Vous êtes sur la page 1sur 258

Sons of Shem

:

Part I

The birthright was passed to Shem, the youngest son of Noah, as priest of God in the order of
Melchisedek. The descendants of Shem carried the priesthood down to Abraham and on into the
lines of the descendants of Abraham. Shem produced a number of children and from them sprung
a number of important nations of the world. The sons of Shem intermingled with the sons of Ham
and Japheth and God’s promises to the world would be fulfilled in that mixing of nations.

Preface

The Conversion of the Sons of Abraham

God established a covenant with Abraham and said He would make him the father of many nations.
Through his offspring, who we call the Patriarchs, a number of nations were commenced and they were
given birthright promises and were made part of an ongoing covenant between God and Abraham that
they were expected to continue and fulfil.

In this series we will deal with the identities and ultimate destiny of these nations and their influence on
the rest of the world.

Over the next time-cycle of 19 years and the final sequence of the Wars of the End arriving at the Jubilee
of 2027, we will see these nations brought to repentance and conversion on a systematic and progressive
basis.

Part I (No. 212A) deals with the Sons of Shem and their locations.

Part II (No. 212B) deals with the sons of Lot and also those of Esau and their identity, destiny and
conversion.

Part III (No. 212C) deals with Ishmael and its destiny and conversion and place in the Kingdom of God.

Part IV (No. 212D) deals with the sons of Keturah and their identity, destiny and conversion.

Part V (No. 212E) will deal with the destiny of Judah and its conversion in the Last Days.

Part VI (No. 212F) will deal with Israel and its crisis and repentance.

Part VII (No. 212G) will be an Appendix for tables and charts

These six parts will explain what is required of the sons of Abraham and their place in the restoration of
the world to the Laws of God.

The details of the covenant God made with Abraham and the legacy and priesthood established with him
through Shem is also explained in the site www.abrahams-legacy.org

Introduction

The purpose of this paper is to expand on the work on the Genetic Origin of the Nations (No. 265) and
deal with the sons of Shem and then lead in to the sons of Arphaxad and the descendants of Abraham,
and their place in history and prophecy and their current identities.

The sons of Shem are Elam and Asshur, Arphaxad, Lud and Aram.

We know for certain that the Elamites became the Persians, the sons of Asshur became the Assyrians,
the sons of Arphaxad became the Hebrews, and Aram became the Syrians and the source of the name of
the Aramaic language. They also later went north into Armenia.

From the modern DNA sampling of the Assyrian project, the modern Assyrians are L, G, J and some
R1b1, but it seems that the R1b1 tested are English on the paternal side and Assyrian on the maternal
side. Thus, northern Aram (in the area of Armenia and Georgia) and Asshur developed the G
Haplogroup, which is where it is found in greatest percentages.

Josephus gives us a clear indication of the sons of Aram when he says that of the four sons of Aram, Uz
founded Trachonitis and Damascus, which is the country between Palestine and Ceolesyria, Ul founded
Armenia and Gather the Bactrians, and Mesa the Mesaneans now called Charax Spasini. From this
record the Semitic G Haplogroup would appear to come from Aram and Asshur. Josephus records that
Abraham first settled with an army in Damascus (ibid., Whiston tr., p. 32).

Josephus says that Joktan of the Hebrews had thirteen sons: Elmodad, Saleph, Asermoth, Jera, Adoram,
Aizel, Decla, Ebal, Abimael, Sabeus, Ophir, Eulat, and Jobab. He says that these people inhabited Asia
from the Indian River, Cophen, and the lands surrounding it. This is modern Kabul and the valley of its
river. The land further towards the Indus is Bactria. Thus, if that is the fact of the matter they seemingly
moved through the Arabian Peninsular and most went on to India. The result could be the composite
groups of Joktan in what is Afghanistan, Gather in Bactria and then Lud in the Punjab. The Semitic
Haplogroup H in India would then be derived from a mutation that occurred among the Hebrews of
Joktan and the Semites of Lud. The golden wedge of Ophir refers to the lands of one of the sons of
Joktan who settled in Afghanistan or India, and thus the area of Ophir may be from the Hindu Cush into
India or perhaps, even more likely, Sri Lanka (Ceylon) (see also below).

Afghan and other Pashtun

The Wikipedia article on Pashtuns says they would appear to be primarily of Iranian origin, but have
similarities with Persians, Kurds, Tajiks and Baluchis.

Pashto-speaking Pashtuns (or Pukhtuns, depending on dialect) and are found in southern and eastern
Afghanistan and western Pakistan. These Pashtuns also became intermingled with others groups, such as
the Ghilzai (who possibly mingled with Turkic tribes), the Durrani (who interacted with the Tajiks), and
Pashtun tribes north of Peshawar (who mingled with Dardic groups).

The article went on to say that from the first to the fifth century BCE huge migrations of peoples from
Aryans, Persians, Sakas, Scythians, Kushans, Huns, and Greeks moved into the regions where the
Pashtuns lived. Later invaders were Muslim Arabs, Central Asian Turkic tribes and Mongols.

The anthropological evidence that the Pashto-speaking Pashtuns are an Indo-European Caucasoid
people, who are related to other Iranian groups and to speakers of the Kalasha and Nuristanis languages,
is by no means conclusive. So far the testing has not shown any substantial connection between the
Pashtun population sampled to the genetic markers found amongst most Greeks, Jews, or Arabs. The
answer may be that Pashtuns have been slightly modified over time by various invaders and mixes as
mentioned above. Yet they have kept their eastern Iranian base genetically overall.

There would thus also be Japhethitic R1a and R1b and Hamitic C YDNA present.

Many conclusions concerning the Semites come from the premise that the Semitic Haplogroups are all J
as found among the three populations mentioned.

The Pashtun are classified as Iranian, which as we have seen is primarily Haplogroup I which is derived
from the Semitic IJ Haplogroup (see below) but they vary as a typical Central Asian composite YDNA
grouping. An attempt was made to classify the Pashtun in the 16th century as one of the Bani Israel, of
the Lost Ten Tribes and as Joseph. This was debunked based on their Indo-Iranian affinities and
language. However, it is an historical fact that the area of Khandahar, Kabul and Bactria also, on the
other side of the Hindu Cush, were made provinces or satrapies of the Persian Empire and their
languages are thus affected by that fact. The DNA similarities with Elam and their reported historical
descent and affinity with Joktan indicate that the original DNA of the Semites, including the Joktan
Hebrews, was not J but F and the primary Semitic derivative is I and the secondary derivatives are J,
both derived from IJ (based on S2 and S22) and then H and G. All the Eastern Semites of Elam and
Joktan were Hg. I, rather than J. Thus these mutations occurred over the second millennium BCE and the
extended mathematical models of the evolutionists are wrong.

The Durrany and Galzay tribes are held to be direct descendants of the Ibrani or Hebrews and probably
of the sons of Joktan. Some also hold the Rabbani, Shinwari, Levani, Deftali, and Jaji from Afghanistan,
and the Efridi and Yusufzai from Pakistan to also be Hebrew tribes.

Lud

Lud is a source of uncertainty and there are two explanations for the identification of, and locations of
the sons of Lud. We will return to this puzzle shortly.

Other Locations of the Hebrews

The origin and location of the Hebrews is identified with Abraham as coming out of Ur of Chaldea and
the sons of Arphaxad are identified with the Akkadian groups in the Mesopotamian plain between the
children of Asshur, or the Assyrians, and the sons of Elam, who were on the east of the Tigris basin to
the Persian plateau.

The other group of the Medes, who were associated with the Persians and occupied the high country to
the north of Elam and Gutea, are not basically Semite, but we will see they do contain Semites now from
their exposure to the Arabs and perhaps earlier. The Kurds predominantly derived from the Medes, the
sons of Madai, a Japhethite. We will return to them later. The Guteans or Guti may well also be
associated with the Goths as part of the later Parthian or Scythian Horde. We will examine their
movements in a later paper.

Professor Cyrus Gordon also holds the early Minoans to be Semites and their language Linear A as
being Semitic. His work on Linear A has been met with controversy.

The sons of Arphaxad are: Salah and Eber (from where the name Hebrew is derived). His sons Peleg and
Joktan saw the split in the Hebrews. The sons of Joktan were thirteen in number and occupied the entire
eastern area of the Arabian peninsular (Gen. 10:21-32) but many went on into Afghanistan or Pakistan,
as we see above. The sons of Abraham through Hagar and some of the sons of Keturah, such as Midian,
later joined them. The line of Abraham through Peleg was to Reu, Serug, Nahor, Terah to Abraham,
Nahor and Haran. Abraham was called out of Ur of Chaldee and sent into the land of Canaan.

It follows that the lineages of the Semitic countries will give us clues as to the distribution of Semitic
Haplogroups and mutations. The original position was to say simply that Haplogroup J is the Semitic

Haplogroup and all others are not Semitic, but that cannot be true given the distribution and mixtures of
the nation groups; and we now know that to be false in regard to the IJ proto Haplogoup. From the
historical reconstruction, a number of other groups are also Semitic, as we will see.

For example, in the genetic structure of the Persians or Elamites, Hg I is predominant. It exceeds J by
some 10%, and has an element of F and G with it. Those groups constitute half the YDNA of the
Persians. The Middle Eastern Arabs also have a significant amount of I and some G. Haplogroups G, I
and J constitute half of the Georgians/Armenians and the Turks and F, G, I and J are half the Italians
with I and J comprising half the YDNA of the Greeks. When we go into Europe the balance of I
increases dramatically.

G, (M201), H (M69), I (M170, M258, and P19) and J (12f2.1) appear to be known Semitic lineages with
K (M9), the root base for all the sons of Japheth. Hg. J decreases as it moves west in Europe, but Hg. I
remains more or less highly significant as far west as the Anglo-Saxons and then decreases among the
Basque, Welsh, Irish and Scots, but is nevertheless still found in quantities of up to 15% among these
known Celts.

The Anglo-Saxons came in from the Middle East as part of the horde at the fall of the Parthian Empire
from what is now the area of Iraq and the area north of it. That occurred at the end of the second century
CE. They moved into the area of NW Europe and the horde split up in various waves. The Anglo-Saxons
and Jutes and the associated tribes of Lombards, Danes, Norwegians, Saxons and Fris, split up but
retained a similar diversity. The northern French are also from the Middle East. The Normans constitute
one element and are predominantly R1b but they contain other DNA groups such as I. The others are
Francs in two groups. These are the Riphathian Francs and the Salien Francs. The Salien Francs could
inherit through the male line only but the Riphathian Francs could inherit through both.

As we know, Riphath was a son of Japheth and we know that the nobility of these people also claimed
descent from Antenor I, King of the Cimmerians, and also from the Trojans. They were understood to be
the offspring of the group that remained in the Middle East with the sons of Hector. They named their
major city after Paris and Troyes. Many of these people settled across the Channel in Britain and those
tribes (e.g. Parisii) were also R1b Celts. Over 35% of the northern French are Haplogroups I and J.
Approximately 35% of the Anglo-Saxons are Middle East Hg. I with some small amount of J.
Approximately 40% of English are Middle Eastern and seemingly Semites of I mutated from the IJ
group. The majority of all NW Celts and Anglo-Saxons are R1b and part of the same genetic divisions
as the known Japhethite tribes. The obvious exception is to the east where the Slavs are R1a, and the
largest R1a divisions among the horde coming into the North West was among the Norwegians, at about
30%.

Arabs

From the Bible, Torah and Qur’an, we learn that the Arabs are descendants of Shem, son of Noah. Some
Arabs claim to trace their ancestry directly back to Noah and Adam.

Arab origin is divided into two major groups:
al-‘Āriba meaning, "Pure origin" and al-Musta’ribah meaning, "Arabised Arabs".

The Pure Arabs are considered to be descendants of Noah through his son Shem, through his sons Aram
and Arphaxad, and are known as Qahtanite. The Qahtanite are considered to have originated from the
South Arabians, according to Arab genealogies.

The term Arabised-Arabs can be used for three different groups:
1) 1) For Arabs considered to be descendants of Abraham through Ishmael, through his son
Adnan and known as Adanites.

2) 2) For Arabs who spoke other Afro-Asiatic languages. As Arabic speakers they are regarded
as Arabs in contemporary times.
3) 3) For the "Mixed Arabs", between "Pure Arabs" and the Arabs from South Arabia.

The break-up of these groups will be discussed in the papers on Ishmael and Keturah.

Religions

While most Arabs are Muslim, a minority are Christians, and some are Jews. Muslims comprise Sunni,
Shi’ite, Ibadhite, Alawite, Ismaili or Druze.

Before the introduction of Islam, most Arabs worshipped a number of deities while some converted to
Christianity or Judiasm. The pagan deities were those such as Hubal, Wadd, Al-Lat, Manat and Uzza. A
few hanifs favoured a vague form of monotheism. However, as Islam expanded more and more Arabs
became Muslims and the old traditions disappeared.

Arab Christians generally follow one of the four main churches: Coptic, Maronite, Greek Orthodox, or
Greek Catholic.

Gypsies or Roma

When the British explorer Richard Burton travelled throughout the Land of Midian in the late 19 th
century, he came upon a people known as the Hutaym (meaning broken). Although Muslims, they were
a tribe of pariahs also found in Egypt.

The Arabs of Midian always compare the Hutaym with the Ghagar (Ghajar) or Gypsies of Egypt;
and this is the point which gives the outcasts a passing interest. I have not yet had an opportunity of
carefully studying the race; nor can I say whether it shows any traces of skill in metal-working.
Meanwhile, we must inquire whether these Helots [slaves], now so dispersed, are not old immigrants
of Indian descent, who have lost their Aryan language, like the Egyptian Ghajar. In that case they
would represent the descendants of the wandering tribes who worked the most ancient ateliers
[workshops]. Perhaps they may prove to be congeners of the men of the Bronze Age, and of the
earliest waves of Gypsy-immigration into Europe. (Burton, Midian (Revisited), p. 119; emphasis
added)

Burton goes on to say:
And I would here lay special stress upon my suspicion that the ancestors of the despised Hutaym
may have been the Gypsy-caste that worked the metals in Midian. (ibid., p. 135).

The Hutayim he saw may have been simply the remnant of the true sons of Midian whose brother tribes
had long since migrated into other areas of the Middle East and eventually into Europe, some perhaps
via India.

In his book Travels in Arabia (1845 and 1848) (reprinted by The Oleander Press, Cambridge, UK,
1979), G.A. Wallin had this to say of the tribe known as the Hutaym:
They are despised and illtreated by their Bedawy neighbours, to whom they are forced to pay a
heavy brother-tax (khawe) without being thereby freed from other contributions of every kind. I have
often seen how haughty Bedawies have driven their horses and camels through yet unmown fields,
permitting the animals to feed on the corn without any check … they [the Hutaym] silently submit to
their tyranny.
When in their tents they are usually seen doing some handiwork, as repairing their weapons or
making utensils and furniture … They also showed a stronger religious feeling … in their features
also a different origin is to be traced, and their type is most evidently Syrian, but often with a very

often travelling showmen and circus people (Other experts. traditionally coppersmiths. dates from the Byzantine era during a time of famine in the 9th century. North Africa. are a diverse ethnic group who live primarily in Southern and Eastern Europe. insist that Sinti are not a subgroup of Roma but rather a separate ethnic group which also had Indian origins and a history of nomadism). Burton’s use of the term Gypsy on several occasions may be the key to the identity of a relatively small group of the present-day descendants of Midian. in 803 A. The word means "husband". associated with entertainment. Sinti mostly in Alsace and other regions of France and Germany. the Roma had reached the Balkans. Around 1360. (Greek). I regard them as a scanty remainder of some of the old Jewish or Nabataean aborigines of the land. 6:3-6). cultural and dialectal differences. … In 1322 a Franciscan monk named Simon Simeonis described people resembling these "atsinganoi" living in Crete and in 1350 Ludolphus of Sudheim mentioned a similar people with a unique language whom he called Mandapolos. In the year 800 A. ventriloquists and wizards who visited the Emperor Constantine IX in the year 1054.D. and by the 16th century. … (p. there are an estimated 8 to 10 million Roma. under the term "Atsinganoi". and North Africa. Worldwide. They began their migration to Europe and North Africa via the Iranian plateau around 1050.D. Western Asia. many of whom migrated to central Europe and North America. often referred to as gypsies or gipsies. from the Balkans. The Roma recognize divisions among themselves based in part on territorial. The Wikipedia article (abridged) on the Gypsies or Roma contains a number of interesting facts. and Sinti themselves. … The origin of the word Rom … is proposed as the Sanskrit word ram … or rama … meaning "husband". "Atsingani" was used to refer to itinerant fortune tellers. the former Soviet Union. a word which some theorize was possibly derived from the Greek word mantes (meaning prophet or fortune teller). and Erlides (also known as Yerlii or Arli) settled in South-eastern Europe and Turkey. an independent Romani fiefdom (called the Feudum Acinganorum) was established in Corfu and became "a settled community and an important and established part of the economy. Latin America. Germany. 133) Wallin’s comment about the Bedawi (Bedouin) manner of driving livestock into their neighbours’ crops is reminiscent of the Midianites doing the same to the Israelites when they were given mastery over Israel (Jdg. Some authorities recognize five main groups: Kalderash are the most numerous. . while Romni means "wife". In fact. Contemporary scholars have suggested that one of the first written references to the Roma. there may be a strong case for including these people with the other known sons of Keturah. The largest population of Roma is found on the Balkan peninsular. Later. the Middle East. Theophanes the Confessor wrote that Emperor Nikephoros I had the help of the "Atsinganoi" to put down a riot with their "knowledge of magic". significant numbers also live in the Americas. Most Roma refer to themselves as Rom. the United States and the Middle East. sometimes called "Romany folk" in the United Kingdom. sometimes Rroma. The Roma (singular Rom. by 1424."[32] … By the 14th century. Rrom) or Romanies. however. Gitanos (also called Calé) mostly in the Iberian Peninsula. Saint Athanasia gave food to "foreigners called the Atsinganoi" near Thrace. They are believed to have originated in the Punjab and Rajasthan regions of the Indian subcontinent. an Indo-Aryan language. Romnichal (Rom'nies) mainly in Britain and North America. Western Europe. Most Roma speak one of several dialects of Romani... and southern France. prominent Jewish cast.

abduction of their children.000 to 800. 2006. X (7%). but only 10-15% in the southeast. … Roma were enslaved for five centuries in Romania until abolition in 1864. H is logged as an earlier division of F. Specifically. “ This data and the information above would indicate that Sinhalese Sri Lankans may well be Semites from the same early base as the Rom and may be the Ophir group of the sons of Shem with the Rom being another of the brothers of Ophir of the Joktan Hebrews with some Bengalis also related. Like the Jews. Haplogroup L is found in about 10% of Indian males but is absent from Roma (though Gresham et al. Kivisild et al. The M217 marker.6% of male Roma. U3 (10%). a population that has a large proportion of Bengali and Sri Lankan groups. Genetic data strongly supports linguistic evidence that the Roma originated on the Indian subcontinent. 2006). Hg. I (22%) and J2 (14%). does not seem to test for it). female haplogroups U2i and U7 are almost absent from female Roma. By contrast.000 people. Baltic and Vlax Roma genetics suggest that about 50% of observed haplotypes belong to Y-chromosomal haplogroup H. R2 and J2 increase in frequency towards the southeast. On the other hand. other (20%). Sengupta et al. but a large number of matches on haplogroup H with British Asian Londoners. 2003. . is also found in West Bengal (Kivisild (2003) et al). H and J2 occur 20-30% in South and East India. Sinhalese are mostly descendants of East and South Indian communities. 2001. female-line) haplogroups are H (35%). the Nazis murdered 200. they were subject to ethnic cleansing. R2 occurs around 20-40% in West Bengal and Andhra Pradesh (Bamshad et al. J2 (20%) and a high frequency of R2 (50%) which is found frequently in West Bengal and among the Sinhalese of Sri Lanka. However. common Y-chromosome (i. M (26%).000 Roma in an attempted genocide known as the Porajmos. but are present in South Asia (11%-35% approx). This genetic evidence indicates that approximately half of the gene pool of these studied Roma is similar to that of the surrounding European populations.e. and must be viewed from this genetic profile of Romas. The two currents met in France. Similar studies of the same population with mitochondrial DNA show 50% belong to female mitochondrial haplogroup M. Haplogroup R1a1 occurs around 35-45% in the northwest of the Indian subcontinent. Whereas male haplogroup H and female M are rare in non-Roma European populations. Common mitochondrial (i. Luba Kalaydjieva's research has shown that the original group appeared in India some 32-40 generations ago and was small.Scotland and Sweden. 36% of Roma are either Hg. Y-haplogroups H. likely under 1. A study published in Nature associates the Roma with the Sinhala. the rest are found throughout Europe. I or J2 Semites. which is the primary mutation for all Semites and Japhethites. Sahoo et al. which accounts for about 1. they were marked for extermination and sentenced to forced labour and imprisonment in concentration camps. and also from West Bengal and Central Asian Sinti (Kivisild (2003) et al). male-line) haplogroups are haplogroups H (50%). Both of these are widespread across South Asia. All these genetic studies indicate a South-East Indian origin of the male Roma population. Yhrd gives few matches with South Asian populations. and forced labor. Elsewhere in Europe. reaching Europe via Spain in the 15th century. During World War II. Studies of Bulgarian. Some Roma migrated from Persia through North Africa. H is a derivative of F. However.e. and R1b (7%). a search of the Yhrd database shows that some Roma populations in Europe have considerable percentages of male haplogroup R1a1. male Sinti Roma in Central Asia have H (20%).

org/wiki/Roma_people) The R2 is a Japhethite group that is Aryan and related to the Celts and Slavs.000-40. The subgroup of the Vlax Rom are probably derived from an ancestor no more than 400-500 years ago in Europe. et al. The Eurasian Heartland: A continental perspective on Y-chromosome diversity. who intermingled with the C basic earlier inhabitants of Australia and perhaps even as late as the first millennium BCE from the Indianisation of South East Asia. Australia and India. The Concise Oxford Dictionary. Both these groups are descended from the R basic Haplogroup. Of course evolutionists assert that the founder of Haplogroup H probably lived about 30. It gives the origin of the term as: “earlier gipcyan. occurred in a Haplogroup F man. This Haplogroup has not yet been studied in a comprehensive manner. are the main source of Haplogroup H in Western Europe. Thus the YDNA Haplogoup H was developed from F on the Indian subcontinent (as was L) and the predominant source of H in Europe is from the Gypsies and subsequent Indian immigrants. Haplogroup F The F Haplogroup stems from the division between the Yap M145. I are found in Assyrians with I and J being found in the Assyrians. Underhill. probably in the Indian subcontinent. and J are assumed to be of Semitic origin and G. Wells et al.” Gypsy YDNA may look like this: H M69 • H* - • H1 M52 • • H1* - • • H1a M82 • • • H1a* - • • • H1a1 M36. M203 divide for D and E and the RPS4Y 711 M216 divide for the C group. Haplogroups G. I and J are now known derivations from the one IJ group. gipsen from Egyptian. It is a small group and sometimes acts as a catchall because researchers did not do enough testing to determine the group correctly. M197 • • • H1a2 M97 • • • H1a3 M39. who apparently originated in India.wikipedia. H. Keturah Arab and Ishmaelite Arab and Jewish populations respectively.) (Retrieved from http://en. There are small F groups in . Bharti Morar. as well as being very thinly spread through the Middle East. found in Cameroon (Africa). nearly all members of Haplogroup H live in the Indian subcontinent area.(Ref: Origins and Divergence of the Roma (Gypsies). The language of the Romani was seemingly developed in Europe after they left India. Am J Hum (2001). We will look more at the timings below. M138 • • H1b M370 • H2 Apt Y-DNA Haplogroup H: The founding mutation for Haplogroup H. and speaking a language (Romany) related to Hindi”. Peter A. The later waves of the Australian Aboriginals were thus Aryans related to the Dravidians. The Roma (also known as Gypsy) people. David Gresham. I. under the entry gypsy. also says that the Roma were “of Hindu origin with dark skin and hair. The Aryan invasion of India took place 1000 BCE and the R basic subdivision is a later mutation of the YDNA system derived from P. H. Arphaxadites or Hebrews. Thus a significant percentage of Aborigines are proto-Celt/Slavs or Aryans of the sons of Japheth. from the supposed origin of gypsies when they appeared in England in the early 16th c. which is found amongst the Dravidians and a large proportion of the Australian Aboriginals. Today. M69.000 years ago. Whilst we can demonstrate reasonably well that Gypsies are of Semitic origin that came in via India we cannot demonstrate their origin in the sons of Keturah.

when we examine the tree of mtDNA we find some interesting group derivatives. I and R1b and R1a groupings satisfy these criteria. J. The blessings of Shem accrue to Japheth even though Japheth is larger in percentage terms in each nation. Perhaps Ham also passed it to one of his sons. God said that He would bless Japheth. The blessing of Japheth places Japheth within the tents of Shem. together with some R1a and R1b. M213. among the Kazan Tartar and in Khazakstan. who was told that God would enlarge him and he would dwell in the tents of Shem. which has an identified clear lineage to Shem. Q and R appear to be Japhethite tribes. but it might be then argued that G to I are open to both. producing the major national groups and the mutations that flowed from that stem. Conventional wisdom identifies the Middle Eastern Arabs as Haplogroup J and the Jewish Aaronic priesthood. Thus Hgs. The YDNA groups All other YDNA groups from G to R2 are derived from one central Haplogroup F. This Haplogroup division identifies also the Buba Clan of the Lemba Tribe of Zimbabwe as Aaronic priests and they have been separated from the rest of Judah/Levi for perhaps 1900-2. which is P14. The basic F is P14. H. I and J. P29 Haplogroups K. M89. N. Persia. and thus prophecy is fulfilled. This F group is central to known lineages of both Shem and Japheth. M213. Abraham has indeed become the father of many nations. There are also some lineages of E3b African or Hamitic lineages. Thus we would expect to find a mixture of Japheth and Shem in the same national groupings. I.Georgia/Armenia. This line is the basic line for G. O. L. there “are 26 mtDNA Haplogroups indicating 26 female mtDNA lines. The argument might be raised that the Haplogroups of Shem and Japheth are both F and that all their sons are simple variations from them without distinction. 265). Those arguments do not appear to stand up to scrutiny on a simple population basis. or female “eves” are posed for Europe. M89. either through their maternal or paternal lines. We know that the lineages in known Semitic nations are G. is at J2. Thus the J2 division is at least as old as that separation. Isaac and Jacob. both Shem and Japheth passed this core Haplogroup on to all their offspring. Thus K must include all Japheth. Georgia/Armenia and Italy. This stem determines all the other Haplogroups from F to R. M. The so- . The conclusion is that the basic root of F is nearly gone but the prolific sons survived and flourished. P. What is certain is that the sheer extent of the Haplogroups I and R1b and also R1a in Europe makes it virtually impossible for every person in Europe not to be a descendant of Abraham. We will start with Lineage F.500 years. These lineages with G also spread to Turkey. However. Some seven original Hgs. Thus the Hittite and Parthian alliance with Israel has made them one people spread over a vast area with various language entities. Uzbekistan. and K. In biblical terms. The mtDNA puzzle As we noted in the paper Genetic Origin of the Nations (No. The charts would make Ham’s sons widely divergent. and thus G to J are of both groups with K forming the next division and one that does not appear in the known Semitic J.

given the fact that Noah may have had daughters not mentioned. N and perhaps R. Thus. The L2 and L3 split may have come from the family structure before the Flood. L. and N came on to the Ark within the accepted biblical account. So in reality. they came from three main female lines. Ham and Japheth. and then L2 and L3. all females came from one Eve whose mtDNA line was L. N. The daughters of Noah and the wives of the sons could have carried all three of the L subdivisions and the basic core subgroups of M.called Supergroups are really only in three basic groups. Both of these groups are independent direct mutations of Hg. So we can assume that Eve produced the line L and the three wives of Shem. then M and N and subsequently R. The L groups L1. It is also possible that the subdivision Supergroup R may have come on the Ark. if we assume that the entire L line came in through the wife of Ham. In other words. and D and G. namely the wives of Shem. L we get Hg. It may have even been R. That is the basic reason why evolutionists claim that we all came out of Africa. Ham and Japheth are at least the three groups L. N. The line L3 diverged and from L3 came the other mtDNA mutations. L2 and L3 are all found in Africa and are the major groups almost exclusively in sub- Saharan Africa. M and Hg. The placement of the DNA groups can be seen in the work of J. From a biblical point of view we can argue easily that L was formed with Eve and the other groups were pre-Flood divisions that came on to the Ark. we could correctly argue that L.scs. could easily have contained the basis for the modern mtDNA .uiuc. This line then split into L1. There may have been further divisions. All subsequent groups from R are subgroups of R. The two groups M and N formed the following subgroups: M produced three subdivisions: M subgroup including. M and N. and their mtDNA line may have been L.edu/~mcdonald/WorldHaplogroupsMaps. L. as the L line is almost confined to the sub-Saharan tribes.pdf. and Q subdivision We might thus also deduce that the wives of the sons of Noah were taken from the one family lineage maintaining purity in the generations in the female line also. namely Haplogroup L. M. It is therefore possible that the women of the Ark. even if there were only the daughter of Noah and the wives of Shem. McDonald who has grouped them by charts of Y and mtDNA Haplogroups available at http://www. or M or N. depending on the number of females. from the original Hg. That is what we would expect to find if we assume there were only three females that bred on from the Ark. E subdivision. which split from each other. all females are descended from one female line Hg. Thus. C and Z. The wives of Shem and Japheth were of the subdivisions of L. The Supergroups M and N were next to diverge or mutate. Thus the only argument between the Bible account and modern scientific DNA is the supposition that the mathematical models require a much longer period to mutate than the Bible chronology. Only from Ethiopia north do we get large diversity of the mtDNA record. These Haplogroups are all descended from a single female Supergroup. which itself is a mutation of Hg. We also have to address the fact that Eve was dark.skinned and the fact that Adam means “the one who was red”. All mtDNA Haplogroups are subdivisions of L. Ham and Japheth. D. That assumption is based on the premise that mtDNA does not force mutation of the Human Genome and that assumption is now being shown to be false. Thus. That is super L. perhaps M and N or perhaps also R.

The Cohen Modal Haplotype (CMH) for the sons of Aaron falls in J1 and in J2.” We will deal with the female mtDNA diversity of the known Semitic nations in a later paper. the scientific advances we find here. the most recent one probably associated with the diffusion of Arab people Haplogroup J1 is most frequent in Palestinian Arabs (38. Thus we have a clear acceptance in biblical terms that the Bible record that Hebrew peoples came from the one ancestor. What we do not fully know is if the IJ group developed in any of the other sons of Shem.2%) with a small portion falling outside Haplogroup J (3. and we can identify these lines elsewhere. The significance is that science is now beginning to hold and accept that I and J were once the same group and that all I Hg. The IJ group is defined by S2 and S22 in the YDNA chain. Whilst science holds these evolutionary extended time-frames it still agrees that they arose in the Near East. is correct. mtDNA Haplogroups L. 265) we concluded that “there is thus nothing in the mtDNA variations and Haplogroups to preclude the Bible story and the Genesis account being accommodated by. The mutations occurred as each group moved out from the Middle East and crossbred with moving tribes and families over time.8%). Haplogroup IJ is in turn derived from Haplogroup F.0%) and J2 (43. In Palestine. or the equivalent M304 marker. Also in Arabic speaking countries like: Algeria (35%). The Bible time-frame allows for an origin no earlier than 2200 BCE. The bulk of CMH is observed in J1 (53. Arphaxad. Egypt and South Pakistan it is common today to find these groups. defined by the M267 marker. and Haplogroup J1.4%) [Semino et al] and Arab Bedouins (62% and 82% in Negev desert Bedouins). We would not be surprised to find such diversity in a family of married sons even today. The main current subgroups of J are J1 and J2.” Semitic Haplogroup J The Wikipedia article on the Semitic Haplogroup J identified the Haplogroup as coming originally from the combined Haplogroup IJ. It is defined by the 12f2.diversity.” Haplogroup J2 is defined by the M172 marker. or accommodating. M. people came from the same ancestry as the Jews and Arabs that possess the J system. it is the genetic signature in J1 that is considered the Jewish priestly signature. This Haplogroup is the key Haplogroup for all Semitic and Japethite people. N and perhaps R were present in the women on the Ark. Wikipedia holds that “although you can have the CMH in either J1 or J2. They involve cross-breeding among nations. the southern . Syria (30%). Thus the J1 J2 and other divisions must have occurred after the split of the Aaronic priesthood in 722 BCE or it is an independent mutation that does not solely identify the entire priesthood. The Wikipedia article on: Haplogroup J1 (Y-DNA) says: Haplogroup J1 is notable since this haplogroup shows highest frequencies in the Middle East North Africa and Ethiopia [Thomas et al study 1999] J1 was spread by two temporally distinct migratory episodes. In the paper Genetic Origin of the Nations (No. Haplogroup J was previously known as HG9 or Eu9/Eu10. and between them account for almost all of the population of the Haplogroup.1 genetic marker.

The Haplotype thus mutates faster than thought and the models are wrong. Pakistan. B7_1). The Semites moved on into South India. Armenia). The Sinhalese of Sri Lanka also have R2 Japhethite lineages. In Jewish populations overall.The distribution of J1 outside of the Middle East is associated [with] Arabs and Phoenecians through trade and conquest like Sicily south Italy. 14% in Aryan upper castes. Wikipedia says regarding Haplogroup J2 (Y-DNA) Haplogroup J2 is present mostly in Europe. who had not interbred with Canaanites or Egyptians in either the Mixed Multitude or the occupation of Canaan. It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22. Central Turks (27. the Sinai Peninsula.9%).) and finally Somalian (see ref: Semino et al. 2004). Caucasian (Georgia. Mysticism Chapter 1 Spreading the Babylonian Mysteries (No.2%. but is found especially in the northern Levant (Kurdistan. It entered Ethiopia in the Neolithic with the Neolithic Revolution and spread of agriculture. where it became something like a marker of the Arab expansion in the early medieval period (Semino et al. and the Arabian Peninsula collapsing suddenly at the borders of Arabic countries with non Arabic countries (Turkey and Iran).8%). J2 was found to encompass several unrelaterd sub-Haplogroups (22 subs with 12 subs that have high frequencies) that originated in different regions: Italians. and with Jews who have historical origins in the Middle East and speak (or historically spoke) a Semitic language.6%) and in southern Italy (16. 2004).7%).6%) J2 is not found in Semitic languages speaking populations of Africa (like Amhari and Tigrinia in Ethiopia) (Semino et al. Haplogroup J1 is found almost exclusively among modern populations of Southwest Asia.Levant Iraq (33%).3%).g. Aegean. Sengupta et al.0%. However. Anatolian (Kurds and Turkey). Tunisians 30. which is the Indian mutation from RxR1. Its frequency rapidly drops in the Carpathian basin (Croatians 6. Anatolia: Muslim Kurds (28. Balkan. Albanians 19.2%) and Sephardim Jews (28. 2006) must be of a very early date. It was thought of as the genetic markers of Anatolian Neolithic agriculturalists. Researchers believe that marker DYS388=17 (Y DNA tests for STR . As we have seen.1%). The significant presence of J2 (J2b2+J2a) in India (18.” (cf. the Roma have similar mixes of Haplogroups. essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages . .6% of the Ashkenazim results and 11.Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. It is also very frequent in the Balkans (Greeks 20. Wikipedia article Haplogroup J) The significance of the Cohen Modal Haplotype in both J1 and J2 indicates that the division and development of these Haplogroups are a result of mutation after the spread of the Aaronic priesthood which occurred no earlier than 1458 BCE and perhaps later than 722 BCE. 2004).2%). because “Indian J2 is not accompanied by its ‘loyal fellow-traveller’ E3b1 that penetrated to the Near East from North Africa after the end of the Ice Age and is tightly bound with the spread of both J-subbranches since the Neolithic era. Georgians (26. Turkey. Azerbaijan. Balkan. or even earlier) that moved from Assyria probably with the Assyrians and Cushites and some Japhethites Hg.0%. and East Africa. but Oromo 3. Algerians 35. Thus the migration of these people must have occurred with the early Hebrews (perhaps Joktan. though typically Haplogroup J2 is more than twice as common among Jews. Hungarians 2.9% of the Sephardic results (Semino et al. The presence of J2 in India without the E3b1 traveller indicates that the J2 Haplotype developed in India from Hebrews. J1 constitutes 14. Ukrainians 7.1%). A large portioin of this appears to be among Arabs also.7-29. Amhara 33.6% in Dravidian upper castes. Spain.3%. where it is found mainly among Semitic speakers (e. 2% in tribes. Iraqis (25.6%. 2004). Lebanese (25%). 2004). RxR1 to Harappa and Mohenjo Daro in the Indus perhaps even as early as the occupation in the 18th century BCE (cf.4%). Ashkenazi Jews (23. North Africa. Bengal and Sri Lanka.

No Semites moved to Australasia. D from which many of the the Japanese and Tibetans are descended. together with the Chinese and Malays and some Polynesians and Philippinos under the O haplogroup. The Cushites and other Hamitics also moved Northeast and formed the Mongols and the base population of what became the Maori and the C3 Amerindians. P mutated into the RxR1 Hg. K at M9 also split into a single group M214 which formed the branch of the Japhethite sons of the Huns and Finns under the N Haplogroup. The K populace mutated from F and a major section formed the Negritos and Melansesians. . from which all Celts and Slavs are descended. They appear to have come in eight waves. This means that haplogroup J* includes all of J except for J1 and J2 Technical specification of mutation The technical details of M304 are: Nucleotide change: A to C Position (base pair): 421 Total size (base pairs): 527 Forward 5′→ 3′: caaagtgctgggattacagg Reverse 5′→ 3′: cttctagcttcatctgcattgt Semitic Haplogoups and their subclades will be reproduced in another paper Appendix. they are extremely rare. One community is apparently a late arrival Hg. The Hamitic group also formed the mutation Hg. Hg. 212G). 1700 BCE. Wikipedia specific information on Base J is: J*(xJ1. The next division of F Japhethite subdivision and the RxR1 had split from them into P in the Middle East. The basic Papua/New Guinea populations retained the original K as did some Phoenician traders at K2. however. O. and formed the basis of the Australian Aboriginal population ca. Tasmania was inhabited originally by K Negritos as was New Zealand with the Maorii or Moriori after an earler settlement and ultimately they were forced out by the HG C Maori. probably from the Indo-Malays or Chinese. RxR1 remained in India forming the Dravidians and another base group moved with the majority C basic Hg.J2). perhaps not mixed originally. Tables of the lineages of the Sons of Shem will be reproduced in the paper Sons of Shem Part VII: Charts for P212A-212F (No.The Cushites and Japhethites also went into South India and moved on into Southeast Asia.J2) There are also some Haplogroup J Y-chromosomes that belong to neither J1 nor J2. and are said to be in the Haplogoup or paragroup J*(xJ1.

By this time both Abraham and Lot had accumulated great wealth. (SHD 3875: a veil or covering). They will be united under Messiah for the millennial system. 11:27. 13:5). Descendants of Abraham Part II: Lot. and nephew of Abraham (Gen. Sarai’s childlessness and Haran’s death may be the reason Lot continued with Abraham instead of staying with Nahor. No doubt because Abraham was blessed Lot was also blessed. through Canaan to Egypt. Moab. But because “their substance was great” they could no longer dwell together. 13:6-7). Sarai and Lot to Haran. Perhaps there was no formal adoption but Lot was a likely candidate to become Abraham’s heir. 13:1-3). Ammon and Esau LOT Lot. Lot.31-32). his grandfather (Terah) took Abraham. from the Hebrew word pronounced lote. Moab. At the age of 205 Terah died there in Haran (Gen. and back again to Beth-el (Gen. There were quarrels between the herdsmen on both sides because the land’s resources were obviously not enough for all the herds and cattle. So when God commanded Abraham to leave Haran we find Lot accompanies Abraham on his journeys from Mesopotamia to Canaan. 11:27-32). was the son of Haran. and after the death of his father there. Lot was born in Ur of the Chaldees. Abraham was obviously the head of the family and Lot the subordinate but Abraham had allowed Lot to have his own flocks and herds and tents (Gen. 12. . Ammon and Esau The blessings conferred on Abraham also extended to the children of Lot and the sons of Isaac. grandson of Terah. Also the Canaanites and Perizzites dwelt there in the land (Gen.

showing that Lot was a real citizen. 9 then the Lord knows how to rescue the godly from trial. his wife and two of his daughters and led them safely out of the city. . We next hear of Lot in Genesis 19 when God sent angels to rescue Lot and his family before the cities of the plain were destroyed. We note that Lot was sitting at the gate when the angels arrived at Sodom. Some years after this separation. He recovered all the spoils they had taken and brought back Lot with the other captives. greatly distressed by the licentiousness of the wicked 8 (for by what that righteous man saw and heard as he lived among them. looked back. which was all the plain of the Jordan near the cities of Sodom and Gomorrah. When Abraham heard about this he armed his 318 trained servants. Lot's wife. They were told to flee into the mountains and warned not to look back at the doomed city. as the city gate was where legal matters were discussed and prosecuted. and pitched his tent towards Sodom (Gen. So Abraham dwelled in the land of Canaan and Lot dwelled in the cities of the plain. and pursued the retreating victorious kings as far as Dan. which was one of the five doomed cities. he was indeed a righteous man as we see from 2Peter 2:4-9 (esp. but refused to take anything. vv. who consented that he might retire to Zoar. The wickedness of the people there had called down God’s wrath but Abraham had pleaded for Lot’s safety and protection. since the land there was well watered. It is also interesting to note that while Lot is often portrayed in a bad light from the events of the OT text. So. Abraham was offered a reward by the King of Sodom. However. 7 and if he rescued righteous Lot. he was vexed in his righteous soul day after day with their lawless deeds). and was turned into a pillar of salt (v. Chedorlaomer and his allies attacked the kings of Sodom and the neighbouring cities. Lot had seemingly become a member of Sodom’s ruling council. and to keep the unrighteous under punishment until the day of judgment (RSV used throughout) Continuing with Lot. 13:10-12).Inheritance of Lot So Abraham offered Lot the choice of the land and Lot chose what he thought was the better part. but at dawn the angels took Lot. disregarding the warning of the angels. Bullinger says in his notes to Genesis 19:1 that the gate was the seat of judgment. … 6 if by turning the cities of Sodom and Gomor'rah to ashes he [God] condemned them to extinction and made them an example to those who were to be ungodly. 6-9). 24). Lot entreated the angels. we see a number of events ensued during that night before the destruction of Sodom. Lot was among the many captives taken and he lost all of his possessions.

38 The younger also bore a son. from the father). It extends along the eastern shore of the Salt Sea (called the Dead Sea). Lot's daughters incorrectly believed they were the only females to have survived the devastation. Inheritance altered by Israel and Gilead Ammon had no authority to possess Gilead or take it from Israel. or Ben-Ammi (Heb. Sons of Lot The older daughter had a son. He was the patriarch of the nation known as Moab. Yet both nations would be extended salvation under Messiah in the Last Days. inbred. the mother of Obed. Ammon (SHD 5983) from (SHD 5971): tribal. Moab was to take part in the lineage of Messiah through Ruth (a Moabitess). They assumed it was their responsibility to bear children and enable the continuation of the human race. Lot left Zoar and retired with his two daughters to a cave in an adjacent mountain. The land of Moab was occupied by . 24)). i. he is the father of the Moabites to this day. He became the patriarch of the nation of Ammon. means beautiful land. MOAB The Land Moab is the historical name for a mountainous strip of land in modern-day Jordan.Sodom was destroyed and Lot and his family were saved from the destruction by the Angel of Yahovah (see the paper The Angel of YHVH (No. and she named him Ben-Ammi (Gen. Moab (SHD 4124. On two subsequent nights they got their father drunk enough to have sexual intercourse with them. wife of Boaz. and she named him Moab. the father of David (see Ruth 4:16-22). Moab also a territory. the father of Jesse.) Son of Ammi = “god of Am” – Bullinger. 19:30-38). Genesis 19:37 The first-born bore a son. the younger daughter also had a son. and called his name Moab.e. By him each became pregnant. he is the father of the Ammonites to this day. and called his name Ben-ammi.

where he says that Alexander (Janneus) overcame the Arabians. but the conquest was not permanent. But when Balak son of Zippor. Jehoshaphat and Jehoram together made an expedition into Moab and defeated the Moabites with great slaughter (2Kgs. but passed around on the eastern border (Deut. xiii. but they afterward fell out among themselves and destroyed each other (2Chr. Here the Israelites found them as they approached the Promised Land. king of Moab. but Eglon was assassinated by Ehud. he made alliance with the Midianites against them and called in the aid of Balaam [see the paper The Doctrine of Balaam and Balaam’s Prophecy (No. 20). 12:20). 3:27). had subdued the northern part of Moab as far as the Arnon (Num. 21:31-32). which may be the disaster to Moab recounted in Isaiah 15. . 3). It revolted again in the reign of Ahaziah (2Kgs. 2:8. The Moabites lost their identity as a nation and were afterward confounded with the Arabs. 5). and the Moabite yoke was cast off after 18 years. 1:1. 21:21- 26). as we see in the statement of Josephus (XIII. however. Bands of Moabites ventured to raid the land of Israel when weakened by the conflict with Hazael (2Kgs. 25).4).9) and came into conflict with the Amorites in the North (Num. but did not subdue it (1Sam. 22. When David became king he made war upon Moab and completely subjugated it (2Sam.the tribe of Moab in ancient times which is demonstrated by numerous archeological findings.29). and it was tributary to Ahab (2Kgs. for Moab recovered its lost territory and became strong enough to encroach upon Israel across the Jordan. was not subdued (2Kgs. Some time before the establishment of the kingdom in Israel the Midianites overran Moab. and afterward completely freed his land from the dominion of Israel (M S). History: from The International Standard Bible Encyclopedia We know scarcely anything of the history of the Moabites after the account of their origin in Genesis 19 until the time of the exodus.2). 24).. defeating them and occupying the territory (Num. 3:13-14). as would appear from the passage in Genesis 36:35. 8:2). for we find David putting his father and mother under the protection of the king of Moab when persecuted by Saul (1Sam. At a later date Moab was overrun by the Nabathean Arabs who ruled in Petra and extended their authority on the east side of Jordan even as far as Damascus (Josephus. under their king Sihon. 208)] but as he could not induce Balaam to curse them he refrained from attacking the Israelites (Num. But Mesha. such as the Moabites and the Gileadites. But this friendship between David and Moab did not continue. They did not at first disturb the Moabites in the South. J. On the division of the kingdom between Rehoboam and Jeroboam the latter probably obtained possession of Moab (1Kgs.l 14:47). xv. 22:3. Their capital was Dibon. XIII. that they had suffered from the invasions of the Amorites. suffered disaster when the Lord’s anger burned against them because of their sins (Num. 21:21-31). 13:20). who. 3:5). but Moab was probably subdued again by Jeroboam II (2Kgs. The Israelites. but it revolted and Omri had to reconquer it (M S). located next to the modern Jordanian town of Dhiban. Eglon of Moab oppressed Israel with the aid of Ammon and Amalek (Jdg. 1. however. saw what a powerful people was settling on his border. 14:25). This was probably at the time when Israel and Judah were at war with Hazael of Damascus (2Kgs. 8:28. Saul smote Moab. 1:1). king of Moab. Ant. Seir and destroyed the latter. It would seem. and Moab and Ammon made war on Jehoshaphat and Mt.

1Kings 11:1-2 Now King Solomon loved many foreign women: the daughter of Pharaoh. Moab is within the Kingdom of Jordan. and the LORD strengthened Eglon the king of Moab against Israel. Often the idolatry was brought in by the rulers of Israel themselves. because I have given Ar to the sons of Lot for a possession. Judges 3:28-30 And he said to them. not a man escaped. Solomon clung to these in love.studylight. for the LORD has given your enemies the Moabites into your hand. 9 And the LORD said to me. away from our brethren the sons of Esau who live in Se'ir. Alliance within Moab When Israel lapsed into idolatry then God used the idolatrous nations around them to punish them. E'domite. See the territorial map at Appendix A. for surely they will turn away your heart after their gods". `Do not harass Moab or contend with them in battle. when they were faithful they ruled over them or were free of their systems.org/enc/isb/view. able-bodied men. . all strong. 30 So Moab was subdued that day under the hand of Israel. 13 He gathered to himself the Ammonites and the Amal'ekites. and went and defeated Israel. and allowed not a man to pass over. because they allowed themselves to be corrupted by these false gods. And the land had rest for eighty years. because they had done what was evil in the sight of the LORD. 2 from the nations concerning which the LORD had said to the people of Israel. according to the word of the LORD. and Hittite women. "Follow after me." So they went down after him. and they took possession of the city of palms.cgi?number=T6108 The Bible tells us the land of Moab is located east of the Jordan River and the Dead Sea. The restrictions on marriage were because of idolatry and not for racist consideration. and south of the Arnon (Num. It was always the same. 21:10-15). When Israel repented and turned to God they were restored and given rest. Thus.http://www. neither shall they with you. Ammonite. 6 and he buried him in the valley in the land of Moab opposite Beth-pe'or. When they were idolatrous they were ruled by others. Sido'nian. "You shall not enter into marriage with them. for I will not give you any of their land for a possession. Israel was allowed to be ruled under their laws and unjust systems. and Moabite. even though they were worshipping the gods of these nations. "And we turned and went in the direction of the wilderness of Moab. Today. away from the Arabah road from Elath and E'zion-ge'ber. 14 And the people of Israel served Eglon the king of Moab eighteen years. Inheritance of Moab Deuteronomy 2:8-9 So we went on. Judges 3:12-14 And the people of Israel again did what was evil in the sight of the LORD. 29 And they killed at that time about ten thousand of the Moabites. and seized the fords of the Jordan against the Moabites. but no man knows the place of his burial to this day.' Moses buried in the land of Moab Deuteronomy 34:5-6 So Moses the servant of the LORD died there in the land of Moab.

do not keep silence. do not hold thy peace or be still. Moab women intermarry with Israel Ezra 9:1-2 After these things had been done. over Philistia I shout in triumph. O God. 3 They lay crafty plans against thy people. "Come. the Ammonites. and the Mo'abites became servants to David and brought tribute. Edom and Ishmael will all be dealt with in the Last Days. they conspire with one accord. Extension of the Messianic Kingdom of the sons of the Patriarchs The extension of the kingdom under Messiah as the Kingdom of David is already given in prophecy. the Hittites. they consult together against thy protected ones. "The people of Israel and the priests and the Levites have not separated themselves from the peoples of the lands with their abominations. those who hate thee have raised their heads." 9 Who will bring me to the fortified city? Who will lead me to Edom? The person implied here in the question “who” it is that will lead them to Moab was Judah. 8 Assyria also has joined them. This action points towards the restoration under Messiah. 4 They say. 2 For they have taken some of their daughters to be wives for themselves and for their sons. [Selah] This alliance in the Last Days is a union aimed at the destruction of Israel and it will not succeed but rather bring about the unification of the children of Abraham and the destruction of those who oppose the people of God. and the Amorites. 7 Gebal and Ammon and Am'alek. E'phraim is my helmet. thy enemies are in tumult. Philistia with the inhabitants of Tyre. And in this faithlessness the hand of the officials and chief men has been foremost. Manas'seh is mine.David subdued Moab When Israel was given rest under David the surrounding nations were subjugated. from the Canaanites. the officials approached me and said. 8 Moab is my washbasin. upon Edom I cast my shoe. Psalm 83:1-8 A Song. as all nations there will be brought into the inheritance of Messiah. the Moabites. let us wipe them out as a nation. . Psalm 60:7-9 Gilead is mine." This intermarriage was due to idolatry and that was the faithlessness spoken of by God. 1Chronicles 18:2 And he defeated Moab. the Jeb'usites. A Psalm of Asaph. against thee they make a covenant – 6 the tents of Edom and the Ish'maelites. as fulfilled in part under the Macabbees and John Hyrcanus but all of which pointed towards Messiah. O God! 2 For lo. Judah is my scepter. the Per'izzites. so that the holy race has mixed itself with the peoples of the lands. Moab and the Hagrites. the Egyptians. they are the strong arm of the children of Lot. let the name of Israel be remembered no more!" 5 Yea.

E'phraim shall not be jealous of Judah. 3:4-27). Moab and Ammon will obey Judah. Jehoshaphat gained victories (2Chr. Moab. says the LORD.5). and paid tribute to Ahab (2Kgs. 14:47) and David (2Sam. Manas'seh is mine. from Hamath. 20:1-30. Isaiah 11:10-16 In that day the root of Jesse shall stand as an ensign to the peoples. from Shinar. Tiglath-pileser . And the surrounding nations will assist them and be in alliance with them. The Second Exodus Edom. but in fact not being true to the Faith and circumcised in heart. Judah my scepter. 9 Moab is my washbasin. over Philistia I shout in triumph. for all these nations are uncircumcised. 2:9. 12 He will raise an ensign for the nations. and together they shall plunder the people of the east. him shall the nations seek. 1:1. The entire people of Israel will be returned to the Holy Land. and will wave his hand over the River with his scorching wind. and will assemble the outcasts of Israel. 2Kgs. provides punishment in the Last Days and over time. from Egypt. from Ethiopia. and from the coastlands of the sea. The nation of Jordan will become a part of Israel in its entirety by 2027. the sons of Ammon." Judah does not escape this punishment and will be cleansed of these mystics and traditions. This punishment extended also to the Jews. 14 But they shall swoop down upon the shoulder of the Philistines in the west. that is. the days are coming. 8:2). and smite it into seven channels that men may cross dryshod. and his dwellings shall be glorious. and all who dwell in the desert that cut the corners of their hair.Repeat of the sentiments of Psalm 60:8 Psalm 108:8-10 Gilead is mine. They will be made to prostrate themselves in adoration before the true Church of God. and gather the dispersed of Judah from the four corners of the earth. They shall put forth their hand against Edom and Moab. 11 In that day the Lord will extend his hand yet a second time to recover the remnant which is left of his people.26 Egypt. as there was for Israel when they came up from the land of Egypt. from Pathros. Jeremiah 9:25-26 "Behold. 3:4. upon Edom I cast my shoe. Judah. The Burden of Moab Moab had been subdued by Saul (1Sam. when I will punish all those who are circumcised but yet uncircumcised -. and the Ammonites shall obey them. and Judah shall not harass E'phraim. E'phraim is my helmet. 15 And the LORD will utterly destroy the tongue of the sea of Egypt. 16 And there will be a highway from Assyria for the remnant which is left of his people." 10 Who will bring me to the fortified city? Who will lead me to Edom? They will be joined to Israel as allied nations under Messiah. Edom. to those who say they are Jews but are not but are of the synagogue of Satan (Rev. from Assyria. from Elam. and those who harass Judah shall be cut off. 13 The jealousy of E'phraim shall depart. Prophecy against Moab: They say they are circumcised but are not The punishment for claiming to be of the circumcision of the sons of Abraham. 3:9). and all the house of Israel is uncircumcised in heart.

no shouts are raised. every beard is shorn. 3 in the streets they gird on sackcloth. On every head is baldness. 13 This is the word which the LORD spoke concerning Moab in the past. 5 then a throne will be established in steadfast love and on it will sit in faithfulness in the tent of David one who judges and seeks justice and is swift to do righteousness. be a refuge to them from the destroyer. when he comes to his sanctuary to pray. 7 Therefore let Moab wail. which reached to Jazer and strayed to the desert. hide the outcasts. For at the ascent of Luhith they go up weeping. and those who survive will be very few and feeble. the glory of Moab will be brought into contempt. the vintage shout is hushed. Isaiah 16:1-14 They have sent lambs to the ruler of the land. the lords of the nations have struck down its branches. and my heart for Kir-he'res. 2 The daughter of Dibon has gone up to the high places to weep. the wailing reaches to Beer-e'lim. the verdure is no more. the new growth fails. 12 And when Moab presents himself. in spite of all his great multitude. his soul trembles. and his insolence -. therefore the armed men of Moab cry aloud. utterly stricken. and he who tramples under foot has vanished from the land. the wailing reaches to Egla'im.carried away tribes east of Jordan and received tribute from Moab as well as from Ahaz (2Kgs. I drench you with my tears. 8 For the fields of Heshbon languish. They are taken from a land under siege but they are protected and set aside for the Messiah. his fugitives flee to Zo'ar. 6 the waters of Nimrim are a desolation. Prophecy – reference to Petra This text refers to the conversion of Moab and the people of what is now Jordan. betray not the fugitive. to the mount of the daughter of Zion. his pride. for the raisin-cakes of Kir-har'eseth. 8 For a cry has gone round the land of Moab. They escape out of the hands of the King of the North in the occupation but they are all persecuted for the Faith. let every one wail for Moab. like the years of a hireling. the grass is withered. 11 Therefore my soul moans like a lyre for Moab. 7 Therefore the abundance they have gained and what they have laid up they carry away over the Brook of the Willows. on the road to Horona'im they raise a cry of destruction. and in the vineyards no songs are sung. yet I will bring upon Dibon even more. 4 let the outcasts of Moab sojourn among you. O Heshbon and Ele- a'leh. he will not prevail. grant justice. a lion for those of Moab who escape. (see Bullinger’s notes on Isa. because Kir is laid waste in a night Moab is undone. Israel is to be a refuge to the outcasts of Moab. 16:10). how proud he was. for the remnant of the land.his boasts are false. 2 Like fluttering birds. 5 My heart cries out for Moab. over Nebo and over Med'eba Moab wails. 15:1) Isaiah 15:1-9 An oracle concerning Moab. to Eg'lath-shelish'iyah. When the oppressor is no more. its shoots spread abroad and passed over the sea. Because Ar is laid waste in a night Moab is undone. no treader treads out wine in the presses. 4 Heshbon and Ele-a'leh cry out. 10 And joy and gladness are taken away from the fruitful field. 14 But now the LORD says. for upon your fruit and your harvest the battle shout has fallen. make your shade like night at the height of noon. so are the daughters of Moab at the fords of the Arnon. by way of the desert." Judgment on Moab ." 6 We have heard of the pride of Moab. and destruction has ceased. from Sela. 3 "Give counsel. like scattered nestlings. their voice is heard as far as Jahaz. Mourn. 9 Therefore I weep with the weeping of Jazer for the vine of Sibmah. of his arrogance. on the housetops and in the squares every one wails and melts in tears. when he wearies himself upon the high place. 9 For the waters of Dibon are full of blood. and the vine of Sibmah. "In three years.

before there comes upon you the fierce anger of the LORD. Behold. amid shouting and the sound of the trumpet. No promises of Moab’s survival In that subjugation their identity as nations would be blurred. Ezekiel 25:8-11 "Thus says the Lord GOD: Because Moab said. This subjugation before Messiah in the Last Days is complete. Isaiah 25:10-12 For the hand of the LORD will rest on this mountain. perhaps you may be hidden on the day of the wrath of the LORD. yea. 2 So I will send a fire upon Moab. who do his commands." 10 This shall be their lot in return for their pride. because they scoffed and boasted against the people of the LORD of hosts. 11 The LORD will be terrible against them. 12 And the high fortifications of his walls he will bring down. all you humble of the land. seek righteousness. how they have taunted my people and made boasts against their territory. 8-11 Come together and hold assembly. and Kiriatha'im. Moab and Ammon given to the people from the East – Ishmaelites/Arabs The sequence was to reduce Moab and Ammon and then bring them into subjugation to the Eastern tribes until the times of the end. a land possessed by nettles and salt pits." says the LORD. Then they will know that I am the LORD." says the LORD of hosts. all the lands of the nations. because he burned to lime the bones of the king of Edom. seek humility. 9 therefore I will lay open the flank of Moab from the cities on its frontier. God warns them and then states what He will do with them. 3 Seek the LORD. O shameless nation. Against Moab and Ammon 8 "I have heard the taunts of Moab and the revilings of the Ammonites. Divine Judgment of the Last Days . Beth-jesh'imoth. and Moab shall die amid uproar. 10 I will give it along with the Ammonites to the people of the East as a possession. and it shall devour the strongholds of Ker'ioth. the house of Judah is like all the other nations. before there comes upon you the day of the wrath of the LORD. as I live. 3 I will cut off the ruler from its midst. but the LORD will lay low his pride together with the skill of his hands. the God of Israel. and a waste for ever. and the Ammonites like Gomor'rah. and will slay all its princes with him. he will famish all the gods of the earth. 2 before you are driven away like the drifting chaff. each in its place. and for four. and the survivors of my nation shall possess them. that it may be remembered no more among the nations. and Moab shall be trodden down in his place. Ba'al-me'on. the glory of the country. and to him shall bow down. 9 Therefore. and cast to the ground. lay low. I will not revoke the punishment. 11 and I will execute judgments upon Moab. as straw is trodden down in a dung-pit. "Moab shall become like Sodom. even to the dust. 11 And he will spread out his hands in the midst of it as a swimmer spreads his hands out to swim. Amos 2:1-3 Thus says the LORD: "For three transgressions of Moab. The remnant of my people shall plunder them. Prophecy – Last Days Zephaniah 2:1-3.

who are saying to you.' 28 "And if they refuse to accept the cup from your hand to drink. and the king of Sidon by the hand of the envoys who have come to Jerusalem to Zedeki'ah king of Judah. and put its neck under the yoke of the king of Babylon. 3 Send word to the king of Edom. it does not refer to that as we see here. the king of the sons of Ammon. with the result that you will be removed far from your land. said to me: "Take from my hand this cup of the wine of wrath. all his people. all the kings of Elam. Babylon was conquered but here it is still the dominant factor. for I am summoning a sword against all the inhabitants of the earth. until I have consumed it by his hand. and the remnant of Ashdod). and shall you go unpunished? You shall not go unpunished. 20 and all the foreign folk among them. Order of Captivity: Babylon and then through the nations Jeremiah 27:1-11 In the beginning of the reign of Zedeki'ah the son of Josi'ah. 25 all the kings of Zimri. the God of Israel. or your sorcerers. its kings and princes. and made all the nations to whom the Lord sent me drink it: 18 Jerusalem and the cities of Judah. your dreamers. the king of Tyre." 17 So I took the cup from the LORD's hand. and I give it to whomever it seems right to me. then many nations and great kings shall make him their slave. king of Judah. all the kings of the land of Uz and all the kings of the land of the Philistines (Ash'kelon. 11 But any nation which will bring its neck under the yoke of the king of Babylon and serve him. and put them on your neck. far and near. one after another. 4 Give them this charge for their masters: `Thus says the LORD of hosts. 16 They shall drink and stagger and be crazed because of the sword which I am sending among them. 21 Edom. and you will perish.' 10 For it is a lie which they are prophesying to you. all the kings of Sidon. and the kings of the coastland across the sea. this word came to Jeremiah from the LORD. The entire Kings of the North are to be summoned against Jerusalem. and I have given him also the beasts of the field to serve him. We are speaking of a religious and administrative system in the Last Days being brought into subjection and destroyed. and all who cut the corners of their hair. his servants. and with pestilence. my servant. and the sons of Ammon. This was first done when Babylon was conquered by the Medes and Persians. to till it and dwell there. 2 Thus the LORD said to me: "Make yourself thongs and yoke-bars. because of the sword which I am sending among you. with famine. your soothsayers."'" . 22 all the kings of Tyre. the God of Israel: This is what you shall say to your masters: 5 "It is I who by my great power and my outstretched arm have made the earth. until the time of his own land comes. Jeremiah 25:15-29 Thus the LORD. his princes. Gaza. `Thus says the LORD of hosts: You must drink! 29 For behold. 6 Now I have given all these lands into the hand of Nebuchadnez'zar. a hissing and a curse. says the LORD. 8 "`"But if any nation or kingdom will not serve this Nebuchadnez'zar king of Babylon. 26 all the kings of the north. to make them a desolation and a waste. 27 "Then you shall say to them. `Thus says the LORD of hosts. I will leave on its own land. and all the kingdoms of the world which are on the face of the earth. Tema. be drunk and vomit. the God of Israel: Drink. your diviners. I will punish that nation with the sword. the king of Babylon. and I will drive you out. the king of Moab. as foretold in Daniel Chapter 2. and make all the nations to whom I send you drink it. `You shall not serve the king of Babylon. 23 Dedan. 24 all the kings of Arabia and all the kings of the mixed tribes that dwell in the desert. as at this day. However. with the men and animals that are on the earth. And after them the king of Babylon shall drink. Ekron.' This prophecy covers from Egypt to Arabia and the end of the Persian Empire. 19 Pharaoh king of Egypt. 9 So do not listen to your prophets. says the LORD of hosts. and all the kings of Media. I begin to work evil at the city which is called by my name. 7 All the nations shall serve him and his son and his grandson. fall and rise no more. says the LORD. Moab. Buz. then you shall say to them.

8 The destroyer shall come upon every city. when I shall send to him tilters who will tilt him. for she would fly away. to Hellenised systems. . you also shall be taken. 10 "Cursed is he who does the work of the LORD with slackness. we saw a sequence of kingdoms degenerating in the purity of their systems through Medes and Persians to Greco-Macedonian. and no city shall escape. the fortress is put to shame and broken down. 11 "Moab has been at ease from his youth and has settled on his lees. a cry is heard as far as Zo'ar. 13 Then Moab shall be ashamed of Chemosh. shall be brought to silence.' 18 "Come down from your glory. for it is laid waste! Kiriatha'im is put to shame. he has not been emptied from vessel to vessel. `Desolation and great destruction!' 4 Moab is destroyed. as the house of Israel was ashamed of Bethel.Compare Daniel Chapter 2 God decreed that this system would rule until the end of days and be replaced by the Messiah. From the head of gold. all you who are round about him. and the plain shall be destroyed. But their corruption in adopting Hadithic Islam has not helped them either. `How the mighty scepter is broken. Message about Moab God revealed through Jeremiah a number if things that would happen concerning Moab. the valley shall perish. and Chemosh shall go forth into exile. 3 "Hark! a cry from Horona'im. O Madmen. the glorious staff. and his scent is not changed. 5 For at the ascent of Luhith they go up weeping. to the Romans. 16 The calamity of Moab is near at hand and his affliction hastens apace. 6 Flee! Save yourselves! Be like a wild ass in the desert! 7 For. The real reason that God dealt with Moab was idolatry and the horrors of Chemosh. and to the Holy Roman or Trinitarian Empire ruling from Europe. which is the last empire of the Last Days. From then Messiah reigns and hands the Kingdom back to God and God becomes all in all. and empty his vessels. 9 "Give wings to Moab. O inhabitant of Aro'er! Ask him who flees and her who escapes. In Heshbon they planned evil against her: `Come. Thus says the LORD of hosts. They are still corrupt. as the LORD has spoken. O inhabitant of Dibon! For the destroyer of Moab has come up against you. says the LORD. for at the descent of Horona'im they have heard the cry of destruction. and cursed is he who keeps back his sword from bloodshed. says the King. with no inhabitant in them. and the choicest of his young men have gone down to slaughter. the days are coming. behold. 12 "Therefore. because you trusted in your strongholds and your treasures. the God of Israel: "Woe to Nebo. with his priests and his princes. `We are heroes and mighty men of war'? 15 The destroyer of Moab and his cities has come up. and sit on the parched ground. he has destroyed your strongholds. 14 "How do you say. whose name is the LORD of hosts. which is finally smashed by the stone uncut by human hands which falls from Heaven and strikes this empire of the feet of iron and clay. which was Babylon. Jeremiah 48:1-47 Concerning Moab. it is taken. her cities shall become a desolation. and all who know his name. 19 Stand by the way and watch. the sword shall pursue you. their confidence. so his taste remains in him. 2 the renown of Moab is no more. 17 Bemoan him. say. and break his jars in pieces. let us cut her off from being a nation!' You also. nor has he gone into exile.

reached as far as Jazer. and spread his wings against Moab. because he magnified himself against the LORD. therefore the riches they gained have perished. the shouting is not the shout of joy. a flame from the house of Sihon. 25 The horn of Moab is cut off. far and near. says the LORD. and his arrogance. 21 "Judgment has come upon the tableland. upon your summer fruits and your vintage the destroyer has fallen. They will be delivered from Hadithic Islam as they were delivered from Chemosh. that whenever you spoke of him you wagged your head? 28 "Leave the cities. and Beth-me'on. O Moab! The people of Chemosh is undone. 38 On all the housetops of Moab and in the squares there is nothing but lamentation. 36 Therefore my heart moans for Moab like a flute. and Nebo.he is very proud -. no one treads them with shouts of joy. says the LORD. and on the loins is sackcloth. The heart of the warriors of Moab shall be in that day like the heart of a woman in her pangs. upon all the hands are gashes. 26 "Make him drunk. and Beth-ga'mul. Ammon and Edom. his pride. This will be the end result for Moab. 39 How it is broken! How they wail! How Moab has turned his back in shame! So Moab has become a derision and a horror to all that are round about him. For the waters of Nimrim also have become desolate." Thus far is the judgment on Moab. 37 "For every head is shaved and every beard cut off. yet God makes a promise of Restoration in the Last Days. him who offers sacrifice in the high place and burns incense to his god. and with many . 43 Terror. for I have broken Moab like a vessel for which no one cares. for a fire has gone forth from Heshbon. 23 and Kiriatha'im. 45 "In the shadow of Heshbon fugitives stop without strength. say. 46 Woe to you. O inhabitants of Moab! Be like the dove that nests in the sides of the mouth of a gorge. and my heart moans like a flute for the men of Kir-he'res. and all the cities of the land of Moab. his deeds are false. for it is broken. pit. 34 "Heshbon and Ele-a'leh cry out. For I will bring these things upon Moab in the year of their punishment. and he too shall be held in derision. `What has happened?' 20 Moab is put to shame." 40 For thus says the LORD: "Behold. I cry out for all Moab. for your sons have been taken captive. says the LORD. 32 More than for Jazer I weep for you. 31 Therefore I wail for Moab. but the king of the north shall rush upon him like a whirlwind. and Meph'a-ath. Restoration of Moab Jordan is to be restored in the latter days. 41 the cities shall be taken and the strongholds seized. O vine of Sibmah! Your branches passed over the sea. and the haughtiness of his heart. says the LORD. They were given into the hands of the tribes of the East to rid themselves of Chemosh and of Milcom in Ammon. upon Holon. the crown of the sons of tumult. and Bozrah. wail and cry! Tell it by the Arnon. O inhabitant of Moab! says the LORD. 22 and Dibon. because he magnified himself against the LORD. says the LORD. from Zo'ar to Horona'im and Eg'lath-shelish'iyah. as far as Jahaz they utter their voice. that Moab is laid waste. 29 We have heard of the pride of Moab -. 44 He who flees from the terror shall fall into the pit. for the men of Kir-he'res I mourn. 35 And I will bring to an end in Moab. 24 and Ker'i-oth. one shall fly swiftly like an eagle. 27 Was not Israel a derision to you? Was he found among thieves. So we see that in order to rid the lands and the sons of Lot and Edom from idolatry they had to be sent into captivity. so that Moab shall wallow in his vomit. and his arm is broken. with chariots and horsemen. it has destroyed the forehead of Moab. and he who climbs out of the pit shall be caught in the snare. and Jahzah. his boasts are false. 42 Moab shall be destroyed and be no longer a people. and snare are before you. 33 Gladness and joy have been taken away from the fruitful land of Moab. says the LORD. and your daughters into captivity. and Beth-diblatha'im. Daniel 11:40-45 "At the time of the end the king of the south shall attack him. 30 I know his insolence. 47 Yet I will restore the fortunes of Moab in the latter days.of his loftiness. and dwell in the rock. I have made the wine cease from the wine presses.

10). where it flows from south to north. ships. to the north of the Arnon. as in the days of Saul (1Sam. 45 And he shall pitch his palatial tents between the sea and the glorious holy mountain. They were defeated. Sihon was said to have been found by the Israelites. especially Tell el-Amarna Letters. and the land of Egypt shall not escape. and the Libyans and the Ethiopians shall follow in his train. Jordan is located on roughly the same site. And tens of thousands shall fall. and on the east it may have melted away into the desert peopled by Kedarites and other nomadic tribes. http://en. the Ammonites were driven out of Gilead across the upper waters of the Jabbok. i. claiming that the latter had deprived them of their territory when they came from Egypt. Thus. In the days of Jephthah they oppressed the Israelites east of the Jordan. yet he shall come to his end. after their deliverance from Egypt. 44 But tidings from the east and the north shall alarm him. 42 He shall stretch out his hand against the countries. the metropolis of the Ammonites. and he shall come into countries and shall overflow and pass through. Israel helped Ammonites by destroying their old enemies. on the north. today known as Nahr `Amman. 12:26-31). but their hostility did not cease. They were pressed on the north by the Hittites who forced them upon the tribes of the south. 11:1-28). BC). the whole country on the left bank of the Jordan. By this invasion. with none to help him.whence the designation "city of waters" The city of Amman. and their conduct toward the Israelites was particularly shameful. which continued to be their western boundary. it probably adjoined the land of Moab.wikipedia. AMMON Territory From their original territory. in possession of Gilead. and some of them settled east of the Jordan.e. that is. called Rabbathammana by the later Greeks. This may account for the cruel treatment meted out to them in the war that followed (2Sam. 11) and of David (2Sam. 41 He shall come into the glorious land. . On the south. king of the Amorites. 212C)] The chief city of the country was Rabbah or Rabbath Ammon. it may have met that of the king of Geshur. and made it a large and strong city with an acropolis. the approximate date of the Amorite invasion (14th and 13th centuries. [For Kedar see also the paper Descendants of Abraham Part III: Ishmael (No.org/wiki/Ammon The International Standard Bible Encyclopedia states: We know from the records of Egypt. 43 He shall become ruler of the treasures of gold and of silver. and he shall go forth with great fury to exterminate and utterly destroy many. and this makes their conduct at a later period the more reprehensible. Ptolemy Philadelphus changed its name to Philadelphia. the river of Ammon -. but these shall be delivered out of his hand: Edom and Moab and the main part of the Ammonites. the Ammonites are supposed to have been expelled by Sihon. whereas it was the possessions of the Amorites they took (Jdg. situated on both sides of a branch of the Jabbok. and all the precious things of Egypt.

Zechariah 2:8. and the Syrians of Zobah and of Rehob. and David slew of the Syrians the men of seven hundred chariots." 6 When the Ammonites saw that they had become odious to David. "Remain at Jericho until your beards have grown. and wounded Shobach the commander of their army. 10 the rest of his men he put in the charge of Abi'shai his brother. and their destruction by Jeremiah 49:1-6. and shaved off half the beard of each.org/enc/isb/view. he sent to meet them.They seem to have been completely subdued by David and their capital was taken." So David sent by his servants to console him concerning his father. but if the Ammonites are too strong for you. Their cruelty is denounced by the prophet Amos 1:13. and the king of Ma'acah with a thousand men. and came to Helam. they likewise fled before Abi'shai. he chose some of the picked men of Israel. at their hips. "Do you think. and the Syrians of Zobah. the Ammonites became subjects of Benhadad. but met with disaster (2 Chronicles 20). They paid tribute to Jotham (2 Chronicles 27:5)." 13 So Jo'ab and the people who were with him drew near to battle against the Syrians. and when the Syrians of Damascus deprived the kingdom of Israel of their possessions east of the Jordan. "I will deal loyally with Hanun the son of Nahash. 15 But when the Syrians saw that they had been defeated by Israel. 4). the Ammonites sent and hired the Syrians of Beth- re'hob. Their hostility to both kingdoms.cgi?number=T475 David defeats the Ammonites 2Samuel 10:1-19 After this the king of the Ammonites died. http://www. Jeremiah 40:14) was a dastardly act. twenty thousand foot soldiers. and to overthrow it?" 4 So Hanun took David's servants. and let us play the man for our people. and then return. and crossed the Jordan. 12 Be of good courage. And the king said. 14 And when the Ammonites saw that the Syrians fled. and arrayed them against the Syrians. because David has sent comforters to you. so . 11 And he said. for Nahash of Rabbah showed kindness to him when a fugitive (2Sam. and sent them away. 17:27-29). then I will come and help you. for the men were greatly ashamed. and cut off their garments in the middle. they gathered themselves together. and entered the city. then you shall help me. and brought out the Syrians who were beyond the Euphra'tes. and the men of Tob and Ma'acah. that he is honoring your father? Has not David sent his servants to you to search the city. and he arrayed them against the Ammonites. with Shobach the commander of the army of Hadade'zer at their head. and Hanun his son reigned in his stead. was often manifested. and the men of Tob. he sent Jo'ab and all the host of the mighty men. "If the Syrians are too strong for me. and they fled before him. on the division of the kingdom. Judah and Israel. And the Syrians arrayed themselves against David. and they came to Helam. Their murder of Gedaliah (2Kgs. 3 But the princes of the Ammonites said to Hanun their lord. twelve thousand men. and may the LORD do what seems good to him. and for the cities of our God. 7 And when David heard of it. 16 And Hadade'zer sent.studylight.9. as his father dealt loyally with me. And David's servants came into the land of the Ammonites. and forty thousand horsemen. and came to Jerusalem. and we find a better spirit manifested afterward. 18 And the Syrians fled before Israel. In the days of Jehoshaphat they joined with the Moabites in an attack upon him. 8 And the Ammonites came out and drew up in battle array at the entrance of the gate. Then Jo'ab returned from fighting against the Ammonites. 17 And when it was told David. 25:22-26. Ezekiel 21:28-32. 5 When it was told David. and their opposition to the Jews did not cease with the establishment of the latter in Judea. and to spy it out. 2 And David said. 9 When Jo'ab saw that the battle was set against him both in front and in the rear. were by themselves in the open country. Tobiah the Ammonites united with Sanballat to oppose Ne (Neh. he gathered all Israel together. Their country came into the possession of Jeroboam. and fought with him.

Only at the return of the Messiah will they be truly healed and free of their idolatry. Gods of the sons of Lot Lot’s sons went after strange gods they developed in the land. So the Syrians feared to help the Ammonites any more. They were a horrific version of the Baal sacrifices where children were sacrificed and then immolated in order to appease the gods of the grain. says the LORD. 11:7). and you shall be driven . 4 Why do you boast of your valleys. and his people settled in its cities? 2 Therefore. Milcom and Chemosh are to be destroyed. The god of Ammon was Milcom. 1Kgs. the days are coming. says the Lord GOD of hosts. They had to be sent into captivity for centuries to deal with that idolatry. oil and wine. that he died there. says the LORD. lament. which is what Islam has become through the corruption by the Hadith. when I will cause the battle cry to be heard against Rabbah of the Ammonites. who trusted in her treasures. Prophecy – Exclusion from the assembly The exclusion of Moab and Ammon from the congregation was because of their idolatry. but the LORD your God turned the curse into a blessing for you. 5 Nevertheless the LORD your God would not hearken to Balaam. In names such as Malcom. Deuteronomy 23:3-6 "No Ammonite or Moabite shall enter the assembly of the LORD. for Ai is laid waste! Cry. O daughters of Rabbah! Gird yourselves with sackcloth. 6 You shall not seek their peace or their prosperity all your days for ever. with his priests and his princes. Jeremiah 49:1-6 Concerning the Ammonites. also 1Chr. they made peace with Israel. 19 And when all the kings who were servants of Hadade'zer saw that they had been defeated by Israel. (cf. as we saw the God of Moab was Chemosh. O faithless daughter. from all who are round about you. and became subject to them. it shall become a desolate mound. and because they hired against you Balaam the son of Be'or from Pethor of Mesopota'mia. even to the tenth generation none belonging to them shall enter the assembly of the LORD for ever. to curse you. and its villages shall be burned with fire. when you came forth out of Egypt. I will bring terror upon you. behold. James/Shamus/Saun (for Shams the sun god/goddess). because the LORD your God loved you. and run to and fro among the hedges! For Milcom shall go into exile. 4 because they did not meet you with bread and with water on the way. `Who will come against me?' 5 Behold. O Heshbon. then Israel shall dispossess those who dispossessed him. The Phoenicians were also followers of this form of god of the sacrifices and they joined with the sons of Esau in this practice (cf. saying. 3 "Wail.19:1-19) The Bible set the sequence of conquest from David but that was to point forwards to the times of the end in the Last Days and to the coming of the Messiah. The ancient gods of the Middle East were carried in with the tribes to Europe. Thus says the LORD: "Has Israel no sons? Has he no heir? Why then has Milcom dispossessed Gad. It was for this reason that a Moabite man could not enter the congregation of the Lord God of Israel.

a sword is drawn for the slaughter. that is. but the Ammonites call them Zamzum'mim. Israel forbidden to disturb the inheritance of Lot In spite of the punishment of the sons of Lot. Deuteronomy 2:19. and say. and over the land of Israel when it was made . That was the blessing of God to Abraham. the time of their final punishment. 28 "And you. every man straight before him. set your face toward the Ammonites. in the land of your origin. Abraham honoured Lot’s choice of lands. for I will not give you any of the land of the sons of Ammon as a possession. 30 Return it to its sheath. `Aha!' over my sanctuary when it was profaned. when he destroyed the Horites before them.29 while they see for you false visions. 37 Only to the land of the sons of Ammon you did not draw near. do not harass them or contend with them. and settled in their stead even to this day. 22 as he did for the sons of Esau. says the LORD. Because you said.' 20 (That also is known as a land of Reph'aim. to all the banks of the river Jabbok and the cities of the hill country. it is polished to glitter and to flash like lightning -. Reph'aim formerly lived there. Restoration and Reconciliation As with Moab. with none to gather the fugitives. 21 a people great and many. I will blow upon you with the fire of my wrath. Thus says the Lord GOD concerning the Ammonites. because I have given it to the sons of Lot for a possession. 3 Say to the Ammonites. whose day has come.' Thus they are to become part of Israel under Messiah but they are to retain their lands as part of that final alliance. skilful to destroy. and they dispossessed them. and prophesy against them. Rabbah and Ammon are to be reconciled. 19 and when you approach the frontier of the sons of Ammon. Hear the word of the Lord GOD: Thus says the Lord GOD. say. Ezekiel 21:20. out. Israel was expressly forbidden to disturb their inheritance. prophesy. who live in Se'ir. 18 `This day you are to pass over the boundary of Moab at Ar. and concerning their reproach. your blood shall be in the midst of the land. while they divine lies for you -. and tall as the Anakim. 6: But afterward I will restore the fortunes of the Ammonites. for I the LORD have spoken. 37 and when you approach the frontier of the sons of Ammon. A sword. but the LORD destroyed them before them.to be laid on the necks of the unhallowed wicked. do not harass them or contend with them. for I will not give you any of the land of the sons of Ammon as a possession. and Lot was both his nephew and his adopted son. Ammon is also to be restored. I will judge you. and settled in their stead." Inheritance of Ammon Deuteronomy 2:16-22 "So when all the men of war had perished and were dead from among the people. and wherever the LORD our God forbade us. 28-32 mark a way for the sword to come to Rabbah of the Ammonites and to Judah and to Jerusalem the fortified. son of man. because I have given it to the sons of Lot for a possession. 32 You shall be fuel for the fire. In the place where you were created." Ezekiel 25:1-11 The word of the LORD came to me: 2 "Son of man. 31 And I will pour out my indignation upon you. and I will deliver you into the hands of brutal men. and they dispossessed them. you shall be no more remembered. 17 the LORD said to me.

Ba'al-me'on. The remembrance is only of Ammon. 11 and I will execute judgments upon Moab. but these shall be delivered out of his hand: Edom and Moab and the main part of the Ammonites. as I live. Beth-jesh'imoth. Their king in the Last Days will be the Messiah who comes. and for four. in the name of Amman. behold." says the LORD. and it was given with Ammon to the Arab nation and was joined with Ammon. because they have ripped up women with child in Gilead. he and his princes together. Remember Amalek is also a descendant of Abraham. that it may be remembered no more among the nations. which will be placed under Messiah as King in the near future. they shall eat your fruit. and I will cut you off from the peoples and will make you perish out of the countries. 14 So I will kindle a fire in the wall of Rabbah. Daniel 11:41 He shall come into the glorious land. I have stretched out my hand against you. with a tempest in the day of the whirlwind. It is under the Kingdom of Jordan. of Ishmael and Amalek and others. as we see above. 5 I will make Rabbah a pasture for camels and the cities of the Ammonites a fold for flocks." . 15 and their king shall go into exile. and Kiriatha'im. Amos 1:13-15 Thus says the LORD: "For three transgressions of the Ammonites. 7 therefore. the glory of the country. but Moab carries no remembrance. Then you will know that I am the LORD. I will destroy you. Restoration of the Last Days Zephaniah 2:8-11 "I have heard the taunts of Moab and the revilings of the Ammonites. 6 For thus says the Lord GOD: Because you have clapped your hands and stamped your feet and rejoiced with all the malice within you against the land of Israel. and over the house of Judah when it went into exile. Together with Edom and the Midianites they made up the Shepherd Kings of the Hyksos in Egypt. 9 therefore I will lay open the flank of Moab from the cities on its frontier. 4 therefore I am handing you over to the people of the East for a possession. These are the Arabs. with shouting in the day of battle. desolate. 10 I will give it along with the Ammonites to the people of the East as a possession. and they shall set their encampments among you and make their dwellings in your midst. and will hand you over as spoil to the nations. the younger. And tens of thousands shall fall. This royal family extended from Damascus to Iraq after WWII and was replaced by the republic there under the Baath party and Saddam Hussein. the house of Judah is like all the other nations. 8 "Thus says the Lord GOD: Because Moab said. and they shall drink your milk. which is the capital of Jordan. Then you will know that I am the LORD. 9 Therefore. and it shall devour her strongholds. Then they will know that I am the LORD. how they have taunted my people and made boasts against their territory. Behold. that they might enlarge their border. Ammon and Moab and the Amorites Prophecy says that Ammon and Moab and the main part of the Amorites shall escape out of the hand of the King of the North. I will not revoke the punishment. Moab was no longer to be named.

20:16). all the lands of the nations. or Wady el-Chasa. because they scoffed and boasted against the people of the LORD of hosts. This last. and the people as Idumeans. and was marked by Wady el-Kurachi. slew 10. The Edomites pressed into the now empty lands in the South of Judah. 2:8).org/enc/isb/view. which was garrisoned by Israelites. He paved the way to the throne for his son Herod the Great.studylight. The line may be generally indicated by the course of Wady el-Fiqrah. On the West of the `Arabah the north boundary of Edom is determined by the south border of Israel. was taken by Judas Maccabees in 165 BC (1 Macc 4:29. The remnant of my people shall plunder them. and to him shall bow down. http://www. Idumaea and the Idumeans West of the `Arabah the country they occupied came to be known by the Greek name Idumaea. 11 The LORD will be terrible against them. Idumaea disappears from history. On the East of the `Arabah the northern border ran from the Dead Sea. History We first hear of war between Israel and Edom under Saul (1Sam. Amaziah invaded the country. The southern border ran by Elath and Ezion-geber (Deut. lay in the "uttermost" of the border of Edom (Num. In 300 BC Mt. With the fall of Judah under the Romans. each in its place. who compelled the people to become Jews and to submit to circumcision. the God of Israel. Ezek. David prosecuted the war with terrific energy. They gave what help they could to Nebuchadnezzar. a land possessed by nettles and salt pits. 4:21. Samaria and Galilee by Julius Caesar. says the LORD of hosts. 8:20). he will famish all the gods of the earth. 5:65). On the East it marched with the desert. and later became a source of trouble to Solomon (1Kgs. and exulted in the destruction of Jerusalem. and the survivors of my nation shall possess them.25). 1:10). was made procurator of Judea. and the Ammonites like Gomor'rah. yea.61. "Moab shall become like Sodom. 25:12. Obad.000 Edomites (so read instead of "Syrians") in the Valley of Salt (2Sam. and took Sela which he named Joktheel (2Kgs. we are told. slaying 18. governor of Idumaea. 14:22). Antipater. 11:15). 8:13). as indicated in Numbers 34:3 f: a line running from the Salt Sea southward of the Ascent of Akrabbim to Zin and Kadesh-barnea. In 126 BC the country was subdued by John Hyrcanus." 10 This shall be their lot in return for their pride. 14:7). their chief city.000 in the Valley of Salt. Edom revolted. stirring the bitterest indignation in the hearts of the Jews (Lam. 14:47). How much of the uplands West of the `Arabah southward to the Gulf of `Aqaba was included in Edom it is impossible to say. 11:14. Under Jehoram son of Jehoshaphat.cgi?number=T2891 . Joab remaining for six months in the country. Jehoram defeated them at Zair. Hebron. Hadad of the blood royal of Edom escaped to Egypt. but was unable to quell the rebellion (2Kgs. Uzziah restored the Edomite port of Elath (2Kgs. "until he had cut off every male in Edom" (1Kgs. and a waste for ever. ESAU/EDOM From The International Standard Bible Encyclopedia The boundaries of Edom may be traced with some approach to accuracy. Seir with its capital Petra fell into the hands of the Nabateans. 35:3.

the capital of Edom. 22 The children struggled together within her. Prophecy concerning Edom Before Esau's birth. In Ezek 25:13 desolation is denounced upon Edom: "From Teman even unto Dedan shall they fall by the sword. "Two nations are in your womb. 1 Ch 1:53). etc. The ISBE has this to say about them.). and again as standing for Edom. Adom/Edom in Hebrew means red but the Greeks named it Idumea (Isa. It was also known as "the field of Edom" (Gen. because she was barren. Husham of the land of the Temanites was one of the ancient kings of Edom (Gen 36:34. 1 Ch 1:45). since Esau was born hairy and very strong. The Temani extended east also as did the other tribes into other nations. W. They are mentioned in conjunction with Dedan in the south of Edom. named after Teman the grandson of Esau. 36:16). Teman must be sought in the North Eusebius. and Rebekah his wife conceived.e. shall be divided. No trace of the name has yet been found. and she said. made and complete. Obad 1:8 f). 35:15). born of you. and the LORD granted his prayer. Onomasticon knows a district in the Gebalene region called Theman. The root of the name in Hebrew is derived from the word asuy denoting "completion". "on the right. the Lord told Rebekah that her older son would serve the younger son. occupied by a Roman garrison. Eliphaz the Temanite was chief of the comforters of Job (2:11. 1 Ch 1:36).19.Esau first-born of Isaac and Rebekah Esau was the eldest son of Isaac and Rebekah. the elder shall serve the younger.te'-man (teman. the son of his firstborn. A duke Teman is named among the chiefs or clans of Edom (Gen 36:42. In Am 1:12 it is named along with Bozrah.21). it was also known as "the mountains of Esau" or "the mountain of Seir" (Obad. now by itself. Edom (Gen. 34:5-6.9. TEMAN [ISBE] TEMAN . and called the country after his own name. Unfortunately no indication of direction is given. 23 And the LORD said to her. and left it to his brother and dwelt in Seir. Thaiman): The name of a district and town in the land of Edom. in the place of the firstborn. Genesis 23:21-23 And Isaac prayed to the LORD for his wife." Esau departed from the city of Hebron. and also a town with the same name. The manner in which the city is mentioned by the prophets. and two peoples. Ezek. why do I live?" So she went to inquire of the LORD. "south"." Dedan being in the South. 32:3). the one shall be stronger than the other. From Obad 1:9 we gather that Teman was in the land of Esau (Edom). being "completed" and not infantile. The inhabitants of Teman seem to have been famous for their wisdom (Jer 49:7. The southern part of Edom was known as Teman." i. 1:8. Ewing . Eliphaz (Gen 36:11. 15 miles from Petra. Because the region was part mountainous. He does not however appear first. It may have been on the road from Elath to Bozrah. and the twin brother of Jacob. shows how important it must have been in their time. "If it is thus.

"The days of mourning for my father are approaching. and they were absorbed into Judah in Judea as opposed to Judah in Galilee. Oholibamah and Basemath. Ish'mael's daughter. his cattle. his sons. "Your brother came with guile. I have made him your lord. away from the fatness of the earth shall your dwelling be. "Bless me.Whilst Teman was in the North near Petra. Bas'emath bore Reu'el. and Korah. Esau’s sons These are the descendants of Esau (that is. he cried out with an exceedingly great and bitter cry. We will see more of this later (see also the paper War with Rome and the Fall of the Temple (No. . my father? Bless me. Esau is Edom. 2 Esau took his wives from the Canaanites: Adah the daughter of Elon the Hittite. and away from the dew of heaven on high. 5 and Oholiba'mah bore Je'ush. and he has taken away your blessing. 3 and Bas'emath. and behold. 9 These are the descendants of Esau the father of the E'domites in the hill country of Se'ir. and Esau said to himself. 4 And Adah bore to Esau. Oholiba'mah the daughter of Anah the son of Zib'eon the Hivite. Oholibamah/Judith and Basemath/Mahalath. "Behold. El'iphaz. 6 Then Esau took his wives. Edom). my son?" 38 Esau said to his father. Herod was an Edomite of the Hasmoneans. He took away my birthright. Isaac’s blessing to Esau Genesis 27:34-41 When Esau heard the words of his father. even me also. the sister of Neba'ioth. 7 For their possessions were too great for them to dwell together. and you shall serve your brother. O my father. and all his property which he had acquired in the land of Canaan." 36 Esau said. What then can I do for you. but when you break loose you shall break his yoke from your neck. "Have you not reserved a blessing for me?" 37 Isaac answered Esau." This prophecy was to be fulfilled when the Edomites were conquered by Judah under John Hyrcanus in the Second Century BCE. "Is he not rightly named Jacob? For he has supplanted me these two times. 8 So Esau dwelt in the hill country of Se'ir. even me also. and all the members of his household. it was also in the east and separated from the hills of Paran by the Arabah. These woman were also known by a second name: Adah/Bashemath. Genesis 36: The Family of Esau Esau married three wives: Adah. thus extending around Edom to Dedan. the land of their sojournings could not support them because of their cattle. then I will kill my brother Jacob. and with grain and wine I have sustained him. and said to his father." 41 Now Esau hated Jacob because of the blessing with which his father had blessed him. Jalam. his daughters. 298))." And Esau lifted up his voice and wept. "Have you but one blessing. 40 By your sword you shall live. 39 Then Isaac his father answered him: "Behold. O my father!" 35 But he said. all his beasts. and all his brothers I have given to him for servants. The Edomites also mingled with the Phoenicians. and he went into a land away from his brother Jacob." Then he said. now he has taken away my blessing. These are the sons of Esau who were born to him in the land of Canaan.

Esau's wife. It appears Esau’s clan must have driven away the original Horite inhabitants of Seir (Gen. 16 Korah. these are the chiefs born of Oholiba'mah the daughter of Anah. they are the sons of Bas'emath. Jalam. Omar. Omar. Esau's wife. Esau had five sons from his three wives. Edom). Esau's son. and these are their chiefs. Esau's wife: she bore to Esau Je'ush. and Am'alek. Esau's wife. Zepho. and Korah. 13 These are the sons of Reu'el: Nahath. 14 These are the sons of Oholiba'mah the daughter of Anah the son of Zib'eon. Esau's wife: the chiefs Je'ush. Shammah. Zerah. Jalam.e. Shammah. and Mizzah. Esau's wife. Deut. these are the chiefs of Reu'el in the land of Edom. Sons of Eliphaz – Esau’s grandsons and chiefs Teman (SHD 8487. Adah (1) Eliphaz: firstborn son (SHD 646) means god of gold. hunter . 12 (Timna was a concubine of El'iphaz. and Kenaz. and Mizzah. 15 These are the chiefs of the sons of Esau. and Korah. smooth) Esau’s grandsons 11 The sons of El'iphaz were Teman. Esau's son: the chiefs Nahath. they are the sons of Adah. Bashemath (Ishmael’s daughter) (1) Reuel (SHD 7467) means friend of God Oholibamah (1) Jeush/Jehush (SHD) 3266) means hasty (2) Jalam/Jaalam (SHD 3281) occult (3) Korah (SHD) 7141 means ice (as if bald i. she bore Am'alek to El'iphaz. 2:12). Zepho. these are the chiefs of El'iphaz in the land of Edom. from 8486) meaning from the south (being on the right-hand side of a person facing east) Omar (SHD 201): talkative Zepho (SHD 6825): observant Gatam (SHD 1609): uncertain derivation Kenaz (SHD 7073): to hunt. 18 These are the sons of Oholiba'mah. Gatam. 17 These are the sons of Reu'el. Kenaz. 14:6. These are the sons of Bas'emath. 19 These are the sons of Esau (that is.) These are the sons of Adah.Seir is another name for Edom. The sons of El'iphaz the first-born of Esau: the chiefs Teman. Gatam. Zerah.

The Horites were alleged by Bullinger to be a branch of the Nephilim (cf. 26 These are the sons of Dishon: Hemdan. These are also termed Horites from his grandson Hori who was the son of Lotan son of Seir. Shobal. Timnah was also the name of a Duke of Edom (cf. Lotan’s sister was Timna. as he pastured the asses of Zib'eon his father. . Anah. 29 These are the chiefs of the Horites: the chiefs Lotan. 15:10. these are the chiefs of the Horites. 28:18).Amalek (SHD 6002): descendant of Esau (from Eliphaz's concubine Timna) Sons of Reuel – Esau’s grandsons and chiefs Nahath (SHD 5184): quiet(ness) Zerah (SHD 2226): a rising of light Shammah (SHD 8040): ruin. waste Mizzah (SHD 4199): to faint with fear No grandsons from Oholibamah are listed but her sons Jeush. Gen. 27 These are the sons of Ezer: Bilhan. 36:40 and 1Chr. Korah are also listed as chiefs. the inhabitants of the land: Lotan. Shepho. and Cheran. his note to Gen. 23 These are the sons of Shobal: Alvan. 28 These are the sons of Dishan: Uz and Aran. Anah. Shobal. 30: Dishon. Jalan. Ezer. Zib'eon. and Akan. Zib'eon. 21 Dishon. and Lotan's sister was Timna. 28:12-14) and also a city in Dan (Josh. 14:1-5. What is certain is that they dwelt in the land of Edom and were the original inhabitants. and Dishan. 36:20 and his Appendices 23 and 25 in The Companion Bible). the sons of Se'ir in the land of Edom. Jdg. Ithran. Seir is a name for the mountain and its aboriginal occupants. 24 These are the sons of Zib'eon: A'iah and Anah. Man'ahath. Their sub-tribes are thus of lesser significance in terms of prophecy. astonishment dislocate(ion). Sons of Seir the Horite 20 These are the sons of Se'ir the Horite. The name may be thus of Canaanite derivation. The Dukes of the Horites were listed. 2Chr. Eshban. according to their clans in the land of Se'ir. these are the chiefs of the Horites. Ebal. 1:51) and a city in Judah (Gen. 22 The sons of Lotan were Hori and Heman. and Dishan. and Onam. he is the Anah who found the hot springs in the wilderness. Za'avan. 25 These are the children of Anah: Dishon and Oholiba'mah the daughter of Anah. Ezer. It might be assumed that she was the Timna who was a concubine of Eliphaz and she was the mother of Amalek but this has enormous repercussions for Esau.

concubine of Eliphaz. 34 Jobab died. and Hadar reigned in his stead. and Husham of the land of the Te'manites reigned in his stead. and Jobab the son of Zerah of Bozrah reigned in his stead. 134)). Teman. 32 Bela the son of Be'or reigned in Edom. Jetheth. Esau. The Horim are in effect the same as the Horites and are thus Nephilim. cf. also 1Chr. according to their families and their dwelling places. the name of his city being Avith. 1:43-50) Chiefs descended from Esau 40 These are the names of the chiefs of Esau. before any king reigned over the Israelites. Gen. 43 Mag'diel. Seir before Esau took it over and destroyed them and lived in their land. 35 Husham died. 35:11 and Deuteronomy 17:14-20. and Shaul of Reho'both on the Euphra'tes reigned in his stead.Listed as living among the Canaanites are also the Rephaim and the Anakim who were sons of Rapha and of Anak of the Nephilim. Emim and Zamzumim and Horim all of whom have no resurrection. YDNA easily identifies the lineages of humans today and they are all from one lineage and the mtDNA is from one female. 37 Samlah died. That is why they were allowed to be destroyed by order of the king of Persia as we see in Esther (see the Commentary on Esther (No. 42 Kenaz. 14:5) were as great and tall as the Anakim and accounted among the giants. 63)) and why God ordered the destruction of Agag and the Amalekites and why Saul was rebuked and Agag was killed by Samuel. the name of his city being Pau. who defeated Mid'ian in the country of Moab. the name of his city being Din'habah. reigned in his stead. 41 Oholiba'mah. 33 Bela died. Pinon. but the Moabites called them Emim. Deuteronomy 2:12 says that the Horim also dwelt in Mt. and who had to be destroyed (see the paper The Nephilim (No. 31 These are the kings who reigned in the land of Edom. his wife's name was Mehet'abel. and Ba'al-ha'nan the son of Achbor reigned in his stead. Anakim. the daughter of Matred. 265)). Deuteronomy 2:10 and 11 says that the Emim (or Terrible Ones. The Kings of Edom Bullinger notes that verse 31 (below) refers to Genesis 17:6. Mibzar. 36 Hadad died. If Timna. The Ammonites called the Nephilim in their area Zamzumim and in the same way they destroyed them. by their names: the chiefs Timna. Elah. the father of Edom). (cf. and Hadad the son of Bedad. and Samlah of Masre'kah reigned in his stead. From the account in Deuteronomy 2 in verse 9 the Moabites were given the lands of Ar for a possession. daughter of Me'zahab. these are the chiefs of Edom (that is. 38 Shaul died. is the sister of Lotan then she is a Horite and if indeed the Horites were Nephilim then the Amalekites are part Nephilim and the later irruptions resulted in the orders for the exterminations of some Canaanite tribes due to contamination with the Rephaim. Alvah. and Iram. and thus the Nephilim have been exterminated (see the paper Genetic Origin of the Nations (No. according to their dwelling places . 39 Ba'al-ha'nan the son of Achbor died.

you shall not abhor an Egyptian. these are the chiefs of Edom.) Children of the third generation could be received into the congregation of Israel Deuteronomy 23:7-8 "You shall not abhor an E'domite. Jetheth. he knows your going through this great wilderness. they are as still as a stone. Exodus 15:15-17 Now are the chiefs of Edom dismayed. 12 The Horites also lived in Se'ir formerly. and tall as the Anakim. that you may eat. 16 Terror and dread fall upon them. but the sons of Esau dispossessed them. 6 You shall purchase food from them for money. and destroyed them from before them. all the inhabitants of Canaan have melted away. You are about to pass through the territory of your brethren the sons of Esau. So take good heed. and they will be afraid of you. 7 For the LORD your God has blessed you in all the work of your hands. away from the Arabah road from Elath and E'zion- ge'ber. you have lacked nothing. the place. From the Song of Moses When Israel was taken from Egypt they had become a great multitude and the sons of Lot and Esau saw them as a great threat. till the people pass by whom thou hast purchased. till thy people. which thou hast made for thy abode. These people will be part of the conflict against Israel all the way to the end of the Last Days and the establishment of the Kingdom of God in the Millennium. `Do not harass Moab or contend with them in battle. pass by. 9 And the LORD said to me. who live in Se'ir. for I will not give you any of their land for a possession. . for I will not give you any of their land. not so much as for the sole of the foot to tread on. O LORD. because of the greatness of thy arm. because you were a sojourner in his land. 8 The children of the third generation that are born to them may enter the assembly of the LORD. The Israelites were to take over the lands that were in the hands of the Amorites. O LORD. 53 Kenaz. Al'iah. 52 Oholiba'mah. Land of Edom Moses was told to bypass Edom. which the LORD gave to them. these forty years the LORD your God has been with you.' 10 (The Emim formerly lived there. Moab and Ammon because of their blood relationship to Israel. The Lord had given the descendants of Esau and Lot (Moabites and Ammonites) their lands just as He was giving the Israelites theirs. The chiefs of Edom were: chiefs Timna. but the Moabites call them Emim. Deuteronomy 2:4-12 And command the people. a people great and many. 17 Thou wilt bring them in. because I have given Mount Se'ir to Esau as a possession. LORD. away from our brethren the sons of Esau who live in Se'ir. which thy hands have established. Elah. and you shall also buy water of them for money. and Iram. Mibzar.' 8 So we went on. because I have given Ar to the sons of Lot for a possession. "And we turned and went in the direction of the wilderness of Moab. trembling seizes them. and settled in their stead. Pinon. that you may drink. 1Chronicles 1:51-54 And Hadad died. for he is your brother. Amalek had become a powerful force and they lay in the path of Israel to their Promised Land. 54 Mag'di-el. no. 5 do not contend with them. the leaders of Moab. 11 like the Anakim they are also known as Reph'aim. the sanctuary. Teman. as Israel did to the land of their possession. and plant them on thy own mountain.

O God. But later. Psalm 83 is a statement made by David of the enemies of Israel in his day. and understanding . "Who will bring me down to the ground?" 4 Though you soar aloft like the eagle. Philistia with the inhabitants of Tyre. as to Sis'era and Jabin at the river Kishon.In the days of Saul. 18 Let them know that thou alone. those who hate thee have raised their heads. 8 Will I not on that day. 14 As fire consumes the forest. A Psalm of Asaph. Moab and the Hagrites. art the Most High over all the earth. whose name is the LORD. 15 so do thou pursue them with thy tempest and terrify them with thy hurricane! 16 Fill their faces with shame. "Come. the Edomites became independent of Israel (2Kgs. I will make you small among the nations. who say in your heart. 11 Make their nobles like Oreb and Zeeb. 8 Assyria also has joined them. 4 They say. if plunderers by night -. in the days of Joram. would they not leave gleanings? 6 How Esau has been pillaged. do not hold thy peace or be still." 13 O my God. Obadiah concerning Edom The entire book of Obadiah records an extended prophecy against Edom. says the LORD. who became dung for the ground. 3 The pride of your heart has deceived you. 17 Let them be put to shame and dismayed for ever. 3 They lay crafty plans against thy people. O LORD. says the LORD. that they may seek thy name. thy enemies are in tumult.there is no understanding of it. as the flame sets the mountains ablaze. you who live in the clefts of the rock. like chaff before the wind. let us wipe them out as a nation. the son of Ahab. 2 Behold. his treasures sought out! 7 All your allies have deceived you. 10 who were destroyed at En-dor. They remained independent until the subjugation of John Hyrcanus when they joined with Israel in part in Judea. "Let us take possession for ourselves of the pastures of God. you shall be utterly despised. 5 If thieves came to you. they conspire with one accord. [Selah] 9 Do to them as thou didst to Mid'ian. let the name of Israel be remembered no more!" 5 Yea. We can notice that the same combination is against Israel today and it is thus prophecy. 12 who said. Edom was to be destroyed and Israel would be delivered. they consult together against thy protected ones. 8:14). 0: A Song. they have driven you to the border. against thee they make a covenant -. 14:47). Edom was made subject to Israel (1Sam. and David established garrisons there (2Sam. whose dwelling is high. Edom’s hostile activities against Israel had spanned centuries and God’s wrath was upon them. they are the strong arm of the children of Lot. your trusted friends have set a trap under you -. your confederates have prevailed against you. 8:16-22). This is what the sovereign Lord says about Edom. O God! 2 For lo. all their princes like Zebah and Zalmun'na. let them perish in disgrace.6 the tents of Edom and the Ish'maelites.how you have been destroyed! -- would they not steal only enough for themselves? If grape gatherers came to you. though your nest is set among the stars. do not keep silence. 7 Gebal and Ammon and Am'alek. thence I will bring you down. make them like whirling dust. destroy the wise men out of Edom. An envoy was sent to the nations calling them to battle against Edom.

out of Mount Esau? 9 And your mighty men shall be dismayed, O Teman, so that every man
from Mount Esau will be cut off by slaughter. 10 For the violence done to your brother Jacob,
shame shall cover you, and you shall be cut off for ever. 11 On the day that you stood aloof, on
the day that strangers carried off his wealth, and foreigners entered his gates and cast lots for
Jerusalem, you were like one of them. 12 But you should not have gloated over the day of your
brother in the day of his misfortune; you should not have rejoiced over the people of Judah in
the day of their ruin; you should not have boasted in the day of distress. 13 You should not have
entered the gate of my people in the day of his calamity; you should not have gloated over his
disaster in the day of his calamity; you should not have looted his goods in the day of his
calamity. 14 You should not have stood at the parting of the ways to cut off his fugitives; you
should not have delivered up his survivors in the day of distress. 15 For the day of the LORD is
near upon all the nations. As you have done, it shall be done to you, your deeds shall return on
your own head. 16 For as you have drunk upon my holy mountain, all the nations round about
shall drink; they shall drink, and stagger, and shall be as though they had not been. 17 But in
Mount Zion there shall be those that escape, and it shall be holy; and the house of Jacob shall
possess their own possessions. 18 The house of Jacob shall be a fire, and the house of Joseph a
flame, and the house of Esau stubble; they shall burn them and consume them, and there shall
be no survivor to the house of Esau; for the LORD has spoken. 19 Those of the Negeb shall
possess Mount Esau, and those of the Shephe'lah the land of the Philistines; they shall possess
the land of E'phraim and the land of Sama'ria and Benjamin shall possess Gilead. 20 The exiles
in Halah who are of the people of Israel shall possess Phoenicia as far as Zar'ephath; and the
exiles of Jerusalem who are in Sephar'ad shall possess the cities of the Negeb. 21 Saviors shall
go up to Mount Zion to rule Mount Esau; and the kingdom shall be the LORD's.
Note that at the end of this verse it says that Saviours will go up to Mt. Zion to rule Mt. Esau. This
text refers to the Messiah and the Church of the First Resurrection. They will take their place for
the millennial rule and the judgment of the nations.

Jacob loved, Esau hated
Paul explains God’s love for Jacob and hatred for Esau on the basis of election (Rom. 9:10-13).
Likewise Leah was “hated” in that Jacob loved Rachel more (Gen. 29:31-33). Also believers are to
hate their mother and father, etc. (Lk. 14:26) in the sense that they must love God more than
anyone or anything else.

Malachi 1:1-5 The oracle of the word of the LORD to Israel by Mal'achi. 2 "I have loved you,"
says the LORD. But you say, "How hast thou loved us?" "Is not Esau Jacob's brother?" says
the LORD. "Yet I have loved Jacob 3 but I have hated Esau; I have laid waste his hill country
and left his heritage to jackals of the desert." 4 If Edom says, "We are shattered but we will
rebuild the ruins," the LORD of hosts says, "They may build, but I will tear down, till they are
called the wicked country, the people with whom the LORD is angry for ever." 5 Your own
eyes shall see this, and you shall say, "Great is the LORD, beyond the border of Israel!"
This tearing down was to continue to this day and Edom is still a waste under Jordan. These days
will end and the area will become part of the land that passes to Israel with Jordan as part of the
greater nation under Messiah.

Edom refuses the Israelites passage through their country
Moses’ attempt to pass through the territory of Edom in a peaceful manner was met with
hostility.

Numbers 20:18-21 But Edom said to him, "You shall not pass through, lest I come out with the
sword against you." 19 And the people of Israel said to him, "We will go up by the highway;
and if we drink of your water, I and my cattle, then I will pay for it; let me only pass through
on foot, nothing more." 20 But he said, "You shall not pass through." And Edom came out
against them with many men, and with a strong force. 21 Thus Edom refused to give Israel
passage through his territory; so Israel turned away from him.

David makes conquest of Edom
1Chronicles 18:11-13 these also King David dedicated to the LORD, together with the silver and
gold which he had carried off from all the nations, from Edom, Moab, the Ammonites, the
Philistines, and Am'alek. 12 And Abi'shai, the son of Zeru'iah, slew eighteen thousand E'domites
in the Valley of Salt. 13 And he put garrisons in Edom; and all the E'domites became David's
servants. And the LORD gave victory to David wherever he went.
Their destiny was to become part of Israel under the Messiah.

The Lord raised up Hadad the Edomite against Solomon
They were subdued by David but used by God against Solomon when he sinned.

1Kings 11:14-16: And the LORD raised up an adversary against Solomon, Hadad the
E'domite; he was of the royal house in Edom. 15 For when David was in Edom, and Jo'ab the
commander of the army went up to bury the slain, he slew every male in Edom 16 (for Jo'ab and
all Israel remained there six months, until he had cut off every male in Edom);

Battle songs concerning conquest of Edom
Psalm 60:8-9 Moab is my washbasin; upon Edom I cast my shoe; over Philistia I shout in
triumph." 9 Who will bring me to the fortified city? Who will lead me to Edom?
To cast one’s shoe means to take possession as an estate (cf. also Psa. 108:9-10).

The Lord delivered the army of Edom into the hands of Jehoshaphat
2Chronicles 19:20-23 And the Levites, of the Ko'hathites and the Kor'ahites, stood up to praise
the LORD, the God of Israel, with a very loud voice. 20 And they rose early in the morning and
went out into the wilderness of Teko'a; and as they went out, Jehosh'aphat stood and said,
"Hear me, Judah and inhabitants of Jerusalem! Believe in the LORD your God, and you will be
established; believe his prophets, and you will succeed." 21 And when he had taken counsel
with the people, he appointed those who were to sing to the LORD and praise him in holy
array, as they went before the army, and say, "Give thanks to the LORD, for his steadfast love
endures for ever." 22 And when they began to sing and praise, the LORD set an ambush against
the men of Ammon, Moab, and Mount Se'ir, who had come against Judah, so that they were
routed. 23 For the men of Ammon and Moab rose against the inhabitants of Mount Se'ir,
destroying them utterly, and when they had made an end of the inhabitants of Se'ir, they all
helped to destroy one another.

The Edomites thus became confederates of Jehoshaphat (2Kgs. 3:8-9, 26-27).
8
Then he said, "By which way shall we march?" Jeho'ram answered, "By the way of the
wilderness of Edom." 9 So the king of Israel went with the king of Judah and the king of Edom.

And when they had made a circuitous march of seven days, there was no water for the army or
for the beasts which followed them.
26
When the king of Moab saw that the battle was going against him, he took with him seven
hundred swordsmen to break through, opposite the king of Edom; but they could not. 27 Then
he took his eldest son who was to reign in his stead, and offered him for a burnt offering upon
the wall. And there came great wrath upon Israel; and they withdrew from him and returned to
their own land.

Reading this we see that the sacrifice to Chemosh of the son of the king of Moab was followed by
great wrath coming upon Israel. We are not told how the wrath came about but God detests the
sacrifice to an idol of the Moabites. However, it seems to have rallied the Moabite troops.

Revolt in the days of Joram
Edomites were often in a state of war with the neighbouring Kings of Israel and Judah.

2Kings 8:20-22 In his days Edom revolted from the rule of Judah, and set up a king of their
own. 21 Then Joram passed over to Za'ir with all his chariots, and rose by night, and he and his
chariot commanders smote the E'domites who had surrounded him; but his army fled home. 22
So Edom revolted from the rule of Judah to this day. Then Libnah revolted at the same time.

(cf. also 2Chr. 21:8-10; 28:17)

Amaziah, king of Judah, invades the territory of Edom
Amaziah defeated Edom and then became so proud he decided to attack Israel. He was defeated
by a more worthy opponent.

2Kings 14:7-12 He killed ten thousand E'domites in the Valley of Salt and took Sela by storm,
and called it Jok'the-el, which is its name to this day. 8 Then Amazi'ah sent messengers to
Jeho'ash the son of Jeho'ahaz, son of Jehu, king of Israel, saying, "Come, let us look one
another in the face." 9 And Jeho'ash king of Israel sent word to Amazi'ah king of Judah, "A
thistle on Lebanon sent to a cedar on Lebanon, saying, `Give your daughter to my son for a
wife'; and a wild beast of Lebanon passed by and trampled down the thistle. 10 You have
indeed smitten Edom, and your heart has lifted you up. Be content with your glory, and stay at
home; for why should you provoke trouble so that you fall, you and Judah with you?" 11 But
Amazi'ah would not listen. So Jeho'ash king of Israel went up, and he and Amazi'ah king of
Judah faced one another in battle at Beth-she'mesh, which belongs to Judah. 12 And Judah was
defeated by Israel, and every man fled to his home.
The reason he did not listen was because like all corrupt people they had taken the Edomites and
then gone after their gods when they conquered them.

Amaziah threw down ten thousand men of Edom, or Seir, at the cliffs of Petra in vengeance but
God punished him with the defeat by Israel.

2Chronicles 25:11-12 But Amazi'ah took courage, and led out his people, and went to the
Valley of Salt and smote ten thousand men of Se'ir. 12 The men of Judah captured another ten
thousand alive, and took them to the top of a rock and threw them down from the top of the
rock; and they were all dashed to pieces.
This was not to end hostilities. The harsh treatment of enemies inspires greater hatred as we see
today in the Middle East. The women were taken and the gods of Edom, similar to Milcom and
Chemosh of the Ammonites and Moabites, entered Judah. Amaziah was taken in a conspiracy
against him after he fled from Jerusalem to Lachish. They sent a force there and killed him and
brought his body back to Jerusalem and buried it there in the city of Judah (2Chr. 25:25-28).

His son Uzziah was made king at 16 years of age and he sought The God (Ha Elohim, The One
True God) in the days of Zechariah and God strengthened him against the Philistines of the coast
in the cities of Gath, Jabneh (Yebah between Joppa and Ashdod) and also Ashdod. He defeated
the Arabians at Gur-Baal and Mehunims (or Maonites of the sons of Ham). The Ammonites
became tributary to him and he fortified Jerusalem with towers (2Chr. 26:1-9). Uzziah became
arrogant and took incense into the Temple of God to burn it and was resisted by Azariah and
eighty of the priests. He went out of the Temple but while the censer was in his hands he was
struck with leprosy (2Chr. 26:16-21). He was confined to a separate dwelling and Jotham his son
presided over the people and their worship from that time forward.

Jotham obeyed God and likewise made the Ammonites tributary to him while he obeyed God. He
fortified the countryside with cities and towers or castles in the forests. He reigned sixteen years
and died and was replaced by Ahaz his son who did not do what was right in the eyes of the Lord.
He walked in the ways of the kings of Israel and made Baalim or images of Baal and worshipped
them (2Chr. 28:1-8). Judah was then sent into captivity and defeated first by the Syrians and then
by Israel and many hundreds of thousands were taken captive. The prophet Oded commanded
Israel to clothe and return the captives of Judah and they did that when the army returned with
them, refusing to allow them to be kept.

Ahaz had brought Judah very low and made it weak through his idolatry and his sacrificing the
children to the gods of the Edomites and of Milcom and Chemosh. They were weakened and the
Edomites then invaded.

2Chronicles 28:17 For the E'domites had again invaded and defeated Judah, and carried away
captives.
After the Edomites plundered Judah in the east, the Philistines also invaded from the coasts and
took Beth Shemesh, Ajalon, Gederoth, Shocho, Timna and Gimzo.

This was to be a lesson and will repeat itself when Judah is in sin. So too they have lost Gaza and
the coastlands and are under pressure and attack from the east.

Israel had distressed Judah and removed a portion of the House of God and the King of Judah and
gave it to Tiglath-pileser, the King of Assyria, but the Assyrian did not assist Israel.

Ahaz, king of Judah, then sacrificed to the gods of Damascus and the Syrians. And Ahaz took the
vessels of the Temple and sealed the Temple up and cut the vessels in pieces and erected altars
to idols on every street corner in Jerusalem. He provoked God to wrath and he died and was
replaced by Hezekiah his son, who brought the land back to the Lord God in his restoration (2Chr.
28:22-27; 29:1-2).

When Judah sins it is punished. In the same way the Assyrians took Israel into captivity. Even
though they had weakened Judah and given spoil to the Assyrians the Assyrians despised them
for it.

When Judah is weak and is attacked it is because they sin. Their traditions cause them to
transgress the Laws of God and these aspects will be addressed and corrected in the Last Days.

The Lord uses Ammon, Moab and Edom to correct Israel and Judah and punishes them when they
turn from God. These nations were all to be punished and placed under Israel while it was the
vineyard of the Lord and faithful to Him. They are one people dedicated to the Lord God of
Abraham and in the end they will be together as one people. Edom is already joined to Israel in a
major way from the subjugation in the Second Century BCE.

A Jewish prophet in Babylon denounces Edom

Psalm 137:7 Remember, O LORD, against the E'domites the day of Jerusalem, how they said,
"Rase it, rase it! Down to its foundations!"

Prophecies concerning Edom
Genesis 25:23 And the LORD said to her, "Two nations are in your womb, and two peoples,
born of you, shall be divided; the one shall be stronger than the other, the elder shall serve the
younger."

Genesis 27:29,37-40 Let peoples serve you, and nations bow down to you. Be lord over your
brothers, and may your mother's sons bow down to you. Cursed be every one who curses you,
and blessed be every one who blesses you!"

Isaiah 11:14 But they shall swoop down upon the shoulder of the Philistines in the west. This section concerns the sons of Keturah through Midian to Dedan – a son of Midian – who had occupied the area east of Edom and were part of this confederacy. even me also. Their lands shall form part of Israel also. Some of this tribe is understood to have taken occupation of part of Mt. and together they shall plunder the people of the east. away from the fatness of the earth shall your dwelling be. his enemies." And Esau lifted up his voice and wept." Dumah is held to be a shortening of Idumea. and all his brothers I have given to him for servants. seemingly by Edom or Dumah. Herod was an Idumean. but when you break loose you shall break his yoke from your neck. "Watchman. come back again. They shall put forth their hand against Edom and Moab. Isaiah seems to be using this to refer to the composite in the Last Days. 37 Isaac answered Esau. Se'ir also. and away from the dew of heaven on high. This prophecy refers to the fall of Babylon (the religious system) in the Last Days and the burdens placed on these people. They have not broken loose from Israel and are in fact part of Israel. and the Ammonites shall obey them. and with grain and wine I have sustained him. This was the Sixth burden of Isaiah and the Seventh burden follows this text concerning Arabia. Numbers 24:18 Edom shall be dispossessed. until they are resettled by Messiah as a part of the confederacy. O my father. inquire. Seir when Edom moved northwest to occupy some of the vacant lands of Israel after the captivity of the Babylonians. One is calling to me from Se'ir. The prophecy concerns Revelation 18 when Babylon is fallen and all her idols are broken and cast to the ground." So the children of Esau were to live by the sword. which is the Kingdom of Edom. when is the dawn of the Millennial Day? When is the Shabbat of Messiah? How much . The question to the prophet. what of the night? Watchman. my son?" 38 Esau said to his father. The problem we have is that Dumah is also the name of one of the tribes of Ishmael (see Descendants of Abraham Part III: Ishmael (No. my father? Bless me. is: “how far gone is the night?” In other words. and you shall serve your brother. while Israel does valiantly. "Behold. The term “in Arabia” (ba’rab) has the meaning of at the sunset or the evening and carries with it the same significance as does Dumah meaning the silence. what of the night?" 12 The watchman says: "Morning comes. Isaiah 21:11-12 The oracle concerning Dumah. "Have you but one blessing. If you will inquire. 39 Then Isaac his father answered him: "Behold. It means silence and the word is used for the silence of the Last Days. and also the night. 40 By your sword you shall live. I have made him your lord. What then can I do for you. shall be dispossessed. We can see from this reference that Edom is interbred with Dumah as well as with Judah. 212C)).

with the fat of the kidneys of rams. Bozrah means vintage (cf. This conflict will last one year and in that year all the glory of Kedar will fail. In other words. Come!” This is the morning of the millennial dawn and the repentant will see it and the invitation is given. 25:13. Isaiah 34:5-6 For my sword has drunk its fill in the heavens.longer have we to go? The answer is given: “The morning comes and also the night. 25:3. This year sees the coming of the Messiah and the resurrection of the elect. but they will be helped and restored in the end process of the Millennial Restoration (cf. in endurance and strength (Heb. 1:30). 6 The LORD has a sword. Media is the area occupied by the Kurds or Kurdistan. son of Abraham by Keturah (Gen. ch. 34:5). Tema brought bread and water to those fleeing the grievousness of war. . For the LORD has a sacrifice in Bozrah. which is the valley around Jerusalem where Abraham first saw his vision and the prophets have done ever since. Isaiah chapter 21 deals with the conquests of the Medes and the Persians and the fall of Babylon and its effects on the sons of Abraham through Hagar and Keturah. Elam is Persia or modern-day Iran. and of Isaac through Esau. The word used here for winepress is Gath.15. it is sated with blood. upon the people I have doomed. Messiah is travelling as bending forward in marching. The garments of the Messiah will all be stained with blood and Messiah says here that. which includes Turkey and Iraq and into Georgia and Iran. 1Chr. The word red here is ‘adom and is a reference to Edom. Isa. 21:14-16). This is his return in might and power and not in weakness. “The day of my vengeance is in my heart and the year of my redeemed is come”. We know that this action is undertaken by Messiah on his return in the execution of vengeance in judgment. Tema and Kedar are also mentioned. If you will return then return. The Septuagint and the Arabic version render “Valley of Vision” as “Jerusalem. The tribes that are involved in this conflict are the sons of Dedan. with the blood of lambs and goats. it descends for judgment upon Edom. behold. a great slaughter in the land of Edom. it is gorged with fat. They are mentioned in Jeremiah 49:28 and Job 6:13.” After the war in the heavens and the subjugation of the Host the descent on the Earth commences with the Middle East and with Edom. Koah). Chapter 22 then goes on to deal with the Valley of the Vision. 1Chr. son of Midian. 1:32). a section of the sons of Ishmael through Kedar will be devastated by the conflict as will be their land. Tema and Kedar are also sons of Ishmael as is Dumah (Gen. 21:9) but this also looks forward in prophecy to the false religions that come undone in this final conflict. It sees the fall of Babylon (Isa.

Bible. and all who dwell in the desert that cut the corners of their hair. 50:37. that is the uncircumcised of heart. the days are coming. Comp. all the kings of Sidon." The unconverted. he that is glorious in his apparel. 106:35). mighty to save. Ezek. will be dealt with.26 Egypt. and I have stained all my raiment. I trod them in my anger and trampled them in my wrath. 30:5. Moab. Moab. which is Job’s country near Idumea (cf. but not acting as directed by God when using the term Nebuchadnezzar. God says He will send “the cup of the wrath of His fury” to a number of nations and. and thy garments like his that treads in the wine press? 3 "I have trodden the wine press alone. Tema. as are those across the sea in the coastlands. to v. Jerusalem was made an astonishment and a hissing and a curse to the end. Isaiah 63:1-4 Who is this that comes from Edom. and all who cut the corners of their hair. Where the r is used in his name the reference is to the King of the North acting. Esau and Ishmael will be brought to conversion and subjection in might and power. marching in the greatness of his strength? "It is I.From this year he subjugates the Middle East. Judah. their lifeblood is sprinkled upon my garments. for all these nations are uncircumcised. and my year of redemption has come. Lam. 4:2). In the Inscription of Sennacharib (Bellino’s Cylinder line 13). Ezra 9:2. and the sons of Lot. The tribes are to be attacked in the Last Days Jeremiah 9:25-26 "Behold. the sons of Ammon. and the kings of the coastland across the sea. He uses the Babylonians as a reference to Nebuchadrezzar." 2 Why is thy apparel red. The land of Uz is mentioned. Dan. 22 all the kings of Tyre. in Jeremiah 25 when God is prophesying through Jeremiah what is to happen. This refers to the influence of the Babylonian system of sun worship and those also who make tonsures of their hair. Ps. 20). says the LORD. Note the system now extends north to Lebanon and they are included in the subjugation. and all the house of Israel is uncircumcised in heart. and it shall be rebuilt at the return of Messiah. Jeremiah 25:21-23 Edom. in crimsoned garments from Bozrah. when I will punish all those who are circumcised but yet uncircumcised -. So also shall Egypt be struck. the Urbi are joined with the Aramaens who are the nomad tribes west of the Euphrates. This text in chapter 25 refers to the cup of the wrath of God and it is to be spilled out on Jerusalem and the cities of Judah and its administration. Buz. announcing vindication. and from the peoples no one was with me. . 23 Dedan. and the sons of Ammon. fn. In verse 20 Jeremiah refers to the ‘ereb which is rendered Mingled people in the KJV (cf. 2:43. Sennacharib says that Hezekiah had some Urbi soldiers with him in Jerusalem (cf. 4 For the day of vengeance was in my heart. Edom. Bullinger.

Dedan is also on the borders of Idumea. and the king of Sidon by the hand . “You will surely die”. For a long while it was given to the King of the North (Nebuchadnezzar. Ekron (now ‘Akir) and Ashdod (now ‘Esdud). the king of Tyre. as will be the case in the Last Days. The princes were invoked and Jeremiah again said what he was commanded to say. the priests and the prophets and the people seized him saying. God sent Jeremiah to call the people to repentance. 25:2). 3 Send word to the king of Edom. with n not r). 2 Thus the LORD said to me: "Make yourself thongs and yoke-bars. All were to serve him. Tema and Buz are the country of Elihu (Job 32:2). The same area is sent into captivity and the prophecy is against the same nations. This region is the entire area from Syria to Lebanon and south to Egypt and east to Saudi Arabia. It will all be brought under subjection to Messiah as part of greater Israel. but that time is to cease and Isaiah shows that Babylon is to fall and then these nations will be subject to and dealt with by Messiah. Zimri is also mentioned and it is thought that this name refers to Zimran the son of Abraham by Keturah (Gen. king of Judah. The KJV follows some codices and the Syriac in placing the word Zedekiah in the text. the king of the sons of Ammon.The Philistines are mentioned at Azzah or Gaza and Ashkelon. as He will send the Two Witnesses in the Last Days to speak again and call these people to repentance. This text was written in the reign of Jehoiakin on the fourth year of Zedekiah. After he had spoken what the Lord had commanded him to speak. the king of Moab. and put them on your neck. Jeremiah 27:1-11 In the beginning of the reign of Zedeki'ah the son of Josi'ah. this word came to Jeremiah from the LORD. In Jeremiah chapter 26 we see that the Lord God spoke through the prophet Jeremiah and the people were told to walk in the ways of the Law of God and to listen to the prophets. Jeremiah was not then put to death.

Jeremiah 49:7-22 Concerning Edom. 9 So do not listen to your prophets. O inhabitants of Dedan! For I will bring the calamity of Esau upon him. I will punish that nation with the sword. and put its neck under the yoke of the king of Babylon. until the time of his own land comes. 8 "`"But if any nation or kingdom will not serve this Nebuchadnez'zar king of Babylon. that Bozrah shall become a horror. says the LORD. then many nations and great kings shall make him their slave. would they not destroy only enough for themselves? 10 But I have stripped Esau bare. and you will perish. I will suddenly make them run away from her." 14 I have heard tidings from the LORD." The wars of the end . says the LORD. I will bring you down from there. until I have consumed it by his hand. and the heart of the warriors of Edom shall be in that day like the heart of a woman in her pangs. every one who passes by it will be horrified and will hiss because of all its disasters. and I will drive you out. I will leave on its own land. your diviners. Though you make your nest as high as the eagle's. 16 The horror you inspire has deceived you."'" Jeremiah confirms Isaiah regarding the coming punishment of the sons of Lot and Esau along with Dedan and Teman. no man shall sojourn in her. and the pride of your heart. 4 Give them this charge for their masters: `Thus says the LORD of hosts. and with pestilence. 7 All the nations shall serve him and his son and his grandson. no man shall dwell there. 9 If grape-gatherers came to you. and a messenger has been sent among the nations: "Gather yourselves together and come against her. of the envoys who have come to Jerusalem to Zedeki'ah king of Judah. but you must drink. who hold the height of the hill. and he is no more. your dreamers. I will make you small among the nations. 13 For I have sworn by myself. 21 At the sound of their fall the earth shall tremble. one shall mount up and fly swiftly like an eagle. 18 As when Sodom and Gomor'rah and their neighbor cities were overthrown. my servant. I will keep them alive. and I give it to whomever it seems right to me. the God of Israel: This is what you shall say to your masters: 5 "It is I who by my great power and my outstretched arm have made the earth. with the result that you will be removed far from your land. says the LORD. dwell in the depths. like a lion coming up from the jungle of the Jordan against a strong sheepfold. says the LORD. with famine. and his brothers." 12 For thus says the LORD: "If those who did not deserve to drink the cup must drink it. and rise up for battle!" 15 For behold. or your sorcerers. 11 Leave your fatherless children. 11 But any nation which will bring its neck under the yoke of the king of Babylon and serve him. `You shall not serve the king of Babylon. the time when I punish him. with the men and animals that are on the earth. and I will appoint over her whomever I choose. 17 "Edom shall become a horror. and he is not able to conceal himself. and let your widows trust in me. 19 Behold. the sound of their cry shall be heard at the Red Sea. and I have given him also the beasts of the field to serve him. despised among men. and his neighbors. 22 Behold. surely their fold shall be appalled at their fate. and a curse. would they not leave gleanings? If thieves came by night. and spread his wings against Bozrah. you who live in the clefts of the rock. turn back. I have uncovered his hiding places. your soothsayers. Thus says the LORD of hosts: "Is wisdom no more in Teman? Has counsel perished from the prudent? Has their wisdom vanished? 8 Flee. says the LORD.' 10 For it is a lie which they are prophesying to you. a waste. will you go unpunished? You shall not go unpunished. and all her cities shall be perpetual wastes. For who is like me? Who will summon me? What shepherd can stand before me? 20 Therefore hear the plan which the LORD has made against Edom and the purposes which he has formed against the inhabitants of Teman: Even the little ones of the flock shall be dragged away. a taunt. who are saying to you. His children are destroyed. to till it and dwell there. the king of Babylon. 6 Now I have given all these lands into the hand of Nebuchadnez'zar.

22 The punishment of your iniquity. the King of the South shall push at the King of the North. they lie uncircumcised with those who are slain by the sword. Thus says the Lord GOD: Behold. he will punish. from Teman even to Dedan they shall fall by the sword. Remember also that many of Edom are in Judah now. at the time of their final punishment. and cut off from it man and beast.e. 3 and say to it. 7 I will make Mount Se'ir a waste and a desolation. and gave over the people of Israel to the power of the sword at the time of their calamity. and I will make it desolate. on your hills and in your valleys and in all your . i. 14 And I will lay my vengeance upon Edom by the hand of my people Israel. 6 therefore. he will keep you in exile no longer. with those who go down to the Pit. but to you also the cup shall pass. says the Lord GOD. Mount Se'ir. and blood shall pursue you. And tens of thousands shall fall. who for all their might are laid with those who are slain by the sword. and with many ships. O daughter of Zion. and I will cut off from it all who come and go. I will stretch out my hand against Edom. set your face against Mount Se'ir. Daniel 11: 40-41 "At the time of the end the king of the south shall attack him. but your iniquity. Many of the sons of Kedar will be killed in this war. This action is in the Last Days. with chariots and horsemen. says the Lord GOD. 5 Because you cherished perpetual enmity. 13 therefore thus says the Lord GOD. therefore blood shall pursue you. and I will make you a desolation and a waste. O daughter of Edom. 4 I will lay your cities waste. and he shall come into countries and shall overflow and pass through. The King of the North shall enter a number of countries and overflow the Middle East and take possession of the Middle East and Israel. The text shows that the people in charge of the South. I will prepare you for blood. 8 And I will fill your mountains with the slain. When Israel’s exile is over and she returns then Edom will be subjugated and the people’s sins will be made bare. and you shall become a desolation. and bear their shame with those who go down to the Pit. who have gone down in shame with the slain. O daughter of Edom. and all the Sido'nians. This subjugation includes the Sidonians and all the princes of the North Country. all of them. Lamentations 4:21-22 Rejoice and be glad. and you shall know that I am the LORD.As we have seen. but these shall be delivered out of his hand: Edom and Moab and the main part of the Ammonites. as I live. and prophesy against it. because you are guilty of blood. 30 "The princes of the north are there. but the king of the north shall rush upon him like a whirlwind. dweller in the land of Uz. Egypt and the Islamic system. Ezekiel 25:12-14 "Thus says the Lord GOD: Because Edom acted revengefully against the house of Judah and has grievously offended in taking vengeance upon them. and they shall do in Edom according to my anger and according to my wrath. 41 He shall come into the glorious land. her kings and all her princes. they lie with the uncircumcised. Ezekiel 32:29-30 "Edom is there. I am against you. is accomplished. and I will stretch out my hand against you. you shall become drunk and strip yourself bare. Edom had to be dealt with before Israel could find peace Ezekiel 35:1-15 The word of the LORD came to me: 2 "Son of man. and they shall know my vengeance. will push at or invade the King of the North and they will be repulsed and in turn invaded. he will uncover your sins. for all the terror which they caused by their might.

and all Edom. I will deal with you according to the anger and envy which you showed because of your hatred against them. God blesses His people by destroying their enemies Joel 3:19 "Egypt shall become a desolation and Edom a desolate wilderness. and we will take possession of them. you shall be desolate. they are given us to devour. because they have shed innocent blood in their land. `They are laid desolate. the LORD. Thus the word of God is quite clear that these nations will be dealt with and joined to Israel in the Last Days. saying. 14 Thus says the Lord GOD: For the rejoicing of the whole earth I will make you desolate. Mount Se'ir. These prophecies are the reason Hadithic Muslims attacks the veracity of the Bible texts. 12 So I will send a fire upon Teman. Then you will know that I am the LORD. before the Millennium. Then they will know that I am the LORD. and against all Edom. and the Law of the Lord God of Israel will be placed among them and they will be part of the inheritance of the Messiah as promised to their father Abraham. for the violence done to the people of Judah. have heard all the revilings which you uttered against the mountains of Israel. and rebuild it as in the days of old. that they might possess it and plunder it.  . 9 I will make you a perpetual desolation. ravines those slain with the sword shall fall. and for four. so I will deal with you. all of it. and it shall devour the strongholds of Bozrah. and cast off all pity. 12 And you shall know that I. and raise up its ruins. I heard it. 12 that they may possess the remnant of Edom and all the nations who are called by my name. and multiplied your words against me. because he pursued his brother with the sword.' 13 And you magnified yourselves against me with your mouth. who gave my land to themselves as a possession with wholehearted joy and utter contempt. says the Lord GOD. and he kept his wrath for ever." says the LORD who does this. The fact is that they are both now part of Jordan and will be combined in the Last Days. and his anger tore perpetually." Note that Bosrah is referred to as being in both Edom and in the inheritance of Lot amongst Moab. and your cities shall not be inhabited. and I will make myself known among you. Ezekiel 36:5 therefore thus says the Lord GOD: I speak in my hot jealousy against the rest of the nations. when I judge you. `These two nations and these two countries shall be mine. Edom was persistently hostile and would be punished Amos 1:11-12 Thus says the LORD: "For three transgressions of Edom.although the LORD was there – 11 therefore. 15 As you rejoiced over the inheritance of the house of Israel. because it was desolate. Israel’s future restoration Amos 9:11-12 "In that day I will raise up the booth of David that is fallen and repair its breaches. 10 "Because you said.' -. as I live. I will not revoke the punishment.

.

and gave her to Abram her husband as a wife. go in to my maid. "Behold now. 3 So. As Sarai had not been able to have children and was then over childbearing age. your maid is in your power. The King James Version at Genesis 16:3 states that Hagar was given to Abraham by Sarai to be his wife. Ishmael Background Ishmael was Abraham’s first son. and she conceived. she looked with contempt on her mistress. bore him no children. her maid. and when she saw that she had conceived. "May the wrong done to me be on you! I gave my maid to your embrace. an Egyptian who was the servant of Sarai (later named Sarah). 2 and Sar'ai said to Abram.1 20070203-20070203-20070417) Abram and Lot were a tribe. Abram's wife. 7 The angel of the LORD found her by a . Sar'ai. 4 And he went in to Hagar. Genesis 16:1-10 Now Sar'ai. the LORD has prevented me from bearing children. Descendants of Abraham Part III: Ishmael (Edition 1. do to her as you please. she looked on me with contempt. her handmaiden. They decided not to wait for Sarai to bear a child so Hagar. it may be that I shall obtain children by her. and when she saw that she had conceived. but as yet Abram had no children of his own. took Hagar the Egyptian. his mother was Hagar." Then Sar'ai dealt harshly with her. after Abram had dwelt ten years in the land of Canaan. she gave Hagar to Abraham for the purpose of giving him a child. May the LORD judge between you and me!" 6 But Abram said to Sar'ai. She had an Egyptian maid whose name was Hagar. Sarai had been given Hagar whilst in Egypt and it is alleged by Arabs that the Pharaoh gave Hagar to Sarai from the Royal household in recompense for his sin. Abram's wife. and she fled from her. was given to Abraham and he had Ishmael by Hagar. "Behold." And Abram hearkened to the voice of Sar'ai. 5 And Sar'ai said to Abram.

16 Abram was eighty-six years old when Hagar bore Ish'mael to Abram. 13 So she called the name of the LORD who spoke to her.g. Genesis 16:11-16 And the angel of the LORD said to her. 21:20). "I will so greatly multiply your descendants that they cannot be numbered for multitude. and he shall dwell over against all his kinsmen. because the LORD has given heed to your affliction. Note at this stage he is still called Abram. "Have I really seen God and remained alive after seeing him?"14 Therefore the well was called Beer-la'hai-roi. Ezra 8:31. 15 And Hagar bore Abram a son. It is important to note here that God. his hand against every man and every man's hand against him. also Isa. made a covenant at this time to greatly multiply Hagar’s descendants. see Bullinger’s note to v. This was not the only occasion where the greater blessings were given to the younger son. which was customary in those days." Yishma’el (SHD 3458) means God will hear. the Angel of the Lord appeared to him. Jer. The wild ass of a man refers to the fact of his dwelling in the wilderness of a fiercely independent spirit over against his brethren. God blessed the lad and he dwelt in the wilderness of Paran and became an archer. "Behold. Bible). The traditional explanation of this event based on the text in Galatians 3:19 was that he was born through the weakness of Sarah’s faith and thus the Law came to represent the transgression. This is even more so today and he will not be truly free until Messiah comes (cf. "Return to your mistress. whom Hagar bore. spring of water in the wilderness." 10 The angel of the LORD also said to her. it lies between Kadesh and Bered. while being the firstborn. you shall call his name Ish'mael. The name Abram (SHD 87) means high father and points to the very fact of God extending Himself to become the . God’s Promise to Abraham When Abraham was ninety-nine years old. Ishmael. "I am fleeing from my mistress Sar'ai. He was prophesied to become a wild man (or wild ass of a man) with his hand against all men. and shall bear a son. where have you come from and where are you going?" She said. through the Angel of the Lord. 12 He shall be a wild ass of a man. 15 in The Comp. and the Levitical priesthood also became the precursor to the Messiah and the Church (e. 21:13. However. 3:2. the spring on the way to Shur. "Thou art a God of seeing". Sarai was held in contempt by Hagar when she did conceive and bear a child." (RSV) Sarai did not wait for the promise of God but tried to pre-empt the birth of a male heir through her servant Hagar. was not given the same promise as given to Isaac later. Hagar took a wife from Egypt for him (Gen. and submit to her. you are with child. 10:8-9). Ps. and Abram called the name of his son. maid of Sar'ai. However. Ish'mael. for she said. 8 And he said. "Hagar. and it is at this time that he is given the promise that he would become the father of many nations and his name is changed to Abraham." 9 The angel of the LORD said to her. This promise was not simply to point to a genetic inheritance but also to the fact that through his son Isaac he would be the ancestor of the Messiah and salvation would be extended to the nations.

In the same way Sarai means my lady or my princess. but Sarah shall be her name. and kings shall come forth from you. 16 I will bless her. However. and be blameless. 6 I will make you exceedingly fruitful. 11 You shall be circumcised in the flesh of your foreskins. or bought with your money from any foreigner who is not of your offspring. Nevertheless. my covenant is with you. kings of peoples shall come from her. all the land of Canaan. and will multiply you exceedingly. 13 both he that is born in your house and he that is bought with your money.Father of many nations (or a multitude (SHD 85) as the Ha Elohim. you shall keep my covenant." Circumcision was a sign of God’s Covenant with the sons of Abraham and the elect. He would be the father of twelve princes and he would be a great nation. "As for you. "I am God Almighty. but your name shall be Abraham. for an everlasting possession. 5 No longer shall your name be Abram. God also promised that Ishmael would also be the father of many. Thus there exists a covenant with Ishmael as an extension of Isaac under the Messiah. the covenant was with Isaac." 15 And God said to Abraham. I will bless her. 14 Any uncircumcised male who is not circumcised in the flesh of his foreskin shall be cut off from his people. 10 This is my covenant. between me and you and your descendants after you: Every male among you shall be circumcised. It was in this act and promise that God revealed His Plan to the world. walk before me. which you shall keep. the land of your sojournings. and I will be their God. the prince of the Elohim. again showing the change of status and the extension of this covenant between God and His people and the extension of salvation to the Gentiles through His Church. and I will make nations of you. Just as Abram means high father and Abraham means father of a great multitude. whether born in your house. So shall my covenant be in your flesh an everlasting covenant. you and your descendants after you throughout their generations. we saw that change of name was also a change of status." 3 Then Abram fell on his face. . for I have made you the father of a multitude of nations. "As for Sar'ai your wife. Genesis 17:1-16 When Abram was ninety-nine years old the LORD appeared to Abram. and God said to him. to be God to you and to your descendants after you. and said to him. you shall not call her name Sar'ai. 4 "Behold. and to your descendants after you. and it shall be a sign of the covenant between me and you." 9 And God said to Abraham. and she shall be a mother of nations. 2 And I will make my covenant between me and you. Abraham was concerned for Ishmael and asked God that Ishmael might live in His sight. and you shall be the father of a multitude of nations. while Sarah means lady or princess and princess of the multitude. 12 He that is eight days old among you shall be circumcised. The names given to God’s servants are very important. he has broken my covenant. shall be circumcised. 8 And I will give to you. and moreover I will give you a son by her. 7 And I will establish my covenant between me and you and your descendants after you throughout their generations for an everlasting covenant. every male throughout your generations.

in the field of Ephron the son of Zohar the Hittite. and he circumcised the flesh of their foreskins that very day. God went up from Abraham. The story of Isaac and that of the sons of Keturah are dealt with in paper Numbers 212E. 1Chronicles 5:10-20 deals with wars against the Hagarites during the time of Saul. bear a child?" 18 And Abraham said to God. behold. 26 That very day Abraham and his son Ish'mael were circumcised. who was the sister of Neba'ioth. Abraham was buried by his two elder sons. he shall be the father of twelve princes. The descendants of Isaac went to war against the descendants of Hagar. We know little from the Bible apart from the basic details of the birth of Ishmael. and you shall call his name Isaac. as God had said to him. a slave to Sarai. with Sarah his wife. a hundred and seventy-five years. These descendants were known as Hagrites. east of Mamre. and said to himself. however his descendants are listed at Genesis 25:12-18." 22 When he had finished talking with him. Hagarites or Hagarenes. and 212C respectively. 27 and all the men of his house. Bas'emath later married Esau (Gen. 25 And Ish'mael his son was thirteen years old when he was circumcised in the flesh of his foreskin. Genesis 17:17-27 Then Abraham fell on his face and laughed. "No. "Shall a child be born to a man who is a hundred years old? Shall Sarah. 9 Isaac and Ish'mael his sons buried him in the cave of Mach- pe'lah. I have heard you. 23 Then Abraham took Ish'mael his son and all the slaves born in his house or bought with his money. 8 Abraham breathed his last and died in a good old age. The meaning of her name is a stranger. whom Sarah shall bear to you at this season next year. were circumcised with him. I will establish my covenant with him as an everlasting covenant for his descendants after him. 24 Abraham was ninety-nine years old when he was circumcised in the flesh of his foreskin. She was an Egyptian. one that fears. 36:2-3). Bas'emath. Genesis 25:7-10 These are the days of the years of Abraham's life. . There Abraham was buried. every male among the men of Abraham's house. Hagar We will deal firstly with Hagar. 21 But I will establish my covenant with Isaac. and was gathered to his people. "O that Ish'mael might live in thy sight!" 19 God said. who is ninety years old. I will bless him and make him fruitful and multiply him exceedingly. 212F. and I will make him a great nation. an old man and full of years. 10 the field which Abraham purchased from the Hittites. but Sarah your wife shall bear you a son. He also had a daughter. The Bible does not give a great deal of information regarding Ishmael. He lived to 137 years of age and indeed had 12 sons as was prophesied. He was 175 years old. a concubine of Abram and the mother of Ishmael. those born in the house and those bought with money from a foreigner. At the end of his life. 20 As for Ish'mael. which is indicative of a continuing relationship between him and the brothers.

1952. von Wissmann proposed that the term Hagar could be used to describe a walled city with towers and bastions. they do not belong to the Ishmaelites. Philistia with the inhabitants of Tyre. 18-22.net has an article on the subject of Hagar. and though Arabians. The Hagarites have been identified with the Agraioi mentioned by Strabo (xvi.S. Muller held the view that a city of the people of Hagar would have been written as han-Hagar in Aramaic and possibly Hagara.6 the tents of Edom and the Ish'maelites. 7 Gebal and Ammon and Am'alek. There are thus two groups. p. This appears to indicate that Hagar went on to have other children later who became a ‘people’ or nation in their own right. It is also noted that H. v. The Historians’ History of the World makes the Hagarites an Ishmaelite clan but mythologises their ancestry along with that of Ishmael in the first reference. Emil G. against thee they make a covenant -. Here Ishmael and the Hagrites are denoted separately. however. which is in the hills near Amman Jordan. 2). Psalm 83:5-8 Yea. Nabataea. 66. 111).F. It is generally assumed that the Ishmaelites became the Arabs of the Middle East. states: There are in various passages in Chronicles. The Poems and Poetical Fragments. 8 Assyria also has joined them. mentions in a poem the “nomads of Gerrha and those who plough their fields by the Euphrates” (A. Gotthard Deutsch Executive Committee of the Editorial Board. Using these theories archaeologists have speculated that the east Arabian Kingdom of the Gerrhaeans can be attributed to the descendants of Hagar. History tells us much more of the people known as Gerrhaeans in the Greek world.Psalm 83:6 indicates that the Ishmaelites and the Hagarites were two separate peoples. but seems to treat it as genuine in the second regarding Ezra (ibid.129).com.W. they are the strong arm of the children of Lot.F. It notes that W. pp. 38. Moab and the Hagrites. Nicander. 2. but later moved to present day Iraq. in its article on Hagar (by Solomon Schechter. Hirsch Hartwig Hirschfeld). one being the nomads of Gerrha and the other a sedentary farming community on the Euphrates nearby. references to the tribe of Hagarites. Nicander of Colophon. . Thus it is argued that when this name is Hellenised it would have become Gerrha. Vol. 31). Scholfield. [Selah] The online Jewish Encylopedia at JewishEncyclopedia. Cambridge. The Hagarites lived east of Gilead. writing in the third century BCE. who were neighbors of the transJordanic tribes of Israel and were driven from their homes by them (I Chron. 4. Gow and A. 10. xi. they conspire with one accord.. xxvii.

(KJV) This might be read two ways but the text in Psalm 83:6-8 says plainly: The temples of Edom. The biblical account tells us in 1Chronicles 5 that: 1Chronicles 5:19-22 And they made war with the Hagarites. art. with Jetur. However. 19- 20. many historians have put forward theories about them. 511). and of asses. of their camels fifty thousand. they were conquered by Reuben and Trans-Jordanian Israel. ‘Hagrite’. Jeremiah 49:7. Movers. art.There is little mention of them in either Assyrian or Chaldean records. Ptolemy and Pliny” (ibid. 2. Under Saul. in keeping with the tradition of the East. Obadiah 8 (ibid. Schnell notes that the Sons of Hagar or ‘Agarenes (KJV) are mentioned in connection with Teman in Baruch 3:23. C. F. and of sheep two hundred and fifty thousand. 5:19) (The Interpreter’s Dictionary of the Bible. Movers suggested that it might have been Nebuchadnezzar who exiled the nomadic Gerrhaeans as part of a policy to protect his country from menacing Arab tribes (F. R. Das phonizische Alterthum. for they cried to God in the battle. and of men a hundred thousand. . Vol. Moab and the Hagarenes. and he was entreated by them because they put their trust in him. Berlin 1856. Ammon. and Naphish and Nodab. 308). and the Hagarites were delivered into their hand. mentioned also in 1Kings 4:30-5:10. pp. 21 And they took away their cattle. two thousand. That may have forced their move north towards the Euphrates after the conquests of David. iii. And they dwelt in their stead until the captivity. Newman says that whether there is a connection between the Hagrites of 1Chronicles 5:10. ‘Hagar’. 25:15) are Hagrites (1Chr. but the text is not considered significant and. because the war was of God. Gebal. Importantly. 20 And they were helped against them. and all who were with them. p. Amalek. the Ishmaelites. Psalm 83:6-H83:7 is not certain but seems likely since two of the sons of Ishmael (Gen. 22 For there fell down many slain.). the Philistines with the inhabitants of Tyre. Schnell in his article on the Hagrites also says the link is not certain but considers that they are likely the “Agraioi referred to by the Greek geographers Strabo. who extended their boundaries to the desert and occupied their lands. Assyria also is joined with them. 508-9). they have the children of Lot Thus we must assume that at least by the time of David the Ishmaelites and the Hagarites had split into a minimum of two identifiable groups.

S. who says "the Arabs paid 1. 18896)." 135 Strabo 16. Petra and Palestine where the Gerrhaeans and Minaeans and all the Arabs who live in the region bring incense from the highlands. Gerrha. iii: Pre-Mohammedan Settlements". Because Gerrha is not mentioned by Herodotus. The Early Commerce of Babylon". 1878.25 AD) and Pliny (AD 77)(NH 12." . 'Ancient Trading Centres of the Persian Gulf.It was obvious at the time of Baruch that the sons of Hagar were considered to be associated with Teman.131 BC) tells us ".. H. Stiffe. Lehrbuch der alten Geographie' Berlin. 1926. 1271) or else at some point in the Achaemenid era. it is said. 10. Intercourse between India and the Western World from the Earliest Times to the Fall of Rome. Kiepert..3 records: "The Gerrhaeans import most of their cargo on rafts to Babylonia and thence sail up the Euphrates with them. O." and "The Gerrhaeans traffic by land for the most part. however. 5 believed that the Chaldaeans left Babylon after Darius I re-conquered the city in 488 BC. G. Geschichte und Morphologie.H. p. Cf Shiwek.. GJ9 (1897). Amer proposed an even later foundation in 'The Ancient Trans-Peninsular Routes of Arabia. The expulsion of the Gerrha nomads Rawlinson dates the expulsion of the Nomads of Gerrha to the Neo-Assyrian period after Sennacharib had exterminated the Chaldeans in 694 BCE and suggests he expelled a number of people (including the nomadic Gerrha) and relocated the Chaldeans there (Rawlinson.80) records: "For this trade (with Elymais and Marmania) they opened the city of Carra (Gerrha) where their market was held.19 tells us that "from their trafficking both the Sabaeans and the Gerrhaeans have become richest of all (the Arabians). 328. A. 311. In an article titled The Twelve Lost Tribes of Ishmael we read the comments and then the quotations from the ancient writers we see as follows: “Most writers. Kennedy. Tkac. Heeren. 'Der Persische Golf'. 188. in the Arabian merchandise and aromatics. A manual of Ancient History.000 talents of incense yearly to the kings of Persia. Inauguraldiss. they began later for the same reason to go to the empire of the Parthians. Genthe. For they all used to set out on the twenty-day march to Babba and Syria-Palestine.4.W. It seems to me that still earlier they brought their goods to the Persians rather than to Syria and Egypt. (Marburg." Juba (25 BC . Der Persische Meerbusen. (e.g. According to Juba's report. Blau 'Altarabische Sprachstudien: 2 Theil' ZDMG 27 (1873). M." which Herodotus confirms.." Agatharchides (200 . 64) who suggested that the expulsion of the Chaldaeans took place during the reign of Xerxes following the brutal repression of the revolt in Babylon of Megabyzus in 482 BC.6). 271 and n. and their aromatic products. A. and then convey them by land to all parts of the country. have favored a date either in line with the fall of the Chaldaean supremacy a the hands of Achaemenids (eg. Cambridge. " Strabo 16.3. L.40. H.. (Oxford 1833).

htm#anchor78633 Location of the later Gerrha D. in his two-volume series entitled The Arabian Gulf in Antiquity (Volume II. Perhaps the advances in DNA will tell us the definite solution once the tribes are properly identified and tested. Hagar’s first-born or only son. may have gladly done this in a derogatory sense. Strabo said that that Gerrha was located two hundred stadia distant from the sea. The question as to whether the Hagarites are the descendants of Ishmael. Clarendon Press. Writing in the third century BCE. The Jews. (cf. It is Potts suggestion that there was both a city of Gerrha and also a port of Gerrha and that they were located some twenty miles apart. it is doubtful that a tribe would call itself after a female descendant. lumping together Ishmael's children and any other children that Hagar may have had. The Mystery The question as to whether Hagar remarried and had other children is considered by some to be a matter of conjecture. They were nomadic but they also kept a reasonably comprehensive genetic record. and 2.balaams-ass.” . Nicander of Colophon mentions the nomads of Gerrha. suggests that Gerrha would have been located in the region of the modern port of al- Jubayl in eastern Saudi Arabia. We are going to attempt to identify the Twelve Tribes of Ishmael and their previous and current locations. 1990) using Strabo’s description.net assume that the Hagarites and subsequently the Gerrhaeans (their Greek name) refer to the twelve tribes that came from Ishmael.com/alhaj/twelvetribesofishmael. From Alexander the Great to the Coming of Islam. Potts. Oxford. or the sons of another tribe altogether is still to be solved. http://www. however. They consider it to be very probable that the Jews simply referred to them as the descendants of Hagar. and subsequently from Hagar. They expanded and later the name Gerrha was applied to the entire eastern coast of Arabia. Some students such as those at Nabataea.400 stadia from Teredon (which would have been located near modern-day Basra).T. The biblical record places the Hagarites in the desert east of Palestine and towards Babylon. and places them along the shores of the Euphrates River. They say: “In the male dominated culture of the Middle East.

Adbeel." 31 So. so it is now. do you not hear the law? 22 For it is written that Abraham had two sons. we are not children of the slave but of the free woman. being a free woman. which is opposite Egypt in the direction of Assyria. Dumah. and she is our mother. Galatians 4:21-31 Tell me. These are the sons of Ish'mael. Abraham's son. 30 But what does the scripture say? "Cast out the slave and her son. We will now examine those tribes. Dumah. break forth and shout. One is from Mount Sinai. she is Hagar. you who desire to be under law. one by a slave and one by a free woman. and Ked'emah. and Ked'emah. Sarah's maid. Naphish. Tema. he settled over against all his people. 13 These are the names of the sons of Ish'mael. 17 (These are the years of the life of Ish'mael. for she is in slavery with her children. 27 For it is written. Neba'ioth." 28 Now we. she corresponds to the present Jerusalem. 23 But the son of the slave was born according to the flesh. a hundred and thirty-seven years. by their villages and by their encampments. 1Chronicles 1:29-31 These are their genealogies: the first-born of Ish'mael. Chronicles also lists the sons of Ishmael. and Kedar. 31 Jetur. and was gathered to his kindred. Tema. whom Hagar the Egyptian. the son of the free woman through promise.Paul in Galatians 4:21-31 says that Hagar as a slave represents the Old Covenant while Sarah. brethren. for the son of the slave shall not inherit with the son of the free woman. 15 Hadad. 26 But the Jerusalem above is free. for the children of the desolate one are many more than the children of her that is married. . twelve princes according to their tribes. Adbeel. Massa. brethren. Naphish. The entire covenant was established with Abraham to point towards Christ and ultimately would rest in the Church. The Sons of Ishmael The sons of Ishmael became the Arab Bedouin also. Paul uses the analogy of the conflict between Ishmael and Isaac to illustrate the fact that the Church is to Judah what Judah considered itself to be towards Ishmael. Mibsam.) 18 They dwelt from Hav'ilah to Shur. Mibsam. he breathed his last and died. like Isaac. 29 But as at that time he who was born according to the flesh persecuted him who was born according to the Spirit. you who are not in travail. Jetur. 16 These are the sons of Ish'mael and these are their names. 30 Mishma. 24 Now this is an allegory: these women are two covenants. bearing children for slavery. the first-born of Ish'mael. 14 Mishma. The comparison by Paul is aimed directly at Judah. Genesis 25:12-18 These are the descendants of Ish'mael. It claims Jerusalem as its centre and relies on the physical aspects of its descent from Isaac and the promise of salvation as a physical one. and Kedar. bore to Abraham. Hadad. 25 Now Hagar is Mount Sinai in Arabia. and the sons of Lot and Esau but to all the nations of the world as part of the Israel of God in Christ. represents the New Covenant. which was open to the Gentiles and not just to Ishmael. and we now have many tribes named that consider themselves distinct from the Bedouin. named in the order of their birth: Neba'ioth. "Rejoice. are children of promise. Massa. O barren one who does not bear.

While Josephus and other scholars have previously identified Nebaioth with the Nabataeans. However. The Jewish Encyclopaedia also discards this theory. rebelled against Sennacharib. Book 1. Josephus notes this in Antiquities of the Jews. All the flocks of Kedar shall be gathered to you.As noted above.” He was the head of the tribe named after him. . Neba'ioth Nebaioth. both because of their own virtue. This verse shows the two tribes of the sons of Ishmael that will be converted and they will offer sacrifice to God in Jerusalem as part of the millennial Restoration. “These inhabited all the country from the Euphrates to the Red Sea. and they name their tribes from these. These tribes were not conquered and they were recorded as fleeing from Assyria into the Arabian Desert. and I will glorify my glorious house. Among the rebels. the records of Tiglath- pileser III lists the Nabatu (possible descendants of Nebayoth. a group of Chaldeans. in 703 BCE. and his brothers settled in Arabia. From Assyrian records we learn that King Ashurbanipal (668-662 BCE) fought with the Nabataeans. the Assyrian ruler. Ishmael’s eldest son) and the Kedarites (descendants of Ishmael’s second son). or Nabajoth. Then in 652 BCE when conflict broke out between the two brothers. and fled to the leader of the Nabayat for safety. they shall come up with acceptance on my altar. 60:7).4. but she was also called Basemath. the rams of Nebai'oth shall minister to you. They were defeated. The “rams of Nebai’oth ministering to you” is an allusion to the function of the first-born of Ishmael as part of the priesthood under the Messiah. the International Standard Bible Encyclopedia (ISBE) says that the fact of a spelling difference makes this theory unacceptable. When the Kedarites and the Nabayat later attacked the western borders of Assyria they were defeated. He and his brother Kedar were renowned for sheep rearing in the time of Isaiah (Isa. and because of the dignity of Abraham their father. Chapter 12. and called it Nabatene. including some neighbouring tribes. the Kedarites supported the Babylonian king in an invasion of western Assyria. As might be expected the Assyrian kingdom was eventually divided as the two brothers began to rule – one as King of Babylonia and the other King of Assyria. They are an Arabian Nation. Ishmael also had a daughter whose name was Mahalath.

574ff. made use of Aramaic which was the civilised language of the time for literary purposes. was also utilised as a royal city. and T. Jauf.Some three hundred years later the Zenon papyri. Barton states that while it was initially thought that the Nabatæans were the same people as the Nebajoth of Genesis 25:13. T. In time the Nabatu began to occupy the vacant land left by the Edomites and eventually make it the centre of the Nabataean Empire. Schurer considers their identification with the .) says that so little is known of the Nabateans that not even their ethnic origin is certain. and Tayma. pp. it appears that the Nabataeans were of Arabian background but possibly they were Arabs under Arabian influence. Clark Edinburgh. which date from 259 BCE. Yet. Schurer. From this evidence it has therefore been concluded that they were Arabs who.. in The History of the Jewish People in the Age of Jesus Christ. they were repeatedly spoken of as Arabs by ancient writers. However. the Jewish Encyclopedia in its article by George A Barton on the Nabataeans states that they are not identical with Nebayoth. transporting it to Gaza and Syria through the Kedarite centres of northern Arabia. So also the Arabian tribes began to move northward. However. mention that the Nabatu were trading Gerrhean and Minaean frankincense. 1987. in Syria. on the other hand. While the city of Petra was the original capital. not only by those remote from them in time but also by Josephus who is expected to know full well the difference between the two. et al. (ed. Their language on inscriptions and coins was without exception Aramaic. Historical records clearly state that in 586 BCE the Edomites began to move north into the Jewish lands that Nebuchadnezzar had emptied. Vermes. which indicates they were Aramaeans. and also with the Naba-a-a-ti of the annals of Assurbanipal. Bostra. in 106 CE the Nabataeans seceded their empire to the Romans and over time they lost their individuality. it is now considered that they should be identified with the Kadmonites of Genesis 15:19. Other cities were also built in the Negev. Appendix II. As inscriptions have been found written in Aramaic. in northern Saudi Arabia today. because Arabic was not yet developed into a written language. the Nabataeans went on to build an impressive civilization. and in parts of modern Jordan. Based on merchant trade.

). 5:25. They were at that time settled where the Edomites lived between the Dead Sea and the Gulf of Aqaba. c. in the region of Petra which Schurer says is probably not identical with the old Sela of the Edomites (ibid. Antigonus then sent his son Demetrius to subdue them but without success. The first known dynasty of these people was Aretas who was described as Tyrannos or tyrant. and Isaiah 60:7 as an Arab tribe as very improbable. 2-50 CE. According to Diodorus who wrote the account. his army was virtually annihilated in a night assault by the Nabataeans (ibid. Aretas III. Obodas II. They developed a coinage in the 2 nd century BCE bearing the names of the following rulers: Malchus I. Malchus III. 110-100 BCE. he sent his general Athenaeus against the Nabataeans with 4000 infantry and 600 cavalry and attacked their fortress at Petra by surprise. There they erected a temple to their native deity.. due to his own carelessness. Obodas I. and Rabel. Other trade routes were also available to them and a colony was established at the Italian port of Puteoli. c. Their power reached as far as east of the Jordan. they were primitive pastoral nomads who had not developed a kingship. Thus he discounts them as being sons of Ishmael. 70-95. (Obodath Melek Nabatu). (Obodath). they reached their greatest power under Erotimus (Aretas II?) ca. After Antigonus had driven Ptolemy Lagus from Coele-Syria in 312 BCE. Aretas IV. (Haretath Melek Nabatu). They are not Edomites of the sons of Esau. The High Priest Jason sought refuge with him in 168 BCE (2Mac. Antiochus XII fell in the battle at Cana. c. It is possible that they are both. 576). It is only from the beginning of the Hellenistic period that a coherent picture of them emerges.Nebayoth of Genesis 25:13. 36:3. (Maliku). but if Schurer is to be followed they are not Ishmaelites but are Arabs of the sons of Keturah. They traded from Egypt and Gaza through Petra to central Arabia and as far as Babylonia. 97-85. p. 50-70. 85-62. 5:8). . 145 BCE. 9:35). However. In the end of the second century BCE when the Ptolemaic and Seleucid empires collapsed. (Haretath). The Palestinians and Syrians were defeated a number of times by the Arabs seemingly under the king of the Nabataeans from 93 BCE (Alexander Jannaeus) to 87 BCE (Antiochus XII) perhaps both times under Obodat or Obodas I. They were friendly with the Jewish party in the Maccabean revolt in 164 and 160 BCE (see 1Mac. 1Chronicles 1:29. Thus we have a fair idea of the strength and power and we know their location. 28:9.

they were able to maintain a line of fortresses linking their southern dominions with the region around Damascus. l. 2. . cf. over which they still held a protectorate. 5. 18:20). However. and the camel-riding Midianite Kings (Jdg. 4:30-31 (H5:10 see Interpreter’s Dictionary of the Bible. It was during this same rule that Paul escaped from Damascus (2Cor. In the time of Augustus the Nabatæan kingdom became dependent on Rome. p.. 8:10-12. If the Nabataeans were indeed the Kadmonites of Genesis 15:19 then we are dealing with the Qedem.” It was to the land of Qedem that Abraham sent the sons of Keturah and that was believed to have been in the Syrian Desert. the Kenites and the Kenizzites were given to the descendants of Abraham and thus they were absorbed into the sons of Keturah. 9) (see also the paper War with Rome and the Fall of the Temple (No. Vol. 298)). 21. Jews. xvii. in other words Nabataean Arabia was made a Roman province by Cornelius Palma. 14:3ff. 10. east of Byblos. Most of the extant dated Nabatæan inscriptions come from Aretas IV. The sons of Qedem are identified as “the people of the east” which was to include Job a son of Issachar of Israel (Job 1:3. kings of this period and interestingly it was Aretas’ (Haretath) daughter who was divorced by Herod Antipas in favour of Herodias (Josephus. Arabia belonging to Petra. 11:32). under the Romans. governor of Syria on the orders of Trajan (ibid. Mat. xviii.. 585). Malchus III. so Schurer records. formed part of the province of Arabia.Aramaic inscriptions show that the Nabataeans controlled the area from the Arnon to Damascus early in the First Century and later lost the Hauran and Peræa to Herod. The Messiah will always come from the east and hence the orientation of the Hebrews was to the east as being to the “front.).c. art. 1. The Nabatæan kingdom ended under Trajan with the nearer portions of it brought into the Roman province of Arabia. 25:6 RSV). and Rabel. 3. of the land of Qedem which is the east country (Gen. 26) and the wise men who bore names of Arabian association (1Kgs. p. ‘Kadmonites’). Ant. We can thus assume that if the Nabataeans were not originally Arab but Aramaic (sons of Aram) the region and its people were subsequently absorbed into and. The lands of the Kadmonites. In 106 CE. The Nabatæans provided assistance to the army of Titus during the siege of Jerusalem (Josephus. as did the Judean kingdom.

They were originally living in Canaan. 6). ibid. 4:11.). whilst he was living in Gath of the Philistines. At that time they had become associated with the Amalekites and Saul warned them to separate if they wished to avoid destruction. are not held in the same respect as these Kenites were from as early as 1300 BCE. LXX) among whom are those named as residing in the cities of the Kenites (1Sam. Jdg. 15:19). However. The Arabic Sleib. The reference in Numbers 24:21 says they are “set in the rock” which places them at the time of Balaam in the Wadi Arabah. The Kenites to the east became absorbed into the Arabs. There is a significant E3b YDNA composition among Jews. the postulated relationship between the Kenites and the Arab tribe of the Banu’l-Qayn living in the region between Teima and Hauran in the sixth century CE just before the time of the Prophet cannot be demonstrated (ibid. 1:16). p. In the period of the Judges a nomadic branch of the Kenites under Heber inhabited Galilee (Jdg. 1:16).The Kenites were a tribe of semi-nomadic smiths or metalworkers and occupied the rock country south of Tell Arad on the western slopes of the mineral rich Wadi Arabah above Tamar (Num. Dict.. who are nomadic metalworkers. which probably came from the Canaanites. plundered clans living in the Negeb of the Kenites (1Sam. 27:10) and then David sent spoil to the elders of Judah and to his kinsmen (cf. p. tracing their ancestry from Hammath father of the house of Rechab. which land was promised to Abraham and his descendants (Gen. as the term is also applied on occasion to Jethro. The Interpreter’s Dictionary considers that they may have been living among the Midianites and taught them metal work and it is thought that Moses learned metal work while among the Kenites and Midianites. 30:29). 1Chronicles 2:55 describes as Kenite certain families of scribes who dwelt in Jabez in southern Judah. . 5:24) (Int. 24:21.. 7). Jdg. Moses’ father-in-law. In Judges 4:11 the Kenites are designated as descendants of Hobab (cf. Shortly after this the Kenites entered Palestine as part of Israel in the tribe of Judah and this relationship seems to be reaffirmed in 1Samuel 15:6 where the Kenites were described as showing loyalty to Israel in the Exodus.. (ibid. The last mention of the Kenites in the Bible is when David.

15:52-54). Jdg. but may actually derive from none of them but rather from early Canaan and have association with Aram and hence Aramaic as well as with the Arabs and Jews. Kedar. which were well known in the ancient world. The name also applies to the sons of Eliphaz. The Arab genealogists say there are 40 generations from Kedar to ‘Adnan and his son Ma’ad from whom ‘Adnanian Arabs trace their ancestry. He is quoted as saying. who must have occupied the southernmost hill country of Judah. 1:11-15). which actually is a term applied to sons of Shem both from Aram and Arphaxad (see also Descendants of Abraham Part IV: Sons of Keturah (No. The Babylonians.The Kenizzites mentioned are a composite group that were present in Canaan when their lands were promised to be given to the descendants of Abraham. Thus the Prophet was not a “Pure” or al-‘Ariba Arab. 14:6-14. 212D)). The name Kedar was rendered by the Hebrews as Qedar and by the Assyrians as Qidri. Kedar also lived at Mecca (Makkah). Rahmat-ul-lil’alameen 2/7-17). the final part of which was the destruction of Jerusalem and Judah. The Hadith says that the Prophet only traced his ancestry back to ‘Adnan and stopped there as he held the uncertainty of the genealogy from that date. Thus the southern group associated with the Nabataeans that has later Arab association is also associated with Edom and Judah. They were associated with the Edomites and the Kenites. The Kenizzites are a non-Israelite composite group that moved into the Negeb from the southeast before the main body of the conquest. “Genealogists tell lies” (cf. are placed within the restoration amongst the flock. The first-born plays a lead roll in the ministry but also the sons of the second- born. Prophecies in Isaiah and Jeremiah indicate wars and defeat but that in the end times they will be restored and placed within Israel as part of the Messianic Kingdom. Jeremiah foretold the battle in Jeremiah 49:28-29. The second group were the Othnielites who occupied Debir (modern Tell Beit Mirsim?) (Jos. In these records Kedar and Nebai’oth are in close association. fought a battle against them in 599 BCE. The third possible group may have been the Jerahmeelites. first-born of Esau. 15:15-19. which is the Church of God. They were composed of the clans of the Calebites who occupied Hebron (modern El Khalil) (Jos. Kedar (blackness. This was part of the subjugation of the southern Semites. and are dealt with in that section. The tribe of Kedar had a long history of conflict with the sons of Asshur and they are mentioned in the Assyrian records of Ashurbanipal and in those of various other Assyrian kings with whom they were in conflict. They were a nomadic people trading particularly in sheep and goats and living in tents. . They dwelt in black tents. under Nebuchadnezzar. The Arabs refer to them as Qidar They became a powerful tribe of Arabs in the northwest Arabian Peninsula. sorrow) There are a few allusions to Kedar in the Bible.

Thus the wars with the Assyrians and the expansion of the Spartans into Laconia were all before ’Adnan and the wars were fought by the sons of Kedar and Nabai’oth. Mudar The last two formed a variety of septs.The Prophet was an Arabicised Arab or al-Musta’ribah of the sons of Ishmael. Rabi’a’s son. The term al-Musta’ribah is also used for non-Ishmaelites or the Mixed Arabs of both groups The forty generations of Kedar between him and ‘Adanad are no doubt also dispersed into a great people and later absorbed into other tribes. From Qais ‘Ailan came: . Eyad 2. Altamimi. Anazah. had two sons Bakr and Taghlib. Bani Khaled. The Mudar tribes formed into two great divisions: 1. The time-frame of forty generations is 1600 years. The expansion occurred from ‘Adnan at Mecca. Rabi’a fathered Asad. Bani hashim etc. Hanifa and others. being some time in the end of the period of Judges and the fall of Troy. ‘Abdul. Some famous noble ‘Ananaite families from the Quriesh group are Alnazi. Bani Kolab. Qais. These were: 1. Ma’ad son of ‘Adnan had only one son. and these tribes were subjugated by David as were those of Meshech and the Syrians before what became Sparta was conquered. If thirty years are allowed we are at the period after the fall of Israel and at about the time of the Babylonian Captivity. The expansion of the Edomites occurred after the fall of Israel and Judah. Rabi’a 4. Anmar 3. Nizar. If we only allow twenty years per generation it is still 800 years until ‘Adnan. Nizar had four sons who branched out to form four great tribes. Wa’il. The septs of Elias bin Mudar. Almaleek. The septs from Qais ‘Ailan bin Mudar 2.

called Muhammed. ‘Abs. the banu Asad bin Khuzaimah and the septs of the Kinana bin Khuzaimah. Hashim It is from the family of Hashim that the man Abu Qasim. from whom descended. . the descendants of Fahr bin Malik. and the Banu Ghatafan. Zubyan. Nawfal 3. The children of ‘Adnan spread out over Arabia.witnesss-pioneer. the Prophet of Arabia. From Elias came: Tamim bin Murra. The line is Ishmael to Kinana to Quraish. ‘Abdud-Dar bin Qusai. the most notable being Jumah. Tayim. Muttalib 4. to Hashim to Qasim known as Muhammed (cf. a compilation of traditions and false interpretation that was later used to establish the religion of Islam. bin An- Nadr bin Kinana. Muslim 2/245. and three septs of the Qusai bin Kilab. (cf.The Banu Saleem. bin ‘Abdul-Muttalib bin Hashim. is descended. also www. was converted to the Christian faith. Asad bin ‘Abdul ‘Uzza bin Qusai and ‘Abd Manaf bin Qusai. His followers later corrupted the faith with what became known as the Hadith. Makhzum. Sahm. ‘Abd Manaf branched out into four tribes: 1.html) Thus Kedar’s most well-known contribution was when one of the descendants of Kedar. ‘Abd Shams 2. From them came also the tribe of ‘Abdul Qais with the septs of Bakr bin Wa’il and Tamim who emigrated to Bahrain.org/vil/Books/SM_tsn/ch1s1. Hudhail bin Mudrika. from whom came the famous Quraish. Abu Qasim. The Quraish branched out into various tribes. being Qasim bin ‘Abdullah. ‘Adi. Ashja’ and Gani bin A’sur. Zahra. the Banu Hawazin. Tirmidhi 2/201).

to the sea’s shore and to the outer borders of Iraq. The Banu Asad lived on the east of Taim and west of Kufa with the Banu Tai’ living between them and Taim. Ablah and Hait. The importance of the Qureish was increased significantly and many of the sons of Kedar trace their origins through his family. Zubyan lived on the lands between Taim and Hawran. For the movement of the sons of Keturah into Mecca and Medina under the Roman occupation of Arabia see the paper Descendants of Abraham Part IV: Sons of Keturah (No. Thus all the tribes of Bakr bin Wa’ol lived in the area of land which included Yamama.The Banu Hanifa bin Sa’b bin Ali bin Bakr settled in Hijr the capital of Yamama. Mudadrat Tareekh Al-Umam Al-Islamiyah 1/15-16). Bahrain. Saif Kazima. 212D). . which recognised their status and importance as a tribe. some five days walk from Kufa. The Taqif lived in Ta’if and Hwazin east of Mecca near Autas on the Mecca-Basra road. by Qusai bin Kilab who rallied their ranks thus making them a force (cf. Whilst some septs of Kinana lived in Tihama. Most of the tribe of Tahglib lived in the Euphrates area and some of them lived with the Bakr. The Banu Tamim lived in the Basra semi-desert. the septs of Quraish lived in Mecca and were disunited completely. The Banu Saleem lived in the vicinity of Madinah (Medinah) between Wadi Al-Qura to Khaibar to the eastern mountains of Harrah. The Quraish were finally united on honourable terms.

dwell in the depths. Thus says the LORD: "Rise up. 32 Their camels shall become booty. says the LORD. Jeremiah 49:28-39 Concerning Kedar and the kingdoms of Hazor which Nebuchadrez'zar king of Babylon smote. no man shall sojourn in her. Prophecy under the Babylonians Jeremiah speaks of Kedar under the Babylonians. their curtains and all their goods. 33 Hazor shall become a haunt of jackals. no man shall dwell there. The Rabi’a are centred around the Kut city area. the mainstay of their might. For Nebuchadrez'zar king of Babylon has made a plan against you. O inhabitants of Hazor! says the LORD. that has no gates or bars. being the Barakat and the al-Naqib. 31 "Rise up. The Bani (Banu) Tamim are in central and southern Iraq with  Al-Suhail clan as the tribal leaders near Abu Ghuraib  Al-Turshan section centred in the Diyala governorate  Al-Kan’an section in the Basra governorate and across the borders in Iran in Kuzestan Province. an everlasting waste. their herds of cattle a spoil. The Bani Ka’b Federation are also in Basra and in the Kurdestan Province in Iran. says the LORD. The full list of the septs or tribes of the family of the Prophet in Iraq are given at Annex A. wander far away. I will break the bow of Elam." 34 The word of the LORD that came to Jeremiah the prophet concerning Elam. in the beginning of the reign of Zedeki'ah king of Judah. 36 and I will bring upon Elam the four winds from the four . There are seventy-two septs or sub-tribes claiming descent from the Prophet in Iraq alone. that dwells securely. There are altogether 150 tribes in Iraq. advance against a nation at ease. However there are many of the sons of Ishmael through Kedar in Iraq. 35 Thus says the LORD of hosts: "Behold. that dwells alone. advance against Kedar! Destroy the people of the east! 29 Their tents and their flocks shall be taken. and I will bring their calamity from every side of them. thirty of which are the most important.For example: there are two families descended from the Prophet in Basra. and men shall cry to them: `Terror on every side!' 30 Flee. Most of these tribes or clans regard loyalty to their clan as being more important than any national loyalty. I will scatter to every wind those who cut the corners of their hair. The Arab Federations and their locations in Iraq are in Appendix A. their camels shall be borne away from them. and formed a purpose against you.

obeying) Again." These wars will come to an end and the Messiah will establish the men of Kedar and use those of the first-born Nebai’oth to convert all of the Arabs and the sons of the Middle East. in relation to the . until I have consumed them. "Within a year. 14 To the thirsty bring water. according to the years of a hireling. all the glory of Kedar will come to an end. the God of Israel. from the drawn sword. p. has spoken. or cloud of God. These Idiba’ileans are the Idibi’ilu of Arubu. They are mentioned in Genesis 25:13 and 1Chronicles 1:20. Isaiah 21:14-17 The oracle concerning Arabia. I will bring evil upon them. and destroy their king and princes.. for the LORD. 1. says the LORD. from the bent bow. O caravans of De'danites. says the LORD. S. would be defeated. Cohen says they were identical with the Idiba’ileans that were conquered by Tiglath-pileser III (some attribute as II) and then appointed as guards on the Egyptian frontier (Interp. who were mighty men and skilled archers. Isaiah states that the nation of Kedar. and they will be brought to peace and ruled from Jerusalem. also servant of God). Dict. 16 For thus the Lord said to me. Adbeel (vapour. and before those who seek their life. and goats. 38 and I will set my throne in Elam. there is little information about these two tribes. 39 "But in the latter days I will restore the fortunes of Elam. Ezekiel 27:21 Arabia and all the princes of Kedar were your favored dealers in lambs. says the LORD. O inhabitants of the land of Tema. in these they trafficked with you. 45). quarters of heaven. and from the press of battle." Ezekiel 27 deals with the lamentation of Tyre. 15 For they have fled from the swords. and there shall be no nation to which those driven out of Elam shall not come. The International Standard Bible Encyclopedia says that as these two names are also noted in 1Chronicles 4:25ff. meet the fugitive with bread. rams. 17 and the remainder of the archers of the mighty men of the sons of Kedar will be few. Mibsam (smelling sweet) and Mishma (hearing. Some authorities attempt to locate the tribe in the Sinai because they dwelt in the west. Vol. 37 I will terrify Elam before their enemies. Tyre was a great trading centre and Kedar was a favoured resource for trade in sheep and goats. my fierce anger. This tribe was located in the northwest of Arabia close to Kedar and Nebaioth. I will send the sword after them. and I will scatter them to all those winds. In the thickets in Arabia you will lodge.

Seir while the northern section of Dumah lived in the area in Mesopotamia to the north. 369). The name of Dumah is still preserved in the modern Arab city of Dumat-al-Jandal. Thus we must assume that a section of the tribe of Dumah was connected with Edom in Mt. Isaiah 21:11 makes that connection. were prophesied against by Isaiah. Now this cannot be correct as Dumah is a son of Ishmael but is also used to refer to Mt. . which may have become affiliated with the Simionites. Seir and seemingly absorbed into Edom but. The explanation is probably that. as the text in Genesis would seem to require an early connection. Cohen identifies Mibsam as a descendant of Simeon and the father of Mishma from 1Chronicles 4:25 and appears to make them distinct from the Ishmaelites (Interp. Seir. S. p. 38-43). 3. The accuracy of this is not fully known. art. at the very least. the Dumah moved into the lands of Mt. but the southern expansion of Simeon seems a very plausible explanation. 404 he notes that there is a Jebel Mishma between Teima and Jebel Shamar. However. He then goes on to say that the presence of the two names here and in the Ishmaelite genealogies may indicate that the two were Arabian tribes that had become affiliated with Simeon in the course of the latter’s expansion southward (vv. ‘Mibsam’. which was the capital of the tribe. It may be that they became affiliated from Egypt even before the Exodus perhaps even under the Hyksos. but the reading is uncertain. and that they were two Arabian tribes. in his article ‘Mishma’ on p. These two tribes appear to have been associated with the Idiba’ileans in the same area. as Edom moved northwest into the lands of depopulated Israel and Judah. which is the home of the son of Esau. These tribes would thus also be Jews and perhaps scattered in Israel as well.sons of Simione. Vol. Dict. Dumah (silence) The Dumah are held to be the Idumaeans.

1890.v. 26). Sennacherib struck against their capital. Dumah is mentioned in the biblical records as a city in Canaan (Josh. King of the Arabs. 32. Skizze der Gesch. Babylon. p. Glaser. prophecy) From the Nabataean website: The records of Tiglath Pileser III mentions the inhabitants of Mas'a and of Tema.net: Dumah is generally identified by historians with the Addyrian Adummatu people. Abu al-Walid's Dictionary. before proceeding on to Syria or Babylonia. From a geographical standpoint. the Vulgate. It goes on to say that it is the name of a land probably identical with the territory of the tribe of Ishmael (Isa. Burkhardt. 52). It is also associated with Edom and Seir in Isaiah 21:11. ). it is the name of a city of Judah (Josh. s. Dumat el Jandal is at the southeastern end of Al Jawf. s. and was a stopping place for caravan traders coming from Tayma. who is called. The Dumathii are mentioned in Porphyry. Also. located about fourteen kilometers south of Tayma. the war against Nabayat and the war against Massaa.. archeologists Winnett and Reed discovered some graffiti texts mentioning the tribe Massaa. und Geographie Arabiens. The name Dumah seems to point.v. states that in biblical literature Dumah has been found in Dumat al-Jandal in Arabia. like the name Hadramaut (Gen. in connection with Dedan and Nebayot. De Abstinentia (ii. Solomon Schechter and Kaufmann Kohler. 11). Massa (a burden. the famous depression situated half way between Syria and Mesopotamia. 662). This strategic location effectively made Dumah the entrance to north Arabia. xv. mention a village of the name of "Dumah". Historia Naturalis. Therefore. Hirsch. Haza'il. and comp.The Jewish Encyclopedia. Stephanus Byzantius. his father. in his attempt to subdue the Arabs. who paid him tribute. to some legend of Hades (cf. 440). Travels in Syria. Adummatu is often associated with the medieval Arabic Dumat el-Jandal. The Ginsburg MS. This area has water. as an Arabian tribe which sacrifices a boy every year and buries him under the altar of its idol. Kaza'il is also referred to in one inscription of Ashurbanipal as King of the Kedarites. Najd and the Hijaz area. These texts refer to the war against Dedan..). but Jerome's and Eusebius' Onomastica. these tribes appear to have . in its article by Emil G. 56). s. xxi. which was in ancient times a very important and strategic junction on the major trade route between Syria. called Jauf today (Yakut. From Nabataean. and often denotes the whole lower region of Wadi as Sirhan. which he called the stronghold of the Arabs. which is a desert basin. vi. This oasis was the center of rule for many north Arabian kings and queens. and the Septuagint have "Rouma". x. On the summit of Jebal Ghunaym. which has been identified with "Khirbat Daumah" in the neighbourhood of Bait Jibrin.. 15:52).v. and compared with Domatha (Pliny.v.. s. The Septuagint substitutes Idumea (see commentaries ad loc. as related to us in Assyrian records. Esarhaddon related how. Sennacherib captured their king. p. Adummatu.

Most of the Hadads are now Christians. Jordan. ‘Tema’. cf. 49:28-33). and who gained an important victory over the Midianites (Gen. I Chron. as "Hadadrimmon" and "Hadadezer." It was primitively the name of an Aramean divinity and formed a part of various Aramean theophorous names. Tema escaped destruction by paying tribute to the Assyrians. 250 miles SE of Aqaba on the road to the head of the Persian Gulf and about 200 miles NNE of Medina on the road to Damascus. perfection. who reigned before the time of the first king of Israel. The last Idumean king (I Chron. It is the same as the modern Teima which is an oasis located ca." The name was borne by: 1. . i. that lived near the mountains northwest of Palmyra. xxxvi. Nebuchadnezzar of Babylon waged campaigns against the region and the prophecy may have referred to that campaign or had a dual aspect. noise. However. and are located throughout the Levant (e. p. These caravans are mention in Job 6:19 and headed to that city. The tribe of Massaa is possibly connected with the Masanoi in the vicinity of Tema. 46). 51). ( ) One of the sons of Ishmael (Gen.: see Edom. Vol. I Chron. Hirsch and M.). 1:30). Lebanon. xxxvi. In Gen. clamour) Some historians speculate that this tribe may have become known as the Harar. i. Hadad (joy. or the Hararina people. 533)." 3. i. The third Idumean king. 15 [A. been close to each other at this time. which bids the inhabitants of Tema help their fugitive brethren with food and drink. "Hadar"]. 14 et seq. In view of its strategic location at the junction of the two main caravan routes it was an important caravansary (Interp. Although parts of Northern Arabia were conquered. 2. Jeremiah issued dire warnings against them (Jer. is thought to refer to the campaign of Tiglath- pileser III of Assyria in 738 BCE. V. 4. Syria. 1Chr. art. Palestine). consummation). the meaning of which is "a loud noise. Cohen says that he was a son of Ishmael and hence the name of an Arabian locality (Gen. Jewish Encyclopedia article by Emil G. 4. Tema (admiration. xxv. It is also interesting to notice that there is a Hadad tribe in Arabia. 25:15. as did other oases. who escaped the massacre under Joab and fled to Egypt (I Kings xi. Seligsohn states that it is the … “name of several Idumean kings. To the west lies the Nefud Desert which separates Tema from Dumah and Edom. of the Bible.g. 30)”. 39 the name occurs as "Hadar. Dict. 35. A member of the royal house of Edom. The oracle in Isaiah 21:14. 25:23.

God raised Cyrus in 540 BCE to conquer the Babylonians. Saunders (Interp. he left his son Belshazzar to rule in Babylon (cf. From the Early Iron Age I-II pottery (ca. 1:31) was one of the tribes at war with Israel in the Tranjordan (1Chr.). Note the names of the coalition and their relationship to the sub-tribes of Ishmael and also of Keturah to the south-east and to the far west of Tema. 7:1) and destroyed the city of Tema and its populace. One of the kings there was Husham of the Temanites (Gen. was defeated and made to pay significant tribute. 36:34. art. According to Xenophon Cyrus conquered all that region of Arabia.. The coalition was made up of Massaa. mountainous) This tribe of Ishmael (Gen. p. However.. then rebuilt it and repopulated the city with a large range of different people. with Babylon itself falling a year later (ibid. pp. 1200- 600 BCE) found there. Badana. 36:11. 773) places it NE of Galilee in the Anti-Lebanon country settled by Arab people of Ishmaelite stock. it seems to have been of considerable importance (ibid. art. Female rulers among the ancient Arabs were not uncommon as we saw with the Queen of Sheba. 1Chr. These people are not to be confused with the Temani or Temanites who are a clan of the people of Esau (Gen. 25:15. The Assyrian records also show that a coalition headed by Samsi. He lived there for ten years (ca. 5:19). which was his only ally against the Persians. 549-539) probably to consolidate the region and consolidate his links with Egypt. Dict. Those people lived at Tawilan NE of Elji on a shelf of land above Elji and below Jebel Heidan. the city of Tayma. queen of the Arabs. ‘Iturea’. Hajappa. 1:45). ‘Teman’. Hatti. Vol. succession. Dan. the tribes of Saba.15). 1Chr. This was a very fertile area and thickly populated. The Assyrian Sennacharib named the great gate at Nineveh the Desert Gate because the tribute of the Sumu’anites and the Temaites entered through it. Jetur (order. which lay far to the west. 2.Nabonidus (555-539) was the last king of Babylonia and was in danger from the Medes and Persians. which rises above it to the NE. The region was included in the Tetrachy of . In 552 BCE (following Cohen). 533-534). and Idiba'il.

J. Josephus describes a campaign against them by Aristobulus I in 105-104 BCE (Saunders. XIII. It belonged in earlier times to Zenodorus and before that it was the kingdom of the Itureans. The comment by Luke referred in fact to only a small part of what was once a far greater kingdom.Philip (Lk. 21:27. and carefully distinguishes it from the territory of the Trachons. 4:43. xi. down to and perhaps including the northern borders of Galilee. 1987. T. Vol. Originally they were a hill people living on the western slope of Anti-Lebanon and perhaps in the larger Lebanon region towards Phoenicia. Strabo (Geography XVI. After the death of Lysanius in 36 BCE the kingdom may have been divided into several smaller districts. iii 3. II.18) locates the kingdom of the Itureans in Anti-Lebanon in the Beqa’ valley with its capital at Chalcis. Saunders holds that the people known from the Second Century BCE (by the Hellenised form) as ‘Itouraoi are undoubtedly the same tribe as the descendants of Jetur mentions in Genesis 25:15 and as being the enemies of Reuben. They were forcibly annexed by Judea and the men were forcibly circumcised (A of J. In the First Century BCE under Ptolemy and Lysanius the kingdom developed lands to its greatest extent. ibid.1 (37)) and Gaulanitis provided the eastern boundary of Galilee (vol.). It is not certain whether Iturea and Trachonitis were wholly distinct districts or overlapped or were identical. 1. p. and T. 6:56). 23:1). Schurer details the extent of Iturea in his work. 3:1). The exact boundaries of the Itureans of northern Palestine are difficult to define. Jos. 561). The Itureans were regarded by both Greeks and Romans as an uncivilised bandit people and they designated them . The district of Panias. which was occupied by the Itureans.. 1Chr. extending from the sea in the west to Damascus in the east and included the lands of Panias and Ulatha in the south. Edinburgh. 20:8. 1.2. Schurer says exactly the same thing in his work (The History of the Jewish People in the Age of Jesus Christ. 5:19).). It is thus the lowlands east of the Jordan from its source to the southern tip of Lake Genessaret. 337 n. Gad and Manasseh (1Chr. ed. Appendix 1. p.16. Josephus distinguishes upper and lower Gaulanitis and says Gamal lay in lower Gaulanitis east of Lake Genessaret (B. Clark. He notes Gaulanitis to be to the east of the Jordan and taking its name from the Golon and was the ancient Bashan (Deut. was located on the town of Panias at the source of the Jordan (Vol. Vermes et al. 3).

south of the Hauran. Lucan. hence Abila or Abilene (Schurer. Cicero and Strabo all mention their skill as bowman. 10. At the instigation of Mark Antony large portions were given to Cleopatra. XIX. His son Lysanius inherited the tribal principality and is referred to as a King of the Itureans by Dio Cassius (XLIX. Dict. and both Plutarch (Antony 36) and Josephus (Antiq. In the First Century BCE they were ruled by Ptolemy the son of Mennaeus (ca. Antiq.). p. cit. Saunders considers that it probably consisted of the northern territory below Heliopolis to Laodicea.as both Syrians and Arabians.1). The town contains the place of the tomb of the Prophet Abel.. who was successor to Lysanius as a vassal of Cleopatra.iv. The Hellenized name first appears in the second century BCE before Roman rule in Palestine.1 and XX. Interp. Abila lay 18 Roman miles from Damascus on the road to Heliopolis and is now the village of Suk on the Barada and which lies on the remains of the ancient town.ii. The references in Vergil. In 20 BCE Augustus conferred the tetrarchy of Zenodorus.vii.v. which was the tetrarchy of Arca (Saunders. In 38 CE the territory of Soemus of the Itureans was seized by Caligula and later incorporated into the province of Syria.). The tetrarchy centred on Abila was conferred by Claudius on Herod Agrippa I in 41 CE (see also Josephus.10). xv. The Lysanius son of Ptolemy is not the Lysanius referred to in Luke and Josephus. Ant.32). The subsequent history is confused but it was probably divided into four parts. It is a much younger Lysanius that Josephus is referring to. . They formed a strong confederacy scattered throughout Lebanon. XV. on Herod the Great who in turn bequeathed it to his son Philip (Josephus. The southern borders of Philip’s territory also excluded the cities of Bosra and Salcah. and archaeological evidence both at Abila (Corpus Inscriptorium Graecarun 4521) and Heliopolis (4523) has now confirmed that both Josephus and Luke are referring to this younger tetrarch who ruled Abila before 47 CE. ibid. as we have inscriptions placing the Nabataean kings Malchus and Aretas over them. 85-40 BCE) and Strabo says he possessed “Massyas and the Mountainous country of the Itureans” (Geography XVI. Pompey destroyed many of the fortified strongholds and reduced the area. loc. he ruled the principality until his death in 36 BCE.1-2) confirm this. 3) (see also Saunders.567).

1881. ii. Iturea (Lk.. Philippics. That Iturea was in the region of Mount Lebanon is confirmed by an inscription of about the year 6 CE (Ephemeris Epigraphica. The tribe was defeated by the Transjordan Israelite tribes and survivors . In 38 CE Caligula placed the Itureans under a Soaemus who died in 49 CE and the Itureans were incorporated into Syria. Josephus. Thus the Syrians were a composite of Ishmaelites and Aramites who are not descendants of Abraham and other nations. as Luke says. They were known to the Romans as a predatory people (Cicero. Panias and also. 1884. and their cohorts and cavalry served all over the Empire.cit. Æmilius Secundus relates that he was sent by Quirinius against the Itureans in Mount Lebanon. p. p. 112). Bellum Africanum. pp. refreshes himself. 23) "king of the Itureans. Syrians and Arabs. 569). from an Aramaic inscription Schurer says that Hebran on the southern slope of the Hauran belonged to Philip (op. The actual break-up of the area of the Itureans is placed by Schurer as most probably in the governorship of Quirinius when his praefectus Q. Augusta Ituræorum" are met with in the inscriptions (Ephemeris Epigraphica. loc. pp. l. 3:1) was a mixture of re-settled Jews. and others. Aemelius Secundus undertook a military expedition against the Itureans (Schurer.).. 194). ix. 338 n. YDNA K2 Tarshish Phoenicians. Gaulanitis. who is called by Dio Cassius (lix. in which Q. and were appreciated by them for their great skill in archery (Cæsar. Trachonitis. loc. In 38 Caligula gave Iturea to a certain Soemus. Pliny the Elder. Naphish (the soul. The Wikipedia states that Itureans are first mentioned by Eupolemus – as one of the tribes conquered by David (Eusebius. The name of Massyas may also indicate another Arab or Syrian tribe. Augusta Ituræorum" and "Cohors I. he that rests. 12) and by Tacitus (Annals. After this incorporation the Itureans furnished soldiers for the Roman army." After the death of Soemus (49) his kingdom was incorporated into the province of Syria (Tacitus. p. and the designations "Ala I. Greeks. Herod the Great settled Jews from Babylon in Batanea (Schurer. Druze. Præparatio Evangelica. or rests) The ISBE records Naphish as the 11th son of Ishmael and the chief prince of the Arabian tribe that descended from him. cit. Certainly under Claudius the kingdoms of Chalcis and Iturea existed side by side. Auranitis.). 30) – and subsequently by Strabo. xii.c. 337-338) and the populace in these areas of Batanea. some of whom designate the Itureans as Arabs and others as Syrians. 537-542). 20). cit. The Romans then raised auxiliaries from the Itureans once they were in Syria..However.

but they can be identified by their YDNA. chapters 40 and 41 mention Ish'mael the son of Nethani'ah. They are also dealt with elsewhere in the papers dealing with Edom and the other sons of Abraham. Thus we have identified the sons of Ishmael and their various movements and the likely places of their residence. 7:52). listed with the Kenites and Kenizzites of Edom.  . This tribe can be considered as a part of Judah today. Neh. Ish'mael's daughter. a people of the east. Ked'emah (oriental. Some became temple slaves and are listed among the families that returned from exile (Ezra 2:50. 3 and Bas'emath. Marriage into Edom Genesis 36:2-3 Esau took his wives from the Canaanites: Adah the daughter of Elon the Hittite. They have moved all over the Middle East and all over the world. first) They are identified as the Kadmonites. Jeremiah. but he is not the Ishmael discussed here. Oholiba'mah the daughter of Anah the son of Zib'eon the Hivite. ancient. the sister of Neba'ioth.were taken captive.

Appendix A Descendants of Abraham Arab Tribes in Iraq Tribe Sub Group Place of Settlement Federations (qabila) AL-BU MUHAMMAD centred in the Maysan governorate ‘ANZA (pronounced ‘Aniza) federation ‘AZZA federation around Balad DULAYM centred in the Anbar governorate Al-Bu Fahd group Al-Bu Nimr (from al-Ramadi) Al-Mahamda Al-Falahat Al-Bu Fahad Al-Bu Dhiyab Al-Bu Mahhal Al-Bu Issa (in Fallujah) Al-Jumeilat (in Fallujah) Al-Karabla Al-Bu Assaf Al-Bu Risha Al-Bu Aiwan Al-Bu Farraj Al-Karabla JUBOUR BANI KA’B federation centred south of the city of Basra .

and across the border in the Khuzestan province of Iran KHAZA’IL BANI LAM MUNTAFIQ A1-Sa’dun clan (tribal leaders) BaniMalik Bani Khalid (plural al- Khawalid) Bani Qais (Al-Qaisiyun) Bani Sa’id Bani Hassan (southern Iraq) Bani Khafaja Abbouda Al-Bu Salih A1-Mayyah Al-Izayrij Bani Zaid Al-Sharifat (An-Naasriya. south of Iraq) Al-Ghizi Al-Hameed RABI’A (pronounced centred around the Kut city area Rubai’a) Shammar the Ninawa governorate BANI TAMIM central and southern Iraq (sometimes written Timim or Temim) al-Suhail clan (tribal near Abu Uhuraib .

JABUR. Janabi and ‘UBAYD federations above are all subsections of the ZUBAYD Baghdad area BANI TAMIM Shammar SHAMMAR is a subsection of the Tayy Tikrit area Shammer Jarba (Sunni) Shammer Toga (Shia) Zoba Al-Dulaym Al-Janabi Al-Nidawat Al-Ubayd . leaders) al-Turshan section centred in the Diyala governorate al-Kan’an section in the Basra governorate and across the border in the [[Arabs of Khuzestan/Khuzestanl] province of Iran Tikriti federation Al-Bu Nasir (includes Saddam Hussein) Al-Bu Ajeel Al-Shaya’isha ‘UBAYD al-’Alam and Tarmiya ZUBAYD Note: The ‘AZZA. DULAYM.

most of them in western Anbar province Al-Hayali Al-Jubour Al-Lihaib Al-Bu Hamad Al-Bu Hamdan .Al-Azza Al-Akabi Al-Bu Mohammed Al-Bu Aitha Al-Bu Amir Al-Jubour Al-Muj ama’ Al-Ghrair Al-Ugaydat Al-Anbariyeen Al-Qarraghul Al-Dafaf a Al-Bu Muhyi Bani Saad Bani Lam Rubai’a Khazraj Shammar Toga Mosul area Al-Dulaim 100.000.

Al-Bu Badran Al-Bu Mitaywit Al-Ugaydat Al-Jihaysh Hadid Bayyat Khazraj Descendants of the Khazraj section of the Ansar Shammar subsection of the Tayy Tayy Tikrit area Al-Bu Nasir Tikrit Al-Bu Latif Hadithiyyin Rifa’iyyin Al-Ubayd Al-Azza Al-Bu Farraj Jawa’ina Baiji Lihayb Sharqat Al-Mushahadah An individual from this tribe will have the name of Mash-hadani Al-Mashayikh Tarmiya and in Al-Hawejah (The individual called Al-Mashayikhi) .

Najaf area Al-Bu Dush Al-Fatla Al-Ghazalat Al-Jaryu Al-’Isa Al-Shibil Al-Zagarit Bani Hassan Bani Assad Kaab Abu Gulal Hilla area Al-Bu Sultan Al-Bu Amir Al-Masoud Al-Jubour Al-Janabi Al-Ma’amra Al-Dulaym Al-Qarraghul Shammar Zoba’a Zubayd .

Jihaysh Khafaja Arnarah area Bani Lam Al-Bu Mohammed Al-Izayrij Al-Bu Darraj Al-Sudan Al-Beidhan Al-Sarai Al-Bahadil Al-Suwa’id Al-Issa Al-Maryan Al-Bazzoun Basra area BANI KAB Bani Malik Bani Assad Bani Mansour BANI TAMIM Bani Khalid Al-Shirish Al-Sayamur Al-Mayyah .

Nassrallah) AI-Sa’eed Al-Abbouda Al-Jawabir Al-Dhufayr Al-Dulaym Al-Qanaghul Al-Husseinat Al-Sharifat Al-Shuwailat Al-Ghizi .Al-Duwasir (Bedouin) Al-Mutawr Al-Mutayr (Bedouin) Al-Halaf Al-Eidan Al-Gatarna Al-Garamsha Al-Suwa’id Al-Ghanim Khafaja Rubai’a Nasfriyah area Al-Bu Salih (Alrumaieth.

Kuwait and northern Arabia) Al Diwaniyah area Khaza’il Al-Bidayr Al-Jubour Al-Agra’ Al-Zeyad Al-Ibrahim Al-Bahahtha Al-Dulaym Al-Zirfat Al-Kurd Al-A’ajeeb Al-Ardhiyat .Al-Bidor Al-Jubour Bani Rikab Bani Hassan Bani Khaigan Bani Assad Bani Zaid Chinana Hacham Al-Sa’doun (Tribal leaders of the Muntafiq federation that ruled southern Iraq.

Al-Izayrij Bani Hacheem Afaj Zubayd Chabsha Kut area Rubai’a A1-Shohman Zubayd Shammar Toga Bani Lam Giraish Al-Mayyah Al-Magasis Al-Dulaym Al-Jubour Kirkuk area Al-Ubayd Al-Jubour A1-Ni’aim Al-Bayyat Al-Azza Al-Tamimi Bani Zaid .

Shammar Harb Qays Jibari (Kurdish) Dawoudi (Kurdish) Salehi (Kurdish) Shwann (Kurdish) Zengena (Kurdish) Baquba area Shammar Bani Tamim Bani Zaid Bani Ways Bani Lam Al-Azza Al-Ubayd A1-Ambakiya A1-Bayyat Al-Girtan Al-Tatran Al-Ma’amra Al-Jubour A1-Mujama’ Al-Dafafa Al-Sigoug Al-Karkhiya .

Al-Khishalat Al-Maghamis A1-Zuhairiya A1-Dainiya A1-Suwa’id A1-Dilfiya Al-Ridainiya Al-Nida A1-Sumaida’ Al-Bu Jawari Qays Khafaja Rubia’a Shammar Toga Ramadi area Al-Dulaym Al-Ugaydat Al-Jaghayfa Al-Lihaib Al-Halabsa Al-Ma’adhid Al-Jubour Shammar Zoba’a (Zoba is a subsection of Shammer) Aniza .

Other northern tribes Al-Bayyat It is said that this was originally a Turkmnen tribe that later mixed with the al-’UBAYD Al-Hadid (plural al- Hadidiyun) The Bani Harb A1-Saadun Al-Shammawi UBAYD southern Haweeja plains Basra Families Descendants of the noble family of the Prophet Muhammad Barakat al-Naqib From the Bani Khalid (Khawalid) Muhammad A1-‘lsa Al-’Abdul-Wahid Najdi families al-Zuhair Other families al-Khudairy al-Mandeel al-Nama .

Iraq. This is one of the largest Arab Bedouin tribes. The sheikh general lives in western Iraq. Kuwait and Bahrain are traced to this tribe. Gulf countries. Turkey and Egypt. Palestine. Syria.) Al-Dhufayr Al-Ghalal Al-Hassan Al-Mutayr Al-Sulayb Al-Bu Mitaywit Harb Shammar Al-Kharsa Sinjara Zoba Al-Sayih . with clans in Saudi Arabia. Kuwait. al-Rasheed al-Thukair Baraak Basha-Ayan Bacha-Chi Sheikh Khaz’al Khan (Mohammed Khan Family) Bedouin tribes ‘ANIZA (pronounced ‘Iniza) (The Royal families of Saudi Arabia. Jordan.

Bani Khalid (plural Al- Khawalid) Al-Noor Descendants of the family of the Islamic prophet Muhammad Al-Awadi (Najaf) Al-Mossawi Al Yaseen (Najaf) A1-Mushahadah in Tarmiya Al-Ni’aym Kirkuk. Hawija and Baghdad Al-Bu Milais Samarra Al-Bu Badri Samarra Al-Bu Baz Samarra Al-Bu Aswad Samarra Al-Bu Abbas Samarra Al-Bu Darraj Samarra Al-Bu Issa Samarra Al-Bu Nissan Samarra Al-Bu Udhaym Samarra Al-Marasma Balad. Samarra and Baquba Al-Tarabla Tikrit Al-Bu Nasir Tikrit Al-Hadid (plural al- Hadidiyun) Al-Naqib family in Basra Al-Sadoun Basra Al-Ridaini in Basra .

Barakat family Basra Al-Hakim family Naj af Kamuna family Najaf Al-Qizwini family Najaf Al-Tabataba’i family Najaf Bahr Al-Uloom family Najaf Al-Khoei family Najaf Al-Kharsan family Najaf Al-Zuwain family Najaf Al-Zaini family Najaf Al-Taliqani family Najaf Al-Allaq family Najaf A1-Faqih family Najaf Al-Jazatiri family Najaf A1-Keshwan family Najaf Al-Hilu family Najaf Al-Safi family Najaf Al-Ghraifi family Najaf Al-Sharmuti family Najaf Al-Hamami family Najaf Al-Abu Tubikh family Najaf Al-Yasir Najaf Shubbar family Najaf Al-Saraf family Najaf Al-Adhari Al Diwaniyah Al-Suwafi Diwaniyah .

descendants of the former royal family Al-Gailani family Baghdad Al-Haideri family Baghdad Al-Alusi family Baghdad Al-Tatar family Baghdad Al-Wa’idh family Baghdad Al-Witri family Baghdad Al-Shahristani family Baghdad Al-Sadr family Baghdad and Najaf Al-Haboubi family Baghdad and Najaf Utayfa family Baghdad Witwit family Hilla Al-Rifa’i family Basra. Baghdad. Samarra and Ana Al-Muwashit Ad-Dawr A1-Mishayikhoun Dujail A1-A’raji family Mosul.Hashimi family Baghdad. Baghdad and Najaf Al-Husseini family Mosul Al-Bu Sab’a Mosul Al-Sada Tal Afar Al-Barzanchi family Sulaimaniya and Arbil Al-Naqshabandi family Sulaimaniya Al-Kasnazani family Kirkuk Al-Talabani family Kirkuk Al-Dawudi family Kirkuk Al-Rijaibat Kirkuk and Baquba Al-Kaysey Baghdad .

Others. to be classified Harb (in ad-Dur) Al-Fallujiyyin (in Falluja) .

.

AUSTRALIA Email: secretary@ccg.org (Copyright © 2007 Wade Cox & anor. No charge may be levied on recipients of distributed copies. WODEN ACT 2606.) This paper may be freely copied and distributed provided it is copied in total with no alterations or deletions. Christian Churches of God No. 212D Descendants of Abraham Part IV: Sons of Keturah (Edition 2. . Christian Churches of God PO Box 369. The truth is important to understanding the destiny of the sons of Abraham in prophecy. Brief quotations may be embodied in critical articles and reviews without breaching copyright. The publisher’s name and address and the copyright notice must be included.0 20070302-20070303-20070417) The identity of the sons of Keturah is not well known and is often confused with the sons of Ishmael.

org .ccg.org and http://www.This paper is available from the World Wide Web page: http://www.logon.

Descendants of Abraham Part V: Sons of Keturah .

The next Surah deals with the transmission of prophecy through the Arab prophets and also through the sons of Keturah in Midian. however. The Surah also mentions two other prophets. Epher. there are some clues in the historical records. written about four years before the Hijrah. Hence.Perhaps the most enigmatic of all the descendants of Abraham are the Sons of Keturah. and Shu’eyb of Midian. 3 Jokshan was the father of Sheba and Dedan. the Qur’an is explaining further the transfer of authority of the Scriptures to Israel through Moses and Aaron. and Le-um'mim. 4 The sons of Mid'ian were Ephah. The identities of their descendants down to the present day have largely remained a mystery. The basis is that Midian was the tribe of the father-in-law of Moses and thus closest to Israel in importance and location. who Pickthall says is identified with Jethro. in that his descendants are mentioned more often in the Bible. Their names are recorded in Genesis 25:2-4 and 1Chronicles 1:32-33. Surah 10 titled “Jonah” draws its name from the reference to the people that Jonah witnessed to and who believed (S. The Surah 11 “Hud” refers to the Arabian prophet Hud not mentioned in the Bible. Both Surahs then devolve authority on Moses and Aaron. The Surahs of the Qur’an. Abi'da. deal with the concept of the revelation of God through the prophets. Surah 11:95 in the Qur’an says that one of the sons. Mid'ian. (RSV) The six sons were probably born in the first half of the 1800s BCE. Letu'shim. Ishbak. He was of the tribe of A’ad. Midian was the most notable son. The Tribe of Midian was used to effect that process through Moses’ sojourn in Midian and the preparation for the Exodus. and Shuah. Salih of the tribe of Thamud. The sons of Dedan were Asshu'rim. Genesis 25:1-4 Abraham took another wife. 2 She bore him Zimran. Midian is then shown as being removed after a catastrophe that befell the unjust. Midian. Medan. Hanoch. whose name was Ketu'rah. saving only Shu’eyb and those . All these were the children of Ketu'rah. the Qur’an and in secular records than any of his brothers’ descendants. was “removed from sight” – perhaps until these Last Days. If Shu’eyb is indeed Jethro. and Elda'ah. more will be written about Midian and the tribes descended from him. 10:99). Jokshan.

The Arabs. from 6989). 91a). Keturah Keturah is one of the most evocative names in the Bible. However. some of whom were Medes and sons of Japheth rather than the sons of Cush (see below). however. Thus the reference to Kushite must refer to the robber tribes that inhabited the area of Babylonia. namely piylegesh (SHD 6370). only the faithful were saved at that time. chpt. were continually paganised for millennia. a Cushite. and brings to mind the burning aroma of the sacrifices and the incense smoke that ascended as a sweet offering to the Lord. H. We will deal more with Jethro below. RSV).e. Sel. Hirsch and M. Here Hagar and Keturah are each referred to as concubine. The word qetorah (SHD 6988. claim that Keturah is simply another name for Hagar. Abraham married three wives – Sarah. 12:1. including rabbinic literature. Some commentaries. The Arabic name for Keturah is Saffurah. M. and Hagar. in their article on Keturah in the Jewish Encyclopedia. Keturah. In other words. Still it seems that such was not the opinion of the Talmudic doctors. a daughter of Japheth. Traditionally the Temple records also claim that Keturah was descended from Japheth. as with Moses’ wife in Num. (ibid. a daughter of Ham.E. found only in Deuteronomy 33:10. Messrs E. It appears also that Abraham married Keturah about 65 years after taking Hagar as concubine. for example. a daughter of Shem. the two women and their various offspring are mentioned quite separately on several occasions – in Genesis 25:6. Seligsohn. dismiss the idea of her being synonymous with Hagar. for the children of Ishmael and the children of Keturah are kept distinct in the story of their complaints against the Jews before Alexander the Macedonian (Sanh. 8) . also means smoke of sacrifice or incense. who was described as a Kushiyat (i. It means perfumed or incense (SHD 6989).who followed him. The Yakult Midrash makes a not unreasonable assertion concerning all three wives of Abraham. the concubine/wife of Abraham and mother of Ishmael. G..

by T & T Clark. and ledanum” (Histories. 2:1-2). The prophet Jeremiah mentions incense coming from Sheba (Jer. but its use was forbidden with sin offerings (Lev. 25 1ff. Jn. According to Selbie. Frankincense was also uniquely used with the sacrifice offerings along with fine flour and oil (Lev. 24:5-7). Lk. an offering made by fire on the two piles of 6 loaves each of unleavened bread upon the ‘pure’ table within the Tabernacle and the Temple (Lev. has anointed you with the oil of gladness above your fellows.. It was one of the four ingredients of the specially prepared holy incense (Ex. like a column of smoke. publ. Herodotus (ca. knew them as traders in that commodity. Myrrh is often referred to in conjunction with frankincense. and adds: “Concerning the spices of Arabia let no more be said. Sprenger [in Geog. myrrh. 5:11) or jealousy offerings (Num. Song of Solomon 3:6 What is that coming up from the wilderness. The whole country is scented with them. cinnamon. It was to be burned for a memorial. Arab genealogists maintain there was a tribe called Katura living in the neighbourhood of Mecca. 2:11. cassia. Selbie in A Dictionary of the Bible (James Hastings. 19:39-40). Edin. 5:15). 8 your robes are all fragrant with myrrh and aloes and cassia. with all the fragrant powders of the merchant? (RSV) Psalm 45:7b-8 Therefore God. 15:23. perfumed with myrrh and frankincense. (RSV) . 295] suggests that the ‘sons of Keturah’ were so named because the author of Gn. 107). Arab. Frankincense (lebonah: SHD 3828) was found almost exclusively in Arabia. your God.A. and it is the only country which produces frankincense.J. ‘frankincense’. and exhales an odour marvellously sweet” (ibid. 30:34) used in both the Tabernacle and the Temple (cf. 1:9-10). 6:20). III. and is associated with both the birth and death of Messiah (see Mat. 1899) adds this comment on the sons of Keturah: From the meaning of the name Keturah.. 490-425 BCE) stated that: “Arabia is the last of inhabited lands towards the south. 113). Mk.

meaning a woman taken for the purpose of bearing sons. She obviously became Abraham’s second wife perhaps on the death of Sarah. Gen.This refers to the normal custom in the East of perfuming a bridegroom. and Shu'ah. in this particular case. on the Red Sea. We will examine this aspect separately. It is mentioned by Jeremiah for destruction along with Elam and the kings of the Medes. Medan. We may perhaps compare also ZIMRI of Jer 2525.5). the Messiah has been anointed above his fellow elohim. Sons of Abraham by Keturah In Chronicles 1. supposedly located west of Mecca. Jeremiah 25 deals with the entire destruction of the Middle East commencing with Jerusalem and the princes of Judah to make them a hissing and a curse and from there on to Egypt and all the Middle East. his name means musical or musician (SHD 2175). This view was adopted as fact by the Hebrews and we may thus take it as reasonably certain (see Interpreter’s Dictionary of the Bible. (p. “Keturah’. She is later referred to as a wife showing a change in status (cf. Jokshan. 8). We see also in Nehemiah 13:5 that frankincense was considered one of the Temple treasures. The main city occupied by Zimran and his descendants was called Zabram. Mid'ian. Abida. but it may have been beforehand. Thus we are dealing with the destruction of the Saudi Arabian coastlands. art.’ this animal having doubtless been the totem of the clan. The sons of Jokshan: Sheba and Dedan. (RSV) The sons of Keturah came to be organised into a sub-group of six tribes. 25:1). All these were the descendants of Ketu'rah. of Mecca. Epher.vii. Ishbak. Abraham's concubine: she bore Zimran. a major element of which was Midian that occupied the east and south of the area of Palestine. 1Chronicles 1:32-33 The sons of Ketu'rah. Keturah is referred to as Abraham’s concubine. Hanoch. 982) . and Elda'ah. Zimran Zimran was the first son of Abraham by Keturah. W. It is thought to be the same as the Zimri of Jeremiah 25:25. 33 The sons of Mid'ian: Ephah. nation by nation. Vol. Hastings’ Dictionary says of the place name Zimran: Possibly Knobel is right in connecting it with Zabram of Ptolemy (VI. p. 3. The name is derived from zemer. ‘mountain-sheep or -goat.

and the tribes from these brothers settled in northern Arabia. art. insidious (Strong: SHD 3370). 743). 1Chr. the Letushim and the Leummim (Gen. and some remained there at least until Jeremiah. v. On Cohen’s analysis Jokshan may also be the person called Kahtan or Qahtan by the Arabs. as mentioned previously. Hastings’ Dictionary thinks it is quite plausible that Jokshan is identical with Joktan (see Tuch): “The two forms might represent respectively the Hebrew and the Aramaic pronunciation of the same word …” (ibid. this is biblically impossible and Cohen finds the equation phonetically difficult. 25:2-3. The error. hence by implication a birdcatcher. 25:3). They are not Ishmaelites. these are of a different lineage. Sheba and Dedan (Gen. Dedan is recorded as being the progenitor of the Asshurim. however. had two sons Sheba and Dedan. ‘Jokshan’. alternatively. however. p. Jokshan produced two sons. These Arabized Arabs are the progeny of Ishmael and are regarded as being adopted into the progeny of the pure Arabs and these Ishmaelites from Northwest Arabia are called ‘Adnanian Arabs. 212A)). Joktan was the brother of Peleg and the Hebrews descended from him moved much further abroad. Sheba and Dedan The second son of Keturah by Abraham. p. one in Arabia and the other in the Hindu Cush (see the paper Sons of Shem: Part I (No. However. He does however identify him as the father of Sheba and Dedan (Interpreter’s Dictionary of the Bible.We can see that the sons of Keturah moved into the Arabian peninsular before Israel even went into Egypt. 2. 1:32). They regard themselves as pure Arabs. . being the sons of Raamah (cf. may explain another link made between two areas. The major Arab tribes are the Qahtan Arabs who came from the Yemen. Jokshan He was the second-born son. Another Sheba and Dedan are mentioned together in Ezekiel 27. Vol. whose name can mean snarer (BDB). 22) who was a son of Cush. Jokshan. 963).. They are the sons of Ya’rub bin Yashjub bin Qahtan. while the sons of Ishmael are called Arabized Arabs.

Aws. Tai’. Quda’a and Sakasic. however. In later Jewish literature the Asshurim are described as ‘travelling merchants’. For instance: although the term Asshurim here is related to Asshur (SHD 804). that is. son of Eber (from whom the Hebrews are named). from a root word meaning to gather. all terms which could be applied to the modern-day Roma[ny] people or Gypsies. Kinda. although we can demonstrate their Semitic origin (see the paper Sons of Shem: Part I (No. Mudhhij. merchants and tinkers. perhaps alluding to the Greek islands. and those who became the kings of old Syria. who were descendants of Asshur son of Shem. In later Jewish writings the Leummim are described as the ‘chief of those who inhabit the isles’. Asshurim (SHD 805) means steps in the sense of taking steps to go somewhere. namely the descendants of Jafna. 2. Lakhm. Khazraj. whet (BDB). Sheba was the name given generations earlier to one of thirteen sons of Joktan. the Letushim were occupied in the sharpening of cutlery and weaponry.Confusion can arise with several of these names. it refers to a different people from the Assyrians (also 804). This would also help to further explain the two major Semitic Haplogroups of the Greeks being J and I with the later major haplogroup being the Hamitic E3b from North African occupation there. Leummim (SHD 3817) means peoples or communities. directly related to a word (3913) meaning to sharpen. Anmar. Kahlan whose most famous septs were: Hamdan. hammer. Azd. Similarly. Himyar of whom the most famous septs were: Zaid Al-Jamhur. The Gypsies. Judham. Thus two branches of the sons of Keturah may be involved in Greece. Letushim (SHD 3912) means hammered or oppressed (Strong). . cannot be tied to the sons of Keturah. but the ones we know as the main two lineages of the sons of Ya’rub or the Arab sons of Jokshan were: 1. These sons of Keturah may be the Laconian Greeks or Spartans although they did not inhabit the islands rather the mainland. Origin of the Name Arab These sons of Keturah who were to become the Pure Arabs were divided into many tribes. We see with the Asshurim and Letushim that they are travellers. 212A)).

On gaining strength he headed for Madinah (Medina) where he remained and his descendant Haritha bin Tha’labah had two sons. it also controlled the land across the Red Sea in the Horn of Africa and that accounts for the extension of the legends of Sheba into Africa. Aws and Khazraj.A tribe of the Himyar called the Quda’a moved from the Yemen and on to the Samawa semi- desert on the borders of Iraq. During its rule from before the Kingdom of Israel until the Romans suppressed its influence. but known as Khuza’a. Its gates are still there today. Joskshan was the father of Sheba and his lands were centred on the area and his people built that dam. by which time it and the culture there were no longer of importance. 600 CE. 146). The area of the Queen of Sheba in Southwest Arabia in that part of the Yemen was very rich while the dam there was operational. Kinda The Azd. Banu Tai’ 4. under the leadership of ‘Imran bin ‘Amr Muzaiqb (ca. These Kahlan septs were forced to relocate because of Roman occupation of Egypt and Syria and the disruption of the long-standing trade routes under Roman pressure. He wandered with his people in Hijaz and settled in Mar Az-Zahran subsequently . The first section under Tha’labah bin ‘Amr moved to Hijaz and lived between Tha’labiyah and Dhi Qar. This immigration broke into four main sections. The last repairs to the dam wall were built from part of the town buildings. with the nearby town buildings in varying states of decomposition. The second section or group was headed by the son of ‘Amr named Halitha bin’Amr. wandered in the Yemen and after despatching pioneer scouts moved north. which is referred to as the Great Flood (Sail Al’’Arim). This shows that the city and area was in decline even then. Kahlan septs emigrated from the Yemen into the different parts of the Arabian peninsular prior to the breach of the Ma’rib Dam. 600 BCE and collapsed ca. who were famous at Madinah. The dam was built ca. We will now divide the Kahlan septs into four groups: 1. Azd 2. Lakhm and Judham 3.

The fourth group under ‘Imran bin ‘Amr went to ‘Oman where the tribe of the Azd became entrenched. Jadis. after driving the original occupants of Makkah. the Kinda. The sons of Keturah fit into this amalgam and are perhaps often misclassed as sons of Ishmael or as sons of Ya’rub bin Yashub. bin Qahtan. for example. Thus the major section of the inhabitants of Mecca and Medina and Oman and the rulers of Syria are all of the sept of the Azd of the sons of Jokshan.conquering the Harram and. and the descendants inhabited Tihama and became known as Azd of Shanu’a. which was named for a spring of water in Hijaz where they had stopped for a time. These are the sons of Jokshan from whom the Arabs are named. Thamasam. Emlaq. Early Arabs The earliest Arabs are called the Perishing Arabs of whose history little is known. son of Abraham by Keturah. Thus the Perishing Arabs are older and from less successful tribes and even from the Canaanites that are also mislabelled Kushites. then settled in Makkah (Mecca). dwelt in Bahrain until they were expelled to Hadramout and Najd. The Palestinians. 212C)). are not all the same people and . we see the kings of Heerah established by Nasr bin Rabi’a. Of the other two groups the one under Jafna bin’Amr went to Syria where he established the Kingdom of Ghassan. These were ‘Ad. The Banu Tai’ also moved north to the Aja and Salma mountains. Of the second major group Lakhm and Judham. and others. father of Manadhira. The fourth group. Some are certainly from the other sons of Keturah but draw their names from this founder of the Arabs who are named for him (see also the table to the paper Descendants of Abraham Part III: Ishmael (No. from where the tribe faded into oblivion. which were subsequently renamed the Tai’ mountains. the tribe of Jurhum.

” In medieval times ibn Kaldun defined as Arab only the nomadic Bedouin that can trace themselves to one of the original tribes. On its formation in 1946 the Arab League defined an “Arab” as follows: “An Arab is a person whose language is Arabic. some Berbers might also call themselves “Arabs. Alzahrani. Q1)). Alghamedey. The same holds true for the Lebanese who are also K2 descendants of Japhethite Tarshish seamen. And the prophet ‘Muhammed’ was a baptised Christian of one sect where he was referred to as Abu Qasim before he was baptised into the Unitarian faith of the Churches of God. The most prominent Christian kingdoms were found among the sons of Keturah in the Ghassanid and Lakhmid Kingdoms. Wadd. such as the Saudi Arabians and those in the modern Gulf States. article ‘Arab’ on Wikipedia). The prophecy of Ishmael breaking free of his brethren has a new meaning. Qatabanic and Hadramatic (cf. Our job is to unravel this broad-brush picture and trace the origins of the people. son of Abraham. Aldosari. Instead they spoke the South Semitic languages such as Sabaic (from Sheba). Manat and Uzza. These sons of Keturah did not speak the early forms of Arabic such as East Aramaic. The Pure Arabs we now know as Qahtanian Arabs are from the grandson of Jokshan. Famous Arab families of the Qahtanite groups can be recognised by the surnames such as: Alqahtani. who is in sympathy with the aspirations of the Arabic speaking peoples”. Religions Before the coming of Islam the Arabs were crossed between paganised Arabs and Christianised Arabs. Aws and Khazraj (Alansari or Ansar). Kurds do not define themselves as Arabs. Ishmael is subject to the sons of Keturah who form the ruling class of the Arabs and will be liberated when Messiah comes. However. both Muslims and Copts. Some individuals such as the hanifs had adopted a monotheism and rejected the polytheism of the paganised Arabs. who lives in an Arabic speaking country. Alkhoza’a. Such distinction is still widely used. Alojman and so on. Other groups that reject the label Arab are the Berbers of North Africa and many branches of the Lebanese and the Egyptians. Islam is itself a version of Unitarian Christianity and the founders of Islam were Christians (see the Introduction to the Commentary on the Koran (No. Minaic.are comprised of at least three groups of genetic diversity. Morra. Al-lat. son of Keturah. Likewise. . the allies of the Phoenicians of Tyre and Sidon. He contrasted this with the urban lifestyles where people were likely to be of Arabized descent. These pagans worshipped a number of deities such as Hubal. Many were Nestorians. Alharbi.

2% of the population of the Near East and 39% of Lebanon and 10 to 15% of Syria. Shiite. It was this rise in power there in the fourth century that saw the reaction of Arab Jews to the Unitarian Christian faith in the seventh century and the rise of Islam. southern Lebanon. Christians make up some 9.Modern Muslims are broken into Sunni. Two thirds of Arabs who migrate to the Americas and Australia are Christians. Alawite and Ismaili. Ibadhite. Before Mizrahi was coined as a term. also converted to Judaism. The immense success of Islam saw the Khazars decide to convert to Judaism in the Russian Steppes ca. The Kindite kingdom of Central Arabia allied with the Himyarite Empire of South Arabia. . Jews in Iraq and elsewhere considered themselves as Arabs of the Jewish faith. In the late 4th century the Himyarite kings were converted to Judaism and their vassals. northern Yemen and the Al-Batinah region of Oman. Pre-classical Arabic emerged in the second century BCE from Qaryat-al-Faw near Sulayyil. Some consider the Druze as a Muslim sect. Safaitic inscriptions did not emerge until the first century BCE. That began in the 8th century BCE with the Hasaean inscriptions of eastern Saudi Arabia and the Thamudic texts of Arabia and the Sinai which were not connected with the Thamud. Nestorianism disappeared. which was ancient North Arabian. Language The Hebrew Bible refers to the Arvi (or Arabs) in connection with the inhabitants of the Syrian Desert and in Arabia long before the Qahtanian Arabs of South Arabia emerged. the Kindites. Greek Orthodox.” The term is rarely used today. Proto-Arabic. 740 CE. parts of Syria. Until the pro-Nazi and anti-Jewish actions of the 1930s and 1940s. The Nabatean inscriptions are written in Aramaic but contain many Arab names. From the fourth century CE we see the emergence of the Christian kingdoms of the Lakhmids of southern Iraq and the Ghassanids in southern Syria. or Greek Catholic. southern Iraq and southern Iran and adjacent parts of Saudi Arabia. There is a large section of J1 YDNA Haplotypes among both Arabs and Jews. others do not. Maronite. The Lakhmids allied with the Sassanid Empire and the Ghassanids allied with the Byzantine Empire. Arab Jews were called Yehudin ‘Aravim or “Arab Jews. Some Arabs are also Jews. Today Jews such as Mizrahi and Yemenite Jews are not considered as Arabs. The Unitarian faith became absorbed into Islam. Modern Christian Arabs are Coptic. Sunni Islam dominates completely in North Africa while Shi’a Islam is prevalent in Bahrain. was not written in Arabic script but in the epigraphic South Arabian Musnad. These Arabs converted to Judaism and had extensive influence across the Red Sea in Africa. Christians comprise roughly 10% of the Arab Israeli population and 6% of the Egyptian population.

He apparently founded a number of northern Arabian tribes. As such his descendants will be dealt with in greater detail than any of the others.. Some commentators say that Midian’s name may in fact be derived from the Semitic word for judgment. The nomadic Arabs or Bedouin were referred to as ‘a’rab. seems to be the north Arabic dialect probably of the Qays. Ayyat 43:2-3). Now back to the sons of Keturah. . and Abd-al-Madan is commonly seen in the Arab systems as a family name.It is important to note that the Qur’an does not use the word ‘Arab. which lay slightly west of south of modern Taima. The Himyarite language. including the tribes of Mecca. Madan or Medan is also mentioned in the inscriptions from the reign of the Babylonian Tiglath-pileser III (ca. and influenced by Old South Arabic. Medan The third of Keturah’s six sons. Identifying these groups and tribes is a difficult task. only the adjective ‘arabiyyun where is refers to itself as clear mubinun (Clear) Book in ‘arabiyyun (Arabic) (e. being Arabized Arabs. brawling or contention (SHD 4080). 732 BCE). Arabic thus was spread through Arabization under conquest from France to China. 946).g. Chaldean and Eastern Aramaic. Thus Arabic became the language of the Arabs from its use in the Qur’an. Madan was perhaps turned into an Arabian god under the ancient system of ancestor worship. The Qur’an refers to the Lost Arabs al-‘Arab al-ba’ida and says that they were lost as a punishment for their idolatry or disbelief. The Medans did not speak Chaldean but the Assyro-Babylonians did. Midian Although he was the fourth son of Abraham and Keturah. also S. ‘Medan’. The prophet says the Clear Book was rendered in Arabic so that they might understand. discord or strife (SHD 4091). 3. Cohen. were the sons of Ishmael. which became spoken in the south. (cf. p. as with his brother Medan. Interp. Midian’s name means strife. Vol. Medan carries a name meaning contention. 318). This term carried a negative connotation from the text in the Qur’an. where it was referred to as Badan. art. Dict. This distinction was to lead to real enmity between the northern Qays and the southern Kalb especially in Spain. while the later Northern Arabs. There seems also to be a link with Midian as seen below. The consonants b and m are often interchanged in Arabic and its predecessors. The terminology used referred to sedentary Arabs living in cities such as Mecca and Media as ‘arab. which was described by Al-Hamdani (d. Midian was the progenitor of perhaps the most important of all six-brother tribes. and his name is preserved in the town of Madan. They were thus regarded as the true Arabs as sons of Keturah. which was a Sabaean dialect of the sons of Keturah.

19:13. The Sarakolese of West Africa do likewise and the Mandingo of the Sudan wait for between twelve and fourteen years. "And where is he? Why have you left the man? Call him. and Eliezer. . 4:18. 23:15). "How is it that you have come so soon today?" 19 They said. as it was not done by Moses initially. 4:11) and also the Sodomites (Gen. for example. The incident with Moses and the circumcision of his son (Ex. The Turks circumcise between six and thirteen years. Num. and circumcised in the sense of “daughter’s husband” in relations to both the Midianites (Ex. The term circumciser and circumcised for father-in-law and son-in-law seems to have entered the Hebrew language without retaining the connotation of which it originally had (see Encyclopaedia of Religion and Ethics (ERE) Vol. meaning exile (SHD 1648). and stayed in the land of Mid'ian. The Wydah and Coast region of West Africa wait until 12 to 16 years and sometimes as late as 20. It is also recounted in the Qur’an at Surah 28:22-28.The Midianite tribes were referred to in Egyptian and other literature. No Semites circumcise later than this age. She bore two sons to Moses: Gershom. The story of Moses’ flight to Midian is provided in Exodus 2. he said. pp. (See also Acts 7:29 cf. and even drew water for us and watered the flock. 662). and Moses was going to be punished for that negligence. Thus we can infer that circumcision was performed by the father-in-law in both these people being the sons of Canaan and the sons of Shem. It should also be noted that the south-western Arabs circumcise in multiples of seven days from birth. calls them Modiana. but Moses stood up and helped them. "An Egyptian delivered us out of the hand of the shepherds. generally up to eight years in Kashgar and up to ten years in Turkistan. meaning God is help (SHD 461) (see 1Chr." 21 And Moses was content to dwell with the man. 18 When they came to their father Reu'el. and they came and drew water. and he sat down by a well. (RSV) Zipporah means a bird (SHD 6855).14). and Muslims circumcise from two years of age onwards. 10:29 and Jdg. 2:15. 1:18." 20 He said to his daughters. 16 Now the priest of Mid'ian had seven daughters.25ff. 3. The term circumciser is first used in the Bible in the sense of the future father-in-law. Ptolemy. and watered their flock. that he may eat bread. and he gave Moses his daughter Zippo'rah. 4:25) shows a reinforcement of the act as performed on Isaac at the eighth day. 17 The shepherds came and drove them away. Ex. Yet that was not the precedent set by Abraham and seemingly Jethro did not perform that rite and certainly not on his grandsons. But Moses fled from Pharaoh. It is only the sons of Ishmael among the Arabs that circumcise at the later age of twelve to thirteen years. 3:1. 661. he sought to kill Moses. and filled the troughs to water their father's flock.) Exodus 2:15-21 When Pharaoh heard of it.

Ishbak Ishbak was the fifth son of Abraham by Keturah. and for the profession of the true religion. Hastings’ Dictionary has this to say about Ishbak on page 501: Frd. where it is mentioned as a land (mat) whose king was allied with Sangara (Shamgar?) of Gargamis (Carchemish) and others against Assur-nazir-pal and Shalmaneser II (c. 1962. art. This may be correct as the two Septuagint sources use Iesbok (LXXA) or eosbak (LXXB) (cf. 1685. emphasis added). 2. the most notable of whom was Bildad. incline (Strong: SHD 7744). however. Dict.C. Apparently he and his descendants settled in the lands to the east of Canaan. Only the ancient Egyptians circumcised at 14 years and the Angaardi of the Murchison River in Western Australia do likewise from 14-16 years. however. Most people assume Arabs are sons of Ishmael and circumcise at thirteen years of age..). 747). sink.92) identifies it with Iasbuk of the cuneiform inscriptions. London. this sixth and last of Keturah’s sons has a name meaning variously wealth (BDB) or dell. (A Commentary on the Holy Bible. and living in the same country with him. His name means he releases (BDB) or he will leave (Strong: SHD 3435). as shown above. ‘Ishbak’. that is very far from the truth. son of Shuach. He was the progenitor of the Shuhites. Shuah Also called Shuach. and akin to Job. . 859 B. for wisdom and knowledge. Interp. and one of Job’s ‘comforters’ (Job 2:11). p. Matthew Poole makes some interesting comments on this verse in Job. Delitzsch (Z SKF ii. being probably of the posterity of Abraham. very little else is known about this tribe from either the Bible or secular sources. Vol. They were persons then eminent for birth and quality.Thus the circumcision practice among Semites also provides clues as to their origins. reprint by Banner of Truth Trust. Some South Australian tribes have adopted to wait until hairs appear on the face.

according to Josephus. meaning a cave-dweller). the inheritance being now come to him. a view in line with Arabic opinion that she was a Cushite (also from Ham) but which is contradicted by most other authorities. or they may in fact have been descended from them.. Josephus claims that the descendants of Abraham by Keturah went into Arabia and into a land called Troglodytes (from which we get the term Troglodyte.Shuah’s descendants were also well known to the Assyrians. London. et al). these may have displaced the descendants of these sons of Keturah. who referred to them as Suhu. This is repeated in Book II. 1:1ff. Thus their lands are well known. According to Jasher. Keturah is said to have come from the land of Canaan and is therefore most likely descended from the Patriarch Ham rather than Japheth. I. (Ant.) The Victorian explorer Richard Burton says that a race called the Beni Thamud were also described as Troglodytes (The God-Mines of Midian. Kegan Paul & Co. as also to his sons by Ketura. Accordingly Isaac married her. . Holzinger.). Canaan. Jews. chapter 10 where the main areas of habitation of the various children of Abraham are given. Jews. south of Carchemish and between the Balikh and Khabur rivers (cf. (Ant. iii) This is confirmed somewhat by the Scripture saying that only Ishmael and Isaac buried their father Abraham (Gen. That he left to Ismael and to his posterity the country of Arabia. presumably the sons of Keturah had already relocated elsewhere. ibid. Bk. In his Antiquities of the Jews. Troglodytis. 1878). 25:9). for the children by Keturah were gone to their own remote habitations. The name Shuhite is Sauchaioon in Greek. Ptolemy calls the latter Chaboras. and to Isaac. and described their land as being on the right bank of the Euphrates River. Keturah’s sons had moved away. which is probably one of the two Chebar rivers referred to by Ezekiel (Ezek. 16. Dillmann. Josephus claims that by the time of Isaac’s wedding. The lineage of all six brothers is further extended in Chapter 25 of the apocryphal and perhaps spurious Book of Jasher and includes several names not found in the Bible.

We can. In the days of the ancient Midianites the frontiers were so elastic that. 1879). but never for a continuity. Speculation that Job was a Kadmonite may be misplaced as he is listed in Genesis as being either the grandson or great-grandson of the Patriarch Issachar. coupled with the Egyptians in their fame for wisdom. children of the East … descendants (?Gn 256) of Abraham by Keturah (Gn 291. The Land of Midian In his second book The Land of Midian (Revisited) (C. be sure that Kadmonite became an area term rather than a specific tribal group. The children of the East are represented in the passages referred to as occupying Paddan-aram. London. Kegan Paul & Co. This view is quite incorrect as the tribes mentioned are other tribes of the sons of Noah and only one or two are Nephilim (see also the paper The Nephilim (No. but of the Keturaean Arabs. In that case. at times. Any Nephilim were exterminated. If he was also a Kadmonite it could only be by association with the Midianites and other sons of Keturah among whom he lived. Job 13. Burton estimated that Midianite territory at one time covered quite an extensive area. 831). . Is 1114.The Kadmonites There is another tribe of interest when discussing possible descendants of Keturah: the Kadmonites. 154)). they embraced Sinai. Kadmonite would be the designation of no particular tribe. and were pushed forward even into Central Palestine. Hastings’ Dictionary has this to say about them: Kadmonites … Ewald [in History of Israel] and many following him regard the Kadmonites as equivalent to the Bene Kedem. Jer 4928. neighbours and conquerors of the children of Ammon. as distinguished from the Ishmaelites.. however. Jg 712. and the people there were absorbed into the sons of Abraham from the text in question. son of Jacob. Whether they are to be viewed as a branch of the Ishmaelitish or of the Keturaean Arabs is not clear (p. Bullinger lists them as part of the Nephilim in Appendix 25 to The Companion Bible from Genesis 15:18-21. … Job is regarded as one of them. (p. 1 K 430. Ezk 254-10). It seems better to regard the Kadmonites as a particular tribe like the other nations named in this list. associated with the Midianites and Amalekites.295) In Genesis 25 we see that Abraham sent the sons of Hagar and Keturah away from Isaac presumably in order not to confuse their inheritances. inhabiting Kedar.

2. p. Burton also maintained there were vast iron ore deposits to be found in the area. silver. 7). In fact. holds that Cushan-Rishathain of Judges 3:8-11 was named for a tribe and was in fact a Jerahmeelite king who they identify with the Amalekites and Edomites. Num. iron. Extensive remains of industrial activity such as gold extraction were noted by him. 11:18).e. He also refers to another city Modiama but this is situated inland in northern Midian. Apparently . It may therefore have been much later and perhaps as a result of tribal over-crowding to the east of Jordan that at least one of the Keturan tribes. copper. antimony and titanium ores. When analysed the samples were found to contain gold. Burton and his party took many geological samples from the land of Midian. 6 But to the sons of his concubines Abraham gave gifts. lead (cf. who were dominant in northern Arabia at the time. so that by sending them “east” they would have to move in either a north-easterly or south-easterly direction to avoid the Salt (Dead) Sea. In 1Chronicles 1:46 we also see Midian being defeated in the land of Moab. relocated directly south toward the Red Sea. hence there was great fluidity of movement and perhaps some overlapping in the tribal areas. eastward to the east country. and varies between 24 and 70 miles (40-110 km) in depth. it appears that the Egyptians had operated gold mines and smelters in the area for centuries. 31:22). which would have effectively sent them towards Ammon and Edom respectively. i. The land loosely referred to as “Midian” in Bible atlases extends for up to 200 miles in a coastal strip alongside the Gulf of Aqaba and the Red Sea. and while he was still living he sent them away from his son Isaac. Genesis 25:5-6 Abraham gave all he had to Isaac. as well as zinc. the Gulf of Aqaba. (RSV) The same Hebrew word qedem (SHD 6924) is used for both eastward and east which seems an unnecessary repetition. Midian. unless the latter when combined with country is intended to signify an unspecified ancient land. The Historians’ History of the World (Vol. wolfram (tungsten). It is said of Hadad the Edomite that he “arose out of Midian” (1Kgs. As Abraham was later buried at Mamre it could be speculated that he and his offspring were living near Hebron at the time. which was found to be very rich in minerals and in turquoise stones. The domination was finished by aid of a friendly clan of Kenizzites. Ptolemy locates Modiana on the eastern shore of the Red Sea.

. as noted above. meaning God has known or called of God (SHD 420). meaning darkness or gloomy (SHD 5891). from the Arabic name for Jethro. His descendants in turn were called the Apparu as inscriptions from the time of King Assurbani-pal of Assyria show. which was described as being Pharaoh’s Treasury at one time. there are Minean inscriptions of ca. meaning a calf (SHD 6081). has the notable meaning of dedicated or [God’s] follower (SHD 2585). He was purported to be the father of the Kenites. and was known to the Arabs as ’Ofr. No further lineages are mentioned in the Bible. at the south-west foot of the Arabian peninsula. As with their brother tribe. 715 BCE. was the second son of Midian.Modiama was second only in importance to Petra. as well as among the half-tribe of Manasseh across the Jordan (1Chr. meaning my father knows or father of knowledge (SHD 28). 2:46. Abida(h) and Eldaah.H. roughly in modern Ghuwafa. 4:17). was the progenitor of tribes referred to as the Yada’il in ancient Sabean inscriptions. about ‘three days distant’ from Mecca. The ancient pre-Islamic city of Madyan is now Magha’ir Shu’aib. although local tradition during E. was the father of the tribes which settled in the northwest of the Arabian peninsula. Palmer’s exploration of the area identified the city of Midian (Madyan) with the extensive ruins of El Midayen. was the fourth son of Midian. close to Medina. Another Ephah is also mentioned twice in the genealogical records of the tribe of Judah (1Chr. Epher. 5:24).47). they apparently settled in the area of south-western Arabia. Hanoch. Epher. The Babylonian king Tiglath-pileser III calls this tribe the ’Ayappa. the Book of Jasher adds numerous sons produced by these five grandsons of Abraham. Sons of Midian Midian was the father of five sons: Ephah. the time of Sargon II. In Yemen. These tribes originally settled in the south-west region beside the Gulf of Aqaba. who were famed metalworkers or smiths. south-west of Tebuk. Eldaah. The Epherite city of Ghifar. still carries the name of its founder. however. Abida(h). Henoch (Chanoch). now modern Yemen. the name Epher appears in the genealogy of Judah (1Chr. 9th century BCE which refer to these people as the Abiyadi’. The last known reference to them is found in an inscription dated to ca. Ephah. or the Khayappa Arabs. As with Ephah above.

. with their camels bearing gum. chp. 11) describes Moses’ introduction to Midian. which included Ishmaelites and also perhaps Medanites. and perhaps with the Amorites as well (Jos. and expands a little upon the text in Exodus 2. may be the ancient Hyksos we see later in Egyptian history in the Nile Delta. Genesis 37:23-28.). on their way to carry it down to Egypt. and looking up they saw a caravan of Ishmaelites [SHD 3459] coming from Gilead. The first recorded contact between the Israelites and the Midianites is noted in Genesis 37. and myrrh. and they drew Joseph up and lifted him out of the pit. let us sell him to the Ish'maelites. II. we see the intermixing of the two main branches of the Arabs referred to above. there was no water in it. There are two different Hebrew words used for Midianite in the text. and let not our hand be upon him. balm. our own flesh. an officer of Pharaoh. 36:35. 13:21). (RSV) We see here an apparent contradiction in that the Midianites are referred to as Ishmaelites. the Midianites were cattle herders in accordance with the biblical account in Judges 6. "What profit is it if we slay our brother and conceal his blood? 27 Come. By the time of Joseph and the other tribal Patriarchs. 24 and they took him and cast him into a pit. in every other instance in the OT texts the use of the word translated as Midianite is SHD 4080. . Numbers 25:17 and 31:2-3 both use SHD 4084 in referring to Midianites. for he is our brother. the long robe with sleeves that he wore. The term used for these merchants in Genesis 37:28 is Midyaniy (SHD 4084) which is a native of the land of Midian. 28 Then Mid'ianite [SHD 4084] traders passed by. 25 Then they sat down to eat. However. These. they stripped him of his robe. and they took Joseph to Egypt. 22:1ff. Num. … 36 Menwhile the Mid'ianites [SHD 4092] had sold him in Egypt to Pot'i-phar. the sons of Keturah regarded as the Pure Arabs and the sons of Ishmael regarded as the Arabized Arabs. 26 Then Judah said to his brothers. the son of Abraham. The pit was empty. which refers to Midyan himself. In Genesis 37:36 we see that the Midianites (SHD 4092. This is a version of Midianite according to Strong but may well be another of the sons of Keturah of the Medani or sons of Medan. 25:1ff. According to Josephus. with the ancient Arab tribes now disappearing and the Amorites. We can thus assume that the caravan that took Joseph to Egypt was made up of people dwelling in the land of Midian. They are mentioned in the Bible as being allied with the Moabites against Israel (Gen. Medaniy) sold him in Egypt.The Early Midianites Josephus’ Antiquities of the Jews (Bk. and sold him to the Ish'maelites for twenty shekels of silver. the captain of the guard." And his brothers heeded him.36 So when Joseph came to his brothers.

threatening the passenger. 2). 15:78. The person Shu’eyb here is Jethro. and several Surahs highlight the disasters that befell them after their rejection of the messengers. and (the tribes of) A'ad and Thamud. priest of Midian and Moses’ father-in-law. who were forced at times to become cave-dwellers (Troglodytes) like the Kenites. In addition. are seen as metal-smiths from their very name. if ye believe. Lo! Allah verily is guiding those who believe unto a right path. and seeking to make it crooked. when ye were few and God multiplied you: and behold what hath been the end of those who acted corruptly. but I indulged the disbelievers a long while. and the LORD gave them into the hand of Mid'ian seven years. This will be better for you. denied (Our messengers). In Genesis the Midianites are similarly portrayed as traders (Gen. The above injunction in the Qur’an to deal only in lawful and just weights and measures echoes that in the Bible (Lev. Baidhawi. And Moses was denied. sent by God. in that they used two different kinds of weights and measures – buying by one and selling by the other (cf.54 If they deny thee (Muhammad). 44 (And) the dwellers in Midian.42-44. Tafsir-i-Raufi). and how (terrible) was My abhorrence! … 54 And that those who have been given knowledge may know that it is the truth from thy Lord. 2 And the hand of Mid'ian prevailed over . and God often used them purposely to punish the Israelites. the Kenites. as a sub-tribe of Midianites. so that they may believe therein and their hearts may submit humbly unto Him. 19:36. and diminish not unto men aught of their matters: neither act corruptly in the earth after its reformation. Surah 11 makes an interesting comment concerning the Midianites. and turning aside from the path of GOD him who believeth in him. even so the folk of Noah. 11:84 cf.The people of Midian are mentioned many times in the Qur’an. Midian is mentioned in the following Surahs: 9:70. Although it is difficult to know whether the Prophet is speaking to the original Midianites or to the Ishmaelites. et al. Surah 22. Therefore give full measure and just weight. Judges 6:1-2. 37). 86 Now hath an evident demonstration come unto you from your LORD. One of their crimes was in deceitful business practices. 28:45. it appears that a distinctive feature of some known as ‘Midianites’ is that they are merchants or traders. Prov. 43 And the folk of Abraham and the folk of Lot. The Midianites were to prove a troublesome people to Israel. then I seized them.6a The people of Israel did what was evil in the sight of the LORD. whereas in Exodus they are noted as being pastoralists (Ex.71. 87 And beset not every way. 50:14. before thee. both angelic and human. 26:175. (Pickthal) We see here that those inhabiting Midian had been given the true teachings of God at one time. And remember. or a combination of the two tribes. 20:10).

seventy-two thousand cattle. all the cities of the tableland. The Midianites stretched along the coast for 200 miles and the army that was defeated was not all of the Arabian forces and families of Midian but those mustered there and the families from Petra living there. namely Evi. 14:7). Rekem. Zur of Midian was the father of princess Cozbi. Arecema [El-Rekem]. Joshua 13:21 that is. Rekem. and in so doing he turned away God’s wrath. Petra was the ‘chief city and capital of all Arabia’ called in Hebrew Ha-Sela. shortly before his death Moses was told to “take vengeance on the Midianites for the children of Israel”. 52). whom Moses defeated with the leaders of Mid'ian. gave his name to the “most conspicuous city among the Arabs. and because of Mid'ian the people of Israel made for themselves the dens which are in the mountains. and by the Greeks. 25:11-15). and the caves and the strongholds…. 32-34). earrings and necklaces (v. the princes of Sihon. bracelets. called to our day under every King.1). Evi. God subsequently blessed Phinehas for his decisive action on behalf of Israel (Num. The text in Joshua 13:21 also mentions the princes (nasiy: SHD 5387) of Midian. such as armlets. Rekem. .7. who dwelt in the land. however. iv. Both were killed by Phinehas in righteous indignation. Hur. and all the kingdom of Sihon king of the Amorites.6 And Israel was brought very low because of Mid'ian. Jews. Zur. All the male Midianites and most of their females were killed. (RSV) Princes and Kings of Midian As recorded in Numbers 31:1ff. sixty-one thousand donkeys (vv. Evi and Rekem and Zur and Hur and Reba. Verse 15 says that Zur was “head over a people and of a chief house of Midian”. and Reba. including their five kings. the cliff (2Kgs. (RSV) Josephus claims that the second of these kings or sheiks. who reigned in Heshbon. Zur.. The telling comment of the Bible text was who dwelt in the land and thus we are dealing with the Midianites that dwelt in the land there. Petra” (Ant. signet rings. as the portion of plunder that the Israelites offered to the Lord amounted to sixteen-thousand seven-hundred and fifty shekels in the form of fashioned ornaments. They also possessed much gold. The Midianites were very rich in livestock as the booty taken from them showed: six hundred and seventy-five thousand sheep. Israel. the one who consorted provocatively with a prince of Israel. who are called kings (melek: SHD 4428) in Numbers 31. Hur and Reba.

Judges 7:25 And they took the two princes of Mid'ian. converted this place of worship into a shrine of their own religion. Bantam rev. were mining copper on their own account at Timna. Other sub-tribes were linked to them. Egyptian place of worship dedicated to the goddess Hathor. Numbers 10:29-32 And Moses said to Hobab the son of Reu'el the Mid'ianite. They were killed by the Ephraimites after being pursued by Gideon and the other Israelite warriors.." 31 And he said. Oreb and Zeeb. (RSV) There are also two kings of Midian mentioned in Judges 8:5. Moses' father- in-law. New York. It is not without a touch of dramatic effect that we note that it was at an archaeological site showing signs of Midianite occupation that Benno Rothenberg found an idol in the form of a brazen serpent five inches in length and partly decorated with gold. for the LORD has promised good to Israel. come with us. and we will do you good. namely Zebah and Zalmunnah (meaning sacrifice and deprived of protection. it seems that Hobab was also known as Jethro (meaning his excellence). That they all slipped from the Faith is a matter of record. (p. Although there is much confusion over these names. Early Midianite Religion Werner Keller in The Bible as History (Hodder & Stoughton Ltd. "I will not go. and Zeeb they killed at the wine press of Zeeb. as they pursued Mid'ian. I will depart to my own land and to my kindred. The Midianites who. who had tried to invade Palestine but were defeated by Gideon. following the Egyptians. and they brought the heads of Oreb and Zeeb to Gideon beyond the Jordan. 147-8) The fact that Abraham instructed all his sons in the worship of the One True God makes it hardly surprising that monotheism and the worship of Yahovah of Hosts was found amongst them. respectively). Thus Midian occupied territory from the lands of Edom along the coast of Arabia south and east from Aqaba for 200 miles." 30 But he said to him. are mentioned in Judges 7:25. who was the son of Reuel or Raguel (Num. … this small bronze serpent was found in the Holy of Holies of a tabernacle! … It was found on the site of an older. "Do not . `I will give it to you'.Two other princes of the Midianites. 1982) briefly touched on some aspects of the Midianite religious system. 10:29). Oreb (meaning raven) and Zeeb (wolf). The Israelites are supposed to owe the strange cult of the brazen serpent to Reuel [aka Jethro]. ed. "We are setting out for the place of which the LORD said. they killed Oreb at the rock of Oreb. Jethro: priest of Midian Moses’ father-in-law was called Hobab.

the same will we do to you. as in v. son of Mour. Jews. just as much as his own people. Matthew Poole gives a reasonable explanation for this discrepancy in his comment on Exodus 2:18 below. It is thus beyond doubt that he was sheik and High Priest of Midian and hereditary religious leader of the tribe. (RSV) The name Hobab (SHD 2246) means cherished or loved fervently. whatever good the LORD will do to us. . 29) was Moses’ father-in-law. Chobab (SHD 2246) means cherished and is derived from 2245: hide as in the bosom. the Friend of God is the rendering of the names of Jethro.e. son of Abraham." (RSV) Exodus 3:1a Now Moses was keeping the flock of his father-in-law. Reuel or Reguel. Hence. Other commentators claim that Jethro was an honorary title. son of Anka. however. Judges 4:11 (see below) clearly states that he was known as Hobab. son of Midian. Thus we are looking at Hobab the name and Jethro the title. as with the Keturah/Hagar question. Raguel is simply another version of this title (see Strong’s Hebrew Dictionary). Jethro] for a surname”. Hobab. Jethro. Yithrow (SHD 3503) means His excellence coming from Yithrah (SHD 3502. Hobab had “Iothor [i. According to Josephus. perhaps by God. His Excellence. leave us. to cherish. excellence). which would explain the inspired advice he later gave to Moses regarding judgments given to the Israelites. III. 32 And if you go with us. Reuel (SHD 7467. iii) claimed that Raguel (also Reuel. It was obviously carried by the Priest of Midian as it was carried by the father of Hobab and by Hobab/Jethro himself. Re’uw’el) means Friend of God and is a title given to Abraham and was carried by Jethro as Priest of Midian. there is some contradictory opinion over identity and this perhaps sums up the rather mysterious nature of the sons of Keturah and their descendants. Jethro’s descent is given as: son of Nawil. I pray you. son of Rawail. Hobab. the priest of Mid'ian. Josephus (Ant. while Reuel was his personal name. for you know how we are to encamp in the wilderness. and you will serve as eyes for us.

p. 539. Schwab’s version. Other commentators add that he was old and blind. for which sin they were destroyed by fire from heaven.. ii. El-Kesai states that his original name was Boyun. (ftnt. 18:11). on account of the words of wisdom which he bestowed upon his son-in-law (Exod. and to convert the people of his native city Midian. 260). and delivered me from the sword of Pharaoh"). of whom the name of the one was Gershom (for he said. or strangers. Moses’ father-in-law. ibn Yashjar. He was already a priest of Midian and it is obvious that he is observing the activities of the Being sent to Israel as proof of the birthright promises given to Isaac. 2 Now Jethro. The Kuturah or Pure Arabs. He fled to Palestine. with Israel as the people of God (Ex. is said to have been blind. 117). Bell & Co. affiliated to Israel on account of their good deeds (p. 4 and the name of the other.Another Reuel mentioned in the Bible is a son of Esau by Bashemath. 3 and her two sons.” Jetro [sic. The Friend of God (Raguel: Josephus) took the fact of the supremacy over the Egyptians in the Red Sea as proof positive of the power of the Angel of Yahovah acting for the One True God. after he had sent her away. They rejected his doctrine and mocked the blind prophet. E. UK. 36:4ff. while Midian was laid waste by an earthquake. "The God of my father was my help. Exodus 18:1-12 Jethro. 48. daughter of Ishmael (Gen. and is said to be buried near Safed. and of few words (Sale’s Koran. Moses' father-in-law. 1871). Jethro alone escaping alive. That view was to continue down to the writing of the Qur’an and is reflected in the Qur’an. but they are charged with ignorance by Ahmed ibn Abd el-Halim.] and Rahab are Gentiles. M. 18) … Some writers have made him the son of Mikhail. resent that birthright to this very day. as the Arabs call Jethro. Moses' father-in-law. Burton in The Gold-Mines of Midian has this to say in his footnote on page 332: Jethro’s Moslem title is “Khatib el-Anbiya. that he was comely of person. Elie'zer (for he said. how the LORD had brought Israel out of Egypt. as well as the sons of Ishmael. and had been given a commission to preach the true Faith.). Paris: Imprimerie Nationale.” or Preacher to the Prophets. Moses' wife. Palmer in The Desert of the Exodus (Deighton. notwithstanding which infirmity he was divinely commissioned to preach the true religion lately revealed unto Abraham. ibn Madyan. heard of all that God had done for Moses and for Israel his people. 1871) repeats the assertion that Jethro/Hobab was blind. came with his sons and his wife to Moses in the wilderness where he . had taken Zippo'rah. In the “Berakhoth. 5 And Jethro.H. Cambridge. See the paper Law and the Seventh Commandment (No. Moses' father-in-law. very thoughtful. p. emphasis added) It appears that Jethro/Hobab. "I have been a sojourner in a foreign land"). but spare and lean. the priest of Mid'ian. Sho‘eib.

11 Now I know that the LORD is greater than all gods.  Melchizedek was the priest of the Most High God. Jethro was the priest of Midian. in that he had delivered them out of the hand of the Egyptians. 19 And he blessed him and said. (RSV) There are also some noteworthy parallels in the encounter between Moses and Jethro (Ex. when they dealt arrogantly with them. cf. 9 And Jethro rejoiced for all the good which the LORD had done to Israel. Jethro also arranged a sacrificial meal and bread to be eaten with Moses. verse 20 above and Ex." 12 And Jethro. "Lo." 7 Moses went out to meet his father-in-law. offered a burnt offering and sacrifices to God. from 7999) blessed Abraham. 18:7. from 7999) or Salaams in the typical Middle-eastern manner (Ex. king of Elam. was encamped at the mountain of God. all the hardship that had come upon them in the way. Exodus 4:18 Moses went back to Jethro his father-in-law and said to him." And Jethro said to Moses. the King's Valley).  There is a general theme of “peace” and friendship in the two encounters: the king of Salem (SHD 8004. the king of Sodom went out to meet him at the Valley of Shaveh (that is. maker of heaven and earth. "Blessed be the LORD. to my kinsmen in Egypt and see whether they are still alive. who has delivered your enemies into your hand! (RSV)  Abraham had just defeated Chedorlaomer. I pray. Aaron and all the elders of Israel. "Go in peace. while Moses had earlier witnessed the defeat of Pharaoh.  Melchizedek brought bread and wine for a ceremonial meal with Abraham. and Aaron came with all the elders of Israel to eat bread with Moses' father- in-law before God. Genesis 14:17-20 After his return from the defeat of Ched-or-lao'mer and the kings who were with him. also 4:18). and went into the tent. and they asked each other of their welfare. 8 Then Moses told his father-in-law all that the LORD had done to Pharaoh and to the Egyptians for Israel's sake. 18:10). "Blessed be Abram by God Most High. and did obeisance and kissed him. 18:1ff. while Jethro and Moses are said to have exchanged Shaloms (SHD 7965." (RSV) . and how the LORD had delivered them.  Both Melchizedek and Jethro ‘blessed’/gave praises to God for their deliverance using very similar language (cf. "Let me go back. 18 And Mel-chiz'edek king of Salem brought out bread and wine. Moses' father-in-law. because he delivered the people from under the hand of the Egyptians. 6 And when one told Moses. 10 And Jethro said. who has delivered you out of the hand of the Egyptians and out of the hand of Pharaoh. he was priest of God Most High. king of Egypt. your father-in-law Jethro is coming to you with your wife and her two sons with her.) and the one between Abraham and Melchisedek recorded in Genesis 14. 20 and blessed be God Most High.

you are not able to perform it alone. O my people. 14 When Moses' father-in-law saw all that he was doing for the people. worship GOD. Exodus 18:13-27 On the morrow Moses sat to judge the people." 24 So Moses gave heed to the voice of his father-in-law and did all that he had said. 20 and you shall teach them the statutes and the decisions. and all the people stand about you from morning till evening?" 15 And Moses said to his father-in-law. 23 If you do this. south east of Sinai and the same as the Modiana of Ptolemy. 25 Moses chose able men out of all Israel. and they will bear the burden with you. of fifties. both for Moses’ sake and so that “all this people shall also go to their place in peace” (v. he said. and God be with you! You shall represent the people before God. 26 And they judged the people at all times. but any small matter they shall decide themselves. "Because the people come to me to inquire of God.). 16 when they have a dispute. and the people stood about Moses from morning till evening. and of tens. and God so commands you. hard cases they brought to Moses. and bring their cases to God. Moses sat down among the Israelites to make judgment upon a number of matters (Ex. "What is this that you are doing for the people? Why do you sit alone. "What you are doing is not good. every great matter they shall bring to you. He said unto them. 21 Moreover choose able men from all the people. of hundreds. and place such men over the people as rulers of thousands. men who are trustworthy and who hate a bribe. of fifties. they come to me and I decide between a man and his neighbor. Surah 11:86 And unto Madian we sent their brother Shuaib. then you will be able to endure. as is also shown when his wise counsel is heeded by Moses. Jethro advised Moses on a more practical way of doing this. ye have no GOD but Him … Sale says Midian was a city on Hijaz on the Red Sea. but any small matter they decided themselves. such as fear God. 23). . of hundreds. and all this people also will go to their place in peace. (RSV) Jethro in the Qur’an The Qur’an has much to say about Jethro (Shuaib) and the Midianites. I will give you counsel. What was remaining of it at the time of the prophet was demolished in the following wars. and he went his way to his own country. for the thing is too heavy for you. and of tens. Jethro is depicted as specially favoured and directed by God. and made them heads over the people. rulers of thousands. 18:13ff. and make them know the way in which they must walk and what they must do. 27 Then Moses let his father-in-law depart. and I make them know the statutes of God and his decisions." 17 Moses' father-in-law said to him. 18 You and the people with you will wear yourselves out. 19 Listen now to my voice. 22 And let them judge the people at all times. so it will be easier for you.We see that on the day after these pleasantries.

(ibid. He said. Baidhawi says he was the son of Mikail. we understand not much of what thou sayest. or the preacher to the prophets. 13). Jethro is called Shuaib" (Notes on the Roman Urdu Quran). This is indicative of a schism in the religious beliefs of Midian and the beginning of the paganisation of the Arabs from the surrounding tribes. S. the father-in-law of Moses.(92) Shuaib said. O my people. who were elated with pride. What! though we be averse thereto? We will surely cast thee . and be turned unto him: for my LORD is merciful and loving. Midian having married the daughter of Lot. whence he had the surname of Khatib al anbiyah. Rodwell relates a Jewish tradition of similar import regarding Jethro. 11:88 He [Shuaib] said. O Shuaib. Muslim writers generally identify Shuaib with Jethro. . … However they say (after the Jews) that he gave his son-in-law that wonder-working rod with which he performed all those miracles in Egypt and the desert. out of our city. and the Tafsir-i- Raufi relates that he was descended from Lot. Notes on the Roman Urdu Quran) 89The chiefs of his people. the son of Yashjar." (222. and those who believe with thee. answered.Shuaib. (91) They answered. or the people of Hud. We will surely cast thee. and he hath bestowed on me an excellent provision. therefore. O my people. and we see thee to be a man of no power among us: if it had not been for the sake of thy family. tell me: if I have received an evident declaration from my LORD. and I will not consent unto you in that which I forbid you.. (89) O my people. and also excellent advice and instructions (Exod. 223) It can be inferred from this that Shuaib (Jethro) had the true Faith. Origin of the Arabic name of Hobab No miracles wrought by Shuaib are described either in the Quran or the Traditions. . neither couldst thou have prevailed against us. is my family more worthy in your opinion than GOD? and do ye cast him behind you with neglect? Verily my LORD comprehendeth that which ye do. let not your opposing of me draw on you a vengeance like unto that which fell on the people of Noah. He was a priest of the Most High in Midian. xviii. and unto him do I turn me. We see from verse 88 that at the very least he worshipped God. do I seek any other than your reformation. to the utmost of my power? My support is from GOD alone: on him do I trust. out of our city: or else thou shalt certainly return unto our religion. we had surely stoned thee. (90) Ask pardon. O Shuaib. the son of Midian. and this was the reason he was cast out of the city along with other believers. of your LORD. "In the commentary of the Syrian Ephream. or the people of Salih: neither was the people of Lot far distant from you.

son of Keturah. Moses’ father-in-law. an event referred to earlier in verse 71 of Surah 9 concerning repentance. Their main area of habitation was probably in the south-east of Aqaba but they were to be found much further afield. 35:6-10) were also a clan of the Kenites and whose . some suppose that Shuaib was so. and had pitched his tent as far away as the oak in Za- anan'nim. weak. 24:22). (363) The elohim speak of the destruction of the city of Madian/Midian in Surah 11:96.g. 34:3) to the south of the former Canaanite city of Arad. Num. they tend to receive favourable mention in the Bible. Kinaiaoi. The Book of Judges tells us that the descendants of Jethro. as we shall see. Judges 4:11 Now Heber the Ken'ite had separated from the Ken'ites. The Kenites The Kenites or Kainites (SHD 7017) were a tribe of smiths descended from Midian. as a defect which disqualified him for the prophetic office. hence Heber removed himself quite some distance from his fellow-Kenites. The Kenites are variously referred to by classical historians as the Kenaioi. or Negeb: RSV) of Genesis 20:1 is recognised as the land south of Palestine and adjoining Midian. which is near Kedesh.Sale. The ‘south country’ (KJV. "The Arabic word dhaif. Hence it appears that part of the Kenite tribe at some time became closely associated with or even incorporated into the tribe of Judah. signifying also. Jer. Judges 1:16 And the descendants of the Ken'ite.(91) A man of no power. in the Himyaritic dialect. and they went and settled with the people. (RSV) The Kedesh mentioned here is within the tribal lands of Naphtali in the northern part of Israel. 15:22). The name Za-anan’nim in verse 11 appropriately means removings or wanderings. went up with the people of Judah from the city of palms into the wilderness of Judah. and that the Midianites objected that to him. Notably. blind. travelled with the children of Judah from Jericho (? cf.". which lies in the Negeb near Arad. Jerahmeel was the great-grandson of the Patriarch Judah. the descendants of Hobab the father-in-law of Moses. which lay beyond the northern wilderness of Judah. (RSV) Arad was also the location for the Jewish town of Kinah (Jos. Cinaeus or simply Kain (cf. It is noted that the Rechabites (e. Moses' father-in-law. Deut.

let not a man escape. 28 Thus Jehu wiped out Ba'al from Israel.3). The following text is from the end of one genealogical record of the House of Judah." So he had him ride in his chariot. 27 And they demolished the pillar of Ba'al. This accounts for Jehu’s action in 2Kings 10. and demolished the house of Ba'al. "Is your heart true to my heart as mine is to yours?" And Jehon'adab answered. speaks of them as ‘the race of the Shechemites’ (Sikimitoon) in his account of Saul’s expedition (Ant. "Come with me. "It is. but only the worshipers of Ba'al. The Targums transform the name into Salmaite. and said. (Vol. the Shim'e-athites. give me your hand. p. It is possible. In a note to this verse. that at least some of the so-called ‘Jewish’ scribes may have been originally Kenites who had become fully integrated with Judah. and burned it. 15. and see that there is no servant of the LORD here among you. and the Su'cathites. ‘the father of Beth-lehem’. 16 And he said. and made it a latrine to this day. "If it is. The Sam.16.vii." Jehu said. "Search. 23-28 And when he departed from there. he met Jehon'adab the son of Rechab coming to meet him. and said to him.” may have been teachers. and see my zeal for the LORD. who elsewhere calls the Kenites kentides. 834. II. Now Jehu had stationed eighty men outside.VS of Gn 1519 inserts the same name before ‘Kenite’.progenitor was Hammath. and he greeted him. … 23 Then Jehu went into the house of Ba'al with Jehon'adab the son of Rechab. And Jehu took him up with him into the chariot. Jehu said to the guard and to the officers. These are the Ken'ites who came from Hammath." So he gave him his hand.. Bullinger (The Companion Bible) says of the Kenites: They became an ascetic people. who seems to be termed a Kenite in 1Ch 254. emphasis added) . 1Chronicles 2:55 The families also of the scribes that dwelt at Jabez: the Ti'rathites. the guard and the officers cast them out and went into the inner room of the house of Ba'al 26 and they brought out the pillar that was in the house of Ba'al. by being mentioned here in connection with “scribes. "Go in and slay them. "The man who allows any of those whom I give into your hands to escape shall forfeit his life. the father of the house of Rechab. (RSV) Josephus. therefore." 25 So as soon as he had made an end of offering the burnt offering. 2Kings 10:15-16. and. VI." 24 Then he went in to offer sacrifices and burnt offerings. from Salma. (RSV) The scribes here are the sopherim (SHD 5608).55. and he said to the worshipers of Ba'al." So when they put them to the sword.

27:10). Saul honourably advised the Kenites to move away from their former associates in order not to be killed along with them (1Sam. O LORD! But thy friends be like the sun as he rises in his might. he fell. In 1Samuel 30:29 some elders of Judah are to be found in Kenite cities. "Enduring is your dwelling place. Heber and his family apparently went to Kedesh in northern Israel following Sisera’s defeat." And the land had rest for forty years. "Am'alek was the first of the nations. 4:17). she shattered and pierced his temple. the Shechemites were at one time a sub-tribe of Manasseh (Num. Judges 5:24-27. 1:28. after he was commanded to destroy the Amalekites. he lay still at her feet. there he fell dead. she struck Sis'era a blow.However. she crushed his head. and said. but in the end he shall come to destruction. It is of note that Jael’s decisive action helped usher in a period of forty years of peace for Israel. … 31 "So perish all thine enemies. of tent- dwelling women most blessed. and took up his discourse. she brought him curds in a lordly bowl. The Kenites inhabited the Negev desert south of Judah (1Sam. However. A. 26:29-31). so Josephus’ comment may refer to the period before Manasseh’s occupation of that city. the wife of Heber the Ken'ite. (RSV) This blessing is reminiscent of the one upon Mariam. Saul gave the people the chance to save themselves in view of their help to Israel on previous occasions. and your . H. Jael was the wife of Heber a Kenite (Jdg. and took up his discourse. 26 She put her hand to the tent peg and her right hand to the workmen's mallet. he fell. 25 He asked water and she gave him milk. at her feet he sank. and said. In another incident we see that. although he claims that the latter are descendants of the Amalekites spoken of in Scripture.42). Alternatively. 27 He sank. where he sank. Numbers 24:20-22 Then he looked on Am'alek. mother of Joshua the Messiah (cf." 21 And he looked on the Ken'ite.31 "Most blessed of women be Ja'el. the enemy of Israel. 15:6). Deborah the prophetess and ‘mother’ of Israel blessed Jael in her victory song because of Jael’s courage and resolve in killing Sisera. the Kenites may have intermarried with the Manassites. Sayce notes that the Kenites were nomads like the Bedawin (Bedouin). the fate of the Amalekites and the Kenites was prophesied together in Numbers 24. Lk.

The beginnings of this important city and state are given in the Wikipedia article on Sparta. Solomon ruled with those lands under subjugation for a further 40 years to 938. The rock is thought by some to be Sela. which were later united under one government. This is identified with Hazazon-tamar (dividing the palm tree. the ‘father of history’. and Josephus claim that they were also descended from Keturah. 1005 BCE and ruled there for 33 years. A section of the sons of Kedar and Nabai’oth in northern Arabia near the Euphrates probably moved into the Hellenes on the expansion of David and established Sparta under the rule of Solomon before 950 BCE. It consisted of the four villages of Pitane. Limnai and Konooura. Around the middle of the 6th century BC. cit. … Classical sources [also] tell us that Sparta was founded in the 10th century BC. .) claims that the caves of the Kenites were located around Engedi. in about 733 BCE. 978 BCE. 282B) and Rule of the Kings Part III: Solomon and the Key of David (No. Tristram in The Land of Israel (op. that is. strictly-speaking the city-state of Sparta the capital. We will recall that David conquered Jerusalem and occupied it from Hebron ca. both Herodotus. Earliest archeological evidence testifying settlement in Sparta dates from around 950 BC. also known as Petra. He had occupied the lands of Kedar and of Mesech in Cappadocia and the control of those lands was extended to his son Solomon ca. Sparta controlled much arable land. The territory was divided into two parts. Mesoa. They occupied the better agricultural land of the Hellenes (see also the papers Rule of the Kings Part II: David (No. nest is set in the rock. from Lacedaemon (or Laconia). Unlike other Greek cities. The mention of nest in the rock here is a play on the word ken or qen (SHD 7064) and the tribal name Kenite. How long shall Asshur take you away captive?" (RSV) The northern Kenites (Kain) were thus to be taken captive by the Assyrians. The Spartans Although there is some debate as to the true origin of the Spartans. probably at the same time that the Kingdom of Israel was conquered. 282C)). 22 nevertheless Kain shall be wasted. the southern Peloponnese was Spartan territory. Laconia and Messenia. 20:2) which was originally occupied by the Amorites and is claimed by some to be the oldest city in the world. which were separated by the Taygetos mountain range. 2Chr. They are often referred to as the Lacedaemonians. even older than Hebron with its very long record of continuous occupation.

KING OF THE LACEDEMONIANS. … His uncle also. TO ONIAS. Society The following are further selective extracts from the Wikipedia article. will bring your answer back to us. who would select one of the alternatives by voting. Ephors themselves had more power than anyone in Sparta. a council consisting of 28 elders over the age of 65. Onias. Because most Spartan laws were passed down orally and committed to memory. To him it was that Areus. This letter is four-square. the gerousia. 4) Other references to the Spartans or Lacedaemonians being of the same stock as the Jews are found in Antiquities Book 13: 5. and the two kings. and was accompanied on the field by two ephors. Demoteles.Josephus gave credence to the claimed descent of the Spartans from Abraham when he wrote the following in his Antiquities of the Jews: 10. sent an embassage. being the son of Antiochus the Great. and the seal is an eagle. Onias his son succeeded him in that dignity. although the fact that they only stayed in power for a single year reduced their ability to conflict with already established powers in the state. I285a) … Dating from the period of the Persian wars. king of the Lacedemonians. And [now] Hyrcanus's father. they. At this time Seleucus. SENDETH GREETING. and esteem your concerns as our own. who brings you this letter. … The difference with today's states is that Sparta had a special policy maker. High state policy decisions were discussed by this council who could then propose action alternatives to the Damos. and will look upon our concerns as in common with yours. died. reigned over Asia. We will also do the same thing. were the executive branch of the state. iii. Aristotle describes the kingship at Sparta as "a kind of unlimited and perpetual generalship" (Pol. who are our brethren. the king lost the right to declare war. elected for life and usually part of the royal households. After the ephors were introduced. . with a dragon in his claws. and are derived from the kindred of Abraham (14) It is but just therefore that you. together with the two kings. whereby we have discovered that both the Jews and the Lacedemonians are of one stock. the copy whereof here follows: "AREUS. with an epistle. who was called Soter. should send to us about any of your concerns as you please. "We have met with a certain writing." (Bk. died. 8 and in the apocryphal 1Maccabees 12:6. And when he was dead. and left the high priesthood to his son Simeon. He was supplanted also by the ephors in the control of foreign policy…. little is known about Spartan society. Joseph. chp. Spartan society was considered primitive even by Greek standards. 12. the collective body of Spartan citizenry.

Not all inhabitants of the Spartan state were considered to be citizens (part of Damos). Only
the ones that had followed the military training, called the agoge, were eligible. However, the
only people eligible to receive the agoge were Spartiates, or people who could trace their
ancestry to the original inhabitants of the city. … The Spartan exercised the full rights and
duties of a citizen at the age of thirty.

A strong emphasis was placed on honor and carrying out acts because it was the 'right thing
to do.' Xenophon wrote about the Spartans as he observed them during an Olympic game:

"An elderly man was trying to find a place to sit and observe the Olympic Games, as he went
to each section. All the other Greeks laughed as he tried to make his way through. Some
ignored him. Upon entering the Spartan section all the Spartans stood and offered the
elderly man their seats. Suddenly the entire stadium applauded. All the Greeks knew what
was the right thing to do, but the Spartans were the only ones who did it." (emphasis
added)

Training in music and literature occupied a subordinate position. The tireless emphasis on
physical training gave Spartans the reputation for being “laconic”, economical with words, a
word derived from the name of their homeland of Laconia. Education was also extended to
girls, in the belief that strong and intelligent mothers would produce strong and intelligent
children. Thus modern day historians, with the corroboration of ancient writers, tend to
conclude that Spartan women were among the most educated in the ancient Greek world.

The term "Spartan" still remains synonymous for anyone rigorously self-disciplined or
courageous in the face of pain, danger, or adversity. … Sparta did not suffer under the rule of
any tyrant or dictator, and its phalanxes were considered undefeatable.

Interestingly, we see above that the Spartans were governed by a council consisting of 28 elders
plus the 2 kings, thereby unconsciously(?) mirroring the Inner Council of the 30 Beings in Heaven.

Military
The military prowess of the Spartans was unrivalled. The Battle of Thermopylae of 480 BCE is also
famous. 300 Spartan warriors under King Leonidas held the pass of Thermopylae for a number of
days against the might of King Xerxes’ Persian army (estimated by Herodotus to total 5.28 million
– although modern historians naturally dispute that figure and claim perhaps 400,000) as it was
attempting to invade Greece. 700 Thespian warriors were the only others who fought to the
death alongside the Spartans from a total of 6000 Greeks, the bulk of whom had been ordered to

retreat. Xerxes (the Ahasuerus of Esther) even sent his crack troops the Immortals against the
Spartans – they were also unable to break through. The Spartans were finally defeated by Greek
treachery, although the outcome was inevitable, and the Persians subsequently gained control
over central Greece. Herodotus gives a full account of this battle in his Histories (Bk. VII, 172-234).

The Spartans appear to have had a particular interest in the number 300. G. Rawlinson, in his
notes to the Histories, says that the Spartan bodyguard usually consisted of 300 men (VI, 56). In
Book I, 82 we also find 300 Spartans engaged in mortal combat with an equal number of Argive
warriors in order to determine the outcome of a battle without the main armies having to engage
– thereby limiting the bloodshed.

This common type of early combat was seen when Goliath of Gath challenged any single Israelite
warrior to come out against him (1Sam. 17:4-10); also, when 12 Israelites competed with David’s
12 warriors of Judah in single combat and with far deadlier import than merely rising up “to play”
as in the KJV (2Sam. 2:14-16); again, it was to avoid major bloodshed, although a full-scale battle
did ensue.

In Histories we are told that Aeimnestus the Spartan fought and died “with but 300 men against
the whole force of the Messenians” at a battle near Stenyclerus (Bk. IX, 64). This regular
reference to 300 fighting men may well be that Spartan folklore recalled the act some centuries
earlier of God through Gideon routing their Midianite cousins with the well-chosen band of
Gideon’s 300 men (see Jdg. chapter 7).

The Spartans themselves were a military society and accomplished warriors, so it could be
speculated that, out of admiration for the exploits of Gideon’s 300, they modelled themselves on
such men (see the paper Gideon’s Force and the Last Days (No. 22)). Their military society was
finally to be their undoing. However, until their defeat by the Romans they were unsurpassed.

Immediately before Thermopylae, Xerxes was advised by Demaratus a Greek with the Persian
army: “Thou hast now to deal with the first kingdom and town in Greece, and with the bravest
men” (ibid., VII, 209). Demaratus had earlier said:

So likewise the Lacedaemonians, when they fight singly, are as good men as any in the world,
and when they fight in a body, are the bravest of all. For though they be free-men, they are
not in all respects free; Law is the master whom they own; and this master they fear more
than thy subjects fear thee. Whatever he commands they do; and his commandment is
always the same: it forbids them to flee in battle, whatever the number of their foes, and
requires them to stand firm, and either to conquer or die (ibid., VII, 104; emphasis added).

The Spartan kings were supposedly descended from the hero Heracles (Hercules) who
conquered Sparta two generations after the Trojan War. The Trojan War was in 1054 at the last
years of Eli judge in Israel and two generations later placed them squarely in the rule of David
King of Israel.

Along with the Thracians, Scyths, Persians, Lydians and most Greeks, the Spartans in particular
were known for their love of war and their aversion to trade and ‘handicrafts’ (Histories, II,
167).

It is said that Laconia was eventually overrun by the Goths and Huns arriving from the east, and in
396 CE Alaric destroyed the city of Sparta. Sparta was finally defeated by Rome in about 195 BCE.

The paper titled The Genetic Origin of the Nations (No. 265) gives further information on various
tribes under the heading ‘Sons of Abraham’. To quote:

We know from the authority of Josephus that the Spartans were sons of Keturah. Thus the
large amount of YDNA Hg. I in Greece may be from the Sons of Keturah with the J coming in
later from the conquests in Asia Minor and from the Arabs in later centuries. There are
significant Semitic Hg. J populations around the Mediterranean but I is greater in incidence all
over Europe. Greece also has the largest percentage E3b population outside of Africa.

However, we now know that the IJ combined group based on S2 and S22 split into the two groups
and may have split in Greece also from the one IJ basic group that went in there.

The Druze

Several modern commentators claim that descendants of the Kenites are to be found today
among the Druze people of Lebanon, Syria and Israel.

The Wikipedia article states

The Druze call themselves The People of Monotheism or Muwahhidūn ("Monotheists"). The
origin of the name Druze is traced to Nashtakin ad-Darazi, one of the first preachers of the
religion.

The Druze reside primarily in Lebanon, with smaller communities in Israel, Syria, and Jordan.
While most Druze consider themselves Arabs, some living in Israel do not.[2] There are thought to
be as many as 1 million Druze worldwide, the vast majority in the Levant or East
Mediterranean.[3] However, some estimates of the total Druze population have been as low as
450,000.[4] … About 50,000 Druze live in the United States.

In 1167, noted traveller Benjamin of Tudela wrote about the Druze in his diary. He describes the
Druze as "Mountain dwellers, monotheists, believe in soul transfigurations and are good friends
with the Jews".

The Druze have played major roles in the history of the Levant. They were mostly scattered in the
Chouf Mountains, which are part of Mount Lebanon (known for some time as the Mount of the
Druzes), and later the eponymous Jabal al-Durūz (Mount of the Druzes) in Syria. … However,
many Druze living in the Golan Heights consider themselves Syrian and refuse Israeli citizenship,
while the remainder consider themselves Israeli. In general elections, the majority of Druze
villages have similar voting patterns as the general public. Israeli Druze also serve in the Israeli
army, voluntarily since 1948 …

The Druze community reveres the non-Jewish father-in-law of Moses, Jethro, whom Muslims call
Shu’ayb. According to the biblical narrative, Jethro joined and assisted the Jewish people in the
desert during the Exodus, accepted monotheism, but ultimately rejoined his own people. In fact,
the tomb of Jethro near Tiberias is the most important religious site for the Druze community.[7]

Beliefs of the Druze

The Druze believe in the unity of God, hence their preference for the name "People of
Monotheism" or "Monotheists". Their theology has a Neo-Platonic view about how God interacts
with the world through emanations and is similar to some gnostic and other esoteric sects. They
are not, however, influenced by the Sufi philosophy, as many believe. The Druze believe in
reincarnation and are pantheistic.

The principles of the Druze faith are: guarding one's tongue (honesty), protecting one's brother,
respecting the elderly, helping others, protecting one's homeland, and belief in one God. Another
well-known feature of the Druze religion is a fervent belief in human-only reincarnation for all the
members of the community. They reject polygamy, tobacco smoking, alcohol, or consumption of
pork, although pork and alcohol may be consumed in many non-religious and/or al-Juhl
households. Druze religion does not allow them to intermarry with Muslims, Jews, or members of
any other religions.

The Druze believe in prophets like Adam, Noah (Nū), Abraham (Ibrāhīm), Sarah, Jacob (Ya’qub),
Moses (Mūsā), Solomon (Sulaymān), John the Baptist (Yahya), and Jesus (Isā) (as mentioned
above, in contrast to members of the other monotheistic faiths, they also elevate Jethro, or
Shu’ayb, father-in-law of Mūsā, to the status of major prophet). They also believe in the wisdom
of classical Greek philosophers such as Plato and Pythagoras, who have the same stature as other
prophets. In addition, they have an array of "wise men" that founded the religion in the 11th
century.

...Druze are not required to follow the Muslim duties of prayer, fasting, or pilgrimage to Mecca.
However, they may should they be inclined to. One of the faith's holy books is called the Kitābu l-
Hikma or "Book of Wisdom", largely compiled by a mysterious figure called al-Muqtana. It has six
volumes and is compiled in chapters, each covering a specific issue. The teachings denounce
materialism, especially materialism relative to religion. The sacred books of the Druzes,
successfully hidden from the world for eight centuries, have since the middle of the 19th century
found their way into European libraries. [8]

Druze places of worship are usually very modest and the Ajawīd lead very modest lifestyles.
Prayer is usually conducted discreetly, among family and friends. There is little official hierarchy in
the religious community except for the Shaykh al-‘Aql, whose role is more political and social than
religious. A religious figure is admired for his wisdom and lifestyle. (emphasis added)

(Retrieved from http://en.wikipedia.org/wiki/Druze)

As with Judah and Ishmael, the strict monotheism of the Druze could point to these people being
direct descendants of Abraham by Keturah. And the fact that they venerate Jethro would strongly
indicate descent from this particular priest and prophet of Midian who also appeared well-
acquainted with the One True God. However, much like Christianity, the Druze’s faith has
apparently been infiltrated by Gnosticism and a belief in such ideas as reincarnation.

Their YDNA structure identifies them as the second largest ethnic group with Haplogroup G,
which is 19% and indicated they may have Assyrian bloodlines or they may have developed
Haplogroup G in isolation from the original F. The highest group of G are Georgians, and the
Assyrians are similar. The Georgians might be assumed to be a core of the ancient Assyrians.
However, that will be examined in the paper on the Sons of Shem. The Druze also have 33% L
which is indicative of Japhethite origin. The K2 structure in Lebanon is also Japhethite.

and incidence among Kurds and Druze indicate that the Druze are probably a composite people that relate to the replacements sent in by the Assyrians on the removal of Israel rather than being descended from Jews or Arabs. shows 35% L haplogroup among a sample of Druze. 34 J2. 4K*. 7 P*(xR1) Compare these with the samples of Malta and Sicily. 4 I. 12% (F*xIJK. Prophecies concerning the sons of Keturah Midianites As the most ubiquitous descendant of Abraham by Keturah. 10 F*. The Kurds are Medes with some composite mixture. 25% J2. (See also Psalm . 5 K*(xP) Christian Lebanese (43 p) 16% E3b. before the main Aryan conquests ca. 22 R1b Reconstruction of patrilineages and matrilineages of the Samaritans by Shen et al. 8 JxJ2. K2 also in Lebanon is derived from Tarshish traders in Phoenician systems. 32 R1b Sicily (200p) roughly averaging: E3b 23%. Cutheans and Medes placed in Israel by the Assyrians after the capture and deportation of the ten tribes of Israel in 722 BCE. shows some L in Kurds but not in Jews or Arabs. 21 J2. but no L among Jews or Palestinians.Some samples of Lebanese YDNA are as follows (from Capelli 2005): Muslim Lebanese (39 people) 18% E3b. 21 J2. that is. Thus the Druze are probably descended from the Assyrians. Midian is mentioned three times by the prophet Isaiah. G). Malta (90p) 9 E3b. 4 K*. 30% JxJ2. 1000 BCE at the time of David. 6 I. on the other hand. 6 F*. 9 JxJ2. 12 I. The references to Midian in Isaiah 9:4 and 10:26 are in a negative light and concern the punishment meted out to his descendants as an example to Israel. The Samaritan results. were similar to the Jewish results but just as varied. The Druze are thus not homogenous sons of Abraham. 18 F*. The Y chromosome of Jews The Y Chromosome of Jews by Nebel et al. 6 JxJ2. They appear to be related to the Aryans that went into India and formed the L Haplogroup there from as early as the Assyrian contact at Harappa and Mohenjo Daro. 4 K*.

rays flashed from his hand. p. 6 He stood and measured the earth. Vol. Burton suggests that Cushan is possibly a more general term equivalent to Midian.. in wrath remember mercy. in the midst of the years make it known. Cohen (Interp. 1. Selah 4 His brightness was like the light. and the lands near there were traditionally called the Kingdom of Khus or Cush. In the midst of the years renew it.. making mischief. 265) 2nd ed. 751) also holds this view and says it may be an older and poetical name for Midian based on the presence of tribes descended form Cush. and the Holy One from Mount Paran. as linked by Habakkuk 3:7. then the eternal mountains were scattered. Dict. do I fear. which ties in with the Arab conception of Keturah being a Cushite woman. I have heard the report of thee. Surah 29:36 And unto Midian We sent Shu'eyb [Jethro]. and look forward to the Last Day. O LORD. 2 O LORD. he looked and shook the nations. and thy work. He thinks it is probable that the word Cushite applied to the wife of Moses does not mean Ethiopian but rather refers to the Midianitess (Num. Habakkuk 3:1-7 A prayer of Habak'kuk the prophet.). and the earth was full of his praise. His glory covered the heavens. and plague followed close behind. their brother. 12:1). . Cusham-Rishathaim) thinks the term is most likely related to a Midianite tribe near Edom. one in particular speaking of the end times. Kraft (ibid.) The Qur’an also has many injunctions directed at the Midianites. in the earth. art. ‘Cushan’. 3 God came from Teman. His ways were as of old. according to Shigion'oth. and there he veiled his power. He said: O my people! Serve Allah. (RSV) As noted earlier. 5 Before him went pestilence.83:1-18. art. There is also a connection with the Land of Midian. the curtains of the land of Mid'ian did tremble. The early YDNA of the Cushites is from HG C and develops from there but the YDNA groups of the Arab sons of Keturah and Midianites are not C or E3b but Semitic haplogroups (see the paper Genetic Origin of the Nations (No. the everlasting hills sank low. and do not evil. The term is also used to refer to the Kassites of Babylonia. (Pickthal) The Book by the so-called minor prophet Habakkuk contains a prophecy concerning the coming of Messiah in great glory. 7 I saw the tents of Cushan in affliction.

The power and wealth of this area lies in the hands of the Arabs. (RSV) They are mentioned as coming from Sheba which we now know is in Southern Arabia and was once the great oasis fed by the immense dams that deteriorated just as the Romans reduced Sheba in power by their occupation of Arabia and the dominance of trade. Here we see that Ephah and Midian are listed as two separate tribes. but the LORD will arise upon you. The third mention of Midian by Isaiah is in chapter 60. and I will glorify my glorious house. and shall proclaim the praise of the LORD. 4 Lift up your eyes round about. because the abundance of the sea shall be turned to you. and your daughters shall be carried in the arms. They disappeared and consequently the Historians at that time thought they were a myth. your sons shall come from far. and thick darkness the peoples. Matthew Poole states that Ephah. and see. the young camels of Mid'ian and Ephah. the rams of Nebai'oth shall minister to you. they come to you. and is also prophetic. They shall bring gold and frankincense. all those from Sheba shall come.). Q and C3 in that order of incidence. 2 For behold. for your light has come. they all gather together. shine. 6 A multitude of camels shall cover you. The tents of Kedar and Nabaioth were in the northwest and extend to the Euphrates. The confusion with the early Midianites probably comes from the association of the Hyksos. and the glory of the LORD has risen upon you. your heart shall thrill and rejoice. darkness shall cover the earth. and kings to the brightness of your rising. 10:8). cit. . 2:13. Gen. son of Midian.The Historians’ History of the World points to the complex problem of the Cushites being both in Ethiopia and the Sudan and in Babylonia by pointing out that the confusion stems from the fact that the tribe in Babylonia was the robber tribe of the Kasshu or the Kossaeans and they dominated Babylonia for centuries. which we have identified now as the sons of Keturah and not the sons of Ishmael. they shall come up with acceptance on my altar. and his glory will be seen upon you. We now know from DNA that a branch of the same C YDNA groups have spread all over the world from Asia to Australia and to New Zealand and Polynesia and to the Mongols and into the Americas with the Nadene or Chippewa and down to the Apache and even to some sections of the Mayans who are Q3. He also makes an interesting comment on Isaiah 60:6. The Bible identifies them with the African branch also (cf. 5 Then you shall see and be radiant. op. the wealth of the nations shall come to you. 3 And nations shall come to your light. Isaiah 60:1-7 Arise. “dwelt beyond Arabia” (A Commentary on the Holy Bible. of which the Edomites and the sons of Keturah were no doubt part. nomadic marauders. 7 All the flocks of Kedar shall be gathered to you. The sluice gates are still there but the wall has never been rebuilt.

We have no vineyard or field or seed. also or even the dromedaries. to which are the better enabled. and all his sons. and other rich treasure.e. but you shall live in tents all your days." (RSV) Jonadab or Jehonadab (meaning Jehovah is willing. "We will drink no wine. and I said to them. the like phrase with that Judg. (SHD 3082 and 3122). son of Habazzini'ah. who were a branch of the Kenite tribe of which Jethro was the most eminent member. and speak with them. they can endure thirst four days together: (op. which are lesser sort of camel. neither you nor your sons for ever. this being the creature the Eastern people used for carriage of their gold and spice. our wives. as Pliny observes. 5:21). for Jon'adab the son of Rechab. `You shall not drink wine.vi. or. the abundance of wealth and treasure that is brought upon camels. king of Judah: 2 "Go to the house of the Re'chabites. Those concerning the Kenites are found in Jeremiah 35. 11 But when Nebuchadrez'zar king of Babylon came up against the land. the man of God. Kenites and Rechabites Some of the descendants of Midian. to drink no wine all our days. 9 and not to build houses to dwell in.5: or whereby is understood those people that did use to ride on camels. Jeremiah 35:1-11 The word which came to Jeremiah from the LORD in the days of Jehoi'akim the son of Josi'ah. that you may live many days in the land where you sojourn. and his brothers. which was near the chamber of the princes. emphasis in bold added). Job 1:3 also mentions camels when describing Job’s great wealth (see also 1Chr. `Come. you shall not sow seed. and by them is implied the coming in of all nations unto Christ. so called from their swiftness in running. as the Arabians and the bordering countries. because. was noted as a reformer who kept himself pure” (Key Word Study Bible)." 3 So I took Ja-azani'ah the son of Jeremiah. above the chamber of Ma-asei'ah the son of Shallum. and have obeyed and done all that Jon'adab our father commanded us. our father. and cups. commanded us. Bullinger also . 7 you shall not build a house. which are said to cover them. into one of the chambers." 6 But they answered.' 8 We have obeyed the voice of Jon'adab the son of Rechab. are mentioned in certain end-time prophecies.. you shall not plant or have a vineyard. cit. ourselves. then offer them wine to drink. our sons. i. and bring them to the house of the LORD. keeper of the threshold. namely the Kenites and Rechabites. 4 I brought them to the house of the LORD into the chamber of the sons of Hanan the son of Igdali'ah. and therefore they are brought in as presenting the chiefest commodities of their respective countries … The dromedaries. The multitude of camels.' So we are living in Jerusalem. or our daughters. "Drink wine. in all that he commanded us. as “a later descendant of Rechab. and the whole house of the Re'chabites. This prophet was told to go to the house of the Rechabites. and let us go to Jerusalem for fear of the army of the Chalde'ans and the army of the Syrians. 5 Then I set before the Re'chabites pitchers full of wine. we said. hence these animals appear indicative of riches generally in a Middle-Eastern context. our father. for by these and such-like figuratively and borrowed expressions in several verses of this chapter is particularized several nations. 10 but we have lived in tents.

summed up the semi-nomadic life of the Patriarch and. In 1839. Their Patriarch Abraham was described as a Hebrew (Gen. Abraham was not descended from Aram but from Arphaxad. not idolators. A Kenite tribe. who embodies in his upbringing a message he will come to represent: the perpetual stranger in a strange land. who migrated with Israel to Canaan … They were proselytes. However. Wolff found a tribe near Mecca in Arabia which claimed to be descended from J[eh]onadab. and the Arabs are not sons of Aram. others not) thus: Abraham is not a settled man. the pious who finds a palliative in God for his endlessly painful life. as we see above. He was a man of Ur of the Chaldees in Akkadia. the landless who longs for land. 14:13). or a wandering man. It is possible that both are correct in their assumptions due to the habitual wandering of these people. 14:2). Several distinctive features of the Rechabites are that they would build no homes and plant no crops. In the sense it is used of Jacob it means Highlander or someone coming from the Syrian plains and the hills of Canaan. 21) We see from verse 2 in Jeremiah 35 that God calls for the Rechabites to be brought into His House. inhabiting the wilderness south of Judah. Jn. Dr. Bullinger says of the Rechabites: They were descended from Hobab. London. in which there are many chambers (cf. . (p. a Bedouin tribe located near the Dead Sea also professed to be descendants of the same Kenite sheik. as we saw earlier in 2Kings 10. Bruce Feiler.] of Moses.says that Jonadab became the sheik and lawgiver of the Rechabites. He states. ‘Aram (SHD means the highland or elevated plain and also was the name given to the son of Shem. by inference. in his book Abraham: In Search of the Father of Civilisation (Judy Piatkus (Publ. Aram does not mean semi- nomad.) Ltd. that verses 1-11 represent Jeremiah’s 30th prophecy in a series (The Companion Bible). 26:5). but rather would live a nomadic lifestyle. incidentally. He’s a combination. The assumption that the term Arab derives from Aram is incorrect. his descendants (some of whom would be settled. Jacob was described as a Syrian or Aramaean (Deut. the outsider who longs to be the insider. the brother-in-law [sic. 2002). It must be remembered that Jehonadab of the Rechabites assisted Jehu king of Judah in the destruction of the Baal system in Judah. The real progenitor and the source of the name as a pure identity are with the son of Jokshan. On verse 2.

I have called to them and they have not answered. The Liyatheneh retain not only the distinctive physiognomy. Palmer. Will you not receive instruction and listen to my words? says the LORD. whose observances are really more Sabaean than Muslim. who explored much of the Sinai Peninsula.. the God of Israel: Go and say to the men of Judah and the inhabitants of Jerusalem. for they drink no wine and dwell in tents. The Kheibari are still found in large numbers about Mecca and Medina … by Dr Wolff and other learned travellers they have been identified with the Rechabites mentioned in Jeremiah xxxv. 188)) – apart from applying to those in former times who were under a God-ordained Nazirite vow. 16 The sons of Jon'adab the son of Rechab have kept the command which their father gave tem.H. but you have not listened to me. thus says the LORD.7 … This precept. they are laxer in their religious discipline than even the Bedawin themselves. 432-433) Continuing with the text in Jeremiah: Jeremiah 35:12-17 Then the word of the LORD came to Jeremiah: 13 "Thus says the LORD of hosts. and a branch of the Kheibari Jews. which is in effect that they should assimilate their mode of life to that of the Arabs amongst whom they dwelt. they have obeyed to the present day. saying. The modern Rechabites will most certainly be required to break their vow concerning abstinence by partaking of a small amount of wine at the annual . has been kept.' But you did not incline your ear or listen to me. such as wearing the Pharisaic love-locks. but many of the customs of the Jews. Although professing themselves to be Mohammedans. for they have obeyed their father's command. 14 The command which Jon'adab the son of Rechab gave to his sons. the God of hosts. I am bringing on Judah and all the inhabitants of Jerusalem all the evil that I have pronounced against them. a lineal descendant of Ka’ab. the God of Israel: Behold. E. who resided near Mecca and played so important a part in the early history of Islam. cit. and they drink none to this day.In The Desert of the Exodus. 15 I have sent to you all my servants the prophets. pp. and do not go after other gods to serve them. because I have spoken to them and they have not listened. `Turn now every one of you from his evil way. and then you shall dwell in the land which I gave to you and your fathers. which is generally unbiblical and unnecessary (cf." (RSV) The purpose of referring to Jonadab’s prohibition on drinking wine by his people throughout their generations was not to condone this stricture. 17 Therefore. the paper Wine in the Bible (No. to drink no wine.6. and amend your doings. The immediate neighbourhood of Wady Musa is in the hands of Fellahin called the Liyatheneh … They are the sons of Leith [lion: Arabic]. gives his opinion as to the identity of the Rechabites and their descendants. but this people has not obeyed me. sending them persistently. I have spoken to you persistently. (op.

"Thus says the LORD of hosts. John 6:53-54 So Jesus said to them." (RSV) This is a signal honour for the Rechabites in having at least one of their descendants standing before the Lord forever. and done all that he commanded you. also 1Cor. 15:19). To stand before someone is obviously to enjoy special favour from them. 16:22) and Moses and Samuel did with God (Jer. 10:8) to perform service as a type of first-born of all the children of Israel. (RSV) Having already demonstrated their compliance with a relatively minor injunction from their earthly father Jonadab. cf. And God says He requires obedience (from the heart) rather than the sacrifice of rams (from the hand only). as David did with Saul (1Sam. along with the prophet Elijah (1Kgs. 1:13-14). New Moons and Holy Days. were not obedient to God in many other respects (see Isa. unless you eat the flesh of the Son of man and drink his blood. you have no life in you. the God of Israel: Jon'adab the son of Rechab shall never lack a man to stand before me. and I will raise him up at the last day. The tribe of Levi was similarly required to “stand before the Lord” (Deut. otherwise they have no place in the Churches of God or in the First Resurrection. I say to you. as in obeying the voice of the LORD? Behold. also Jer. as Christ himself said in John 6 (cf. to obey is better than sacrifice. 11:25). "Has the LORD as great delight in burnt offerings and sacrifices. 19 therefore thus says the LORD of hosts. the Rechabites would perhaps have fewer problems than most. the God of Israel: Because you have obeyed the command of Jon'adab your father. 18:15). for all their apparent piety and devotion in performing the requisite animal sacrifices on Sabbaths. truly.Lord’s Supper. 15:1. and to hearken than the fat of rams. . "Truly. 54 he who eats my flesh and drinks my blood has eternal life. 1Samuel 15:22 And Samuel said. (RSV) Rather. and kept all his precepts. It is noteworthy that they have already been given a high-value reward. with unquestioning obedience to God the Father once they are awakened to or become reacquainted with His Laws. Jeremiah 35:18-19 But to the house of the Re'chabites Jeremiah said. the obedience of the Rechabites was mentioned in order to shame Judah and Benjamin who.

and from the Negeb. cereal offerings and frankincense. and gold itself was found in abundance in the ancient Land of Midian. A Call to Keturah’s Sons The tribes mentioned above are but a select few of those extant today that are descended from Abraham and his wife Keturah. As recorded in Matthew 2:1-11.Jeremiah speaks of a future time which resonates with that spoken of by another great prophet in Isaiah 2:1-5. . hence an altogether strong Midianite connection. Jeremiah 17:26 And people shall come from the cities of Judah and the places round about Jerusalem. the “wise men” or magos of the East (to which vague area Keturah’s sons had been sent centuries earlier) arrived after Christ’s birth to present him with gold. frankincense and myrrh. On current science. Huns The Huns have sometimes claimed to be descended from the sons of Keturah although their YDNA structure is predominantly N. These two most important spices were traded in early times by Arabians including Jokshan and Midianite merchants. they will be part of this calling. The prophecy of Isaiah may well refer also to these men of Jokshan who dwelt in Sheba just before the dam was destroyed. from the Shephe'lah. bringing burnt offerings and sacrifices. (RSV) This verse seems to speak primarily to Judah (also encompassing Benjamin and Simeon). We saw also in Judges 8:27 that the captured gold of Midian was used by Gideon to make an ephod. and then by assisting the end-time work of publishing the Gospel to all nations starting with their respective tribes in the House of Abraham. as is the Finns’. the Kenites were known to be occupants of the Negeb. It would have to be demonstrated that K was a composite of Shem and Japheth for this to be even plausible. from the land of Benjamin. along with the Jews and the Cherethites (Philistines). and bringing thank offerings to the house of the LORD. the majority remaining largely undiscovered. N is a derivative of F though K and related to the known sons of Japheth probably through Togarmah from its distribution. as the various areas mentioned equate roughly to the four quadrants of the extended land of Judah. from the hill country. As descendants of Keturah and a sub-tribe of Midian. including the Negeb desert. However. All have their part to play by firstly responding to the call for a return to God and His Laws.

. ‘My husband’ [Heb. and no longer will you call me. 60:6 above). 4:14) for close on 4000 years (on “a thousand years is as a day” basis) and presumably would therefore have a great thirst for the Spirit of God in these Latter Days – together with the rest of mankind. (RSV) Like all other sons of Abraham and followers of Christ no matter from what tribe or nation. their dealing with the spirit world as “fortune-tellers” and become instead true prophets and servants of the God Most High. but with broad application to all who are willing to return to God. Ishi]. naturally. Lamentations 3:45-46 Thou hast made us offscouring and refuse among the peoples. 4:13). has been without the “water springing up to eternal life” (Jn. ‘My Baal’ [Baali]. father-in-law of Moses.If we accept Pliny’s observation that dromedaries can endure thirst for up to four days (see Poole’s comment on Isa. which to the Roma sounds depressingly familiar. It is no permanent hardship to be an outcast or a “wanderer among the nations” (Hos. This may be the time for those of Kenite descent to embrace and preach the true religion as zealously as did their ancestor Jethro. who appears to have been directly commissioned by God. The Druze and all Islam have to alter their ways also. we could apply it spiritually and say that most of Midian. With respect to the plight of the Druze and the Roma or Gypsies. you will call me. (RSV)] Just as Israel was typified by idolatry. for this also is said of God’s beloved Israel – as long as the wandering results in all people finding their way back to Him. 46 "All our enemies rail against us. In Hosea a call is made ostensibly to Israel. the off-scouring of all things” (1Cor. Paul said that the true apostles and people of God are also considered “as the refuse of the world. Hosea 2:16 And in that day. the Roma would be required to put aside their false gods. whether or not they might be sons of Keturah or otherwise we see that God very often favours the outcasts and weak of this world. or any of the sons of Keturah for that matter. it is prophesied that the descendants of these same people will one day remember God in far countries (Zech. says the LORD. 9:17). And the prophet Jeremiah noted that God’s people were often brought low and made contemptible in the sight of others. 10:9).

" 14 But how are men to call upon him in whom they have not believed? And how are they to believe in him of whom they have never heard? And how are they to hear without a preacher? 15 And how can men preach unless they are sent? As it is written. the end-time Churches of God. "every one who calls upon the name of the Lord will be saved. 6 being ready to punish every disobedience. to follow the example of your mother Keturah’s piety and nobility. Descendants of Abraham Part V: Judah . 4 for the weapons of our warfare are not worldly but have divine power to destroy strongholds. Romans 10:12-15 For there is no distinction between Jew and Greek. the same Lord is Lord of all and bestows his riches upon all who call upon him. 2Corinthians 10:3-6 For though we live in the world we are not carrying on a worldly war. 5 We destroy arguments and every proud obstacle to the knowledge of God. "How beautiful are the feet of those who preach good news!" (RSV) You Sons of Keturah are called to return to the One True God whom your fathers knew. the father of all nations now being brought into the House of God. and as lovers of law. 13 For. when your obedience is complete. Once informed of the truth and fully convinced of it. Allied with their remarkable military prowess – demonstrated in the fierce defence of their nation against overwhelming might – it seems likely that their descendants would make unrivalled soldiers in the army of the Lord. and take every thought captive to obey Christ.Those of Spartan descent may have retained their forebears’ nobility of spirit and sense of knowing and (more importantly) of doing what is right (as in the example of giving place and honour to an old man at the Games). and live up to her name by becoming a truly sweet aroma to your Father in Heaven. they would presumably act upon it and help carry the message without fear or favour to their fellow Keturites and beyond. and to eventually become known as ‘friends of God’ like your illustrious and blessed Patriarch Abraham. (RSV) The skills of the Spartans could be put to better use spiritually in the service of God today.

The blindness that came upon Judah is detailed in the paper War with Rome and the Fall of the Temple (No. The sequence was done in accordance with prophecy we see from Daniel regarding the Temple and as explained in the paper The Sign of Jonah and the History of the Reconstruction of the Temple (No. and the Messiah had to be killed in accordance with prophecy. Descendants of Abraham Part V: Judah Introduction It is a matter of Scripture that Judah will be converted in the Last Days and the hardening of their hearts will be removed. The sequence of the changes of Judah’s beliefs and the trials they have suffered when seen in context of Scripture and prophecy are recognisable as fitting into the overall structure. 298). Soon they will repent and their eyes will be opened.Scripture tells us that a hardening came over the hearts of Judah and that in the Last Days they will turn and be converted so that Messiah might return to his own people and his own inheritance. 13). Judah had to be removed from Israel and the physical Temple destroyed because of their blindness on the first part and the Plan of God in relation to the Temple on the second part. In the Last Days the blindness will be lifted and the Holy Spirit will be poured out on Judah so that they are converted and the Plan of God is implemented. . A hardening came upon the hearts of Judah. They need not have suffered as much outside of the Plan of God but they are a stiff-necked people and a hardness did come upon their hearts.

but Cromwell himself gave permission in 1656. The Jews in England The year 2006. Judah will survive and they will overcome and be restored. that Jews in Britain received full and equal rights as citizens. Saints’ days and other non-biblical holy days. those nations. had been by edict of King Edward I enacted on All Saints’ Day in 1290. or 29/120. In the same way. hence there was no actual law of expulsion to revoke. freedom of religion – including their own synagogues and cemeteries. Their expulsion. and the nations allied with. including Egypt. sought to readmit the Jews for a number of reasons. Persia. 10:34-35). Many of his fellow . merchants and clergymen were in fact opposed to the idea. In 1655 he presented a petition to the Council of State in England asking that the Jews be granted freedom of trade. 294)). However. no decision was made by the committee formed to look at the question of their readmission. Their story is Scripture and Scripture cannot be broken (Jn. Their readmission came about mainly through the efforts of one man. prophecy deals with the Church and with the other nations surrounding the Holy Land. who died in 1658. or placing themselves in league with. however. There has always been a question of freedom and persecution for Jews. Cromwell and his Puritans had also sensibly supported an earlier parliamentary ban on the celebration of Christmas. For an example of their handling we will turn to England. The prophecies cover the Middle East. It was noted that the ban by Edward was by royal prerogative only and not by any Act of Parliament.They still have a number of trials to endure (see the paper War of Hamon-Gog (No. lasting about 366 years. Most of the members of that committee of judges. England was thus the first European country to formally expel the Jews following several hundred years of persecution. Rabbi Menasseh ben Israel of Amsterdam. and the right to operate under Mosaic Law – and calling for the revocation of all anti- Jewish laws. marked the 350th anniversary (equal to 7 Jubilees) of the decision by Oliver Cromwell as Lord Protector to readmit the Jews to England. However. It wasn’t until over 200 years later in 1858. Cromwell.

There are more Jews in the USA than in Israel and the US and British Commonwealth is the true home for the majority of Judah today.000 Jews in the UK. founder of the Anglo-Jewish Historical Society. frankly. but the discovery that Jews recited a Prayer for the Royal Family at every Sabbath service. It is ironic that Israel and Australia are grouped together in the same division of the world by the Rome agreements. Someone who visited the Sephardi Synagogue in Creechurch Lane.the first Jewish worship she had attended . the Jews had set up business in Amsterdam and had been instrumental in making the city one of the busiest ports in the world at that time. Expelled earlier from Spain and Portugal during the Catholic Inquisition. part of which reads as follows. The primary reason was apparently for straightforward commercial advantage. Lucien Wolf. wrote early in the 20th century on what he considered was the motive for readmission: “It was really the deficiency of bullion in the country which. When the late Princess Margaret visited Maidenhead Synagogue ten years ago . although. while for others it was a matter of political expediency. In The Times (London) of 1 June 2002. Bevis Marks. remains the oldest in Britain today.” In October 1663.” And settle they did. some kings and queens have deserved it less than others. they did build booths on the other side of the Thames and keep the Feast of Tabernacles in them. London in 1662 was told: “One year in Oliver’s time. the famous diarist Samuel Pepys also visited this Sephardi Synagogue. … It is not just the present Queen for whom the Jews have prayed. Following Cromwell’s decision many of these Sephardi and other Jews began moving to England and reintroducing some aspects of Torah-observance to Britain. Today there are about 300. Since their formal readmission. the immediate successor of which. Rabbi Jonathan Romain wrote an article entitled ‘Pariahs. in ever-growing numbers. it has been a long-standing tradition to ask for God’s blessing on the monarch as the symbol of national stability.she admitted afterwards that what had amazed her most was not the Hebrew or the rituals. as early as 1643 … suggested to Cromwell the desirability of settling Jewish merchants in London. . as there was a lucrative trade operating between Holland and England at the time and the Jews were recognised as master traders and merchants who could facilitate that trade. In that sense the Jews are being reunited with Israel and the nation called Israel is really a section of the Commonwealth. out of an estimated 13-14 million scattered throughout the world.Puritans had a sincere interest in the Hebrew language and literature and felt a certain sympathy for the ‘people of the Old Testament’. the Jews have become fully integrated into British society and have proven themselves loyal servants of the Crown and an invaluable asset to the country in a great number of ways. heroes and a loyal people: how England’s monarchs saw their Jewish subjects’.

but for now they are more than happy to join in the acclaims of ‘Long live the Queen’ (emphasis added). so that the year 1977 was her official jubilee (albeit a silver one.org/Sabbath/2004/S_07_03_04. levying punitive taxes on the Jews … For her part. who shall come forth from your body. when a settled community was established here after he brought across Jews from Normandy to help colonise his new kingdom. giving Jews rights of residence and protection. The relationship between the Crown and the Jews started with William I. … Subsequent kings abused this special power. 33:17).htm Many royals know this fact. As a point of interest. with Anglo-Saxons wishing to be rid of him and his own nobles vying for power. They were seen as a trustworthy element in an otherwise unstable population. Perhaps unknowingly. as it has been proven that members of the present Royal Family are direct descendants of King David of Israel and are therefore of the tribe of Judah. See the paper From David and the Exilarchs to the House of Windsor (No. Elizabeth II has treated her Jewish subjects as they would wish: exactly the same as everyone else. the present Queen. David’s everlasting throne Both kings David and Solomon were told that the throne they had been given would be everlasting (2Sam. and I will establish his . with Orthodox and Progressive rabbis participating alongside other religious leaders. Their relations with William II were even more cordial and he even jested that he would consider converting to Judaism if they could out-debate his bishops . responsible directly to the Throne and belonging to it.much to the horror of the latter. 7:13. The majority of the subjects of the Crown. the Jews are actually praying for their own kin. I will raise up your offspring after you. Queen Victoria (reigned 1837-1901) was fully aware that she occupied the throne of David. Jer. The first year of the new jubilee in 1978 was the beginning of the true 120th Jubilee of God’s Calendar.ccg.e. as there is a genealogical table in Windsor Castle actually showing their descent from King David. This definition held many advantages. Elizabeth II. however. a half jubilee). Such dedication and respect for the Monarchy is rarely to be seen among the most loyal of her other subjects. Christian or otherwise. Her silver jubilee coincided with the true year of Jubilee.org/_domain/ccg. … Most Jews would be delighted to see a multi-faith element to any future coronations. i.16. began her reign in February 1952. As newcomers to the country. 67) and the Sabbath Message 16/4/27/120 at: http://www. 2Samuel 7:12-17 When your days are fulfilled and you lie down with your fathers. remain in ignorance to this day. the Jews … were formally declared to be “the chattels” of the Crown. although it was never put to the test.

and his testimonies. walking in his ways and keeping his statutes. 'If your sons take heed to their way. The latter have not been repealed for the last two thousand years since the death of Messiah. I will chasten him with the rod of men. to walk before me in faithfulness with all their heart and with all their soul. 4 that the LORD may establish his word which he spoke concerning me. verse 45 of 1Kings 2 suggests the throne would be established forever from its inception. his throne as long as the sun before me. 16 And your house and your kingdom shall be made sure for ever before me. Rather. but the promise regarding the continuity of the royal line on Israel’s throne would never be revoked. your throne shall be established for ever. I will not lie to David. with the stripes of the sons of men. 2 "I am about to go the way of all the earth.'" 17 In accordance with all these words. In verse 14 of 2Samuel 7 above. 3 and keep the charge of the LORD your God. 132:11-12). irrespective of obedience by the kings (and queens) who would ascend it. However. Nathan spoke to David. Be strong. 6:16. both the royal line on the throne and God’s royal Law have been in continuous operation from their inception.' … 45 But King Solomon shall be blessed. 15 but I will not take my steadfast love from him." (RSV) An analogy can be made between the throne of David and God’s Laws. and in accordance with all this vision. 2:1-4." (RSV) And again in the Psalms: Psalm 89:35-37 Once for all I have sworn by my holiness. as I took it from Saul. and show yourself a man. 14 I will be his father. 37 Like the moon it shall be established for ever. in the coming Kingdom of God. as Scripture unequivocally indicates they will.45 When David's time to die drew near. and I will establish the throne of his kingdom for ever. and he shall be my son. his commandments. (RSV) It could be inferred from some Scriptures that total obedience to God and His Laws was required for the promise to remain in force regarding the physical throne of Israel (e. When he commits iniquity. 1Kings 2:1-4. and the throne of David shall be established before the LORD for ever. he charged Solomon his son. kingdom. . that you may prosper in all that you do and wherever you turn. saying. since the captivity of Judah in 586 BCE). 13 He shall build a house for my name.e. Ps. 1Kgs. Neither has the physical throne of David disappeared for 2600 years or so (i. it appears that Solomon and the kings after him would be chastised severely for their sins. whom I put away from before you. as it is written in the law of Moses. there shall not fail you a man on the throne of Israel. his ordinances. 2Chr. it shall stand firm while the skies endure. 36 His line shall endure for ever.g. only to become enforceable. saying. only to reappear when Messiah comes to take up his kingship.

as alluded to in a recently-released film The Queen. and Jacob. and will have mercy upon them. Royal obligations This royal aspect brings with it certain privileges as well as duties. who have performed the continuous spiritual service since the Holy Spirit was given in the new era. 15 In those days and at that time I will cause a righteous Branch to spring forth for David. Day and night have come at their appointed time with absolute certainty since the Earth was renewed. vv. and he shall execute justice and righteousness in the land. so that he shall not have a son [or sons] to reign on his throne. of which the Levitical was only a temporary subset. and to make sacrifices for ever. hence God’s covenant concerning them has never been broken – and neither has His covenant of putting an unbroken line of David’s descendants on the throne of Israel (cf. in the same way that the present Royal Family has obligations to the United Kingdom and the entire Commonwealth. We see also that the Levitical priesthood is never referred to as royal. starring Helen Mirren in the title role. so I will multiply the descendants of David my servant. unlike that of Melchisedek (1Pet. says the LORD. 18 and the Levitical priests shall never lack a man in my presence to offer burnt offerings. God offers a challenge in verses 20 and 21. 26 then I will reject the descendantsof Jacob and David my servant and will not choose one of his descendants to rule over the seed of Abraham. If there are any ‘privileges’ of royalty they are ones associated with selfless dedication and service to the nation. 2:9). And this is the name by which it will be called: 'The LORD is our righteousness. so that day and night will not come at their appointed time. Jeremiah 33:14-26 "Behold. For I will restore their fortunes. and the Levitical priests who minister to me. The elect in fact are of the superior Melchisedek priesthood. 2:8). ." 23 The word of the LORD came to Jeremiah: 24 "Have you not observed what these people are saying. Isaac. 'The LORD has rejected the two families which he chose'? Thus they have despised my people so that they are no longer a nation in their sight." 19 The word of the LORD came to Jeremiah: 20 "Thus says the LORD: If you can break my covenant with the day and my covenant with the night. The Law of God is similarly called royal (Jas. of noblesse oblige. which the present Queen in particular has consistently demonstrated. The Levitical priesthood mentioned is now (since the destruction of the Temple at Jerusalem) the elect among the Churches of God. 25-26). 25 Thus says the LORD: If I have not established my covenant with day and night and the ordinances of heaven and earth. when I will fulfil the promise I made to the house of Israel and the house of Judah. She was born to a job she never wished for and which is thankless at the best of times. to burn cereal offerings. 22 As the host of heaven cannot be numbered and the sands of the sea cannot be measured. 21 then also my covenant with David my servant may be broken. the days are coming." (RSV) In anticipation of widespread scepticism.' 17 "For thus says the LORD: David shall never lack a man to sit on the throne of the house of Israel. 16 In those days Judah will be saved and Jerusalem will dwell securely. and my covenant with the Levitical priests my ministers. which currently consists of about 54 nations and is undoubtedly the Ephraimite company of nations spoken of in Genesis 48:19.

just as average. Rabbi Harold S. might consider themselves to be superior to other people: What does it mean for us as Jews to consider ourselves a “chosen people”? It certainly does not mean that we think we are better than other people. Those whom the world despises. has helped them to literally make ‘the desert bloom as a rose’ in the State of Israel. However. art and music (both as composers and performers). A child of slaves can be greater than a prince. I was a congregational rabbi for thirty years. They thereby invite envy if not outright hatred from less-energetic and less-creative peoples.The Chief Rabbi of the United Hebrew Congregations of the Commonwealth. for instance. and to the law. It’s moral courage. Only by being true to his people and to God did he become a hero. Had Moses been an Egyptian prince. They are about recognising God’s image in the weak. and if there is one thing I know beyond the shadow of a doubt. The Bible suggests that royalty isn’t about privilege and wealth. to invention and commerce. Freud [author of Moses and Monotheism. God loves. It’s not power that matters. … the story of Moses is one of the great narratives of hope in the literature of mankind (The Times (London). dealing professionally with Jewish families. Professor Jonathan Sacks. who together account for only about 0. From an objective and unprejudiced viewpoint we see that the Jews. bar none. God’s standards are not power and privilege.23% of the world’s population. in marked contrast with many of its neighbouring states. Judah’s pre-eminence As mentioned earlier. 1993). had something to say about things ‘royal’ from a biblical perspective. he would have been eminently forgettable. just as imperfect as anyone else. it is that Jews are just as flawed. and fighting for their cause. There is no claim of Jewish biological superiority … We have no way of knowing how many of today’s Jews are the pure biological descendants of Abraham and Sarah. NY. about 25% of the world’s scientists have been Jewish). splendour and palaces. either individually or collectively. as a result of their accomplishments. finds greatness. from science and medicine (since the mid-1800s. the suffering. had this to say about the Jews who. Kushner. 23 June 2001). They have been pioneers in virtually every field. the Jews have made an enormous contribution to the UK and most other countries as well. though we are all their spiritual descendants. the afflicted. in his book To Life! A Celebration of Jewish Being and Thinking (Warner Books. but the fight for justice and freedom. in discovering that he is the child of slaves. must surely rank as the most talented and productive group of people. Moses. … . in which he tried to prove that Moses was actually an Egyptian] … failed to see that he had come face to face with one of the most powerful moral truths the Bible ever taught. They possess natural intelligence and great energy which. the powerless.

49:9). The tribe of Simeon also came to be incorporated or enfolded into Judah’s territory (Jos. 265) 2nd edition. But it is a historical fact that the Jews. and were the first to move out of the camp following the Ark of the Covenant. and is himself set in the vanguard of spiritual Israel. 19:1. Jos. and no one else. because he has a different spirit and has followed me fully. 14:6-15. They should be and will be praised. and was essentially because Caleb the son of Jephunneh (of the tribe of Judah) had “wholly followed the Lord God”. Just as the term Joseph most often applies to the combined tribes of Ephraim and Manasseh. There was also the close historical relationship between Simeon and Levi (Gen. as this tribe is included with Judah in their inheritance and was scattered amongst Israel. Their ensign or standard was a young lion (cf. Judah’s pre-eminence and pioneering spirit were demonstrated in former times by the fact that they were required to march in the vanguard of the armies of Israel (Num. and it is no one’s right to question that or be envious toward those whom He has chosen. The fact is that only about a third of Jews are actually even Semitic let alone Jews. 2:2-3. 15:13-17). During the wars of conquest and possession in the Promised Land. (RSV) Even though Joshua the Ephraimite was also loyal and apparently had the right spirit. so . (cf. his descendants were not to possess the land on a continuous basis. for reasons of His own. 1:3). chose to make the Jewish people the instrument of His self-revelation to the world (p.9 and 14. Messiah is referred to as a Lion of the Tribe of Judah. I will bring into the land into which he went. Jdg. and his descendants shall possess it. the representative of the tribe of Judah. as noted also in the Book of Numbers. it appears that when Judah is spoken of in Deuteronomy 33 it includes Simeon. The origin of the Jews is detailed in the paper Genetic Origin of the Nations (No. It is estimated that Judah actually occupied one-third of the entire western side of the Jordan once all the tribes had been settled in their respective areas.9). gave the world the Bible … God. as were the generations of Caleb. 19:9). The key there is that God chose. 64:8). Numbers 14:24 But my servant Caleb. as He is the Master Potter who fashions and selects human vessels for use according to His will (Isa. The reason for this is contained in verses 8. 49:5). Gen. Judah uniquely was given its inheritance in the territory which that tribe had conquered (Jos. Judaism is a religion now and not a single people. although it retained a separate identity. 32).

Palestine is not going to go away. the true Unitarian Law-keeping Church of God. Islam is closer to Jewry than Christianity. and perhaps suggests that this tribe will one day be praised by its brother tribes and the rest of the world as having been a vital instrument of God’s salvation. in the 20th century. quite apart from Judah having provided the Messiah through King David. It is purely a political matter. there’s no reason why Jews and Muslims can’t. It is a call which conveniently overlooks the fact that the most vicious wars in that region have been fought (and continue to be fought) between so-called Muslim brothers. Israel is not going to go away. with the anti-Jewish pogroms in both Tsarist and Communist Russia. The origins of these people and the determinations of what is to happen to them is dealt with in the other papers in the series dealing with those countries. has suffered intense persecution over the centuries. and more recently between the differing sects of Islam. both Semites. as the most readily-identifiable part of physical Israel. we have seen the unequivocal call by President Ahmadinejad of Iran for the extermination of the State of Israel (and presumably all the Jews with it). such as Iraq and Iran in the 1980s. Much of the conflict is between sons of Shem and between Elam and Ishmael and Keturah as well as Judah. The name Judah means praised (SHD 3063). but even then the Jews had to fight for their lives. On several infamous occasions Judah has even been the target for attempted annihilation by its enemies: once by the Amalekite Haman. More recently. it is worth reading what Rabbi Sacks wrote in The Times (London) of 7 September 2001 regarding the permanent and often violent friction between the Jews and the sons of Ishmael. If Jews and Christians can live together. On the Middle East question. within modern Iraq. and secondly. so too Judah. has suffered horribly. And shared tears do bring people closer together. whose plan was thwarted by Esther and Mordecai (Est. . We have to co-exist. all descendants of the Patriarch Abraham: We are both the same race. as if this would somehow solve the chronic and intractable problems in the Middle East.there is a great deal of interconnection between the tribes. Jews are not optimists. Iran is dealt with in Sons of Shem: Part I (No. Judah’s enemies Just as spiritual Israel. along with the mass extermination in Hitler’s Germany and its occupied (and often complicit) territories in Europe. 212A) and in the papers concerning the coming of the Messiah and also World War III. namely Shia and Sunni. 3-9). but we never give up hope for Israel.

compassion and peace (The Times. if not arrogant. It is certain that God arranged the separateness of the Jews that way for a number of reasons. they have absorbed a number of people and their diverse DNA structure proves that fact. “I have been very zealous for Your sake. However. as evidenced by man’s entire history. adding that this was their most striking and admirable characteristic (The Times. whether through a vision or a tragedy of history. and therefore almost certainly bound not to be heeded in this age at least (and without divine help) for “the way of peace they know not” (Isa. 20 June 2001). The Holocaust . The fact is that only very few people are actual Jews of those claiming Judaism and when they cease to practise the religion they are simply Gentiles within Judah claiming protection under the Laws of God. Nowhere is this told more dramatically than in the story of Elijah. 59:8). He had come to the mountain fresh from a decisive and bloody victory over the prophets of Baal. Elijah?” The prophet replied. however. the Russian author and dissident Alexander Solzhenitsyn said that the Jews were unique in never assimilating with another nation in 2. God asked him. as on the occasions mentioned. Rather. Then came the “still small voice” that was the voice of God. 20 April 2002). and that they thereby invite persecution upon themselves.” He then witnessed a whirlwind. that God lives in the still small voice of reason.Professor Sacks said in a subsequent article: It is not that religion is intolerant. we must learn the hard way that religion must never have recourse to power. it has also allowed them to be singled out from much of the rest of the population. The zealot believes that God is power. an earthquake and a fire. It may seem to many that the Jews remain insular and aloof. “What are you doing here. not just that of the chronically troubled Middle East. However. But “the Lord was not in” the wind or the earthquake or the fire.000 years of history. Under the headline “The Burning Question”. That is why zealots must learn. Words of wisdom. when Christ gets here he most certainly will take power and enforce a religion and one that is not kept on this planet at present except for a very few people who are persecuted for that faith.

Many faithful Torah-observant Jews in those camps prayed to God for deliverance and even marched into the crematoria praising Him. to be ‘holocausted’ in their millions in the crematoria like so many animals of the burnt offering (cf. About 3664 years later. but without acknowledging God’s undoubted help and protection during their many battles for survival. is nevertheless fitting. In order not to compare these more recent events with the burnt offerings of the sacrifices. 1:13) which. Judah and his brothers sold their half-brother Joseph into slavery in ca. the term Holocaust is not used in some modern Hebrew texts. They were punished by God for exalting themselves and their own abilities without reference to their Creator and the fact that they were merely a tool in His hands. many who survived these death camps simply deserted their faith altogether. although an unfortunate analogy. As a result of what they’d witnessed. At any time. because of an arrogant attitude on their part. For more information. as their forebears had unwisely done with their own children during the worship of pagan gods centuries earlier (2Chr. many asked where God was at a time like that and how He could allow them to suffer as horrifically as they did if they were His chosen people.1727 BCE. as even the Gentile Assyrians were to discover (Isa. Rabbi Kushner had this to say on the subject: It is nearly impossible for non-Jews to appreciate the meaning of the scar that the Holocaust. by a not-unjustified pride in their own power. instead. The secular Jewish rejection of the God of their fathers is perhaps understandable considering the number of deaths in the concentration camps both immediately before and during the Second World War in Europe.). Lev. see the Holocaust Revealed website at: http://www. 10:12ff.ccg. God may choose to remove His protection from individuals or from a nation. have left in the Jewish soul.Many secular Jews today consider themselves either atheistic or agnostic. and the centuries of persecution leading up to it. 28:3). Judah itself was sent into captivity in the Third Reich and brother Joseph (basically modern America and the British Commonwealth) was instrumental in rescuing their remnant from the death camps. including the State of Israel.org/_domain/holocaustrevealed. Those in the State of Israel take the view that their country has survived for nearly 60 years in a supremely hostile environment due to their own efforts and a particularly effective military force. This is a rather dangerous position to take. I don’t know of . The Jewish adults and children were literally made to pass through the fire. in other words. it is often referred to as the Shoah or Calamity.org The Jews had been sent like lambs to the slaughter.

If we didn’t learn from history. no matter how atrociously we misused it. “Nevertheless. pp. Jews understand that no matter how economically successful or socially integrated we are. 2:4). and sometimes they happen because God will not interfere to take away our human freedom. If anything. Earlier in his book Rabbi Kushner dealt with the age-old question. 162-3. God’s displeasure with Judah While R. it makes it harder for me to believe in man without God (ibid. He did allow it to happen). any other people that wakes up virtually on a daily basis wondering if the world will let them live. … This. “Why did God let it happen?” Because God determined at the outset that He would not compromise our human freedom to choose between good and evil. about this most unpleasant episode in Jewish history. 247-9). this should not be construed as His hatred for or abandonment of the Jewish people.. irrespective of how harsh that punishment may appear at the time. there are those who demonstrate a certain dignity in being able to be more understanding. cit. Kushner and others may not blame God. as God says through His prophets and in the Writings that He chastens those whom He loves. pp. the One True God – . as any loving parent chastises his son for the son’s ultimate benefit. we can never feel totally secure. not God’s. in fact. (Does anyone call for the dismantling of Pakistan and giving the land back to the tens of millions of Hindus who were displaced when a Moslem state was created there in 1947?) (op. the chronic persecution of the Jews and the Holocaust itself may actually have been direct punishment from God (for.. I have somewhat against you. However. despite the understandably horrific memories and intense grief engendered by the Holocaust (or Calamity). as they also have left their first love – Eloah. Quite the contrary. Hence. I suspect. Even something as monstrous as the Holocaust comes to be seen as Man’s doing. if not forgiving. because you have left your first love” (Rev. to save so many millions of lives?’ … would that mean He should also have intervened to stop Stalin and Pol Pot from killing millions of people in Russia and Cambodia? … on what grounds would God suspend the rules in one case and not in others? For me. it is a psychological issue: “How could human beings have so grossly misused their freedom to decide how to treat each other?” It does not challenge my faith in God. we would go on hurting and killing each other. from the voice of conscience. the Holocaust is not a theological issue: “Why didn’t God stop it?” For me. … But after the Nazi experience. He could just as easily be speaking to Judah or the Jews today. is why so many of us react so defensively when Israel is criticized: because we are always afraid that criticism will lead to a withdrawal of approval of Israel’s right to exist at all … It is not hypersensitivity on our part to notice that no other country is called on continually to justify its right to exist. at the very least. emphasis added). from experience. Why does God permit evil? Sometimes bad things happen to good people because laws of Nature can’t tell a good person from a bad one. ‘Couldn’t God have made an exception to that rule in this one case. no matter how destructively we intend to use it. To quote the words that Jesus Christ gave to the angel assigned to the Church at Ephesus in Asia Minor.

if you honor it. More importantly. I will feed you with the heritage of Jacob your father. his whole house or heritage was later cut off (see 1Kgs. and there are definite consequences for devising one’s own agenda. (See the papers God's Calendar (No.) The correct days for worship do seem to matter to God and His Messiah. or Yehoshua ben Yoseph. the holiest day of the year. not going your own ways. as King Jeroboam of Israel was to discover when he commissioned a festival one month later than the God-ordained Feast of Tabernacles. God has postponed the deliverance and salvation of Judah … until these Last Days. or seeking your own pleasure. from doing your pleasure on my holy day. it won’t do so by loud insistence. and call the sabbath a delight and the holy day of the LORD honorable.e. i. Yom Kippur. “This is the way. The same could apply in many Synagogues today where a good deal of worldly business is conducted on the Sabbath. 30:21). which includes not speaking idle gossip. the Holy Spirit is presently conducting ‘a campaign to win hearts and minds’. For all Judah. 2:13-17). . Among the called of God. He requires our ‘hearts and minds’ as exemplified by adherence to the spirit of the Law. It’s not a matter of simply observing the Sabbath as a duty or weekly ritual. or talking idly. 14 then you shall take delight in the LORD. small voice behind us saying. Isaiah 58:13-14 "If you turn back your foot from the sabbath. 156) and The New Moons (No. Maybe as a result of the postponements of His ordained Holy Days and Sabbaths and non- observance of the New Moons for centuries past. Jesus. We are told rather that it will be as a still. with far greater meaning than the present clichéd military term. instead. 12:32-33 and 13:33-34). for the mouth of the LORD has spoken. He means just that. walk you in it” (Isa. as He says quite plainly. this fast wasn’t actually being observed on the correct day according to the original Temple calendar anyway. when He will once again have mercy upon them. When God tells us to keep the Sabbath holy. That task can be done on any other day of the week. merely following the letter of the Law as many adherents to Judaism do. 125). God is clear that He doesn’t only want our ‘hands’. However.and have suffered for it. and I will make you ride upon the heights of the earth. it is the spirit in which it is kept that most pleases God. adhered to this injunction when he forcibly drove the money-changers and other Sabbath-breakers from the Temple precinct (Jn. should have been a time for reflection and re-evaluation along with Godly repentance. However." (RSV) Neither does He want people exchanging financial advice and business ideas on the Sabbath like modern-day equivalents of the money-changers in the Temple.

" (RSV) Rabbi Saul/Paul of Tarsus. Do not defraud. was also certain that love of money was a primary cause of people separating themselves from God and forsaking their Faith. and said to him. 9 But those who desire to be rich fall into temptation." 22 At that saying his countenance fell. Jesus. God promises that our idols of silver and gold –the riches and possessions that have become our little gods – will be thrown to the bats and moles at the culmination of this age. who apparently studied under Gamaliel the Elder. "Children. into a snare. when the Patriarch Judah suggested to his brothers that they sell Joseph into captivity rather than kill him (Gen. 1Timothy 6:6-11 There is great gain in godliness with contentment. (RSV) Mark 10:17-25 And as he was setting out on his journey. You cannot serve God and mammon. and come. Do not bear false witness. Matthew 6:24 "No one can serve two masters. 7 for we brought nothing into the world. and asked him. SGD 1320. Through His prophets. follow me. had a great deal to say on the subject of money and riches. It may have been to save Joseph’s life. and he went away sorrowful.The Qur’an also forbids trading on the Sabbath yet on both Friday and Sabbath on the Temple Mount to this very day money-changers charge people access to the Al Aksah mosque in direct violation of the Koran and the Scriptures. and give to the poor. 37:26-28). The undoubted money-making ability of the Jews today was evident much earlier in their history. "Why do you call me good? No one is good but God alone. 2:20). into many senseless and hurtful desires that plunge men into ruin and destruction. sell what you have. Do not steal. when they are finally recognised as being of so little real value (Isa. But Jesus said to them again. how hard it is to enter the kingdom of God! 25 It is easier for a camel to go through the eye of a needle than for a rich man to enter the kingdom of God. Do not commit adultery. what must I do to inherit eternal life?" 18 And Jesus said to him. for he had great possessions. 23 And Jesus looked around and said to his disciples. "You lack one thing. go. all these I have observed from my youth. . 19 You know the commandments: 'Do not kill. where materialism and love of money hold unprecedented sway. for either he will hate the one and love the other. a man ran up and knelt before him. however. financial gain seems to have played a large part in Judah’s motivation and thinking … and perhaps still does.'" 20 And he said to him. or he will be devoted to the one and despise the other. or Rabbi]. or Yehoshua. although they are far from alone in that in today’s world. Honor your father and mother. "Good Teacher [didaskalos. 8 but if we have food and clothing. with these we shall be content. and we cannot take anything out of the world." 21 And Jesus looking upon him loved him. "How hard it will be for those who have riches to enter the kingdom of God!" 24 And the disciples were amazed at his words. "Teacher. and you will have treasure in heaven.

And devour his flesh. Rabbi Kushner then ties this issue to the perennial problem of latent anti-Semitism often arising from envy. not to love money. it is through this craving that some have wandered away from the faith and pierced their hearts with many pangs. 11 But as for you. And now I command you. And suffer not a man to have compassion upon his neighbour. (RSV) However.H. London. faith. nor he who loves wealth. and the prayers of my father been accepted. my children. and I sinned as a man and as flesh. aim at righteousness. therefore. 5 And he hindereth the sacrifices of God. XXVI. 3. and the love of money. 2. because for the sake of money and beauty I was led astray to Bathshua the Canaanite. Beware. nor to gaze upon the beauty of women. And oppress him with toils and troubles. my children. love. therefore. and hearken to Judah your father. because. He hearkeneth not to a prophet when he speaketh. man of God. My children. Of particular relevance here are those made by the Patriarch Judah.) XVII. my children. And teach arrogance. one is entitled to dislike them as individuals but has no right to extend that dislike to . of fornication. The Testaments are based upon the supposed deathbed comments of the sons of Jacob to their children. Observe. with gain: this also is vanity. when led astray through money. being corrupted through sins. all the law of the Lord. and the writer of the Book of Ecclesiastes had this to say on the same subject: Ecclesiastes 5:10 He who loves money will not be satisfied with money. gentleness. the pseudepigraphical work called The Testaments of the Twelve Patriarchs (R. 1917. because I did it in ignorance. shun all this. (RSV) Similarly. Charles. contains some incisive observations and warnings. I should have died childless. translated from Armenian). For the sake of money I lost my children. the love of money leadeth to idolatry. for there is hope for all them who hold fast unto His ways. men name as gods those who are not gods. 4. (Known interpolations have been removed from the text. 4. and had not my repentance. SPCK. And resenteth the words of godliness. They rob his soul of all goodness. And the prince of deceit blinded me. steadfastness. godliness. 2. and it causeth him who hath it to fall into madness. But the God of my fathers had mercy on me. the fourth son of Jacob and his first wife Leah. If some Jews are loud and aggressive or guilty of unethical business practices (as are lots of gentiles). 10 For the love of money is the root of all evils. There is an obvious theme here. XVIII. XIX. And blind the inclination of the soul. For these things withdraw you from the law of God. 3. which was supposedly written in the second century BCE and was therefore contemporary with the Dead Sea Scrolls.

Jewish advocacy The Patriarch Judah showed great compassion and impressive verbal skills as the advocate for his half-brother Benjamin (Gen. justice must also be swift and the truly guilty punished as a warning to others. not with his victim (op. and do not slay the innocent and righteous. at the break-up of the Kingdom following Solomon’s death. 82:2-4) or to try and mitigate the sentence of a guilty person. it was assuredly not to get the guilty off on a legal technicality. 8 And . Exodus 23:6-8 "You shall not pervert the justice due to your poor in his suit. Job 8:3. as the ‘front’ is always facing the East in Hebrew. Antisemitism. will be punished by God in the Last Days. The basic purpose of advocacy was supposed to be the defence of the innocent and needy (Ps. Also. The right also means the South. The name Benjamin means son of the right hand. as recorded in 1Samuel 20:42. This arrangement had been ratified and given permanence earlier by David (of Judah) and King Saul’s son Jonathan (of Benjamin). 44:16-34). Justice must be done and done correctly and the perversion of justice by Judah or the other tribes will be punished. It is not incumbent upon any lawyer to search out and exploit legal loopholes or defend the indefensible. It was obviously God’s doing as part of His unfolding plan. In order to be most effective. He says He hates injustice and the perversion of the justice system (cf. so much so that he melted Joseph’s heart in Egypt.. 262). innocent members of the larger group. by deliberately flouting the spirit of the law. p. as might be expected. in the same way the Talmud perverts the Laws of God and will be destroyed. is a sign that something is wrong with the hater. to the detriment of a nation’s system of justice and of the society in general. Joseph may have had the primacy in Egypt. Judah nobly took upon himself the role of protector. It is ironic that they were predominantly left handed-people and were almost destroyed for their perversity. 7 Keep far from a false charge. but it seems Judah is to have the ascendancy in Jerusalem (metaphorically referred to as Egypt). The Torah is quite specific on the need for true justice for all people. cit. That sort of unethical behaviour. like all racial and religious prejudice. for I will not acquit the wicked. It is interesting that the royal city of Jerusalem was apparently located within the historical boundary of the tribe of Benjamin rather than Judah. and his Christ-like act of intercession on behalf of his brother probably bound the two so closely that. Benjamin became allied with Judah (along with half the tribe of Levi) rather than with his full-brother Joseph’s tribe. 36:17). so it seems he and his descendants were always destined to be the right-hand man of Judah.

Scribes have been referred to as Sopherim (from saphar. whereby each letter was considered . 23:5. which particularly fitted them for the task of transcribing the holy texts. a detailed and reverent ritual for copying the Scriptures was required. And as the writer of Ecclesiastes warns and the prophet Isaiah enjoins: Ecclesiastes 5:8 If you see in a province the poor oppressed and justice and right violently taken away. however. 2 Blessed is the man who does this. SHD 5608) since Ezra’s time. they speak lies. no one goes to law honestly. (RSV) It would appear that truth. for soon my salvation will come. Jer. who keeps the sabbath. Some Kenites also had this task. (RSV) Isaiah 56:1-2 Thus says the LORD: "Keep justice. 60:7 and 108:8). Ezek. 45:9). justice and righteousness here are synonymous and interchangeable. SHD 2710). that was only until the death of Messiah and the formation of the Churches of God from the Apostles onwards (see the paper The Oracles of God (No. For without justice (tsedek. and vice versa. 3:1-2)." (RSV) Again. and keeps his hand from doing any evil. 184)). do not be amazed at the matter. for a bribe blinds the officials. and the son of man who holds it fast. for the high official is watched by a higher. By tradition. Proverbs 21:3 To do justice and judgment is more acceptable to the LORD than sacrifice. (RSV) The prophet Isaiah was aware of the situation in his time and foresaw the same thing happening in these Last Days. SHD 6664) there can be no righteousness (tsedek). with their dedication and thoroughness. and do righteousness. Torah observance It appears that Judah or Levi was assigned to be God’s scribes or lawgivers (chaqaq. justice and equitable treatment are extremely important to God as such requirements of the leaders and the people are mentioned often enough in Scripture (e. and subverts the cause of those who are in the right. they conceive mischief and bring forth iniquity. It is recorded that the Jews and Levites were appointed custodians of the Oracles of God from the beginning (Rom. and were given the task of faithfully preserving Scripture down through the centuries (Pss. they rely on empty pleas. in line with the dual application of much of Scripture.g. and my deliverance be revealed. not profaning it. you shall take no bribe. and there are yet higher ones over them. It was perhaps the Jews’ and Levites’ natural abilities. Isaiah 59:4 No one enters suit justly.

Christians naturally owe a huge debt of gratitude to the Scribes for faithfully copying and preserving the Hebrew Scriptures (the Tanakh) for hundreds of years. also Jn. They continued to worship in their local Synagogues. I worship the God of our fathers. Judah often went to the other extreme. however. In contrast to the pseudo-Christians’ willingness within just a few centuries to abrogate the Law. Certain strands of Judaism also saw the need to put a fence around the Laws of God as shown. so no adjoining letters were permitted to touch. they have forgotten that the majority of first-generation Christians were Jews or Hebrews of all twelve tribes of Israel. which they call a sect [heresy: KJV]. as is still being done today. claiming these were part of the Oral Law given to Moses. for example. and every letter and word were counted to ensure that none had been added or omitted. that according to the Way. the rest of Israel seemed more inclined to water down the Laws of God. located both within Judaea and in the Diaspora. perhaps. in accordance with the injunction in the Torah (Deut. 9:22).holy in itself. (RSV) It simply wasn’t a case of Paul believing everything in the Law but then not acting upon that belief. They did. It was quite the opposite in fact. although many were later expelled as Jesus/Yehoshua said they would be (Jn. by their 39 Sabbath prohibitions. until finally deciding that these Laws had been done away with altogether and that we are solely under “grace” within the new Christian dispensation. 16:2. and who didn’t suddenly give up their keeping of Torah when they became baptised Christians. cf. albeit with noble intent. Acts 24:14 But this I admit to you. It wasn’t the sort of information that many people wanted to know (see Acts chap. each word was to be read aloud from an original version of the text. believing everything laid down by the law or written in the prophets. 4:2). They had a tendency to introduce more and more man- made ordinances and restrictions. at the appropriate time. In Acts 24. take liberties with the Scriptures but preserved those texts for a permanent record and which we know today (see for example The Companion Bible notes to the texts). It seems pseudo-Christianity is in such a rush to disassociate itself from everything Jewish and the Jews (even until fairly recently known as “Christ-killers”). and his statement here refutes the antinomian opinion that Paul denigrated the Law in his numerous other epistles. few of which bear any . 7). they might be translated into all the languages of the world. yet had been ignominiously killed. perhaps for mentioning the “heresy” that the long-awaited Messiah of their liberation had already appeared. so that. Paul stated unequivocally before the Roman governor Felix and many eminent Jews that he still observed the Law. In addition.

Geza Vermes.” (op. before encountering the first attempts at systematization. long after the fall of the Temple.6-9) in mid-second century BC. … The freedom the Law offers is the freedom of the athlete who disciplines his body so that he is free to do things physically that you and I are incapable of. and often hypocritical.” That is not love but an abdication of responsibility. and by sharing with us His precious Torah.. 1993). and need to be superseded by the rule of love and forgiveness. 7. “We have to wait until the Book of Jubilees (50.14-12. “Do whatever you want. had this to say about the prohibitions.” (fn. It offered advice.2) before receiving a detailed list of thirty-nine classes of proscribed action.). and until the relevant section of the Mishnah (Shab. God shows His love for us by reaching down to bridge the immense gap between Him and us. In our view.6) half a century later. punishing God. This making of laws more binding and unnecessarily burdensome was what Yehoshua condemned (cf. a loving parent does not show his or her love by telling a child. He shows His love for us by inviting us to enter into a Covenant with Him. 47-8) He goes on to share a few thoughts that should be noted by the antinomian Christians in particular. Judaism – while admiring love and forgiveness … – sees the role of the Law totally differently. … The freedom the Torah offers us is the freedom to say no to appetite. and the statutes of the Damascus Document (10. “We learn two lessons from the stories we tell about ourselves: that God loves us and that God needs us. with its myriad regulations and prohibitions. R. London. religious types.resemblance to the original injunctions regarding the Sabbath in the Torah as given directly by the Angel of the Covenant (who became the Messiah). in his book The Religion of Jesus the Jew (SCN Press. … . The idea that giving us laws is a sign of God’s love is one of the fundamental theological differences between Judaism and [mainstream] Christianity. restrictive. Hence it was long after the written Torah was produced that this so-called Oral Law was codified. p. as a source of freedom. pp. cit. We tend to think of laws as restricting our freedom. … But Judaism insists that living by God’s laws is a matter not only of obedience. It may seem strange to speak of the Torah. and guidelines. … Laws are seen [by the latter] as the instrument of a harsh. 23:1ff. He obviously recognised the difference between the Laws he had given to Moses and those added afterwards by over-zealous. Mat. It is the freedom of being the master of appetite rather than its slave. insight. but of a more important kind of freedom.12) The Mishnah was compiled about 200 CE. … Jews have understood from the beginning that ours was a religion of love because it did not leave us to find our way through life unaided. and I will still love you. Kushner gave the Jewish perspective on God’s Law or Torah and why it is still binding upon all who claim to love God and act as His servants today.

In brief. in the Lord’s Prayer (Matt. pp. intensified and sought boldly to inject into the Judaism of ordinary people the magnificent prophetic teaching of the religion of the heart (cf. The problem is that Judaism as a religion has corrupted the Laws of God by tradition. ready when necessary to choose between conflicting obligations. pp. the survey of Jesus’ preaching in parables. ‘Thy will be done’. there is still the more important spiritual application that needs to be addressed. we are able to keep the Law in its physical aspect. What he strove to emphasize was inward piety for the individual devotee of the Kingdom of heaven.34). sleeping. The Law does not make us sinners. 50-4). … The second gift of the Law is the reassuring message that we and our moral choices are taken seriously at the highest level. This is certainly good advice for taking care of most aspects of life. which concurs with the views expressed above by Rabbi Kushner regarding Torah observance. and working habits is to take the most common and mundane activities and invest them with deeper meaning. Vermes continues with this theme on page 194: As has been clearly demonstrated in chapter 2. Earlier in his book.10) the petition. Jesus made no attempt to restrict. through self- discipline and self-denial. he adopted. Perhaps even more pregnantly.. turning every one of them into an occasion for obeying (or disobeying) God (ibid. … But what the Jewish way of life does by imposing rules on our eating. That practice must be stopped and Judah’s and Levi’s conduct corrected. the essential requisites are detachment from possessions. proclamations and sayings has shown that. is followed by. Isa.13) (emphasis added). unquestioning trust in God and absolute submission to him. the Torah. ‘Thy Kingdom come’. The Law tries to make us strong enough to resist the many temptations to sin to which the human being is subject daily. It is approval of his recapitulation of the Torah as love of God and love of men that brings the sympathetic scribe ‘near to the Kingdom’ (Mark 12. the above author made the following comment. or interfere with. but that he acknowledged the Law of Moses as the foundation-stone of his Judaism (op. 188-9). cit. he rather embraced it as the recognized framework of Judaism. 29. The fact that the duties imposed are generally expressed in ethical rather than ‘legal’ terms should not lead one to imagining that Jesus’ eschatological preaching conflicts with his attachment to the Law. Yehoshua as a Torah-observant Jew Geza Vermes was also unequivocal with regard to Jesus/Yehoshua’s observance of the Law of Moses: … Jesus not only was not hostile to the Torah in principle or refused to abide by it in practice. a divine will seen by Judaism of all ages . however.. To be brief. 6. It’s true that.

One can. It is known absolutely that he didn’t abrogate Torah either when he was alive or by his death and resurrection.” (ibid. 15. whereas in the case of Jesus. emphasis added) The one known as Jesus Christ was referred to by his fellow Jews as a Rabbi on numerous occasions (Mat. “Keep all the Commandments for now but. debate the nature of the contrasts in question. Jn. according to Mark 7.E.10-13 (Matt. but the point at issue is that if Jesus’ teaching ‘shatters the letter of the Law’. 1:38. emphasis added). 237). it was a matter of ‘the Son elucidating its real meaning’ (C. so perhaps respect is due for his wisdom and teaching ability as for any other Rabbi before or since.).. It is worthy of note also that the Fourth Commandment requiring seventh- day Sabbath observance was too obvious to be mentioned here at all. which is of course nonsense. Lond.4-6). he did not “shatter the letter of the Law” as claimed by Ernst Kaesemann in Essays on New Testament Themes (transl. that of the Pharisees seems to do the same. 1964). He didn’t say to the wealthy Jewish leader who was seeking the best way to eternal life. 20:7). Akiba or Rashi. 148-9. 13:14). for everyone will come under grace from that time forward” (see Luke 18:18-30). pp. p.49. . the Pharisees are said to have propounded their doctrine concerning qorban: ‘Moses said … but you [Jesus] say’ (Mark). etc. by W.28 Footnote 28: In the words of a well-known New Testament scholar. that my death and resurrection will abolish all those Laws of God that most people find so burdensome and difficult anyway.). and his footnote speaks of Jesus explaining the true meaning of the Law: Incidentally. such as Gamaliel. Abraham was called “a friend of God” (2Chr. Messiah came to introduce the vital spiritual dimension that is impossible to engender within ourselves. and may have been the expected Teacher of Righteousness mentioned by the Essenes. Montague. the power of God. As a Rabbi he was speaking almost exclusively to other Jews of his day. or even more strongly. however.. needless to say. as being expressed and manifested in the commandments received by Moses on Mount Sinai (Vermes. Jesus’ antitheses do not differ structurally from that which. The Patriarchs and prophets were among the few people in the Hebrew Scriptures recorded as having received God’s Spirit. 31. in order to allow a more faithful keeping of the Law than ever before possible. In doing so. This is the reason that Messiah had his Advent and began his teaching about the higher aspects of the Law and the availability of the Holy Spirit to a far greater number of people than the mere handful of specially-favoured men and women who had received it up until that time. Cranfield. The Gospel according to Saint Mark (1959). They were among the first to receive the Spirit but were to be far from unique in this. know this. Vermes countered Kaesemann as follows. They were given God’s Spirit and were led by it. yet could in no way be considered abolished by Christ’s silence on the matter. ‘God commanded … but you say’ (Matt. 23:7-8. ibid.B. while David was known as “a man after God’s own heart” (1Sam. as so many Christians incorrectly claim today. 20:16.J.. the scribes and Pharisees were ‘tampering with God’s Law’.

(See also Commentary on Zechariah (No. John. the fourth kingdom extant in Messiah’s time. "They shall look on him whom they have pierced. as one weeps over a first-born. the person whom the first Jewish converts and all subsequent Christians have acknowledged as the long- awaited Messiah. was the promised Messiah. or Yehoshua ben Yoseph. One example is from Zechariah. and then to be finally transformed into spirit beings on a par with the angels in Heaven and thus become full Sons of God. It is His intention that all human beings who ever existed are to be called into the Body of Israel at some point. so it seems logical that the person spoken of here must have been pierced in the past. when he will appear as an all-conquering King-Messiah. The stone is shown striking the great image on its feet of mixed iron and clay . the disciple whom Jesus loved. It is generally acknowledged that the iron legs of this image represent the Roman Empire. (RSV) He is not about to be pierced at his glorious Advent as King-Messiah. as one mourns for an only child.) Hence his first Advent according to Judah will actually be his second. and weep bitterly over him. He is the same one pierced by the Jews (by proxy) and the Gentile Romans (by commission). This is dealt with in the paper Advent of the Messiah (No. When they arise in the Second Resurrection of the dead. The Advent of Messiah Jews generally have never accepted that the man called Jesus Christ." (RSV) The text in Zechariah undeniably alludes to two separate Advents of the one person. 210). stated categorically that the above Scripture referred to this same Jesus or Yehoshua ben Yoseph. despite many references to him in the Tanakh. Another Scripture that implies two Advents from an historical point of view is found in Daniel 2:31-45. then and now. so that.Through the Messiah. they shall mourn for him. or who called for that to happen. given the Spirit so that they are better able to keep the full intent (i. the spirit) of the Law. when they look on him whom they have pierced. all those who pierced Messiah. where the Messiah is prophesied as one who is to be killed by being pierced.e. and thereafter have eternal life. thus he has already had one Advent … and most of the Jews. God is actually giving all of us the chance to become “a friend” of His and “a person after His own heart”. 297). will come under judgment before him. John 19:37 And again another scripture says. Zechariah 12:10 "And I will pour out on the house of David and the inhabitants of Jerusalem a spirit of compassion and supplication. who was a Levite. knew it not or refused to accept it. then resurrected to life in order to be seen again by those who pierced him at some time in the future. and that the stone uncut by human hands is Messiah himself.

Amen. Acts 24:24-25a After some days Felix came with his wife Drusil'la. Mat. Mk. And the understanding that he would set up the physical Kingdom there and then. the Gentile centurion verbally acknowledged Jesus/Yehoshua as the Son of God. so it is quite conceivable . To him who loves us and has freed us from our sins by his blood 6 and made us a kingdom. 15:39. and he sent for Paul and heard him speak upon faith in Christ Jesus. who was of the tribe of Benjamin. 25 And as he argued about justice [righteousness. with the millennial Kingdom on Earth not to be set up until after his Second Advent. For instance. That Empire was to last several hundred years after his death and resurrection. and from the seven spirits who are before his throne. and raised some uncomfortable issues regarding justice and a resurrection to judgment. 22:23. so the Sadducees are without excuse when attempting to deny any future resurrection (cf. Amen. spoke to the Roman governor of Judaea. Even so. and all tribes of the earth will wail on account of him. KJV] and self-control and future judgment. without the promised physical Kingdom being set up on Earth during that period. Lk. and his Jewish wife.rather than on the legs. priests to his God and Father. to him be glory and dominion for ever and ever. Instead. however. (RSV) Again.). in other words. Paul. 27:54. Revelation 1:7 contains a dual meaning. Lk. the first-born of the dead. he is coming with the clouds. 20:27ff. and every eye will see him. in either the First or Second Resurrection. besides speaking of two Advents of Messiah. Several Scriptures hint at this (Mat. who was a Jewess. 5 and from Jesus Christ the faithful witness. and therefore that Yehoshua ben Yoseph could not have been the promised Messiah. Incidentally. “Every one who pierced him” may not be there to personally witness Messiah coming in great glory in the clouds. the prophet Zechariah (Ezekiel also) talks about a definite raising of the dead to life. he set up the Kingdom spiritually in the hearts and minds of a number of faithful disciples at that time. Felix was alarmed … (RSV) At some stage we are all required to acknowledge that Messiah has indeed already come once to this Earth. Messiah didn’t destroy the Roman Empire and the occupiers of Judaea at his first Advent as Jesus Christ. every one who pierced him. It is even possible that some of the Roman soldiers and others who had a part in the death of Messiah will be in the First Resurrection and thus will literally meet him in the air at his second Advent. Also. 23:47). Felix. and the ruler of kings on earth. is erroneous. 7 Behold. Revelation 1:4-7 John to the seven churches that are in Asia: Grace to you and peace from him who is and who was and who is to come. they and everyone else will most certainly see him sometime after they’ve been resurrected to life again.

Messianic brooding and reflection went hand in hand with the belief that the Anointed had already come. Talmud.e. in Revealing Jesus as Messiah (Christian Focus Publ. and there is none to justify us. "Truly this was the Son of God!" (RSV) It seems strange that a Gentile should recognise the Messiah when so many Jews of the time didn’t. Scotland. they were filled with awe. 135).that he was later converted and became a disciple along with many other witnesses to the crucifixion.Messiah and the second was as the King. the repayment in kind by God for good or evil). 53:4-5). The Servant Songs Another Jewish author. mida keneged mida (lit. Messianic speculation in ancient Judaism included notions of a priestly and prophetic Messiah. of a Messianic figure who would perform all these functions in one. The first Advent was as the Priest. this was the second recorded occasion on which a Gentile knew Christ to be the Messiah. also mentioned this possibility. Among the ancient prayers said for the Day of Atonement may be found the words of Eleazar ben Qalir (perhaps as late as AD 1000): ‘Our righteous Messiah has departed from us. saw the earthquake and what took place. Geza Vermes. Many of the leaders of Judah were jealous of Yehoshua ben Yoseph. In addition to the royal concept. The Jews persecuted the Church endlessly and that was why they wanted the prophet Muhammed and the small group in Arabia killed so that it was wiped out. made this observation: Some Talmudic writers have recognized the likelihood that suffering is bound up with Messiah’s work [Babyl. tractate Sanhedrin 98b]. 4:4ff. comes around’ or. p. ‘What goes around.Messiah. As the saying goes. the other being when he spoke to the Samaritan woman at the well (Jn. ‘measure for measure’. i.. Matthew 27:54 When the centurion and those who were with him. The Dead Sea Scrolls show that the understanding of the community there was that the Messiah was the same person. Lond. p. In fact. 89). 1998. in Hebrew. The texts are examined in the symbolism of the High Priest on . and in some cases. furthermore. 27:18). and this was perhaps a major reason for wanting him dead (see Mat.). Hence it appears that some Jewish writers acknowledged (albeit rather quietly) the fact that the Messiah had actually come and gone. in his book Jesus the Jew (SCM Press Ltd. He bears on his shoulders our sins to find pardon for our iniquities. we are horror-stricken. keeping watch over Jesus. and said.. Isa. being of two Advents. Our iniquities and the yoke of our transgressions he carries.’ (cf. Stuart Sacks. On occasions. This envy and murder was to be returned with interest upon their own descendants’ heads over two millennia leading up to the Holocaust of the 20th century. and is wounded for our transgressions. 1983.

emphasis added). we do not have the remotest idea of whom Isaiah is speaking (ibid. they have pierced my hands and feet (RSV) That is just one small example from a whole set of criteria required for Yehoshua/Jesus to be fully acknowledged as the promised Messiah. dogs are round about me. while the wounds in his hands and feet allowed blood to run down onto his thumbs and big toes. 49. Returning to the Tanakh. Psalm 22:16 Yea. The fact remains that the final Song’s fifteen verses [52:1-53:12] fit none other so well as the Messiah as he was revealed in first century Palestine. so to speak. Stuart Sacks had this to say about the last of these Songs: Although the Jewish community has traditionally thought of this final Servant Song in messianic terms. 52:13-15. 68. 214). how wonderful it will be in that day when multitudes of the household of Israel accept the Scripture’s reliable witness through such men as Luke and Philip [cf. 1Timothy 2:3-6 This is good. for it is recorded that Jesus (Gk: Iesous) will save his people from their sins (Mat.. God thereby arranged for Yehoshua ben Yoseph to be fully consecrated as a Priest. 42. and it is acceptable in the sight of God our Savior. of the Messiah who was to come. in accordance with the solemn ordination ceremony of Aaron and his sons (and all their priestly descendants) as described in Leviticus 8:23-24 (see also the paper Wave Sheaf Offering (No. This author added that the latter Song “clearly identifies individual suffering in place of a rebellious people”. as High Priest in the Melchisedek priesthood. there were also puncture marks around the head of this crucified one from the crown of thorns that had been jammed onto his head. part 40 and 61 also). These holes in his scalp allowed blood to trickle down his face and settle on his earlobes. Acts 8:34-35]. 1:21). Isaiah 53 is one of a small series of texts recorded by the prophet Isaiah and usually known as the Servant Songs (also Isa. and there . Yehoshua is willing and able to make intercession directly to God the Father on behalf of the called-out and chosen ones alive on the Earth. if they do not refer to Jesus. p. as Timothy showed. 5 For there is one God. a company of evildoers encircle me. 4 who desires all men to be saved and to come to the knowledge of the truth.Yom Kippur and are examined in the paper Day of Atonement (No. and the person known as “Jesus (Yeshua) is the perfect embodiment of the word yasha” (meaning to save). Besides the piercing of his hands and feet by the nails. 106b)). 138) and Azazel and Atonement (No. Even now. the Psalmist gave a specific description of the hallmarks. 50.

The basic building blocks are the same. 6 who gave himself as a ransom for all. especially in the thought of Paul and the Fourth Evangelist (The Holy Spirit in Christian Theology.. that is because it most certainly is at odds with it. Lond. and these are to be found. The only pattern which can be discerned. not so much in the texts in which the names of the three “persons” occur together …. i. One such point concerns the use of the term echad instead of yachid in the ‘Shema Ysrael when speaking of the ‘one and only’ God. That is not so. This is actually a rather brave admission considering the Trinity concept is supposed to be pivotal to Christian belief. is analogous to the pattern of DNA found in all living creatures. just as a human and a gorilla possess a similar make-up of DNA (sharing about 98% of genes) but only one will inherit eternal life. the testimony to which was borne at the proper time. one would reasonably expect the doctrine to be plainly laid out in the New Testament Scriptures. p. But He certainly doesn’t want the Jews to dispense with their Monotheism and embrace the false gods of the Trinitarian concept adhered to by the overwhelming majority of ‘Christians’. SCM Press Ltd.e. is one mediator between God and men. . but the conclusions reached can be totally different. that the New Testament contains the materials out of which the doctrine of the Trinity took shape. found in neither the Tanakh nor. surprisingly. the man Christ Jesus. in the books of the Christian New Testament. when that is not the case at all. Son and Holy Ghost’ as it is totally unscriptural. apart from in men’s fertile imaginations. it is more commonly recognized than it has sometimes been. as rather in the outlines of a Trinitarian pattern which can be discerned. though perhaps with a little less honesty than found in the opening sentence. we use the same scriptural texts in expounding doctrine. If we have accepted that Messiah has already had one Advent and died for the salvation of all people in the world. If this belief takes some swallowing and appears to run contrary to the ‘Shema Ysrael. The paper Consubstantial with the Father (No. Some pseudo-Christians have even claimed that the idea of a Trinity is implicit in the Old Testament or Tanakh. It is now generally acknowledged that the doctrine of the Trinity is not found in the New Testament. then there is no longer a need to struggle with the alien concept of the Trinity of ‘Father. George S. whose Jesus is one of three co- equal members of an exclusive Godhead. A typical Trinitarian thesis might include the following. Hendry. At the same time. (RSV) Jews for Jesus God surely wants everyone of Judah to become “a Jew for Jesus”. 1965.30). As Christians are also meant to be People of the Book. 81) should be studied for an explanation of the use of the term echad in the ‘Shema.

such as being expounded by the Christian Churches of God. 18 And when your people say to you. from Elam. and his dwellings shall be glorious. and they shall go up from the land. and the children of Israel associated with him'. and gather the dispersed of Judah from the four corners of the earth. from Shinar. provides a scripturally-based alternative to the paganised and syncretic or pick-and-mix beliefs of the so- called Christians. Thus says the Lord GOD: Behold. and I will join with it the stick of . for to be magnanimous in victory is a Godly characteristic. from Ethiopia. from Pathros. from Egypt. and those who harass Judah shall be cut off. out of Judah and from the lineage of Jesse and David. Therefore God strongly advised them to show compassion. (RSV) We see in 2Chronicles 28:9-15 that Ephraim had a change of heart when it and the other tribes had warred with Judah and taken many captives. and from the coastlands of the sea. Israel had been over-zealous in its treatment of the captured Jews. Some time soon. Psalm 114:2 Judah became his sanctuary [SHD 6944: holiness. take a stick and write on it. (RSV) Ezekiel 37:15-22 The word of the LORD came to me: 16 "Son of man. as we see in Hosea 1:11 and Ezekiel 37:15-22.The original Christian faith. from Hamath. from Assyria. Israel his dominion. for great shall be the day of Jezreel. of course. and Judah shall not harass E'phraim. sacredness]. 12 He will raise an ensign for the nations. and will assemble the outcasts of Israel. rebellion and an unhealthy love of wealth and status. 17 and join them together into one stick. it appears that Judah holds a special place of affection in God’s heart. 13 The jealousy of E'phraim shall depart. 11 In that day the Lord will extend his hand yet a second time to recover the remnant which is left of his people. then take another stick and write upon it. that they may become one in your hand. and they shall appoint for themselves one head. Hosea 1:11 And the people of Judah and the people of Israel shall be gathered together. Messiah was born for the salvation of the entire world. E'phraim shall not be jealous of Judah. there will be a foretold reconciliation of Judah and Israel. him shall the nations seek. I am about to take the stick of Joseph (which is in the hand of E'phraim) and the tribes of Israel associated with him. 'Will you not show us what you mean by these?' 19 say to them. Isaiah 11:10-13 In that day the root of Jesse shall stand as an ensign to the peoples. (RSV) And. We are often judged on how we treat our enemies. 'For Judah. Although God was angry with Judah and allowed them to be defeated. Reconciliation of Judah and Israel Despite its persistent sinfulness. 'For Joseph (the stick of E'phraim) and all the house of Israel associated with him'.

until he comes to whom it belongs. 7:6. 20 When the sticks on which you write are in your hand before their eyes. the Patriarch Jacob. your father's sons shall bow down before you. Mat. Isaiah 11:13 states prophetically that. one’s own blood relatives. and make them one stick. is not confined to the synagogue. your hand shall be on the neck of your enemies. 27:40. Genesis 49:8-12 Judah. Had there been a negative connotation to this part of verse 8. i. it would probably have spoken of Judah having his foot upon the necks of his enemies (Jos. The Just of the Nation of God We know that the essence of Torah is the love of God and the love of man. 12 his eyes shall be red with wine. He stooped down. One of the fundamental teachings of Judaism is that the search for holiness. As mentioned earlier. and his teeth white with milk. 10:24). Thus says the Lord GOD: Behold. he washes his garments in wine and his vesture in the blood of grapes. (RSV) The last verses of this text refer to the death of the Messiah in Jerusalem. 5:7). Isa. and Judah shall not vex Ephraim”. from the prey. or a yoke of bondage upon their necks (Gen. just as Judah may have envied Joseph (father of Ephraim) as the favourite son of their father. and will gather them from all sides. for the encounter with God. Everything we do can be transformed into a Sinai . By his death he accomplished the washing of his vestments and the vestments of all of his people as the vineyard of the House of God (cf. Judah. and no longer divided into two kingdoms. and one king shall be king over them all. 11 Binding his foal to the vine and his ass's colt to the choice vine. to embrace them and to weep upon each other’s necks (cf. Kushner sees the need for all of us to imbue everything in our daily lives with holiness in order to please God. Similarly. you have gone up. upon the mountains of Israel. Gen. this alludes to the jealousy and dislike of a group of people (in this case a brother tribe) toward Judah (the Jews). 10:36). while speaking primarily to fellow Jews. that is. my son. it appears that the reference here is to Judah’s hand being on the neck or back of his brothers also (as former enemies) in order to draw them to him. and as a lioness.e. (RSV) In the prophecy given by Jacob/Israel to his sons on his deathbed. and to him shall be the obedience of the peoples. 21 then say to them. 22 and I will make them one nation in the land. “Ephraim [representing the 10 Tribes] shall not envy Judah. and bring them to their own land. 33:4. that they may be one in my hand. The term enemies thus appears to be in the same sense as enemies shall be of one’s own household (Mic. Jer. nor the ruler's staff from between his feet. In view of the words brothers and father’s sons elsewhere in verse 8. 27:12). R. Judah’s hand is said to be on the neck (or back) of his ‘enemies’. 9 Judah is a lion's whelp. your brothers shall praise you. and they shall be no longer two nations. I will take the people of Israel from the nations among which they have gone. as Geza Vermes restated above. 45:14) in a spirit of reconciliation rather than enmity. he couched as a lion. who dares rouse him up? 10 The scepter shall not depart from Judah.

. Judaism has always insisted that knowledge has the power not only to make people smart but to make them good. endowments riches. p. which although hollow and frail and fleeting. But the danger of believing too fervently in a World to Come is that you may come to care less about the imperfections of this world. Rabbi Kushner made this observation: . who came not to condemn the world but ultimately to save it. cit. Almost universally. (ibid. namely kosmos (SGD 2889): 5) the inhabitants of the earth. or simply waiting for the promised Kingdom to come in order to have Messiah clean up the mess on the Earth and solve everything for us. There has often been a certain high-principled idealism exhibited by the Jewish people. at least as a place from which to start. how to take the ordinary and make it holy. And if we love God. men. pleasures. there is a nobler way in which to make a personal and positive impact upon the world: through study and implementation of all that we have learned. The goal of Judaism is not to teach us how to escape from the profane world to the cleansing presence of God. we should commit ourselves to live differently as a result of what we have learned. 3:16-17). And having resolved to live differently. right here and now. or … 7) world affairs. it can be explained simply as an injunction to hate the man-made and Satan-inspired systems (which are not of God. So what if there is rampant crime and disease? So what if widows and other poor people are taken advantage of by the rich and powerful? This world is only God’s waiting room. Jews reject that perspective. (op. but to teach us how to bring God into the world. Having studied. experience.” (ibid. an encounter with the sacred. There is a vital need to work in this world. the New Testament Scriptures concur with R. 49) It is not a matter of washing our hands of this world because of its seemingly insoluble problems. making it an orderly. beautiful. precious place. to make it a better place. Speaking as an American Jew. 44-45) As the Rabbi would have it. Brown-Driver-Briggs (BDB) make the distinction in their definition of the Greek term for world. stir desire. Kushner by telling us that God so loved the world that He gave up to a violent death His only human-born Son (Jn. to love and care for other human beings as God Himself loves all His creation.. This is quite a different concept John later gave at 1John 2:15 and which apparently contradicts the former text by telling us not to love the world. as R. people will get what they deserve and the last shall be first. Kushner would attest. but are certainly allowed by Him to exist) of this world yet.. However. Our creed would seem to be that God so loved the world that He lavished upon it immense care in creating it. advantages.304) While no one is good but God alone (Mk. etc. the aggregate of things earthly 7a) the whole circle of earthly goods. we should feel obliged to treat with love the world He loves so much … the reader of the Bible is told that the abstract concept of justice is meaningless unless it is translated into the lives of every citizen. seduce from God and are obstacles to the cause of Christ. In Eternity. 10:18). p. we should then go forth to bless God’s world and sanctify it. at the same time. pp. the human family.

Geza Vermes states: Here the coming of the Kingdom entails an element of mystery: the salvation of Israel is presented as a magnet attracting the rest of mankind to God (ibid. 123-4). However. many Jews were attracted to the Communist party not only because it replaced a cruel. pp. 48) In the Mishnah. but because it promised to make the world better. Salvation was open to them first. by freely choosing to do good. We tend not to vote for Jewish candidates." (RSV) . and we disappoint Him cosmically if we fail to respond to His challenge. We are important.” (op. viciously antisemitic czar in Russia. loving mankind (ha-beriyot) and bringing them near to the Torah (mAb 1. as it is written. "He who through faith is righteous shall live. In his comment on Isaiah 60:3. although it must be increasingly obvious that man alone will not be able to solve the multitude of problems this world faces. Jewish voters tend to support the candidate who seems most committed to making the world a better place. showing them what the God-oriented life looks like. We are called on to do something for God and for the world.. to crown His creation with goodness. beginning with the 42-plus years from the preaching of John the Baptist until the destruction of the Temple in Jerusalem in 70 CE. Salvation to the Jews first Again we see the pre-eminent position in God’s grand scheme given to Judah.12). God depends on us to complete and sanctify His world.. In the early part of the twentieth century. and make this world. cit. and certainly not because Jews are by nature revolutionaries. the Kingdom of God. they withdrew their loyalty. 46-7) That is obviously a very worthy view to hold. we are empowered. or for the most pro-Israel candidate. But they continued to look for a cause to follow. It is our obligation to be a role model for all nations. to the Jew first and also to the Greek.6f.. not some other far-off world. there is a saying attributed to Hillel. it demonstrates that Jews (among many others) often have a highly-developed sense of justice and empathy for their fellow man. because they believed that the purpose of human beings on earth was to do for God the one thing He could not do for Himself. 17 For in it the righteousness of God is revealed through faith for faith. The claim that God needs us is not so much a statement about God as it is about us. pp. When communism turned out to be a “god that failed.” when Stalin’s Russia turned out to be as brutal and as antisemitic as any czarist regime. Romans 1:16-17 For I am not ashamed of the gospel: it is the power of God for salvation to every one who has faith. Paul reiterated this fact.. loving peace and pursuing peace. and it is our obligation to make God’s world complete by giving Him the one thing He cannot do for Himself. p. (ibid. The foundation story of Judaism [and all biblical Israel] teaches us these two lessons. an older contemporary of Jesus/Yehoshua: Be of the disciples of Aaron.

because you are instructed in the law. having in the law the embodiment of knowledge and truth-. and all who have sinned under the law will be judged by the law. The call is going out at present. will not his uncircumcision be regarded as circumcision? 27 Then those who are physically uncircumcised but keep the law will condemn you who have the written code and circumcision but break the law. nor is true circumcision something external and physical. at the time of the destruction of the Temple and in the Holocaust centuries later.21 you then who teach others. "The name of God is blasphemed among the Gentiles because of you. 12 All who have sinned without the law will also perish without the law. do you rob temples? 23 You who boast in the law. 19 and if you are sure that you are a guide to the blind. The rest of Israel may yet have to experience their own punishment. the Jew first and also the Greek. which speaks of the seed or the word of God being broadcast or distributed abroad and whether or not it finds root in fertile ground. (RSV) When Paul spoke about the true circumcision (i. but the doers of the law who will be justified…. as it is written. do you commit adultery? You who abhor idols. remove the foreskin of your hearts. . spiritual and not literal. 28 For he is not a real Jew who is one outwardly. lest my wrath go forth like fire. for example. 26 So. 17 But if you call yourself a Jew and rely upon the law and boast of your relation to God 18 and know his will and approve what is excellent. a teacher of children. he was echoing Jeremiah’s words. not just the Jews." (RSV) Similarly.Judah was thus given ‘first refusal’ on the truth and salvation through Jesus the Messiah. the Jew first and also the Greek. and it is up to individuals within Judah to allow those words to take root in their hearts and minds and to respond to that call. and real circumcision is a matter of the heart. 10 but glory and honor and peace for every one who does good. Romans 2:9-13. of the heart) required of all people." 25 Circumcision indeed is of value if you obey the law.e. in that it meant Judah would also be the first to be punished for rebellion such as. and sow not among thorns. 29 He is a Jew who is one inwardly. but if you break the law. His praise is not from men but from God. a light to those who are in darkness.. 13 For it is not the hearers of the law who are righteous before God. Jeremiah 4:3-4 For thus says the LORD to the men of Judah and to the inhabitants of Jerusalem: "Break up your fallow ground. 17-29 There will be tribulation and distress for every human being who does evil. 11 For God shows no partiality. pre-eminence was to prove a two-edged sword. do you steal? 22 You who say that one must not commit adultery. Yehoshua restated Jeremiah’s words when he gave the parable of the sower in Matthew 13:3ff. if a man who is uncircumcised keeps the precepts of the law. and burn with none to quench it. 20 a corrector of the foolish. 4 Circumcise yourselves to the LORD. do you dishonor God by breaking the law? 24 For. O men of Judah and inhabitants of Jerusalem. your circumcision becomes uncircumcision. will you not teach yourself? While you preach against stealing. however. because of the evil of your doings.

And while it is noble and right to have a strong connection with the physical land of Israel. It connected them to their biblical origins. pp.It seems that when we scratch the skin of a self-confessed atheistic or agnostic Jew we find not too far below the surface a rather spiritual person who might readily respond to God’s calling of him or her. the Christian Churches of God bring together those vital strands of religious belief and practice.. ch. (Kushner. 7:3-5). p. We know that forgiveness from God is available at any time and not just on a . ibid. The Great Multitude of the First Resurrection (Rev. .. Within two months of the end of the Six-Day War. there remains the more vital connection we are required to have with spiritual Israel. by being both Torah-observant and by promulgating God’s ways as widely as possible with the ultimate aim of encouraging the whole world to turn to Him. the Tomb of the Patriarchs in Hebron. had come to Jerusalem to pray at the Western Wall.000 in total (Rev.. Israel is not a new. They are ‘prodigal sons’… as are we all. It has already been decided that a full 12. forty-year old country. But Judaism needs Christianity to remind us that the word of God is not meant to be kept for ourselves alone. 7) is to consist of members of all tribes and nations of the Earth. Christianity needs Judaism to remind it of what pure. Awaiting Judah The elect cannot be sealed. the Western Wall of the Temple. We are called on not merely to live by God’s ways. numbering 144. until a certain number from the tribe of Judah are brought into God’s true Church. Kushner in To Life! explains how (mainstream) Christianity and Judaism can learn valuable lessons from each other. (ibid.000 people from the tribe of Judah will be inducted into the central core of God’s chosen or elect. but to do it in such a manner that the world will be persuaded to turn to God. Rabbi Kushner gave a hint of the latent spirituality in many secular Jews. 290) In point of fact. but is in fact one of the oldest countries in the world … That explains why Jews were moved to tears in June 1967 when the Old City of Jerusalem.. and the world in general cannot be saved. 252-3) Like all of God’s children. R. and even non-religious Jews were thrilled by that. uncompromised ethical monotheism looks like. most of them non-religious Jews. they undoubtedly have a strong innate desire ‘to find their way back home’ to Him. fully half the population of Israel. … Christianity needs the example of the Jewish community actually striving to do what the Torah calls upon us to do. and other biblical sites became part of Israel.

those bringing the message of the recall to God. Saul repented and was baptised and renamed Paul. I also have heard you. and against its inhabitants. he has forsaken you. "Give thanks to the LORD. when God calls Judah to return to Him through Yehoshua the Messiah. 2Kings 22:18-19 But as to the king [Josiah] of Judah.18-21 Then Jehosh'aphat feared. God is not mocked. of the Ko'hathites and the Kor'ahites." 21 And when he had taken counsel with the people. and proclaimed a fast throughout all Judah…. and say. as when Stephen made the truth known to Jews from many parts of the Near and Middle East in the first century CE (Acts 6:5-7:60). 19 Yet he sent prophets among them to bring them back to the LORD. And He eventually deals with all people’s games and their refusal to acknowledge Him or listen to His servants. Judah and inhabitants of Jerusalem! Believe in the LORD your God. who sent you to inquire of the LORD. Yet. and served the Ashe'rim and the idols. 13:1- 3). `Why do you transgress the commandments of the LORD. and he stood above the people. "Thus says God. but they would not give heed. and said to them. This has been demonstrated many times throughout the history of Israel and Judah. although this led inexorably to Saul’s belief in Jesus/Yehoshua as the Messiah and to his miraculous conversion on the road to Damascus. 19 And the Levites. stood up to praise the LORD. and as they went out. these testified against them. even today.'" 21 But they conspired against him. 19 because your heart was penitent. and set himself to seek the LORD. (RSV) 2Chronicles 20:3. He doesn’t want to see His prophets. he appointed those who were to sing to the LORD and praise him in holy array. . and all Judah and the inhabitants of Jerusalem fell down before the LORD. when you heard how I spoke against this place. 20 And they rose early in the morning and went out into the wilderness of Teko'a. and you will be established. thus shall you say to him. He too was stoned to death for his efforts.specific day of the year such as Yom Kippur. the God of Israel. and by command of the king they stoned him with stones in the court of the house of the LORD. and you have rent your clothes and wept before me. abused or even murdered as happened on numerous occasions in the past. "Hear me. and a certain Pharisee named Saul of Tarsus was consenting to his death (Acts 8:1). as they went before the army. Jehosh'aphat stood and said. Thus says the LORD. provided that repentance is genuine. the God of Israel: Regarding the words which you have heard. And wrath came upon Judah and Jerusalem for this their guilt. that they should become a desolation and a curse. and you humbled yourself before the LORD. the God of their fathers. for his steadfast love endures for ever. says the LORD. and you will succeed. believe his prophets. 2Chronicles 24:18-21 And they forsook the house of the LORD. 20 Then the Spirit of God took possession of Zechari'ah the son of Jehoi'ada the priest. but in His own time He will deal with each person to their own good. so that you cannot prosper? Because you have forsaken the LORD. with a very loud voice. worshiping the LORD. (RSV) Little was to change in subsequent years. 18 Then Jehosh'aphat bowed his head with his face to the ground. ignored." (RSV) A prophet of Judah was once used by God to warn Israel’s king of impending disaster (1Kgs.

A more successful campaign had been implemented by King Asa of Judah. 8 and with them the Levites. the prophecy of Azari'ah the son of Oded. he will forsake you. and furthermore he took the high places and the Ashe'rim out of Judah. 2Chronicles 15:1-9 The Spirit of God came upon Azari'ah the son of Oded. Asa. and with these Levites. Ben-hail. "Hear me. the God of Israel. having the book of the law of the LORD with them. And. and Simeon who were sojourning with them. 2Chronicles 19:4-11 Jehosh'aphat dwelt at Jerusalem. Zechari'ah. "Consider what you do. and sought him. and all Judah and Benjamin: The LORD is with you. 4 but when in their distress they turned to the LORD. Zebadi'ah. 3 For a long time Israel was without the true God. As'ahel. Adoni'jah." 8 When Asa heard these words. he is with you in giving judgment. nation against nation and city against city. for your wrk shall be rewarded. and Micai'ah.It is perhaps appropriate that Second Chronicles is the last book in the Jewish Tanakh. for God troubled them with every sort of distress. 7 Now then. (RSV) Jehoshaphat later set judges in all Judah to administer righteous judgment and thereby true justice for all. to teach in the cities of Judah. 5 In those times there was no peace to him who went out or to him who came in. for great numbers had deserted to him from Israel when they saw that the LORD his God was with him. and he went out again among the people. . Shemai'ah. and Tobadoni'jah. Judah may be required to set the example and march in the vanguard. and they made no war against Jehosh'aphat. Nethani'ah. 9 And they taught in Judah. the priests Eli'shama and Jeho'ram. but if you forsake him. and he repaired the altar of the LORD that was in front of the vestibule of the house of the LORD. and brought them back to the LORD. 5 He appointed judges in the land in all the fortified cities of Judah. 6 and said to the judges. 7 But you. they went about through all the cities of Judah and taught among the people. he took courage. (RSV) Similarly. 9 And he gathered all Judah and Benjamin. while you are with him. 10 And the fear of the LORD fell upon all the kingdoms of the lands that were round about Judah. take courage! Do not let your hands be weak. Jehon'athan. King Jehoshaphat of Judah finally saw the need to teach and implement the Laws of God throughout Israel as an essential part of any restoration process. and those from E'phraim. let the fear of the LORD be upon you. this time in the much more-important campaign to deliver the true message of salvation to all. 6 They were broken in pieces. Tobi'jah. he will be found by you. 2Chronicles 17:6-10 His heart was courageous in the ways of the LORD. Nethan'el. he was found by them. Obadi'ah. for great disturbances afflicted all the inhabitants of the lands. Judah’s renowned advocacy skills could be useful also in persuading the rest of Israel to return to God. 2 and he went out to meet Asa. and without a teaching priest. If you seek him. as so often before. as it contains pertinent messages for these Last Days of the present age. Manas'seh. Shemi'ramoth. and said to him. the God of their fathers. from Beer-sheba to the hill country of E'phraim. city by city. for you judge not for man but for the LORD. and without law. and put away the abominable idols from all the land of Judah and Benjamin and from the cities which he had taken in the hill country of E'phraim. 7 In the third year of his reign he sent his princes. as they tried to do before with limited success (see 2Chronicles 29 and 30).

he had compassion for them. says the LORD. in all the king's matters. take heed what you do. an with your whole heart: 10 whenever a case comes to you from your brethren who live in their cities. “I saw all Israel scattered upon the mountains. for there is no perversion of justice with the LORD our God. as those who didn’t accept him in the period between his two Advents will be distraught at having ‘missed the boat’ through their indecision. Amari'ah the chief priest is over you in all matters of the LORD. who saw that Judah was a lost nation: Matthew 9:36 When he saw the crowds. to give judgment for the LORD and to decide disputed cases. op. (RSV) This was echoed later by Yehoshua/Jesus. concerning bloodshed. Isaiah 59:20 "And he will come to Zion as Redeemer. 11 And behold. The overall mission of Yehoshua the Messiah was put very succinctly by Geza Vermes. or partiality. law or commandment. it will be rather too late for us to be included in the First (and greater) Resurrection. at his next Advent. and the Levites will serve you as officers. 9 And he charged them: "Thus you shall do in the fear of the LORD. Which is why Christ says there will be a weeping and gnashing of teeth (Mat. because they were harassed and helpless.. the governor of the house of Judah. p. cit. 215). statutes or ordinances. disbelief or lack of a repentant attitude when they knew the Truth and . and the fact that the prophet Micah “saw” this hints at a prophetic significance for today. is the fact that if we wait until Messiah makes his appearance upon the Earth before we finally commit to recognising and acclaiming him as the expected Anointed One. and Zebadi'ah the son of Ish'mael. Messiah will come as the Redeemer from enslavement to sin as a result of rebellion to God. in faithfulness. who yearn for a world of mercy. was directionless and lacking a shepherd or guide. including Judah. 8:11-12). and may the LORD be with the upright!" (RSV) Thus the restoration must be according to the Laws of God. (RSV) Of vital importance though. Thus you shall do." 8 Moreover in Jerusalem Jehosh'aphat appointed certain Levites and priests and heads of families of Israel. like sheep without a shepherd. 2Chronicles 18:16a And he said. or taking bribes. the stray sheep of mankind. justice and peace lived in as children of God (The Religion of Jesus the Jew. that they may not incur guilt before the LORD and wrath may not come upon you and your brethren. The writer of Chronicles noted that all Israel. to those in Jacob who turn from transgression. and you will not incur guilt. as sheep that have no shepherd. then you shall instruct them. Deal courageously. For the magnetic appeal of the teaching and example of Jesus holds out hope and guidance to those outside of the fold of organized religion. (RSV) However. They had their seat at Jerusalem.

where to find it. presumably with a genuine desire to return to God instead of merely going through the motions of religiosity. pardon us. or smugly imagined themselves to be sons of Abraham by heritage and thus with one foot in the Kingdom already. (RSV) A particularly relevant part of the Amidah Prayer may be worth remembering here also. O our King. 2Chr. Mat. 137). to Your service. 6:12-42). 15:8). For Repentance: Bring us back. 2Chronicles 16:9a For the eyes of the LORD run to and fro throughout the whole earth. to show his might in behalf of those whose heart is blameless toward him. But it is when he is out of sight right now that we are expected to believe the reports about him and to walk by faith. We are told that the proud or haughty of Judah will be removed. 5. says the LORD. O Lord. 3:11). that is. who delights in repentance. and is willing to act upon it. 282C) for the full text of Solomon’s Temple prayer and the fact of its application to the Gentiles as well as to Israel. who is merciful and always ready to forgive. O our Father. Of particular note is the verse: “whenever they call upon you”. draw us near. Just as God listened and heeded Solomon’s prayer. with a heart far from God (Isa. (RSV) He is also in a state of readiness to listen to heartfelt prayer. These aspects are also covered in the paper Measuring the Temple (No. we are reminded that He sees all and rewards accordingly. 29:13. 14 I will be found by you. and I will bring you back to the place from which I sent you into exile. 8:22-53. Jeremiah 29:12-14 Then you will call upon me and come and pray to me. including the Rabbis and the Zionists teaching untruths (Zeph. says the LORD. 13 You will seek me and find me. O our Father. It will be easy enough to accept the King-Messiah as the Anointed One when we are standing before him. Blessed are You. Solomon’s prayer at the dedication of the Temple is arguably the most beautiful and moving in the entire Bible (1Kgs. and cause us to return to You in perfect repentance. when you seek me with all your heart. for You pardon and forgive. to Your Instruction. . Refer to the paper Rule of the Kings Part III: Solomon and the Key of David (No. and I will restore your fortunes and gather you from all the nations and all the places where I have driven you. and I will hear you. and the Jews will be converted in spite of their unbiblical traditions. Blessed are You. for we have transgressed. We don’t need faith to believe in someone or something that is in front of us. For Forgiveness: Forgive us. 6. for we have sinned. O Lord. O our King. not without some trepidation perhaps.

 .To you who have given mankind so much already: God can certainly use your undoubted talents in His work for the salvation of the world. Judah. You are encouraged to take up your position in the vanguard of Israel’s return to the Promised Land and to God’s favour. You have to be prepared so that Messiah can return to His own tribe and people in due process. The world awaits you.

a Belgian journalist.telegraph.co. We can determine that from the YDNA structure of his family. and Marc Vermeeren. earlier this year. tracked down the Fuhrer’s relatives. In other words he was a convert to Judaism. Since that time the scientific evidence has been collected and we can now say with certainty that he was a Jew. The YDNA comes from Egyptian/North African or Canaanite YDNA.uk/news/newstopics/world-war-2/7961211/Hitler- had-Jewish-and-African-roots-DNA-tests-show. Knack. What is understood to be the case is that his father Alois Hitler was the illegitimate son of the maid Maria Schickelgruber and a 19-year-old Jewish man named Frankenberger. Heidi Blake wrote an article on it on 24 August 2010 in the Telegraph: http://www." Mr Mulders wrote in the Belgian magazine. Schikelgruber in an Austrian death camp. E1b is not Semitic and certainly not a son of Judah. He was however not a son of Judah but rather of an early convert to Judaism. whether Sephardi or Ashkenazi is not yet certain. from both sides of his ancestry. "One can from this postulate that Hitler was related to people whom he despised. It is most probably of ancient Egyptian stock that led into the Phoenician stock of Carthage. Jean-Paul Mulders. a historian. one Alois V.html Hg.APPENDIX Some time ago I wrote on the aspect of Hitler being a Jew. including an Austrian farmer who was his cousin. 39 of his relatives had DNA tests done and he has proven to be of the Hamitic YDNA E1b1b1. What we do know now beyond doubt is that Adolph Hitler was a Jew of ancient lineage that was of itself not of the sons of Judah. The Gestapo in Austria imprisoned his cousin. .

"This is a surprising result. a genetic specialist at the Catholic University of Leuven. appears to be one of the major founding lineages of the Jewish population. Knack." said Ronny Decorte. E1b1b1 may stem from an early group of north Africans that came into Israel from Egypt even as early as the Exodus or who were Canaanites or were converted from North African Berbers at a later date into the Jewish community there. Haplogroup E1b1b1 which showed up in the samples of Hitler’s family is rare in Western Europe and is most commonly found in the Berbers of Morocco. He had his own relatives killed in an Austrian death camp. a nation to which he did not even really belong although he fought for it and was decorated by them. says the DNA was tested under stringent laboratory conditions. E1b is a foundational stock of Judaism. He mobilised that nation and imbued it with the express desire to wipe out an ethnic group of people that comprised a large part of the intelligentsia of his own people and to which the sordid little man himself belonged in an extended family that still live there in Austria to this day. The Jews there in Austria may have even come into Europe with Punic forces but it is far more likely that they came in with the Ashkenazi Jews that went west even as early as the Tenth Century with the founders of Austria. Algeria and Tunisia. What is the most amazing and appalling fact is that a full-blooded “Jew” assumed rulership of Germany. E and Hg. which published the findings. Some 25% of all European Jews are of Hg. as well as among Ashkenazi and Sephardic Jews. Certainly they had come in by 1215. So also is E3b.Haplogroup E1b1b1. What sort of a mind are we dealing with? A very sick one is the obvious conclusion. It is quite a serious possibility that Hitler’s family were Egyptian slaves that left Egypt as part of the Mixed Multitude and were allocated to Judah or Levi in the allocation of workers in the .6 per cent to 30 per cent of Sephardic Y-chromosomes. which accounts for approximately 18 to 20 per cent of Ashkenazi and 8.

We now know beyond any doubt what Hitler was and what family structure he came from and what he did to his own people. They were persecuting their own brethren and when they found out the truth they were furious. They were not repentant. The command is to love all men and show thereby that you love God whom you have not seen. The only possibility of any Semite blood in them is through the female lineages. Be very careful because you never know who your brother might be. . This section deals with the nation of Israel often referred to as the Lost Ten Tribes and their role in prophecy. One of the funniest things I was told about the Klansmen in the US was that there were a number of families that went to be YDNA tested and they were furious when they found out that they were descended from African slaves that may well have come in as early as the Roman period. Their YDNA completely eliminates the possibility that they were Semites. They thought they were white and they were not.Temple system. The correction of the second resurrection will confront literally millions of people with an awful truth that they will have great difficulty in dealing with. Descendants of Abraham Part VI: Israel The nation of Israel was divided into two kingdoms: one of Judah and the other of Israel proper. Every two bit Nazi loving hater of Jews and other races will have to be faced with the fact of what they followed and who they were.

his son Rehoboam was proclaimed king. The reigns of all 20 kings of the Northern Kingdom will be examined chronologically. The complete story of his life and reign. Many in Israel showed their displeasure by supporting his rival. The Northern Kingdom soon became idolatrous also. is dealt with in the paper Jeroboam and the Hillel Calendar (No. A suggested Chronology of the Kings of Israel is also appended. 282C). . Descendants of Abraham Part VI: Israel Introduction The story of the kingdom of Israel up until the death of Solomon is contained in the paper Rule of the Kings Part III: Solomon and the Key of David (No. the Ephraimite. and it was periodically invaded and most of its inhabitants were sent into captivity. The restoration of a united Kingdom is prophesied. These events can be seen ultimately as a means of preserving both Israel and Judah. from the tribe of Ephraim. This work is concerned with the fate of Israel after the division. God ordained the resulting division of Solomon’s Kingdom as punishment for his idolatry Upon Solomon’s death in 932 BCE. Jeroboam The first ruler of the breakaway Kingdom of Israel was Jeroboam the son of Nebath. as recorded in 1Kings 12 and 13. 191). The final Assyrian invasion and deportation of Israel occurred in 722 BCE. Jeroboam.

43 Go. was enjoined upon Moses by the Angel of Yahovah. “he lifted up his hand against the king” (1Kgs. 2:6). Judah was told that the division of the kingdom had been ordered by God. 10:2ff.). however. the burden upon the Israelites was not lightened by Rehoboam. “there was war between Rehoboam and Jeroboam all the days of his life” (1Kgs. hence. Hos. 11:26ff. decisive and permanent. even to an oppressive and hard-hearted Pharaoh let alone the people of Israel. and speak good words to them when you answer them. . so that the division between Judah and Israel was inevitably swift. to ask that he lighten the hard service imposed by his father (2Chr. On his return from exile following the death of Solomon. as the Qur’an records. He then fled to Egypt for sanctuary. (RSV) The need sometimes to speak a good or gentle word. (Pickthal) According to God’s purpose. just as many others had done before and since. The older and more experienced advisers approached Rehoboam with a plea on behalf of Israel. both of you. that peradventure he may heed or fear. "If you will be a servant to this people today and serve them. 15:6). Lo! he hath transgressed (the bounds).. including Messiah’s parents (cf. 2:15). and be not faint in remembrance of Me. 1Kings 12:7 And they said to him. and their great men exercise authority over them. 44 and whoever would be first among you must be slave of all. 43 But it shall not be so among you. 2Chr." (RSV) This fundamental principle of service to one’s people was reinforced by Christ in a rebuke to his disciples. with My tokens. unto Pharaoh. but whoever would be great among you must be your servant. Mark 10:42b-44 "You know that those who are supposed to rule over the Gentiles lord it over them. Surah 20:42 Go. However. 11:1. 44 And speak unto him a gentle word. In 1Kings 11:28 it is said that Jeroboam was a very industrious and capable man who had been put in charge of the forced labour of the House of Joseph during Solomon’s extensive building programs. Rehoboam. thou and thy brother. Jeroboam and the congregation of Israel came before the new king. then they will be your servants for ever. civil war was narrowly averted … for the time being. Mat.We saw that Jeroboam had been involved in a rebellion against Solomon whereby.

are preparing for battle. rose up and rebelled against his lord. David and Solomon had lasted exactly 120 years. and Jerobo'am drew up his line of battle against him with eight hundred thousand picked mighty warriors. 2Chronicles 13:1-22 In the eighteenth year of King Jerobo'am Abi'jah began to reign over Judah. 51) under the heading ‘Salt’. As a direct result of Jeroboam’s slide into idolatry many of the former priests and Levites found themselves destitute and deserted the Northern Kingdom for Jerusalem. because Jerobo'am and his sons cast them out from serving as priests of the LORD. where Jeroboam and Abijah. when Rehobo'am was young and irresolute and could not withstand them. O Jerobo'am and all Israel! 5 Ought you not to know that the LORD God of Israel gave the kingship over Israel for ever to David and his sons by a covenant of salt? The covenant of salt could not be altered or rescinded (Num. 6 Yet Jerobo'am the son of Nebat. and the Levites. Ahijah the prophet had already informed Jeroboam that he was to be given leadership over these northern ten tribes (v. while the Northern Kingdom of Israel was to survive for a further 210 years. 35). from 1052 to 932 BCE. four hundred thousand picked men. the sons of Aaron. 3 Abi'jah went out to battle having an army of valiant men of war. Now there was war between Abi'jah and Jerobo'am. 15 and he appointed his own priests for the high places. 8 "And now you think to withstand the kingdom of the LORD in the hand of the sons of David. and made priests for yourselves like the peoples of other lands? Whoever comes to consecrate himself with a young bull or seven rams becomes a priest of what are no gods. and for the satyrs. His mother's name was Micai'ah the daughter of U'riel of Gib'e-ah. 2 He reigned for three years in Jerusalem. 16 And those who had set their hearts to seek the . 2Chronicles 11:13-16 And the priests and the Levites that were in all Israel resorted to him from all places where they lived. 7 and certain worthless scoundrels gathered about him and defied Rehobo'am the son of Solomon. 9 Have you not driven out the priests of the LORD. Such a covenant is further explained in the paper Passover Questions and the Reasons for Our Faith (No.The united Kingdom of Saul. and said. "Hear me. 18:19) and Abijah is reminding Israel of this fact. the new king of Judah. 4 Then Abi'jah stood up on Mount Zemara'im which is in the hill country of E'phraim. and for the calves which he had made. The story of the Northern Kingdom continues in 2Chronicles 13. 14 For the Levites left their common lands and their holdings and came to Judah and Jerusalem. a servant of Solomon the son of David. because you are a great multitude and have with you the golden calves which Jerobo'am made you for gods.

and God gave them into their hand. do not fight against the LORD. and his priests with their battle trumpets to sound the call to battle against you. Continuing in 2Chronicles 13: 10 But as for us. and they cried to the LORD. King Asa had also removed the sun images (Heb. God defeated Jerobo'am and all Israel before Abi'jah and Judah. Thus Judah was able to encroach upon Ephraim’s territory to the north and create a buffer zone." Judah continued to uphold the correct Temple service and was favoured by God for so doing. and so prevailed. 20 Jerobo'am did not recover his power . however. and the priests blew the trumpets. 14:5). the God of their fathers. 13 Jerobo'am had sent an ambush around to come on them from behind. the God of your fathers. We have priests ministering to the LORD who are sons of Aaron. and care for the golden lampstand that its lamps may burn every evening. God is with us at our head. from their idolatry in worship of the golden calves. because they relied upon the LORD. the LORD is our God. the God of their fathers. And when the men of Judah shouted. 19 And Abi'jah pursued Jerobo'am. and we have not forsaken him. chamman) from all the cities of Judah (2Chr. thus his troops were in front of Judah. for we keep the charge of the LORD our God. 18 Thus the men of Israel were subdued at that time. The ultimate defeat of the northern Israelites was sealed. so there fell slain of Israel five hundred thousand picked men. They inflicted losses of 500. Although the army of Judah was outnumbered two-to-one by the other Israelites in this battle. and that remained the case after the Babylonian captivity also. secondly. also the size of the armies). they correctly deduced that they had God (and moral right) on their side. (RSV) It may be that fully two-thirds of the people – a great multitude – sided with Jeroboam in his rebellion (cf. and took cities from him. and Levites for their service. that the Levites did not all remove to Jerusalem and the twenty-four divisions of the Levites had to be reconstituted from the three full divisions left in Judah plus some returnees. The fact is. O sons of Israel. but you have forsaken him. 12 Behold. 14 And when Judah looked. and the ambush was behind them. for you cannot succeed. Bethel with its villages and Jesha'nah with its villages and Ephron with its villages. 17 Abi'jah and his people slew them with a great slaughter. 16 The men of Israel fled before Judah.000 men killed upon Israel – more than half of its warrior strength. and the men of Judah prevailed. behold. LORD God of Israel came after them from all the tribes of Israel to Jerusalem to sacrifice to the LORD. firstly by taking to themselves the priestly duties reserved for those of Aaronic or Levitical descent and. 11 They offer to the LORD every morning and every evening burnt offerings and incense of sweet spices. the battle was before and behind them. set out the showbread on the table of pure gold. 15 Then the men of Judah raised the battle shout.

21 But Abi'jah grew mighty. and because of the anger to which he provoked the LORD. He was killed by Baasha at a place called Gibbethon just inside the border with Philistia. 29 And as soon as he was king. . and Ba'asha struck him down at Gib'bethon. of the house of Is'sachar. Nadab Jeroboam was followed on the throne of Israel by his son Nadab (meaning generous) who reigned for only 2 years. which belonged to the Philistines. and reigned twenty-four years. Baasha’s idolatry was merely a continuation of what Jeroboam had begun. Baasha The second dynasty in Israel began with Baasha. 27 Ba'asha the son of Ahi'jah. and walked in the way of Jerobo'am and in his sin which he made Israel to sin. the God of Israel. 26 He did what was evil in the sight of the LORD. for Nadab and all Israel were laying siege to Gib'bethon. 909-886 BCE following its relocation from Shechem. according to the word of the LORD which he spoke by his servant Ahi'jah the Shi'lonite. 30 it was for the sins of Jerobo'am which he sinned and which he made Israel to sin. Jeroboam’s reign. 1Kings 15:25-31 Nadab the son of Jerobo'am began to reign over Israel in the second year of Asa king of Judah. and he died. he killed all the house of Jerobo'am. and walked in the way of his father. as well as those of subsequent kings. and reigned in his stead. (RSV) He reigned in the new capital Tirzah in the period ca. his ways and his sayings. And he took fourteen wives. conspired against him. 28 So Ba'asha killed him in the third year of Asa king of Judah. (RSV) King Jeroboam was finally struck down by God and died. and all that he did. Ba'asha the son of Ahi'jah began to reign over all Israel at Tirzah. are written in the story of the prophet Iddo. he left to the house of Jerobo'am not one that breathed. Although his name is forever synonymous with “evil”. 31 Now the rest of the acts of Nadab. in the days of Abi'jah. son of Ahijah of the tribe of Issachar and from humble beginnings. and in his sin which he made Israel to sin. and the LORD smote him. 22 The rest of the acts of Abi'jah. 33 In the third year of Asa king of Judah. generally proved disastrous. and he reigned over Israel two years. 1Kings 15:32-34 And there was war between Asa and Ba'asha king of Israel all their days. are they not written in the Book of the Chronicles of the Kings of Israel? (RSV) Little else is known of Nadab from either the Bible or secular sources. until he had destroyed it. the Hebrew word ra‘ or ra‘ah (SHD 7451) used can mean disaster or calamity (resulting from sin) and not just moral wickedness. who would certainly live up to his name (meaning wicked). 34 He did what was evil in the sight of the LORD. and had twenty-two sons and sixteen daughters.

In King Asa’s 36th year on the throne of Judah.). However. It was built partly from the materials Baasha had been using to fortify Ramah of Benjamin on the same road. and while that kingdom was enjoying relative peace. are they not written in the Book of the Chronicles of the Kings of Israel? 6 And Ba'asha slept with his fathers. It was subsequently returned upon Baasha’s own family by his ‘servant’ Zimri when he became king. This massive construction hints at the intensity and bitterness of the wars between the rival kingdoms. and was buried at Tirzah. and any one of his who dies in the field the birds of the air shall eat. and I will make your house like the house of Jerobo'am the son of Nebat. and also because he destroyed it.). and what he did. I will utterly sweep away Ba'asha and his house. in being like the house of Jerobo'am. seven miles (11 km) north of Jerusalem. Baasha enjoyed the third longest reign in Israel’s history (24 years) and died a natural death. provoking him to anger with the work of his hands. saying. 1Kings 16:1-7 And the word of the LORD came to Jehu the son of Hana'ni against Ba'asha. The walls of Mizpah were discovered to be an impressive 26 feet (8 metres) thick in a 1930s American excavation of the site – now Tell en- Nasbe. 119)). 4 Any one belonging to Ba'asha who dies in the city the dogs shall eat. you shall have wars!” (v. 3 behold. it was still a regicide that had to be punished (see the paper Genealogy of the Messiah (No. both because of all the evil that he did in the sight of the LORD. Baasha began a military campaign against him (2Chr. 7 Moreover the word of the LORD came by the prophet Jehu the son of Hana'ni against Ba'asha and his house. and have made my people Israel to sin. Darmesek) who attacked several Israelite cities in order to relieve the pressure on Judah (v. 16:6). Asa called for help from the Syrian king Ben-hadad of Damascus (Heb. During this turbulent period King Asa built a fortress at Mizpah on the main route north from Jerusalem (1Kgs. and you have walked in the way of Jerobo'am. provoking me to anger with their sins. 2Chr. Asa had forgotten his covenant of reliance upon God. 15:22. 16:1ff." 5 Now the rest of the acts of Ba'asha. 2 "Since I exalted you out of the dust and made you leader over my people Israel. consequently. (RSV) Although Baasha was the instrument for fulfilling Ahijah’s prophecy by killing Nadab (14:1ff. he was told by the prophet Hanani: “henceforth. and Elah his son reigned in his stead. 4). 9). and his might. Despite his wickedness. Elah .

Solomon had compared his Shulammite woman to Tirzah in Song of Songs 6:4 (see the paper Song of Songs (No. and all that he did. 145)). are they not written in the Book of the Chronicles of the Kings of Israel? 15a In the twenty- seventh year of Asa king of Judah. 10 Zimri came in and struck him down and killed him. drinking himself drunk in the house of Arza.Elah the son of Baasha became the fourth king on Israel’s throne. Zimri belied his melodious name and set about fulfilling Jehu’s prophecy concerning the house of Baasha with ruthless efficiency. Elah the son of Ba'asha began to reign over Israel in Tirzah. in the twenty-seventh year of Asa king of Judah. It is not unreasonable to suppose that Arza was party to the conspiracy to murder Elah. 1Kings 16:8-10 In the twenty-sixth year of Asa king of Judah. which he spoke against Ba'asha by Jehu the prophet. When he was at Tirzah. Zimri. however. His reign of two years was cut short by his own chariot-force commander. It is now called Tell el-Farah and lies about 9 miles (14 km) north of modern Sabastiyeh (formerly Samaria). When Israel heard that Zimri had murdered the king in a conspiracy the army commander Omri was declared king and they took the city. 13 for all the sins of Ba'asha and the sins of Elah his son which they sinned. provoking the LORD God of Israel to anger with their idols. Zimri reigned seven days in Tirzah. as soon as he had seated himself on his throne. His name means my music. he killed all the house of Ba'asha. In fact. 9 But his servant Zimri. Israel experienced the second murder of their incumbent king. and reigned in his stead. and which they made Israel to sin. Once he became king. commander of half his chariots. 14 Now the rest of the acts of Elah. Zimri Zimri was a successful cavalry officer and commanded half of Israel’s chariot force. and reigned two years. according to the word of the LORD. during a bout of drunkenness. . he did not leave him a single male of his kinsmen or his friends. 12 Thus Zimri destroyed all the house of Ba'asha. (RSV) Tirzah was an ancient Canaanite city of particular beauty. While Judah at this time was enjoying relative stability under King Asa (who reigned a total of 41 years). conspired against him. 1Kings 16:11-20 When he began to reign. who was over the household in Tirzah. during his reign Asa saw no fewer than seven kings come and go on the throne of Israel.

Ward (The Interpreter’s Dictionary of the Bible art. and for his sin which he committed. the son of Ginath. 18). However. and he has killed the king". 2002) that Tibni reigned for 2 years and died in battle. the Philistine city in the tribal lands of Dan that was given to the Kohathite Levites. says in The Lost Testament (Century. to make him king. 17 So Omri went up from Gib'bethon. Tibni (probably originally Tabni). and Omri became king. The destruction of the palace may have been one reason for the subsequent transfer of the capital to Samaria (renamed Sebaste by the Romans). 1Kings 16:21-28 Then the people of Israel were divided into two parts. 19 because of his sins which he committed. walking in the way of Jerobo'am. Vol. and all Israel with him. therefore all Israel made Omri. are they not written in the Book of the Chronicles of the Kings of Israel? (RSV) Gibbethon (the mound). 641) says the civil war was three years. doing evil in the sight of the LORD. 4. the commander of the army. the Egyptologist and historian. "Zimri has conspired. The Jewish Encyclopedia claims that he “was regent over half the kingdom of Israel for a period of four years” (art. being made king by all Israel. the same amount given by Naaman to Elisha’s mercenary servant Gehazi (2Kgs. Omri began to reign over Israel. The most notable achievement of Omri was the building of a new capital at Samaria. 18 And when Zimri saw that the city was taken. and died. while David Rohl. making Israel to sin. Tibni and Omri In verse 16 we saw another military commander. six years he reigned in Tirzah. the owner of the hill. . and the conspiracy which he made. so Tibni died.Zimri committed suicide by deliberately setting fire to the king’s house while still inside (v. 22 But the people who followed Omri overcame the people who followed Tibni the son of Ginath. 23 In the thirty-first year of Asa king of Judah. he went into the citadel of the king's house. half of the people followed Tibni the son of Ginath. ‘Tibni’. Omri (heaping). for which site at Shomeron he paid a mere two talents of silver. king over Israel that day in the camp. which belonged to the Philistines. 15b Now the troops were encamped against Gib'bethon. and they besieged Tirzah. after the name of Shemer. What followed was a three-year civil war where Tibni was killed and Omri ascended the throne of all Israel. garnered enough support from half of Israel to also be proclaimed king. and reigned for twelve years. 5:23). and called the name of the city which he built. Sama'ria. again figured in the story of transfer of the kingship. 24 He bought the hill of Sama'ria from Shemer for two talents of silver. p. The Bible states simply that he “died”. 20 Now the rest of the acts of Zimri. and he fortified the hill. and burned the king's house over him with fire. It was the same city of the siege in which Nadab was killed by Baasha. and half followed Omri. London. ‘Zimri’). 16 and the troops who were encamped heard it said.

A local spring makes the place ideal for defence. I destroyed. and he oppressed Moab many days. I took their warriors prisoner and impaled them on stakes before their cities. which rises gently out of a broad and fertile valley and is surrounded by a semi-circle of higher mountains. and in the sins which he made Israel to sin. Part of the inscription on the stone reads: Omri [was] king of Israel. ‘I will oppress Moab. Hodder & Stoughton. Omri found little favour with God. excepting Jeroboam perhaps. And Israel surely perished forever! (lines 4- 7) Israel was indeed effectively ‘to perish’ from off their land when they were deported by their Assyrian conquerors beyond the Araxes River. to anger by their idols. the God of Israel. He was the Omri mentioned in the inscription on the famous Moabite Stone (now in the Louvre Museum. 1980. pp. and did more evil than all who were before him.’ In my days Che[mosh] said. The Assyrians had already shown their intentions during Omri’s reign by attacking and pillaging the Phoenician cities of Tyre. (Bantam Books. His son followed him and he also said. An inscription of King Ashurnasir-pal II proclaimed triumphantly: I marched from the Orontes … I conquered the cities … I caused great slaughter. . before relocating to Samaria in about 880 BCE. I burned.Omri reigned six years in Tirzah. about 300 feet high. The choice of a site revealed the expert who was guided by strategic considerations. Werner Keller gives details of the site of the new city. for Chemosh was angry with his land. I settled Assyrians in their place … I washed my weapons in the Great Sea. 222)). ‘I will see my desire on him and his house. 25 Omri did what was evil in the sight of the LORD. 26 For he walked in all the way of Jerobo'am the son of Nebat. Sidon and Byblos. provoking the LORD. Paris) attributed to King Mesha of Moab whose capital was at Kir-Haresheth. 243-4) Great military planner or not. the modern Kerak/Karak. He has the distinction of having done more evil than all previous kings. I demolished. In The Bible as History. Chemosh here is the god associated with the golden calves that Jeroboam erected and to which children were sacrificed (see the paper The Golden Calf (No. Samaria lies on a solitary hill.

32 He erected an altar for Ba'al in the house of Ba'al. Ahab did more to provoke the LORD. to anger than all the kings of Israel who were before him. 31 And as if it had been a light thing for him to walk in the sins of Jerobo'am the son of Nebat. 1Kings 16:29-34 In the thirty-eighth year of Asa king of Judah. he took for wife Jez'ebel the daughter of Ethba'al king of the Sido'nians. that I may make you a desolation. Perhaps the two events were linked. although the invasions had actually begun as early as Menahem’s reign. from ca. 30. 30 And Ahab the son of Omri did evil in the sight of the LORD more than all that were before him. which he built in Sama'ria. The more evil they became the more prone to invasions they were to become. and was buried in Sama'ria. and worshiped him. he laid its foundation at the cost of Abi'ram his first- born. (RSV) Unlike several of his predecessors and despite being an unrepentant idolatrous king it seems that Omri died in peace. Ahab had one of the longest reigns at 22 years. and you have walked in their counsels. and set up its gates at the cost of his youngest son Segub. Both Israel and Syria were to suffer the same fate at the hands of the determined Assyrians during the reign of Hoshea. He had the singular dishonour of doing more evil than all that were before him (vv. Ahab the son of Omri began to reign over Israel. and your inhabitants a hissing. the God of Israel. and Ahab the son of Omri reigned over Israel in Sama'ria twenty-two years. (RSV) . and the might that he showed. as seen below. are they not written in the Book of the Chronicles of the Kings of Israel? 28 And Omri slept with his fathers.33) and was also the first king to come into conflict with the Assyrians in the time of Shalmaneser III.The Orontes is the main river flowing through Syria and is about 400 miles (640 km) long. and all the works of the house of Ahab. 874 to 853 BCE. King Ahab. and was denounced by the prophet Micah." (RSV) 1Kings 15 ends: 27 Now the rest of the acts of Omri which he did. so you shall bear the scorn of the peoples. 34 In his days Hi'el of Bethel built Jericho. which he spoke by Joshua the son of Nun. and went and served Ba'al. Ahab Although one of the most notorious of all the kings of Israel. and Ahab his son reigned in his stead. according to the word of the LORD. Micah 6:16 For you have kept the statutes of Omri. 33 And Ahab made an Ashe'rah. The moral corruption that was to develop in Israel included adherence to the so-called statutes of Omri and the wicked ways of his successor.

137) and is shown to have relevance to the Last Days. 6:26). as in to cut a covenant. said to Ahab. Now that the Holy Land stratigraphical timeline has been re-synchronised [by Rohl] with the New Chronology historical timeline (and therefore biblical history). except by my word. which was forced to pay annual tribute to avoid immediate conquest. 3 "Depart from here and turn eastward. Elijah’s Prophecy The significance of Elijah being a Gileadite or Gadite is explained in the paper Measuring the Temple (No. Hiel ritually sacrificed his eldest and youngest sons. 858-824 BCE and his Annals record that he came up against Ahab and Israel in the 6th. "As the LORD the God of Israel lives. the pattern of archaeological remains at Tell es-Sultan (the ruin-mound of Jericho) corresponds remarkably with the biblical narrative (op. namely Baal and Astarte/Ishtar. not for himself but for his two sons when he planned to rebuild the foundations and raise the gates of Jericho (see the curse in Jos. Hiel (God lives) of Bethel seems to have had a literal death-wish (v. in order to lay their bodies as foundation deposits beneath the chieftain’s new residence and town gate. It was to be that Jericho was not to be rebuilt but the words of God were disobeyed. … Hiel’s new town is represented in the archaeological record by Iron Age pottery found at Jericho. the succeeding phases of which continue on down into Byzantine times. The brook Cherith (SHD 3747) has the meaning cutting. cit..Ahab (whose name means brother/friend of his father) married Jezebel (Yezebul) the daughter of Ethbaal (Ittobaal) king of Sidon. 34). or Moon City. derived from karath (3772). As had been the custom for centuries in the ancient Levant.401). The Baal here has been identified as either Baal Shamem (lord of heaven) or Melqart. of Tishbe in Gilead. Jericho. was a rebuilt on these ancient practices and sacrifices. in the same way that Solomon had been enticed by his foreign wives. Shalmaneser reigned ca. and hide yourself by the brook Cherith. He refers to Ahab of Israel as Akhabbu of Sir’ala in these campaign records. 11th and 14th years of his reign." 2 And the word of the LORD came to him. 4 You shall drink . p. David Rohl states that from this time onwards “the ruin-mound of Jericho was reoccupied on a permanent basis”. 1Kings 17:1-24 Now Eli'jah the Tishbite. that is east of the Jordan. before whom I stand. Ahab’s Phoenician wife inevitably led him into serving her gods. ‘king of Tyre’ (or king of the underworld). In The Lost Testament he gives an alternative and plausible reason for Hiel’s sacrifice of his sons. Abiram and Segub. The Subjugation of Israel King Shalmaneser III was sent against Israel. there shall be neither dew nor rain these years. with the prophesied penalty.

and dwellthere." 5 So he went and did according to the word of the LORD. "Bring me a little water in a vessel. who shakes his hands. I am gathering a couple of sticks. and cried to the LORD. his bread will be given him. who stops his ears from hearing of bloodshed and shuts his eyes from looking upon evil. and the soul of the child came into him again. and he drank from the brook. became ill." In this text we see a demonstration of the promise by God that he would feed His servants even in times of famine. and he called to her and said. his water will be sure. and there were none more righteous than Elijah at this time. and carried him up into the upper chamber. and Eli'jah said. hast thou brought calamity even upon the widow with whom I sojourn. but first make me a little cake of it and bring it to me. the Sarepta of Luke 4:26. the mistress of the house. let this child's soul come into him again. 9 "Arise. now known as Surafend. 14 For thus says the LORD the God of Israel. that I may go in and prepare it for myself and my son. 17 After this the son of the woman. and die. a widow was there gathering sticks. Isaiah 33:15-16 He who walks righteously and speaks uprightly." 24 And the woman said to Eli'jah. by slaying her son?" 21 Then he stretched himself upon the child three times. his place of defense will be the fortresses of rocks. Behold. 20 And he cried to the LORD." 13 And Eli'jah said to her. and when he came to the gate of the city. and I have commanded the ravens to feed you there. and the cruse of oil shall not fail." 12 And she said. O man of God? You have come to me to bring my sin to remembrance. Isaiah 33 confirms that the righteous will have their bread and water supplied. and she. and laid him upon his own bed. "What have you against me. 16 he will dwell on the heights. neither did the cruse of oil fail. and he. and brought him down from the upper chamber into the house. he went and dwelt by the brook Cherith that is east of the Jordan. 49:10). 18 And she said to Eli'jah. I have commanded a widow there to feed you. "Bring me a morsel of bread in your hand. 7 And after a while the brook dried up." And he took him from her bosom. 16 The jar of meal was not spent. "Give me your son. both physical and spiritual (cf. and now. and delivered him to his mother. and he revived. and his illness was so severe that there was no breath left in him. lest they hold a bribe. I have nothing baked. 8 Then the word of the LORD came to him. refine or test. 23 And Eli'jah took the child." 11 And as she was going to bring it. 6 And the ravens brought him bread and meat in the morning." (RSV) . 10 So he arose and went to Zar'ephath. that we may eat it. until the day that the LORD sends rain upon the earth. `The jar of meal shall not be spent. "O LORD my God. from the brook. Its name means refinery. behold. go to Zar'ephath. (RSV) Elijah was then sent to Zarephath. that I may drink. only a handful of meal in a jar. where he lodged. and that the word of the LORD in your mouth is truth. which belongs to Sidon. and bread and meat in the evening. who despises the gain of oppressions. "As the LORD your God lives. he called to her and said.'" 15 And she went and did as Eli'jah said." 22 And the LORD hearkened to the voice of Eli'jah. and afterward make for yourself and your son. "Fear not. from the root meaning to smelt. "Now I know that you are a man of God. and a little oil in a cruse. because there was no rain in the land. go and do as you have said. also Isa. and her household ate for many days. your son lives. according to the word of the LORD which he spoke by Eli'jah. "See. and to cause the death of my son!" 19 And he said to her. "O LORD my God.

God responds according to His own timing. . This was to continue for centuries wherever Israel was established. This incident also shows that even God’s greatest prophets are required to be persistent in prayer. As noted earlier. However. "Go through the land to all the springs of water and to all the valleys. Eli'jah is here. behold. who was over the household. to kill me? 10 As the LORD your God lives. `Behold. 5) and an angel (19:5-6). 7 And as Obadi'ah was on the way. and not lose some of the animals. 1:10). there is no nation or kingdom whither my lord has not sent to seek you. We see here the lengths to which the false religious system goes to find (and. i. kill) the prophets of God." 6 So they divided the land between them to pass through it. tell your lord. "Is it you. 4 and when Jez'ebel cut off the prophets of the LORD. saying. where possible.' he would take an oath of the kingdom or nation.) Bullinger notes that this is the first recorded instance of civil power being used against the true religion (Companion Bible).e. 1Kings 18:1-46 After many days the word of the LORD came to Eli'jah. Although He hears all prayer. but also by birds (v. and Obadi'ah went in another direction by himself. "It is I. although the civil power was used in Egypt against the covenant people. 3 And Ahab called Obadi'ah. and fed them with bread and water. and said. show yourself to Ahab. His spokesman rather than simply a prophet as a foreteller of events. that they had not found you. and I will send rain upon the earth. the system is only permitted certain power for a specific time as all nations and peoples are ultimately in God’s hands. either along with or mingled with other nations. God also ensures that His servants are fed and watered at all times. such as Elijah here and Jeremiah (Jer. It is here being used to suppress the prophets of God within Israel itself.'" 9 And he said. Now the famine was severe in Sama'ria. in this case by a woman. 5 And Ahab said to Obadi'ah. (Now Obadi'ah revered the LORD greatly. that you would give your servant into the hand of Ahab. and fell on his face. Eli'jah met him. "Wherein have I sinned. and Obadi'ah recognized him. perhaps we may find grass and save the horses and mules alive. and when they would say.The city lived up to its name by being a place of testing for the widow: she was shown undeniably who was the man of God. my lord Eli'jah?" 8 And he answered him. `He is not here. He may also choose to delegate power over the nations to His prophets." 2 So Eli'jah went to show himself to Ahab. "Go. Ahab went in one direction by himself. Obadi'ah took a hundred prophets and hid them by fifties in a cave. in the third year. and that an answer may not be given immediately. Go.

meaning garden-land and hence a particularly fertile area of Israel."15 And Eli'jah said. the Spirit of the LORD will carry you whither I know not. 19 Now therefore send and gather all Israel to me at Mount Carmel. art thou not God in heaven? Dost thou not rule over all the kingdoms of the nations? In thy hand are power and might. and said. because you have forsaken the commandments of the LORD and followed the Ba'als. located on the outskirts of modern Haifa. 43 And he said to his servant. Ahab said to him. 17 When Ahab saw Eli'jah. 1Kings 18:41-46 And Eli'jah said to Ahab. and put his face between his knees. and told him. Elijah is said to have lived in a particular cave (of the Sons of the Prophet. 13 Has it not been told my lord what I did when Jez'ebel killed the prophets of the LORD. "Behold. And Ahab rode and went to Jezreel. Following the killing of all these idolatrous priests by Elijah and the people at the brook Kishon. a little cloud like a man's hand is rising out of the sea. which the Roman Emperor Vespasian consulted before besieging Jerusalem. God of our fathers. although I your servant have revered the LORD from my youth. so that none is able to withstand thee."' 12 And as soon as I have gone from you. before whom I stand. and your father's house. "Go up. There is also a perennial fountain on the Carmel range said to be ." 44 And at the seventh time he said. and he bowed himself down upon the earth. I will surely show myself to him today. and there was a great rain. "Is it you. And Eli'jah went up to the top of Carmel. "Behold. Eli'jah is here"'. and so. and he girded up his loins and ran before Ahab to the entrance of Jezreel. 1Kgs. lest the rain stop you. "I have not troubled Israel. `Go. "As the LORD of hosts lives.19:9). "Go again seven times. but you have. and fed them with bread and water? 14 And now you say. (RSV) Continuing in 1Kings 18: 11 And now you say. and so has always had some spiritual significance. he will kill me. "Behold." 16 So Obadi'ah went to meet Ahab. eat and drink. and Ahab went to meet Eli'jah. 2Chronicles 20:6 "O LORD. you troubler of Israel?" 18 And he answered." And he went up and looked. `Prepare your chariot and go down. (RSV) Carmel. who eat at Jez'ebel's table. 254). 46 And the hand of the LORD was on Eli'jah. how I hid a hundred men of the LORD'S prophets by fifties in a cave." And he said." And he said. look toward the sea. was referred to in the records of Pharaoh Thutmosis III in the 15th century BCE as Holy Head. "Go up. "There is nothing. `Go. Eli'jah is here." 42 So Ahab went up to eat and to drink." (RSV) The full text (vv. and the four hundred and fifty prophets of Ba'al and the four hundred prophets of Ashe'rah. say to Ahab. Even today the cave is a place of pilgrimage and prayer for Jews. Christians and Muslims alike. for there is a sound of the rushing of rain. the prophet appeared again before King Ahab. 20-40) of Elijah’s test of spiritual strength with the 450 priests of Baal is given in the paper Law and the Second Commandment (No. Mount Carmel was supposedly the location of an oracle. and he will kill me. when I come and tell Ahab and he cannot find you.'" 45 And in a little while the heavens grew black with clouds and wind. tell your lord. "Go up now. tell your lord.

who literally ran for his life into a remote area. The symbols of the rain and the power exercised by Elijah are important to the function of the elect in the Last Days. 4:1-2). and came to Beer-sheba. "Arise and eat. She was determined to take revenge on Elijah. 1Kings 19:1-21 Ahab told Jez'ebel all that Eli'jah had done. . and he was transfigured before them. The nearby river Kishon rises in Mt. Tabor and empties into the Mediterranean. and ate and drank. 4 But he himself went a day's journey into the wilderness. which belongs to Judah. there was at his head a cake baked on hot stones and a jar of water. for I am no better than my fathers. I say to you. and he arose and went for his life." 8 And he arose. saying. culminating in the Laws of God being developed and the nexus of the Law being restored (see the paper Seven Spirits of God (No. the place of burning. and more also. there are some standing here who will not taste death before they see that the kingdom of God has come with power. "Truly. "Arise and eat. 2 Then Jez'ebel sent a messenger to Eli'jah. "So may the gods do to me. else the journey will be too great for you. Elijah will again be sent to Israel in the Last Days and he will exercise the power of the Holy Spirit as the Seven Spirits of God in command of the Seven Churches. 34:28. 3 and his garments became glistening. take away my life.that used by Elijah. Mat. and how he had slain all the prophets with the sword. Elijah fasted for 40 days and nights in the wilderness (cf. 64)). if I do not make your life as the life of one of them by this time tomorrow. Queen Jezebel was now extremely vexed because her prophets had not only been shown to be powerless before the single priest of God but also had been destroyed. 7 And the angel of the LORD came again a second time. and came and sat down under a broom tree. and behold. "It is enough. and left his servant there. Exactly as Moses had done and Christ would do in the future. See also the paper The Angel of YHVH (No. El-Muhraka. It is significant that these three met together in the transfiguration scene witnessed by a select few disciples during the demonstration of the Kingdom of God in power (Mk. saying. And he ate and drank. O LORD. Why then did Elijah run to Judah from Israel after performing such a miracle? Was he entirely afraid or simply weary of the work of God? The symbol is that He will deal with Israel and the false religions and then also with Judah. called in Arabic. an angel touched him. and touched him. 24)." 3 Then he was afraid. Ex. Mark 9:1-4 And he said to them." 2 And after six days Jesus took with him Peter and James and John. and in the southeast tip of the range is the supposed site of the testing of Baal. now. and said to him. and led them up a high mountain apart by themselves. and he asked that he might die." 5 And he lay down and slept under a broom tree. 9:1-4). and behold. and went in the strength of that food forty days and forty nights to Horeb the mount of God. In the strength and power of God he will rebuke Israel and the nations of the world following that. and lay down again." 6 And he looked. and said. who is separate to the nation of Israel but is to be rejoined to it.

and him who escapes from the sword of Jehu shall Eli'sha slay.14). 4 And there appeared to them Eli'jah with Moses. 15 And the LORD said to him. thrown down thy altars. even I only. intensely white. 17 And him who escapes from the sword of Haz'ael shall Jehu slay. and after the fire a still small voice. who was eventually to take over from him. and he said to him. "Go. And behold. and when you arrive. thrown down thy altars. to take it away. 18 Yet I will leave seven thousand in Israel. all the knees that have not bowed to Ba'al. there came a voice to him." Elijah is given the task of anointing two kings. and lodged there. and Eli'sha the son of Shaphat of A'bel-meho'lah you shall anoint to be prophet in your place. "What are you doing here. but the LORD was not in the wind." The still small voice was that of an angelic being (cf. and every mouth that has not kissed him. even I only. "Go forth. and said. am left. and slain thy prophets with the sword. and a great and strong wind rent the mountains. 11 And he said. but the LORD was not in the fire. Elisha. and they seek my life. Eli'jah?" 10 He said." Bullinger’s comment here is that “there were lay altars (local) for customary individual offerings by laymen. "I have been very jealous for the LORD. 10. 13 And when Eli'jah heard it. he wrapped his face in his mantle and went out and stood at the entrance of the cave. but the LORD was not in the earthquake. and behold. as well as at Jerusalem. the word of the LORD came to him. "I have been very jealous for the LORD. for the people of Israel have forsaken thy covenant. and they were talking to Jesus. 16 and Jehu the son of Nimshi you shall anoint to be king over Israel." And behold. and after the wind an earthquake. and one prophet. and stand upon the mount before the LORD. 24)). and broke in pieces the rocks before the LORD.) The tribes of Israel sacrificed locally and conducted prayer services locally while their priestly divisions were on duty at the Tabernacle and later at the Temple under Solomon. am left. Eli'jah?" 14 He said. The word for word repetition of Elijah’s explanation to this Angel indicates its importance (vv. . as no fuller on earth could bleach them.” (ibid. for the people of Israel have forsaken thy covenant. of Syria and Israel. to take it away. These had no horns. and I. 12 and after the earthquake a fire. the God of hosts. the LORD passed by. and I. and they seek my life. (RSV) Continuing in 1Kings 19: 9 And there he came to a cave. you shall anoint Haz'ael to be king over Syria. "What are you doing here. return on your way to the wilderness of Damascus. and slain thy prophets with the sword. The Angel of YHVH (No. the God of hosts.

and found Eli'sha the son of Shaphat. and he went up and besieged Sama'ria. your wives and your children". he said to his men. "The gods do so to me. as required by God. and they ate. and they shall search your house and the houses of your servants. as did some of Jesus’ potential disciples (Lk. and more also. and fought against it. "Deliver to me your silver and your gold." 8 And all the elders and all the people said to him. 20 And he left the oxen. now. and said. "As you say. thirty-two kings were with him." And he said to him." And they took their positions against the city. "Mark. and said.'" 4 And the king of Israel answered. (RSV) Elisha the son of Shaphat has the composite meaning of “God is salvation: He has judged”. and see how this man is seeking trouble.The practice of bending the knee and kissing the images of Baal is carried on to this day in a number of religions including the churches that purport to be Christian. 6 nevertheless I will send my servants to you tomorrow about this time." 11 And the king of Israel answered. and boiled their flesh with the yokes of the oxen. `All that you first demanded of your servant I will do. "Take your positions." 5 The messengers came again. and slew them. Then he arose and went after Eli'jah. but this thing I cannot do. "Tell my lord the king. for he sent to me for my wives and my children. and he was with the twelfth. saying. "Thus says the LORD. I am yours. and took the yoke of oxen. is found in the parable of the two sons (Mat. A similar reluctance followed by obedience. and said to him. Elisha anointed 19 So he departed from there.'" 12 When Ben-ha'dad heard this message as he was drinking with the kings in the booths. and gave it to the people. and I did not refuse him. 1Kings 20 details the war that developed between Ben-hadad of Syria and his thirty-two allies on one side and Israel on the other. and take it away. `Let not him that girds on his armor boast himself as he that puts it off." 14 And . Eli'jah passed by him and cast his mantle upon him. and horses and chariots.). 21:28ff. "Thus says Ben-ha'dad: `I sent to you. and lay hands on whatever pleases them. your fairest wives and children also are mine. 9:57-62). Have you seen all this great multitude? Behold. and you shall know that I am the LORD. I will give it into your hand this day. Israel’s War with Syria Syria was also known as Aram or the Aramaean Kingdom of Damascus. and all that I have. O king. 13 And behold. Elisha demonstrated the same unwillingness to go immediately with Elijah. 1Kings 20:1-43 Ben-ha'dad the king of Syria gathered all his army together. 2 And he sent messengers into the city to Ahab king of Israel. 10 Ben-ha'dad sent to him and said." 9 So he said to the messengers of Ben-ha'dad. who was plowing.'" 7 Then the king of Israel called all the elders of the land. my lord. and ran after Eli'jah. for what have I done to you?" 21 And he returned from following him. with twelve yoke of oxen before him. "Go back again. and for my silver and my gold. a prophet came near to Ahab king of Israel and said. "Do not heed or consent. and said. if the dust of Sama'ria shall suffice for handfuls for all the people who follow me. "Tell him. and then I will follow you. "Let me kiss my father and my mother.'" And the messengers departed and brought him word again. and ministered to him. "Thus says Ben-ha'dad: 3 `Your silver and your gold are mine.

Ahab said, "By whom?" He said, "Thus says the LORD, By the servants of the governors of
the districts." Then he said, "Who shall begin the battle?" He answered, "You." 15 Then he
mustered the servants of the governors of the districts, and they were two hundred and thirty-
two; and after them he mustered all the people of Israel, seven thousand. 16 And they went out
at noon, while Ben-ha'dad was drinking himself drunk in the booths, he and the thirty-two
kings who helped him. 17 The servants of the governors of the districts went out first. And
Ben-ha'dad sent out scouts, and they reported to him, "Men are coming out from Sama'ria." 18
He said, "If they have come out for peace, take them live; or if they have come out for war,
take them alive." 19 So these went out of the city, the servants of the governors of the districts,
and the army which followed them. 20 And each killed his man; the Syrians fled and Israel
pursued them, but Ben-ha'dad king of Syria escaped on a horse with horsemen. 21 And the
king of Israel went out, and captured the horses and chariots, and killed the Syrians with a
great slaughter. 22 Then the prophet came near to the king of Israel, and said to him, "Come,
strengthen yourself, and consider well what you have to do; for in the spring the king of Syria
will come up against you."

Springtime was traditionally the time to begin military campaigning. 2Samuel 11:1 reads: “In the
spring of the year, the time when kings go forth to battle …” (RSV); although the literal Hebrew is
at the return of the year, indicating precisely when the year begins in God’s true Calendar,
namely, March/April in the northern hemisphere. It will be so also in the Last Days that the
Spring-offensives will determine the conduct of some theatre operations such as of the Taliban
in Afghanistan in 2007. The major offensives will be from Spring to Summer and the King of the
South will push at the King of the North from Spring to Summer, and many of the sons of Shem
will die in that war.

23
And the servants of the king of Syria said to him, "Their gods are gods of the hills, and so
they were stronger than we; but let us fight against them in the plain, and surely we shall be
stronger than they. 24 And do this: remove the kings, each from his post, and put commanders
in their places; 25 and muster an army like the army that you have lost, horse for horse, and
chariot for chariot; then we will fight against them in the plain, and surely we shall be stronger
than they." And he hearkened to their voice, and did so. 26 In the spring Ben-ha'dad mustered
the Syrians, and went up to Aphek, to fight against Israel. 27 And the people of Israel were
mustered, and were provisioned, and went against them; the people of Israel encamped before
them like two little flocks of goats, but the Syrians filled the country. 28 And a man of God
came near and said to the king of Israel, "Thus says the LORD, `Because the Syrians have
said, "The LORD is a god of the hills but he is not a god of the valleys," therefore I will give
all this great multitude into your hand, and you shall know that I am the LORD.'" 29 And they
encamped opposite one another seven days. Then on the seventh day the battle was joined;
and the people of Israel smote of the Syrians a hundred thousand foot soldiers in one day. 30
And the rest fled into the city of Aphek; and the wall fell upon twenty-seven thousand men
that were left. Ben-ha'dad also fled, and entered an inner chamber in the city. 31 And his
servants said to him, "Behold now, we have heard that the kings of the house of Israel are
merciful kings; let us put sackcloth on our loins and ropes upon our heads, and go out to the
king of Israel; perhaps he will spare your life." 32 So they girded sackcloth on their loins, and
put ropes on their heads, and went to the king of Israel and said, "Your servant Ben-ha'dad
says, `Pray, let me live.'" And he said, "Does he still live? He is my brother." 33 Now the men
were watching for an omen, and they quickly took it up from him and said, "Yes, your brother
Ben-ha'dad." Then he said, "Go and bring him." Then Ben-ha'dad came forth to him; and he
caused him to come up into the chariot. 34 And Ben-ha'dad said to him, "The cities which my

father took from your father I will restore; and you may establish bazaars for yourself in
Damascus, as my father did in Sama'ria." And Ahab said, "I will let you go on these terms."
So he made a covenant with him and let him go.
Note that they encamped seven days and joined battle on the seventh day. This is the same as it
was at Jericho and has a similar symbolism (see the paper The Fall of Jericho (No. 42)).

Ahab actually sinned by sparing the defeated Ben-hadad’s life and this subsequently brought
great trouble to the whole of Israel (1Kgs. 20:20-43).

The story continues in verse 35.
35
And a certain man of the sons of the prophets said to his fellow at the command of the
LORD, "Strike me, I pray." But the man refused to strike him. 36 Then he said to him,
"Because you have not obeyed the voice of the LORD, behold, as soon as you have gone from
me, a lion shall kill you." And as soon as he had departed from him, a lion met him and killed
him.

Josephus identified this certain man with Micaiah in 1Kings 22:8. Severe and sometimes
immediate consequences result from failure to obey a directive from God through His servants
the prophets.

37
Then he found another man, and said, "Strike me, I pray." And the man struck him, smiting
and wounding him. 38 So the prophet departed, and waited for the king by the way, disguising
himself with a bandage over his eyes. 39 And as the king passed, he cried to the king and said,
"Your servant went out into the midst of the battle; and behold, a soldier turned and brought a
man to me, and said, `Keep this man; if by any means he be missing, your life shall be for his
life, or else you shall pay a talent of silver.' 40 And as your servant was busy here and there, he
was gone." The king of Israel said to him, "So shall your judgment be; you yourself have
decided it." 41 Then he made haste to take the bandage away from his eyes; and the king of
Israel recognized him as one of the prophets. 42 And he said to him, "Thus says the LORD,
`Because you have let go out of your hand the man whom I had devoted to destruction,
therefore your life shall go for his life, and your people for his people.'" 43 And the king of
Israel went to his house resentful and sullen, and came to Sama'ria. (RSV)

Naboth’s Vineyard

1Kings 21:1-29 Now Naboth the Jezreelite had a vineyard in Jezreel, beside the palace of
Ahab king of Sama'ria. 2 And after this Ahab said to Naboth, "Give me your vineyard, that I
may have it for a vegetable garden, because it is near my house; and I will give you a better
vineyard for it; or, if it seems good to you, I will give you its value in money."

This is precisely the type of situation that Samuel had warned Israel about when, in their
faithlessness, they had asked for a flesh-and-blood king like the surrounding nations (1Sam.

8:11,14). In accordance with the Law (Lev. 25:23; Num. 36:7,8), Naboth quite rightly refused to
part with his inheritance, even to a king of Israel.

3
But Naboth said to Ahab, "The LORD forbid that I should give you the inheritance of my
fathers." 4 And Ahab went into his house vexed and sullen because of what Naboth the
Jezreelite had said to him; for he had said, "I will not give you the inheritance of my fathers."
And he lay down on his bed, and turned away his face, and would eat no food. 5 But Jez'ebel
his wife came to him, and said to him, "Why is your spirit so vexed that you eat no food?" 6
And he said to her, "Because I spoke to Naboth the Jezreelite, and said to him, `Give me your
vineyard for money; or else, if it please you, I will give you another vineyard for it'; and he
answered, `I will not give you my vineyard.'" 7 And Jez'ebel his wife said to him, "Do you
now govern Israel? Arise, and eat bread, and let your heart be cheerful; I will give you the
vineyard of Naboth the Jezreelite." 8 So she wrote letters in Ahab's name and sealed them with
his seal, and she sent the letters to the elders and the nobles who dwelt with Naboth in his city.
9
And she wrote in the letters, "Proclaim a fast, and set Naboth on high among the people; 10
and set two base fellows opposite him, and let them bring a charge against him, saying, `You
have cursed God and the king.' Then take him out, and stone him to death." 11 And the men of
his city, the elders and the nobles who dwelt in his city, did as Jez'ebel had sent word to them.
As it was written in the letters which she had sent to them, 12 they proclaimed a fast, and set
Naboth on high among the people. 13 And the two base fellows came in and sat opposite him;
and the base fellows brought a charge against Naboth, in the presence of the people, saying,
"Naboth cursed God and the king." So they took him outside the city, and stoned him to death
with stones.

The matter of swearing an oath falsely (vv. 10-13) is dealt with in the paper Law and the Third
Commandment (No. 255).

14
Then they sent to Jez'ebel, saying, "Naboth has been stoned; he is dead." 15 As soon as
Jez'ebel heard that Naboth had been stoned and was dead, Jez'ebel said to Ahab, "Arise, take
possession of the vineyard of Naboth the Jezreelite, which he refused to give you for money;
for Naboth is not alive, but dead." 16 And as soon as Ahab heard that Naboth was dead, Ahab
arose to go down to the vineyard of Naboth the Jezreelite, to take possession of it. 17 Then the
word of the LORD came to Eli'jah the Tishbite, saying, 18 "Arise, go down to meet Ahab king
of Israel, who is in Sama'ria; behold, he is in the vineyard of Naboth, where he has gone to
take possession. 19 And you shall say to him, `Thus says the LORD, "Have you killed, and
also taken possession?"' And you shall say to him, `Thus says the LORD: "In the place where
dogs licked up the blood of Naboth shall dogs lick your own blood."'" 20 Ahab said to Eli'jah,
"Have you found me, O my enemy?" He answered, "I have found you, because you have sold
yourself to do what is evil in the sight of the LORD. 21 Behold, I will bring evil upon you; I
will utterly sweep you away, and will cut off from Ahab every male, bond or free, in Israel; 22
and I will make your house like the house of Jerobo'am the son of Nebat, and like the house of
Ba'asha the son of Ahi'jah, for the anger to which you have provoked me, and because you
have made Israel to sin. 23 And of Jez'ebel the LORD also said, `The dogs shall eat Jez'ebel
within the bounds of Jezreel.' 24 Any one belonging to Ahab who dies in the city the dogs shall
eat; and any one of his who dies in the open country the birds of the air shall eat."

Jezebel’s blood was thus to join Naboth’s in the dust of Jezreel rather than in her capital city of
Samaria.

25
(There was none who sold himself to do what was evil in the sight of the LORD like Ahab,
whom Jez'ebel his wife incited. 26 He did very abominably in going after idols, as the
Amorites had done, whom the LORD cast out before the people of Israel.) 27 And when Ahab
heard those words, he rent his clothes, and put sackcloth upon his flesh, and fasted and lay in
sackcloth, and went about dejectedly. 28 And the word of the LORD came to Eli'jah the
Tishbite, saying, 29 "Have you seen how Ahab has humbled himself before me? Because he
has humbled himself before me, I will not bring the evil in his days; but in his son's days I will
bring the evil upon his house." (RSV)

In spite of the multitude of Ahab’s evil deeds, as soon as he fasted and humbled himself before
God, his repentance (however brief) was accepted and the intended retribution was put upon
his son’s head instead. Ahab’s repentance can be compared with that of King Manasseh of Judah
(2Chr. 33:12-13).

Assuming Ahab as a devotee of Baal was a type of Satan, we can deduce from this that even the
present ‘king’ of this Earth will one day repent and find acceptance from God. The Great Whore
of the religious systems of this world, typified by his consort Jezebel, will be totally cut off and
destroyed, however. She typifies the religion of the god of this world for whom the name King of
Tyre is an epithet. Her death represents the cutting of Tyre and Sidon, symbols of religious
power on this Earth.

In his book, The History and Religion of Israel, Dr. G.W. Anderson linked the breakdown in social
justice with the introduction of the Baal system to Israel.

As the importation of Baal worship involved a denial of the supreme lordship of Yahweh in
Israel, so the ruthless removal of Naboth and his sons was an outrage against the status and
rights of the ordinary Israelite within the covenant community and against the sanctity of the
administration of justice. Developments had already begun which were to be increasingly
evident in the kingdoms of Israel and Judah: the pressure, not only of Canaanite fertility
religion, but of the cults of foreign kingdoms; the threat to traditional norms of equity brought
about by economic and social changes; and the corruption of judges and witnesses in the
interests of the rich and powerful. Later prophets inveighed against these abuses. (Oxford
University Press, 1966; p.94)

Anderson could hardly better describe the situation in the nations descended from Israel today,
nearly 2900 years later.

In its article ‘Ahab’, the Jewish Encyclopedia gives a more favourable view of this particular king
of Israel.

Though held up as a warning to sinners, Ahab is also described as displaying noble traits of
character (Sanh. 102b; Yer. Sanh. xi. 29b). Talmudic literature represents him as an
enthusiastic idolater who left no hilltop in Palestine without an idol before which he bowed,
and to which he or his wife, Jezebel, brought his weight in gold as a daily offering. So defiant
in his apostasy was he that he had inscribed on all the doors of the city of Samaria the words,
"Ahab hath abjured the living God of Israel." Nevertheless, he paid great respect to the
representatives of learning, "to the Torah given in twenty-two letters," for which reason he
was permitted to reign for twenty-two successive years. He generously supported the students
of the Law out of his royal treasury, in consequence of which half his sins were forgiven him.

This belies the persecution of his wife of the prophets. Ahab supported both sides to cover
contingencies, as it were.

Israel and Judah at War with Syria

We see that there had been a peace of sorts between Israel and Syria for three years (cf. 20:34).
However, the warlike tendencies of the kings of Israel soon surfaced with an attempt to retake
Ramoth-gilead from the Syrians, with Judah’s help. This was a City of Refuge, probably taken in
the former war (16:34; 20:43) by Ben-hadad I from Ahab’s father Omri; however, his son Ben-
hadad II agreed to restore it to Israel. During this time Jehoshaphat “strengthened himself
against Israel” (2Chr. 17.1).

1Kings 22:1-39 For three years Syria and Israel continued without war. 2 But in the third year
Jehosh'aphat the king of Judah came down to the king of Israel. 3 And the king of Israel said to
his servants, "Do you know that Ramoth-gilead belongs to us, and we keep quiet and do not
take it out of the hand of the king of Syria?" 4 And he said to Jehosh'aphat, "Will you go with
me to battle at Ramoth-gilead?" And Jehosh'aphat said to the king of Israel, "I am as you are,
my people as your people, my horses as your horses." 5 And Jehosh'aphat said to the king of
Israel, "Inquire first for the word of the LORD." 6 Then the king of Israel gathered the
prophets together, about four hundred men, and said to them, "Shall I go to battle against
Ramoth-gilead, or shall I forbear?" And they said, "Go up; for the Lord will give it into the
hand of the king." 7 But Jehosh'aphat said, "Is there not here another prophet of the LORD of
whom we may inquire?" 8 And the king of Israel said to Jehosh'aphat, "There is yet one man
by whom we may inquire of the LORD, Micai'ah the son of Imlah; but I hate him, for he
never prophesies good concerning me, but evil." And Jehosh'aphat said, "Let not the king say
so." 9 Then the king of Israel summoned an officer and said, "Bring quickly Micai'ah the son
of Imlah." 10 Now the king of Israel and Jehosh'aphat the king of Judah were sitting on their
thrones, arrayed in their robes, at the threshing floor at the entrance of the gate of Sama'ria;
and all the prophets were prophesying before them. 11 And Zedeki'ah the son of Chena'anah
made for himself horns of iron, and said, "Thus says the LORD, `With these you shall push
the Syrians until they are destroyed.'" 12 And all the prophets prophesied so, and said, "Go up
to Ramoth-gilead and triumph; the LORD will give it into the hand of the king." 13 And the
messenger who went to summon Micai'ah said to him, "Behold, the words of the prophets

as sheep that have no shepherd. the LORD has not spoken by me. teaching in their synagogues and preaching the gospel of the kingdom." 14 But Micai'ah said.' 22 And the LORD said to him. `You are to entice him. "Behold. that I will speak. 30 And the king of Israel said to Jehosh'aphat. but the laborers are few. to obey or be obedient. 21 Then a spirit came forward and stood before the LORD. "Go up and triumph." And he said. you shall see on that day when you go into an inner chamber to hide yourself. `I will entice him." 16 But the king said to him. 31 Now the king of Syria had commanded the thirty-two captains of his chariots. he had compassion for them. all you peoples!" The word for hear is shama‘ (SHD 8085) meaning not just to listen with one’s ears but. the LORD has put a lying spirit in the mouth of all these your prophets. that he may go up and fall at Ramoth-gilead?' And one said one thing. but only with the king of Israel. "Therefore hear the word of the LORD: I saw the LORD sitting on his throne. and will be a lying spirit in the mouth of all his prophets. and feed him with scant fare of bread and water. 36 When he saw the crowds. and all the host of heaven standing beside him on his right hand and on his left."'" 28 And Micai'ah said. "Did I not tell you that he would not prophesy good concerning me. 20 and the LORD said. Christ himself spoke of similar lost souls in Israel in his day." 32 And when the captains of the chariots saw . "Put this fellow in prison. more importantly. "If you return in peace.' And he said. and speak favorably. what the LORD says to me. shall we go to Ramoth-gilead to battle. `By what means?' And he said. `Who will entice Ahab." And the king of Israel disguised himself and went into battle. but evil?" 19 And Micai'ah said. the LORD has spoken evil concerning you." 24 Then Zedeki'ah the son of Chena'anah came near and struck Micai'ah on the cheek. `These have no master. and said. 27 and say. "Micai'ah." 15 And when he had come to the king. and another said another. "Fight with neither small nor great. and healing every disease and every infirmity. go forth and do so. It is the same term used for the ‘Shema Ysrael (Deut. 37 Then he said to his disciples. "How did the Spirit of the LORD go from me to speak to you?" 25 And Micai'ah said. the king said to him. `I will go forth. 29 So the king of Israel and Jehosh'aphat the king of Judah went up to Ramoth-gilead." 26 And the king of Israel said.'" The forthcoming battle against the Syrians is also described in 2Chronicles 18:2ff. with one accord are favorable to the king. "Hear. like sheep without a shepherd." (RSV) Continuing in 1Kings 22: 18 And the king of Israel said to Jehosh'aphat. "The harvest is plentiful. "As the LORD lives. "Seize Micai'ah. 38 pray therefore the Lord of the harvest to send out laborers into his harvest. or shall we forbear?" And he answered him. `Thus says the king. saying. but you wear your robes. and you shall succeed. 6:4). let each return to his home in peace. Matthew 9:35-38 And Jesus went about all the cities and villages. "I saw all Israel scattered upon the mountains. until I come in peace.' 23 Now therefore behold. the LORD will give it into the hand of the king. and take him back to Amon the governor of the city and to Jo'ash the king's son. let your word be like the word of one of them. "How many times shall I adjure you that you speak to me nothing but the truth in the name of the LORD?" 17 And he said. and the LORD said. because they were harassed and helpless. "I will disguise myself and go into battle.

and the blood of the wound flowed into the bottom of the chariot.246) . Finds of ivory in itself are nothing unusual in Palestinian excavation. On almost every site this expensive material is encountered. 17:1] and for Ahab’s father-in-law Ethbaal of Sidon were provided by Menander of Ephesus. until at evening he died. p. … Menander records the catastrophic drought which set in throughout Palestine and Syria during the reign of Ittobaal [Ethbaal] and lasted a whole year. every square yard. During two archaeological excavations in 1908-10 and 1931-35. for I am wounded. they said. and the harlots washed themselves in it. 38 And they washed the chariot by the pool of Sama'ria. "Every man to his city. are they not written in the Book of the Chronicles of the Kings of Israel? The ivory houses mentioned in verse 39 were long thought to have been inventions by the writer of the Book of Kings (i. and Jehosh'aphat cried out. op. they came across these yellowish brown chips and flakes. … It is now quite clear what happened: Ahab had the rooms of the palace decorated with this wonderful material and filled them with ivory furniture (Keller. the site of the former capital of Samaria revealed some surprising finds. as well as fragments which still showed the marvellous craftsmanship of these elegant reliefs carved by Phoenician masters. therefore he said to the driver of his chariot.e. and the ivory house which he built. Jehosh'aphat. Once again. and they buried the king in Sama'ria. they turned back from pursuing him." 35 And the battle grew hot that day. The Bible as History. a Phoenician historian. however. On the acropolis on the west side of the hill foundations and walls of a building were exposed. and carry me out o the battle." So they turned to fight against him. 245-6). and the king was propped up in his chariot facing the Syrians. 36 And about sunset a cry went through the army. according to the Talmud). p. and the dogs licked up his blood. "Turn about.. cit. yet in Samaria the ground is literally covered with them.. "It is surely the king of Israel. (ibid. … Obviously this monarch did not build his entire palace of ivory. This enclosed a wide courtyard and was a royal palace of the northern kingdom of Israel. Werner Keller concurs with this sentiment (hence the title of his book) by adding: The proofs of the historical basis for the drought [1Kgs. At every step. according to the word of the LORD which he had spoken. … As the rubble was being carted off the diggers very quickly noticed the innumerable splinters of ivory that it contained. Jeremiah. and every man to his country!" 37 So the king died. but always in isolated pieces. and all that he did. and was brought to Sama'ria. the Bible record stands up to the most minute scrutiny when viewed alongside archaeological finds and in the light of secular historical records. 33 And when the captains of the chariots saw that it was not the king of Israel. and all the cities that he built. 39 Now the rest of the acts of Ahab. and struck the king of Israel between the scale armor and the breastplate. 34 But a certain man drew his bow at a venture.

Ahaziah The fourth dynasty in Israel continued with its ninth king. after Ahab was killed in battle his body was taken to Samaria and buried in that city. His mother's name was Azu'bah the daughter of Shilhi. and how he warred. 53 He served Ba'al and worshiped him. 51 Ahazi'ah the son of Ahab began to reign over Israel in Sama'ria in the seventeenth year of Jehosh'aphat king of Judah. 41 Jehosh'aphat the son of Asa began to reign over Judah in the fourth year of Ahab king of Israel. and Ahazi'ah his son reigned in his stead. yet the high places were not taken away. 47 There was no king in Edom. 48 Jehosh'aphat made ships of Tarshish to go to Ophir for gold. saying. and he reigned twenty- five years in Jerusalem. "Because you have joined with Ahazi'ah. 1Kings 22:40-53 So Ahab slept with his fathers. "Let my servants go with your servants in the ships. Moab rebelled against Israel. the LORD will destroy what you have made. and in the way of his mother. but reigned for only two years. he exterminated from the land. are they not written in the Book of the Chronicles of the Kings of Judah? 46 And the remnant of the male cult prostitutes who remained in the days of his father Asa. 49 Then Ahazi'ah the son of Ahab said to Jehosh'aphat. a deputy was king. and walked in the way of his father. . He ascended the throne in the 17th year of Jehoshaphat of Judah. and the people still sacrificed and burned incense on the high places." And the ships were wrecked and were not able to go to Tarshish. to anger in every way that his father had done. and he reigned two years over Israel. son of the infamous Ahab. Ahaziah. where Ahaziah “did evil in the sight of the Lord as did the house of Ahab: for he was the son-in-law of the house of Ahab. 45 Now the rest of the acts of Jehosh'aphat. and was buried with his fathers in the city of David his father." but Jehosh'aphat was not willing. (RSV) 1Kings 22 continues: 50 And Jehosh'aphat slept with his fathers.” 2Kings 1:1-18 After the death of Ahab. 42 Jehosh'aphat was thirty-five years old when he began to reign. for the ships were wrecked at E'zion- ge'ber. the God of Israel. who made Israel to sin. 44 Jehosh'aphat also made peace with the king of Israel. 37 Then Elie'zer the son of Do-dav'ahu of Mare'shah prophesied against Jehosh'aphat. (RSV) We can see the evil influence that Israel had exerted upon Judah from 2Kings 8:26-27. doing what was right in the sight of the LORD. he did not turn aside from it. and Jeho'ram his son reigned in his stead. 2Chronicles 20:35-37 expands upon the story and highlights inappropriate alliances. but they did not go. He thus suffered a less ignominious end than either his wife or son. and provoked the LORD. and in the way of Jerobo'am the son of Nebat. 43 He walked in all the way of Asa his father. and his might that he showed.As we saw in 1Kings 22:37. 52 He did what was evil in the sight of the LORD.

had its name changed by the Jews to Beel-zebul (lord of dung). at the break-up of the united Kingdom. inquire of Ba'al-ze'bub. `You shall not come down from the bed to which you have gone. let my life. "Why have you returned?" 6 And they said to him." Then the fire of God came down from heaven and consumed him and his fifty. control over them passed to Israel. 3 But the angel of the LORD said to Eli'jah the Tishbite. etc. "O man of God. but you shall surely die. "What kind of man was he who came to meet you and told you these things?" 8 They answered him." The true prophets of God often wore rough or hairy clothing (cf. and say to them. was another prophet clothed in rough garments (Mat. Is it because there is no God in Israel that you are sending to inquire of Ba'al-ze'bub. 26). And he went up and said to him.'" So Eli'jah went. go up to meet the messengers of the king of Sama'ria. "It is Eli'jah the Tishbite. `Come down. fire came down from heaven.'" 10 But Eli'jah answered the captain of fifty. whether I shall recover from this sickness. so he sent messengers. 11:8). John the Baptist. be precious in your sight. Consulting or serving ‘gods that are not gods’ or demons was strictly forbidden (Ex. telling them. this is the king's order." And he said. 8:2) and. "If I am a man of God. and he said to them. And the third captain of fifty went up. and the life of these fifty servants of yours.). and said to him. the god of Ekron?' 4 Now therefore thus says the LORD. let fire come down from heaven and consume you and your fifty. who was likened to Elijah. "Arise. 2Kgs. 17:35. 11 Again the king sent to him another captain of fifty men with his fifty. 13 Again the king sent the captain of a third fifty with his fifty. and came and fell on his knees before Eli'jah. I pray you. 14 Lo. Baal-zebub. "O man of God. "If I am a man of God." . `Go back to the king who sent you. the pagan lord of the flies. and consumed him and his fifty. and say to him. `Come down quickly!'" 12 But Eli'jah answered them. "O man of God." Then fire came down from heaven. with a girdle of leather about his loins.'" 7 He said to them. "There came a man to meet us. 23:13. but now let my life be precious in your sight. the king says. the god of Ekron? Therefore you shall not come down from the bed to which you have gone.3:4. "Go. 9 Then the king sent to him a captain of fifty men with his fifty. and said to us. the god of Ekron. Zech. He went up to Eli'jah. 13:4) as a token of their humility perhaps or as a kind of permanent sackcloth in mourning for their nation and its inhabitants. and entreated him. Thus says the LORD. The text in 2Kings 1 continues: 2 Now Ahazi'ah fell through the lattice in his upper chamber in Sama'ria. "He wore a garment of haircloth. `Is it because there is no God in Israel that you are going to inquire of Ba'al-ze'bub." A fatal mistake … as we see in verse 4. and consumed the two former captains of fifty men with their fifties. this became the Greek Baal-zebul (lord of abominable idols) as in Matthew 12:24. who was sitting on the top of a hill. 5 The messengers returned to the king. The Moabite Stone records the rebellion of Moab following the death of King Ahab. and lay sick.David had previously subdued Moab (2Sam. but shall surely die. and was identified with Satan (v. let fire come down from heaven and consume you and your fifty.

king of Judah. "Behold. as my lord sees. Elisha sixteen miracles." 20 He said. . "Go down with him. It means youth and covers the same broad meaning. the situation of this city is pleasant. and while he was going up on the way. who happened to be in the “Samaria” of Elijah at the time of their request to Jesus (Lk. henceforth neither death nor miscarriage shall come from it. "Thus says the LORD. 19:16). are they not written in the Book of the Chronicles of the Kings of Israel? (RSV) The taking of Elijah by a whirlwind (2Kgs. 21 Then he went to the spring of water and threw salt in it. and the land is unfruitful. "Go up. Jeho'ram. you baldhead!" 24 And he turned around. The term Father is now forbidden to the Church by Christ. who had been called by God about ten years earlier (1Kgs. He was succeeded in the chief prophet-ship of Israel by Elisha (God is salvation). Bible). He referred to Elijah as my father. – is it because there is no God in Israel to inquire of his word? – therefore you shall not come down from the bed to which you have gone. according to the word which Eli'sha spoke. and when he saw them. some small boys came out of the city and jeered at him. "Did I not say to you. And two she-bears came out of the woods and tore forty-two of the boys. 18 Now the rest of the acts of Ahazi'ah which he did. his brother. Joseph (39) and Rehoboam (40). the repetition of this term (2:12) giving an implied meaning of revered or beloved father-figure or mentor. but the water is bad. 15 Then the angel of the LORD said to Eli'jah." So they brought it to him. 9:54). the god of Ekron. 23 He went up from there to Bethel. and put salt in it. 25 From there he went on to Mount Carmel. because Ahazi'ah had no son. it is to be used of God and of no priest. 16 and said to him.'" 17 So he died according to the word of the LORD which Eli'jah had spoken. I have made this water wholesome. he cursed them in the name of the LORD." So he arose and went down with him to the king. you baldhead! Go up. 2Kings 2:18-25 And they came back to him. and said. It was noted also that Elisha had asked for a double portion of Elijah’s spirit before the latter was “taken” by God. saying. "Bring me a new bowl. 2:1-17) is covered in the paper The Witnesses (including the Two Witnesses) (No. while he tarried at Jericho.Elijah’s calling down of fire from heaven was considered an historical event worth repeating – at least to the disciples James and John. as per Bullinger’s note (Comp. and he said to them. "Thus says the LORD. `Because you have sent messengers to inquire of Ba'al-ze'bub. 135). Do not go?" 19 Now the men of the city said to Eli'sha. and thence he returned to Sama'ria. became king in his stead in the second year of Jeho'ram the son of Jehosh'aphat." 22 So the water has been wholesome to this day. Bullinger suggests that this was fulfilled in the number of recorded miracles the two prophets performed: Elijah performed eight miracles. but you shall surely die. do not be afraid of him. (RSV) The Hebrew word na’ar used here was also applied to Isaac (28 years old).

there was no water for the army or for the beasts which followed them. 4 Now Mesha king of Moab was a sheep breeder. (RSV) Israel was consistently held up as an example that Judah ought not to follow (also 2Chr. my people as your people. he had all his brothers killed as potential rivals (2Chr. "The king of Moab has rebelled against me. who were better than yourself. Jeho'ram the son of Ahab became king over Israel in Sama'ria. Judah and Edom." 9 So the king of Israel went with the king of Judah and the king of Edom. 2 He did what was evil in the sight of the LORD.Jehoram The tenth king to reign in Israel was Jehoram or Joram. 142)). the king of Moab rebelled against the king of Israel. "By the way of the wilderness of Edom. and by so doing effectively introduced idolatry into Judah from Israel (cf. there was a king named Jehoram on the throne of Judah at the same time. and also you have killed your brothers. of your father's house. and the wool of a hundred thousand rams. 10 Then the king of Israel said. 6 So King Jeho'ram marched out of Sama'ria at that time and mustered all Israel. "Alas! The LORD has called these three kings to give them into the hand of Moab. Coincidentally. and have led Judah and the inhabitants of Jerusalem into unfaithfulness. 17:4). 21:5-6). 5 But when Ahab died. as the house of Ahab led Israel into unfaithfulness. he did not depart from it. my horses as your horses. Jehoram’s evil was tempered somewhat by the fact that he got rid of the pillar dedicated to Baal worship in Samaria. Ahab’s son by Jezebel and the brother of the previous king Ahaziah who produced no male heir (v. "By which way shall we march?" Jeho'ram answered. 7 And he went and sent word to Jehosh'aphat king of Judah. daughter of Ahab and Jezebel." 8 Then he said. . The latter’s seven-day circuit through the wilderness was not to have the positive result achieved by Joshua and the Israelites when they circled around Jericho in seven days (see the paper The Fall of Jericho (No. 17). 3 Nevertheless he clung to the sin of Jerobo'am the son of Nebat. and he reigned twelve years. This Jehoram also married Athaliah. which he made Israel to sin. 2Chronicles 21:13 but have walked in the way of the kings of Israel. And when they had made a circuitous march of seven days." In this case God arranged for the Moabites to succeed in the battle against an unlikely alliance of Israel. though not like his father and mother. and he had to deliver annually to the king of Israel a hundred thousand lambs. for he put away the pillar of Ba'al which his father had made. 21:4). "I will go. will you go with me to battle against Moab?" And he said. 2Chr. 2Kings 3:1-27 In the eighteenth year of Jehosh'aphat king of Judah. I am as you are.

The kings of Israel appeared particularly prone (2Kgs. and your beasts. 25 And they overthrew the cities. and the sun shone upon the water. all who were able to put on armor. "As the LORD of hosts lives. water came from the direction of Edom.Elisha’s Prophecy 11 And Jehosh'aphat said. opposite the king of Edom. 15 But now bring me a minstrel. 33:6). and shall fell every good tree. who poured water on the hands of Eli'jah.' 17 For thus says the LORD." 12 And Jehosh'aphat said. you. and felled all the good trees. 16:3. and every choice city. 18:21). The Israelites had to be told specifically to desist from such an abomination (Lev. when these tribes to the east of the Jordan would be among the first to go into captivity. your cattle. through whom we may inquire of the LORD?" Then one of the king of Israel's servants answered." But the king of Israel said to him. Dibon and Kerioth) as a sort of prelude to what would happen under the Assyrians.' 18 This is a light thing in the sight of the LORD. the power of the LORD came upon him. they stopped every spring of water. 26 When the king of Moab saw that the battle was going against him. Israel’s joint expedition to bring Moab to heel had failed. And there came great wrath upon Israel. although many ignored the injunction. but they could not. "Eli'sha the son of Shaphat is here. were it not that I have regard for Jehosh'aphat the king of Judah. . nor see you. He took many cities belonging to Reuben and Gad (e. about the time of offering the sacrifice. and offered him for a burnt offering upon the wall. `You shall not see wind or rain. the kings have surely fought together." So the king of Israel and Jehosh'aphat and the king of Edom went down to him. 21 When all the Moabites heard that the kings had come up to fight against them." And when the minstrel played. behold. and they went forward. so that you shall drink. and they withdrew from him and returned to their own land. till only its stones were left in Kir-har'eseth. 27 Then he took his eldest son who was to reign in his stead. until it was covered. were called out. Chemosh) was apparently endemic in the Middle East. 2Chr. and slain one another. till they fled before them. 23 And they said. to the spoil!" 24 But when they came to the camp of Israel." 20 The next morning. and stop up all springs of water. and it was King Mesha who gained the ascendancy." 14 And Eli'sha said.g. I would neither look at you. and the slingers surrounded and conquered it. Moab. "Is there no prophet of the LORD here. till the country was filled with water. but that stream-bed shall be filled with water. which is perhaps why Abraham was not fazed by the Angel’s request to sacrifice his son Isaac (cf. `I will make this dry stream-bed full of pools. (RSV) This barbaric practice of burning one’s first-born son in offering to a god (e. he will also give the Moabites into your hand. he took with him seven hundred swordsmen to break through. "The word of the LORD is with him. the Moabites saw the water opposite them as red as blood. and on every good piece of land every man threw a stone. 71)). 16 And he said. whom I serve. from the youngest to the oldest. it is the LORD who has called these three kings to give them into the hand of Moab. 13 And Eli'sha said to the king of Israel. the Israelites rose and attacked the Moabites. The great wrath upon Israel may have reflected the demons being permitted to punish Israel and allow the Moabites to gain their freedom. and ruin every good piece of land with stones. "This is blood.g. "What have I to do with you? Go to the prophets of your father and the prophets of your mother. Aroer. "No. the paper The Angel and Abraham’s Sacrifice (No. Now then. slaughtering the Moabites as they went. "Thus says the LORD. and were drawn up at the frontier. 19 and you shall conquer every fortified city. 22 And when they rose early in the morning.

and a lamp. and put there for him a bed. 4:21. so that whenever he comes to us. The rest of the story of Elisha and the Shunemite woman (2Kgs. 17:10ff." And there was no . and came and cut them up into the pot of pottage. "Set on the great pot." (RSV) The word used to describe the woman can mean either monetarily wealthy or a person of high standing in the community. 4 Then go in. 10 Let us make a small roof chamber with walls. hence. "Behold now." 5 So she went from him and shut the door upon herself and her sons. what have you in the house?" And she said." 39 One of them went out into the field to gather herbs.). "There is not another. borrow vessels of all your neighbors. but the creditor has come to take my two children to be his slaves. It was almost as if Elisha’s bed also became a holy thing as it had played a part in healings (2Kgs. there is death in the pot!" And they could not eat it. where a wealthy woman lived. 2Kings 4:38-44 And Eli'sha came again to Gilgal when there was a famine in the land. The chamber given to Elisha became a safe haven or sanctuary for him. "O man of God. who urged him to eat some food. 40 And they poured out for the men to eat. 7 She came and told the man of God. he can go in there. "Then bring meal." And he threw it into the pot. and you and your sons can live on the rest. and found a wild vine and gathered from it his lap full of wild gourds. it could perhaps be likened to the altar of incense." 3 Then he said. with its table (cf. "Bring me another vessel. and when one is full. cf. and pour into all these vessels. 2Kings 4:1-44 Now the wife of one of the sons of the prophets cried to Eli'sha. not knowing what they were. that they may eat. sell the oil and pay your debts." 2 And Eli'sha said to her. and you know that your servant feared the LORD. "Your servant my husband is dead. a type of Tabernacle." And he said to her. "Pour out for the men. 6 When the vessels were full. 41 He said. But while they were eating of the pottage. I perceive that this is a holy man of God. who is continually passing our way. a chair." Elisha and the Shunemite The following story has a number of parallels with that of Elijah and the poor widow of Zarephath (1Kgs. and said. he said to his servant." Then the oil stopped flowing. 8 One day Eli'sha went on to Shunem. they cried out. "Your maidservant has nothing in the house. And as the sons of the prophets were sitting before him. he would turn in there to eat food. 145). except a jar of oil. 9 And she said to her husband. and shut the door upon yourself and your sons. and he said. and as she poured they brought the vessels to her. and boil pottage for the sons of the prophets. she said to her son. "Go outside. "Go. a table. So whenever he passed that way. empty vessels and not too few. 4:11-37) is dealt with in the paper Song of Songs (No. "What shall I do for you? Tell me. shewbread) and lamp stand. set it aside. also Elijah’s bed in 1Kgs 17:19) and before which the prophet offered up his prayers.

Elisha’s servant saw an angelic army that more . he cut off a stick. 15 When the servant of the man of God rose early in the morning and went out. (RSV) The feeding of the hundred men here is one of three miracles in the Bible concerned with feeding a multitude (see Mat. his axe head fell into the water. for thus says the LORD. and let us make a place for us to dwell there. 5 But as one was felling a log. "Take it up. meaning thrice-great lord (BDB). saying. and fresh ears of grain in his sack. 20:1). O king. that they may eat." 10 And the king of Israel sent to the place of which the man of God told him. tells the king of Israel the words that you speak in your bedchamber." 14 So he sent there horses and chariots and a great army. "See. and surrounded the city." And he answered. And they ate. This event took place during the Passover season as the first-fruits of the barley harvest are mentioned (see The Passover (No. and he called his servants and said to them. And Eli'sha said. "Give them to the men. 2 Let us go to the Jordan and each of us get there a log. "Alas. "Beware that you do not pass this place." 43 But his servant said. an army with horses and chariots was round about the city. and they came by night. "Behold. "Go. is dealt with in the paper The Messages of Revelation 14 (No." So the LORD opened the eyes of the young man. so that he saved himself there more than once or twice. 7 And he said. Thus he used to warn him." 17 Then Eli'sha prayed." 3 Then one of them said. and he cried out. the prophet who is in Israel. "Where did it fall?" When he showed him the place. "Be pleased to go with your servants. 270). 8 Once when the king of Syria was warring against Israel. but Eli'sha. 15:34. "Go and see where he is. for those who are with us are more than those who are with them. 14:20." 4 So he went with them. and had some left. and threw it in there. The complete text of 2Kings 5 concerning Naaman. my master! What shall we do?" 16 He said. the Syrian leper. they cut down trees. that I may send and seize him. the mountain was full of horses and chariots of fire round about Eli'sha.'" 44 So he set it before them. However. "Alas. 42 A man came from Ba'al-shal'ishah." It was told him. "How am I to set this before a hundred men?" So he repeated. Elisha was forewarned by the Angel of God of the intent of the king of Syria (probably Ben-hadad of 1Kgs. "I will go. he is in Dothan. he took counsel with his servants. I pray thee. my lord.38). who became so frustrated that his plans were being revealed in advance to Israel that he set out to capture the prophet. And when they came to the Jordan. "Give to the man. "Will you not show me who of us is for the king of Israel [Jehoram]?" 12 And one of his servants said. "O LORD." So he reached out his hand and took it. and made the iron float. that they may eat. The Army of God 2Kings 6:1-33 Now the sons of the prophets said to Eli'sha. and said. and he saw. 11 And the mind of the king of Syria was greatly troubled because of this thing. "Fear not. "None. for the Syrians are going down there. open his eyes that he may see." 13 And he said." 9 But the man of God sent word to the king of Israel. "At such and such a place shall be my camp. bringing the man of God bread of the first fruits. harm in the pot. according to the word of the LORD. behold." 6 Then the man of God said. my master! It was borrowed. twenty loaves of barley." And he answered. `They shall eat and have some left. 98)). The town in Ephraim from which the man came was Baal-shalishah. And the servant said. and behold. the place where we dwell under your charge is too small for us.

throwing down their arms. being eager to see for myself. This line suddenly halted. … Outlined on the slight rise by the La Bassee village. houses or human beings. who a short time before had commenced a forward movement to victory. "Fritz has gone barmy. yet the enemy gunfire broke on it with increasing fury." . and. … I was responsible for the intelligence on this sector of the battle area." I followed him shortly afterwards. The incident concerned the so-called White Cavalry. as we watched. haversacks. the statement the senior German officer made was as follows: The order had been given to advance in mass formation. when Friedrich my lieutenant here said: "Herr Kapitan. for. It was not long before my Sergeant arrived with two German officer prisoners … Briefly. and our troops were marching behind us singing their way to victory. I can personally vouch for as being true. The following account of what occurred between the months of April and August. They must be mad. they are all in white uniform and are mounted on white horses. "Get along down to the canal and see what is happening there. these English. which had been largely directed against the shattered town of Bethune. and as far as we could see. Such a Host is alluded to in Isaiah 66 (cf. suddenly lifted and began to burst on a slight rise beyond its outskirts.than matched the Syrian army surrounding the city of Dothan. as there were obviously no troops within sight against whom the Germans could be directing their fire. 34:7). coats and anything which might impede their flight. As I made my way over the scattered debris of the ruined houses. and therefore made my headquarters in the bright little town of Bethune … The British troops had been in the trenches fighting for weeks without rest or relief owing to the fact that reserves were practically exhausted. the enemy's fire suddenly ceased. was a dense line of German troops. in mass formation." said the Sergeant. we saw it break! Before our astonished eyes. just look at that open ground behind Bethune. also Ps. This open ground was absolutely bare of trees. sir. rifles." I replied. The above incident had a remarkable parallel during a First World War battle in France when the British and their allies were in danger of being overrun by the Germans. that well-drilled and seemingly victorious army broke up into groups of frightened men who were fleeing from us. and was augmented by heavy bursts of massed machine guns which raked it backward and forward with a hail of lead. I suppose they must be cavalry of one of their Colonial Forces. as witnessed by British Captain Cecil Hayward. … the enemy shellfire. We stood looking in astonishment. 1918. There is a brigade of cavalry coming up through the smoke drifting across it. to advance against such a force as ours in the open. "What in the world is he peppering the naked ground for?" "I can't think. see. and a curious calm fell on everything.

This is in spite of the fact that at least two of us could swear that we saw no cavalry in action. whose hair. But it was not necessary for us to do so. They have all been fighting on foot for several years past. The German Army is broken. and this is not the city. "Strike this people. 18 And when the Syrians came down against him. all of whom came forward at a quiet walk-trot. a fine figure of a man. each man and horse in his exact place. above all from their awe-inspiring leader whose hair shone like a golden aureole. but his hands lay quietly holding the reins. shone in an aura round his head." So he struck them with blindness in accordance with the prayer of Eli'sha. and anyway. "This is not the way. and said. yes. like the incoming tide surging over a sandy beach. an Officer of the Prussian Guard." "We saw the shells bursting among the horses and their riders. In spite of heavy shell and concentrated machine-gun fire. Steadily they advanced. and I turned to flee. and a few paces in front of them rode their leader. clear in the shining sunlight." And he led . Eli'sha prayed to the LORD. but on they came and not a single man or horse fell. but we have lost the war. Shortly afterwards our machine guns opened a heavy fire. Their one desire was to get away from that advancing White Cavalry. remorseless as fate. "I have never heard of the English having any white-uniformed cavalry. We are beaten – by the White Cavalry … I cannot understand … I cannot understand. the British soldiers saw nothing. I. Obviously enough men had died on both sides and the Host had intervened to shorten the conflict. panic stricken. I pray thee. with blindness. whether Colonial or not. the White Cavalry advanced. the fact that it was recorded by the British from German eyewitnesses and the British involved saw nothing would tend to indicate its authenticity. at that particular time. fled. not white. and around me were hundreds of terrified men. the whole of the German Army was able to see the White Cavalry. In this instance. and I will bring you to the man whom you seek. While this incident may sound mythical." I said. That is all I have to tell you. … Then a great fear fell on me. raking the advancing cavalry with a hail of lead. whimpering like children. and in substance. "Strange. the evidence of their presence had to come from the enemy. in parade-ground formation. The story of Elisha and the Syrian host continues in 2Kings 6. their accounts tallied with the one given here. Neither did any of us see so much as a single white horse either with or without a rider. By his side was a great sword. here or elsewhere. they are in khaki. follow me. as his huge white charger bore him proudly forward. It appears that the God of Hosts had indeed dispatched an angelic army (although not a fiery one) at a critical point in the battle. 19 And Eli'sha said to them. We are beaten." During the following few days I examined many prisoners. There may be fighting. like spun gold. throwing away their arms and accoutrements in order not to have their movements impeded … all running.

them to Sama'ria. my lord. however. And the Syrians came no more on raids into the land of Israel. as did many martyrs for the truth (Rev. It is normally the sign of a civilised society to be magnanimous in victory. and the fourth part of a kab of dove's dung for five shekels of silver. and ate him. the king came down to him and said. 21 When the king of Israel saw them he said to Eli'sha. O king!" 27 And he said. and hold the door fast against him. as they besieged it. when the messenger comes. and when they had eaten and drunk. that we may eat him'. "What is your trouble?" She answered. shall I slay them? Shall I slay them?" 22 He answered. "Do you see how this murderer has sent to take off my head? Look. and we will eat my son tomorrow. and lo. 26 Now as the king of Israel was passing by upon the wall. and the elders were sitting with him. "This trouble is from the LORD! Why should I wait for the LORD any longer?" (RSV) It seems beheading was a routine method of killing God’s prophets in these times: Elisha here was threatened with it. "You shall not slay them. and they saw." 23 So he prepared for them a great feast. . and besieged Sama'ria. `Give your son. he had sackcloth beneath upon his body – 31 and he said. but before the messenger arrived Eli'sha said to the elders.' 29 So we boiled my son. if the head of Eli'sha the son of Shaphat remains on his shoulders today. Would you slay those whom you have taken captive with your sword and with your bow? Set bread and water before them. that they may eat and drink and go to their master. The curse of Deuteronomy 28:50-57 – promised long before by Moses as an inevitable consequence of disobedience to God – had come upon Samaria. Is not the sound of his master's feet behind him?" 33 And while he was still speaking with them. "O LORD. until an ass's head was sold for eighty shekels of silver. that they may see." 32 Eli'sha was sitting in his house. and behold. saying. he sent them away. and they went to their master. that we may eat him today. Now the king had dispatched a man from his presence. 30 When the king heard the words of the woman he rent his clothes – now he was passing by upon the wall – and the people looked. Here we see the correct conduct in dealing with prisoners of war when not told specifically by God to extirpate them. "May God do so to me." So the LORD opened their eyes. "This woman said to me. or from the wine press?" 28 And the king asked her. Siege and famine in Israel 24 Afterward Ben-ha'dad king of Syria mustered his entire army. but she has hidden her son. Their reward. and more also. shut the door. We see in verse 21 the king of Israel also deferring to Elisha as his “father”. although the decision in this case was to have an unfortunate outcome. `Give your son. 25 And there was a great famine in Sama'ria. open the eyes of these men. 20:4). 20 As soon as they entered Sama'ria. they were in the midst of Sama'ria. a title of honour and affection. Eli'sha said. "If the LORD will not help you. whence shall I help you? From the threshing floor. "Help. and went up. while John the Baptist suffered it." This gruesome incident reflected the dire situation in which the inhabitants of the city of Samaria found themselves. And on the next day I said to her. "My father. is pre-eminence in the First Resurrection. a woman cried out to him.

(op.. He states: Every chariot was manned by three men: the driver. the fighter. In this way he protected the warrior and the driver in the rear and prevented them from being thrown out during those furious sallies in battle when the open car passed over dead and wounded men. . the king of Israel has hired against us the kings of the Hittites and the kings of Egypt to come upon us. but you shall not eat of it." 7 So they fled away in the twilight and forsook their tents. the sound of a great army. from the root meaning three or triad. "Hear the word of the LORD: thus says the LORD. if they spare our lives we shall live. "Behold. and we shall die there. and if we sit here. but when they came to the edge of the camp of the Syrians. cit. where he comes to an unfortunate end. 2Kings 7:1-20 But Eli'sha said. The Hebrew word is shaliysh (SHD 7991). Tomorrow about this time a measure of fine meal shall be sold for a shekel. Elisha made the most incredible prophecy: an imminent end to the famine and an abundance of food to follow. and their asses. at the gate of Sama'ria. let us go over to the camp of the Syrians. so that they said to one another. They seemed to have forgotten about the angelic army previously sent to unsettle them. and a man who stood behind him. This man is mentioned again in verse 17. "Why do we sit here till we die? 4 If we say. So now come. and fled for their lives. behold.At the height of the siege and consequent famine in the city." A minor historical point is made by Werner Keller concerning the person known as the captain (lord: KJV) in verse 2. p. as they attributed the sound to the Hittites or Egyptians. This time it was just the sound of a huge army which caused panic in the Syrian host. leaving the camp as it was. we die also. `Let us enter the city. "You shall see it with your own eyes." 5 So they arose at twilight to go to the camp of the Syrians. and they said to one another. 9:24). could this thing be?" But he said. This then was the “third man” … the strap-hanger in King Jehoram’s chariot. "If the LORD himself should make windows in heaven. and two measures of barley for a shekel. 3 Now there were four men who were lepers at the entrance to the gate. there was no one there. and of horses. 247) The third man would presumably have carried a shield on his back for his own protection in addition to his armour to avoid the fate suffered by King Jehoram (2Kgs. 6 For the Lord had made the army of the Syrians hear the sound of chariots. their horses.' the famine is in the city." 2 Then the captain on whose hand the king leaned said to the man of God. and if they kill us we shall but die. With outstretched arms he held on to two short straps which were fastened to the right and left sides of the chariot.

9 Then they said to one another. when the woman returned from the land of the Philistines. 8 And when these lepers came to the edge of the camp. thinking. and a measure of fine meal for a shekel." 11 Then the gatekeepers called out. we shall take them alive and get into the city. and depart with your household. according to the word of the LORD. and told the king." 2 So the woman arose. and. "We came to the camp of the Syrians. for the LORD has called for a famine. just as the Patriarch Jacob had sent his sons there for sustenance during a similar famine in Palestine. So a measure of fine meal was sold for a shekel. and entered another tent. O king. she told him. "Tell me all the great things that Eli'sha has done. and said to his servants. Egypt is represented as a place of sanctuary." 19 the captain had answered the man of God. In this case she went to the land of the Philistines. let us send and see. "The . and when it was told him. 3 And at the end of the seven years. she went forth to appeal to the king for her house and her land.'" 13 And one of his servants said. and it was told within the king's household. and the asses tied." 5 And while he was telling the king how Eli'sha had restored the dead to life. here is the woman. 17 Now the king had appointed the captain on whose hand he leaned to have charge of the gate. `When they come out of the city. and two measures of barley for a shekel. and ate and drank." 20 And so it happened to him. and sojourn wherever you can. "If the LORD himself should make windows in heaven. and went and hid them. "You shall see it with your own eyes. and the people trod upon him in the gate. seeing that those who are left here will fare like the whole multitude of Israel that have already perished. "Go and see. she went with her household and sojourned in the land of the Philistines seven years. "Two measures of barley shall be sold for a shekel. "Restore all that was hers. And the messengers returned. Elisha prepared the Shunemite woman for the approaching seven-year famine by sending her to “Egypt”. and went and hid them." 14 So they took two mounted men. "My lord. therefore they have gone out of the camp to hide themselves in the open country. so that he died. let us go and tell the king's household. 4 Now the king was talking with Geha'zi the servant of the man of God. saying. the woman whose son he had restored to life appealed to the king for her house and her land. lo. "We are not doing right. if we are silent and wait until the morning light. punishment will overtake us. 12 And the king rose in the night. now therefore come. "I will tell you what the Syrians have prepared against us. and they carried off silver and gold and clothing. together with all the produce of the fields from the day that she left the land until now. and did according to the word of the man of God. "Arise. about this time tomorrow in the gate of Sama'ria. So the king appointed an official for her. all the way was littered with garments and equipment which the Syrians had thrown away in their haste. they went into a tent. for the people trod upon him in the gate and he died. This day is a day of good news. as the man of God had said when the king came down to him. there was no one to be seen or heard there." 7 Now Eli'sha came to Damascus. saying. and here is her son whom Eli'sha restored to life. 16 Then the people went out. "Let some men take five of the remaining horses. and the king sent them after the army of the Syrians. and the tents as they were. 18 For when the man of God had said to the king. then they came back. 2Kings 8:1-15 Now Eli'sha had said to the woman whose son he had restored to life. and behold. And Geha'zi said." 10 So they came and called to the gatekeepers of the city. Once again. could such a thing be?" And he had said. They know that we are hungry. and plundered the camp of the Syrians." 6 And when the king asked the woman. and it will come upon the land for seven years. but you shall not eat of it. behold. (RSV) This text seems to represent a fatal lesson in not believing the words of God’s true prophets and in blasphemously suggesting a limit to God’s power." 15 So they went after them as far as the Jordan. nothing but the horses tied. and told them. and carried off things from it. saying. Ben-ha'dad the king of Syria was sick.

O commander." 6 So he arose. all kinds of goods of Damascus. While varying widely on most of their chronologies of the kings. "Because I know the evil that you will do to the people of Israel. "To which of us all?" And he said. "Thus says the LORD the God of Israel. 12 And Haz'ael said. went to Ramoth- gilead. he said. `Shall I recover from this sickness?'" 9 So Haz'ael went to meet him. till he died. and rip up their women with child. and inquire of the LORD through him. "What is your servant." 15 But on the morrow he took the coverlet and dipped it in water and spread it over his face. The dates for the start of Jeroboam’s reign (932 BCE) and the captivity of Israel (722 BCE) are also reasonably certain. namely his commander. until he was ashamed. 2 And when you arrive. (RSV) Ben-hadad of Syria was thus smothered to death by his servant Hazael. `Thus says the LORD. "Gird up your loins. And the man of God wept. which was to last for nearly 90 years. and go to Ramoth-gilead. "Your son Ben- ha'dad king of Syria has sent me to you. and say. saying. and take this flask of oil in your hand. "Go. saying to him. say to him. who said to him. and he said. "The LORD has shown me that you are to be king over Syria. 5 And when he came. Jehu began the fourth dynasty." 14 Then he departed from Eli'sha." 8 the king said to Haz'ael. do not tarry." And Jehu said. that he should do this great thing?" Eli'sha answered. saying. "What did Eli'sha say to you?" And he answered. and dash in pieces their little ones. behold. look there for Jehu the son of Jehosh'aphat. but the LORD has shown me that he shall certainly die. "He told me that you would certainly recover. and went into the house. who then ascended the throne. O commander." 11 And he fixed his gaze and stared at him." 4 So the young man. "I have an errand to you. We saw earlier that Jehoram. son of Nimshi. "To you. and took a present with him. man of God has come here. "Why does my lord weep?" He answered. and pour it on his head. Jehu (see below).' Then open the door and flee. and the young man poured the oil on his head. Jehu The eleventh king of Israel was Jehu. 3 Then take the flask of oil." 13 And Haz'ael said. you will set on fire their fortresses. was also killed by someone close to him. and lead him to an inner chamber. forty camel loads. the commanders of the army were in council. and came to his master. the prophet. "Take a present with you and go to meet the man of God. `You shall certainly recover'. an army commander and expert charioteer (2Kgs. I anoint . Jehoram had reigned for 12 years. and you will slay their young men with the sword. who is but a dog. and go in and bid him rise from among his fellows. 2Kings 9:1-37 Then Eli'sha the prophet called one of the sons of the prophets and said to him. 9:20) who was anointed king by Elisha in Ramoth-gilead while he and his troops waited for an expected Syrian attack. And Haz'ael became king in his stead. He was also commissioned by the prophet to wipe out the whole house of Ahab. king of Israel. `Shall I recover from this sickness?'" 10 And Eli'sha said to him. I anoint you king over Israel. biblical scholars almost universally agree that his reign covered the period 842 to 814 BCE. When he came and stood before him. thus providing a reference point for dating before and after.

7 And you shall strike down the house of Ahab your master. and none shall bury her. in Israel. `Thus says the LORD. who was the one destined to kill Jeroboam’s descendants (cf. "What have you to do with peace? Turn round and ride behind me. and they blew the trumpet. when he fought with Haz'ael king of Syria. "Thus says the king. Again. and said. 10 And the dogs shall eat Jez'ebel in the territory of Jezreel. "Make ready. and went to Jezreel. tell us now. but he is not coming back. bond or free. "Take a horseman. (Now Joram with all Israel had been on guard at Ramoth-gilead against Haz'ael king of Syria. "You know the fellow and his talk. 15:29." 12 And they said. "Thus the king has said. "That is not true. and said. and proclaimed. 22 And when Joram saw Jehu. "If this is your mind. 9). so long as the harlotries and the sorceries of your mother Jez'ebel are so many?" . and put it under him on the bare steps. "Is it peace. "Is all well? Why did this mad fellow come to you?" And he said to them. 22:3). I anoint you king over Israel." 21 Joram said. "What have you to do with peace? Turn round and ride behind me. "He reached them. and let him say." 19 Then he sent out a second horseman. "Thus and so he spoke to me. Ahaziah was also the grandson of the noble Jehoshaphat of Judah who. he said. that I may avenge on Jez'ebel the blood of my servants the prophets." And Joram said. This was the third time that God had arranged for all the males of a king’s house to be slaughtered. `Is it peace?'" And Jehu answered. And Ahazi'ah king of Judah had come down to visit Joram. Joram here is King Jehoram. 9 And I will make the house of Ahab like the house of Jerobo'am the son of Nebat. and went to meet Jehu. And the driving is like the driving of Jehu the son of Nimshi. `Is it peace?'" And Jehu said." 20 Again the watchman reported. 8 For the whole house of Ahab shall perish. "Jehu is king. and the blood of all the servants of the LORD. but he is not coming back. they said to him. over Israel. “sought the Lord with all his heart” (v. Then Jora king of Israel and Ahazi'ah king of Judah set out." And the watchman reported. and I will cut off from Ahab every male. 16:11). and fled." 14 Thus Jehu the son of Jehosh'aphat the son of Nimshi conspired against Joram. the others involved Jeroboam and Baasha. and met him at the property of Naboth the Jezreelite. "What peace can there be. saying. and like the house of Ba'asha the son of Ahi'jah. 15 but King Joram had returned to be healed in Jezreel of the wounds which the Syrians had given him. saying." Then he opened the door. `Is it peace?'" 18 So a man on horseback went to meet him. Messiah himself suffered the accusation (Jn. you king over the people of the LORD. for Joram lay there. 10:20).) So Jehu said. the tenth ruler in Israel since the split with Judah. 17 Now the watchman was standing on the tower in Jezreel. each in his chariot." And they made ready his chariot." And he said. and “his mother was his counselor in doing wickedly” (2Chr. then let no one slip out of the city to go and tell the news in Jezreel. Ahaziah was the son of Athaliah and thus the grandson of the infamous Ahab and Jezebel. and send to meet them. This wasn’t the first time that a prophet of God was called mad. 1Kgs.'" 13 Then in haste every man of them took his garment." 16 Then Jehu mounted his chariot. "I see a company. and he spied the company of Jehu as he came. "The messenger reached them. 7). an unrighteous king’s downfall was occasioned by God (v. for he drives furiously. who came to them. 11 When Jehu came out to the servants of his master. and said. unlike the kings of Israel. Jehu?" He answered.

and died there. and she painted her eyes. and bury her. and he said. 15). "Is it peace. then it will be known that the LORD has truly sent the prophet. 21:23). 25-26). 25:1 and 31:16. they found no more of her than the skull and the feet and the palms of her hands. so that the arrow pierced his heart. Jez'ebel heard of it.Asking about peace three times was perhaps an earnest desire for a peace that could never come at this juncture (cf. "Take him up. when you and I rode side by side behind Ahab his father. and buried him in his tomb with his fathers in the city of David. saying to Ahazi'ah. And he fled to Megid'do. “the way of peace they know not” (Isa. but was killed by divine command to avenge the death of Naboth and his sons (vv. 6:14. 28 His servants carried him in a chariot to Jerusalem. The latter had only just recovered from wounds received while fighting the Syrians (v. 31 And as Jehu entered the gate. you Zimri. 30 When Jehu came to Jezreel." So they threw her down. he fled in the direction of Beth-haggan. and they trampled on her. However. "Treachery. he thereby joined his mother Jezebel’s blood in the dust of Jezreel. "Throw her down. 34 Then he went in and ate and drank. It is noted that Jehoram’s body was cast into Naboth’s field. "Who is on my side? Who?" Two or three eunuchs looked out at him. And Jehu pursued him. and the wall of separation between God and mankind generally that was built upon this idolatry is torn down. and they shot him in the chariot at the ascent of Gur. for remember. and looked out of the window. and cast him on the plot of ground belonging to Naboth the Jezreelite. for. there is to be a day when peace does break out according to the word of God’s true prophets. "See now to this cursed woman. 36 When they came back and told him. 29 In the eleventh year of Joram the son of Ahab. 8:11). Jeremiah 28:9 As for the prophet who prophesies peace. it appears there will be no real peace within or between the nations until all these Babylonian influences have been removed. and sorceries (witchcrafts: KJV) are spiritism. Jehu was commissioned by Elijah to destroy the whole house of Ahab including his wife Jezebel. "Shoot him also". in accordance with the word of the LORD. "This is the word of the LORD. in accordance with the earlier prophecy (1Kgs. how the LORD uttered this oracle against him: 26 `As surely as I saw yesterday the blood of Naboth and the blood of his sons – says the LORD – I will requite you on this plot of ground.' Now therefore take him up and cast him on the plot of ground. and he sank in his chariot. the two words being used together in Numbers 24:1. and said. 33 He said. she said. for she is a king's daughter. which is by Ibleam. and shot Joram between the shoulders. 59:8). Jer. he said. O Ahazi'ah!" 24 And Jehu drew his bow with his full strength. 23 Then Joram reined about and fled. murderer of your master?" 32 And he lifted up his face to the window. and some of her blood spattered on the wall and on the horses. when the word of that prophet comes to pass. Thus we see Jehu killing both kings Jehoram of Israel and Ahaziah of Judah in quick succession. 25 Jehu said to Bidkar his aide." 35 But when they went to bury her. Harlotries represent idolatry. Ahazi'ah began to reign over Judah." 27 When Ahazi'ah the king of Judah saw this. and said." (RSV) As Jezebel personified idolatrous pagan practices. which he spoke by his . and adorned her head.

they took the king's sons. 2Kings 10:1-36 Now Ahab had seventy sons in Sama'ria." 11 So Jehu slew all that remained of the house of Ahab in Jezreel. he stood. and I will put an end to the kingdom of the house of Israel. "You are innocent. how then can we stand?" 5 So he who was over the palace. possibly including his grandsons and great-grandsons. and he who was over the city. and if you are ready to obey me. and come to me at Jezreel tomorrow at this time. fortified cities also. 37 and the corpse of Jez'ebel shall be as dung upon the face of the field in the territory of Jezreel. do whatever is good in your eyes. and his familiar friends. all his great men. to forgive them at all. "Call her name Not pitied. . seventy persons. so that no one can say. In connection with Jezreel. to the rulers of the city. were with the great men of the city. (RSV) The whole house of Ahab was about to be cut off. and weapons. for I will no more have pity on the house of Israel. saying." 4 But they were exceedingly afraid. 5 And on that day. and said to all the people. and to the guardians of the sons of Ahab. saying. We will not make any one king. and sent them to him at Jezreel. which the LORD spoke concerning the house of Ahab. Hosea 1:4-7a And the LORD said to him. and his priests. and said. 7 But I will have pity on the house of Judah. saying.'" (RSV) This signifies that the entire Babylonian mystery religion will one day be brought to remembrance no more. It was I who conspired against my master. 3 select the best and fittest of your master's sons and set him on his father's throne. seventy persons." 6 Then he wrote to them a second letter. "Behold. to the elders. and I will punish the house of Jehu for the blood of Jezreel. I will break the bow of Israel in the valley of Jezreel. and put their heads in baskets. it is to be thoroughly eliminated. the two kings could not stand before him. sent to Jehu. and fight for your master's house. for the LORD has done what he said by his servant Eli'ah. seeing your master's sons are with you. and there are with you chariots and horses. "We are your servants." 6 She conceived again and bore a daughter. and I will deliver them by the LORD their God. 2 "Now then. `In the territory of Jezreel the dogs shall eat the flesh of Jez'ebel. King Hoshea. but who struck down all these? 10 Know then that there shall fall to the earth nothing of the word of the LORD. when he went out. and sent them to Sama'ria. as soon as this letter comes to you. 8 When the messenger came and told him. "Call his name Jezreel. together with the elders and the guardians. for yet a little while. So Jehu wrote letters." Now the king's sons. servant Eli'jah the Tishbite. the prophet Hosea (Hoshea) mentioned the final captivity and deportation of Israel that was to happen during the reign of his namesake. "If you are on my side. 7 And when the letter came to them. and slew them. who were bringing them up. "They have brought the heads of the king's sons." he said. "Lay them in two heaps at the entrance of the gate until the morning." 9 Then in the morning. with literal beheadings of his 70 “sons” or descendants. And the LORD said to him. This is Jez'ebel. and we will do all that you bid us. and slew him. take the heads of your master's sons. until he left him none remaining.

" Jehu said. 16 And he said. and see that there is no servant of the LORD here among you. Now Jehu had stationed eighty men outside. 27 And they demolished the pillar of Ba'al." And they took them alive. and made it a latrine to this day. 22 He said to him who was in charge of the wardrobe." So they proclaimed it." 25 So as soon as he had made an end of offering the burnt offering. "Sanctify a solemn assembly for Ba'al. he slew all that remained to Ahab in Sama'ria.Hence. He was to prove a loyal assistant to Jehu in the destruction of the Baal system in Israel – with possible repeat application to the Last Days. for I have a great sacrifice to offer to Ba'al. and see my zeal for the LORD. And. so that there was not a man left who did not come. all his worshipers and all his priests. the whole household in Jezreel loyal to King Ahab was killed." So he had him ride in his chariot. "If it is. forty-two persons. when he was at Beth-eked of the Shepherds. "Come with me. "The man who allows any of those whom I give into your hands to escape shall forfeit his life. 23 Then Jehu went into the house of Ba'al with Jehon'adab the son of Rechab. and he spared none of them. till he had wiped them out. give me your hand. according to the word of the LORD which he spoke to Eli'jah. but also those who had advised and ministered as priests to Ahab. let none be missing. "Search. And Jehu took him up with him into the chariot. and slew them at the pit of Beth-eked. And they entered the house of Ba'al. albeit temporary (and seen earlier with the prophet Elijah). 18 Then Jehu assembled all the people. Jehonadab. "Take them alive. and the house of Ba'al was filled from one end to the other. in spite of Jehu’s zeal . and burned it. and he said to the worshipers of Ba'al. is mentioned in the paper Seven Days of the Feasts (No. 19 Now therefore call to me all the prophets of Ba'al." 14 He said. This destruction of the Baal system in Israel. Jethro (see the paper Descendants of Abraham Part IV: Sons of Keturah (No. and demolished the house of Ba'al. and he greeted him." So he brought out the vestments for them. was a Kenite and a descendant of Moses’ father-in-law. "We are the kinsmen of Ahazi'ah. "It is. "Ahab served Ba'al a little." So he gave him his hand. according to the prophecy of Elijah (9:8). 20 And Jehu ordered. but only the worshipers of Ba'al. he met Jehon'adab the son of Rechab coming to meet him. and said to them. and we came down to visit the royal princes and the sons of the queen mother. and all the worshipers of Ba'al came. whoever is missing shall not live. let not a man escape. 21 And Jehu sent throughout all Israel." 24 Then he went in to offer sacrifices and burnt offerings. 15 And when he departed from there. the guard and the officers cast them out and went into the inner room of the house of Ba'al 26 and they brought out the pillar that was in the house of Ba'al. These were not just his blood relatives. 13 Jehu met the kinsmen of Ahazi'ah king of Judah. "Bring out the vestments for all the worshipers of Ba'al. but Jehu will serve him much. And Jehu hadn’t finished yet. and said. 12 Then he set out and went to Sama'ria. 49). "Who are you?" And they answered." So when they put them to the sword. Jehu said to the guard and to the officers. and said to him. 212D)). and he said. "Is your heart true to my heart as mine is to yours?" And Jehon'adab answered. 28 Thus Jehu wiped out Ba'al from Israel. "Go in and slay them. son of Rechab. On the way." But Jehu did it with cunning in order to destroy the worshipers of Ba'al. 17 And when he came to Sama'ria.

Haz'ael defeated them throughout the territory of Israel: 33 from the Jordan eastward. from Aro'er. Gilead and Bashan. Some commentators suggest that this Shalmaneser had even assisted Jehu to claim the throne of Israel. His reign lasted 17 years. and they buried him in Sama'ria. Jehoahaz The twelfth king of Israel was Jehoahaz (Jehovah has seized). and have done to the house of Ahab according to all that was in my heart. son of Jehu. He greatly punished Israel as foretold by Elisha (2Kgs. he did not turn from the sins of Jerobo'am. 8:28. and in Dan. And Jeho'ahaz his son reigned in his stead. Ezek. 9:14). which he made Israel to sin. It is of note that the three capitals of the Northern Kingdom after the division. the golden calves that were in Bethel. which is by the valley of the Arnon. Layard in 1846 during an archaeological excavation at Nimrud. south of Baghdad. London). 30 And the LORD said to Jehu. . which he made Israel to sin. such as all of the eastern side of the Jordan by Hazael of Syria. Jehu’s dynasty was to be the longest in Israel’s history. the Gadites. and all his might. "Because you have done well in carrying out what is right in my eyes. 34 Now the rest of the acts of Jehu. and the Reubenites. discovered by A. 32 In those days the LORD began to cut off parts of Israel. Despite his idolatry. and the Manas'sites. Jehu had also been forced to pay tribute to King Shalmaneser III of Assyria as noted on the so- called Black Obelisk (now in the British Museum." 31 But Jehu was not careful to walk in the law of the LORD the God of Israel with all his heart. 8:12). 21:26-27). 36 The time that Jehu reigned over Israel in Sama'ria was twenty-eight years. are they not written in the Book of the Chronicles of the Kings of Israel? 35 So Jehu slept with his fathers. (RSV) It is by God’s will here that parts of Israel are conquered. were all located within the tribal territory of Manasseh. that is. Tirzah and Samaria. he still retained Jeroboam’s golden calves – apparently a separate form of idolatry to the Baal system. The Obelisk also mentions King Hazael of Damascus (2Kgs. and all that he did. the Syrians appeared not to have taken the Israelites into captivity as happened later with the Assyrians. all the land of Gilead. 29 But Jehu did not turn aside from the sins of Jerobo'am the son of Nebat. however.H. your sons of the fourth generation shall sit on the throne of Israel. namely Shechem. In a sense we thus have three “over-turnings” (from Jerusalem) of the capital of the northern tribes (cf.and being used in such a mighty way. Manasseh was cut off because of the sins of Jehu.

and Jo'ash was buried in Sama'ria with the kings of Israel. "Shoot". and his might. and he shot. are they not written in the Book of the Chronicles of the Kings of Israel? 9 So Jeho'ahaz slept with his fathers. Then Eli'sha said. 8 Now the rest of the acts of Jeho'ahaz and all that he did. "Open the window eastward". and he reigned sixteen years. and stopped. and he drew it. 3 And the anger of the LORD was kindled against Israel. "Take the arrows". and they buried him in Sama'ria. Bullinger‘s note). Jehoahaz. he did not depart from them. And he said to the king of Israel.) 7 For there was not left to Jeho'ahaz an army of more than fifty horsemen and ten chariots and ten thousand footmen. 16 Then he said to the king of Israel. and the LORD hearkened to him. for the king of Syria had destroyed them and made them like the dust at threshing. 12 Now the rest of the acts of Jo'ash. king of Judah. 14:27. And he said. v. 2Kings 13:10-25 In the thirty-seventh year of Jo'ash king of Judah Jeho'ash the son of Jeho'ahaz began to reign over Israel in Sama'ria. so he took a bow and arrows. and followed the sins of Jerobo'am the son of Nebat. "Take a bow and arrows". and he took them. so that they escaped from the hand of the Syrians. 25. son of the previous king. which he made Israel to sin. and said. crying. 6 Nevertheless they did not depart from the sins of the house of Jerobo'am. and the people of Israel dwelt in their homes as formerly. and all that he did. It was the typical and oft-repeated cycle of idolatry/punishment/repentance." 18 And he said. and Jo'ash his son reigned in his stead. 2Kings 13:1-9 In the twenty-third year of Jo'ash the son of Ahazi'ah. or Elisha. "The LORD's arrow of victory. 2 He did what was evil in the sight of the LORD. "Strike the ground with them". are they not written in the Book of the Chronicles of the Kings of Israel? 13 So Jo'ash slept with his fathers. and he gave them continually into the hand of Haz'ael king of Syria and into the hand of Ben-ha'dad the son of Haz'ael. "You should have . "My father. 5 (Therefore the LORD gave Israel a savior. 4 Then Jeho'ahaz besought the LORD. and Jerobo'am sat upon his throne. (RSV) Jehoash The thirteenth man to ascend the throne of Israel was Jehoash (given by the Lord: BDB). the arrow of victory over Syria! For you shall fight the Syrians in Aphek until you have made an end of them. "Draw the bow". in this case a saviour – either an angel. and he reigned seventeen years. my father! The chariots of Israel and its horsemen!" 15 And Eli'sha said to him. or a general of Jehovah (cf. but again God took note of the latter and provided a means of deliverance. how the king of Syria oppressed them. 17 And he said. and the might with which he fought against Amazi'ah king of Judah. Jeho'ahaz the son of Jehu began to reign over Israel in Sama'ria. for he saw the oppression of Israel. and he struck three times. 14 Now when Eli'sha had fallen sick with the illness of which he was to die. 19 Then the man of God was angry with him. Jo'ash king of Israel went down to him. and he opened it. and the Ashe'rah also remained in Sama'ria. and wept before him. And Eli'sha laid his hands upon the king's hands. which he made Israel to sin. but walked in them. he did not depart from all the sins of Jerobo'am the son of Nebat. 11 He also did what was evil in the sight of the LORD. but he walked in them. which he made Israel to sin.

6 He hired also a hundred . The arrows represented God’s deliverance. As related in 2Chronicles 25. "The fathers shall not be put to death for the children. a marauding band was seen and the man was cast into the grave of Eli'sha. He mustered those twenty years old and upward. and found that they were three hundred thousand picked men. and Jacob. 22 Now Haz'ael king of Syria oppressed Israel all the days of Jeho'ahaz. and they buried him. nor has he cast them from his presence until now. and set them by fathers' houses under commanders of thousands and of hundreds for all Judah and Benjamin. 25 Then Jeho'ash the son of Jeho'ahaz took again from Ben-ha'dad the son of Haz'ael the cities which he had taken from Jeho'ahaz his father in war. lo. according to what is written in the book of the law of Moses. In verse 20 we again see that the spring months were the time for war (cf. able to handle spear and shield. fit for war. His mother's name was Jeho-ad'din of Jerusalem. to happen three times only. struck five or six times. This act was to represent the Resurrection of the Dead through the intervention of Messiah in the Holy Spirit. Three times Jo'ash defeated him and recovered the cities of Israel. 11:1). 20 So Eli'sha died. 2Kings 14:1-22 In the second year of Jo'ash the son of Jo'ahaz. 2 He was twenty-five years old when he began to reign. but every man shall die for his own sin. yet not like David his father. Now bands of Moabites used to invade the land in the spring of the year. he revived. The acts of resurrection that were tied to Elisha were to point to the fact that God worked through him and it was not the power of Elisha himself. 21 And as a man was being buried. and stood on his feet. as he remained dead for this last example." This injunction is from Exodus 17:14 and Deuteronomy 24:16. king of Israel. king of Judah. and as soon as the man touched the bones of Eli'sha. (RSV) Jehoash actually regained territory lost to Syria." We now see an incredible miracle performed by God using the dead body of Elisha. or the children be put to death for the fathers. and would not destroy them. but now you will strike down Syria only three times. 2Chronicles 25:5-10 Then Amazi'ah assembled the men of Judah. 4 But the high places were not removed. 3 And he did what was right in the eyes of the LORD. where the LORD commanded. then you would have struck down Syria until you had made an end of it. 5 And as soon as the royal power was firmly in his hand he killed his servants who had slain the king his father. 23 But the LORD was gracious to them and had compassion on them. 6 But he did not put to death the children of the murderers. Amazi'ah the son of Jo'ash. Ben-ha'dad his son became king in his stead. he did in all things as Jo'ash his father had done. 24 When Haz'ael king of Syria died. and he reigned twenty-nine years in Jerusalem. because of his covenant with Abraham. Amaziah set out to deal with the Edomites and unwisely enlisted Israel’s aid. Isaac. the people still sacrificed and burned incense on the high places. 2Sam. and he turned toward them. began to reign.

(RSV) This is reminiscent of the time when the foreigners in Jerusalem wanted to assist with reconstruction of the Temple under Ezra and Nehemiah. 8 But if you suppose that in this way you will be strong for war. king of Israel. lived fifteen years after the death of Jeho'ash son of Jeho'ahaz. 10 You have indeed smitten Edom. and he and Amazi'ah king of Judah faced one another in battle at Beth-she'mesh. which belongs to Judah. and returned home in fierce anger. `Give your daughter to my son for a wife'. however. and every man fled to his home. and a wild beast of Lebanon passed by and trampled down the thistle. 7 But a man of God came to him and said. 13 And Jeho'ash king of Israel captured Amazi'ah king of Judah. and how he fought with Amazi'ah king of Judah. and came to Jerusalem. they were told they had no part in it." 10 Then Amazi'ah discharged the army that had come to him from E'phraim. It was one of the cities of the priests (Jos. Be content with your glory. now Ain Shems) is on the border between Judah and Dan and lies about 15 miles (24 km) west of Jerusalem (Jos. which is its name to this day. 17 Amazi'ah the son of Jo'ash. saying. for the LORD is not with Israel. In this instance. thousand mighty men of valor from Israel for a hundred talents of silver. 8 Then Amazi'ah sent messengers to Jeho'ash the son of Jeho'ahaz. Beth-shemesh (house of the sun. king of Judah." 9 And Amazi'ah said to the man of God. and called it Jok'the-el. from the E'phraim Gate to the Corner Gate. let us look one another in the face. and Jerobo'am his son reigned in his stead. saying. "Come. do not let the army of Israel go with you. for why should you provoke trouble so that you fall. just as the Ephraimites or Israelites above had no part in the army of the Lord because of their sins. "But what shall we do about the hundred talents which I have given to the army of Israel?" The man of God answered. Israel was given the victory over Judah. for God has power to help or to cast down. king of Israel. 15:10). But they sent after him to Lachish. and all the vessels that were found in the house of the LORD and in the treasuries of the king's house. the son of Jeho'ash. and he returned to Sama'ria. So Jeho'ash king of Israel went up. son of Ahazi'ah. at Beth- she'mesh. and he fled to Lachish. son of Jehu. "O king. to go home again." 9 And Jeho'ash king of Israel sent word to Amazi'ah king of Judah. "The LORD is able to give you much more than this. you and Judah with you?" 11 But Amazi'ah would not listen. also hostages. and his might. and he was buried in Jerusalem with his fathers in the city . are they not written in the Book of the Chronicles of the Kings of Judah? 19 And they made a conspiracy against him in Jerusalem. 12 And Judah was defeated by Israel. Returning to 2Kings 14: 7 He killed ten thousand E'domites in the Valley of Salt and took Sela by storm. And they became very angry with Judah. 21:9). and stay at home. are they not written in the Book of the Chronicles of the Kings of Israel? 16 And Jeho'ash slept with his fathers. 14 And he seized all the gold and silver. and was buried in Sama'ria with the kings of Israel. "A thistle on Lebanon sent to a cedar on Lebanon. and your heart has lifted you up. and broke down the wall of Jerusalem for four hundred cubits. 15 Now the rest of the acts of Jeho'ash which he did. God will cast you down before the enemy. with all these E'phraimites. 20 And they brought him upon horses. and slew him there. 18 Now the rest of the deeds of Amazi'ah.

and perhaps ruling over a portion of his father’s Kingdom." The dating formerly accepted (825-772 B. king of Judah. 25 He restored the border of Israel from the entrance of Hamath as far as the Sea of the Arabah. the length of the reign (41 years) cannot be reconciled with xv. he did not depart from all the sins of Jerobo'am the son of Nebat. as the Jewish Encyclopedia points out. about 785(3)-745(3) is more probable. although this 30-year period is still at odds with the biblical figure of 41 years (v.C. Jeroboam II The fourth dynasty begun by Jehu was continued by accession to Israel’s throne of the second king named Jeroboam. There is some confusion and seeming contradictions in the length of reign ascribed to Jeroboam in the Bible. king of Israel. Samaria. The chronological data require emending. began to reign in Sama'ria. The most reasonable explanation is that Jeroboam was co-regent with his father for about 11 years.) is now generally abandoned. but does not harmonize with xv. The synchronism in II Kings xiv. and is known today as Tel el-Hesy. 24 And he did what was evil in the sight of the LORD. who was sixteen years old. which he made Israel to sin. ‘Jeroboam’) The likely duration of Jeroboam’s reign over Samaria or Israel is ca. He then ascended the throne over all Israel upon the death of Jehoash. and he reigned forty-one years. 23 agrees with verse 17 preceding. 8. 22 He built Elath and restored it to Judah. Lachish sat on the frontier between Judah and Philistia. 23 should perhaps be "fifty-one. 29). according to the word of the . In xv. (art.782-753 BCE. 2Kings 14:23-29 In the fifteenth year of Amazi'ah the son of Jo'ash. after the king slept with his fathers. 1 following. This was during the campaigns that led to the capture of Jerusalem and subsequent exile of Judah. (RSV) Lachish is the city that would become famous for the historically important Letters written on potsherds during the Babylonian siege. Jerobo'am the son of Jo'ash. of David. Again." while the "forty-one" in xiv. and made him king instead of his father Amazi'ah. 21 And all the people of Judah took Azari'ah. Jehoash’s reign lasted sixteen years. 1 "twenty-seventh year" must be changed to "fifteenth. this one being the son of Jehoash. beginning as early as 793 BCE. He apparently died in peace and was buried in the capital.

and there was none to help Israel. (RSV) Damascus and Hamath were both originally part of the Kingdom under Solomon (1Kgs. most of his ministry was to the Northern Kingdom in the period of about 765-755 BCE. Jonah and Micah. He was also a contemporary of the prophets Hosea. Damascus was later lost to King Rezin of Syria (1Kgs. two years before the earthquake. and all that he did. for there was none left. (RSV) Amos (a burden) was originally from Judah. which he saw concerning Israel in the days of Uzzi'ah king of Judah and in the days of Jerobo'am the son of Jo'ash. The prophet Amos had much to say during this period of Israel’s history." says the LORD. who was from Gath-he'pher. the first having been the originator of serious idolatry in Israel. The Sea of the Arabah (meaning plain) is the same as the Salt (Dead) Sea. 5 I will break the bar of Damascus. LORD. who was among the shepherds of Teko'a." 3 Thus says the LORD: "For three transgressions of Damascus. are they not written in the Book of the Chronicles of the Kings of Israel? 29 And Jerobo'am slept with his fathers. 4:21). 28 Now the rest of the acts of Jerobo'am. and how he recovered for Israel Damascus and Hamath. 27 But the LORD had not said that he would blot out the name of Israel from under heaven. and the top of Carmel withers. and Zechari'ah his son reigned in his stead. king of Israel. because they have threshed Gilead with threshing sledges of iron. how he fought. however. many of whose prophecies were to have dual application. 4 So I will send a fire upon the house of Haz'ael. 26 For the LORD saw that the affliction of Israel was very bitter. the God of Israel. . bond or free. which had belonged to Judah. Under Jeroboam. but with relevance to the Northern Kingdom. and cut off the inhabitants from the Valley of Aven. and him that holds the scepter from Beth-eden. and for four. so he saved them by the hand of Jerobo'am the son of Jo'ash. however. the prophet. Significantly. Amos 1:1-5 The words of Amos. Israel was able to move across the Jordan again and extend its territory as far north as the border with Syria. Isaiah. The story concerning Israel briefly switches to Judah. and it shall devour the strongholds of Ben-ha'dad. he prophesied during the reign of the second Jeroboam. and the people of Syria shall go into exile to Kir. and utters his voice from Jerusalem. I will not revoke the punishment. the kings of Israel. the pastures of the shepherds mourn. which he spoke by his servant Jonah the son of Amit'tai. and his might. both within a relatively short period of their own time and in the Last Days. 2 And he said: "The LORD roars from Zion. 11:23-25).

2Kings 15:1-7 In the twenty-seventh year of Jerobo'am king of Israel Azari'ah the son of
Amazi'ah, king of Judah, began to reign. 2 He was sixteen years old when he began to reign,
and he reigned fifty-two years in Jerusalem. His mother's name was Jecoli'ah of Jerusalem. 3
And he did what was right in the eyes of the LORD, according to all that his father Amazi'ah
had done. 4 Nevertheless the high places were not taken away; the people still sacrificed and
burned incense on the high places. 5 And the LORD smote the king, so that he was a leper to
the day of his death, and he dwelt in a separate house. And Jotham the king's son was over the
household, governing the people of the land. 6 Now the rest of the acts of Azari'ah, and all that
he did, are they not written in the Book of the Chronicles of the Kings of Judah? 7 And
Azari'ah slept with his fathers, and they buried him with his fathers in the city of David, and
Jotham his son reigned in his stead. (RSV)

Bullinger says of King Jotham of Judah:

The first-named of the four kings in whose reign Isaiah prophesied (Isa. 1:1). Micah also
began to prophesy and mourn over the coming dispersion of Israel (Comp. Bible).

Jeroboam II was on the throne during a period of about fifty years when both Israel and Judah
enjoyed relative stability and prosperity. This came at a great price, however, for the people
soon forgot their God when they grew fat, just as Moses had warned (Deut. 31:20).

Zechariah

The fifteenth king of Israel was Zechariah (Jehovah remembers), son of Jeroboam. He reigned for
only six months and was murdered by Shallum who succeeded him.

2Kings 15:8-12 In the thirty-eighth year of Azari'ah king of Judah Zechari'ah the son of
Jerobo'am reigned over Israel in Sama'ria six months. 9 And he did what was evil in the sight
of the LORD, as his fathers had done. He did not depart from the sins of Jerobo'am the son of
Nebat, which he made Israel to sin. 10 Shallum the son of Jabesh conspired against him, and
struck him down at Ibleam [or before the people: KJV], and killed him, and reigned in his
stead. 11 Now the rest of the deeds of Zechari'ah, behold, they are written in the Book of the
Chronicles of the Kings of Israel. 12 (This was the promise of the LORD which he gave to
Jehu, "Your sons shall sit upon the throne of Israel to the fourth generation." And so it came to
pass.) (RSV)

Zechariah was the fourth generation from Jehu (v. 12), whose dynasty ended there as
prophesied.

Shallum

Shallum (retribution), the son of Jabesh, began the second shortest reign of all the kings of Israel,
possibly as a result of ending Jehu’s dynasty by conspiring against and then killing the
incumbent, Zechariah.

2Kings 15:13-15 Shallum the son of Jabesh began to reign in the thirty-ninth year of Uzzi'ah
king of Judah, and he reigned one month in Sama'ria. 14 Then Men'ahem the son of Gadi came
up from Tirzah and came to Sama'ria, and he struck down Shallum the son of Jabesh in
Sama'ria and slew him, and reigned in his stead. 15 Now the rest of the deeds of Shallum, and
the conspiracy which he made, behold, they are written in the Book of the Chronicles of the
Kings of Israel. (RSV)

Shallum reigned for a single month before being killed by Menahem. He thus became a giver and
receiver of what was possibly divine, and certainly swift, retribution.

Menahem

Menahem (meaning comforter!), the seventeenth king of Israel who began the 5th dynasty, was a
violent and merciless man (v. 16). He had slain his predecessor Shallum and taken the crown.

2Kings 15:16-22 At that time Men'ahem sacked Tappuah and all who were in it and its
territory from Tirzah on; because they did not open it to him, therefore he sacked it, and he
ripped up all the women in it who were with child.

The city of Tappuah, which Menahem sacked, was on the border between Ephraim and
Manasseh (Jos. 17:8).

17
In the thirty-ninth year of Azari'ah king of Judah Men'ahem the son of Gadi began to reign
over Israel, and he reigned ten years in Sama'ria. 18 And he did what was evil in the sight of
the LORD; he did not depart all his days from all the sins of Jerobo'am the son of Nebat,
which he made Israel to sin. 19 Pul the king of Assyria came against the land; and Men'ahem
gave Pul a thousand talents of silver, that he might help him to confirm his hold of the royal
power. 20 Men'ahem exacted the money from Israel, that is, from all the wealthy men, fifty
shekels of silver from every man, to give to the king of Assyria. So the king of Assyria turned
back, and did not stay there in the land.

This is the first recorded invasion of the Northern Kingdom by the Assyrians under King Tiglath-
pileser III, or Pul, referred to as God’s “razor” in Isaiah 7:20. In this case he demanded only
tribute of Israel. As with the Syrians earlier, no land was occupied and no one was taken into
captivity. That would come much later.

The biblical account tallies with a record in the Annals of Tiglath-pileser, which reads succinctly:
“I received tribute from Menahem of Samaria.” Werner Keller suggest there were probably
60,000 wealthy men in Israel at the time, so quite a substantial sum was raised to buy off the

Assyrians. The obvious danger was in not knowing how long they would be prepared to demand
only the riches of Israel.

21
Now the rest of the deeds of Men'ahem, and all that he did, are they not written in the Book
of the Chronicles of the Kings of Israel? 22 And Men'ahem slept with his fathers, and
Pekahi'ah his son reigned in his stead. (RSV)

Menahem thus appears to have been the only king of this turbulent period to have died a
natural death. He reigned for 10 years and was a contemporary of the prophets Hosea and
Amos.

Pekahiah

Menahem’s son Pekahiah was next to ascend the throne of Israel. While Azariah was enjoying
his Jubilee year as king of Judah, the rapid turnover of kings on the throne of Israel continued. It
seems the first Jeroboam had a lot to answer for as the ‘original and worst’, his name being
constantly raised as the one who led Israel into sin and idolatry – and from which it never
recovered.

2Kings 15:23-26 In the fiftieth year of Azari'ah king of Judah Pekahi'ah the son of Men'ahem
began to reign over Israel in Sama'ria, and he reigned two years. 24 And he did what was evil
in the sight of the LORD; he did not turn away from the sins of Jerobo'am the son of Nebat,
which he made Israel to sin. 25 And Pekah the son of Remali'ah, his captain, conspired against
him with fifty men of the Gileadites, and slew him in Sama'ria, in the citadel of the king's
house; he slew him, and reigned in his stead. 26 Now the rest of the deeds of Pekahi'ah, and all
that he did, behold, they are written in the Book of the Chronicles of the Kings of Israel.
(RSV)

Pekahiah’s was killed by his successor Pekah, his reign having lasted only 2 years.

Pekah

The nineteenth and penultimate king of Israel was Pekah, son of Remaliah. He was an army
officer and possibly the chief bodyguard and advisor to King Pekahiah. It seems that the regicide
he committed with the 50 men from Gilead against Pekahiah was also to have severe
repercussions, albeit many years later. Unwisely, he had made a pact with King Rezin of Syria
against Assyria.

2Kings 15:27-38 In the fifty-second year of Azari'ah king of Judah Pekah the son of
Remali'ah began to reign over Israel in Sama'ria, and reigned twenty years. 28 And he did what

was evil in the sight of the LORD; he did not depart from the sins of Jerobo'am the son of
Nebat, which he made Israel to sin. 29 In the days of Pekah king of Israel Tig'lath-pile'ser king
of Assyria came and captured I'jon, A'bel-beth-ma'acah, Jan-o'ah, Kedesh, Hazor, Gilead, and
Galilee, all the land of Naph'tali; and he carried the people captive to Assyria.

This was actually the second recorded invasion of Israel by the Assyrians under Tiglath-pileser III,
but with a completely different emphasis than the first, which was about eight years earlier. It
was attested in the Annals of Tiglath-pileser, in particular the one describing his Western and
Gaza/Damascus Campaign of ca. 734-733 BCE, as follows:

Bit Humri [House of Omri, i.e. Israel]: all of whose cities I had added to my territories on my
former campaigns, and I had left out only the city of Samaria. … The whole of Naphtali I took
for Assyria. I put my officials over them as governors. The land of Bit Humri, all its people
and their possessions I took away to Assyria.

The land of Naphtali was one of the richest in Palestine, and Josephus spoke of it as being the
“ambition of nature” or a type of paradise on Earth. It had close commercial and social
connections with Phoenicia; for example, Hiram the master metal-smith in Solomon's time was
half-Tyrian, half-Naphtalite (1Kgs. 7:13-14).

The Assyrians had swept down the coast to Phoenicia, before turning south-east and heading
directly towards the Sea of Chinnereth (Galilee). They overran the northern half of Asher, and
the territories of Naphtali and Dan. The army then crossed the Jordan into Gilead, mopping up
the eastern Manassites and Gadites, then the Reubenites to the south. 1Chronicles 5:26 makes
only a briefly mention of what must have been a major campaign.

1Chronicles 5:26 So the God of Israel stirred up the spirit of Pul king of Assyria, the spirit of
Til'gath-pilne'ser king of Assyria, and he carried them away, namely, the Reubenites, the
Gadites, and the half-tribe of Manas'seh, and brought them to Halah, Habor, Hara, and the
river Gozan, to this day. (RSV)

The first deportation of the tribes on the eastern side of the Jordan (i.e. those that had settled
first in their inheritance) into Halah and Habor occurred in about 741 BCE. Thus we see the
territory administered by Pekah getting rapidly smaller. Eventually, only the capital city of
Samaria was to be left to Hoshea, the last king of Israel.

30
Then Hoshe'a the son of Elah made a conspiracy against Pekah the son of Remali'ah, and
struck him down, and slew him, and reigned in his stead, in the twentieth year of Jotham the
son of Uzzi'ah. 31 Now the rest of the acts of Pekah, and all that he did, behold, they are
written in the Book of the Chronicles of the Kings of Israel. 32 In the second year of Pekah the

son of Remali'ah, king of Israel, Jotham the son of Uzzi'ah, king of Judah, began to reign. 33
He was twenty-five years old when he began to reign, and he reigned sixteen years in
Jerusalem. His mother's name was Jeru'sha the daughter of Zadok. 34 And he did what was
right in the eyes of the LORD, according to all that his father Uzzi'ah had done. 35
Nevertheless the high places were not removed; the people still sacrificed and burned incense
on the high places. He built the upper gate of the house of the LORD. 36 Now the rest of the
acts of Jotham, and all that he did, are they not written in the Book of the Chronicles of the
Kings of Judah? 37 In those days the LORD began to send Rezin the king of Syria and Pekah
the son of Remali'ah against Judah. 38 Jotham slept with his fathers, and was buried with his
fathers in the city of David his father; and Ahaz his son reigned in his stead. (RSV)

We see in 2Chronicles 28 that Pekah is used to rebuke Judah for its idolatry

2Chronicles 28:5b-20 He was also given into the hand of the king of Israel, who defeated him
with great slaughter. 6 For Pekah the son of Remali'ah slew a hundred and twenty thousand in
Judah in one day, all of them men of valor, because they had forsaken the LORD, the God of
their fathers. 7 And Zichri, a mighty man of E'phraim, slew Ma-asei'ah the king's son and
Azri'kam the commander of the palace and Elka'nah the next in authority to the king. 8 The
men of Israel took captive two hundred thousand of their kinsfolk, women, sons, and
daughters; they also took much spoil from them and brought the spoil to Sama'ria. 9 But a
prophet of the LORD was there, whose name was Oded; and he went out to meet the army
that came to Sama'ria, and said to them, "Behold, because the LORD, the God of your fathers,
was angry with Judah, he gave them into your hand, but you have slain them in a rage which
has reached up to heaven. 10 And now you intend to subjugate the people of Judah and
Jerusalem, male and female, as your slaves. Have you not sins of your own against the LORD
your God?

Flushed with the success God had given them in the battle, the Israelites were about to enslave
the captives of Judah (still described as their kinfolk), until the prophet Oded intervened to
remind them of their own less-than-sinless behaviour (cf. Jn. 8:7).

11
Now hear me, and send back the captives from your kinsfolk whom you have taken, for the
fierce wrath of the LORD is upon you." 12 Certain chiefs also of the men of E'phraim, Azari'ah
the son of Joha'nan, Berechi'ah the son of Meshil'lemoth, Jehizki'ah the son of Shallum, and
Ama'sa the son of Hadlai, stood up against those who were coming from the war, 13 and said
to them, "You shall not bring the captives in here, for you propose to bring upon us guilt
against the LORD in addition to our present sins and guilt. For our guilt is already great, and
there is fierce wrath against Israel." 14 So the armed men left the captives and the spoil before
the princes and all the assembly. 15 And the men who have been mentioned by name rose and
took the captives, and with the spoil they clothed all that were naked among them; they
clothed them, gave them sandals, provided them with food and drink, and anointed them; and
carrying all the feeble among them on asses, they brought them to their kinsfolk at Jericho, the
city of palm trees. Then they returned to Sama'ria.

Isaiah 7:1-9 In the days of Ahaz the son of Jotham. and it shall not come to pass. began to reign. before sending them to Jericho. "Syria is in league with E'phraim. Judah’s troubles were not over. you and She'ar-jash'ub your son. Judah. has devised evil against you. 18 And the Philistines had made raids on the cities in the Shephe'lah and the Negeb of Judah. 5 Because Syria. therefore the chieftains of Ephraim wisely had the captives clothed and fed and their wounds dressed. He even burned his son as an offering. saying. this time against their former allies. and the head of Sama'ria is the son of Remali'ah.). 2 When the house of David was told. Gede'roth. do not fear. and let us conquer it for ourselves. Ai'jalon. and he reigned sixteen years in Jerusalem.'" (RSV) In spite of Isaiah’s prophecy that the Israel/Syria alliance would not succeed against Judah. He showed weakness by ‘supping with the devil’ as it were. in the form of the Assyrian king (2Kgs." his heart and the heart of his people shook as the trees of the forest shake before the wind. 2 Ahaz was twenty years old when he began to reign. for he had dealt wantonly in Judah and had been faithless to the LORD. Even so. son of Uzzi'ah. as his father David had done. 5 Then Rezin king of Syria and . and had taken Beth-she'mesh. 20 So Til'gath-pilne'ser king of Assyria came against him. 4 And he sacrificed and burned incense on the high places. and afflicted him instead of strengthening him. Ahaz the son of Jotham. and carried away captives. Soco with its villages. `Take heed. just as Hoshea of Israel was to run to Egypt for support against Assyria (see below). and they settled there.) 9 And the head of E'phraim is Sama'ria. according to the abominable practices of the nations whom the LORD drove out before the people of Israel. 6 "Let us go up against Judah and terrify it. king of Judah.The Israelites were in imminent danger of incurring God’s wrath. at the end of the conduit of the upper pool on the highway to the Fuller's Field. If you will not believe. 8 For the head of Syria is Damascus. and Gimzo with its villages. at the fierce anger of Rezin and Syria and the son of Remali'ah. Timnah with its villages. and on the hills. And he did not do what was right in the eyes of the LORD his God. with E'phraim and the son of Remali'ah. 2Kings 16:1-5 In the seventeenth year of Pekah the son of Remali'ah. and under every green tree. 17 For the E'domites had again invaded and defeated Judah." 7 thus says the Lord GOD: It shall not stand. 19 For the LORD brought Judah low because of Ahaz king of Israel. and the head of Damascus is Rezin. (RSV) Again the Assyrians were used as God’s instrument of punishment. king of Judah. Rezin the king of Syria and Pekah the son of Remali'ah the king of Israel came up to Jerusalem to wage war against it. "Go forth to meet Ahaz. and do not let your heart be faint because of these two smoldering stumps of firebrands. Ahaz still didn’t put his trust in God. 16:1ff. be quiet. 3 but he walked in the way of the kings of Israel. 4 and say to him. and set up the son of Ta'be-el as king in the midst of it. 16 At that time King Ahaz sent to the king of Assyria for help. 3 And the LORD said to Isaiah. (Within sixty-five years E'phraim will be broken to pieces so that it will no longer be a people. surely you shall not be established. but they could not conquer it.

27) to have been twenty years. son of Nun. was slain by Shallum. appended). According to the Chronology of the Kings of Israel (Table 1. Such an explanation would account for the round number of twenty years of kingship (750-731). he would be the twentieth and last of a far from illustrious line of kings of Israel.(Ye-) had been removed as a sign of God’s disfavour (see the paper Genealogy of the Messiah (No. The same could not be said of King Hoshea. 119)). It appears Hoshea also did evil in God’s sight but not to the same degree as Ahab and other idolatrous kings. with Pekah as king. and they besieged Ahaz but could not conquer him. ‘Pekah’) provides a possible explanation. the son of Jeroboam II. came up to wage war on Jerusalem. That was about 750 or 751. Hoshea Unbeknown to Hoshea when he acceded to the throne. The Annals state: “They overthrew Pekah their king and I made Hoshea to be king over them. At the accession of Pekahiah. (RSV) There is more confusion regarding the actual regnal years of King Pekah. Pekah the son of Remali'ah. Pekah and his valiant followers may have offered their services to the king at Samaria. but east of the Jordan Pekah and his Gileadite followers assumed independence. We see also that King Jeconiah of Judah became plain Coniah after the divine prefix Je. hence there is a reasonable concurrence with the accepted dates. Shallum reigned a short time in Samaria. it appears that Hoshea was merely a puppet ruler and Israel a vassal province of Assyria. king of Israel.” The name Hoshea (meaning salvation or deliverer) was part of the name given to Joshua. Pekahiah may have innocently accepted the offer and have thus given Pekah the long-wished-for opportunity to become king of all Israel. This extent is impossible if reckoned from the usurpation of Pekahiah's throne (736) to the succession of Hoshea (733-31). who was almost an antitype of Messiah by effectively leading his people into captivity. . an explanation that has some plausibility. The length of Pekah's reign is stated (II Kings xv. it was the beginning of general anarchy in Israel. When Zechariah. Also. with the succession of Hoshea in 731 BCE. There is. From the Annals of the Gaza/Damascus campaign of Tiglath-pileser. The Jewish Encyclopedia (art. the twenty years of kingship was perhaps 751-731 BCE. the usurpation of Pekahiah’s throne by Pekah was probably in 740 rather than in 736. and to Messiah: YaHoshua (SHD 3091: Jehovah is salvation) indicating that God was with him. however.

Sargon II (the king of Assyria in v. 36:6).) with a view to avoiding the heavy annual tribute imposed by Assyria. and for three years he besieged it. in particular. these could only have been Israelites deported from the area surrounding Samaria and not from the capital itself. the inhabitants were taken into captivity and exiled. 6 In the ninth year of Hoshe'a the king of Assyria captured Sama'ria. the Assyrians. Jew. Encyc. Halah and Hazor. for he had sent messengers to So. (RSV) As recorded in 1Chronicles 5:26. This time. and he carried the Israelites away to Assyria. It wouldn’t have made sense to leave them among their previously-exiled brethren in the Assyrian cities to plot rebellion. yet not as the kings of Israel who were before him. however. 6). however. Unfortunately for Hoshea. and on the Habor. perhaps in a spirit of ‘divide and rule’. . therefore the king of Assyria shut him up. Isa. Bk. as he had done year by year. Shalmaneser V (reigned 726-722 BCE) discovered that he had been seeking assistance from a Pharaoh. was found to be a broken reed to Israel (cf. 3 Against him came up Shalmane'ser king of Assyria. 9. and these were a rebellious people after all. Shalmaneser died unexpectedly during the first year of the siege of Samaria.) and imprisoned at Shalmaneser’s behest. Sargon claimed in his Annals: “I besieged and conquered Samaria … I led away into captivity 27. which fell to Sargon. Jews. and paid him tribute. He was supposedly blinded (see art.” Josephus states that it was Shalmaneser himself who arranged the deportations (Antiq. named variously So. Tiglath-pileser. It was to be Hoshea’s last mistake. Sewe or Sib’e (Assyr. had also transported the northerners and easterners of Israel to the cities of Assyria. however. the river of Gozan. and bound him in prison. 2Kings 17:1-6 In the twelfth year of Ahaz king of Judah Hoshe'a the son of Elah began to reign in Sama'ria over Israel. 2 And he did what was evil in the sight of the LORD. or Pul. Egypt. 4 But the king of Assyria found treachery in Hoshe'a. if this were so. together with many of the remnant of Israelite tribes west of the Jordan. captured the city and.290 people who lived there. 13) by assuming that the “king of Assyria” was the same person in verses 3. and placed them in Halah. and Hoshe'a became his vassal. His successor. king of Egypt. 5 and 6 above. 5 Then the king of Assyria invaded all the land and came to Sama'ria. and in the cities of the Medes. and offered no tribute to the king of Assyria. ‘Hoshea’. and he reigned nine years. also sent some of the latest contingent farther east into the cities of Media.

In 2Chronicles 30. basically. 9 And the people of Israel did secretly against the LORD their God things that were not right. and had feared other gods 8 and walked in the customs of the nations whom the LORD drove out before the people of Israel. 2Kings 17:7ff. They preferred to have gods they could see with their eyes and touch with their hands – their golden calves. as the nations did whom the LORD carried away before them. they proved ungrateful for the salvation afforded by their God. 31). 11 and there they burned incense on all the high places. Thus ended the reigns of 20 kings and 5 dynasties in the Northern Kingdom of Israel. and in the customs which the kings of Israel had introduced. however. as noted from their attendance at the fourth Great Passover called by King Hezekiah (who reigned ca. we see that Hezekiah called all Israel. The northern tribes of Israel had followed their first king Jeroboam just as eagerly into idolatrous worship as their ancestors under Moses had done. They built for themselves high places at all their towns. The people were reminded that their forebears had been taken out of bondage in Egypt but had quickly returned to the worship of pagan gods. And they did wicked things. 5). their Asherah pillars and their Baals – rather than walking by faith before an invisible God Most High as the Patriarch Abraham had done and for which he was honoured and blessed. 10 they set up for themselves pillars and Ashe'rim on every high hill and under every green tree. Hezekiah followed this up with a wholesale destruction of the Baal system throughout Israel (2Chr. It was an intolerable situation that could only be remedied by enslavement once again. Manasseh and Zebulun responded positively (v. only those of Asher. who had brought them up out of the land of Egypt from under the hand of Pharaoh king of Egypt. Reasons for the Captivity and Exile Second Kings gives a comprehensive list of reasons for Israel’s captivity and exile. there were still some original inhabitants left in the land after Sargon’s deportations. provoking the . 107)). However. 11).Sargon II was the “tartan” (turtaanu: commander-in-chief) of Shalmaneser’s army and supposedly seized the throne of Assyria around the time of the siege of Samaria. 726-697) in Jerusalem (see The Seven Great Passovers of the Bible (No. is a summary of all that had happened to Israel. This was to be the third and final invasion directed primarily at the Northern Kingdom. from Dan to Beersheba (v. because the people of Israel had sinned against the LORD their God. 2Kings 17:7-23 And this was so. from watchtower to fortified city.

and they made an Ashe'rah. Micaiah. and served Ba'al. The prophet Amos predicted the subsequent dispersal of the people of Israel throughout the world – including the self-satisfied and arrogant. until he had cast them out of his sight. Jeremiah reminded them of what had happened to Ephraim (Jer. Israel could not say it wasn’t warned by God of the calamities to come as a direct result of its sins. as their fathers had been.’” (RSV) . Isaiah had foretold something similar in Isaiah 7:8. and shake the house of Israel among all the nations as one shakes with a sieve. ‘Evil shall not overtake or meet us." 13 Yet the LORD warned Israel and Judah by every prophet and every seer. 21 When he had torn Israel from the house of David they made Jerobo'am the son of Nebat king. 7:15) as a representative of all the northern tribes. who say. Amos. and the warnings which he gave them. "Turn from your evil ways and keep my commandments and my statutes. 14 But they would not listen. but no pebble [grain: KJV] shall fall upon the earth. 19 Judah also did not keep the commandments of the LORD their God. and removed them out of his sight. Elisha. therefore. and became false. 12 and they served idols. 18 Therefore the LORD was very angry with Israel. and gave them into the hand of spoilers. but walked in the customs which Israel had introduced. but were stubborn. I will command. and they followed the nations that were round about them. who did not believe in the LORD their God. and his covenant that he made with their fathers. Elijah. When speaking to Judah. of which the LORD had said to them. provoking him to anger. LORD to anger. 23 until the LORD removed Israel out of his sight. they did not depart from them. and sold themselves to do evil in the sight of the LORD. and afflicted them. none was left but the tribe of Judah only. Oded. And Jerobo'am drove Israel from following the LORD and made them commit great sin. 17 And they burned their sons and their daughters as offerings. in accordance with all the law which I commanded your fathers. They went after false idols. Jehu (son of Hanani). So Israel was exiled from their own land to Assyria until this day. 10 All the sinners of my people shall die by the sword." There were a total of nine prophets in the Northern Kingdom of Israel: Ahijah. or those who considered themselves immune. Amos 9:9-10 “For lo. as he had spoken by all his servants the prophets. and made for themselves molten images of two calves. and Hosea. "You shall not do this. and which I sent to you by my servants the prophets. concerning whom the LORD had commanded them that they should not do like them. 16 And they forsook all the commandments of the LORD their God. Jonah. saying. and used divination and sorcery. many of whom were contemporaneous. 22 The people of Israel walked in all the sins which Jerobo'am did. and worshiped all the host of heaven. 20 And the LORD rejected all the descendants of Israel. (RSV) The punishment for their persistent idolatrous practices was to be banished from the land of Israel. 15 They despised his statutes.

Dehavites. and placed them in the cities of Sama'ria instead of the people of Israel. In the first year of Sargon there was war between Cuthah and Babylon. Sippar sa Samas (the sun-god) and Sippar sa Anuituv. and dwelt in its cities.15. An equally diverse contingent was later sent into Israel by Asnapper (Osnappar) or Ashurbani- pal. or the Ahava of Ezra 8. indicating an investigator. They were thus the early administrators and couriers. hence rebellion could be minimised for a long time. The word Apharsathchites is a Persian loan word denoting a judicial official connected with the Old Persian frasaka.34. Dinaites. During the Assyrian Esar-haddon’s campaign against Judah in ca. The one in Syria. Hamath. Ava = either the Ivah of 18. These were the Apharsathchites. Babylonians. Avva. The Assyrians showed their typical astuteness. Israel’s captivity and deportation was to be followed almost 50 years later by that of her sister Judah. Ten miles north-east of Babylon. . 676 BCE. Hamath. It was an effective means of keeping their vassal state of Samaria in bondage. By bringing disparate peoples into Israel. Its use in Ezra 4:9 is connected with the Old Persian from frestak meaning messenger. Susanchites and Tarpelites (Ezra 4:9-10. The cuneiform is iprasakku. Cuthah. Sepharvaim (Dual). they realised it would take generations (if ever) for them to coalesce and provide any serious opposition. Elamites. Archevites. The two Sippars in Babylonia.Resettlement and future of Israel 2Kings 17:24-41 And the king of Assyria brought people from Babylon. Apharsites. and they took possession of Sama'ria. KJV). son of Esar-haddon. he removed many of the remaining Israelites from Samaria and replaced them with more foreigners. and the people of Cuthah were transported to Syria and Palestine. and Sephar-va'im. Bullinger’s note to verse 24 details the areas from which the new residents of Israel were brought: Cuthah.

which were a Persian tribe that lived on the shores of the Caspian Sea (Strabo XI. Dict. 1. p. as the original inhabitants of Edessa became part of the Parthian Empire and one of its mints. Vol. 1. 7). Dinaites are mentioned often in the Aramaic papyri and they are judges.. Babylonians are obviously the citizens of Babylon before it was split from the Assyrian Empire. Tibarenes. or from the Persian tarapara meaning beyond the River referring to Syrians west of the Euphrates. Interp. Elamites are Semitic Persians to the east of the Medes. If they come from southern Anatolia in what is now Turkey they may be Arabs. have been suggested along with men of the Tetrapolis. However. Vol. The resettlement of Israel to the north might well lend credence to the northern captives being sent to the south. Susanchites are natives of Susa in Persia. The Interpreter’s Dictionary of the Bible thinks that the word is dihu and should be read as the men of Susa and that the mispointing created a new tribe. They are thus a Semitic people as well.Apharsites are identified as a section of Persians (RSV) or undefined Gentilic (see Interp. 156). or sons of Tubal. pp. p. These judges also wrote to Artaxerxes (Ezra 4:9). Herodotus and Josephus describe them briefly (cf. Apamea. Archevites are the Aramaic Khetibh.. Dict. which includes Antioch. the vast extent of the dispersal of the Israelites beyond the Araxes into Parthia and Scythia and into Media and northern Persia does not exclude the first meaning. the Akkadian Uruk or Erech. Seleucia. It is an official title and is rendered as such in the LXX (Lucianic Recensions). 749-50). 844). Schnell. They were identified by Herodotus (I. 1. which was the usual Assyrian practice of sending captives to the opposite ends of the empire. 25) as the Daoi. Tarpelites is a rendering of an Aramaic word which is translated in the LXX as tarphallaioi and the Vulgate Terphalaei. The inhabitants there were sons of Keturah called Arabs. Tubal would account for the Japhethite YDNA R in the area. . ibid. It is either a professional name or a tribal name and various meanings have been suggested. Dehavites are part of the group that signed the letter to Artaxerxes to stop the rebuilding of Jerusalem.. and Laodicea (following Strabo XVI.

They knew their own history (as did the Samaritan woman to whom Christ spoke: Jn.. There are now only some 700 left still following the Calendar of Jeroboam and always placing the New Year after 25 March. "Let us build with you. That group is also present but rare in Britain and in some Egyptians and others in the Middle East. These are the people who became known in NT times as the Samaritans. Jacobsen Interp. but their hearts . 1. During the Byzantine Empire the vast numbers that inhabited Samaria of the Samaritans were slaughtered systematically by the Byzantine emperors on an ongoing basis because of constant rebellion. i. Ezra spoke of a time following the return from this last captivity. 752). Cutheans are Cutha or Kuthu from the city of that name north-east of Babylon at Tell Ibrahim. although some were undoubtedly true Israelites as we now know from the YDNA tests done on the Samaritan families. It would explain the reincarnation aspects of the religion of the Druze and the views of some rabbis in Jerusalem today. The mtDNA I haplogroup is prevalent there among the Kurds and in Italy where the sons of Aeneas went after the fall of Troy with a band of the Riphathian Celts of Troy and founded Rome. Nergal might be identified with Mormo. the God of Israel.e. Dict. 4:7ff. rather it was left largely empty until the Jews and other tribes returned from captivity 70 years later. p.). for we worship your God as you do. These foreigners wanted to help with the rebuilding of the Temple under Ezra and Nehemiah. that their forebears had been planted in the land by Esar-haddon. who had conducted the fifth major Assyrian invasion of Palestine (his predecessor Sennacherib had also invaded). 2 they approached Zerub'babel and the heads of fathers' houses and said to them. Judah itself was never replanted with Gentiles. It was famous for the cult of Nergal. The operation to replace many of the remaining Israelites in Samaria (not just the capital) may have fulfilled the prophecy of Isaiah 7:8 concerning the 65 years of Ephraim. Vol." (RSV) Here is direct evidence that these people didn’t consider themselves true Israelites.The R1b YDNA comes directly from the Hittite alliance. This practice is a great clue to the location of the Israelites before the mid-eighteenth century when the Gregorian calendar was adopted. Medes are sons of Madai son of Japheth and their homeland is on the mountain country north of Babylon and north-west of Persia. from 741 to 676 BCE. and the Cutheans brought the cult with them to Palestine (cf. Ezra 4:1-2 Now when the adversaries of Judah and Benjamin heard that the returned exiles were building a temple to the LORD. god of the cult of the dead. and we have been sacrificing to him ever since the days of E'sar-had'don king of Assyria who brought us here. having close relationship with some Jews. god of the underworld.

Continuing with 2Kings 17: 25 And at the beginning of their dwelling there. they did not fear the LORD. as the word used for Lord throughout is Yahovah rather than Baal. this may be incorrect. The term god in verses 26 and 27 is Elohim. and let him go and dwell there. the land beyond the Jordan. as it seems they were more interested in maintaining social harmony and efficient administration (for which they were renowned) of their vassal states than in eliminating other religions or even restricting their practices. because they do not know the law of the god of the land. which occurred during Isaiah’s lifetime. is something positive for Galilee. Bullinger says that the priest here is: ‘An idolatrous Israelite priest from Samaria’ (note to v. 27). and was the same area (known then as Galilee of the nations) to which Christ went prior to his crucifixion following his rejection by Judah. Galilee of the nations. but in the latter time he will make glorious the way of the sea. It was the first recorded case of someone from Israel (possibly a Levite) preaching to the Gentiles." 27 Then the king of Assyria commanded. implicit in the second fulfilment of the dual prophecy. which killed some of them. however. basically Zebulun and Naphtali. 250)). This gesture by the Assyrians was probably done for purely pragmatic reasons. and behold. they are killing them. . "Send there one of the priests whom you carried away thence. therefore he has sent lions among them. A rather remarkable situation. "The nations which you have carried away and placed in the cities of Sama'ria do not know the law of the god of the land. hence being brought into contempt. and taught them how they should fear the LORD. therefore the LORD sent lions among them. and teach them the law of the god of the land. hence the ‘god of the land (of Israel)’ is Yahovah Elohim. Isaiah 9:1 But there will be no gloom for her that was in anguish. or the Angel of Great Counsel. in these Latter Days. as Ezra could discern (see the paper Reading the Law with Ezra and Nehemiah (No. 26 So the king of Assyria was told. (RSV) We saw in the reign of Pekah that Naphtali was the first tribe of Israel to go into captivity.weren’t right. In the former time he brought into contempt the land of Zeb'ulun and the land of Naph'tali. where we have the Assyrian king arranging for a priest to return from captivity in order to instruct the foreigners occupying Samaria about the God of Israel." 28 So one of the priests whom they had carried away from Sama'ria came and dwelt in Bethel. Isaiah 9:1-7 talks about the establishment of God’s Kingdom under Messiah and.

Good King Josiah of Judah instituted the fifth Great Passover as recorded in 2Chronicles 35 (see The Seven Great Passovers of the Bible (No. 107)). every nation in the cities in which they dwelt. 1Chronicles 5:26 deals with Pul’s or Tiglath-pileser’s exiling of Israelites to Halah. 30 the men of Babylon made Suc'coth-be'noth. 245). with reference again to Samaria: 29 But every nation still made gods of its own. 7:23) – again with possible end-time connotations. Obadiah 1:20 The exiles in Halah who are of the people of Israel shall possess Phoenicia as far as Zar'ephath. ibid. which was inhabited largely by Gentiles.. 18:11). Continuing in 2Kings 17. 17:6. 34:33). See the paper Josiah’s Restoration (No. 512). Halah is an unknown site in the Assyrian Empire or kingdom to which some of the Kingdom of Israel were deported by Shalmaneser in the ninth year of King Hosea (2Kgs. as had been originally intended. p. 5:26). Josiah’s missionary-type activity could also have relevance to these Last Days. ‘Halah’. (RSV) This place of exile called Sepharad (appropriately meaning separated) is probably to be identified as Sardis. art. the men of Cuth[ah] made Nergal. the men of Hamath made . The meaning is that Judah shall be returned and inhabit the south to the Negeb and Israel will return and inhabit Phoenicia between Tyre and within six miles from Sidon. 2. An Aramaic inscription has been found at Sardis itself in a bilingual inscription of the name and it is identical with the text used in Obadiah. 1Chr.It is noteworthy that the men of Naphtali (plus Asher and Manasseh) assisted Gideon against the Midianites (Jdg. The prophet Obadiah spoke of a time when the exiles would be returned to the Promised Land from Halah (cf. Josiah also took his campaign of removing idolatry from his own land into Samaria (2Chr. The RSV in Obadiah 1:20 reads the exiles in Halah for what is termed the exiles of this host (see also Gordon Interp. and put them in the shrines of the high places which the Samaritans had made. Vol. Dict. and the exiles of Jerusalem who are in Sephar'ad shall possess the cities of the Negeb.. whereby Judah may be called upon to take the message of salvation to the Gentiles. capital of Lydia in Asia Minor. The term all Israel in verse 3 hints that there were remnants of the original tribes extant.

Isa. on the other hand. 50). Bible. However. Hos. Oppenheim (see Interp. The Avvites were allegedly Avvim or aboriginal Canaanites that lived in villages near Gaza and were supposedly destroyed by the Philistines or Caphtorim (Deut. Ashima. the Venus Star.T. 3. is known to be a deity worshipped by the Syrian colonists of Israel from Iwwa. Isa. p. 17:31).23. the gods of Sephar-va'im. It is considered to be either an unnamed local deity or a version of the god Athtar. Succoth-Benoth means the Booths of Girls and is probably a reference to Sarpanitu the female consort of Marduk. city god of Babylon. . Dict. Interp. p. with Sharezar.10-12). 13:3. In his note to verse 30. and the Sephar'vites burned their children in the fire to Adram'melech and Anam'melech. The more modern term for her is Dercato and the fish was held sacred to her and is the origin of the fish symbol attributed to Christianity and the origin of eating fish as a religious symbol. 2Kgs. Adram Melech and Anam Melech.L. They were resettled in Samaria. Ashi'ma. p. 1. Nergal we have explained earlier. Nibhaz.18. also Ashimah (Amos 8:14). The Sepharvites we see worshipped the version of Melech. Thus (according to the language of the O.22. 31 and the Av'vites made Nibhaz and Tartak. 19:37. cf.5 with Isa. Vol. there is no known Assyrian interpretation of the name.) Samaria committed adultery (idolatry) with five husbands (cp. 37:39). Repeated individually in John 4.2. No wonder the woman worshipped she knew not what (John 4. This was the ancient northern border of Israel.54.17. may be a corruption of a Canaanite goddess worshipped in Syria on the Orontes River at Hamath (now Nahr el Asi).20.515) says of these five nations: Each brought its own gods. murdered his father in the temple of Nisroch (2Kgs. 2:23. The Serpharvaim are believed to be the Sabraim of Syria by A. Jos. The name Tartuk is unknown but appears to be a corruption of Atargatis the mother goddess worshipped in Syria by the Aramaeans. 546).. Jer. Bullinger (Comp. It is also the name of the son of Sennacharib who. Dict. and thus the Avvim are probably sons of Aram that settled on the coast. Gray believes that the name is a wilful Hebrew distortion of the name of the mizbeah or the altar of the deity which itself was worshipped (cf..22). Vol.

33 So they feared the LORD but also served their own gods. The One True God tells them quite unequivocally. You shall not fear other gods. However. whom he named Israel. and observing the pagan winter festival called Christmas – all in the name of God and supposedly to His glory (cf. Many people ostensibly follow the Bible yet they do not keep the whole Law of God as given therein. and to him you shall sacrifice. you shall bow yourselves to him. paying obeisance to the goddess Astarte/Easter. however. and appointed from among themselves all sorts of people as priests of the high places. Thus the Syrians affected by the cult of Moloch would have allocated their own personalised version of the deity. therefore. 37 And the statutes and the ordinances and the law and the commandment which he wrote for you. the practice was carried out all over Phoenicia and at Carthage in North Africa. and they do not follow the statutes or the ordinances or the law or the commandment which the LORD commanded the children of Jacob. Moloch may well simply be the Moabite form for Lord or King. which is precisely the situation among the descendants of Israel today. and also served their graven images. 39 but you shall fear the LORD your God. so they do to this day. 41 So these nations feared the LORD. And those who purport to be Bible-believing Christians are simultaneously worshipping on the Day of the Sun. 2Kings 17 continues: 32 They also feared the LORD. 34 To this day they do according to the former manner. You shall not fear other gods. which is probably related to the Hebrew melek or king. after the manner of the nations from among whom they had been carried away. and he will deliver you out of the hand of all your enemies. 36 but you shall fear the LORD." 40 However they would not listen. 35 The LORD made a covenant with them. 3:4-5). largely in vain. neither are your ways my ways” (Isa. who sacrificed for them in the shrines of the high places. 2Tim. you shall always be careful to do. They do not fear the LORD. . but they did according to their former manner. "You shall not fear other gods or bow yourselves to them or serve them or sacrifice to them. their children likewise. 38 and you shall not forget the covenant that I have made with you. and their children's children – as their fathers did. but there is no feature of this aspect of the cult in Mesopotamia. 55:8) and hence. The name Anam Melech is probably Anu is king. The Bible clearly says they burned children to the deities. We can see that these numerous Samaritans were not true Israelites but many were Semites with some Japhethites and Hamites among them.The term Melech seems to convey the name Moloch. who brought you out of the land of Egypt with great power and with an outstretched arm. these people are worshipping what they know not and. (RSV) Hence there was a real mixture of religious practice among the people in Samaria at that time. and commanded them. that: “My thoughts are not your thoughts.

“Peter is listed by Hippolytus as preaching the gospel in Pontus. I. and appointed Evodius as bishop there in his place. Peter’s major area of mission was to the Lost Tribes of Israel scattered abroad and there fused with the Scythians and Parthians. However. then went on from there to the north. Evodius died ca 68 and was replaced by Ignatius of Antioch as bishop. Alternatively.iii. Peter was originally bishop or patriarch of Antioch. . they were pushed into many lands far to the north and ultimately northwest from Palestine. He is then held to have been crucified upside down in the time of Nero (ANF. as John lived and controlled the Church from Ephesus and Ignatius must have had close association with him. or he was appointed by instrument of Peter and perhaps ordained by John. (Historia Ecclesiastica. 254-255). such as Philip and Bartholomew. and he either returned to Rome or was never killed in Rome. That means Peter must have been there in 68 CE on the death of Evodius. so also were a number of other apostles crucified upside down. Vol. pp. V. 33a) states that Peter himself appointed Ignatius to the see of Antioch. It is the area from where the Anglo-Saxons came as part of the Parthian horde and where the Israelites had been banished. and not to Rome. well before he died. The Apostle to the circumcision was Peter. Ignatius styled himself Theophoret or bearer of God. Eusebius. Paul was apostle to the Gentiles not Peter. The New Testament tells us that the Ten Tribes were scattered abroad (Jas. Thus Peter is intimately associated with Antioch. and not with Rome. Ignatius may have gone to Rome on the death of Evodius. he must have been. Hippolytus tells us that mission was far to the north. ultimately for their benefit and certain preservation. Andrew was also crucified on an olive tree. Peter went to Antioch and established the Church there. by various routes. Cappadocia and Betania.Conclusion In all of the foregoing history of Israel we can see a divine plan being worked out by God in His omniscience. 1:1) and James addresses his epistle to them. The sheer breadth of Peter’s ministry makes it impossible that he could have been bishop of Rome. Immutab. Theodoret (Dial. Galatia. and in appointing its bishops. iv. and Italy and Asia. II. and is understood to have been a disciple of Peter and John. Indeed.. He arranged for the northern tribes to be sent into captivity in Assyria. then. Betania is in the area of Tbilisi in the Caucasus.22) records that Ignatius succeeded Evodius. he was an apostle to the circumcision.

Turkmenistan. Palestine and Israel.Ignatius was martyred between 98 and 117 CE. 266 (ibid. However. Elymais and Persis. Some of the horde that were to become the Kurds remained behind. Rome itself is not even mentioned as part of the ministry. then Peter was not martyred in Rome where it is commonly believed he died. the Persians who were once part of its empire attacked and defeated the Parthians and caused a portion of its central horde to move north-west into Europe under The Judge who was its leader U’din or Odin or Woden. Parthia at one time occupied areas now in Iran. They brought with them the Almanac or calendar based on the New Moons.). At its greatest extent Parthia occupied a vast area. or had given such instructions”(ibid. Azerbaijan. Pakistan. Parthia stood between Rome and the East. Their most famous leader was Salah’ u’din or Saladin. the timing of the appointments in Antioch shows that Peter was still overseeing operations there to the tribes in the dispersion. Iraq. and Peter then appointed Clement. Turkey.). The sub-kingdoms of the Parthians were Characene. Afghanistan. Armenia. If the tradition is to be accepted that Peter ordained Clement as bishop of Rome on the death of Linus. We can safely say that the Ten Tribes were in the Caucasus in what was Parthia and Scythia at the time of Peter’s missions between 30 and 68 CE. but weakened by them. Lebanon. The sheer magnitude of the area of Peter’s administration is to the north and Italy was a minor part of it and barely rates a mention in relation to the other areas. There is only a general reference to Italy. Tajikistan. Georgia. Jordan. Syria. The details are in the Appendix of paper No. . as we know from Acts 2:9-11. Linus is specifically mentioned by Hippolytus as being bishop of Rome when Peter is alive. Parthia and the surrounding nations that made up its Empire had a large number of Israelites and many made pilgrimages to Jerusalem. Such a view must be dismissed unless Linus was martyred shortly before Peter. After defeating the Romans. Almanach means the counting in Arabic.

have predominantly R1b YDNA with a section of Semitic I. these areas listed by Hippolytus were all parts of the Parthian Empire. or men of Ur. there are distinct differences between regions in burial practices. too little is known about the relationship between material remains and religion (Hansman and Stronach 1970: 49). Human and animal bones were found together. There have been few Parthian burials reported from Iran. and into France and Spain. as well as Anglo-Saxons and Normans. They wore trousers and were associated with horsemanship.” The Parthians were not one tribal group and were nomads. Some are Goths. Many Scythians wore kilts. Alans and Heruli. leading the excavators to speculate on a cultural connection with the Scythians. Irish and other Celts. The tradition that Peter preached to the British comes from his mission to the Israelites among the Anglo-Saxons. who deposited horse bones with human burials. Thus the area contained the groups that went from what is now Armenia and Georgia and the area around the Black Sea and Caspian Sea into Europe. Some attribute the Book of Hebrews to Paul and four texts place it after 2Thessalonians. “Like other aspects of Parthian material culture. Jutes and other tribes of the Horde while in Parthia and not in Britain itself. as simple cremation-type burials leave little for archaeology. Some are known Anglo-Saxons and Celts. The combination of these people would be of R1b and a Semitic Haplogroup I.Without any doubt at the time of Peter’s mission and at the time of the writing of the text to the Hebrews. As with other areas of the Parthian empire. Norse. who form the modern German Thuringians. some are Gomerites and some are Magogites. Angles. . This is probably due to the nature of burial. The historical record shows they were all from the area of the Russian steppes with some from Assyria. The site of Shahr-I Qumis (northeast of Tehran) yielded evidence for multi-room funerary structures. We find this combination throughout Western Europe in the Celts. The I groups are Semites and the divisions of them will no doubt identify the tribes These Gomerites and the I Hg Semites fit the description of Israelites scattered throughout Parthia. Saxons of Britain and Saxony. but the dating and the intent was within the jurisdiction of Peter. Further west the picture is more complicated. Frisians. YDNA evidence now shows that Scots. such as the Hermanduri. Jutes. The men also took wives from other racial or sedentary groups. West Europe and Denmark are largely a combination of R1b and I Haplogroups. Danes. and what was Scythia. and further east they were in the Uigur autonomous region of what is now China.

The absence of R1b in North Africa where the Vandals went indicated they either were completely wiped out or were RxR1 basics and settled in Cameroon. and these were once no doubt part of the Parthian horde that did not move into Europe with the Anglo-Saxons. These people were all predominantly R1b or I haplogroups. or they mutated somehow. and Assyrians and Arphaxadite Hebrews contain multiple types of Hg. The Massagetae. Japheth would be the larger or greater people but the birthright promises of Shem would be conferred on him as well due to their intermarriage. saw the Khazars take up the area once occupied by these nomads and the Israelites and Jews that remained behind with them. that were the Anglo-Saxons. Jutes. and ultimately the R1a Slavs also come from the same lineage.The Romans recruited the Sarmatians after they managed to defeat them and placed many of them in Britain in the army. perhaps higher up. but the R1a of the Slavs predominated among them suggesting that the R1 divisions into R1a and R1b occurred after the split. Goths and Vandals. On the other hand. In other words. . The intermingling of the people now has resulted in all of them carrying some Israelite bloodlines whether they are YDNA Israelites or YDNA Celts of the Hittite and later Parthian alliances. Hence the prophecy was fulfilled that Japheth would be enlarged and would dwell in the tents of Shem. The Anglo-Saxons and the Lombards that split off from them all wore trousers and fringes around the bottoms of them. Lombards. The Goths split up into the Ostrogoths (Eastern Goths) who settled in Italy and Austria along with the Lombards and the Visi-Goths (Western Goths) who occupied Spain. the Semitic groups may have settled into four basic stable groups early. or Greater Goths. Khazars The removal of the Parthians. I. and Vandals moved in as part of the Horde and all were Unitarian Sabbatarians. There is little doubt that the R1bs come from the one ancestor. Thus they were a mixture of Japhethite and Semite lineage. or perhaps some of them became R1a and some developed into R1b due to isolation from the same ancestors. The Khazars were comprised of Ashkenazi Gomerites and Slavs. The predominance in Norway and Sweden of R1a indicates that it may have occurred in the first millennium of the Current Era. Thus the divisions may be very much later indeed.

in 597 CE. it wasn’t until the Act of Union of the Parliaments exactly 300 years ago (in 1707) that the two countries settled their differences long enough to create a new entity called Great Britain. whether in the north (Jer. I will not look on you in anger.The Healing of the Breach The Kingdom of Israel. faithless Israel. and more Jews now live side by side with the Hg I and R1B Celto/Israelites in the US and British Commonwealth than anywhere else on Earth. that you rebelled against the LORD your God . Many Israelites were in the "Isles of the Sea" or the UK and Ireland. 13 Only acknowledge your guilt. (RSV) The call is presently going out to all nations for all people to repent and become the Israel of God. was not to be united again with Judah. and proclaim these words toward the north. until about 2500 years later in the Last Days. It was to be in Europe where most of the “lost” Ten Tribes of Israel had surfaced under Haplogroup I. "Faithless Israel has shown herself less guilty than false Judah. With the inclusion of Ireland in January 1801. are urged to repent and return to the God who their fathers' knew. Wherever they are found in the world today. The YDNA lines of the kings from 1066 were Norman R1b. for I am merciful. the country became known as the United Kingdom for the first time.. being transferred by marriage or migration The Union of the Crowns between the royal houses of England and Scotland was effected in 1603. with Hebrew Davidic lines inherited chiefly through the females. says the LORD. which will ultimately fill the whole Earth. `Return. 12 Go. I will not be angry for ever. (Most of Ireland has since become independent. This was a mere seven years after the rise of the so-called Holy Roman Empire. in effect.. says the LORD. . either through direct YDNA lineage or through cross- breeding with Parthian Anglo-Saxons or Jutes and Lombards or Hittites and other Celts and indeed all nations. Columba. 3:12) or scattered across the globe. Jeremiah 3:11-13a And the LORD said to me.) God has certainly protected these islands in spite of the endemic idolatry and the inroads that Trinitarianism quickly made. however. perhaps indicating that the British Isles was considered an important bastion that had to be thoroughly infiltrated with the Babylonian mysteries in order to eliminate the worship of the One True God of Columba’s followers and others. which ended with Hoshea. The union was commenced from West Europe and ultimately the Americas and Australasia and South Africa. the descendants of Israel. and say. Despite sharing a sovereign. which came soon after the death of the notable Irish Sabbatarian saint. These began basically with Augustine’s mission to England.

Table 1: Chronology of the Kings of Israel Period of Reign Duration Dynasty: no.883/82 2 years Died III: 7* Omri 885/84 .885/84 2 years Murdered 5 Zimri 885/84 7 days Suicide 6* Tibni 885/84 .732/31 20 years Murdered 20 Hoshea 732/31 .852 2 years Died III: 10 Jehoram 852 .874/73 12 years Died III: 8 Ahab 874/73 .740/39 2 years Murdered V: 19 Pekah [751] 740/39 .841 12 years Murdered IV: 11 Jehu 841 .814/13 28 years Died IV: 12 Jehoahaz 814/13 . King End (BCE) I: 1 Jeroboam 932 .853 22 years Killed in battle III: 9 Ahaziah 853 .910/09 22 years Died I: 2 Nadab 910/09 .753 41 years Died II IV: 15 Zechariah 753 .909/08 2 years Murdered II: 3 Baasha 909/08 .886/85 24 years Died II: 4 Elah 886/85 .798 17 years Died IV: 13 Jehoash 798 .782/81 16 years Died IV: 14 Jeroboam [793] 782/81 .742/41 10 years Died V: 18 Pekahiah 742/41 .752 6 months Murdered 16 Shallum 752 1 month Murdered V: 17 Menahem 752 .722 9 years Died .

Notes: 1) Discrepancies in the reigns of Jeroboam II and Pekah are examined in the text. 2) * denotes concurrent reign .

Centres d'intérêt liés