer, 57, peginterferon alfa-2a in patients with
701-705. chronic hepatitis C virus infection who
Roberts, R.M., Liu, L., Guo, Q., Leaman, D. and are non-responders to standard
Bixby, J. (1998). The evolution of the treatment. J Gastro enterol Hepatol.,
type I interferons. J. Interferon Res., 19, 76–80.
18, 805-816. Rustgi, V.K. (2005). Thymalfasin for the
Romani, L., Bistoni, F. and Perruccio, K. treatment of chronic hepatitis C
(2006). Thymosin alpha1 activates infection. Expert Rev Anti Infect Ther.,
dendritic cell tryptophan catabolism 3, 885–92.
and establishes a regulatory Sambrook, J. and Russel, DW. 2001.
environment for balance of Molecular cloning: a laboratory
inflammation and tolerance. Blood, manual. 3ed. New York; Cold Spring
108, 2265-2274. Harbor Laboratory Press, ISBN 0-
87969-577-3.
Samuel, C.E. (1993). The eIF-2α protein (1998). How cells respond to
kinases, regulators of translation in interferons. Annu. Rev. Biochem., 67,
eukaryotes from yeasts to humans. J. 227-264.
Biol. Chem., 268, 7603-7606. Sztein, M.B. & S.A. Serrate. (1989).
Samuel, C.E. (2001). Antiviral Actions of Characterization of the
Interferons. Clinical Microbiology immunoregulatory properties of
Reviews, 14, 4778-809. thymosin alpha 1 on interleukin-2
Saruc, M., Ozden, N., Turkel, N., Ayhan, S., production and interleukin-2 receptor
Hock, L.M., Tuzcuoglu, I. and expression in normal human
Yuceyar H. (2003). Long-term lymphocytes. Int. J.
outcomes of thymosin-alpha 1 and Immunopharmacol., 11, 789–800
interferon alpha-2b combination Tete, S., Pappalardo, S., Fioroni, M., Salini,
therapy in patients with hepatitis B e L., Imperatrice, A.M. and Perfetti,
antigen (HBeAg) negative chronic E.G. (1999). Bcl-2, p53, Ki-67 and
hepatitis B. J Pharm Sci., 92, 1386- apoptotic index in cancerous and
1395 precancerous lesions of the oral
Saruc, M., Yuceyar, H., Kucukmetin, N., leukoplakia with isotretinoin. Minerva
Demir, M.A. and Kandiloglu, A.R. Stomatol., 48, 411-8
(2002). Combination thymosin-alpha 1 Van Broekhoven, C.L., Parish, C.R.,
and interferon-alpha 2b in the Demangel, C., Britton, W.J and, Altin,
treatment of anti-HBe-positive chronic J.G. (2004). Targeting dendritic cells
hepatitis B in Turkey. with antigen-containing liposomes: a
Hepatogastroenterology,49, 798-802 highly effective procedure for
Shrivastava, P., Singh, S.M. & Singh. N. induction of antitumor immunity and
(2004). Effect of thymosin alpha 1 on for tumor immunotherapy. Cancer Res,
the antitumor activity of tumor– 64, 4357–4365.
associated macrophage-derived van der Most, R.G., Currie, A., Robinson,
dendritic cells. J. Biomed. Sci., 11, B.W., et al. (2006). Cranking the
623–630. immunologic engine with
Stark, G.R., Kerr, I.M., Williams, B.R., chemotherapy: Using context to drive
Silverman, R.H. and Schreiber, R.D. tumor antigen cross presentation
 towards useful antitumor immunity.
Cancer Res, 66, 601-604.
Wang, R.F., Miyahara, Y. and Wang, H.Y.
(2008). Toll-like receptors and
immune regulation: implications for
cancer therapy. Oncogene, 27, 181-
189.
Wu, A.M. and Senter, P.D. (2005). Arming
antibodies: prospects and challenges
for immunoconjugates. Nat
Biotechnol., 23, 1137–1146.
Yao, Q., Doan, L.X. and Zhang, R. (2007).
Thymosin alpha 1 modulated dendritic
cell differentiation and functional
maturation from peripheral blood
CD14+ monocytes. Immunology
Letters, 110, 110-120.
Yao, W., Zhu, Q., Yuan, Y., Qiao, M.,
Zhang, Y., and Zhai, Z. (2007).
Thymosin alpha 1 improves severe
acute pancreatitis in rats via regulation
of peripheral T cell number and
cytokine serum level. J Gastroen
Hepatol., 22, 1866–71.
Zhang, P., Chan, J., Dragoi, A.M., et al.
(2005). Activation of IKK by thymosin
α1 requires the TRAF6 signaling
pathway. EMBO Rep., 6, 531-7