Plant Science 162 (2002) 1007 /1018

www.elsevier.com/locate/plantsci

Cloning and characterisation of chs-specific DNA and cDNA

sequences from hop (Humulus lupulus L.)
J. Matoušek a,*, P. Novák a,b, J. Břı́za a, J. Patzak c, H. Niedermeierová a
a
Institute of Plant Molecular Biology AS CR, Branišovská 31, 37005 České Budĕjovice, Czech Republic
b
South Bohemian University, Biological Faculty, Branišovská 31, 37005 České Budějovice, Czech Republic
c
Hop Research Institute GmbH, Kadaňská 2525, 438 46 Žatec, Czech Republic

Received 16 November 2001; received in revised form 11 March 2002; accepted 12 March 2002

Abstract

A complete sequence of chalcone synthase (CHS) gene from hop was cloned. The gene designated chs _H1 consists of two exons
and one 187 bp intron. CHS protein predicted from chs_H1 cDNA has 42.5 kDa and retains conserved domains and residues
including 26 amino acids at positions identical to those identified by crystallography as characteristic for catalytic domains of alfalfa
CHS (EC 2.3.1.74). Cloned CHS_H1 protein shows specific CHS activity with 4-coumaroyl-CoA. Structure modelling revealed clear
differences between CHS_H1 and phlorisovalerophenone synthase, the only published CHS-like homologue from hop. Conserved
motifs like H, and G boxes characteristic for the light regulated and stress inducible genes were identified within promoter region of
chs _H1 gene. Highly specific expression of chs _H1 mRNA was detected by quantitative RT PCR in glandular trichomes during
cone maturation. Much lower, but significant levels of chs _H1 mRNA were detected at the stage of hop flowering in petioles
(100%), developed flowers (96%), and in stem apexes (78%), while the lowest levels of mRNA were found in the roots (31%) and leaf
blades (9%). Southern blot analyses predicted at least five additional chs -like genes related to chs _H1. A genomic arrangement
different from phlorisovalerophenone synthase sequences was found for these genes. RFLP analyses using DNA from 15 genotypes
revealed several distinct dendrogram clusters, suggesting specific re-arrangements of hop chs -like genes during evolution and/or
during the breeding and selection processes. # 2002 Elsevier Science Ireland Ltd. All rights reserved.

Keywords: Chalcone synthase; Phlorisovalerophenone synthase; Prenylated flavonoids; Plant genome; RFLP analysis

1. Introduction noid inducers and cancer chemopreventive phenylpro-

Chalcone synthase (CHS) is a polyketide synthase
with a specificity for the sequential condensation of one
p-coumaroyl-CoA and three malonyl-CoA molecules to
yield naringenin chalcone, the precursor for a large
number of flavonoids which are widely distributed in the
plant kingdom (for review see Martin [1]). Chalcone
sythase is a member of the CHS superfamily of
polyketide synthases (for review see Schröder [2]), where
as much as 150 CHS-related sequences have been cloned
[3]. CHS homologues play an essential role in the
biosynthesis of a wide spectrum of biologically active
compounds including antimicrobial phytoalexins, flavo-
* Corresponding author. Tel.:
/42-38-777-5529; fax:
/42-38-530-
0356.
E-mail address: jmat@umbr.cas.cz (J. Matoušek).
0168-9452/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved.
PII: S 0 1 6 8 - 9 4 5 2 ( 0 2 ) 0 0 0 5 0 - X
panoids (for review see Schröder [4]). The best
characterised CHS-related enzymes by molecular genetic
methods are stilbene synthases (STS) [5], acridone
synthase (ACS) [6], bibenzyl synthase (BBS) [7], 2-
pyrone synthase (2PS) [8], p-coumaroyltriacetic acid
synthase [9] and phlorisovalerophenone synthase (VPS)
[10,11].
VPS was recently isolated and cloned as the first CHS
homologue from hop Humulus lupulus cones. This
enzyme was proven to be involved in the first steps of
biosynthesis of hop bitter acids by formation of
aromatic intermediates which are then prenylated and
converted to lupulone/colupulone and humulone/cohu-
mulone isomers that play major role in the taste of beer
[10,11]. Bitter acids are synthesised during the develop-
ment of hop female inflorescences into cones and are
accumulated in peltate glandular trichomes forming
1008 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
lupulin [12,13]. Lupulin is known to contain many other
compounds, including complex spectrum of essential
oils and aromatic compounds that changes during cone
maturation [14]. Recently, prenylated flavonoids [15]
and in particular, prenylated chalcones were isolated
from hop extracts [16,17]. These compounds are in-
vestigated as potential antiproliferative and anti-cancer
drugs [18,19]. The presence of prenylflavonoids suggests
that hop cones also express an enzyme that is specifically
involved in flavonoid biosynthesis and is more closely
related to typical CHS (EC 2.3.1.74) than the VPS
identified so far. CHS activity has been demonstrated in
cone extracts by Zuurbier et al. [20], but no sequence
information was available. For the purpose of this work,
the CHS predicted for flavonoid biosynthes will be
called ‘true’ CHS in order to distinguish it from other
CHS-related enzymes.
Many plant species are found to contain small multi-
gene families of chs genes. For example, 12 chs
sequences have been reported in Petunia hybrida [21],
Southern blot analysis of the barley genome for chs
sequences suggested that there may be as many as seven
gene copies [22] and six genes are known in the morning
glory (Ipomoea purpurea ) genome [23]. Analysis of chs
multigene family as shown on the example of morning
glory genome suggests recurrent gene duplications and
subsequent adaptive differentiation among duplicated
chs copies. As a result of this evolution tissue and
developmental specificity of chs genes is observed [23].
Although functional differences among individual mem-
bers of chs multifamilies remain unknown, structure
analysis of CHS from alfalfa which was recently
performed by crystallography [3] could provide the
molecular basis for detailed comparative analysis of
polyketide synthases within CHS superfamily, as well as
within multifamilies of individual chs homologues.
In this study we aimed to fish for ‘true’ chs homo-
logue from H. lupulus valuable in relation to the
biotechnology of medicinal hops. We characterise a
complete gene chs _H1 encoding ‘true’ CHS type of
enzyme from hop, which shows highly specific expres-
sion in glandular trichomes. Furthermore, we describe
the existence of the polymorphism of chs -specific
sequences in the hop genome. Our sequential, structural
and genomic analyses suggest the presence of a multi-
family of chs -related genes in hops, which clearly differ
from the previously described chs homologue encoding
VPS.
2. Materials and methods
2.1. Plant material
Hop (H. lupulus) plants were maintained in breeding
hopgarden in the Hop Research Institute, Žatec. Sam-
ples were collected in June and July of 1999 /2001.
Czech semi-early red-bine hop Osvald’s clone 72 and the
following comprehensive hop cultivars Magnum, Yeo-
man, Southern Brewer, Northern Brewer, Wye Target,
Fuggle, Galena, Eroica, Taurus, Hersbrucker, Spalt and
Brewers Gold were analyzed in our experiments. In
addition, we used two newly established hybrid cultivars
having some genetic background from Osvald 72, cvs.
Premiant and Sládek. For some comparisons we col-
lected samples from field grown Humulus neomexicanus
species.
For some experiments we collected samples from in
vitro culture of hop mericlone Osvald’s 72 maintained
on MS medium as described previously [24]. In vitro
plants were supplied with illumination (16 h) (70 mmol
m 2 s 1 PAR). Day/night temperatures were 25/18 8C.
Preparation of peltate glands from hop cones was
performed similarly as described by Okada and Ito [11].
2.2. Isolation of genomic DNA and Southern blot
analysis
Genomic DNA from leaves was isolated as described
by Tai and Tanksley [25]. Southern analyses were
perfomed by using Qiabrane Nylon Plus membrane
(Qiagen, Hilden, Germany). Hybridisation was con-
ducted according to Church and Gilbert [26] at 65 8C
in 0.4 M phosphate buffer pH 7.2 containing 7% SDS,
1% bovine serum albumin, 1 mM EDTA pH 8.3 and
probe labelled with RedivueTM [a-32P]dCTP, 3000 Ci
mmol 1 random prime labelling kit RediprimeTM
(Amersham Pharmacia Biotech, Freiburg, Germany).
After overnight hybridisation washing at 65 8C 3 times
for 30 min with 100 mM phosphate buffer pH 7.2, 1%
SDS, 1 mM EDTA pH 8.3 was performed. If necessary,
the membranes were stripped by washing in 0.4 M
NaOH at 42 8C for 15 min and then in 0.1 / SSC, 0.1%
SDS, 0.2 M Tris HCl pH 7.5 at 42 8C for 30 min. Three
DNA probes were prepared in order to detect different
regions of the chs _H1 gene. Probe H1Ex1Ex2 covered
gene region from position 489 to position 1852 and was
prepared using primers CHS_H1Nde (5?AGGACA-
TATGGTTACCGTCGAGGAA3?) and CHS_H1Bam ¯
¯
(5?CTAGGATCCCACACTGTGAAGCAC3?) (base
changes to create Nde I and BamH 1 sites for the cloning
purposes are underlined). Probe H1Ex1 (positions 489/
893) was prepared using the primers CHS_H1Nde and
CHSJ5 (5?GCATGTAACGCTTTCTAATCATGG3?).
The third probe H1Ex2 covered exon 2 of chs_ H1
gene in positions 1154 /1824 and was prepared using the
combination of CHSJ3 (5?ATGATGTACCAA-
CAAGGTTG3?) and CHSJ4 (5?GTCTCAACAGTGA-
GTCCAGG3?) primers. The probe for analysis of
phlorisovalerophenone synthase (vps) was homologous
to the probe H1Ex2 and was amplified from genomic
DNA of clone Osvald’s 72 based on the sequence
 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
published in GeneBank (AC: AB047593). The following
primers were used for vps probe amplification: 5?vh1
(5?ATGCTGTATCAACTCGGCTG3?) and 3?vh1
(5?CAGAGGTGGCAGTCTGGGCC3?).
2.3. PCR amplifications, cloning and sequencing
For PCR amplification of the CHS-specific DNA
fragment H1 from the hop genome, we used primers
designated as ‘consensus primers’ CHSJ3 and CHSJ4
(see above). The coding region of chs _H1 was amplified
with primers CHSH1Nde and CHSH1Bam. This frag-
ment was cloned in pET15b for its expression in
Escherichia coli [BL21(DE3)]. The full length chs _H1
gene was amplified using CHSH1PROM (5?GATCA-
CGACCGTCCATTCT3?) and CHSH13?END (5?GA-
AATTGACCTTTA CTCCAAA3?) primers. Forward
primer CHSJ6 (5?GAGCACAAAACTGAGCTCAA-
GG3?) and reverse primer CHSJ5 (5?GCAT-
GTAACGCTTTCTAATCATGG3?) were used for the
analysis of intron length polymorphism in CHS genes. If
not stated otherwise, Pwo polymerase (Angewandte
Gentechnologie Systeme GmbH, Germany) was used
for PCR reactions. In a typical experiment we used the
following amplification conditions: 2 min at 94 8C,
35 / (30 s at 94 8C; 30 s at 52 8C, 60 s at 72 8C); 10
min at 72 8C.
In order to identify the chs _H1 promoter sequence,
inverse PCR reaction was performed using the primers
INV1 (5?GGTACTCACTCTGGAGGATGCA3?) and
INV2 (5?GGACGGTTTCGTTTTGTGG3?). For in-
verse PCR, genomic DNA was digested with Mbo I
and re-ligated into circular form. The amplification
conditions were: 2 min at 94 8C, 35/ (30 s at 94 8C;
30 s at 54 8C, 2 min at 72 8C).
DNA fragments were cloned in the vector pCR-Script
SK(
/) (pCR-Script Cloning Kit, Stratagene). Auto-
matic sequencing was performed with an ALF II system
(Amersham-Pharmacia) using a sequencing kit with
Cy5-labelled standard primers.
2.4. RNA isolation and RT-PCR
For the reverse transcription-polymerase chain reac-
tion (RT PCR) total RNA was isolated using RNeasy
Plant Total RNA kit (Qiagen). RT PCR reactions were
performed using Titan One Tube RT PCR system
(Roche Molecular Biochemicals). If not stated other-
wise, reverse transcription run for 30 min at 48 8C.
After 2 min denaturation at 94 8C the polymerase chain
reaction started 30 s at 94 8C, 30 s at 55 8C and 60 s at
68 8C for 38 cycles.
RT PCR amplification of 3? portion of chs _H1 cDNA
was performed from mRNA purified with oligo dT
coupled to magnetic beads (Dynal, Great Neck, NY). A
combination of oligo dT15 and CHS_H1 A1
1009
(5?ATCACTGCCGTCACTTTC3?) was used for this
reaction. Prior to the amplification of the 5? portion of
chs _H1 cDNA, G-tailed first strand cDNA was pre-
pared according to the principle of the method described
by Lee and Vacquier [27]. An Oligo dC adapter
(5?AAGGAGATATCCACACCCCCCCCC3?) was
then used in combination with the CHS_H1 A2 primer
(5?AAATAAGCCCAGGAACATC3?) in Titan One
Tube RT PCR reaction to amplify specific cDNA
fragment. This fragment was cleaved with EcoR V
before cloning.
Quantitative RT PCR (Q RT PCR) was used to assay
the specific expression of chs _H1 mRNA in different
tissues. Q RT PCR reactions were performed using 5 mg
of total RNA per reaction as template and [g-32P] ATP-
labeled primers CHS_H1 A1 and CHS_H1 A2. The
reaction conditions were the same as described above,
except that 31 instead of 38 cycles were used for Q RT
PCR. Under these reaction conditions, a linear relation
was observed between the amount of RT PCR product
and the amount of RNA in a reaction mixture. Q RT
PCR of cellular 7SL RNA as the reference sample was
performed in parallel, using [g-32P] ATP-labeled primers
a (5?TGTAACCCAAGTGGGGG3?) and anti-b
(5?GCACCGGCCCGTTATCC3?) [28]. A primer desig-
nated UCR (5?CATGTATAAACTTTCTGC3?) [28]
was used in combination with primer a to test the purity
of RNA samples from DNA.
2.5. GenBank database sequences, computer analyses and
other methods
For comparative analyses we selected sequence data
for alfalfa chs 2, petunia chs A, Arabidopsis thaliana
chalcone sythase and phlorisovalerophenone synthase
from the GenBank database (see e.g. [29]) under
accession numbers L02902, X14591, M20308 and
AB047593, respectively. The cloned sequence chs _H1
from our experiments has AC AJ304877.
Sequence data comparisons were carried out with
DNASIS for Windows, version 2.5 (Hitachi) and using
OMIGA software (Oxford Molecular). The cluster
analysis was performed using NTSYS-pc v. 2.02 for
WINDOWS (Exeter Software, US). Only sharp, strong
and reproducible radioactivity signals and silver stained
bands were considered for the analyses. Similarity was
estimated using Jaccard’s [30] similarity coefficient
(JCS/a /(n/d)), which ranges from 0 (all fragments
between accessions were different) to 1 (all fragments
among evaluated genotypes were identical). The den-
drograms were generated using the unweighted pair
group method with arithmetic mean (UPGMA) cluster-
ing procedure.
Comparative protein modelling of the 3-D structures
of CHS_H1 and VPS was performed using SWISS-
MODEL Version 36.0002 [31,32]. The theoretical struc-
1010 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
tures were portrayed against the template of CHS2 of
Medicago sativa (PDB ID 1BI5). This structure was
determined by Ferrer et al. [3] using crystallography.
Alignments of 3-D structures and structural analyses
were performed using Swiss-PdbViewer v3.7b2 [33].
Intron regions of chs genes were analyzed in 6%
acrylamide gels buffered by 1 /TBE pH 8.3 (PAAGE)
and stained for nucleic acids with AgNO3 [34]. The
activity of cloned CHS_H1 with 4-coumaroyl-CoA was
determined according to Zuurbier [35].
All autoradiograms were scanned and quantified
using STORM device and ImageQuaNT software (Mo-
lecular Dynamics, USA).
3. Results
3.1. Cloning and sequence analysis of chs_H1 gene
We aimed to clone ‘true’ CHS-specific fragment (Fig.
1) from the hop genome which could serve for identi-
fication of authentic hop sequence and as a hybridisa-
tion probe for further experiments. Because of the high
homology of various CHS-like proteins, we did not
design degenerate primers. Instead, the primers were
derived from the comparisons of ‘true’ CHSs on
nucleotide (nt) level. Sixteen chs sequences from differ-
ent plant species were aligned (not shown) and con-
Fig. 1. Schematic drawing of PCR amplifications of chs _H1 gene. (I)
PCR amplification of chs _H1 fragment with ‘consensus’ primers. (II)
An amplification of 5? and 3? cDNA fragments using RT PCR. Oligo
dT was used as RT primer to amplify 3? end portion of cDNA from
Poly A tail. Oligo dC adapter was used as PCR primer for the second
strand reaction with G-tailed first cDNA strand template. The
restriction site Cla I within the exon 2 is shown. (III) PCR amplifica-
tion of chs _H1 genomic fragment including the coding region and
intron. (IV) Inverse PCR using Mbo I-cleaved and circularised genomic
fragments to fish for chs _H1 promoter region. (V) PCR amplification
of full length chs _H1 from hop genome. Position of primers described
in Section 2 are indicated by the arrows. The scheme is not in scale.
sensus primers were assembled as a sequence of
nucleotides that have the highest incidence at each
individual nucleotide position. 5? primer CHSJ3 had
95% conservation and covered position 1154 /1173,
while 87% conservation was calculated for 3? primer
CHSJ4, which covered position 1805/1824 on chs _H1
gene (not shown). PCR performed using these primers
yielded a single band of 670 bp. Three clones containing
a 670 bp fragment were sequenced and found to be
identical. This genomic fragment was designated H1. It
exhibited about 75% homology to various chs sequences
on the nucleotide level and, therefore, we used that
sequence further to fish for a hop chs -specific gene. RT
PCR was performed using mRNA isolated from young
hop female inflorescences to ascertain the expression of
H1 sequence and to clone corresponding cDNA (Fig. 1,
step II). Primers A1 and A2 surrounding the unique
restriction site ClaI were designed to obtain two over-
handed cDNA fragments which enabled us to perform
easy amplification, sequencing, and re-constitution of
the full-length H1 coding region. An authentic cistron
was then amplified from the hop genome in the next step
(Fig. 1, step III) which fully corresponded to the original
H1 fragment and chs -specific cDNA. A single intron
was identified in the chs _H1 coding region in a
conserved position characteristic for the majority of
chs genes, between the first and second base of the
cysteine residue at position 60. To obtain the promoter
region, inverse PCR was carried out with primers from
the exon I and intron sequence (step IV, Fig. 1). A single
fragment of about 700 bp containing 495 nucleotides
upstream of the coding region, was obtained from this
reaction. In the last step, a 2093 bp fragment was
amplified from hop genome (step V, Fig. 1) using
primers derived from an upstream promoter region
and from the 3? region including polyadenylation site
identified by cDNA sequencing. The scheme of chs _H1
gene and putative promoter and terminator sequences
are shown in Fig. 2.
It was predicted that the cDNA of chs _H1 encodes
for 399 aa protein of 42.5 kDa. The coding region (exon
1 plus exon 2) of chs_H1 gene is 74, 75 and 77% identical
to Arabidopsis , alfalfa chs 2 and petunia chs A CHS
genes at the nt level, respectively. This identity was
calculated to be 85, 84 and 87% for Arabidopsis , alfalfa
CHS2 and petunia CHSA chalcone synthase at the aa
level, respectively. Very high aa homology of CHS_H1
to different CHSs was found providing that groups of
equivalent residues were included in the calculations.
For instance, this homology was 93% for CHS_H1 and
alfalfa CHS2, which was analyzed in detail by crystal-
lography. Significantly less identity, 70 and 73%, was
found between CHS_H1 to VPS at nt and aa levels,
respectively. A total of 87% aa homology between these
two hop proteins was achieved if equivalent residues
were considered in calculations.
 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018 1011

Fig. 2. Sequence organisation of chs_H1gene within cloned 2093 bp DNA fragment and putative regulatory elements. Putative regulatory signals are
shown within the 5? (promoter) region (A) and 3? region (C) of the gene (see text for further details). The scheme of cloned chs _H1 gene (position 1 /
2093) is depicted in part B. Positions of individual chalcone synthase probes are shown on the top of the scheme. Ex1, Int, Ex2 and PA designate exon
1, intron, exon 2, and polyadenylation signal, respectively.

Various conserved regulatory motifs reviewed by
Martin [1] and Rushton and Somssich [36] were
identified within the promoter region of chs _H1 gene
(Fig. 2). For instance, upstream from the TATA signal
(5?TATAAATA3?), two G-boxes (5?CACGTG3?) were
found, which are characteristic for chs genes responding
to UV irradiation or pathogen attack. H-box
(5?CTACCA3?) which falls in the same category of
regulatory elements as the G-box was identified at
position 22 /27. A CHS-like box (5?TACCACTACC-
AACAT3?), whose sequence is close to the CHS-box
consensus TACC[N7]CT, was identified 25 nucleotides
downstream from the TATA signal. In addition, a motif
for tissue-specific expression (5?TACTAT3?) having
general consensus TACPyAT, was identified within the
promoter region. A polyadenylation signal-like element
(5?AATAATA3?) was identified at position 2055/2061
on the chs _H1 gene (Fig. 2), 34 nucleotides upstream
from the polyadenylation site.
3.2. Comparative modelling, structure analysis of hop
CHS homologues and activity of recombinant CHS_H1
protein
In order to better characterise the CHS_H1 protein, a
comparative modeling approach (see Section 2 for
details) was used to predict the theoretical structure
for CHS_H1 (Fig. 3). Important residues, which form
1012 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018

the geometry of the active site, active center, coumaroyl
binding site and cyclisation pocket, were found in
CHS_H1 at positions identical to those determined for
alfalfa CHS by crystallography [3]. With the exception
of T132 and T197, all conserved residues under con-
sideration were also found in VPS. According to our
homology plots, conserved CHS-specific residue T132
within the cyclisation pocket corresponds to G134 in
VPS. However, T197, which contributes to the coumar-
oyl binding site in CHSs, has no homologous position in
VPS. Apart from these amino acid differences, no
obvious differences between CHS_H1 and VPS at
positions 132 and 197 were detected in the structural
alignment. Some differences, however, were detectable
in several other regions (Fig. 3), including the short
region surrounding the nucleophile attachment site of
the catalytic center formed by residues C164 and C166
in CHS_H1 and VPS, respectively. The difference close
to the catalytic cysteine involved the change of turnlike
glutamine in CHS_H1 (position 162) for leucine in VPS
(position 164). The biggest loops designated I, II and III
(Fig. 3), which were detected on aligned structures, are
obviously due to the presence of non homologous amino
acid residues in these regions. According to our com-
parisons, non-homologous residues at CHS/VPS posi-
tions from N45/K47 to K49/M51 should contribute to
differences within loop I, where a b turn motif is
predicted in CHS, and an a helix is formed in VPS.
Loop II at CHS/VPS positions from N82/H84 to A88/
A90 shows an a helix in CHS, while a b turn-like
structure is predicted in VPS. Loop III indicates some
structural differences in the region extending from I229/
D231 to I236/I239 on the CHS/VPS alignment. These
differences include the prediction of a longer a helix
predicted in CHS as compared to VPS. No 3-D
structural differences between CHS_H1 and VPS were
readily detected by the comparative analysis of the
structure of the cyclisation pocket, which dictates the
specificity of the condensation reaction. Indeed, the
recombinant CHS_H1 protein clearly showed the activ-
ity with 4-coumaroyl-CoA producing naringenin chal-
cone, which under the conditions of the assay cyclises to
naringenin. At the same time, no byproducts were
observed, suggesting high specificity of the reaction. In
contrast, CHS_H1 reaction with isovaleryl-CoA led to
the appearance of phloroisovalerophenone peak accom-
panied with the major prematurely terminated product
(6-isobutyl-4-hydroxy-2-pyrone) (results not shown).

Fig. 3. An alignment of a single-line ribbon monomer models of CHS_H1 and phlorisovalerophenone synthase. The view is oriented from the
optimal angle to give visualisation on calculated structural differences. These differences are indicated by the arrows. The largest loops are marked by
Roman numerals I, II and III and within the loops VPS-specific strands are indicated. The positions of catalytical cysteine C164 and CHS_H1-
specific T197 were identified by the analogy to alfalfa chalcone sythase crystallography [3] and mapped on the structures, using swiss viewers as
described in Section 2.
 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
Thus, it can be concluded from our analyses that the
characterised chs _H1 gene encodes for ‘true’ CHS and
clearly differs from the VPS homologue which was
isolated from hop.
3.3. CHS_H1 mRNA expression in different tissues
We characterised chs _H1 as a CHS encoding gene
that has various regulatory boxes characteristic for light
regulated, pathogen inducible and tissue specific expres-
sion. In further experiments we addressed the question
concerning the possible tissue specific expression of
CHS_H1 mRNA at the stages of hop flowering and
cone maturation. In order to achieve the required
sequence specificity and sensitivity we used the quanti-
tative RT PCR approach. The relative levels of
CHS_H1 mRNA were assessed according to the accu-
mulation of 250 bp fragment amplified by 32P-gATP
end-labelled A1 and A2 primers (Fig. 1). These primers
were specific for chs _H1 clones and no product
appeared from reactions with cloned vps sequences
(not shown). In parallel, we determined the level of
7SL RNA in the samples using end-labelled primers a
and anti-b, described previously [28]. It is known that
the levels of cellular 7SL RNA do not change signifi-
cantly in the young tissue [37] therefore, we used this
system for reference purposes.
While we found no significant quantitative differences
for 7SL RNA expression (not shown), CHS_H1 mRNA
levels exhibited clear differences. At the stage of hop
flowering (Fig. 4), the highest levels of specific radio-
activity signals were detected for petioles (100%),
developed female flowers (97%), young stems (79%)
and in stem apexes (78%), while low levels were found in
young anthers (35%), roots (31%), and leaf blades (9%).
Specific CHS_H1 mRNA expression we found in
maturating cones, where about 100 times higher
mRNA level was detected than in hop petioles (not
shown). No signals were obtained for different tissues
from hop mericlones grown in vitro in glass boxes under
artificial illumination conditions. Taken together, these
results suggest that there is strong tissue specific
regulation of the chs _H1 gene in field grown plants.
Because no expression was seen in in vitro plants, one
can assume strong inducibility of chs _H1 under natural
light conditions. Expression of chs _H1 is clearly induced
in glandular tissue, however, we did not further specify
the factors which may influence the levels of chs_H1.
3.4. Analysis of hop genomic DNA for the variability of
chs-like sequences
It is known that chs genes are usually organised in
small multigene families. In further experiments, South-
ern blot analyses were performed with the aim of
estimating the number of genes related to chs _H1 and
1013
Fig. 4. Quantitative RT PCR of hop chs RNA. RNA was isolated
from different tissues at stage of hop flowering and applied in RT PCR
reactions with 5? end-labeled primers A1 and A2 as described in
Section 2. PCR products were analysed in 5% native acrylamide gels
and quantified using STORM in the ‘volume’ units which characterise
pixel intensities (U) within the zone. The mean values of radioactivity
signal are given in percents (100% corresponds to 79/103 U).
Confidence intervals for individual measurements are given at level
a /0.05. RNA from the following tissues was extracted: 1, young
stem; 2, young female flower (1 /1.8 cm); 3, stem apex; 4, young leaf
blade (5 cm2); 5, leaf petioles; 6, roots; 7, young anthers (2 /2.5 mm).
the variability of chs -related sequences in several hop
genotypes. Southern blot patterns specific for chs _H1,
and the chs homologue-vps, were obtained using chs -
and vps-specific probes (Fig. 5). These results clearly
show 2-4 chs _H1 specific Hind III fragments in different
genotypes ranging from 13.5 to 5.3 kb. The distribution
of vps -specific Hind III fragments was quite different
from the chs _H1 distribution (Fig. 5A). It is known
from GenBank information that there is a Hind III site
within the exon II of vps */this is the reason why the
small (approximately 0.8 kb) fragment was detectable in
all genotypes after the Hind III cleavage. The appearance
of additional genomic fragments in the range of 3.8 /4.8
kb strongly hybridising to vps probe in cvs. Yeoman,
Galena, Taurus and Brewers Gold (Fig. 5A), suggests an
existence of at least one additional vps gene in these
genotypes. Various double digested DNA samples from
the genotype of Osvald’s 72 that probed for chs or vps
genes (Fig. 5B), confirmed different distribution of
genomic fragments hybridising to the respective probes.
While at least four chs -specific fragments were seen for
Osvald’s 72 genotype (the cleavage with Hind III
/
Eco RI), only one vps -specific band was detectable for
Osvald’s 72.
Because a restriction cleavage of the chs _H1 sequence
(Fig. 2) with BstYI should split exon 1 from the
majority of exon 2, we used this restriction enzyme for
more detailed RFLP analysis of chs _H1-related se-
quences from 15 hop genotypes and H. neomexicanus
species. The membranes were probed either with the
1014 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018

Fig. 5. Southern analysis of genomic DNA from hop with chalcone

synthase (chs ) and phlorisovalerophenone synthase (vps ) exone 2-
specific DNA fragments as probes. (A) DNA from seven hop cultivars
was cleaved with Hind III and probed either for chs or vps . Lane 1,
Osvald’s 72; lane 2, Yeoman; lane 3, Southern Brewer; lane 4, Eroica;
lane 5, Galena; lane 6, Taurus; lane 7, Brewers Gold. (B) Analysis of
Osvald’s 72 genomic DNA cleaved with different restriction endonu-
cleases and probed either for chs or vps . Lanes 1 /4, DNA double
digested with Eco RI
/Hin dIII, Eco RI
/Dra I, Eco RI
/Bst YI and
Eco RI
/Bam HI, respectively. DNA marker is aligned on the right side
of the autoradiogram.

hybridisation probe H1Ex1, H1Ex2 or H1Ex1Ex2,

covering exone 1, 2 or the whole chs _H1 coding region,
respectively (Fig. 6). A wide genetic polymorphism of
chs _H1-related sequences was revealed among various
hop genotypes, suggesting specific re-arrangements of
hop chs -like genes during evolution and/or during
breeding and selection processes (Fig. 6). The variability
of chs _H1 related genes was also proved by PCR
analysis of intron regions (not shown). In this case,
specific primers were derived from exon 1 and exon 2 of
chs _H1 and used to amplify intron regions. Surpris-
ingly, no uniform intron sequence was revealed and
instead, various polymorphic fragments ranging from
Fig. 6. Southern blots of 15 H. lupulus genotypes and species H.
260 to 400 bp were detected for different cultivars (not neomexicanus. DNA was digested with Bst Y I, electrophoresed,
shown). These fragments hybridised strongly to the blotted and probed with H1Ex1Ex2 probe (A), H1Ex1 probe (B) or
chs _H1 probe and showed similar distributions even if H1Ex2 probe (C). Probes are positioned on chs_H1 sequence as shown
different combinations of nested primers were used for in Fig. 7. Lane 1, Brewers Gold; lane 2, Eroica; lane 3, Galena; lane 4,
PCR (not shown), suggesting chs -specific PCR pro- Magnum; lane 5, Fuggle; lane 6, Southern Brewer; lane 7, Northern
Brewer; lane 8, Sládek; lane 9, Premiant; lane 10, Osvald 72; lane 11,
ducts. Wye Target; lane 12, Yeoman; lane 13, Taurus; lane 14, Spalt; lane 15,
RFLP data were combined and treated by cluster Hersbrücker; lane 16, H. mexicanus ; lanes kb, marker DNA (1 kb
analysis procedures as described in Section 2. The ladder, BRL).
 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
corresponding dendrogram is depicted in Fig. 7. Several
clusters were formed on this dendrogram. As expected,
Osvald’s hop showed the highest relation to cv. Spalt.
Cultivars originating from Osvald’s hop, i.e. cvs. Pre-
miat and Sládek, fell to related cluster together with
some hops of American origin such as Northern Brewer,
which was used to prepare these cultivars. Other closely
related genotypes, e.g. Galena, Eroica and Brewers
Gold, formed quite a distinct cluster, suggesting lower
homology to hops, which have a genetic background
similar to Osvald’s 72. The lowest level similarity was
found in the wild hop H. neomexicanus, which roots the
dendrogram (Fig. 7).
Different methods, i.e. Southern blot, RFLP and
PCR analyses suggested that there is a family of genes
related to chs _H1 that are distinct from vps, and
showing some degree of genetic polymorphism in their
arrangement in the hop genome. In addition to results in
Figs. 5 and 6, two fragments having 3.1 and 6.5 kb were
obtained after the single Eco RI cleavage. Four Hind III
fragments hybridising to H1Ex2 probe (Fig. 2) and
having 11.5, 9.6, 8.5 and 5.5 kb (Fig. 6), as well as four
Dra I fragments having 14.1, 11.8, 2.5 and 2.4 kb, were
detected on Southern blots, (not shown) suggesting the
presence of at least four genes closely related to chs _H1
in the genome of Osvald’s 72. However, double cleavage
of DNA with Eco RI and Dra I revealed five specific
bands of 12.5, 3.4, 2.3, 2.2 and 2.1 kb hybridising to the
H1Ex2 probe (Fig. 5B) and six distinct bands were
found on the autoradiograms, where DNA was cleaved
with Bst YI and hybridised to the H1Ex1 probe (Fig.
Fig. 7. Genetic diversity analysis of hop based on genomic fragments hybridising to chs _H1 specific probes. The results in Figs. 5 and 6 were
subjected to cluster analysis as described in Section 2. The dendrogram was generated using the unweighted pair group method with arithmetic mean
(UPGMA) clustering procedure. H. neomexicanus species was included to root the dendrogram. Coefficient of genetic similarity is given.
1015
6B). These results suggest that at least six sequences
related to chs _H1 are present in the hop genome and
that some of them are arranged tandemly.
4. Discussion
4.1. Cloning and properties of ‘true’ CHS from hop
In this study we aimed to fish a hop gene encoding
CHS (EC 2.3.1.74). The main reasons to characterise
hop CHS(s) is its role in biosynthesis of prenylated
chalcones [16] either as a natural component in hop or in
medicinal hops modified by biotechnology approaches.
VPS, which was identified to be involved in biosynthesis
of hop bitter acids [11] has no or low specificity for
chalcone synthesis, as no significant CHS activity was
found in purified VPS fractions [10].
We cloned a gene designated chs_H1 encoding ‘true’
CHS type of enzyme from hop. Its coding region shows
high identity */approximately 75% at nucleotide and
about 90% at amino acid level, with known CHSs. The
deduced CHS_H1 protein retained conserved amino
acid residues, which according to the crystallography
analysis of the CHS homologue from alfalfa [3],
contribute to the catalytic properties of CHS. In
addition, the recombinant protein was determined as
CHS by the enzymatic assay.
From our comparisons of aa sequences and substrate
specificities we concluded that the characterised chs _H1
gene encodes for protein, which clearly differs from hop
1016 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
VPS. For the activity of CHS_H1 we got TLC patterns
practically identical to those described by Zuurbier et al.
[35] for CHS from Pinus sylvestris. Differences between
CHS_H1 and VPS include some non-homologous
amino acid changes that surround conserved residues
of the cyclisation pocket; and a set of conserved amino
acid residues forming part of the coumaroyl binding site
in CHS. T197 was mainly found to have no adequate
counterpart in VPS. This amino acid difference is
consistent with the different initial capture specificity
of VPS, which utilises isovaleryl-CoA or isobutyryl-CoA
as substrate components, instead of 4-coumaroyl-CoA,
which is a natural component of the CHS substrate [see
e.g. [10] for substrate specificities]. It is interesting to
mention in this respect the recent work published by Jez
et al. [38], who performed site-specific mutagenesis of
several plant-specific polyketide synthases. In this work
the mutation T197L changed the volume of active site
cavity and catalytical properties of corresponding mu-
tant. In addition to this particular aa difference, several
minor structural deviations and at least three bigger
loops were detected on the CHS_H1/VPS structure
alignment. These bigger loops do not apparently include
the predicted catalytic domains of CHS_H1 or VPS.
However, it is possible that some of these differences
include structural domains responsible for the interac-
tion of CHS_H1 or VPS with various proteins. It is
known that CHS functions in cells as a homodimer (for
review see Martin [1]). Some recent data support the
idea that CHS interacts with other flavonoid enzymes
[39]. Similar protein /protein interactions can also be
assumed for the VPS homologue.
4.2. Expression of chs_H1 gene
The entire cloned sequence of chs _H1 gene has 2093
bp including upstream promoter sequence and the
termination signal. The main characteristics of promoter
regulatory elements of chs _H1, are the presence of CHS,
H and G boxes which are known for light regulated, and
stress-, and pathogen-inducible genes (for reviews see
[1,34]), and these are consistent with CHS regulation.
The characteristics of CHS_H1 mRNA expression
suggests tissue specificity, which is often observed for
CHS isoforms encoded by chs gene families
[21,23,40,41]. It is not known, however, whether or not
the TACPyAT motif of organ-specific expression [42],
which was found in chs _H1, is responsible for the
differences in mRNA levels that we observed by
quantitative RT PCR. The high expression level of
CHS_H1 in glandular trichomes is consistent with the
assumption that this enzyme is responsible for ‘true’
CHS activity in glandular hop tissue as detected by
Zuurbier et al. [20].
4.3. chs_H1 gene family and variability of chs-like
sequences in hop genome
This research demonstrates the presence of at least six
sequences strongly hybridising to chs _H1 in Osvald’s 72
genome and a polymorphism of chs -specific intron
sequences. These results suggest the existence of a family
of genes related to chs _H1. According to recent EMBL
database entries AB061020 and AB061022, there are
known cDNAs of at least two additional, but still not
characterised chs -homologues in hop. Southern blot
patterns of vps genes clearly differed from those of
chs _H1-like genes, suggesting different organisation of
vps gene(s) within the hop genome. It can be predicted
from our Southern blots that there are at least two vps
genes, because there is one monomorphic and one
polymorphic band ranging from 3.8 to 4.8 kb. The
polymorphic band is seen in cvs. Yeoman, Galena,
Taurus and Brewers Gold. The monomorphic band
obviously appeared due to Hin dIII restriction cleavage
within an internal restriction site that is localised in the
coding region of vps , as can be predicted from the
sequence described by Okada and Ito [10].
A wide genetic polymorphism of chs _H1-hybridising
fragments was revealed when fifteen hop genotypes and
H. neomexicanus were analyzed on genomic blots. This
polymorphism suggests specific re-arrangements of chs -
like genes in hop during evolution and/or during the
breeding and selection processes. Several clusters were
formed on the constructed dendrogram and this cluster-
ing corresponded with the genetic origins of analysed
hop genotypes, as also documented by other molecular
genetic methods [43]. Some of the cultivars analyzed
belong to hops that produce high levels of bitter acids,
whereas others like Osvald’s clone 72 belong to fine
aromatic hops. Although it can be assumed that there
are genetic differences in the expression and activity of
CHS, VPS or other CHS-like homologues that could be
involved in the biosynthesis of valuable secondary
metabolites in hop, another study is necessary to analyse
this possibility.
Acknowledgements
The authors thank Drs Gudrun and Joachim Schrö-
der (University Freiburg, Germany) for the enzyme
assays determining activity of cloned CHS_H1 protein.
The authors would like to thank Aaron O. Richardson
(Indiana University, Jordan Hall, Bloomington, USA)
and Sandie King (University of Glasgow, Scotland) for
their help in preparation of this manuscript. We thank
Ing. Lidmila Orctová, Helena Matoušková and Vlasta
Tetourová (Institute of Plant Molecular Biology AS
CR, České Budĕjovice, Czech Republic) for their
excellent technical assistance. The work was supported
 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018
by grant 521/99/1591 from the Grant Agency of Czech
Republic.
References
[1] C.R. Martin, Structure, function and regulation of the chalcone
synthase, Int. Rev. Cytol. 147 (1993) 233 /284.
[2] J. Schröder, A family of plant-specific polyketide synthases. Facts
and predictions, Trends Plant. Sci. 2 (1997) 373 /378.
[3] J.L. Ferrer, J.M. Jez, M.E. Bowman, R.A. Dixon, J.P. Noel,
Structure of chalcone synthase and the molecular basis of plant
polyketide biosynthesis, Nat. Struct. Biol. 6 (1999) 775 /784.
[4] J. Schröder, Probing plant polyketide biosynthesis, Nat. Struct.
Biol. 6 (1999) 714 /716.
[5] G. Schröder, J.W.S. Brown, J. Schröder, Molecular analysis of
resveratrol synthase: cDNA, genomic clones and relationship with
chalcone synthase, Eur. J. Biochem. 172 (1988) 161 /169.
[6] K.T. Junghanns, R.E. Kneusel, A. Baumert, W. Maier, D.
Gröger, U. Matern, Molecular cloning and heterologous expres-
sion of acridone synthase from elicited Ruta graveolens cell
suspension cultures, Plant Mol. Biol. 27 (1995) 681 /692.
[7] R. Preisig-Mueller, P. Gnau, H. Kindl, The inducible 9,10-
dihydrophenantrene pathway: characterization and expression
of bibenzyl synthase and 5-adenosylhomocysteine hydrolase,
Arch. Biochem. Biophys. 317 (1995) 201 /207.
[8] Y. Helariutta, P. Elomaa, M. Kotilainen, R.J. Griesbach, J.
Schröder, T.H. Teeri, Chalcone synthase-like genes active during
corolla development are differentially expressed and encode
enzymes with different catalytic properties in Gerbera hybrida
(Asteraceae), Plant Mol. Biol. 28 (1995) 47 /60.
[9] T. Akiyama, M. Shibuya, H.-M. Liu, Y. Ebizuka, p-Coumaroyl-
triacetic acid synthase, a new homologue of chalcone synthase,
from Hydragea macrophylla var. thunbergii , Eur. J. Biochem. 263
(1999) 834 /839.
[10] N.B. Paniego, K.W.M. Zuurbier, S.Y. Fung, R. van der Heijden,
J.J.C. Scheffer, R. Verpoorte, Phlorisovalerophenone synthase, a
novel polyketide synthase from hop (Humulus lupulus L.) cones,
Eur. J. Biochem. 262 (1999) 612 /616.
[11] Y. Okada, K. Ito, Cloning and analysis of valerophenone
synthase gene expressed specifically in lupulin gland of hop
(Humulus lupulus L.), Biosci. Biotechnol. Biochem. 65 (2001)
150 /155.
[12] T. Hirosawa, T. Saito, T. Tanaka, H. Matsushima, SEM
Observation and HPLC analysis of the accumulation of alpha-
and beta-acids in the fresh developing hop (Humulus lupulus L.)
peltate glandular trichomes, J. Electron Microsc. 44 (1995) 145 /
147.
[13] E.S. Kim, P.G. Mahlberg, Early development of the secretory
cavity of peltate glands in Humulus lupulus L. (Cannabaceae ),
Mol. Cells 10 (2000) 487 /492.
[14] R.C. Menary, P.E. Doe, Some morphological and chemical
changes in hops during maturation, J. Sci. Food Agric. 34
(1983) 921 /929.
[15] J.F. Stevens, M. Ivancic, V.L. Hsu, M.L. Deinzer, Prenylflavo-
noids from Humulus lupulus , Phytochemistry 44 (1997) 1575 /
1585.
[16] N. Etteldorf, N. Etteldorf, H. Becker, New chalcones from hop
Humulus lupulus L, Z. Naturforsch. 54c (1999) 610 /612.
[17] J.F. Stevens, A.W. Taylor, G.B. Nickerson, M. Ivancic, J.
Henning, A. Haunold, M.L. Deinzer, Prenylflavonoid variation
in Humulus lupulus : distribution and taxonomic signifcance of
xanthogalenol and 4?-O-methylxanthohumol, Phytochemistry 53
(2000) 759 /775.
[18] C.L. Miranda, J.F. Stevens, A. Helmrich, M.C. Henderson, R.J.
Rodriguez, Y.H. Yang, M.L. Deinzer, D.W. Barnes, D.R. Buhler,
1017
Antiproliferative and cytotoxic effects of prenylated flavonoids
from hops (Humulus lupulus ) in human cancer cell lines, Food
Chem. Toxicol. 37 (1999) 271 /285.
[19] C.L. Miranda, Prenylated chalcones and flavanones as inducers of
quinone reductase in mouse Hepa 1c1c7 cells, Cancer Lett. 149
(2000) 21 /29.
[20] K.W.M. Zuurbier, S.Y. Fung, J. Johannes, C. Scheffer, R.
Verpoorte, In vitro prenylation of aromatic intermediates in the
biosynthesis of bitter acids in Humulus lupulus , Phytochemistry 49
(1998) 2315 /2322.
[21] R.E. Koes, C.E. Spelt, P.J.M. van Den Elzen, J.N.M. Mol,
Cloning and molecular characterization of the chalcone synthase
multigene family of Petunia hybrida , Gene 81 (1989) 245 /257.
[22] A.B. Christensen, P.L. Gregersen, J. Schröder, D.B. Collinge, A
chalcone synthase with an unusual substrate preference is
expressed in barley leaves in response to UV light and pathogen
attack, Plant Mol. Biol. 37 (1998) 849 /857.
[23] M.L. Durbin, B. McCaig, M.T. Clegg, Molecular evolution of the
chalcone synthase multigene family in the morning glory, Plant
Mol. Biol. 42 (2000) 79 /92.
[24] J. Matoušek, L. Trnená, P. Svoboda, P. Oriniaková, C.P.
Lichtenstein, The gradual reduction of viroid levels in hop
mericlones, Biol. Chem. 376 (1995) 715 /721.
[25] T. Tai, S. Tanksley, A rapid and inexpensive method for isolation
of total DNA from dehydrated plant tissue, Plant. Mol. Biol.
Rep. 8 (1991) 297 /303.
[26] G.M. Church, W. Gilbert, Genomic sequencing, Proc. Natl.
Acad. Sci. USA 81 (1984) 1991 /1995.
[27] Y.-H.o. Lee, V.D. Vacquier, Reusable cDNA libraries coupled to
magnetic beads, Anal. Biochem. 206 (1992) 206 /207.
[28] J. Matoušek, V. Junker, L. Vrba, J. Schubert, J. Patzak, G.
Steger, Molecular characterization and genome organization of
7SL RNA genes from hop (Humulus lupulus L.), Gene 239 (1999)
173 /183.
[29] D. Benson, D.J. Lipman, J. Ostell, GenBank, Nucleic Acids Res.
21 (1993) 2963 /2965.
[30] P. Jaccard, Nouvelles rescherches sur la distribution florale, Bull.
Soc. Vaud. Sci. Nat. 44 (1908) 223 /270.
[31] M.C. Peitsch, Protein modeling by E-mail, Bio/Technology 13
(1995) 658 /660.
[32] M.C. Peitsch, ProMod and Swiss-Model: internet-based tools for
automated comparative protein modelling, Biochem. Soc. Trans.
24 (1996) 274 /279.
[33] N. Guex, M.C. Peitsch, SWISS-MODEL and the Swiss-
PdbViewer: an environment for comparative protein modelling,
Electrophoresis 18 (1997) 2714 /2723.
[34] J. Schumacher, N. Meyer, D. Riesner, H.L. Weidemann, Diag-
nostic procedure for detection of viroids and viruses with circular
RNAs by ‘return’-gel electrophoresis, J. Phytopathol. 115 (1986)
332 /343.
[35] K.W.M. Zuurbier, J. Leser, T. Berger, A.J.P. Hofte, G. Schröder,
R. Verpoorte, J. Schröder, 4-Hydroxy-2-pyrone formation by
chalcone and stilbene synthase with nonphysiological substrates,
Phytochemistry 49 (1998) 1945 /1951.
[36] P.J. Rushton, I.E. Somssich, Transcriptional control of plant
genes responsive to pathogens, Curr. Opin. Plant Biol. 1 (1998)
311 /315.
[37] L. Riedel, U. Volger, R. Luckinger, A. Pütz, H.L. Sänger, M.
Wassenegger, Molecular analysis of the gene family of the signal
recognition particle (SRP) RNA of tomato, Plant Mol. Biol. 31
(1996) 113 /125.
[38] J.M. Jez, M.B. Austin, J.-L. Ferrer, M.E. Bowman, J. Schröder,
J.P. Noel, Structural control of polyketide formation in plant-
specific polyketide synthases, Chem. Biol. 7 (2000) 919 /930.
[39] I.E. Burbulis, B. Winkel-Shirley, Interactions among enzymes of
the Arabidopsis flavonoid biosynthetic pathway, Proc. Natl.
Acad. Sci. USA 96 (1999) 12929 /12934.
1018 J. Matoušek et al. / Plant Science 162 (2002) 1007 /1018

[40] Y. Johzuka-Hisatomi, A. Hoshino, T. Mori, Y. Habu, S. Iida,
Characterization of the chalcone synthase genes expressed in
flowers of the common and Japanese morning glories, Genes
Genet. Syst. 74 (1999) 141 /147.
[41] A.A. Hirner, H.U. Seitz, Isoforms of chalcone synthase in Daucus
carota L. and their differential expression in organs from the
European wild carrot and in ultraviolet-A-irradiated cell cultures,
Planta 210 (2000) 993 /998.
[42] I.M. van der Meer, M. Brouwer, C.E. Spelt, J.N.M. Mol, The
tacpyat repeats in the chalcone synthase promoter of Petunia
hybrida act as a dominant negative cis-acting module in
the control of organ-specific expression, Plant J. 2 (1992) 525 /
535.
[43] J. Patzak, Comparison of RAPD, STS, ISSR and AFLP
molecular methods used for assessment of genetic diversity in
hop (Humulus lupulus L.), Euphytica 121 (2001) 9 /18.