Int. J.

Devl Neuroscience 23 (2005) 287–297

Maternal administration of thalidomide or valproic acid causes abnormal

serotonergic neurons in the offspring: implication for
pathogenesis of autism
Kaoru Miyazaki, Naoko Narita∗ , Masaaki Narita
Neurobiology Laboratory, Institute of Basic Medical Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba-City, Ibaraki 305-8575, Japan
Received 18 February 2004; received in revised form 19 April 2004; accepted 3 May 2004

Abstract
Embryonic exposure to thalidomide (THAL) or valproic acid (VPA) before neural tube closure has been demonstrated as a useful model
for human autism in rats. Abnormalities of the serotonergic system which are often observed in human autism have been shown in these
rats. Thus, we examined whether early serotonergic neuronal development is perturbed by THAL/VPA. When pregnant rats were exposed
to THAL or VPA on embryonic day 9, a dramatic shift of the distribution of serotonergic neurons in the dorsal raphe nucleus was observed
on postnatal day 50. This alteration is thought to reflect abnormality of serotonergic neuronal differentiation and migration. In vitro studies
revealed that VPA retards the maturation of serotonergic neuron from ES cell-derived neuronal progenitors, whereas exogenously added
Sonic hedgehog, a morphogen that has been implicated in serotonergic cell fate, partially prevented this retardation. These results indicate
that disruption of early serotonergic neuronal development might be involved in the etiology of autism.
© 2004 ISDN. Published by Elsevier Ltd. All rights reserved.
Keywords: Autism; Animal model; Differentiation; Migration; Raphe; Serotonin

1. Introduction 5-HT levels remain high in some brain regions throughout

Autism is a congenital neurological disorder charac-
terized by impairment of socialization, abnormalities of
communication, limited activity and curiosity (Charman
and Baird, 2002; Filipek et al., 1999). Dysfunctions of
the serotonergic system have been implicated in autism.
The serotonergic system appears to be developmentally
dysregulated in autism. Early work showed high levels of
serotonin (5-hydroxytryptamine, 5-HT) in blood platelets
of autistics (Anderson et al., 1987, 1990b; Betancur et al.,
2002; Cook et al., 1993). More recently, PET imaging with
radiolabelled l-tryptophan has demonstrated asymmetries
in 5-HT synthesis in the dentato-thalamo-cortical pathway
of autistic boys, such that 5-HT synthesis was decreased in
left frontal cortex and thalamus, but elevated in the right
dentate nucleus (Chugani et al., 1997; Chugani and Muzik,
2000; Chugani and Chugani, 2000). It was also shown that,
while brain 5-HT synthesis is normally high in young chil-
dren (>200% of adult up to 5 years) followed by a gradual
decline, this dynamic is disrupted in autistics such that
∗ Corresponding author. Tel.: +81 29 8536962; fax: +81 29 8646510.
E-mail address: nnarita@md.tsukuba.ac.jp (N. Narita).
development (Chugani et al., 1999a,b; Chugani, 2002).
Recent epidemiological studies revealed that thalidomide
(THAL) or valproic acid (VPA) exposure during the first
trimester in humans causes higher incidence of autism in
the offspring (Stromland et al., 1994; Williams et al., 2001).
Subsequently, morphological abnormalities similar to those
found in autism (e.g. cerebellar anomalies, reduced motor
neuron numbers) have been reported in animals exposed
to these teratogens prenatally (Ingram et al., 2000; Rodier
et al., 1997), suggesting the feasibility of these animals as
an experimental autistic model.
Along these lines, we have recently established an autism
model rat by prenatal THAL or VPA exposure (Narita et al.,
2002). In these rats, we showed a dramatic increase of 5-HT
concentrations in the brain and blood. Interestingly, these
biochemical abnormalities were observed only when ani-
mals were exposed to teratogens on embryonic day (E) 9, the
timing within the critical period window (human E20-24)
for the occurrence of autism in humans (Rice and Barone,
2000).Expression of the serotonergic phenotype begins on
E12 just caudal to the mesencephalic flexure in rats (Aitken
and Tork, 1988; Konig et al., 1988; Lidov and Molliver,
1982; Wallace and Lauder, 1983). However, progenitors of

0736-5748/$30.00 © 2004 ISDN. Published by Elsevier Ltd. All rights reserved.

doi:10.1016/j.ijdevneu.2004.05.004
288 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297
serotonergic neurons are known to appear already on E9 at
the isthmus, a junction between midbrain and hindbrain. The
precise mechanism whereby serotonergic neurons correctly
differentiate and migrate towards raphe nuclei remains un-
clear, but several molecules such as fibroblast growth factor
(FGF) 4, FGF8, and Sonic hedgehog (Shh) are known to
play important roles to lead serotonergic precursors to ap-
propriate differentiation and migration. Other factors, such
as an ETS-domain transcription factor Pet-1, that are in-
volved in the serotonergic neuronal development are also
known (Cheng et al., 2003; Hendricks et al., 1999b, 2003).
Since autism induced by THAL/VPA in humans is
due to fetal exposure to these teratogens within a crit-
ical period window (Ardinger et al., 1988; Stromland
et al., 1994), and since rat E9 is considered to be in-
cluded within this period, our rat autism model is useful
to elucidate the relationship between autistic pathogene-
sis and serotonergic neuronal dysfunction. Therefore, we
examined whether these teratogens might modify seroton-
ergic neuronal differentiation and migration in our animal
model.
2. Materials and methods
2.1. Animals and teratogen exposure
All animal experiments were approved by the Community
of Laboratory Animal Research Center at the University of
Tsukuba, Japan. Details of the teratogen administration have
been described elsewhere (Narita et al., 2002). In brief, fe-
male Wistar rats (SEASCO, Saitama, Japan, 10 weeks old)
were mated overnight. The day of insemination was des-
ignated E1. On E9 at 3 o’clock p.m., 500 mg/kg THAL,
800 mg/kg VPA, or vehicle was administered orally to the
rats of each group without sedation using an infant feeding
tube (Atom Medical, Tokyo, Japan) attached to a 2.5 ml dis-
posable syringe. For determination of the doses of THAL
and VPA, we referred to previous animal experiments us-
ing these teratogens (Ingram et al., 2000; Matsubara and
Mikami, 1985). THAL (Wako, Osaka, Japan) was prepared
by dissolving in 5% arabic gum (Wako, Osaka, Japan) in
distilled water, and 5% arabic gum in distilled water was
used as vehicle treatment. VPA was prepared by dissolving
2-propylpentanoic acid (Sigma, MO, USA) in distilled water
adjusted to pH 9.6 with sodium hydroxide. The dams were
then housed back individually and were allowed to continue
their pregnancy or to raise their own litters.
2.2. Tissue 5-HT immunohistochemistry
Since 5-HT activity is influenced by periodicity of hor-
monal cycle in females, only male animals were used for
brain 5-HT immunostaining on postnatal day (PN) 50. Each
animal was deeply anesthetized with pentobarbital, and
perfused through the ascending aorta with PBS, followed
by a 4% paraformaldehyde/0.1 M phosphate buffer, pH 7.3
(0.1 M PB). Then the whole brain was dissected out and
post-fixed with 4% paraformaldehyde/0.1 M PB at 4 ◦ C,
followed by cryoprotection by immersion in graded sucrose
of 5, 15, 30% in 0.1 M PB. Then the tissue was frozen by
dry ice/isopentane. Coronal serial sections were cut at a
thickness of 40 ␮m on a freezing microtome, and every third
section was used for 5-HT immunohistochemistry staining.
The free-floating sections were pretreated overnight with
0.3% triton X-100/0.01 M PBS, then were blocked by 5%
normal goat serum (NGS, Invitrogen, Carlsbad, CA, USA),
prior to an incubation with anti-5-HT antiserum (at 1:10,000
dilution for 4 h at 37 ◦ C,) (Chen et al., 1997). Biotinated
anti-rabbit antibody (Vector Laboratories, Burlingame, CA,
USA) was used as the secondary antibody, at 1:400 dilution
for 1 h, followed by a Vecstastain ABC kit (Vector Lab-
oratories). Sections adjacent to each immunostained sec-
tion were Nissle stained and precise alignment among the
groups was performed using The Rat Brain in Stereotaxic
Coordinates (Paxinos and Watson, 1998).
2.3. Direct counting of 5-HT immunostaining in the dorsal
raphe nucleus
The counting of the 5-HT positive cells was conducted
blindly by different persons. Sections of every 120 ␮m at
the level of dorsal raphe nucleus, corresponding to approx-
imately Bregma −7.04 to −9.30 mm (Paxinos and Watson,
1998) were examined under an inverted microscope (Leica
DMIRB, Leica microsystems, Germany), and the population
of positive cells in the dorsal raphe nucleus was manually
counted.
2.4. ES cell culture and differentiation into monoaminergic
neurons
Maintenance of undifferentiated ES cells and embryoid
body (EB) formation were carried out as described previ-
ously (Narita et al., 1997) with modifications. Undifferen-
tiated WW6 ES cells (American Type Culture Collection,
Manassas, VA, USA) were first grown on gelatin-coated
tissue culture plates in the presence of 1000 U/ml leukemia
inhibitory factor (LIF, Chemicon International Inc., Temec-
ula, CA, USA) in an ES cell medium consisting of high glu-
cose Dulbecco’s minimal essential medium, supplemented
with 10% fetal calf serum (FCS), 10% newborn calf serum
(NCS), 0.1 mM MEM non-essential amino acids, 0.55 mM
2-mercaptoethanol, 2 mM l-glutamine, and antibiotics (all
from Invitrogen) (stage 1). To form EBs, the cells were dis-
sociated into a single-cell suspension by trypsin-EDTA and
plated onto a bacterial culture dish with a concentration of
2–2.5 × 104 cells/cm2 in an ES cell medium. After 4 days of
culture, the EBs were transferred to an adhesive suspension
culture dish and cultured overnight in the ES cell medium
(Corning Incorporated, Acton, MA, USA) (stage 2). For
 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297
selection of nestin-positive cells and monoamine neuron dif-
ferentiation, the method of Lee et al. (2000) and Kim et al.
(2002) was applied with some modification. Briefly, the ES
medium was changed to an ITSF medium (Okabe et al.,
1996) and the EBs were cultured for 6 days (nestin selection)
(stage 3). The cells were then dissociated by trypsin-EDTA,
resuspended in a N2 medium supplemented with 5 ng/ml
FGF4, 1 ␮g/ml laminin, and 10 ng/ml basic FGF (all from
R&D systems, Minneapolis, MN, USA), and plated on a
glass coverslip inserted in a 1.9 cm2 culture dish at a con-
centration of 1.5–2 × 105 cells/cm2 to encourage cell expan-
sion for 2 days. Then recombinant mouse Sonic hedgehog
(SHH) and recombinant mouse FGF-8b (both from R&D
systems) were added as final concentrations of 500 ng/ml
each, and subjected to 4 more days of culture (stage 4). Fi-
nally, the cells were differentiated by changing the medium
into a N2 medium supplemented with 1 ␮g/ml laminin for
up to 10 days (stage 5). The medium was changed on every
second day. VPA (final concentration 500 ␮g/ml) or PBS for
control study was added to the medium on the first day of
stage 5 and removed on the third day. For the rescue study,
SHH was added to the medium with a final concentration
of 0, 50, or 500 ng/ml during the culture period of stage 5.
2.5. Immunocytochemistry of the differentiated cells
Cells were fixed in 4% paraformaldehyde in 0.1 M PB
at 4 ◦ C for 3 h. Fluorescent immunocytochemistry was
carried out using the standard protocols. The primary an-
tibodies used were anti-5-HT antiserum diluted 1:10,000,
and anti-␤III-tubulin monoclonal antibody diluted 1:3000
(Promega Corp., Madison, WI, USA). For the secondary
antibody, FITC-conjugated (Jackson Immuno Research,
West Grove, PA, USA) or Texas Red conjugated (Vector
Laboratories) was used. A confocal microscope DM IRB
(Leica) and Leica confocal software TCS SP2 (Leica) were
used to obtain digital images of the immunostained cells,
and the number of co-stained neurons were counted in the
sample area of 20 or 40 fields blindly by different persons.
2.6. Total RNA extraction and reverse transcriptase
reaction
Total RNA was extracted from differentiated ES cells
(harvested on the third day of stage 5) or E11 embryos using
a Reagents Total RNA Isolation System (Promega Corp.)
according to the manufacturer’s instructions. One embryo
or approximately 106 cells was individually collected in a
tube and homogenized by a Powered homogenizer (Fisher
Scientific, Pittsburgh, PA, USA) in denaturing solution.
After a treatment with RNase-free RQ DNase (Promega
Corp.,), each concentration of RNA was measured by a
GeneQuant pro spectrophotometer (Amersham Pharmacia
Biotech, Sweden). Two micrograms of each sample was
reverse transcribed using Superscript II First-Strand Syn-
289
thesis System for RT-PCR (Invitrogen) in a total reaction
volume of 20 ␮l using random hexamer as a primer.
2.7. RT-PCR analysis
The cDNAs obtained from ES cell derived neurons, either
control or VPA exposed, were subjected to RT-PCR ampli-
fication to assess mRNA expression of known genes related
to 5-HT neuronal development. The PCR was carried out us-
ing the standard protocols with Taq polymerase (Takara Bio
Inc., Japan) according to a previous report (Lee et al., 2000).
Annealing was carried out at 58–61 ◦ C, for 1 min depending
on the primer, extension at 72 ◦ C, for 1 min, and denaturation
at 95 ◦ C, for 30 s. For each of the target product, PCR am-
plifications with 25, 30, 32, and 35 cycles were performed,
to select the optimal condition for the relative mRNA ex-
pression comparison. PCR products were visualized with
1–2% agarose gel electrophoresis followed by ethidium
bromide staining. The primer sequences (forward and re-
verse), and the lengths of the amplified products were as
follows:
Shh, (GGAAGATCACAAGAAACTCCGAAC, GGAT-
GCGAGCTTTGGATTCATAG, 354); patched (Ptc),
(CCTCCTTTACGGTGGACAAA, ATCAACTCCTCCT-
GCCAATG, 272); Gli1, (TCCACAGGCATACAGGATCA,
TGCAACCTTCTTGCTCACAC, 462); FGF4, (CAACTA-
CAACGCCTACGAAGCC, ACCTTCATGGTAGGCGA-
CACTC, 96); FGF8, (CGCGAAGCTCATTGTGGAGA,
CATGCAGATGTAGAGACCTGTC, 82); actin, (ATG-
GATGACGATATCGCTG, ATGAGGTAGTCTGTCAGGT,
569); Pet-1, (GTACAGAAAGGCAGCGGGCAGA, GCCA-
GTAAGAGAAGCCAGCG, 479).
2.8. Real-time quantitative PCR
Real-time PCR analysis of Shh expression in E11 whole
embryo cDNA was performed by using an ABI Prism 7700
Sequence Detector (Applied Biosystems, Foster City, CA,
USA). Each 50 ␮l PCR reaction contained 1 ␮l of cDNA,
25 ␮l of 2× TaqMan Universal PCR Master Mix (Applied
Biosystems), 1 ␮l of each primer (20 ␮M each), and 0.5 ␮l
of TaqMan probe (5 ␮M). Each target molecule was coam-
plified with primers and the TaqMan probe for GAPDH in
the same PCR tube. PCR parameters were 50 ◦ C for 2 min,
95 ◦ C for 10 min, 40 cycles of 95 ◦ C for 15 s and 60 ◦ C for
1 min. Probe and primer sequences were designed as follows
using Primer Express software (Version 1, Applied Biosys-
tems).
Rat Shh forward primer; 5 -ATCTCCGTGATGAACCA-
GT-3 , reverse primer; 5 -CTGCTCGACCCTCATAGTGT-
AGAG-3 , TaqMan Probe® ; 5 -FAM-ATGAGGACGGCC-
ATCATTCAGAGGAG-TAMRA-3 .
The glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
(Rodent GAPDH Control reagents) (all from Applied
Biosystems) was used as an internal control.
290 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297

The PCR assay was performed simultaneously with stan-
dard samples (whole embryo tissue) in the same plate to
construct a standard curve. Referring to this standard curve,
the expression level of Shh was normalized to the expres-
sion level of the endogenous reference, GAPDH, to calibrate
the possible variability in the initial amount of total RNA
in each sample. To normalize the possible differences in the
developmental stages by the effect of teratogen exposure in
each littermate, at least three independent littermates were
collected, and relative GAPDH expression levels were care-
fully examined among the groups to select embryos at same
developmental stages.
2.9. Statistical analysis
For all experiments, differences between the teratogen
exposed groups and the control group were evaluated by
ANOVA test followed by post hoc Student–Newman–Keuls
test.
3. Results
3.1. Disorganized migration of 5-HT neurons in the
THAL/VPA exposed rats
Neuronal progenitor cells at the isthmus guided by early
developmental markers, such as FGF4, FGF8, or Shh, start
to differentiate into dopaminergic or serotonergic cells on
around E9 of the rat embryo. Then the serotonergic cells mi-
grate towards the caudal direction, i.e. future raphe nuclei.
They begin to express serotonin at around E12 in the ros-
tral cluster, earlier than the caudal cluster (Aitken and Tork,
1988; Lauder and Bloom, 1974; Lauder, 1990; Lidov and
Molliver, 1982; Wallace and Lauder, 1983). We therefore

Fig. 1. Dramatic change in the distribution of 5-HT positive cells of the PN50 dorsal raphe nucleus by prenatal THAL/VPA exposure. 5-HT immunostained
cells were compared between the controls (A, D) and THAL (B, E) or VPA (C, F) exposed rats. Figures indicated by corresponding lower case letters
(controls [a,d], THAL [b,e], and VPA [c,f]) are Nissl staining of adjacent sections in lower magnification, which show no major anatomical difference
among the groups. The squares indicated in Nissl stainings indicate approximate area shown in adjacent 5-HT immunostainings. (A–C) In rostral sections,
control rats (A) showed many 5-HT positive cells compared to the THAL (B), or VPA (C) exposed animals. (D–E) On the other hand, in the caudal
sections, while the control rat (D) had little 5-HT positive staining, THAL (E), or VPA (F) exposed rat retained many 5-HT positive cells in the slide.
Cx: cerebral cortex, CnF: cuneiformnucleus, MiTg: microcellular tegmental nucleus, PL: paralemniscal nucleus, Pn: pontine nuclei, VLL: ventral nucleus
of the lateral lemniscus, VTg: ventral tegmental nucleus. Scale bars: 20 ␮m.
 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297 291

assumed that the dorsal raphe nucleus, which develops from

the rostral cluster, may be the most vulnerable to the terato-
gens administered on E9, and accordingly we first looked
at the distribution of the serotonergic neurons in the dorsal
raphe nuclei of each group using immunohistochemistry.
Dorsal raphe nuclei at PN 50 were immunostained using
anti-5-HT antiserum. Three animals of different litter origin
from each group (control, THAL-exposed, VPA-exposed)
were obtained, and the numbers of 5-HT positive cell in ev-
ery 120 ␮m section were counted and averaged. No major
anomaly, difference in the longitudinal brain length, or total
brain weight among the groups was found upon dissection
(data not shown). With Nissl staining of the brain sections,
no major difference was observed among the groups (Fig. 1).
However, as shown in Figs. 1 and 2A, a dramatic caudal
shift in the position of the 5-HT positive cell population
was observed in the teratogen-exposed groups, compared
to the control group. When the cells of dorsal raphe nuclei
were counted from rostral to caudal sections, the numbers
of 5-HT positive cells peaked at the position of approxi-
mately Bregma −7.88 mm (715 neurons/slide) in the control
group, whereas they both peaked in more caudal positions
in the teratogen-exposed groups (THAL-exposed, Bregma
approx. −8.24 mm, 617 cells/slide and VPA-exposed,
Bregma approx. −8.0 mm, 570 cells/slide, respectively).
On the other hand, the 5-HT positive cells were continu-
ously detected until more caudal slides (to Bregma approx.
−9.3 mm) in the teratogen-exposed groups than the control
group (Figs. 1 and 2A). However, the average total num-
ber of the 5-HT positive cells in the dorsal raphe nuclei Fig. 2. 5-HT immunostained cells in the dorsal raphe nucleus of our rat
of the teratogen-exposed groups were not different from model and controls at PN50. (A) The average number of 5-HT positive
the control group (control; 3692 ± 350.446, THAL; 3624 cells in each 120 ␮m section through the dorsal raphe nucleus are plotted
± 59.468, VPA; 3661 ± 68.501 cells, mean ± S.E.M., in the graph. Note the curve of the control group (filled circle) was
P = 0.974, Fig. 2B). These results indicate that expo- ended at the seventh slide (840 ␮m; Bregma −7.88 mm), which is more
rostral than the THAL-exposed group (open square, 10th slide) (1200 ␮m;
sure of teratogens on E9 may modify migration of 5-HT Bregma −8.24 mm), or the VPA-exposed group (open triangle, eighth
neurons. slide) (960 ␮m; Bregma −8.00 mm). The difference in the number of the
cells were statistically significant at the seventh slide (∗∗ P < 0.005) and
at the 10th slide (∗ P < 0.05) both in control vs. THAL and control vs.
3.2. VPA retards 5-HT neuronal maturation and attenuates VPA by ANOVA followed by post hoc Student–Newman–Keuls test. (B)
The total number of 5-HT positive cells in each group are shown in the
the expression of 5-HT related genes
graph. Total cells from three independent animals, were averaged for each
group (error bar = S.E.M.). There was no significant difference between
In order to know the direct influence of a teratogen on the groups by ANOVA followed by post hoc Student–Newman–Keuls
the 5-HT neuron differentiation occurring on and after E9, test.
we have performed studies in the simplified monoamin-
ergic neuronal culture system. For that purpose, we took
advantage of an in vitro experimental ES-derived serotoner- 3rd day of stage 5 were harvested on the 10th day. They
gic neuron differentiation system reported previously (Kim were subsequently subjected to fluorescence immunohisto-
et al., 2002; Lee et al., 2000). At the end of stage 4 of this chemistry using anti-5-HT antiserum and anti-␤III-tublin
culture system, the destined neuronal progenitor cells to antibody, a marker for mature neuron and the number of
either dopaminergic or serotonergic neurons were about to cells stained both with 5-HT and ␤III-tublin were counted.
start to differentiate into mature neurons under the influ- The average number of serotonin-positive neurons in 40
ence of Shh and FGF8. This period is a reminiscence of low power magnification fields are significantly decreased
the isthmus approximately E9 of the rat. Shh and FGF8 are in VPA-treated cells (control 7.150 ± 1.067, VPA 1.825 ±
withdrawn from the medium at the beginning of stage 5, to 0.322 cells/field, P < 0.0001) (Fig. 3A–G), despite the fact
let the cells grow into the mature neurons. Cells cultured that total cell number including immature cells were not
in the presence or absence of VPA from the 1st day to the different between the experimental groups (data not shown).
292 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297

Fig. 3. 5-HT neuronal maturation in ES cell cultures. Control and VPA-treated ES cells are double immumnostained with anti-␤III tubulin (red) and
anti-5-HT (green) antibodies on the 10th day of stage 5 cultures. (A–C) In the control ES cell culture, mature 5-HT neurons (double stained by ␤III and
5-HT) are present with extensive 5-HT positive neurites. (D–F) In the VPA-treated ES cell culture, mature 5-HT neurons are reduced in number, and
positive cells are rarely observed. (G) Number of ␤III tubulin+ and 5-HT+ cells per low power (20×) field (mean ± S.E.M. from 40 different fields
sampled). The asterisk indicates the significant decrease of the ␤III tubulin+ and 5-HT+ cells in the VPA treated cells compared to the control cells (P
< 0.0001, by ANOVA followed by post hoc Student–Newman–Keuls test). H Expression analysis of genes involved in 5-HT neuronal differentiation by
RT-PCR on the fifth day of stage 5 cultures. Note that the genes in the Shh signaling cascade (Shh, Ptc, Gli1), as well as Pet-1 are expressed at low
levels in the VPA cultures, whereas FGF4 and FGF8 remained at levels similar to control.
 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297 293

These results indicate that VPA retards 5-HT neuronal dif-
ferentiation in vitro. We also examined whether exposure
to VPA altered the expression of regulatory genes reported
to be involved in the 5-HT neuronal development using
the RT-PCR amplification method. On the fifth day of the
stage 5 culture, expressions of Shh, Patched (the receptor
of Shh, Ptc), Gli1 (Shh dependent transcription factor) and
Pet-1 were all decreased in the VPA-treated cells compared
to the control cells, in contrast with FGF4 and FGF8, both
are expressed equally in the control and VPA-treated cells
(Fig. 3H). We have attempted to conduct a same experiment
with THAL, however, the cell-toxicity of dimethyl sulfox-
ide used as a vehicle caused such high levels of cell death,
that data could not be collected.
3.3. Increase in 5-HT positive neurons by SHH
compensation
To assess the role of Shh in the maturation of the
VPA-treated 5-HT neurons, we then examined whether
exogenously added SHH might compensate for retarded
5-HT neuronal differentiation. Recombinant mouse SHH
was added to the culture medium through stage 5 at a
concentration of 0, 50, or 500 ng/ml to each treatment
group. On the 10th day of the stage 5 culture, the cells
were double-immunostained with 5-HT and ␤III-tublin,
and the number of mature neurons stained with both 5-HT
and ␤III-tublin were counted at 20× magnification. As
shown in Fig. 4A and B, mature 5-HT neurons were more

Fig. 4. Exogenous SHH partially rescues the number of 5-HT neurons in the VPA-treated ES cells. (A and B) Examples of the VPA-treated cells cultured
without (A) or with (B) exogenously added SHH, double immumnostained with anti-␤III tubulin (red) and anti-5-HT (green) antibodies on the 10th day
of stage 5 cultures. Note the number of double stained mature 5-HT neurons is increased in the existence of SHH. (C) The number of ␤III tubulin+ and
5-HT+ cells/low power (20×) field (mean ± S.E.M. from 20 different fields sampled) was increased slightly by SHH in VPA-treated ES cells (0, 50,
and 500 ng/ml culture medium), whereas there was no consistent change caused by SHH in control cultures. ∗ P = 0.0151, ∗∗ P = 0.0004, ∗∗∗ P < 0.0001
(by ANOVA followed by post hoc Student–Newman–Keuls test).
294 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297
frequently observed in VPA-treated ES cell culture which
was compensated with exogenous SHH. Although this
effect was not statistically, SHH slightly increased the num-
ber of 5-HT positive mature neurons in a dose-dependent
manner in VPA-treated cultures whereas no consistent
change was observed in control cultures (Fig. 4C). These
results suggest that SHH may be able to compensate, at
least in part, for the VPA-induced growth defect of 5-HT
neurons.
3.4. Shh mRNA is decreased by THAL/VPA exposure in the
embryo
In the ES cell experiments, we demonstrated that Shh
takes an important part in the defect of 5-HT neuronal
differentiation induced by VPA exposure in vitro. Next,
we were concerned with the expression of Shh in vivo,
under the influence of THAL/VPA. For that purpose, the
expression of Shh mRNA in the E9 THAL/VPA-exposed
whole embryos were examined on E11, using the real-time
quantitative PCR technique. The PCR was carried out with
triplicate study of nine different littermate embryos from
each group. Amplification plots with Shh primer/probe
were measured by absorbance at the threshold cycle,
and the relative expressions were normalized by mea-
surements obtained from GAPDH amplification as in-
ternal controls according to previous reports (Dracheva
et al., 2001; Horii et al., 2002). Data then were sub-
jected to the statistical analysis. As shown in Fig. 5,
significant differences were found in the THAL and the
Fig. 5. Shh mRNA expression is decreased in teratogen exposed embryos
as analyzed by quantitative, real-time PCR analysis. Shh mRNA expres-
sion in whole E11 control embryos, E9 THAL exposed, and E9 VPA
exposed embryos. Data are expressed as mean ± S.E.M. of the relative
expression of Shh/GAPDH. Asterisks indicate significant reduction of rel-
ative expression of Shh in the THAL (P < 0.05) and VPA (P < 0.05)
exposed embryos compared to the controls by ANOVA followed by post
hoc Student–Newman–Keuls test.
VPA-exposed groups, compared to the control group (both
P < 0.05).
4. Discussion
4.1. 5-HT neuronal migration defect caused by THAL/VPA
In this study, exposure of THAL/VPA to E9 rat embryo
caused a dramatic shift of the 5-HT positive neuronal pop-
ulation to more caudal location in the dorsal raphe nucleus.
Since 5-HT neurons in the course of maturation migrate
from the ventral isthmus to a more caudal position within
the hindbrain (Lauder, 1990; Zhou et al., 2001b), this shift
in position of 5-HT positive neurons is likely to be a con-
sequence of defective migration and differentiation caused
by THAL/VPA, an interpretation that must be validated in
future studies.
In 5-HT neuronal development, migration is a critical pro-
cess in differentiation. Zhou et al. (2001a) recently showed
a defective 5-HT neuronal development of the raphe nuclei
by fetal ethanol exposure (E8-E15) in mice, which could be
another useful animal model for autism. They showed that
in the brain of the ethanol-exposed fetus, 5-HT positive neu-
rons remained along the midline, mostly undifferentiated and
small with few neurites, whereas 5-HT positive neurons of
control animals had already migrated laterally and dorsally
towards their final position with rich neurite arborizations
by E15.
It appears that the effect of THAL/VPA on 5-HT neu-
ronal development is not due to a progenitor cell death,
but rather to retardation of neuronal maturation, because
if VPA simply killed the progenitor cells, the total num-
ber of 5-HT neurons in the dorsal raphe nucleus should
be reduced in the teratogen-exposed groups. Unlike the
experiment by Zhou et al. which was done by consecutive
ethanol exposure from E8 to E15, we focused on the effect
of single-dose exposure of early stage embryos to terato-
gens based on our previous result showing that a significant
increase in serotonin levels was observed only in the E9
teratogen-exposed groups (Narita et al., 2002). In this case,
maternally administered single-dose teratogen should be
excreted at most within 3 days from the maternal body
(Eriksson et al., 2001), which would give enough time for
serotonergic progenitors to compensate for retarded differ-
entiation and migration. However, since 5-HT neurons are
precisely fate-determined in a time-specific manner in the
embryo, progenitor cells that recovered later should tend to
migrate more caudally to form “caudally-expanded-dorsal
raphe nucleus” (Lidov and Molliver, 1982; Wallace and
Lauder, 1983; Ye et al., 1998) In fact, in our ES cell ex-
periment, although VPA was withdrawn from the medium
after 2 days of stage 5 culture, a dramatic decrease of
the mature 5-HT neurons, but not a decrease of total cell
number, was observed on the 10th day of stage 5 cul-
ture. This result also suggests to us that VPA induces a
 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297 295

retardation of 5-HT maturation, but not a progenitor cell mia has been known to be one of the characteristic features
death. frequently found in autistics (Anderson et al., 1987, 1990a;
Betancur et al., 2002; Cook et al., 1993). Moreover, recent
works with PET imaging revealed that the 5-HT synthesis
4.2. Normal maturation of 5-HT neurons requires other
in the brain of autistics seem to be thoroughly perturbed
than SHH
compared to the controls. Unilateral alterations of 5-HT syn-
thesis in the dentate-tharamo-cortical pathway were shown
In our ES cell experiments, mRNAs for components of the
in autistic boys (Chugani et al., 1997; Chugani and Muzik,
Shh pathway were reduced in the presence of VPA. More-
2000; Chugani and Chugani, 2000), and a decline of 5-HT
over, Shh mRNA expression was also decreased in the E9
synthesis capacity, which normally observed after age of 5,
VPA and THAL-treated embryos on E11, suggesting both
was not found in autistics (Anderson et al., 1987; Chugani
teratogens may down-regulate Shh expression. The number
et al., 1999a,b; Chugani, 2002). These data strongly sug-
of mature 5-HT expressing neurons was significantly re-
gest that congenital defect in serotonergic development is
duced in the VPA-treated cells, which was only partially
involved in the pathogenesis of autism, and with understand-
compensated by exogenously added SHH. These results in-
ing mechanisms underlying disruption of serotonergic de-
dicate that despite the fact that Shh is one of the necessary
velopment, our model rat may be useful to gain insights into
factors, other molecule(s) must be involved in the normal
this neurochemical feature of autism.
maturation of 5-HT neuron.
Fetal exposure to teratogens, alcohol, or environmental
SHH is a secreted polypeptide that belongs to the hedge-
factors may be associated with an apparent increase in the
hog family and acts as an induction and patterning signal
incidence of autism in humans (Anderson et al., 1990b;
for ventral morphogenesis in the early development of ver-
Davis et al., 1992; London, 2000; Nanson, 1992; Stromland
tebrates. At the isthmus on at about E9 of the rat, SHH along
et al., 1994; Williams et al., 2001), during the critical pe-
with FGF8 specifies the cell type of neuronal progenitor cells
riod window for autism, which is thought to be early in
and induces differentiation into serotonergic or dopaminer-
pregnancy (human E20-24) (Rice and Barone, 2000). It
gic neurons (Charytoniuk et al., 2002; Ye et al., 1998). Since
is of particular interest that two such teratogens, THAL
no SHH or FGF was added to the culture medium of stage 5
and VPA have almost identical effects on the serotonergic
ES cells, endogenous SHH may act solely on cell prolifera-
system when rat embryos are exposed on E9, which cor-
tion and survival, rather than to as an inductive factor along
responds to approximately E20-21 in human. Interestingly,
with FGF8 in these cultures.
THAL and VPA share certain common biochemical func-
As discussed in Introduction, the Pet-1 ETS gene also
tions, including suppressing of the effects of the inflamma-
plays an important role in 5-HT progenitor cell specifica-
tory cytokine tumor necrosis factor-alpha (Calabrese and
tion. Pet-1 mRNA expression is observed in the developing
Fleischer, 2000; Ichiyama et al., 2000), anti-angiogenetic
rostral and caudal cell clusters in hindbrain, both of which
effects when combined with interferons (Bauer et al., 2003;
appear prior to the appearance of 5-HT neurons at 12–24 h
Cinatl et al., 2002; Mesa et al., 2003), and direct alteration
(Hendricks et al., 1999a). The raphe nuclei of the Pet-1
of the platelet count in the blood (Eastham and Jancar,
null mouse exhibit extremely reduced serotonergic neurons
1980; Rea, 2002).
(Hendricks et al., 2003), indicating some part of serotoner-
In conclusion, we have demonstrated that THAL and
gic neuron differentiation is dependent on Pet-1. Since the
VPA have an irreversible effect on the 5-HT neuronal dif-
expression of Pet-1 mRNA was also decreased in the pres-
ferentiation and migration, when they are administered to
ence of VPA (Fig. 4H), further studies will be necessary to
early developing rat embryos. This may result from dis-
elucidate whether Pet-1 can compensate VPA-dependent re-
torted patterning of the dorsal raphe nucleus, and perturbed
tardation of 5-HT neuronal maturation.
5-HT levels postnatally. In an ongoing study we are inves-
tigating effects of these teratogens on learning and memory
4.3. Implications for human autism in offspting of pregnant rat treated on E9, in order to shed
light on the behavioral outcomes of these exposures.
Autism is frequently associated with mental retardation
and epilepsy, which suggests that autism as a neurochemical
disorder. Among heterogenic pathogeneses that have been Acknowledgements
proposed, autism induced by THAL or VPA does not ex-
plain the vast majority of cases of the disease. However, We are grateful to Dr. Jean M Lauder for her helpful
we believe that our rat model created by the prenatal ex- suggestions and critical evaluation of the manuscript. We
posure to THAL/VPA can be useful as an animal model also thank Dr. Yasuyoshi Watanabe for helpful comments on
to study mechanisms involved in neurochemical features of this manuscript. This work is supported by Grants-in-Aid for
autism, because neurochemical and functional imaging stud- Scientific Research (C) of Japan Society for the Promotion of
ies of autistic brain have provided evidence of disturbances Science, Japan Science and Technology Corporation, Takeda
in development of the serotonergic system. Hyperserotone- Science Foundation, and Fujisawa Foundation.
296 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297
References
Aitken, A.R., Tork, I., 1988. Early development of serotonin-containing
neurons and pathways as seen in wholemount preparations of the fetal
rat brain. J. Comp. Neurol. 274, 32–47.
Anderson, G.M., Freedman, D.X., Cohen, D.J., Volkmar, F.R., Hoder,
E.L., McPhedran, P., Minderaa, R.B., Hansen, C.R., Young, J.G., 1987.
Whole blood serotonin in autistic and normal subjects. J. Child Psychol.
Psychiatry 28, 885–900.
Anderson, G.M., Horne, W.C., Chatterjee, D., Cohen, D.J., 1990a. The
hyperserotonemia of autism. Ann. N. Y. Acad. Sci. 600, 331–340.
Anderson, G.M., Horne, W.C., Chatterjee, D., Cohen, D.J., 1990b. The
hyperserotonemia of autism. Ann. N. Y. Acad. Sci. 600, 331–340.
Ardinger, H.H., Atkin, J.F., Blackston, R.D., Elsas, L.J., Clarren, S.K.,
Livingstone, S., Flannery, D.B., Pellock, J.M., Harrod, M.J., Lammer,
E.J., 1988. Verification of the fetal valproate syndrome phenotype. Am.
J. Med. Genet. 29, 171–185.
Bauer, J.A., Morrison, B.H., Grane, R.W., Jacobs, B.S., Borden, E.C.,
Lindner, D.J., 2003. IFN-alpha2b and thalidomide synergistically
inhibit tumor-induced angiogenesis. J. Interferon Cytokine Res. 23,
3–10.
Betancur, C., Corbex, M., Spielewoy, C., Philippe, A., Laplanche, J.L.,
Launay, J.M., Gillberg, C., Mouren-Simeoni, M.C., Hamon, M., Giros,
B., Nosten-Bertrand, M., Leboyer, M., 2002. Serotonin transporter
gene polymorphisms and hyperserotonemia in autistic disorder. Mol.
Psychiatry 7, 67–71.
Calabrese, L., Fleischer, A.B., 2000. Thalidomide: current and potential
clinical applications. Am. J. Med. 108, 487–495.
Charman, T., Baird, G., 2002. Practitioner review: Diagnosis of autism
spectrum disorder in 2- and 3-year-old children. J. Child Psychol.
Psychiatry 43, 289–305.
Charytoniuk, D., Porcel, B., Rodriguez-Gomez, J., Faure, H., Ruat, M.,
Traiffort, E., 2002. Sonic hedgehog signalling in the developing and
adult brain. J. Physiol.-Paris 96, 9–16.
Chen, L., Hamaguchi, K., Hamada, S., Okado, N., 1997. Regional
differences of serotonin-mediated synaptic plasticity in the chicken
spinal cord with development and aging. J Neural Transplant. Plast.
6, 41–48.
Cheng, L., Chen, C.L., Luo, P., Tan, M., Qiu, M., Johnson, R., Ma,
Q., 2003. Lmx1b, Pet-1, and Nkx2.2 coordinately specify serotonergic
neurotransmitter phenotype. J. Neurosci. 23, 9961–9967.
Chugani, D.C., 2002. Role of altered brain serotonin mechanisms in
autism. Mol. Psychiatry 7, S16–S17.
Chugani, D.C., Chugani, H.T., 2000. PET: mapping of serotonin synthesis.
Adv. Neurol. 83, 165–171.
Chugani, D.C., Muzik, O., 2000. Alpha[C-11]methyl-l-tryptophan PET
maps brain serotonin synthesis and kynurenine pathway metabolism.
J. Cereb. Blood Flow Metab. 20, 2–9.
Chugani, D.C., Muzik, O., Behen, M., Rothermel, R., Janisse, J.J., Lee,
J., Chugani, H.T., 1999a. Developmental changes in brain serotonin
synthesis capacity in autistic and nonautistic children. Ann. Neurol.
45, 287–295.
Chugani, D.C., Muzik, O., Rothermel, R., Behen, M., Chakraborty, P.,
Mangner, T., da Silva, E.A., Chugani, H.T., 1997. Altered serotonin
synthesis in the dentatothalamocortical pathway in autistic boys. Ann.
Neurol. 42, 666–669.
Chugani, D.C., Sundram, B.S., Behen, M., Lee, M.L., Moore, G.J., 1999b.
Evidence of altered energy metabolism in autistic children. Prog.
Neuropsychopharmacol. Biol. Psychiatry 23, 635–641.
Cinatl Jr., J., Kotchetkov, R., Blaheta, R., Driever, P.H., Vogel, J.U., Cinatl,
J., 2002. Induction of differentiation and suppression of malignant
phenotype of human neuroblastoma BE(2)-C cells by valproic acid:
enhancement by combination with interferon-alpha. Int. J. Oncol. 20,
97–106.
Cook Jr., E.H., Arora, R.C., Anderson, G.M., Berry-Kravis, E.M., Yan,
S.Y., Yeoh, H.C., Sklena, P.J., Charak, D.A., Leventhal, B.L., 1993.
Platelet serotonin studies in hyperserotonemic relatives of children with
autistic disorder. Life Sci. 52, 2005–2015.
Davis, E., Fennoy, I., Laraque, D., Kanem, N., Brown, G., Mitchell,
J., 1992. Autism and developmental abnormalities in children with
perinatal cocaine exposure. J. Natl. Med. Assoc. 84, 315–319.
Dracheva, S., Marras, S.A.E., Elhakem, S.L., Kramer, F.R., Davis, K.L.,
Haroutunian, V., 2001. N-Methyl-d-aspartic acid receptor expression in
the dorsolateral prefrontal cortex of elderly patients with schizophrenia.
Am. J. Psychiatry 158, 1400.
Eastham, R.D., Jancar, J., 1980. Sodium valproate and platelet counts.
Br. Med. J. 280, 186.
Eriksson, T., Bjorkman, S., Hoglund, P., 2001. Clinical pharmacology of
thalidomide. Eur. J. Clin. Pharmacol. 57, 365–376.
Filipek, P.A., Accardo, P.J., Baranek, G.T., Cook Jr., E.H., Dawson, G.,
Gordon, B., Gravel, J.S., Johnson, C.P., Kallen, R.J., Lewin, G.R., Levy,
S.E., Minshew, N.J., Ozonoff, S., Prizant, B.M., Rapin, I., Rogers,
S.J., Stone, W.L., Teplin, S., Tuchman, R.F., Volkmar, F.R., 1999. The
screening and diagnosis of autistic spectrum disorders. J. Autism Dev.
Disorders 29, 439–484.
Hendricks, T., Francis, N., Fyodorov, D., Deneris, E.S., 1999a. The ETS
domain factor Pet-1 is an early and precise marker of central serotonin
neurons and interacts with a conserved element in serotonergic genes.
J. Neurosci. 19, 10348–10356.
Hendricks, T., Francis, N., Fyodorov, D., Deneris, E.S., 1999b. The ETS
domain factor Pet-1 is an early and precise marker of central serotonin
neurons and interacts with a conserved element in serotonergic genes.
J. Neurosci. 19, 10348–10356.
Hendricks, T.J., Fyodorov, D.V., Wegman, L.J., Lelutiu, N.B., Pehek,
E.A., Yamamoto, B., Silver, J., Weeber, E.J., Sweatt, J.D., Deneris,
E.S., 2003. Pet-1 ETS gene plays a critical role in 5-HT neuron
development and is required for normal anxiety-like and aggressive
behavior. Neuron 37, 233–247.
Horii, A., Smith, P.F., Darlington, C.L., 2002. Application of real-time
quantitative polymerase chain reaction to quantification of glutamate
receptor gene expression in the vestibular brainstem and cerebellum.
Brain Res. Brain Res. Protocols 9, 77–83.
Ichiyama, T., Okada, K., Lipton, J.M., Matsubara, T., Hayashi, T.,
Furukawa, S., 2000. Sodium valproate inhibits production of TNF-
alpha and IL-6 and activation of NF-kappaB. Brain Res. 857, 246–251.
Ingram, J.L., Peckham, S.M., Tisdale, B., Rodier, P.M., 2000. Prenatal
exposure of rats to valproic acid reproduces the cerebellar anomalies
associated with autism. Neurotoxicol. Teratol. 22, 319–324.
Kim, J.H., Auerbach, J.M., Rodriguez-Gomez, J.A., Velasco, I., Gavin,
D., Lumelsky, N., Lee, S.H., Nguyen, J., Sanchez-Pernaute, R.,
Bankiewicz, K., McKay, R.D., 2002. Dopamine neurons derived from
embryonic stem cells function in an animal model of Parkinson’s
disease. Nature 418, 50–56.
Konig, N., Wilkie, M.B., Lauder, J.M., 1988. Tyrosine hydroxylase and
serotonin containing cells in embryonic rat rhombencephalon: a whole-
mount immunocytochemical study. J. Neurosci. Res. 20, 212–223.
Lauder, J.M., 1990. Ontogeny of the serotonergic system in the rat:
serotonin as a developmental signal. Ann. N. Y. Acad. Sci. 600, 297–
313.
Lauder, J.M., Bloom, F.E., 1974. Ontogeny of monoamine neurons in the
locus coeruleus, Raphe nuclei and substantia nigra of the rat. I. Cell
differentiation. J. Comp. Neurol. 155, 469–481.
Lee, S.H., Lumelsky, N., Studer, L., Auerbach, J.M., McKay, R.D., 2000.
Efficient generation of midbrain and hindbrain neurons from mouse
embryonic stem cells. Nat. Biotechnol. 18, 675–679.
Lidov, H.G., Molliver, M.E., 1982. Immunohistochemical study of the
development of serotonergic neurons in the rat CNS. Brain Res. Bull.
9, 559–604.
London, E.A., 2000. The environment as an etiologic factor in autism: a
new direction for research. Environ. Health Perspect. 108, 401–404.
Matsubara, Y., Mikami, T., 1985. Teratogenic potentially of single dose
of thalidomide in JW-NIBS rabbits. Jikken Dobutsu Exp. Anim. 34,
295–302.
Mesa, R.A., Steensma, D.P., Pardanani, A., Li, C.Y., Elliott, M.,
Kaufmann, S.H., Wiseman, G., Gray, L.A., Schroeder, G., Reeder, T.,
 K. Miyazaki et al. / Int. J. Devl Neuroscience 23 (2005) 287–297
Zeldis, J.B., Tehheri, A., 2003. A phase 2 trial of combination low-
dose thalidomide and prednisone for the treatment of myelofibrosis
with myeloid metaplasia. Blood 101, 2534–2541.
Nanson, J.L., 1992. Autism in fetal alcohol syndrome: a report of six
cases. Alcoholism. Clin. Exp. Res. 16, 558–565.
Narita, N., Bielinska, M., Wilson, D.B., 1997. Cardiomyocyte differen-
tiation by GATA-4-deficient embryonic stem cells. Development
(Cambridge, England) 124, 3755–3764.
Narita, N., Kato, M., Tazoe, M., Miyazaki, K., Narita, M., Okado, N.,
2002. Increased monoamine concentration in the brain and the blood
of fetal thalidomide and valproic acid exposed rat; putative animal
models for autism. Pediatric Res. 52, 576–579.
Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M., McKay,
R.D., 1996. Development of neuronal precursor cells and functional
postmitotic neurons from embryonic stem cells in vitro. Mech. Dev.
59, 89–102.
Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates,
fourth ed. Academic Press.
Rea, T.H., 2002. Elevated platelet counts and thrombocytosis in erythema
nodosum leprosum. Int. J. Lepr. Other Mycobact. Dis. 70, 167–173.
Rice, D., Barone, S.J., 2000. Critical periods of vulnerability for the
developing nervous system: evidence from humans and animal models.
Environ. Health Perspect. 108, 511–533.
297
Rodier, P.M., Ingram, J.L., Tisdale, B., Croog, V.J., 1997. Linking
etiologies in humans and animal models: studies of autism. Reprod.
Toxicol. (Elmsford, NY) 11, 417–422.
Stromland, K., Nordin, V., Miller, M., Akerstrom, B., Gillberg, C., 1994.
Autism in thalidomide embryopathy: a population study. Dev. Med.
Child Neurol. 36, 351–356.
Wallace, J.A., Lauder, J.M., 1983. Development of the serotonergic system
in the rat embryo: an immunocytochemical study. Brain Res. Bull. 10,
459–479.
Williams, G., King, J., Cunningham, M., Stephan, M., Kerr, B., Hersh,
J.H., 2001. Fetal valproate syndrome and autism: additional evidence
of an association. Dev. Med. Child Neurol. 43, 202–206.
Ye, W., Shimamura, K., Rubenstein, J.L., Hynes, M.A., Rosenthal, A.,
1998. FGF and Shh signals control dopaminergic and serotonergic cell
fate in the anterior neural plate. Cell 93, 755–766.
Zhou, F.C., Sari, Y., Zhang, J.K., Goodlett, C.R., Li, T., 2001a.
Prenatal alcohol exposure retards the migration and development of
serotonin neurons in fetal C57BL mice. Dev. Brain Res. 126, 147–
155.
Zhou, F.C., Sari, Y., Zhang, J.K., Goodlett, C.R., Li, T., 2001b.
Prenatal alcohol exposure retards the migration and development of
serotonin neurons in fetal C57BL mice. Dev. Brain Res. 126, 147–
155.