+ MODEL

Available online at www.sciencedirect.com

ScienceDirect
Journal of the Chinese Medical Association xx (2017) 1e7
www.jcma-online.com

Original Article

Association between preterm labor and genitourinary tract infections caused

by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and
coryneforms
Alaa El-Dien M.S. Hosny a, Waleed El-khayat b, Mona T. Kashef a,*, Mohsen N. Fakhry c
a
Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt
b
Obstetrics & Gynecology Department, Faculty of Medicine, Cairo University, Cairo, Egypt
c
Microbiologist at Chemipharm Pharmaceutical Industries, Cairo, Egypt
Received July 19, 2016; accepted October 7, 2016

Abstract

Background: Preterm labor (PTL) is responsible for most cases of neonatal death. In most of these cases, the causes of PTL have not been
established although several risk factors have been described. Therefore, the aim of this study was to investigate risk factors for PTL before 37
gestational weeks among Egyptian women.
Methods: In this case-control study, 117 pregnant women without risk factors for PTL were chosen. The control group (n ¼ 45) had term labor
(gestational weeks  37 weeks), and the case group (n ¼ 72) had PTL (gestational weeks < 37 weeks). The two groups were screened for urinary
and vaginal infections. The role of different demographic characteristics, patient history, and clinical signs were also investigated.
Results: Several risk factors were identified in this study, including age < 20 years, nulliparity, previous abortion and previous preterm birth, menses
vaginal bleeding, a vaginal pH > 5, a positive whiff test, Trichomonas vaginalis infection, Mycoplasma hominis infection, coryneforms heavy
vaginal growth, and any vaginal growth of Gram-negative bacilli. Urinary tract infection with any colony count was not associated with PTL.
Conclusion: Our study demonstrated that the main risk factors for PTL were vaginal infection with T. vaginalis, M. hominis, coryneforms, and
Gram-negative bacilli, and their determinants (vaginal pH > 5, positive whiff test, heavy vaginal bleeding). Both young age (< 20 years) and
poor obstetric history were also the risk factors. Therefore, screening for genitourinary tract infections is strongly recommended to be included in
prenatal care.
Copyright © 2017, the Chinese Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Keywords: infection; preterm labor; risk factors; urinary tract infection; vaginal

1. Introduction (PTB). PTB causes most of neonatal deaths and different

Preterm labor (PTL) is labor which occurs before 37
completed weeks of gestation and can lead to preterm birth
Conflicts of interest: The authors declare that they have no conflict of interest
related to the subject matter or materials discussed in this article.
* Corresponding author. Dr. Mona T. Kashef, Department of Microbiology
and Immunology, Faculty of Pharmacy, Cairo University, El Qasr El Einy
Street, Cairo 11562, Egypt.
E-mail address: mona.kashef@pharma.cu.edu.eg (M.T. Kashef).
forms of neonatal morbidities.1
The causes of PTB in most cases have not been established
although several risk factors have been identified.2 These
factors include: (1) poor socioeconomic status and low edu-
cation level3; (2) maternal age of < 20 years and > 35 years4;
(3) heavy manual work2; (4) cervical incompetence, multiple
gestations, previous abortion, previous PTB2,4,5; and (5)
genitourinary tract infections.1
Genitourinary infections usually lead to PTB. Because many
of these infections are asymptomatic, underestimation of their
importance may have been occurred.1 Furthermore, few studies

http://dx.doi.org/10.1016/j.jcma.2016.10.007
1726-4901/Copyright © 2017, the Chinese Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007
 + MODEL
2 A.E.-D.M.S. Hosny et al. / Journal of the Chinese Medical Association xx (2017) 1e7
focusing on these infections were conducted in Egypt, and they
investigated only one infection in relation to PTB, such as
chlamydia,6 bacterial vaginosis, or urinary tract infection.7,8
In the present study, we screened women in term labor (TL)
and PTL for the presence of urinary and vaginal infections to
examine their association with PTL. In addition, the role of
different demographic characteristics, patient history, and
clinical signs were also investigated.
2. Methods
2.1. Study population
This case-control study was performed involving Egyptian
women who were in labor and admitted to the Department of
Obstetrics and Gynaecology, Kasr Al Aini hospital, Cairo,
Egypt. The women were enrolled during a 7-month period
from December 2009 to June 2010. For purposes of this study,
labor was defined as at least three uterine contractions in 10
minutes or 2e3-cm cervical dilatation.9
The study population (PTL group) consisted of 72 women
admitted for PTL (< 37 gestational weeks) with or without
preterm premature rupture of membranes (PPROM). The control
group (TL group) consisted of 45 control women admitted for
TL without any complications of pregnancy such as PPROM,
preterm contractions, or vaginal bleeding ( 37 gestational
weeks). The gestational age was based on the last menstrual
period combined with ultrasonographic data, if present.
The study was approved by Kasr Al Aini hospital ethical
committee (992009).
2.2. Exclusion criteria
Women with any of the following risk factors for PTL were
excluded from the study: age < 15 years, placenta previa and
abruptio placentae, multiple gestations, hydramnios, congenital
malformation, intrauterine fetal death, intrauterine growth
retardation, medical complications requiring long-term or
intermittent medications as insulin-requiring diabetes mellitus,
chronic hypertension and maternal cardiac disease, pre-
eclampsia, pregnancy-induced hypertension, erythroblastosis
fetalis, Rh isoimmunization, renal disease with a baseline
creatinine level of > 2.0, autoimmune disease requiring ste-
roids, cervical cerclage, uterine fibroids, abdominal trauma,
in vitro fertilization, clinically evident herpes simplex virus, and
treatment with antibiotics or vaginal douches/pessaries within 4
weeks of enrollment. These factors were chosen based on their
association with medically-induced preterm delivery. There-
fore, this exclusionary regimen facilitates the ability to study the
presence of infection as a sole risk factor in PTL. A gynecologist
was responsible for the inclusion/exclusion of study participants
by applying the suitable medical examination or questionnaire.
2.3. Data collection
A written questionnaire was filled out by a staff nurse prior to
sampling, focusing on patient demographic characteristics
Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007
(gestational age, race, age, weight, height, nonprescription drug
use, prenatal care received, working during pregnancy, smoking,
coffee consumption, education, yoghurt consumption, contra-
ception use, and use of vaginal douches during pregnancy),
pregnancy history (parity, gravidity, previous abortions, and
previous PTB), medical complications (anemia, vaginal bleeding
during pregnancy, urinary tract infection, and other infections),
and results of speculum examination, done at the time of sam-
pling (presence of vaginal discharge, other signs of infection as
erythema, bleeding, vaginal pH, and the whiff test result).
2.4. Sampling
Vaginal swabs were obtained by the attending physician prior
to vaginal examination, and urine samples were collected by the
participants themselves. All specimens were transported to the
laboratory and processed within 18 hours of collection by a
microbiologist who was blinded to the group of participants.10
2.4.1. Vaginal swab samples
A total of five swabs were obtained from each woman. The
first one was used for group B streptococci screening, as previ-
ously described.11 The other four swabs were used for screening
other genital infections using an unmoistened sterile speculum.
Two of these swabs were placed separately into Amies transport
medium (Oxoid Ltd., UK) for microbial biochemical identifica-
tion. The third swab was returned to its plastic tube containing no
transport medium for molecular identification tests. Finally, the
final fourth swab was used for Gram stain scoring of vaginal
sample, pH determination, and whiff test.
2.4.1.1. Isolation and identification of vaginal microorganisms
2.4.1.1.1. Group B streptococci. The swab was inoculated
into selective Todd Hewitt broth supplemented with 15 mg/mL
nalidixic acid, 10 mg/mL colistin, CNA supplement (as
directed), and 10 mg/mL yeast extract (LIM broth); all the
media were purchased from Oxoid Ltd., UK. Next, the broth
was subcultured to a 5% sheep blood agar (SBA) plate. All
cultures were incubated following appropriate atmospheric
conditions.11 Suspected colonies were tested using Strepto-
coccal grouping latex test, according to manufacturer's in-
structions (Oxoid Ltd., UK).
2.4.1.1.2. T. vaginalis detection. One of the swabs, placed in
Amies medium, was inoculated into a modified thioglycolate
medium (Oxoid Ltd., UK), incubated aerobically at 35 C for 7
days, and examined daily for characteristic motility.12
The other swab, placed in Amies medium, was used to
inoculate SBA, MacConkey agar, Sabouraud dextrose agar,
and Rogosa agar (All were from Oxoid Ltd., UK) to isolate
aerobic bacteria, facultative Gram-negative bacilli, yeast spe-
cies, and lactobacilli, respectively. All inoculated media were
incubated according to the recommended conditions. Only
colonies growing in the third or fourth streak were identified as
they indicate a change of vaginal flora to heavy growth of this
microorganism(s).13
2.4.1.1.3. Molecular identification testing. Polymerase
chain reaction (PCR) was used for the detection of Chlamydia
 + MODEL

A.E.-D.M.S. Hosny et al. / Journal of the Chinese Medical Association xx (2017) 1e7 3

trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, M.
genitalium, and Ureaplasma. The genomic DNA was extracted
from the swab using the QIAamp DNA Mini kit (Qiagen,
Germany), according to the manufacturer's instructions.
PCR was subsequently performed, as described pre-
viously.14e19 Table 1 summarizes the sequence of primers
used for detection of each microorganism and the expected
amplicon size. The positive samples in genus-specific PCR for
mycoplasmas and ureaplasmas were further tested for M.
genitalium, M. hominis, and Ureaplasma.
2.4.1.2. Gram stain scoring of vaginal sample, pH determi-
nation, and whiff test. The final fourth swab was rolled over a
glass slide which was Gram stained and scored as described
previously.20 Clue cells were also recorded. The same swab
was then touched to a pH paper (Whatman narrow range pH
paper 4e6, with discrimination of 0.5, UK) for the determi-
nation of the vaginal pH, and a drop of 10% potassium hy-
droxide was placed on it (whiff test). A fishy amine odor was
recorded as a positive whiff test.
Bacterial vaginosis (BV) was also diagnosed using the
Amsel's composite criteria, which suggests that BV should be
suspected if three or more of the following criteria were pre-
sent: homogeneous vaginal discharge, elevated vaginal
pH > 4.5, production of amine odor in whiff test, and presence
of clue cells. Women with less than three of the criteria were
considered as normal.21
2.5. Urine analysis
Each woman was instructed by a staff nurse regarding the
proper collection of the urine sample. The urine was cultured
by the surface streak method on two SBA plates and two
MacConkey agar plates using 1-mL and 10-mL plastic cali-
brated loops (Pbi, Italy), incubated aerobically for 48 hours at
35e37 C.22 Only plates with  10 colonies were consid-
ered.23 The counts were calculated as colony forming units
(CFU)/mL and were placed in one of the following groups: no
growth to < 103,  103 to < 104,  104 to < 105, and  105.
Only growth of one or two isolates of possible uropathogens at
a concentration of  103 CFU/ml was considered, and these
isolates were identified. Cultures growing  3 isolates or any
urethral nonuropathogen flora (diphtheroids, viridans strepto-
cocci, lactobacilli, coagulase-negative Staphylococci other
than Staphylococcus saprophyticus, and Bacillus spp.) were
not identified.24
Different biochemical tests were used for microorganism
identification including colony characteristics, Gram stain
and wet mount, catalase test (3%), growth on Mannitol salt
agar (Oxoid, UK), Dry Spot Staphytect Plus kit (Oxoid, UK),
disk susceptibility with Polymyxin B (300 units, Oxoid, UK)
and Novobiocin (5 mg, Oxoid, UK), oxidase sticks (Oxoid,
UK), RapID STR system (Remel, USA), RapID CB plus
system (Remel, USA), RapID ONE system (Remel, USA),
and RapID SS/u system (Remel, USA). All tests were done
according to the manufacturer's instructions. Thereafter, the
germ tube test was performed for identification of Candida
albicans.22
2.6. Statistical analysis
The tests of two or more proportions were done using
Fisher's exact test. The p values were from two sample-tailed
tests (http://www.physics.csbsju.edu/stats/exact.html). Anal-
ysis of variance test was used to compare continuous data,
such as age and weight between different groups, by the Excel
program after checking data normality using a studentized
range test. Odds ratio (OR) and 95% confidence intervals (CI)
were also calculated for different bacterial forms that were
significantly associated with PTL (http://vassarstats.net/). A p
value < 0.05 was considered significant.
3. Results
There was no significant difference in the pregnancy
outcome based on the most tested demographic characteristics
(data not shown). In addition, there was no significant differ-
ence in the mean age, weight, or height between the PTL
group and control (TL) group ( p > 0.05) as shown in Table 2;
however, 28.36% of the total PTL women were
aged < 20 years compared with only 9.3% of the TL group
( p < 0.05).

Table 1
Primer sequences used in PCR identification of pathogenic microorganisms and their corresponding amplicon size.
Name of microorganism Primer sequence Amplicon size (bp) Reference
Chlamydia trachomatis F: 50 -TCCGGAGCGAGTTACGAAGA-30
R: 50 -AATCAATGCCCGGGATTGGT-30 241 14
Neisseria gonorrhoeae F: 50 -GCTACGCATACCCGCGTTGC-30
R: 50 -CGAAGACCTTCGAGCAGACA-30 390 15
Mycoplasmas and ureaplasmas (genus-specific) F: 50 -GTAATACATAGGTCGCAAGCGTTATC-30
R: 50 - CACCATCTGTCACTCTGTTAACCTC-30 520 16
Mycoplasma genitalium F: 50 -AGTTGATGAAACCTTAACCCCTTGG-30
281 17
R: 50 - CCGTTGAGGGGTTTTCCATTTTTGC-30
Mycoplasma hominis F: 50 -CAATGGCTAATGCCGGATACGC-30
R: 50 - GGTACCGTCAGTCTGCAAT-30 334 18
Ureaplasma F: 50 -GTATTTGCAATCTTTATATGTTTTCG-300 403, 404 (Ureaplasma parvum)
19
R: 50 - CAGCTGATGTAAGTGCAGCATTAAATT C-3 448 (Ureaplasma urealyticum)
bp ¼ base pair; F ¼ forward primer; R ¼ reverse primer.

Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007
 + MODEL

4 A.E.-D.M.S. Hosny et al. / Journal of the Chinese Medical Association xx (2017) 1e7

Table 2 group ( p < 0.05; Table 2). A positive whiff test was signifi-
Comparison of demographic characteristics, pregnancy history, vaginal cantly more common in the PTL group than in the control
bleeding, and results of speculum examination among preterm and term labor
women.
group ( p < 0.01; Table 2).
Characteristics Total PTL cases TL (control) p
3.4. Microbiology
Demographic characteristics
Age (y) 23.13 ± 5.29 (N ¼ 70) 24.45 ± 4.81 (N ¼ 44) 0.1822
Weight (kg) 68.31 ± 13.52 (N ¼ 61) 71.1 ± 11.92 (N ¼ 41) 0.2869
3.4.1. Identification of vaginal microorganisms
Height (cm) 159.69 ± 4.52 (N ¼ 61) 160.05 ± 4.84 (N ¼ 41) 0.7023 N. gonorrhoeae and M. genitalium were not detectable;
Gestational age at 32.38 ± 3.56 (N ¼ 52) 38.91 ± 1.08 (N ¼ 45) < 0.001 thus, they were not considered further. The isolation of group
labor (wk) B streptococci, C. trachomatis and Ureaplasma was compa-
Age < 20 y (No. 19/67 (28.36) 4/43 (9.30) 0.017 rable between the two groups ( p > 0.05; Table 3). Vaginal
with
characteristic/
infection with T. vaginalis was significantly more common in
total no.) (%) the PTL group than in the TL group (49.21% vs. 28.89,
Pregnancy history (No. with characteristic/total no.) (%) p < 0.05; Table 3). There was a two-fold increase in the risk of
1 parous or more 36/72 (50) 31/45 (68.89) PTL in the group infected with T. vaginalis compared with the
Nulliparous 7/72 (9.72) 0/45 (0) 0.032 noninfected group (OR ¼ 2.38, 95% CI ¼ 1.06e5.37,
Primigravida 29/72 (40.28) 14/45 (31.11)
History of PTB 7/43 (16.28) 0/31 (0) 0.037
p < 0.05; Table 4). M. hominis was significantly more detect-
excluding able in the PTL group ( p < 0.05; Table 3).
primigravida Except for coryneforms, the heavy vaginal growth of aer-
History of 16/43 (37.21) 2/31 (6.45) 0.002 obic microorganisms was similar between the two groups
abortion ( p > 0.05; Table 3). Only coryneform heavy vaginal growth
excluding
primigravida
was significantly more common in the PTL group than in the
Menses vaginal 10/66 (15.15) 1/44 (2.27) 0.047 control group ( p < 0.01; Table 3). There was a 20-fold in-
bleeding crease in the risk of PTL in the group with heavy vaginal
Speculum examination (No. with characteristic/total no.) (%) growth of coryneform compared with the group that did not
Vaginal pH  4.5 27/63 (42.8) 24/43 (55.81) show such growth (OR ¼ 20.64, 95% CI ¼ 1.19e356.58,
Vaginal pH ¼ 5 23/63 (36.5) 18/43 (41.86) 0.017
Vaginal pH > 5 13/63 (20.6) 1/43 (2.33)
p < 0.05; Table 4).
Whiff test positive 37/66 (56.06) 11/44 (25) 0.002
PTB ¼ preterm birth; PTL ¼ preterm labor; TL ¼ term labor.
Data are presented as mean ± SD. Table 3
Comparison of microbiological characteristics among preterm and term labor
women.
3.1. Pregnancy history Characteristic (No. with Total PTL cases TL (control) p
characteristic/total no.) (%)
The PTL group showed a significantly higher number of Vaginal infection
nulliparous women than the TL group (9.72% vs. 0%, GBS positive 12/71 (16.9) 4/45 (8.89) 0.277
p < 0.05). This group also recorded significantly higher fre- Chlamydia trachomatis positive 1/72 (1.39) 1/45 (2.22) > 0.99
Ureaplasma positive 26/72 (36.11) 22/45 (48.89) 0.183
quencies of both previous PTB and abortions, excluding pri- Trichomonas vaginalis positive 31/63 (49.21) 13/45 (28.89) 0.047
migravidas, than the TL group ( p > 0.05 vs. p < 0.01), as Mycoplasma hominis positive 11/72 (15.28) 1/45 (2.22) 0.028
indicated in Table 2. Gram-positive cocci a 10/72 (13.89) 7/45 (15.56) > 0.99
Coryneforms a,b 13/72 (18.06) 0/45 (0) 0.002
3.2. Medical complications Gram-negative bacilli a 4/72 (5.56) 1/45 (2.22) 0.648
Candida a 5/72(6.94) 5/45 (11.11) 0.5050
Lactobacilli a 35/72 (48.61) 19/39 (48.72) > 0.99
Only menses vaginal bleeding during pregnancy was Growth of Gram-negative bacilli 43/72 (59.72) 17/45 (37.78) 0.024
significantly more common in the PTL group than in the TL at any streak
group (15.15% vs. 2.27%, p < 0.05; Table 2). However, other Growth of lactobacilli at any 58/72 (80.56) 33/39 (84.62) 0.797
tested medical complications were comparable between the streak
Urine bacterial count
two groups (data not shown). > 103 CFU/mL 58/72 (80.56) 42/45 (93.34) 0.129
 103 to < 104 CFU/mL 3/72 (4.17) 2/45 (4.44)
3.3. Speculum examination  104 to < 105 CFU/mL 5/72 (6.94) 1/45 (2.22)
 105 CFU/mL 6/72 (8.33) 0/45 (0)
The presence of vaginal discharge or other signs of infec- CFU ¼ colony forming unit; GBS ¼ group B Streptococci; PTL ¼ preterm
tion, such as bleeding, erythema, eruptions, warts, ulcerations, labor; TL ¼ term labor.
a
Presence of characteristic growth at the third or fourth streak.
or inguinal adenopathy, on speculum examination did not b
Coryneforms: Brevibacterium spp. (group B) in nine cases, Arcanobacte-
differ significantly between the two groups ( p > 0.05) (data rium pyogenes, Acinetobacter calcoaceticus, and Corynebacterium minu-
not shown). A vaginal pH of > 5 (very abnormal pH) was tissimum each in one case and a mixed Brevibacterium spp. (group B) and
significantly more common in the PTL group than in the TL Corynebacterium minutissimum in one case.

Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007
 + MODEL
A.E.-D.M.S. Hosny et al. / Journal of the Chinese Medical Association xx (2017) 1e7
Table 4
Calculated odds ratio for factors associated with preterm labor.
Infection N (total cases in TL and PTL groups)
Trichomonas vaginalis infection (þve) 44
Trichomonas vaginalis infection (ve) 64
Gram negative bacilli infection (þve) 60
Gram negative bacilli infection (ve) 57
Coryneforms heavy vaginal growth (þve) 13
Coryneforms heavy vaginal growth (ve) 104
OR ¼ odds ratio; CI ¼ confidence interval; PTL ¼ preterm labor; TL ¼ term labor.
When considering any vaginal growth of Gram-negative
bacilli and not only heavy growth, this type of growth was
significantly more common in the PTL group than in the TL
group ( p < 0.05; Table 3). There was a two-fold increase in
the risk of PTL when taking into consideration any vaginal
Gram-negative bacilli infection compared with the group
showing no such infection (OR ¼ 2.4, 95% CI ¼ 1.1e5.2,
p < 0.05; Table 4).
3.4.2. Gram staining of vaginal smears
There was no significant difference in the vaginal grade, the
presence of clue cells, or BV diagnosed by the Amsel method
between the PTL and TL groups (data not shown).
3.5. Urinary tract infection
The urine samples colony count did not differ significantly
between the two groups ( p ¼ 0.129; Table 3). All detected
uropathogens were comparable among the two groups (data
not shown).
4. Discussion
Several factors have been documented to be associated with
PTL. However, only a few of these factors were found to be
associated with PTL in this study, which further highlighted
their importance. These factors included women aged < 20
years, as noted in other studies.4 A plausible biological
explanation may be incomplete maternal physical growth and
relative malnutrition.25 On the contrary, women aged > 35
years, associated with PTL in the same study,4 were not
associated with PTL in this study. This may be due to the
small number of women in this age group who were included
in the study (3 women in each of the TL and PTL group) or
that the risk in this age group arose from the presence of
chronic diseases where women with chronic diseases were
excluded in our study.25
As recorded previously, there was an association between
nulliparous women as well as previous preterm delivery or
previous abortion and PTL.5,25 This may be due to the presence
of complications during childbirth in nulliparous women, such
as obstructed labor, or due to an increased risk of uterine
infection during a prior abortion that can lead to PTB.25,26
Furthermore, in accordance with the results of earlier studies,
intense vaginal bleeding (not spotting) was highly associated
with PTL. The association between vaginal bleeding and PTL
Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007
5
N with PTL Rate of PTL (%) OR (95% CI) p
31 70.45 2.38 (1.06e5.37)
32 50.00 Reference 0.0468
43 71.67 2.4 (1.1e5.2)
29 50.88 Reference 0.02
13 100 20.64 (1.19e356.58)
59 56.7 Reference 0.037
may be due to the consequent thrombin production, which
stimulates uterine contractions as well as proteolytic activity
that can lead to PPROM. In addition, this bleeding may be an
indicator of infection or inflammation.27 As demonstrated in
other studies, vaginal pH > 5 was associated with PTL. This
may be due to the fact that elevated pH is a sign of inflammation
or infection of the endometrium or amniotic fluid with subse-
quent PTL.28
Some studies have suggested an association between BV
and PTL due to released proteolytic enzymes and elevated pH,
which can increase the risk of BV by 10-fold.29 The detection
of BV did not differ significantly between the two groups.
Similar results were reported by Discacciati et al30 and Ver-
straelen et al.31 However, several tested bacterial species were
found to be associated with PTL namely T. vaginalis, M.
hominis, and coryneform bacteria. Furthermore, similar results
were previously reported.31e33 Group B streptococci were
suspected of being associated with PTL; however, this was not
the case in our study as well as in some other studies.30e34 As
only one chlamydial infection was detected in the PTL and TL
groups, this study cannot be relied upon to help prove the
association between PTL and chlamydial infection.
This study results also do not support the claimed associ-
ation between Ureaplasma urealyticum and PTL.35 On the
contrary, this study recorded a higher prevalence of these
species in the TL than in the PTL group, which may be due to
the fact that 60% of healthy women carry U. urealyticum in
their urogenital tract.36 All heavy growing aerobic bacteria,
except coryneforms, were not associated with PTL. Gram-
negative bacilli were associated with PTL when any growth
(whether heavy or not) was used in statistical analysis. This
supports the claim that Gram-negative bacilli are important
placental pathogens responsible for subclinical chorioamnio-
nitis and PTB.33
Consistent with other studies, we found no significant as-
sociation between Candida infection and PTL. Also, lactoba-
cilli, which are the predominating genus in vaginal microbiota
and play an important role in maintaining the natural healthy
balance of these organisms, were found to play a role in PTL
risk. Their absence was associated with PTL in some studies
but not in this study and other studies.12,24 This may be
attributed to other factors that have not been addressed in this
study, such as the diversity of lactobacilli which affects
pregnancy duration.37
Most studies recommend considering a urine culture with
more than 105 CFU/mL as indicative of the presence of
 + MODEL
6 A.E.-D.M.S. Hosny et al. / Journal of the Chinese Medical Association xx (2017) 1e7
urinary tract infection in PTL women.38 In our study popu-
lation, none of the tested urine culture count criteria was
significantly associated with PTL, although a urine culture
colony count of more than 105 CFU/mL was detectable only in
the PTL group. This may be due to the fact that low-count
bacteriuria might be an early phase of urinary tract infection
but not a true infection and due to the lower number detected
of  105 CFU/mL in PTL group (8.33%).39
There were several limitations to this study. First, it is a
one-hospital study and therefore, may not reflect the true
Egyptian population. Second, screening for other infections
associated with PTL, such as hepatitis B, HIV, and syphilis,
were not conducted in our study.1
In conclusion, although several factors were considered as
risk factors for PTL, only a few of them were significantly
associated with PTL in this study. Most of these factors could
be attributed to suspected infection. However, special attention
should be given to nulliparous women, women showing signs
of vaginal infection such as bleeding, and high vaginal pH.
Infection control during abortion or labor is required to avoid
its adverse effect on subsequent pregnancies. Therefore, it is
recommended to detect and treat infections with T. vaginalis,
M. hominis, Gram-negative bacilli, and coryneform bacteria to
avoid their effect on pregnancy outcome in this population.
Larger studies on Egyptian women are needed to support our
findings. This study raises a question about other documented
risk factors which were proved not to be associated with PTL
in this study, such as infection with group B streptococci and
U. urealyticum. These factors need to be reevaluated to
determine if any other associated conditions and mechanisms
are responsible for their previously recorded association with
PTL rather than the infection itself.
References
1. Cram LF, Zapata MI, Toy EC, Baker 3rd B. Genitourinary infections and
their association with preterm labor. Am Fam Physician 2002;65:241e8.
2. Al-Dabbagh SA, Al-Taee WY. Risk factors for pre-term birth in Iraq: a
case-control study. BMC Pregnancy Childbirth 2006;6:13.
3. Savitz DA, Kaufman JS, Dole N, Siega-Riz AM, Thorp Jr JM, Kaczor DT.
Poverty, education, race and pregnancy outcome. Ethn Dis 2004;14:322e9.
4. Ko YL, Wu YC, Chang PC. Physical and social predictors for pre-term
births and low birth weight infants in Taiwan. J Nurs Res 2002;10:83e9.
5. Ezechi OC, Makinde ON, Kalu BE, Nnatu SN. Risk factors for preterm
delivery in south western Nigeria. J Obstet Gynaecol 2003;23:387e91.
6. El-Shourbagy M, Abd-el-Maeboud K, Diab KM, el-Ghannam A,
Nabegh L, Ammar S. Genital Chlamydia trachomatis infection in Egyp-
tian women: incidence among different clinical risk groups. J Obstet
Gynaecol Res 1996;22:467e72.
7. Darwish A, Elnshar EM, Hamadeh SM, Makarem MH. Treatment options
for bacterial vaginosis in patients at high risk of preterm labor and pre-
mature rupture of membranes. J Obstet Gynaecol Res 2007;33:781e7.
8. Dimetry SR, El-Tokhy HM, Abdo NM, Ebrahim MA, Eissa M. Urinary
tract infection and adverse outcome of pregnancy. J Egypt Public Health
Assoc 2007;82:203e18.
9. Buhimschi IA, Christner R, Buhimschi CS. Proteomic biomarker analysis
of amniotic fluid for identification of intra-amniotic inflammation. BJOG
2005;112:173e81.
10. Holst E, Goffeng AR, Andersch B. Bacterial vaginosis and vaginal mi-
croorganisms in idiopathic premature labor and association with preg-
nancy outcome. J Clin Microbiol 1994;32:176e86.
Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007
11. Schrag S, Gorwitz R, Fultz-Butts K, Schuchat A. Prevention of perinatal
group B streptococcal disease. Revised guidelines from CDC. MMWR
Recomm Rep 2002;51:1e22.
12. Poch F, Levin D, Levin S, Dan M. Modified thioglycolate medium: a
simple and reliable means for detection of Trichomonas vaginalis. J Clin
Microbiol 1996;34:2630e1.
13. Carey JC, Klebanoff MA. Is a change in the vaginal flora associated with
an increased risk of preterm birth? Am J Obstet Gynecol 2005;192:
1341e6.
14. Mahony JB, Luinstra KE, Sellors JW, Jang D, Chernesky MA. Confir-
matory polymerase chain reaction testing for Chlamydia trachomatis in
first-void urine from asymptomatic and symptomatic men. J Clin
Microbiol 1992;30:2241e5.
15. Ho BS, Feng WG, Wong BK, Egglestone SI. Polymerase chain reaction
for the detection of Neisseria gonorrhoeae in clinical samples. J Clin
Pathol 1992;45:439e42.
16. Yoshida T, Maeda S, Deguchi T, Miyazawa T, Ishiko H. Rapid detection
of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum,
and Ureaplasma urealyticum organisms in genitourinary samples by PCR-
microtiter plate hybridization assay. J Clin Microbiol 2003;41:1850e5.
17. Jensen JS, Uldum SA, Søndergård-Andersen J, Vuust J, Lind K. Poly-
merase chain reaction for detection of Mycoplasma genitalium in clinical
samples. J Clin Microbiol 1991;29:46e50.
18. Blanchard A, Y
a~nez A, Dybvig K, Watson HL, Griffiths G, Cassell GH.
Evaluation of intraspecies genetic variation within the 16S rRNA gene of
Mycoplasma hominis and detection by polymerase chain reaction. J Clin
Microbiol 1993;31:1358e61.
19. Fanrong K, James G, Zhenfang M, Gordon S, Wang B, Gilbert GL.
Phylogenetic analysis of Ureaplasma urealyticumesupport for the estab-
lishment of a new species, Ureaplasma parvum. Int J Syst Bacteriol 1999;
49:1879e89.
20. Hay PE, Lamont RF, Taylor-Robinson D, Morgan DJ, Ison C, Pearson J.
Abnormal bacterial colonisation of the genital tract and subsequent pre-
term delivery and late miscarriage. BMJ 1994;308:295e8.
21. Amsel R, Totten PA, Spiegel CA, Chen KC, Eschenbach D, Holmes KK.
Nonspecific vaginitis. Diagnostic criteria and microbial and epidemiologic
associations. Am J Med 1983;74:14e22.
22. Winn Jr WC, Allen SD, Janda WM, Koneman EW, Schreckenberger PC,
Procop GW, et al. Konemann's Color Atlas and textbook of diagnostic
microbiology. 6th ed. Philadelphia: Lippincott Williams & Wilkins;
2006.
23. Frimodt-Møller N, Espersen F. Evaluation of calibrated 1 and 10 microl
loops and dipslide as compared to pipettes for detection of low count
bacteriuria in vitro. APMIS 2000;108:525e30.
24. Semeniuk H, Church D. Evaluation of the leukocyte esterase and nitrite
urine dipstick screening tests for detection of bacteriuria in women with
suspected uncomplicated urinary tract infections. J Clin Microbiol 1999;
37:3051e2.
25. Kozuki N, Lee AC, Silveira MF, Sania A, Vogel JP, Adair L, et al. Child
Health Epidemiology Reference Group (CHERG) Small-for-Gestational-
Age-Preterm Birth Working Group. The associations of parity and
maternal age with small-for-gestational-age, preterm, and neonatal and
infant mortality: a meta-analysis. BMC Public Health 2013;13:S2.
26. Dragoman M, Sheldon WR, Qureshi Z, Blum J, Winikoff B, Ganatra B,
WHO Multicountry Survey on Maternal Newborn Health Research
Network. Overview of abortion cases with severe maternal outcomes in
the WHO Multicountry Survey on Maternal and Newborn Health: a
descriptive analysis. BJOG 2014;121:25e31.
27. Yang J, Hartmann KE, Savitz DA, Herring AH, Dole N, Olshan AF, et al.
Vaginal bleeding during pregnancy and preterm birth. Am J Epidemiol
2004;160:118e25.
28. Simhan HN, Caritis SN, Krohn MA, Hillier SL. Elevated vaginal pH and
neutrophils are associated strongly with early spontaneous preterm birth.
Am J Obstet Gynecol 2003;189:1150e4.
29. Jakovljevi
c A, Bogavac M, Nikoli
c A, Tosi
c MM, Novakovi
c Z, Staji
c Z.
The influence of bacterial vaginosis on gestational week of the completion
of delivery and biochemical markers of inflammation in the serum. Voj-
nosanit Pregl 2014;71:931e5.
 + MODEL

A.E.-D.M.S. Hosny et al. / Journal of the Chinese Medical Association xx (2017) 1e7 7

30. Discacciati MG, Simoes JA, Silva MG, Marconi C, Brolazo E, Costa ML,
et al. Microbiological characteristics and inflammatory cytokines associ-
ated with preterm labor. Arch Gynecol Obstet 2011;283:501e8.
31. Verstraelen H, Verhelst R, Roelens K, Claeys G, Weyers S, De Backer E,
et al. Modified classification of Gram-stained vaginal smears to predict
spontaneous preterm birth: a prospective cohort study. Am J Obstet
Gynecol 2007;196:528.e1e6.
32. Mann JR, McDermott S, Gill T. Sexually transmitted infection is
associated with increased risk of preterm birth in South Carolina
women insured by Medicaid. J Matern Fetal Neonatal Med 2010;23:
563e8.
33. Donders GG, Van Calsteren K, Bellen G, Reybrouck R, Van den Bosch T,
Riphagen I, et al. Predictive value for preterm birth of abnormal vaginal
flora, bacterial vaginosis and aerobic vaginitis during the first trimester of
pregnancy. BJOG 2009;116:1315e24.
34. Seyyed EZ, Toossi E, Jalalvand A, Sajadi M. Group B streptococci
investigation in pre-term labors. Med Arh 2013;67:124e5.
35. Vouga M, Greub G, Prod'hom G, Durussel C, Roth-Kleiner M,
Vasilevsky S, et al. Treatment of genital mycoplasma in colonized preg-
nant women in late pregnancy is associated with a lower rate of premature
labor and neonatal complications. Clin Microbiol Infect 2014;20:1074e9.
36. Nassar FA, Abu-Elamreen FH, Shubair ME, Sharif FA. Detection of
Chlamydia trachomatis and Mycoplasma hominis, genitalium and Ure-
aplasma urealyticum by polymerase chain reaction in patients with sterile
pyuria. Adv Med Sci 2008;53:80e6.
37. Petricevic L, Domig KJ, Nierscher FJ, Sandhofer MJ, Fidesser M,
Krondorfer I, et al. Characterisation of the vaginal Lactobacillus micro-
biota associated with preterm delivery. Sci Rep 2014;4:5136.
38. Jain V, Das V, Agarwal A, Pandey A. Asymptomatic bacteriuria & ob-
stetric outcome following treatment in early versus late pregnancy in north
Indian women. Indian J Med Res 2013;137:753e8.
39. Kunin CM, White LV, Hua TH. A reassessment of the importance of “low-
count” bacteriuria in young women with acute urinary symptoms. Ann
Intern Med 1993;119:454e60.

Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas
vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/
j.jcma.2016.10.007