Vous êtes sur la page 1sur 24

Une brève histoire de la génétique

•1866 découverte des lois de Mendel

•1900-1910 théorie chromosomique de l’hérédité

•1928 transformation bactérienne

•1944 identification de l’ADN comme vecteur d’hérédité

•1953 la double hélice

•1970 le clonage de l’ADN

•2002 séquence du génome humain


Unité du monde vivant
Grandes similarités de constitution et d’organisation:

•Les acides nucléiques véhiculent des informations

•Une même lecture de l’information: code génétique

Génotype phénotype

•Ascendance commune (Darwin)


• in vivo ADN
Transcription

ARN
Traduction

protéine
L’ADN permet l’autorenouvellement
du vivant dans un contexte cellulaire
Diversité des organismes vivants
• Une grande variété de « formes »
• Des millions d’organismes vivants (espèces)
Qu’est ce qu’une espèce?
Ensemble d’individus susceptibles d’échanger
préférentiellement du matériel génétique

Présentant une similarité de génotype plus


grande entre individus de la même espèce
qu’avec des individus d’une autre espèce

Présentant une similarité de phénotype


Polymorphisme des individus au sein des espèces

Polymorphisme des Phénotypes

AGTCGGTAGCAGTAGATAATG
environnement

Polymorphisme des Génotypes

AGTCGGTAGCGGTAGATAATG
Apparition de la nouveauté: Reproduction
« presque » à l’identique

•Mutation
•Recombinaison
•Rôle particulier de la reproduction sexuée

Transmission

•Variations neutres, dérive génétique


•Variations sélectionnées
•Polymorphisme des individus

•Isolement reproductif

•Différences génotypiques et phénotypiques

•Sélection

Evolution des espèces, spéciation


Grandes lignes d’une classification du vivant

• Procaryotes/eucaryotes,
unicellulaires/multicellulaires

• Phylogénie
eubactéries archéobactéries

VIRUS
mitochondries
eucaryotes
Organisation du gène eucaryote

promoteur ADN
EXON 1 EXON 2 EXON3 EXON 4
TRANSCRIPTION
ARN transcrit primaire
EPISSAGE

ARNm
AUG UGA

TRADUCTION
protéine
Beaucoup de gènes codent pour des protéines
ayant une structure modulaire

Récepteurs de cytokines
Recombinaison du génome:
Diversité combinatoire au cours de l’évolution

ADN

Recombinaison dans des introns


Nouvelle combinaison des exons
Notions de taille des gènes eucaryotes

• Exons: 150-200 nucléotides en moyenne


• Introns: très variable selon les espèces et selon
les gènes
• Nombre d’exons par gène: de 1 à plusieurs
centaines (souvent autour de 10-20)
Epissage alternatif:
Diversité combinatoire dans l’expression génétique

P1 P2

EXON 1A EXON 1B EXON 2 EXON 3

EX 1A EX 2 EX 3 EX 1B EX 2 EX 3
EXON 1 EXON 2A EXON 2B EXON 3

TRANSCRIPTION
EPISSAGE

EX 1 EX 2A EX 3 EX 1 EX 2B EX 3

Diversité fonctionnelle des isoformes protéiques


Hypothèses la fonction des introns

• Source d’ARNs non codant pour des


protéines
• Source d’éléments de régulation
• Générateurs de diversité par épissage
alternatif
• Permettant le partage de domaines entre
différents gènes par recombinaison
• ADN « égoïste »
Organisation des génomes

Espèces nucléotides gènes % ADN


codant
E. coli ~ 4,2 x 106 ~ 4000 ~ 90

Levure 1,3 x 107 ~ 7000 ~ 70

H. sapiens 3,0 x 109 ~ 30 000 ~ 10


ORGANISATION DU GENOME HUMAIN

GENOME HUMAIN
3200 MB

ADN intergénique:
Gènes: 1200 Mb 2000 MB

Séquences
Autres: 600 MB
répétées: 1400 MB
Gains et perte de gènes, évolution par duplication
Familles de gènes

duplication

Mutations

Mécanismes de duplication: recombinaison inégale


duplication chromosomique

10 000 à 50 000 gènes codant pour de l’ARN ribosomique


ADN répété non codant
Type de Taille du Nombre de localisation
répétition motif copies
En tandem

•DNA satellite α 171 8x105 Centromères


•Minisatellites 6 104 Télomères
télomériques
•Minisatellites 104
6-65
hypervariable
•microsatellites 1-5 5x105

Dispersées
Line 6000 106

Alu 300 106


•Minisatellites télomériques: (TTAGGG)n

•Microsatellites: (GT)n ou (ATT)n avec n compris entre 1 et 5

•Grand polymorphisme de ces séquences (n variable)


AGCCCATGAGTGTGTGTGTGTGTGTATTTGGA

AGCCCATGAGTGTGTGTGTATTTGGA
rétrotransposition

ARN

ADN
POL POLYA

LINE 6000 nt

POLYA

ALU

PSEUDOGENE SANS INTRON

Un petit nombre de séquences LINE et ALU sont « actives »

La rétrotransposition peut entraîner des anomalies génétiques