Archaeol Anthropol Sci (2011) 3:209–221

DOI 10.1007/s12520-011-0055-2

ORIGINAL PAPER

Characterising the potential of sheep wool for ancient

DNA analyses
Luise Ørsted Brandt & Lena Diana Tranekjer & Ulla Mannering & Maj Ringgaard &
Karin Margarita Frei & Eske Willerslev & Margarita Gleba & M. Thomas P. Gilbert

Received: 6 October 2010 / Accepted: 1 February 2011 / Published online: 15 February 2011
# Springer-Verlag 2011

Abstract The use of wool derived from sheep (Ovis
aries) hair shafts is widespread in ancient and historic
textiles. Given that hair can represent a valuable source of
ancient DNA, wool may represent a valuable genetic
archive for studies on the domestication of the sheep.
However, both the quality and content of DNA in hair
shafts are known to vary, and it is possible that common
treatments of wool such as dyeing may negatively impact
the DNA. Using quantitative real-time polymerase chain
reaction (PCR), we demonstrate that in general, short
fragments of both mitochondrial and single-copy nuclear
L. Ø. Brandt : L. D. Tranekjer : E. Willerslev :
M. T. P. Gilbert (*)
Centre for GeoGenetics, Natural History Museum of Denmark,
University of Copenhagen,
Øster Voldgade 5-7,
1350 Copenhagen K, Denmark
e-mail: mtpgilbert@gmail.com
DNA can be PCR-amplified from wool derived from a
variety of breeds, regardless of the body location or
natural pigmentation. Furthermore, although DNA can be
PCR-amplified from wool dyed with one of four common
plant dyes (tansy, woad, madder, weld), the use of
mordants such as alum or iron leads to considerable
DNA degradation. Lastly, we demonstrate that mtDNA at
least can be PCR-amplified, cloned and sequenced from a
range of archaeological and historic Danish, Flemmish and
Greenlandic wool textile samples. In summary, our data
suggest that wool offers a promising source for future
ancient mitochondrial DNA studies.
Keywords Ancient DNA . Mitochondria . Nuclear . Sheep .
Textile . Wool
Introduction

U. Mannering The sheep (Ovis aries) is one of the oldest domestic

Centre for Textile Research, The National Museum of Denmark,
animals, with evidence of its domestication in the Fertile
Frederiksholms Kanal 12,
1220 Copenhagen K, Denmark Crescent dating back to at least the ninth millennium BC
(Clutton-Brock 1999; Peters et al. 2005; Zeder 2005).
M. Ringgaard Although over 1,400 breeds are recognised today (Scherf
Conservation Department, National Museum of Denmark,
2000), varying widely in characteristics such as meat, milk
I.C. Modewegsvej, Brede,
2800 Kongens Lyngby, Denmark and wool quality and quantity, plus tolerance to different
environmental conditions and food sources, the lack of
K. M. Frei woolly coat in their wild ancestor suggests that they were
Centre for Textile Research, SAXO Institute,
likely first domesticated as a stable source of meat
University of Copenhagen,
Njalsgade 80, (Beneckes 1994). The route by which the ancestral wild
2300 Copenhagen S, Denmark sheep subsequently evolved into the breeds of today is a
fascinating question, not just with regard to where, when
M. Gleba
and in what order changes appeared, but also with regard
Institute of Archaeology, University College London,
31-34 Gordon Square, to the strength, and thus rapidity of change. Linked to this
London WC1H 0PY, UK are other questions of interest, including which breeds
210
were kept in prehistory, and if sheep, or secondary
products of sheep, such as wool or wool garments, were
traded (Ryder 1983).
In theory, DNA analyses offer an attractive approach to
study such questions. Not only can many physical traits of
domestic animal be characterised through underlying genetic
signatures at the nuclear DNA (nuDNA) level, but also
furthermore, if sufficiently isolated, different populations of a
species can also be differentiated through genetic markers at
both the nuDNA and mitochondrial DNA (mtDNA) level.
Classically, two routes have been taken with regard to
exploiting the power of DNA. Comparison of genetic markers
between modern individuals has enabled researchers to map
out differences between breeds or populations, and hypothe-
sise not only population relationships but also geographic
locations of origin (e.g. Wood and Phua 1996; Heindleder et
al. 1998, 2002; Guo et al. 2005; Pedrosa et al. 2005; Tapio et
al. 2006). While a powerful tool, modern studies are, however,
limited as they are unable to either account for now lost
variation (e.g. now extinct intermediate steps) or investigate
the strength of change directly. Thus, ancient DNA analyses
represent an alternate approach—something that has to date
been elegantly exploited in a range of other domestic
organisms, for example maize (Jaenike-Despres et al. 2003)
and cattle (Svensson et al. 2007).
A key requirement of successful ancient DNA studies
is the availability of material containing suitably pre-
served, endogenous DNA. Although traditionally aDNA
studies of domestic animals have focused on the hard
calcified tissues bone and teeth (e.g. Cai et al. 2007)—
unsurprising given their general preservation bias in the
archaeological record—in recent years, a number of
studies have demonstrated successful DNA analysis of
alternate materials, including frozen and temperate sedi-
ments (Haile et al. 2007; Hebsgaard et al. 2009), parch-
ments derived from hides (e.g. Burger et al. 2001;
Campana et al. 2010), leather (Vuissoz et al. 2007), and
hair, nail and horn (e.g. Bonnichsen et al. 2001; Gilbert et
al. 2004). The results of these, and other, studies have
demonstrated several useful findings. Firstly, while in
general DNA is found in many substrates, its absolute
quantity and quality vary significantly—and with regard to
biological tissues such as hair where DNA is degraded
during the tissues biosynthesis itself, this variation is not
only between species, but within a species, and possibly
even within an individual (e.g. Gilbert et al. 2007;
Willerslev et al. 2009). Secondly, although all the above
have yielded positive DNA results, a clear result of at least
the hide (Burger et al. 2001) and leather (Vuissoz et al.
2007) studies is that while DNA may initially be present in the
raw materials upon which the studied materials are based,
chemical treatment of these materials may significantly
modify/degrade the DNA they contain. For example, in their
Archaeol Anthropol Sci (2011) 3:209–221
analysis of serially subsampled cow leather, taken throughout
its manufacturing cycle from raw skin to final product,
Vuissoz et al. (2007) demonstrated that nuDNA was rapidly
degraded during the tanning process.
Sheep wool has been, and still remains, one of the major
raw materials for textile making. Archaeological and
historical wool textiles provide a unique and hitherto
unexplored source of ancient sheep DNA. Although some
textiles are produced of naturally pigmented sheep wool,
many archaeological wool samples show traces of dyes
which indicate that the raw wool has undergone significant
modification (Bender Jørgensen and Walton 1986; Frei et al.
2010; Vanden Berghe et al. 2009; Walton 1988). Further-
more, the ultrastructure of wool (for example thickness of
shaft and proportion of different hair types) varies greatly
by breed, and even by individual. Given the above-
discussed potential problems of DNA content and quality
variation by hair type, and artificial treatment, despite a
number of publications of successful mtDNA and nuDNA
recovery from a range of natural ancient hair samples of
other species (e.g. Bonnichsen et al. 2001; Gilbert et al.
2004, 2007, 2008; Willerslev et al. 2009; Miller et al. 2009;
Rasmussen et al. 2010), it is by no means certain whether
(1) DNA of sufficient analytical quality exists in sheep hair,
(2) whether this varies by breed, or factor such as natural
pigmentation or body location, (3) whether this is affected
by procedures commonly involved in the manufacturing of
textiles such as dyeing, and (4) how stable this DNA is
subsequently. In this study, we have investigated the above
questions, in order to lay a foundation upon which future
ancient DNA analyses of wool might be based.
Materials and methods
DNA was analysed from two datasets, chosen to provide as
comprehensive a baseline for future studies as possible. The
datasets and their relevance to specific questions of interest
are described below.
Raw and treated modern wool
Given that any archaeological/historical wool sample will
be associated with unknown parameters such as the breed it
derives from, and the part of the body or hair type it derives
from, and that it cannot, a priori, be expected that DNA of
quality suitable for conventional polymerase chain reaction
(PCR) analysis is present in modern wool (whether raw
coat hair or treated final product), four questions were
addressed with the following datasets of modern wool.
1. Is there a reason to expect that untreated wool from all
breeds of sheep will contain PCR-amplifiable DNA?
Archaeol Anthropol Sci (2011) 3:209–221 211

Untreated wool samples were obtained from specific Thus, merino wool is probably a common component of
individuals of six sheep breeds (Table 1, samples 1–14). Five many historic textiles.
of these breeds belong to a group referred to as ‘Nordic In addition to surveying the wool of six breeds, we also
short-tailed sheep’, a group consisting of sheep breeds today investigated whether DNA could be amplified from the
present in the Nordic area (Ryder 1983; Tapio 2006). Given different hair types of four of the breeds, specifically
the ultimate focus of this study on archaeological/historic underwool and the outer kemp hairs (Table 1, samples 1,
Nordic material, the breeds are thus likely representatives of 3–10, 12–14).
prehistoric and early mediaeval period wool sources. In
2. Do untreated hairs from different locations of the fleece
addition, the Merino breed was also included. This breed is
all yield PCR-amplifiable DNA?
the most important for wool in the world today, and was
developed in Spain in the eighth century AD from breeds of Although in some cases wool from only limited parts
fine wool sheep that were spread in the Mediterranean area of the fleece was used to make ancient textiles, in
(Beneckes 1994). Although Spain had the monopoly on this others, it is possible that wool derived from the entire
wool type in the mediaeval period, in the eighteenth century, body was used. As hair structure differs around the
the breed spread to other parts of Europe (Beneckes 1994). body (Wilson and Gilbert 2007; Schneider et al. 2009),
Table 1 Modern wool samples
analysed, and DNA content as Breeda Average percentb SDc mtDNAd nuDNAe
assessed through real-time
quantitative PCR (qPCR) 1. Faroese I, underwool 102.28 30.80 3.95E+08 +
2. Merino 100.00 9.36 3.37E+08 +
3. Faroese I, kemp 92.82 24.28 3.13E+08 +
4. Faroese, kemp 92.10 95.85 3.10E+08 +
5. Faroese II, kemp 89.69 23.82 3.02E+08 +
6. Old Norwegian, kemp 87.70 25.52 2.96E+08 +
7. Icelandic, underwool 69.97 9.05 2.02E+08 +
8. Old Norwegian, underwool 69.53 2.45 2.34E+08 +
9. Faroese, underwool 64.66 7.86 2.18E+08 +
10. Faroese II, underwool 56.07 12.96 1.89E+08 +
11. Rya 23.86 12.40 8.04E+07 −
12. Icelandic, kemp 21.37 4.87 7.20E+07 +
13. Shetlandic, kemp 21.26 8.56 7.16E+07 +
14. Shetlandic, underwool 16.84 6.70 5.68E+07 +
Body part
15. Shoulder 141.65 21.23 4.05E+08 +
16. Back/overleg 138.13 103.10 4.77E+08 +
17. Back 100.00 25.55 3.46E+08 +
18. Belly 52.28 22.18 1.81E+08 +
10. Back/overleg 50.12 17.10 1.73E+08 +
a
Where multiple individuals of a 20. Back 33.53 26.49 1.16E+08 +
breed were studied, the individual 21. Shoulder 18.51 15.41 6.40E+07 +
number is indicated, as is the wool
type (kemp/underwool) Natural pigments
b
Average percent mtDNA yield 22. Grey raw wool 100.00 161.74 3.87E+08 +
based on triplicate extractions. A 23. Brown raw wool 52.00 10.58 7.25E+07 +
value of 100% was set for Merino 24. White raw wool 29.00 12.66 4.03E+07 +
(breed), Back (body part), Grey
Dyef
(colour) and Madder (dye)
c 25. Madder 100.00 73.26 3.21E+07 +
Standard deviation of the percen-
tages mtDNA 26. Tansy 91.00 18.25 2.93E+07 +
d
Absolute copies of mtDNA tar- 27. Weld 45.00 32.52 1.44E+07 +
get per gram hair, as quantified by 28. Woad 33.00 35.94 1.06E+07 +
qPCR 29. Madder, alum 20% 16.00 17.00 5.30E+06 +
e
Presence or absence of PCR- 30. Tansy, alum 20% 11.00 17.39 3.40E+06 −
amplifiable nuDNA
f
31. Weld, alum 20% 0.00 0.01 3.54E+03 −
Mordant indicated where used
212
we therefore studied a dataset that comprises underwool
from four different body parts of a Shetland sheep, to test
whether there are differences between body parts (Table 1,
samples 15–24).
3. Does the natural pigmentation of the hair affect PCR-
amplifiable DNA?
Different shades of natural pigmentation arose during
domestication of the sheep. The natural colour of hair is
determined primarily by the size and quantity of the
pigment granules in the hair strand. Pigment granules are
composed of melanin, of which there are two types,
eumelanin giving a black or brown colour, and phaeome-
lanin, giving red or yellow colour. The pigmentation of a
single hair is determined by the relative quantities of these
two melanin types, and varies between individuals (Wilson
et al. 2001). Melanin is known to inhibit PCR reactions
(Wilson and Gilbert 2007), and thus, we investigated
whether it was equally easy to obtain PCR-amplifiable
DNA from wool of different natural colour. Therefore, the
third subset of data is made up by samples of three different
colours of natural pigmentation (see Table 1, samples
22–24).
4. Does treatment of natural wool affect PCR-amplifiable
DNA?
Dyeing wool for colour is probably no less ancient than the
weaving of textiles themselves, as humans strove to improve
their aesthetic quality. The earliest evidence for true organic
dyes comes from the late third millennium BC Mesopotamia
(Forbes 1956; Barber 1991). In Central Europe, they were
certainly used by the Middle Bronze Age (Walton Rogers
2003; Hofmann-de Keijzer et al. 2007), and in Denmark at
least by the mid-first millennium BC (Vanden Berghe et al.
2009). Such treatment involved bathing (and often heating)
the natural wool in organic dyestuffs, often derived from
plant material, and frequently also involved the inclusion of a
mordant to help fix the dye (Cardon 2007). Whether such
treatments may be damaging to the DNA naturally present in
the hair is unknown, but represents a key test, as should they
significantly destroy the DNA, then there would be little point
in performing subsequent ancient DNA analyses. The fourth
subdataset therefore consists of a dataset of natural modern
wool (Old Norwegian breed) that had been treated with a
variety of dyes and mordants. Specifically, four different
plant-derived dyes were tested (tansy, weld, madder, and
woad), three of these in both a mordanted (alum) and an
unmordanted form (Table 1, samples 25–31). A brief
discussion on the dyes follows.
The plant woad (Isatis tinctoria L. and related spp.) has
been a key source of the blue colour in Europe since
prehistoric times (Cardon 2007). Its dye component
indigotin has been identified in the textiles from Hallstatt,
Archaeol Anthropol Sci (2011) 3:209–221
Austria, dated to the Middle Bronze Age (1600–1200 BC),
making this the earliest instance of woad use in Europe
(Hofmann-de Keijzer et al. 2007). In Denmark, its use can
be dated back to 400 BC, or Pre-Roman Iron Age and
continues throughout the following periods (Vanden
Berghe et al. 2009; Walton 1988). The main source of
the red dye in Europe was the plant madder (Rubia
tinctorum L.). Its main dye component alizarin has been
detected in Danish textiles dating to as far back as the first
century BC (Vanden Berghe et al. 2009). The plant weld
(Reseda lueola L.) was one of the most important sources
of the yellow dye used in Europe at least since the Bronze
Age (Hofmann-de Keijzer et al. 2007) and dating back in
Denmark to at least 500 BC (Vanden Berghe et al. 2009).
Lastly, the plant tansy (Tanacetum vulgare L.) gives
colours ranging between green and yellow, and although
it has not been recorded in ancient samples, it was used in
historic times.
Generally, dyes have different potentials for binding to
the textile fibres. Some are soluble in water and bind
immediately (direct dyes), while others need to undergo
a chemical process (reduction) to make them water
soluble, and then after impregnation, the fibres reoxidise
to its insoluble form (known as vat dyes, which include
woad; Cardon 2007). Furthermore, most dyes are
mordant dyes, which despite the fact that they are
soluble in water do not bind to textile fibres unless a
mordant is added. Different types of mordants can be
used, including tannins and soluble metal salts, and the
ultimate resulting colour (including brightness and
stability) of the textile is dependent on the mordant used
(Cardon 2007). It is assumed that alum [KAl(SO4)12H20]
was the most frequently used mordant in prehistory,
although iron and copper were also common (Cardon
2007; Ringgaard 2010)
The dying and mordanting of the wool used in this study
were performed in collaboration with the Centre for
Historical Archaeological Research and Communication,
Lejre (Ringgaard 2010).
Archaeological and historic Danish and Greenlandic
textiles
Denmark and Greenland possess a rich collection of prehis-
toric textiles, recovered from contexts such as oak coffin
burials, bog deposits and permafrost conditions that reach
back to the Bronze Age (Broholm and Hald 1940; Hald 1980;
Bender Jørgensen 1986; Østergård 2004), which provide an
informative dataset on which to investigate whether DNA
will survive in wool artefacts over significant time periods.
The textiles subsampled (20 mg of each) derive from eight
geographic locations, and represent a range of preservation
contexts (as defined by observable fibre preservation) and
Archaeol Anthropol Sci (2011) 3:209–221
conditions (Table 2, samples 32–46). Discussion of the
samples, in chronological order, follows.
Borum Eshøj
The oldest sample studied originates from a burial mound,
Borum Eshøj, on the Jutland peninsula, dating to the Early
Bronze Age. The mound contained three oak coffins (A, B
and C), which all had well preserved textiles. Grave C, which
was excavated in 1871, contained the skeleton of a woman
and several wool costumes like an oblong textile sewn
together, a blouse, two belts and several more fragmented
textiles (Broholm and Hald 1940). The coffins from the two
other graves are dendrochronologically dated to 1344 and
1348 BC, and most likely Grave C dates to the years around
this time (Christiansen 2006). The sample included in this
analysis comes from a fragmented dark brown textile that
supposedly covered the body of the deceased (Fig. 1,
Broholm and Hald 1940; Bender Jørgensen 1986). It is
unknown whether this sample was dyed.
Voldtofte
The sample from Voldtofte (Fig. 1) originates from a burial
mound in Lusehøj near the village Voldtofte on the Danish
island of Fyn excavated in 1861 (Thrane 1984). The grave
contained a bronze urn around which a dark brown wool
textile was wrapped. The grave is dated to the Late Bronze
Age (900–700 BC).
Hammerum
In Hammerum, close to Herning on the Jutland peninsula, a
small cemetery was found in 1993. One of the inhumation
graves contained a young female, 14C-dated to AD 1–130,
which places the grave in the Early Roman Iron Age
(Rostholm 2009). Hair and clothes are extremely well
preserved, and the sample (Fig. 1) derives from a reddish
garment with white stripes. No dyes have been detected in
the sample.
Vrangstrup
At Vrangstrup on the Jutland peninsula, a small burial site
was found on a hilltop in 1938. The graves were dug deep
into the clay rich soil, possibly facilitating the preservation
of textiles in two of the burials. The included sample comes
from grave III that contained decomposed textiles on the
bottom on which the deceased lay (Hald 1980). The textile
from grave III is woven with yarns of different natural
pigmentation (Hald 1980). Dye analyses of light and dark
wool from the textile resulted in no dyes detected. The
grave is dated by the rich grave goods to period C2 of the
213
Late Roman Iron Age (AD 250/260–310/320; Lund Hansen
1987; Kaul 1990).
Krogens Mølle Mose
Krogens Mølle Mose is a bog situated on the Jutland
peninsula, north of Limfjorden. In 1878, a female bog body
was found together with several wool textiles and skin
costumes (Hald 1980). The sample included comes from a
light brown wool textile fragment (Hald 1980; Fig. 1). The
find is 14C-dated to 399–207 BC, or the Pre-Roman Iron
Age (Mannering et al. 2009, 2010). This sample has not
been tested for dyes, but another fragment most likely from
the same textile contained traces of luteolin and indigotin,
possibly coming from the dye plants weld and woad.
Mammen
The chamber grave from Bjerringhøj, known as Mammen,
on the Jutland peninsula, is believed to be one of the
earliest Christian graves in Denmark (Gräslund 1991). It
was excavated in 1868 by workmen, who found a wooden
chamber in the mound (Vellev 1991a, b). Dendrochrono-
logical analysis of the wooden posts of the chamber
indicates that they were felled in the winter AD 970–971.
The grave was probably made shortly hereafter (Andersen
1991). The deceased, his costume and the grave furnishings
have probably never been in contact with the surrounding
clay, as he was placed in a coffin in the chamber (Iversen
1991). The sample included comes from the textile with the
embroidered masks (Hald 1980; Fig. 1). The textile has a
red-brown colour, but no dye could be detected during
analysis in 1991 (Walton 1991; Østergård E 1991).
The farm beneath the sand (GUS ‘Gården Under Sandet’)
Two samples come from the Old Norse settlement The Farm
Beneath the Sand in Greenland, excavated between 1992 and
1997. They were found in the area called The Weaving Room
(Room I) that dates to the thirteenth century AD (Østergård
2004). The soil layers were permafrozen, but the preserva-
tion of the 174 textiles fragments on the site varies greatly.
This is probably due to different depths of burial and effect
of the permafrost. One textile has an almost black warp and
brown weft (Østergård 2004). The other is a light brown
fragment of a selvedge (Østergård 2004). No dyes have been
detected in these samples.
Borreby manor
The samples from Borreby derive from a Flemish wool
tapestry (Fig. 1, samples 40–46) dated to the seventeenth
century, which are now hanging in the dark hall of the Borreby
Table 2 Ancient wool samples analysed
214

Locality ID Origin Datea Context Conditionb Dyesc mtDNAd nuDNA

32. Borum Eshøj NMB685 Textile cover Ca. 1350 BC Oak coffin grave Good Not analysed – –
33. Voldtofte NM26436 Wrapping for urn 900–700 BC Cremation in burial mound Poor Not analysed – –
34. Krogens Mølle Mose NMD1310 J Textile fragment 400–200 BC Human bog find Excellent Not analysed, but O. aries –
probably present
35. Hammerum HEM 3231 x83 Dress AD 1-130 Inhumation grave Good None detected –e –
36. Vrangstrup NM023595 Textile cover AD 250/260-310/320 Inhumation grave Poor None detected B. taurusf –
37. Mammen NMC 135a Cloak AD 970-971 + Inhumation grave in grave Good None detected O. aries –
chamber
38. GUS GUS 1950 X528 Textile fragment 13th century Settlement in permafrost Excellent None detected O. aries –
39. GUS GUS 1950 X529 Textile selvedge 13th century Settlement in permafrost Excellent None detected O. aries –
40. Borreby Private collection Tapestry 17th century Exposed to light and air Good White/not dyed O. aries –
41. Borreby Private collection Tapestry 17th century Exposed to light and air Good Brown – –
42. Borreby Private collection Tapestry 17th century Exposed to light and air Good Blue O. aries –
43. Borreby Private collection Tapestry 17th century Exposed to light and air Good Dark red O. aries –
44. Borreby Private collection Tapestry 17th century Exposed to light and air Good Beige O. aries –
45. Borreby Private collection Tapestry 17th century Exposed to light and air Good Green O. aries –
46. Borreby Private collection Tapestry 17th century Exposed to light and air Good Red O. aries –
a
Date as reported in original literature (see main text)
b
As assessed visually
c
As reported in previous studies
d
Based on cloned mtDNA sequence data
e
PCR product could not be cloned
f
Most likely contaminant sequence thus does not reflect on original source species
Archaeol Anthropol Sci (2011) 3:209–221
Archaeol Anthropol Sci (2011) 3:209–221
Fig. 1 Examples of the ancient textile samples studied. Top from left Voldtofte, Krogens Mølle Mose, Hammerum. Bottom from left Mammen,
Borreby
Manor on the Danish Island of Zealand. The samples were
taken from the loose threads on the back side of the tapestry
where the colours were well preserved. The yarns were
coloured with plant dyes. In contrast to the other samples, this
textile was exposed to air throughout its history.
DNA extraction and contamination control measures
As one aim of this study was to compare the recovered yield of
mtDNA and nuDNA from each data point, all samples were
weighed prior to analysis. Triplicate sampling was performed
on all materials, with sample sizes varying from 10–80 mg.
Biological tissues that are expected to contain relatively low
levels of endogenous DNA, such as hair and in general
archaeological materials, are at high risk of contamination
from external sources of DNA. As such, strict protocols must
be followed in order to both remove any contaminants that
might be present on the material prior to the genetic analyses,
and to minimise subsequently the chance of contamination of
the material during the analyses. It has been previously
demonstrated (Gilbert et al. 2004, 2006) that in comparison to
other commonly studied sources of aDNA (e.g. bone and
teeth), hair can be relatively easily decontaminated from
external contaminants through bathing in dilute bleach
solution. Therefore, prior to digestion of the material, all
samples were washed carefully in 1% commercial bleach
solution following Gilbert et al. (2004). Subsequently, all
analyses were performed in dedicated DNA extraction
215
laboratories that are isolated from laboratories where high
quality DNA (including PCR amplicons) are studied. All
reagents used were molecular biology grade, as detailed
above all extractions were performed in triplicate, and all
extractions and subsequent PCR analyses included blanks to
monitor for contamination.
Post-decontamination, DNA was extracted from all
samples following Gilbert et al. (2004), although the
original organic purification was replaced with a silica
purification following Yang et al. (1998). To enable
subsequent quantification, final elutions of all extracts were
standardised into 100 μl buffer EB (Qiagen, Valencia, CA).
Genetic analyses
Post-DNA extraction, the mitochondrial and nuclear DNA
content of the samples were analysed using several tools. In
order to determine whether (1) PCR-amplifiable DNA was
present in the extracts, and (2) how the amounts of such
DNA varied between study samples, SYBR Green-based
quantitative real-time PCR (qPCR) assays were designed to
target short fragments of both the mitochondrial and nuclear
DNA. The mitochondrial DNA assay targeted a 97-bp
amplicon of the sheep d-loop, using primers Ovis-1F (5′
acaacacggacttcccactc) and Ovis-1R (5′ gggtttat-
gaacgctcgtgt). The nuclear DNA assay was designed to
target a 66-bp fragment of exon 10 of the single-copy sheep
prolactin receptor gene (PRLR, GenBank ID FJ901300.1),
216
using primers Ovis-2F (5′ cctccaagttccacattccgg) and Ovis-
2R (5′ gacatgtatgatttgttttgggat). Each 25-μl qPCR reaction
consisted of 0.1 μl Amplitaq Gold (ABI, Foster City, CA),
1× Amplitaq Gold buffer, 2.5 mM MgCl, 400 nM each
primer, 100 nM each dntp, 1 μl SYBR Green/ROX mix
(Invitrogen, Carlsbad, CA), 400 μg BSA, and 1 μl DNA,
and was performed on a Stratagene MX-Pro cycler. Cycling
parameters were as follows: enzyme activation 95°C for
10 min, 50 cycles of 95°C for 30 s and 60°C for 1 min,
followed by a final dissociation curve between 55°C and
95°C. In addition to the samples, a duplicate sevenfold
dilution series of a molecular weight standard specific to
each primer set (10e8 to 10e2 copies per microlitre) was
included in each qPCR reaction.
To monitor for inhibition and to ensure generation of
accurate estimates of DNA content, qPCR reactions were
performed at triplicate dilution series for each DNA extract
(which in turn were performed in triplicate as detailed
above), at 1×, 0.5× and 0.25× concentration. Following
qPCR, the dissociation curves for each sample were
manually assessed to ensure accurate template amplification
and to rule out errors arising due to non-specific amplifi-
cation (e.g. primer dimers). Calculation of the starting DNA
concentration was performed using the MX-Pro software,
based on the standard curves generated using the molecular
weight standards. Only final results that exhibited the
correct dissociation temperature profile and that did not
show evidence of inhibition were used for final calculation
of DNA contents. Subsequently, all calculated concentra-
tions were scaled to account for the initial starting
concentration of wool digested, to yield final results of
DNA concentration per hair sample digested. These in turn
could be converted into relative values, expressed as
percent relative to the best performing sample in each
dataset.
DNA analysis of the historic/archaeological material was
performed through conventional PCR. For the mtDNA,
primers 16sMam3 and 16sMam4 (Haile et al. 2009) were
used, which amplify an approximately 120-bp fragment of
the mitochondrial 16S gene, the sequence of which is
diagnostic to mammalian species. For the nuDNA, the
qPCR primers discussed above were used. PCR reactions
were undertaken and amplified as for the qPCR, although
quantitative data were not assessed. Post-PCR, amplicons
were viewed on 2% agarose gels stained with ethidium
bromide, and all successful amplicons were purified using
Qiaquick columns (Qiagen), cloned using Topo TA kits
(Invitrogen), then sequenced (8 clones per PCR) using ABI
chemistry at the commercial service offered by Macrogen
(Seoul, S. Korea). Species identity was confirmed as 100%
identity matches, against a database of 16S mammalian
sequences (originally curated from NCBI GenBank) held
by the authors.
Archaeol Anthropol Sci (2011) 3:209–221
Results
Modern samples
Table 1 contains the results of the mtDNA qPCR analysis,
which performed as expected on all samples studied. Results
are expressed as an average percent relative to the best
performing sample in a dataset, as well as absolute values. The
reader is cautioned that interpretation of absolute values of
DNA copy per gram is difficult as (1) the value is heavily
dependent on the standard used and the accuracy by which it
was initially measured, (2) the absolute value will be target
and size of target dependent. Although in some extracts
inhibition leads to problems obtaining an accurate measure-
ment for the 1× concentrate, in all cases, this ceased to be a
problem at 0.5× dilution. Each final quantitative observation
was determined from the triplicate extractions of each sample;
therefore, the standard deviation could be calculated for each
sample, and can be used as a means to observe whether data
are significantly different from each other or not. In addition,
where the datasets were large enough, parametric and non-
parametric statistical tests were performed to support the
observations.
In contrast to the mtDNA results, it was not possible to
obtain reliable quantitative results from nuDNA analysis.
Although prior to this analysis it had been optimised and
validated on modern sheep DNA, on the wool samples, it
failed to give consistent and reliable quantitative results, with
replicates of single samples yielding different values. We
believe that this may stem from the overall low levels of
nuDNA in hair extracts, rendering quantitative assays very
susceptible to bias from stochastic factors. When coupled with
both size confirmation of the amplicon on 2% TA gels, and
analysis of the band melt temperatures, the assay could be
used as a qualitative assay, yielding information as to whether
PCR-amplifiable nuDNA survived or not.
DNA presence in hairs from different breeds
MtDNA and nuDNA could be successfully amplified from
almost all the sheep breeds studied (Table 1, samples 1–14),
the exception being nuDNA in the Rya breed. This
indicates that mtDNA of informative PCR-amplifiable size
(>60 bp) can be a priori expected to exist within wool textiles,
and nuDNA presence is likely. The lack of nuDNA in the Rya
breed may reflect an increased strength of the keratinisation
process in this breed, which in general is detrimental for DNA
quality. However, given that significant intraspecific variation
in DNA quality has been observed in other species, such as
mammoths (e.g. Gilbert et al. 2007), this observation may
alternately not be descriptive of the breed, and may simply
relate to the single individual studied. The amount of
amplified mtDNA varies not just between different breeds
Archaeol Anthropol Sci (2011) 3:209–221
but also within samples, as evidenced by both the relatively
large standard deviation for the triplicate samples analysed
for each individual sheep, and the fact that the mtDNA yields
from both Faroese sheep (I and II) also varied. The
observation of yield varying between breeds is also likely
explained through the natural variation between the hair
samples than a significant variation between breeds. MtDNA
and nuDNA could moreover be amplified from both kemp
hair and underwool. However, there was no clear pattern as
to whether the mtDNA content might be consistently higher
in one or the other hair source—in some breeds kemps
yielded more mtDNA than underwool, and in some breeds
the opposite was the case (paired t test p=0.75, Wilcoxon
matched pairs test p=0.68), again pointing towards the fact
that mtDNA yields seem to vary on an individualist basis.
The dataset thus shows that there is no reason to suspect that
source breed will a priori affect chance of obtaining aDNA
from ancient/historic wool.
DNA presence in hairs across different body parts
MtDNA and nuDNA also proved to be amplifiable from
wool from all the body parts included in this study (Table 1,
samples 15–21). Although the amount of DNA varied
between the body parts, yields from samples from the same
body part (for instance shoulder and back/overleg) also
vary. This again is consistent with the observation that the
variation is most probably due to natural variation in the
wool than a true variation between body parts. The dataset
thus shows that DNA is amplifiable from textiles with wool
from different body parts.
DNA presence within naturally pigmented wool
The three colours of natural pigmentation in wool all
yielded mtDNA and nuDNA. Melanin did not seem to
affect the ability to recover DNA from the samples, as the
white samples, containing the least melanin, yielded a
medium amount of DNA (Table 1, samples 22–24). The
variation between the samples is though within what could
be expected for natural variation. Thus, textiles consisting
of wool with different natural pigmentation are not
expected to be a problem regarding DNA amplification.
DNA presence in dyed and mordanted wool
The analysis of dyed and mordanted wool samples showed
that mtDNA could be amplified from all the samples that were
not mordanted (Table 1, samples 25–28). Although for some
dyes the recovered DNA level appears diminished, given the
large standard error and the small number of samples, and
this may suggest that some dyes have a detrimental effect,
we caution that such observations are extremely preliminary.
217
MtDNA could also be amplified from all three mordanted
samples, but the amount of amplified DNA was consistently
much lower than for the unmordanted samples (Table 1,
samples 29–31), in particular when iron was used as the
mordant. Similarly, while nuDNA could be PCR-amplified
from the dyed samples, 2/3 mordanted samples yielded no
PCR-amplifiable DNA. This strongly suggests that the
mordanting treatment degrades mtDNA in wool.
Ancient samples
MtDNA was successfully amplified, cloned and sequenced
from 10 of the archaeological/historical samples (Table 2,
samples 34, 37–40, 42–46). Given that our results from the
modern wool samples indicated wide variation in the initial
levels of PCR-amplifiable DNA in wool, no attempt was
made to qPCR assess the DNA concentration in these
samples, as we judged that the recovered results would shed
little insight into DNA degradation or preservation. The PCR
and extraction blanks yielded no positive results, suggesting
cross-contamination was unlikely. The cloned sequences
contained a low level of sequence variation consistent with
post-mortem sequence modifications (e.g. Pääbo 1989;
Hansen et al. 2001; Hofreiter et al. 2001; Gilbert et al.
2003; Binladen et al. 2006; Vives et al. 2008; Lamers et al.
2009), but with one exception, the consensus sequences were
a 100% match on O. aries, domesticated sheep. The
exception was the product generated from the Vrangstrup
sample, which sequencing revealed as a match to Bos taurus,
the domestic cow (Table 2, sample 36). This result is
possibly caused by contaminant DNA arising from the anti-
inhibition agent bovine serum albumin as part of the PCR.
The sample from Voldtofte (Table 2, sample 32) gave a
faint band on the gel electrophoresis, but could not be cloned
after several attempts. This could be explained if the DNA in
the sample was diluted to a sub-amplifiable level in the
cloning process. It is however unsure if the band seen on the
gel electrophoresis stems from O. aries or a contaminant
species.
The remaining samples yielded no mtDNA amplifica-
tion, and no samples yielded a nuDNA amplicon (Table 2,
samples 35 and 41). Testing of these extracts using a spiked
PCR indicated that the failure was not due to inhibition;
thus, for these samples at least, it seems that the mtDNA
had degraded to sub-amplifiable levels.
Discussion
The presence of DNA in sheep hair and wool
A principal finding of this study is that, in general, one
can expect the presence of short fragments of PCR-
218
amplifiable mtDNA and single-copy nuDNA in modern
sheep hair, regardless of where on the body it comes
from, hair type or breed type. On the one hand, this is
not surprising, as the recovery of DNA from hair has
been reported from a wide range of mammals (e.g.
Bonnichsen et al. 2001; Gilbert et al. 2004). However,
given the extreme variation observed in DNA quality at
even the individual level (e.g. Gilbert et al. 2007), it is
reassuring to find that sheep are no exception to this
pattern. That overall mtDNA analysis was easier than
nuDNA analysis in the modern samples and that no
nuDNA could be recovered from the archaeological/
historic samples is also unsurprising—the mtDNA per
copy level of hair shaft is considerably higher than that of
nuDNA (Gilbert et al. 2004, 2007).
The effect of mordanting
A perhaps major finding is that although there is no
evidence that common plant-derived dyes used on wool
will degrade this DNA, mordanting may represent a
greater problem as limited DNA could be amplified from
samples treated with 20% alum. Why should this be?
One explanation may simply result from the mordanting
process itself, where the metal ions enter the fibres in
order to work as a media for the binding of the dye to
the fibres. This process seems to have a negative effect
on the preservation of DNA. Another fact may be that
both the mordanting and the dyeing process require
heating, first for the mordanting, and secondly for the
dying (Cardon 2007; Ringgaard 2010). Given that DNA
degradation rates are exponentially linked to temperature
(Lindahl 1993), this could confer some effect, although
the evidence also indicates that any heating in the dyeing
step conferred little degradation. Thus, it is unclear why
extra heating during mordanting is a problem. Further-
more, it is worth noting that over the long term, although
the effect of alum has not been studied, iron mordants
have been shown to cause degradation of textile fibres,
through fibre destruction by oxidative processes cata-
lysed by the iron (Ringgaard 2010). Damage to the
surface of hair fibres makes the inner layers of the hair
accessible to degrading microbes and enzymes (Wilson et
al. 2001). This could in turn increase the risk of damage to
DNA (Gilbert et al. 2006).
Given these findings, a means to pre-screen textiles for
mordants, before sampling for DNA analysis, would be
attractive. Ringgaard has previously demonstrated that
some metals used as mordants can be detected through
elemental analysis (Ringgaard 2010), although this can be
complicated as metals tend to migrate from one textile to
another, and because textiles exchange metals with the
surrounding soil (Ringgaard 2010).
Archaeol Anthropol Sci (2011) 3:209–221
DNA survival in ancient samples
mtDNA sequences were recovered from 10 of our 15
archaeological/historic samples. Given that there is no
obvious temporal reason for the results, several other
reasons may explain the difference in preservation. DNA
survival is closely linked to both temperature and pH of an
environment (Lindahl 1993). Although the exact pH values
of the burial environments can have varied through time,
and are not known, assumptions can be made from the
knowledge of pH values in similar environments. For at
least two of the samples, the pH value in the burial
environment has probably determined the survival of
amplifiable DNA. The first of these is the sample from
Krogens Mølle Mose that originated from a peat bog. Bogs
are characteristically wet, acidic, and low oxygen or
completely anoxic conditions (Painter 1995; Painter 1998;
van der Sanden 1996), and poor for DNA survival (Hughes
et al. 1986). It is intriguing therefore that mtDNA could be
successfully amplified from this sample. One potential
explanation is that the tracing strontium isotopic analysis
performed on the same textile from Krogens Mølle Mose
indicated the presence of carbonates, which is unusual for
peat bog environments (Frei, unpublished data). This
suggests that the bog in question is alkaline and not acidic,
probably due to underlying limestone (late Cretaceous-
Palaeocene), and thus much better for DNA survival.
The pH value of the burial environment likely also
played a role in the sample from Borum Eshøj C that
originated from an oak coffin burial. As demonstrated by
Breuning-Madsen and colleagues, the environment within
burial mounds is wet and anaerobic due to redox processes
(Breuning-Madsen et al. 2001; Breuning-Madsen et al.
2003), with pH values of Danish Bronze Age burial at
around 4. Thus, no DNA survival in this sample is
unsurprising.
Dyes and metals as a determining factor of DNA survival
Given that our results suggest that the presence of dyes
themselves does not affect DNA levels in sheep hairs, it is
interesting to note that prior evidence suggests that the
presence of some dyes in general prolongs wool fibre
survival. This is seen, for instance, in the striped shawl
from the Iron Age find at Lønne Hede, where the red stripes
are better preserved than the white stripes (Ringgaard
2010). Ringgaard has argued that this may be explained
through the fact that energy that would otherwise be spent
on the decay of the fibre is instead spent on degrading the
dyes. Of additional interest in this context are the samples
taken from the Flemish tapestry at Borreby Manor, all of
which yielded mtDNA, with the exception of the brown
sample. As they all come from the same textile, it is
Archaeol Anthropol Sci (2011) 3:209–221
unlikely that the lack of DNA is due to preservation factors
such as time and temperature. The only obvious explana-
tion therefore relates to the original processing of the wool.
Dark colours in wools are usually produced with use of iron
mordants, and indeed, it has been observed that in general,
dark, iron-containing dyes have a long-term detrimental
effect on wool, due to the catalytic effects of the iron on
photo-oxidative patterns of degradation (Ringgaard 2010).
Ultimately, either the initial application of the mordant
itself, of its subsequent action, may be the explanation for
the lack of DNA in the brown wool.
Conclusion
In this study, we demonstrate that at least in principal, one
can expect the presence of PCR-amplifiable fragments of
both mitochondrial and nuclear DNA in wool, unless it has
been treated with a mordant. We furthermore demonstrate
that in cool preservation conditions, such as those found in
Northern Europe and Greenland, the mtDNA in wool can
survive several thousand years. Although the size of
fragments tested are relatively small, they are sufficient
for conventional PCR analyses such as those used in
mitochondrial sequence and nuclear SNP analyses of
ancient samples, and more than sufficient for analysis using
high-throughput DNA sequencing platforms such as the
Roche FLX or Illumina Genome Analyzers. Therefore, we
are optimistic that sheep wool will represent a useful source
material for future genetic studies.
Acknowledgements The authors would like to thank Margit
Petersen, who dyed and mordanted some of the wool samples used
in this study, and the Centre for Historical Archaeological Research
and Communication, Lejre, for their collaboration during the work.
We would also like to thank Poul Otto Nielsen, Jetter Arneborg and
Irene Skals (The National Museum of Denmark) for generously
providing access to the ancient samples and their subsampling, and
Roberto Fortuna (National Museum of Denmark) for the photographs
used in Fig. 1. MTPG and UM would like to thank the Danish
National Research Foundation and Basic Research Foundations for
funding the research.
References
Andersen H (1991) Dendrokronologisk datering af Mammengraven.
In: Iversen M (ed) Mammen. Grav, kunst og samfund i viking-
etid. Jysk Arkæologisk Selskab, Højbjerg, pp 43–44
Barber EJW (1991) Prehistoric Textiles. The Development of Cloth in
the Neolithic and Bronze Ages. Princeton University Press,
Princeton
Bender Jørgensen L (1986) Forhistoriske textiler i Sandinavien. Det
Kongelige Nordiske Oldskriftselskab, København
Bender Jørgensen L, Walton P (1986) Dyes and fleece types in
prehistoric textiles from Scandinavia and Germany. J Dan
Archaeol 5:177–188
219
Beneckes N (1994) Der Mensch und seine Haustiere. Die Geschichte
einer jarhuntausendealten Bezieung. Konrad Theiss Verlag
GmbH & Co, Stuttgart
Binladen J, Wiuf C, Gilbert MTP, Bunce M, Barnett R, Larson G,
Greenwood AD, Haile J, Ho SYW, Hansen AJ, Willerslev E
(2006) Assessing the fidelity of ancient DNA sequences
amplified from nuclear genes. Genetics 172:733–741
Bonnichsen R, Hodges L, Ream W, Field K, Kirner DL, Selsor K,
Taylor RE (2001) Methods for the study of ancient hair:
radiocarbon dates and gene sequences from individual hairs. J
Archaeol Sci 28:775–785
Breuning-Madsen H, Holst MK, Rasmussen M (2001) The chemical
environment in a burial mound shortly after construction—an
archaeological-pedological experiment. J Archaeol Sci 28:691–
697
Breuning-Madsen H, Holst MK, Rasmussen M, Elberling B (2003)
Preservation within log coffins before and after barrow construc-
tion. J Archaeol Sci 30:343–350
Broholm HC, Hald M (1940) Costumes of the Bronze Age in
Denmark. Nyt Nordisk Forlag, København
Burger J, Pfeiffer I, Hummel S, Fuchs R, Brenig B, Herrmann B
(2001) Mitochondrial and nuclear DNA from (pre)historic hide-
derived material. Anc Biomol 3:227–238
Cai D-W, Han L, Zhang X-L, Zhou H, Zhu H (2007) DNA analysis of
archaeological sheep remains from China. J Archaeol Sci
34:1347–1355
Campana MG, Bower MA, Bailey MJ, Stock F, O’Connell TC,
Edwards CJ, Checkley-Scott C, Knight B, Spencer M, Howe CJ
(2010) A flock of sheep, goats and cattle: ancient DNA reveals
complexities of historical parchment manufacture. J Archaeol Sci
37:1317–1325
Cardon D (2007) Natural dyes – sources, tradition, technology,
science. Archetype Publications Ltd, London
Christiansen K (2006) Dendrochronological dating of Bronze Age oak
coffins from Denmark & Schleswig. In: Randsborg K (ed)
Bronze Age oak-coffin graves. Archaeology & Dendrodating.
Acta Achaeologica 77:163–246
Clutton-Brock J (1999) A natural history of domesticated mammals.
Cambridge University Press, Cambridge
Forbes RJ (1956) Studies in ancient technology, vol IV. Leiden, Brill
Frei KM, Vanden Berghe I, Frei R, Mannering U, Lyngstrøm H (2010)
Removal of natural organic dyes from wool—implications for
ancient textile provenance studies. J Archaeol Sci 37:2135–2145
Gilbert MTP, Hansen AJ, Willerslev E, Rudbeck L, Barnes I,
Lynnerup N, Cooper A (2003) Characterisation of genetic
miscoding lesions caused by postmortem damage. Am J Hum
Genet 72:48–61
Gilbert MTP, Wilson AS, Bunce M, Hansen AJ, Willerslev E, Shapiro
B, Higham TFG, Richards MP, O’Connell TC, Tobin DJ,
Janaway RC, Cooper A (2004) Ancient mitochondrial DNA
from hair. Curr Biol 14:R463–R464
Gilbert MTP, Janaway RC, Tobin DJ, Cooper A, Wilson AS (2006)
Histological correlates of post mortem DNA damage in degraded
hair. Forensic Sci Int 156:201–207
Gilbert MTP, Tomsho LP, Rendulic S, Packard M, Drautz DI, Sher A,
Tikhonov A, Dalén L, Kuznetsova T, Kosintsev P, Campos PF,
Higham T, Collins MJ, Wilson AS, Shidlovskiy F, Buigues B,
Ericson PG, Germonpré M, Götherström A, Iacumin P, Nikolaev
V, Nowak-Kemp M, Willerslev E, Knight JR, Irzyk FP, Perbost
CS, Fredrikson KM, Harkins TT, Sheridan S, Miller W, Schuster
S (2007) Whole-genome shotgun sequencing of mitochondria
from ancient hair shafts. Science 317:1927–1930
Gilbert MTP, Drautz DI, Lesk AM, Ho SYW, Qi J, Ratan A, Hsu C-H,
Sher A, Dalén L, Götherström A, Tomsho LP, Rendulic S,
Packard M, Campos PF, Kuznetsova T, Shidlovskiy F, Tikhonov
A, Willerslev E, Iacumin P, Buigues B, Ericson PGP, Germonpré
220
M, Kosintsev P, Nikolaev V, Nowak-Kemp M, Knight JR, Irzyk
GP, Perbost CS, Fredrikson KM, Harkins TT, Sheridan S, Miller
W, Schuster SC (2008) Intraspecific phylogenetic analysis of
Siberian woolly mammoths using complete mitochondrial
genomes. Proc Natl Acad Sci USA 105:8327–8332
Gräslund A (1991) Var Mammen-mannen Kristen? In: Iversen M (ed)
Mammen. Grav, kunst og samfund i vikingetid. Jysk Arkæolo-
gisk Selskab, Højbjerg. pp 205–210
Guo J, Du L-X, Ma Y-H, Guan W-J, Li H-B, Zhao Q-J, Li X, Rao S-Q
(2005) A novel maternal lineage revealed in sheep (Ovis aries).
Anim Genet 36:331–336
Haile J, Holdaway R, Oliver K, Bunce M, Gilbert MTP, Nielsen R,
Munch K, Ho SYW, Shapiro B, Willerslev E (2007) Ancient
DNA chronology within sedimentary deposits: are paleobiolog-
ical reconstructions possible and is DNA leaching a factor? Mol
Biol Evol 24:982–989
Haile J, Froese DG, MacPhee RDE, Roberts RG, Arnold LJ, Reyes
AV, Rasmussen M, Nielsen R, Brook BW, Robinson S, Demuro
M, Gilbert MTP, Munch K, Austin JJ, Cooper A, Barnes I,
Möller P, Willerslev E (2009) Ancient DNA reveals late survival
of mammoth and horse in interior Alaska. Proc Natl Acad Sci
USA 106:22352–22357
Hald M (1980) Ancient Danish textiles from bogs and burials. The
National Museum of Denmark, København
Hansen AJ, Willerlev E, Wiuf C, Mourier T, Arctander P (2001)
Statistical evidence for miscoding lesions in ancient DNA
templates. Mol Biol Evol 18:262–265
Hebsgaard MB, Arneborg J, Gilbert MTP, Heyn P, Allentoft ME,
Bunce M, Munch K, Schweger C, Willerslev E (2009) “The farm
beneath the sand”—an archaeological case study on ancient ‘dirt’
DNA. Antiquity 83:430–444
Heindleder S, Mainz K, Plante Y, Lewalski H (1998) Analysis of
mitochondrial DNA indicates domestic sheep are derived from
two different ancestral maternal sources: no evidence for
contributions from Urial and Argali sheep. Heredity 89:113–120
Heindleder S, Kaupe B, Wassmuth R, Janke A (2002) Molecular
analysis of wild and domestic sheep questions current
nomenclature and provides evidence for domestication from
two different subspecies. Proc R Soc Lond B Biol Sci
269:893–904
Hofmann-de Keijzer R, van Bommel MR, Joosten I (2007) Natur-
wissenschaftliche Untersuchungen der Farbungen und Fasern
von bronzezeitlichen Textilien aus dem prahistorischen Salzberg-
bau in Hallstatt. In: K. Gromer, Bronzezeitliche Gewebefunde
aus Hallstatt—Ihr Kontext in der Textilkunde Mitteleuropas und
die Entwicklung der Textiltechnologie zur Eisenzeit. Dissertation
Universitat Wien, pp. 314–320
Hofreiter M, Jaenicke V, Serre D, von Haeseler A, Pääbo S (2001)
DNA sequences from multiple amplifications reveal artifacts
induced by cytosine deamination in ancient DNA. Nucleic Acids
Res 29:4793–4799
Hughes MA, Jones DS, Connolly RC (1986) Body in the bog but no
DNA. Nature 323:208
Iversen M (1991) Genudgravningen af Bjerringhøj 1986. In: Iversen
M (ed) Mammen. Grav, kunst og samfund i vikingetid. Jysk
Arkæologisk Selskab, Højbjerg, pp27–42
Jaenike-Despres V, Buckler E, Smith BD, Gilbert MTP, Cooper A,
Doebley J, Pääbo S (2003) Early allelic selection in maize as
revealed by ancient DNA. Science 302:1206–1208
Kaul F (1990) Endnu en grav fra Vrangstrup. Aarbøger for Nordisk
Oldkyndighed og Historie, 7–12
Lamers R, Hayter S, Matheson CD (2009) Postmortem miscoding
lesions in sequence analysis of human ancient mitochondrial
DNA. J Mol Evol 68:40–55
Lindahl T (1993) Instability and decay of the primary structure of
DNA. Nature 362:709–715
Archaeol Anthropol Sci (2011) 3:209–221
Lund Hansen U (1987) Römischer Import im Norden. Det Kongelige
Nordiske Oldskriftselskab, København
Mannering U, Gleba M, Possnert G, Heinemeier J (2009) Om datering
af mosefundne lig og beklædningsdele. Kuml 2009:103–125
Mannering U, Possnert G, Heinemeier J, Gleba M (2010) Dating
Danish textiles and skins from bog finds by 14C-AMS. J
Archaeol Sci 37:261–268
Miller W, Drautz DI, Janecka JE, Lesk AM, Ratan A, Tomsho LP,
Packard M, Zhang Y, McClellan LR, Qi J, Zhao F, Gilbert MTP,
Dalén L, Arsuaga JL, Ericson PGP, Huson DH, Helgen LM,
Murphy WJ, Götherström A, Schuster SC (2009) The mitochon-
drial genome sequence of the Tasmanian tiger (Thylacinus
cynocephalus). Genome Res 19:1–8
Østergård E (2004) Woven into the Earth. Aarhus University Press,
Aarhus
Østergård E (1991) Textilfragmenterne fra Mammengraven. In:
Iversen M (ed) Mammen. Grav, kunst og samfund i vikingetid.
Jysk Arkæologisk Selskab, Højbjerg, pp 123–138
Pääbo S (1989) Ancient DNA: extraction, characterization, molecular
cloning, and enzymatic amplification. Proc Natl Acad Sci USA
86:1939–1943
Painter TJ (1995) Chemical and microbiological aspects of the
preservation process in sphagnum peat. In: Turner RC, Scaife
RG (eds) Bog bodies. New Discoveries and New Perspectives,
London, pp 88–99
Painter TJ (1998) Carbohydrate polymers in food preservation: an
integrated view of the Maillard reaction with special reference to
discoveries of preserved foods in Sphagnum—dominated peat
bogs. Carbohyd Polym 36:335–347
Pedrosa S, Uzun M, Arranz JJ, Gutiérrez-Gil B, San Primitivo F,
Bayón Y (2005) Evidence of three maternal lineages in Near
Eastern sheep supporting multiple domestication events. Proc
Roy Soc Lond B Biol Sci 272:2211–2217
Peters J, von den Driesch A, Helmer D (2005) The upper Euphrates-
Tigris basin: cradle of agro-pastoralism. In: Vigne J-D, Peters J,
Helmer D (eds) First steps of animal domestication. New
archaeological approaches. Proceedings of the 9th Conference
of the International Council of Archaeozoology, Durham, August
2002. Oxbow Books, Oxford, pp 96–124
Rasmussen M, Li Y, Lindgreen S, Skou Pedersen J, Albrechtsen A,
Moltke I, Metspalu M, Metspalu E, Kivisild T, Gupta R,
Bertalan M, Nielsen K, Gilbert MTP, Wang Y, Raghavan M,
Campos PF, Munkholm Kamp H, Wilseon AS, Gledhill A,
Tridico S, Bunce M, Lorenzen E, Binladen J, Guo X, Zhao J,
Zhang X, Zhang H, Li Z, Chen M, Orlando L, Kristiansen K,
Bak M, Tommerup N, Bendixen C, Pierre TL, Grønnow B,
Meldgaard M, Andreasen C, Dedorova SA, Osipova LP,
Higham TFG, Bronk Ramsay C, Hansen TVO, Nielsen FC,
Crawford MH, Brunak S, Sicheritz-Pontén T, Villems R,
Nielsen R, Krogh A, Wang J, Willerslev E (2010) Ancient
human genome sequence of an extinct Palaeo-Eskimo. Nature
463:757–762
Ringgaard M (2010) To par strixstrømper oc en nattrøie naccarat.
University of Copenhagen, Copenhagen
Rostholm H (2009) Herning Museums arkæologiske virksomhed.
Herning Museum Midtjyske fortællinger 2009:27–36
Ryder ML (1983) Sheep and Man. Duckworth, London
Scherf BD (2000) World watch list for domestic animal diversity, 3rd
edn. Food and Agriculture Organization of the United Nations,
FAO, Rome
Schneider MR, Schmidt-Ullrich R, Paus R (2009) The hair follicle as
a dynamic miniorgan. Curr Biol 19:132–142
Svensson EM, Anderung C, Baubliene J, Persson P, Malmström H,
Smith C, Vretemark M, Daugnora L, Götherström A (2007)
Tracing genetic change over time using nuclear SNPs in ancient
and modern cattle. Anim Genet 38:378–383
Archaeol Anthropol Sci (2011) 3:209–221
Tapio M (2006) Origin and maintenance of genetic diversity in
northern European sheep, PhD dissertation, University of Oulu
Tapio M, Marzanov N, Ozerov M, Cinkulov M, Gonzarenko G,
Kiselyova T, Murawski M, Viinalass H, Kantanen J (2006) Sheep
mitochondrial DNA variation in European, Caucasian, and
Central Asian areas. Mol Biol Evol 23:1776–1783
Thrane H (1984) Lusehøj ved Voldtofte. Odense Bys Museer, Odense
van der Sanden WAB (1996) Through nature to eternity—the bog
bodies of northwest Europe. Batavian Lion International,
Amsterdam
Vanden Berghe I, Gleba M, Mannering U (2009) Towards the
identification of dyesstuffs in Early Iron Age Scandinavian peat
bog textiles. J Archaeol Sci 36:1910–1921
Vellev J (1991) Bjerringhøjundersøgelsen 1868 - og hvad der senere
hændte. In: Iversen M (ed) MAMMEN. Grav, kunst og samfund i
vikingetid. Jysk Arkæologisk Selskab, Højbjerg, pp11–25
Vellev J (1991) Bjerringhøjundersøgelsen 1868 - og hvad der senere
hændte, In: Iversen M (ed) Mammen. Grav, kunst og samfund i
vikingetid. Jysk Arkæologisk Selskab, Højbjerg, pp 11–25
Vives S, Gilbert MTP, Arenas C, Gigli E, Lao O, Lalueza-Fox C
(2008) Statistical analysis of post mortem DNA damage-derived
miscoding lesions in Neandertal mitochondrial DNA. BMC Res
Notes 1:40
Vuissoz A, Worobey M, Odegaard N, Bunce M, Machado CA,
Lynnerup N, Peacock E, Gilbert MTP (2007) The survival of
PCR-amplifiable DNA in cow leather. J Archeol Sci 34:823–
829
Walton P (1988) Dyes and wools in Iron Age textiles from Norway
and Denmark. J Dan Archaeol 7:144–158
221
Walton P (1991) Dyes and wools in textiles from Mammen
(Bjerringhøj), Denmark. In: Iversen M (ed) Mammen. Grav,
kunst og samfund i vikingetid. Jysk Arkæologisk Selskab,
Højbjerg, pp139–145
Walton Rogers P (2003) Dyes and dyeing. In: Jenkins D (ed) The
Cambridge History of Western Textiles, vol I. Cambridge
University Press, Cambridge, pp 25–29
Willerslev E, Gilbert MTP, Binladen J, Ho SYW, Campos P, Ratan A,
Tomsho L, da Fonseca R, Sher A, Nowak-Kemp M, Roth T,
Miller W, Schuster S (2009) Analysis of complete mitochondrial
genomes from extinct and extant rhinoceroses reveals lack of
phylogenetic resolution. BMC Evol Biol 9:95
Wilson AS, Gilbert MTP (2007) Identification from hair and nail. In:
Black S, Thompson T (eds) Introduction to biological human
identification. CRC Press, Boca Ratan, pp 147–174
Wilson AS, Dixon RA, Dodson HI, Janaway RC, Pollard AM, Stern
B, Tobin DJ (2001) Yesterday’s hair—human hair in archaeol-
ogy. Biologist 48:213–217
Wood NJ, Phua SH (1996) Variation in the control region sequence of
the sheep mitochondrial genome. Anim Genet 27:25–33
Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR (1998) Technical
note: improved DNA extraction from ancient bones using silica-
based spin columns. Am J Phys Anthropol 105:539–543
Zeder MA (2005) A view from the Zagros: new perspectives on
livestock domestication in the Fertile Crescent. In: Vigne J-D,
Peters J, Helmer D (eds) First steps of animal domestication.
New archaeological approaches. Proceedings of the 9th Confer-
ence of the International Council of Archaeozoology, Durham,
August 2002. Oxbow Books, Oxford, pp 125–147