Vous êtes sur la page 1sur 258

Sons of Shem

:

Part I

The birthright was passed to Shem, the youngest son of Noah, as priest of God in the order of
Melchisedek. The descendants of Shem carried the priesthood down to Abraham and on into the
lines of the descendants of Abraham. Shem produced a number of children and from them sprung
a number of important nations of the world. The sons of Shem intermingled with the sons of Ham
and Japheth and God’s promises to the world would be fulfilled in that mixing of nations.

Preface

The Conversion of the Sons of Abraham

God established a covenant with Abraham and said He would make him the father of many nations.
Through his offspring, who we call the Patriarchs, a number of nations were commenced and they were
given birthright promises and were made part of an ongoing covenant between God and Abraham that
they were expected to continue and fulfil.

In this series we will deal with the identities and ultimate destiny of these nations and their influence on
the rest of the world.

Over the next time-cycle of 19 years and the final sequence of the Wars of the End arriving at the Jubilee
of 2027, we will see these nations brought to repentance and conversion on a systematic and progressive
basis.

Part I (No. 212A) deals with the Sons of Shem and their locations.

Part II (No. 212B) deals with the sons of Lot and also those of Esau and their identity, destiny and
conversion.

Part III (No. 212C) deals with Ishmael and its destiny and conversion and place in the Kingdom of God.

Part IV (No. 212D) deals with the sons of Keturah and their identity, destiny and conversion.

Part V (No. 212E) will deal with the destiny of Judah and its conversion in the Last Days.

Part VI (No. 212F) will deal with Israel and its crisis and repentance.

Part VII (No. 212G) will be an Appendix for tables and charts

These six parts will explain what is required of the sons of Abraham and their place in the restoration of
the world to the Laws of God.

The details of the covenant God made with Abraham and the legacy and priesthood established with him
through Shem is also explained in the site www.abrahams-legacy.org

Introduction

The purpose of this paper is to expand on the work on the Genetic Origin of the Nations (No. 265) and
deal with the sons of Shem and then lead in to the sons of Arphaxad and the descendants of Abraham,
and their place in history and prophecy and their current identities.

The sons of Shem are Elam and Asshur, Arphaxad, Lud and Aram.

We know for certain that the Elamites became the Persians, the sons of Asshur became the Assyrians,
the sons of Arphaxad became the Hebrews, and Aram became the Syrians and the source of the name of
the Aramaic language. They also later went north into Armenia.

From the modern DNA sampling of the Assyrian project, the modern Assyrians are L, G, J and some
R1b1, but it seems that the R1b1 tested are English on the paternal side and Assyrian on the maternal
side. Thus, northern Aram (in the area of Armenia and Georgia) and Asshur developed the G
Haplogroup, which is where it is found in greatest percentages.

Josephus gives us a clear indication of the sons of Aram when he says that of the four sons of Aram, Uz
founded Trachonitis and Damascus, which is the country between Palestine and Ceolesyria, Ul founded
Armenia and Gather the Bactrians, and Mesa the Mesaneans now called Charax Spasini. From this
record the Semitic G Haplogroup would appear to come from Aram and Asshur. Josephus records that
Abraham first settled with an army in Damascus (ibid., Whiston tr., p. 32).

Josephus says that Joktan of the Hebrews had thirteen sons: Elmodad, Saleph, Asermoth, Jera, Adoram,
Aizel, Decla, Ebal, Abimael, Sabeus, Ophir, Eulat, and Jobab. He says that these people inhabited Asia
from the Indian River, Cophen, and the lands surrounding it. This is modern Kabul and the valley of its
river. The land further towards the Indus is Bactria. Thus, if that is the fact of the matter they seemingly
moved through the Arabian Peninsular and most went on to India. The result could be the composite
groups of Joktan in what is Afghanistan, Gather in Bactria and then Lud in the Punjab. The Semitic
Haplogroup H in India would then be derived from a mutation that occurred among the Hebrews of
Joktan and the Semites of Lud. The golden wedge of Ophir refers to the lands of one of the sons of
Joktan who settled in Afghanistan or India, and thus the area of Ophir may be from the Hindu Cush into
India or perhaps, even more likely, Sri Lanka (Ceylon) (see also below).

Afghan and other Pashtun

The Wikipedia article on Pashtuns says they would appear to be primarily of Iranian origin, but have
similarities with Persians, Kurds, Tajiks and Baluchis.

Pashto-speaking Pashtuns (or Pukhtuns, depending on dialect) and are found in southern and eastern
Afghanistan and western Pakistan. These Pashtuns also became intermingled with others groups, such as
the Ghilzai (who possibly mingled with Turkic tribes), the Durrani (who interacted with the Tajiks), and
Pashtun tribes north of Peshawar (who mingled with Dardic groups).

The article went on to say that from the first to the fifth century BCE huge migrations of peoples from
Aryans, Persians, Sakas, Scythians, Kushans, Huns, and Greeks moved into the regions where the
Pashtuns lived. Later invaders were Muslim Arabs, Central Asian Turkic tribes and Mongols.

The anthropological evidence that the Pashto-speaking Pashtuns are an Indo-European Caucasoid
people, who are related to other Iranian groups and to speakers of the Kalasha and Nuristanis languages,
is by no means conclusive. So far the testing has not shown any substantial connection between the
Pashtun population sampled to the genetic markers found amongst most Greeks, Jews, or Arabs. The
answer may be that Pashtuns have been slightly modified over time by various invaders and mixes as
mentioned above. Yet they have kept their eastern Iranian base genetically overall.

There would thus also be Japhethitic R1a and R1b and Hamitic C YDNA present.

Many conclusions concerning the Semites come from the premise that the Semitic Haplogroups are all J
as found among the three populations mentioned.

The Pashtun are classified as Iranian, which as we have seen is primarily Haplogroup I which is derived
from the Semitic IJ Haplogroup (see below) but they vary as a typical Central Asian composite YDNA
grouping. An attempt was made to classify the Pashtun in the 16th century as one of the Bani Israel, of
the Lost Ten Tribes and as Joseph. This was debunked based on their Indo-Iranian affinities and
language. However, it is an historical fact that the area of Khandahar, Kabul and Bactria also, on the
other side of the Hindu Cush, were made provinces or satrapies of the Persian Empire and their
languages are thus affected by that fact. The DNA similarities with Elam and their reported historical
descent and affinity with Joktan indicate that the original DNA of the Semites, including the Joktan
Hebrews, was not J but F and the primary Semitic derivative is I and the secondary derivatives are J,
both derived from IJ (based on S2 and S22) and then H and G. All the Eastern Semites of Elam and
Joktan were Hg. I, rather than J. Thus these mutations occurred over the second millennium BCE and the
extended mathematical models of the evolutionists are wrong.

The Durrany and Galzay tribes are held to be direct descendants of the Ibrani or Hebrews and probably
of the sons of Joktan. Some also hold the Rabbani, Shinwari, Levani, Deftali, and Jaji from Afghanistan,
and the Efridi and Yusufzai from Pakistan to also be Hebrew tribes.

Lud

Lud is a source of uncertainty and there are two explanations for the identification of, and locations of
the sons of Lud. We will return to this puzzle shortly.

Other Locations of the Hebrews

The origin and location of the Hebrews is identified with Abraham as coming out of Ur of Chaldea and
the sons of Arphaxad are identified with the Akkadian groups in the Mesopotamian plain between the
children of Asshur, or the Assyrians, and the sons of Elam, who were on the east of the Tigris basin to
the Persian plateau.

The other group of the Medes, who were associated with the Persians and occupied the high country to
the north of Elam and Gutea, are not basically Semite, but we will see they do contain Semites now from
their exposure to the Arabs and perhaps earlier. The Kurds predominantly derived from the Medes, the
sons of Madai, a Japhethite. We will return to them later. The Guteans or Guti may well also be
associated with the Goths as part of the later Parthian or Scythian Horde. We will examine their
movements in a later paper.

Professor Cyrus Gordon also holds the early Minoans to be Semites and their language Linear A as
being Semitic. His work on Linear A has been met with controversy.

The sons of Arphaxad are: Salah and Eber (from where the name Hebrew is derived). His sons Peleg and
Joktan saw the split in the Hebrews. The sons of Joktan were thirteen in number and occupied the entire
eastern area of the Arabian peninsular (Gen. 10:21-32) but many went on into Afghanistan or Pakistan,
as we see above. The sons of Abraham through Hagar and some of the sons of Keturah, such as Midian,
later joined them. The line of Abraham through Peleg was to Reu, Serug, Nahor, Terah to Abraham,
Nahor and Haran. Abraham was called out of Ur of Chaldee and sent into the land of Canaan.

It follows that the lineages of the Semitic countries will give us clues as to the distribution of Semitic
Haplogroups and mutations. The original position was to say simply that Haplogroup J is the Semitic

Haplogroup and all others are not Semitic, but that cannot be true given the distribution and mixtures of
the nation groups; and we now know that to be false in regard to the IJ proto Haplogoup. From the
historical reconstruction, a number of other groups are also Semitic, as we will see.

For example, in the genetic structure of the Persians or Elamites, Hg I is predominant. It exceeds J by
some 10%, and has an element of F and G with it. Those groups constitute half the YDNA of the
Persians. The Middle Eastern Arabs also have a significant amount of I and some G. Haplogroups G, I
and J constitute half of the Georgians/Armenians and the Turks and F, G, I and J are half the Italians
with I and J comprising half the YDNA of the Greeks. When we go into Europe the balance of I
increases dramatically.

G, (M201), H (M69), I (M170, M258, and P19) and J (12f2.1) appear to be known Semitic lineages with
K (M9), the root base for all the sons of Japheth. Hg. J decreases as it moves west in Europe, but Hg. I
remains more or less highly significant as far west as the Anglo-Saxons and then decreases among the
Basque, Welsh, Irish and Scots, but is nevertheless still found in quantities of up to 15% among these
known Celts.

The Anglo-Saxons came in from the Middle East as part of the horde at the fall of the Parthian Empire
from what is now the area of Iraq and the area north of it. That occurred at the end of the second century
CE. They moved into the area of NW Europe and the horde split up in various waves. The Anglo-Saxons
and Jutes and the associated tribes of Lombards, Danes, Norwegians, Saxons and Fris, split up but
retained a similar diversity. The northern French are also from the Middle East. The Normans constitute
one element and are predominantly R1b but they contain other DNA groups such as I. The others are
Francs in two groups. These are the Riphathian Francs and the Salien Francs. The Salien Francs could
inherit through the male line only but the Riphathian Francs could inherit through both.

As we know, Riphath was a son of Japheth and we know that the nobility of these people also claimed
descent from Antenor I, King of the Cimmerians, and also from the Trojans. They were understood to be
the offspring of the group that remained in the Middle East with the sons of Hector. They named their
major city after Paris and Troyes. Many of these people settled across the Channel in Britain and those
tribes (e.g. Parisii) were also R1b Celts. Over 35% of the northern French are Haplogroups I and J.
Approximately 35% of the Anglo-Saxons are Middle East Hg. I with some small amount of J.
Approximately 40% of English are Middle Eastern and seemingly Semites of I mutated from the IJ
group. The majority of all NW Celts and Anglo-Saxons are R1b and part of the same genetic divisions
as the known Japhethite tribes. The obvious exception is to the east where the Slavs are R1a, and the
largest R1a divisions among the horde coming into the North West was among the Norwegians, at about
30%.

Arabs

From the Bible, Torah and Qur’an, we learn that the Arabs are descendants of Shem, son of Noah. Some
Arabs claim to trace their ancestry directly back to Noah and Adam.

Arab origin is divided into two major groups:
al-‘Āriba meaning, "Pure origin" and al-Musta’ribah meaning, "Arabised Arabs".

The Pure Arabs are considered to be descendants of Noah through his son Shem, through his sons Aram
and Arphaxad, and are known as Qahtanite. The Qahtanite are considered to have originated from the
South Arabians, according to Arab genealogies.

The term Arabised-Arabs can be used for three different groups:
1) 1) For Arabs considered to be descendants of Abraham through Ishmael, through his son
Adnan and known as Adanites.

2) 2) For Arabs who spoke other Afro-Asiatic languages. As Arabic speakers they are regarded
as Arabs in contemporary times.
3) 3) For the "Mixed Arabs", between "Pure Arabs" and the Arabs from South Arabia.

The break-up of these groups will be discussed in the papers on Ishmael and Keturah.

Religions

While most Arabs are Muslim, a minority are Christians, and some are Jews. Muslims comprise Sunni,
Shi’ite, Ibadhite, Alawite, Ismaili or Druze.

Before the introduction of Islam, most Arabs worshipped a number of deities while some converted to
Christianity or Judiasm. The pagan deities were those such as Hubal, Wadd, Al-Lat, Manat and Uzza. A
few hanifs favoured a vague form of monotheism. However, as Islam expanded more and more Arabs
became Muslims and the old traditions disappeared.

Arab Christians generally follow one of the four main churches: Coptic, Maronite, Greek Orthodox, or
Greek Catholic.

Gypsies or Roma

When the British explorer Richard Burton travelled throughout the Land of Midian in the late 19 th
century, he came upon a people known as the Hutaym (meaning broken). Although Muslims, they were
a tribe of pariahs also found in Egypt.

The Arabs of Midian always compare the Hutaym with the Ghagar (Ghajar) or Gypsies of Egypt;
and this is the point which gives the outcasts a passing interest. I have not yet had an opportunity of
carefully studying the race; nor can I say whether it shows any traces of skill in metal-working.
Meanwhile, we must inquire whether these Helots [slaves], now so dispersed, are not old immigrants
of Indian descent, who have lost their Aryan language, like the Egyptian Ghajar. In that case they
would represent the descendants of the wandering tribes who worked the most ancient ateliers
[workshops]. Perhaps they may prove to be congeners of the men of the Bronze Age, and of the
earliest waves of Gypsy-immigration into Europe. (Burton, Midian (Revisited), p. 119; emphasis
added)

Burton goes on to say:
And I would here lay special stress upon my suspicion that the ancestors of the despised Hutaym
may have been the Gypsy-caste that worked the metals in Midian. (ibid., p. 135).

The Hutayim he saw may have been simply the remnant of the true sons of Midian whose brother tribes
had long since migrated into other areas of the Middle East and eventually into Europe, some perhaps
via India.

In his book Travels in Arabia (1845 and 1848) (reprinted by The Oleander Press, Cambridge, UK,
1979), G.A. Wallin had this to say of the tribe known as the Hutaym:
They are despised and illtreated by their Bedawy neighbours, to whom they are forced to pay a
heavy brother-tax (khawe) without being thereby freed from other contributions of every kind. I have
often seen how haughty Bedawies have driven their horses and camels through yet unmown fields,
permitting the animals to feed on the corn without any check … they [the Hutaym] silently submit to
their tyranny.
When in their tents they are usually seen doing some handiwork, as repairing their weapons or
making utensils and furniture … They also showed a stronger religious feeling … in their features
also a different origin is to be traced, and their type is most evidently Syrian, but often with a very

and Erlides (also known as Yerlii or Arli) settled in South-eastern Europe and Turkey. In fact. Latin America.. and Sinti themselves. The Roma recognize divisions among themselves based in part on territorial. Most Roma speak one of several dialects of Romani. an independent Romani fiefdom (called the Feudum Acinganorum) was established in Corfu and became "a settled community and an important and established part of the economy. from the Balkans. many of whom migrated to central Europe and North America. often referred to as gypsies or gipsies. "Atsingani" was used to refer to itinerant fortune tellers. Burton’s use of the term Gypsy on several occasions may be the key to the identity of a relatively small group of the present-day descendants of Midian. insist that Sinti are not a subgroup of Roma but rather a separate ethnic group which also had Indian origins and a history of nomadism). Saint Athanasia gave food to "foreigners called the Atsinganoi" near Thrace. 6:3-6). the former Soviet Union. prominent Jewish cast. associated with entertainment. dates from the Byzantine era during a time of famine in the 9th century. Romnichal (Rom'nies) mainly in Britain and North America. In the year 800 A. ventriloquists and wizards who visited the Emperor Constantine IX in the year 1054. there may be a strong case for including these people with the other known sons of Keturah.D. I regard them as a scanty remainder of some of the old Jewish or Nabataean aborigines of the land. The Wikipedia article (abridged) on the Gypsies or Roma contains a number of interesting facts. Germany. … In 1322 a Franciscan monk named Simon Simeonis described people resembling these "atsinganoi" living in Crete and in 1350 Ludolphus of Sudheim mentioned a similar people with a unique language whom he called Mandapolos. … (p. significant numbers also live in the Americas. the Roma had reached the Balkans. in 803 A. The Roma (singular Rom.D. (Greek). Around 1360. Theophanes the Confessor wrote that Emperor Nikephoros I had the help of the "Atsinganoi" to put down a riot with their "knowledge of magic". Gitanos (also called Calé) mostly in the Iberian Peninsula. by 1424. Western Europe. Most Roma refer to themselves as Rom. traditionally coppersmiths. The word means "husband". cultural and dialectal differences. Worldwide."[32] … By the 14th century. and North Africa. the United States and the Middle East. Later. Some authorities recognize five main groups: Kalderash are the most numerous. sometimes Rroma. They began their migration to Europe and North Africa via the Iranian plateau around 1050. however. Sinti mostly in Alsace and other regions of France and Germany. Contemporary scholars have suggested that one of the first written references to the Roma. the Middle East. and by the 16th century. while Romni means "wife". under the term "Atsinganoi". … The origin of the word Rom … is proposed as the Sanskrit word ram … or rama … meaning "husband". an Indo-Aryan language. 133) Wallin’s comment about the Bedawi (Bedouin) manner of driving livestock into their neighbours’ crops is reminiscent of the Midianites doing the same to the Israelites when they were given mastery over Israel (Jdg. North Africa. .. are a diverse ethnic group who live primarily in Southern and Eastern Europe. Rrom) or Romanies. often travelling showmen and circus people (Other experts. and southern France. Western Asia. sometimes called "Romany folk" in the United Kingdom. a word which some theorize was possibly derived from the Greek word mantes (meaning prophet or fortune teller). The largest population of Roma is found on the Balkan peninsular. there are an estimated 8 to 10 million Roma. They are believed to have originated in the Punjab and Rajasthan regions of the Indian subcontinent.

The M217 marker. Kivisild et al. Hg. Yhrd gives few matches with South Asian populations. Haplogroup L is found in about 10% of Indian males but is absent from Roma (though Gresham et al. Specifically. abduction of their children. On the other hand. likely under 1. Haplogroup R1a1 occurs around 35-45% in the northwest of the Indian subcontinent. but only 10-15% in the southeast. A study published in Nature associates the Roma with the Sinhala. H is logged as an earlier division of F. 2003. Elsewhere in Europe. Sahoo et al. 2006). Sengupta et al. U3 (10%). During World War II.000 to 800. and also from West Bengal and Central Asian Sinti (Kivisild (2003) et al). Baltic and Vlax Roma genetics suggest that about 50% of observed haplotypes belong to Y-chromosomal haplogroup H. Sinhalese are mostly descendants of East and South Indian communities. is also found in West Bengal (Kivisild (2003) et al). does not seem to test for it).Scotland and Sweden. This genetic evidence indicates that approximately half of the gene pool of these studied Roma is similar to that of the surrounding European populations. which is the primary mutation for all Semites and Japhethites. “ This data and the information above would indicate that Sinhalese Sri Lankans may well be Semites from the same early base as the Rom and may be the Ophir group of the sons of Shem with the Rom being another of the brothers of Ophir of the Joktan Hebrews with some Bengalis also related.6% of male Roma. Some Roma migrated from Persia through North Africa. female-line) haplogroups are H (35%). common Y-chromosome (i. Genetic data strongly supports linguistic evidence that the Roma originated on the Indian subcontinent. I (22%) and J2 (14%). Luba Kalaydjieva's research has shown that the original group appeared in India some 32-40 generations ago and was small. 2001. other (20%).e. the rest are found throughout Europe.000 people. All these genetic studies indicate a South-East Indian origin of the male Roma population. but are present in South Asia (11%-35% approx). R2 occurs around 20-40% in West Bengal and Andhra Pradesh (Bamshad et al. reaching Europe via Spain in the 15th century. Whereas male haplogroup H and female M are rare in non-Roma European populations. a population that has a large proportion of Bengali and Sri Lankan groups. Y-haplogroups H. they were marked for extermination and sentenced to forced labour and imprisonment in concentration camps. male Sinti Roma in Central Asia have H (20%). male-line) haplogroups are haplogroups H (50%). J2 (20%) and a high frequency of R2 (50%) which is found frequently in West Bengal and among the Sinhalese of Sri Lanka. Studies of Bulgarian. . R2 and J2 increase in frequency towards the southeast. and R1b (7%). Similar studies of the same population with mitochondrial DNA show 50% belong to female mitochondrial haplogroup M. and forced labor. M (26%). H and J2 occur 20-30% in South and East India. but a large number of matches on haplogroup H with British Asian Londoners. the Nazis murdered 200. 2006. H is a derivative of F. By contrast. The two currents met in France. a search of the Yhrd database shows that some Roma populations in Europe have considerable percentages of male haplogroup R1a1.000 Roma in an attempted genocide known as the Porajmos. I or J2 Semites. However. which accounts for about 1. Common mitochondrial (i. Like the Jews. Both of these are widespread across South Asia. … Roma were enslaved for five centuries in Romania until abolition in 1864. they were subject to ethnic cleansing.e. 36% of Roma are either Hg. However. female haplogroups U2i and U7 are almost absent from female Roma. X (7%). and must be viewed from this genetic profile of Romas.

Wells et al. Today. Thus the YDNA Haplogoup H was developed from F on the Indian subcontinent (as was L) and the predominant source of H in Europe is from the Gypsies and subsequent Indian immigrants. who intermingled with the C basic earlier inhabitants of Australia and perhaps even as late as the first millennium BCE from the Indianisation of South East Asia. I and J are now known derivations from the one IJ group. are the main source of Haplogroup H in Western Europe. Haplogroup F The F Haplogroup stems from the division between the Yap M145. et al. who apparently originated in India.000 years ago.) (Retrieved from http://en. The Concise Oxford Dictionary. David Gresham. Arphaxadites or Hebrews. occurred in a Haplogroup F man. and J are assumed to be of Semitic origin and G.org/wiki/Roma_people) The R2 is a Japhethite group that is Aryan and related to the Celts and Slavs. Of course evolutionists assert that the founder of Haplogroup H probably lived about 30. gipsen from Egyptian. We will look more at the timings below. and speaking a language (Romany) related to Hindi”. nearly all members of Haplogroup H live in the Indian subcontinent area. The later waves of the Australian Aboriginals were thus Aryans related to the Dravidians. Whilst we can demonstrate reasonably well that Gypsies are of Semitic origin that came in via India we cannot demonstrate their origin in the sons of Keturah. This Haplogroup has not yet been studied in a comprehensive manner. from the supposed origin of gypsies when they appeared in England in the early 16th c.000-40. Thus a significant percentage of Aborigines are proto-Celt/Slavs or Aryans of the sons of Japheth. Peter A. Am J Hum (2001). Haplogroups G. also says that the Roma were “of Hindu origin with dark skin and hair. H. M197 • • • H1a2 M97 • • • H1a3 M39. I. Bharti Morar. probably in the Indian subcontinent. The subgroup of the Vlax Rom are probably derived from an ancestor no more than 400-500 years ago in Europe. H. It is a small group and sometimes acts as a catchall because researchers did not do enough testing to determine the group correctly. under the entry gypsy. Both these groups are descended from the R basic Haplogroup. The Aryan invasion of India took place 1000 BCE and the R basic subdivision is a later mutation of the YDNA system derived from P. I are found in Assyrians with I and J being found in the Assyrians. It gives the origin of the term as: “earlier gipcyan. The Eurasian Heartland: A continental perspective on Y-chromosome diversity. M203 divide for D and E and the RPS4Y 711 M216 divide for the C group.wikipedia. The Roma (also known as Gypsy) people. M69.” Gypsy YDNA may look like this: H M69 • H* - • H1 M52 • • H1* - • • H1a M82 • • • H1a* - • • • H1a1 M36. found in Cameroon (Africa). The language of the Romani was seemingly developed in Europe after they left India.(Ref: Origins and Divergence of the Roma (Gypsies). There are small F groups in . Australia and India. Underhill. as well as being very thinly spread through the Middle East. M138 • • H1b M370 • H2 Apt Y-DNA Haplogroup H: The founding mutation for Haplogroup H. which is found amongst the Dravidians and a large proportion of the Australian Aboriginals. Keturah Arab and Ishmaelite Arab and Jewish populations respectively.

Q and R appear to be Japhethite tribes. There are also some lineages of E3b African or Hamitic lineages. among the Kazan Tartar and in Khazakstan. This F group is central to known lineages of both Shem and Japheth. The so- . This stem determines all the other Haplogroups from F to R. P29 Haplogroups K. M. J. Thus K must include all Japheth. Those arguments do not appear to stand up to scrutiny on a simple population basis. N. These lineages with G also spread to Turkey. together with some R1a and R1b. M213. This Haplogroup division identifies also the Buba Clan of the Lemba Tribe of Zimbabwe as Aaronic priests and they have been separated from the rest of Judah/Levi for perhaps 1900-2. but it might be then argued that G to I are open to both. This line is the basic line for G. The basic F is P14. Abraham has indeed become the father of many nations. who was told that God would enlarge him and he would dwell in the tents of Shem. The blessing of Japheth places Japheth within the tents of Shem. The YDNA groups All other YDNA groups from G to R2 are derived from one central Haplogroup F. O. I and R1b and R1a groupings satisfy these criteria. However. producing the major national groups and the mutations that flowed from that stem.Georgia/Armenia. both Shem and Japheth passed this core Haplogroup on to all their offspring. Georgia/Armenia and Italy. Isaac and Jacob. The charts would make Ham’s sons widely divergent. We know that the lineages in known Semitic nations are G. Thus we would expect to find a mixture of Japheth and Shem in the same national groupings. H. God said that He would bless Japheth. The mtDNA puzzle As we noted in the paper Genetic Origin of the Nations (No. or female “eves” are posed for Europe. We will start with Lineage F. The conclusion is that the basic root of F is nearly gone but the prolific sons survived and flourished. Some seven original Hgs. Conventional wisdom identifies the Middle Eastern Arabs as Haplogroup J and the Jewish Aaronic priesthood. Thus the J2 division is at least as old as that separation. In biblical terms. M213. Perhaps Ham also passed it to one of his sons. there “are 26 mtDNA Haplogroups indicating 26 female mtDNA lines. and thus prophecy is fulfilled. I and J. L. which is P14. M89. What is certain is that the sheer extent of the Haplogroups I and R1b and also R1a in Europe makes it virtually impossible for every person in Europe not to be a descendant of Abraham. M89. Uzbekistan.500 years. Persia. and thus G to J are of both groups with K forming the next division and one that does not appear in the known Semitic J. when we examine the tree of mtDNA we find some interesting group derivatives. and K. I. P. 265). Thus the Hittite and Parthian alliance with Israel has made them one people spread over a vast area with various language entities. The blessings of Shem accrue to Japheth even though Japheth is larger in percentage terms in each nation. is at J2. Thus Hgs. which has an identified clear lineage to Shem. either through their maternal or paternal lines. The argument might be raised that the Haplogroups of Shem and Japheth are both F and that all their sons are simple variations from them without distinction.

There may have been further divisions. We also have to address the fact that Eve was dark. and their mtDNA line may have been L. It may have even been R. L.pdf. which itself is a mutation of Hg. perhaps M and N or perhaps also R. That assumption is based on the premise that mtDNA does not force mutation of the Human Genome and that assumption is now being shown to be false. L.edu/~mcdonald/WorldHaplogroupsMaps.uiuc. This line then split into L1. The Supergroups M and N were next to diverge or mutate. The daughters of Noah and the wives of the sons could have carried all three of the L subdivisions and the basic core subgroups of M. That is super L. The L2 and L3 split may have come from the family structure before the Flood. Thus the only argument between the Bible account and modern scientific DNA is the supposition that the mathematical models require a much longer period to mutate than the Bible chronology. M and Hg. The wives of Shem and Japheth were of the subdivisions of L. and N came on to the Ark within the accepted biblical account. E subdivision. L2 and L3 are all found in Africa and are the major groups almost exclusively in sub- Saharan Africa. In other words. Only from Ethiopia north do we get large diversity of the mtDNA record. The placement of the DNA groups can be seen in the work of J. It is also possible that the subdivision Supergroup R may have come on the Ark. These Haplogroups are all descended from a single female Supergroup. So we can assume that Eve produced the line L and the three wives of Shem. if we assume that the entire L line came in through the wife of Ham. All subsequent groups from R are subgroups of R. given the fact that Noah may have had daughters not mentioned. D. L we get Hg. M. That is what we would expect to find if we assume there were only three females that bred on from the Ark. The two groups M and N formed the following subgroups: M produced three subdivisions: M subgroup including. N. as the L line is almost confined to the sub-Saharan tribes. McDonald who has grouped them by charts of Y and mtDNA Haplogroups available at http://www.called Supergroups are really only in three basic groups. Ham and Japheth are at least the three groups L. Ham and Japheth. all females came from one Eve whose mtDNA line was L. Ham and Japheth. and Q subdivision We might thus also deduce that the wives of the sons of Noah were taken from the one family lineage maintaining purity in the generations in the female line also. Thus. from the original Hg. even if there were only the daughter of Noah and the wives of Shem. The L groups L1. Thus. depending on the number of females. they came from three main female lines. From a biblical point of view we can argue easily that L was formed with Eve and the other groups were pre-Flood divisions that came on to the Ark. all females are descended from one female line Hg. could easily have contained the basis for the modern mtDNA . N. So in reality.skinned and the fact that Adam means “the one who was red”. namely Haplogroup L. It is therefore possible that the women of the Ark. C and Z.scs. then M and N and subsequently R. Thus. M and N. N and perhaps R. which split from each other. and then L2 and L3. we could correctly argue that L. Both of these groups are independent direct mutations of Hg. and D and G. The line L3 diverged and from L3 came the other mtDNA mutations. That is the basic reason why evolutionists claim that we all came out of Africa. All mtDNA Haplogroups are subdivisions of L. namely the wives of Shem. or M or N.

Also in Arabic speaking countries like: Algeria (35%). Thus the J1 J2 and other divisions must have occurred after the split of the Aaronic priesthood in 722 BCE or it is an independent mutation that does not solely identify the entire priesthood. Arphaxad.0%) and J2 (43.4%) [Semino et al] and Arab Bedouins (62% and 82% in Negev desert Bedouins). M. What we do not fully know is if the IJ group developed in any of the other sons of Shem.2%) with a small portion falling outside Haplogroup J (3.” Semitic Haplogroup J The Wikipedia article on the Semitic Haplogroup J identified the Haplogroup as coming originally from the combined Haplogroup IJ. We would not be surprised to find such diversity in a family of married sons even today. and Haplogroup J1.1 genetic marker. and between them account for almost all of the population of the Haplogroup. or the equivalent M304 marker. defined by the M267 marker.” Haplogroup J2 is defined by the M172 marker. Egypt and South Pakistan it is common today to find these groups. or accommodating. The Cohen Modal Haplotype (CMH) for the sons of Aaron falls in J1 and in J2. Haplogroup J was previously known as HG9 or Eu9/Eu10. is correct. 265) we concluded that “there is thus nothing in the mtDNA variations and Haplogroups to preclude the Bible story and the Genesis account being accommodated by. Whilst science holds these evolutionary extended time-frames it still agrees that they arose in the Near East. and we can identify these lines elsewhere. This Haplogroup is the key Haplogroup for all Semitic and Japethite people. The significance is that science is now beginning to hold and accept that I and J were once the same group and that all I Hg.” We will deal with the female mtDNA diversity of the known Semitic nations in a later paper. the scientific advances we find here.8%). The main current subgroups of J are J1 and J2. N and perhaps R were present in the women on the Ark. The Bible time-frame allows for an origin no earlier than 2200 BCE. The mutations occurred as each group moved out from the Middle East and crossbred with moving tribes and families over time. They involve cross-breeding among nations. the southern . In the paper Genetic Origin of the Nations (No. Thus we have a clear acceptance in biblical terms that the Bible record that Hebrew peoples came from the one ancestor. In Palestine. The Wikipedia article on: Haplogroup J1 (Y-DNA) says: Haplogroup J1 is notable since this haplogroup shows highest frequencies in the Middle East North Africa and Ethiopia [Thomas et al study 1999] J1 was spread by two temporally distinct migratory episodes. It is defined by the 12f2.diversity. Haplogroup IJ is in turn derived from Haplogroup F. the most recent one probably associated with the diffusion of Arab people Haplogroup J1 is most frequent in Palestinian Arabs (38. people came from the same ancestry as the Jews and Arabs that possess the J system. it is the genetic signature in J1 that is considered the Jewish priestly signature. Syria (30%). mtDNA Haplogroups L. Wikipedia holds that “although you can have the CMH in either J1 or J2. The bulk of CMH is observed in J1 (53. The IJ group is defined by S2 and S22 in the YDNA chain.

Sengupta et al.1%). The Haplotype thus mutates faster than thought and the models are wrong. The Semites moved on into South India. It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22. 14% in Aryan upper castes. The Sinhalese of Sri Lanka also have R2 Japhethite lineages.) and finally Somalian (see ref: Semino et al. Anatolia: Muslim Kurds (28. J2 was found to encompass several unrelaterd sub-Haplogroups (22 subs with 12 subs that have high frequencies) that originated in different regions: Italians. North Africa. Albanians 19. 2004). where it became something like a marker of the Arab expansion in the early medieval period (Semino et al.0%. In Jewish populations overall. the Roma have similar mixes of Haplogroups.2%. The presence of J2 in India without the E3b1 traveller indicates that the J2 Haplotype developed in India from Hebrews.6%) and in southern Italy (16.6%) J2 is not found in Semitic languages speaking populations of Africa (like Amhari and Tigrinia in Ethiopia) (Semino et al. Amhara 33. Lebanese (25%). Balkan. Azerbaijan. Thus the migration of these people must have occurred with the early Hebrews (perhaps Joktan. Balkan. essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages . As we have seen. Caucasian (Georgia. 2004). Hungarians 2. Its frequency rapidly drops in the Carpathian basin (Croatians 6. and with Jews who have historical origins in the Middle East and speak (or historically spoke) a Semitic language. Spain. Aegean. Bengal and Sri Lanka. Tunisians 30. Ukrainians 7. where it is found mainly among Semitic speakers (e.Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. because “Indian J2 is not accompanied by its ‘loyal fellow-traveller’ E3b1 that penetrated to the Near East from North Africa after the end of the Ice Age and is tightly bound with the spread of both J-subbranches since the Neolithic era. though typically Haplogroup J2 is more than twice as common among Jews. Pakistan.2%) and Sephardim Jews (28.8%). Iraqis (25.6% of the Ashkenazim results and 11.9%). B7_1). 2% in tribes. Anatolian (Kurds and Turkey). who had not interbred with Canaanites or Egyptians in either the Mixed Multitude or the occupation of Canaan. Algerians 35. It was thought of as the genetic markers of Anatolian Neolithic agriculturalists. which is the Indian mutation from RxR1. 2004). Wikipedia article Haplogroup J) The significance of the Cohen Modal Haplotype in both J1 and J2 indicates that the division and development of these Haplogroups are a result of mutation after the spread of the Aaronic priesthood which occurred no earlier than 1458 BCE and perhaps later than 722 BCE.Levant Iraq (33%). A large portioin of this appears to be among Arabs also. Georgians (26. 2004). or even earlier) that moved from Assyria probably with the Assyrians and Cushites and some Japhethites Hg.0%. Ashkenazi Jews (23. Researchers believe that marker DYS388=17 (Y DNA tests for STR .3%.4%).The distribution of J1 outside of the Middle East is associated [with] Arabs and Phoenecians through trade and conquest like Sicily south Italy.3%). Wikipedia says regarding Haplogroup J2 (Y-DNA) Haplogroup J2 is present mostly in Europe.1%). Central Turks (27. . Turkey. the Sinai Peninsula. 2006) must be of a very early date. and the Arabian Peninsula collapsing suddenly at the borders of Arabic countries with non Arabic countries (Turkey and Iran). However. Haplogroup J1 is found almost exclusively among modern populations of Southwest Asia. Armenia).6%.7-29. The significant presence of J2 (J2b2+J2a) in India (18. RxR1 to Harappa and Mohenjo Daro in the Indus perhaps even as early as the occupation in the 18th century BCE (cf.2%). J1 constitutes 14.g. Mysticism Chapter 1 Spreading the Babylonian Mysteries (No. It entered Ethiopia in the Neolithic with the Neolithic Revolution and spread of agriculture.7%). but is found especially in the northern Levant (Kurdistan.9% of the Sephardic results (Semino et al. 2004). but Oromo 3. It is also very frequent in the Balkans (Greeks 20.6% in Dravidian upper castes.” (cf. and East Africa.

212G). P mutated into the RxR1 Hg. Tables of the lineages of the Sons of Shem will be reproduced in the paper Sons of Shem Part VII: Charts for P212A-212F (No. perhaps not mixed originally.The Cushites and Japhethites also went into South India and moved on into Southeast Asia. The Cushites and other Hamitics also moved Northeast and formed the Mongols and the base population of what became the Maori and the C3 Amerindians. Hg. 1700 BCE. The Hamitic group also formed the mutation Hg. and are said to be in the Haplogoup or paragroup J*(xJ1. They appear to have come in eight waves. O. from which all Celts and Slavs are descended. The basic Papua/New Guinea populations retained the original K as did some Phoenician traders at K2. they are extremely rare. The next division of F Japhethite subdivision and the RxR1 had split from them into P in the Middle East. Wikipedia specific information on Base J is: J*(xJ1. D from which many of the the Japanese and Tibetans are descended. The K populace mutated from F and a major section formed the Negritos and Melansesians. and formed the basis of the Australian Aboriginal population ca. K at M9 also split into a single group M214 which formed the branch of the Japhethite sons of the Huns and Finns under the N Haplogroup. One community is apparently a late arrival Hg. together with the Chinese and Malays and some Polynesians and Philippinos under the O haplogroup. probably from the Indo-Malays or Chinese. This means that haplogroup J* includes all of J except for J1 and J2 Technical specification of mutation The technical details of M304 are: Nucleotide change: A to C Position (base pair): 421 Total size (base pairs): 527 Forward 5′→ 3′: caaagtgctgggattacagg Reverse 5′→ 3′: cttctagcttcatctgcattgt Semitic Haplogoups and their subclades will be reproduced in another paper Appendix.J2). No Semites moved to Australasia.J2) There are also some Haplogroup J Y-chromosomes that belong to neither J1 nor J2. . RxR1 remained in India forming the Dravidians and another base group moved with the majority C basic Hg. however. Tasmania was inhabited originally by K Negritos as was New Zealand with the Maorii or Moriori after an earler settlement and ultimately they were forced out by the HG C Maori.

through Canaan to Egypt. (SHD 3875: a veil or covering). and after the death of his father there. They will be united under Messiah for the millennial system. So when God commanded Abraham to leave Haran we find Lot accompanies Abraham on his journeys from Mesopotamia to Canaan. Abraham was obviously the head of the family and Lot the subordinate but Abraham had allowed Lot to have his own flocks and herds and tents (Gen. . was the son of Haran. and back again to Beth-el (Gen. Descendants of Abraham Part II: Lot. No doubt because Abraham was blessed Lot was also blessed. 13:6-7). Moab. But because “their substance was great” they could no longer dwell together. Ammon and Esau The blessings conferred on Abraham also extended to the children of Lot and the sons of Isaac.31-32). Moab. Perhaps there was no formal adoption but Lot was a likely candidate to become Abraham’s heir. Ammon and Esau LOT Lot. 11:27. 12. Also the Canaanites and Perizzites dwelt there in the land (Gen. Sarai and Lot to Haran. Lot. and nephew of Abraham (Gen. At the age of 205 Terah died there in Haran (Gen. his grandfather (Terah) took Abraham. 13:5). from the Hebrew word pronounced lote. 13:1-3). By this time both Abraham and Lot had accumulated great wealth. Sarai’s childlessness and Haran’s death may be the reason Lot continued with Abraham instead of staying with Nahor. grandson of Terah. There were quarrels between the herdsmen on both sides because the land’s resources were obviously not enough for all the herds and cattle. 11:27-32). Lot was born in Ur of the Chaldees.

He recovered all the spoils they had taken and brought back Lot with the other captives. since the land there was well watered. as the city gate was where legal matters were discussed and prosecuted. which was all the plain of the Jordan near the cities of Sodom and Gomorrah. Chedorlaomer and his allies attacked the kings of Sodom and the neighbouring cities. and was turned into a pillar of salt (v. Bullinger says in his notes to Genesis 19:1 that the gate was the seat of judgment. showing that Lot was a real citizen. 7 and if he rescued righteous Lot. Abraham was offered a reward by the King of Sodom. we see a number of events ensued during that night before the destruction of Sodom. So. he was vexed in his righteous soul day after day with their lawless deeds). which was one of the five doomed cities. It is also interesting to note that while Lot is often portrayed in a bad light from the events of the OT text. 24). . We next hear of Lot in Genesis 19 when God sent angels to rescue Lot and his family before the cities of the plain were destroyed. We note that Lot was sitting at the gate when the angels arrived at Sodom. he was indeed a righteous man as we see from 2Peter 2:4-9 (esp. and pitched his tent towards Sodom (Gen. When Abraham heard about this he armed his 318 trained servants. his wife and two of his daughters and led them safely out of the city. but refused to take anything. who consented that he might retire to Zoar. The wickedness of the people there had called down God’s wrath but Abraham had pleaded for Lot’s safety and protection. looked back. Lot was among the many captives taken and he lost all of his possessions. and pursued the retreating victorious kings as far as Dan. vv. Lot had seemingly become a member of Sodom’s ruling council. Lot's wife. However. Lot entreated the angels. but at dawn the angels took Lot. 6-9). 13:10-12). They were told to flee into the mountains and warned not to look back at the doomed city. 9 then the Lord knows how to rescue the godly from trial. So Abraham dwelled in the land of Canaan and Lot dwelled in the cities of the plain.Inheritance of Lot So Abraham offered Lot the choice of the land and Lot chose what he thought was the better part. … 6 if by turning the cities of Sodom and Gomor'rah to ashes he [God] condemned them to extinction and made them an example to those who were to be ungodly. greatly distressed by the licentiousness of the wicked 8 (for by what that righteous man saw and heard as he lived among them. Some years after this separation. and to keep the unrighteous under punishment until the day of judgment (RSV used throughout) Continuing with Lot. disregarding the warning of the angels.

24)). and she named him Moab. Lot left Zoar and retired with his two daughters to a cave in an adjacent mountain. Moab was to take part in the lineage of Messiah through Ruth (a Moabitess). The land of Moab was occupied by .) Son of Ammi = “god of Am” – Bullinger.e. the father of David (see Ruth 4:16-22). By him each became pregnant. he is the father of the Moabites to this day. They assumed it was their responsibility to bear children and enable the continuation of the human race. Moab also a territory. He was the patriarch of the nation known as Moab. and called his name Moab. 38 The younger also bore a son. 19:30-38). i. It extends along the eastern shore of the Salt Sea (called the Dead Sea). Lot's daughters incorrectly believed they were the only females to have survived the devastation. from the father). and she named him Ben-Ammi (Gen. Inheritance altered by Israel and Gilead Ammon had no authority to possess Gilead or take it from Israel. Moab (SHD 4124. means beautiful land. Ammon (SHD 5983) from (SHD 5971): tribal. he is the father of the Ammonites to this day. He became the patriarch of the nation of Ammon. Sons of Lot The older daughter had a son. MOAB The Land Moab is the historical name for a mountainous strip of land in modern-day Jordan. Yet both nations would be extended salvation under Messiah in the Last Days.Sodom was destroyed and Lot and his family were saved from the destruction by the Angel of Yahovah (see the paper The Angel of YHVH (No. Genesis 19:37 The first-born bore a son. the father of Jesse. or Ben-Ammi (Heb. wife of Boaz. the younger daughter also had a son. On two subsequent nights they got their father drunk enough to have sexual intercourse with them. inbred. the mother of Obed. and called his name Ben-ammi.

It would seem.29). Eglon of Moab oppressed Israel with the aid of Ammon and Amalek (Jdg. and Moab and Ammon made war on Jehoshaphat and Mt. They did not at first disturb the Moabites in the South. 21:21- 26). but it revolted and Omri had to reconquer it (M S). Seir and destroyed the latter. such as the Moabites and the Gileadites.4). 8:28. 24). 21:31-32). But when Balak son of Zippor. king of Moab. but did not subdue it (1Sam. It revolted again in the reign of Ahaziah (2Kgs. 8:2). and the Moabite yoke was cast off after 18 years. 1:1. 3:27). but they afterward fell out among themselves and destroyed each other (2Chr. had subdued the northern part of Moab as far as the Arnon (Num. J. Some time before the establishment of the kingdom in Israel the Midianites overran Moab. 20). The Moabites lost their identity as a nation and were afterward confounded with the Arabs. as would appear from the passage in Genesis 36:35. he made alliance with the Midianites against them and called in the aid of Balaam [see the paper The Doctrine of Balaam and Balaam’s Prophecy (No. 25). king of Moab. Bands of Moabites ventured to raid the land of Israel when weakened by the conflict with Hazael (2Kgs. defeating them and occupying the territory (Num. located next to the modern Jordanian town of Dhiban. Here the Israelites found them as they approached the Promised Land. which may be the disaster to Moab recounted in Isaiah 15. 3:5). 1:1). . 1. 21:21-31). suffered disaster when the Lord’s anger burned against them because of their sins (Num. 14:25).the tribe of Moab in ancient times which is demonstrated by numerous archeological findings. where he says that Alexander (Janneus) overcame the Arabians. History: from The International Standard Bible Encyclopedia We know scarcely anything of the history of the Moabites after the account of their origin in Genesis 19 until the time of the exodus. for Moab recovered its lost territory and became strong enough to encroach upon Israel across the Jordan. but passed around on the eastern border (Deut. Ant. saw what a powerful people was settling on his border. under their king Sihon. 22. xv. XIII.l 14:47). 12:20). 22:3. Their capital was Dibon.2). At a later date Moab was overrun by the Nabathean Arabs who ruled in Petra and extended their authority on the east side of Jordan even as far as Damascus (Josephus. and afterward completely freed his land from the dominion of Israel (M S). The Israelites. but Eglon was assassinated by Ehud. who. Saul smote Moab. 13:20). that they had suffered from the invasions of the Amorites. 5). On the division of the kingdom between Rehoboam and Jeroboam the latter probably obtained possession of Moab (1Kgs. for we find David putting his father and mother under the protection of the king of Moab when persecuted by Saul (1Sam. But this friendship between David and Moab did not continue. but the conquest was not permanent. This was probably at the time when Israel and Judah were at war with Hazael of Damascus (2Kgs. but Moab was probably subdued again by Jeroboam II (2Kgs. as we see in the statement of Josephus (XIII. 2:8. and it was tributary to Ahab (2Kgs. xiii.. however. 3:13-14).9) and came into conflict with the Amorites in the North (Num. 3). Jehoshaphat and Jehoram together made an expedition into Moab and defeated the Moabites with great slaughter (2Kgs. however. But Mesha. 208)] but as he could not induce Balaam to curse them he refrained from attacking the Israelites (Num. was not subdued (2Kgs. When David became king he made war upon Moab and completely subjugated it (2Sam.

because I have given Ar to the sons of Lot for a possession. "You shall not enter into marriage with them. Ammonite. and south of the Arnon (Num. and Hittite women. for surely they will turn away your heart after their gods". 1Kings 11:1-2 Now King Solomon loved many foreign women: the daughter of Pharaoh. See the territorial map at Appendix A. neither shall they with you. 9 And the LORD said to me.org/enc/isb/view. not a man escaped. and allowed not a man to pass over. because they had done what was evil in the sight of the LORD. Israel was allowed to be ruled under their laws and unjust systems. able-bodied men. 29 And they killed at that time about ten thousand of the Moabites. Judges 3:12-14 And the people of Israel again did what was evil in the sight of the LORD. 14 And the people of Israel served Eglon the king of Moab eighteen years. Solomon clung to these in love. Moab is within the Kingdom of Jordan. "And we turned and went in the direction of the wilderness of Moab. E'domite. for I will not give you any of their land for a possession. Sido'nian. The restrictions on marriage were because of idolatry and not for racist consideration.' Moses buried in the land of Moab Deuteronomy 34:5-6 So Moses the servant of the LORD died there in the land of Moab. Judges 3:28-30 And he said to them. . all strong. When they were idolatrous they were ruled by others. 30 So Moab was subdued that day under the hand of Israel. away from our brethren the sons of Esau who live in Se'ir. Today. When Israel repented and turned to God they were restored and given rest. for the LORD has given your enemies the Moabites into your hand. according to the word of the LORD. 2 from the nations concerning which the LORD had said to the people of Israel. even though they were worshipping the gods of these nations. and the LORD strengthened Eglon the king of Moab against Israel." So they went down after him. when they were faithful they ruled over them or were free of their systems. Thus. and Moabite. Alliance within Moab When Israel lapsed into idolatry then God used the idolatrous nations around them to punish them.cgi?number=T6108 The Bible tells us the land of Moab is located east of the Jordan River and the Dead Sea. Often the idolatry was brought in by the rulers of Israel themselves. 21:10-15). It was always the same. "Follow after me. 13 He gathered to himself the Ammonites and the Amal'ekites. because they allowed themselves to be corrupted by these false gods. 6 and he buried him in the valley in the land of Moab opposite Beth-pe'or. Inheritance of Moab Deuteronomy 2:8-9 So we went on.studylight. `Do not harass Moab or contend with them in battle. and went and defeated Israel. and seized the fords of the Jordan against the Moabites. but no man knows the place of his burial to this day. And the land had rest for eighty years.http://www. away from the Arabah road from Elath and E'zion-ge'ber. and they took possession of the city of palms.

let the name of Israel be remembered no more!" 5 Yea. let us wipe them out as a nation. the Egyptians." This intermarriage was due to idolatry and that was the faithlessness spoken of by God. from the Canaanites. the Per'izzites. Manas'seh is mine. Psalm 83:1-8 A Song. they consult together against thy protected ones. . the Hittites. and the Amorites. upon Edom I cast my shoe. [Selah] This alliance in the Last Days is a union aimed at the destruction of Israel and it will not succeed but rather bring about the unification of the children of Abraham and the destruction of those who oppose the people of God. the Moabites. 4 They say. O God. Extension of the Messianic Kingdom of the sons of the Patriarchs The extension of the kingdom under Messiah as the Kingdom of David is already given in prophecy. as fulfilled in part under the Macabbees and John Hyrcanus but all of which pointed towards Messiah. those who hate thee have raised their heads. over Philistia I shout in triumph." 9 Who will bring me to the fortified city? Who will lead me to Edom? The person implied here in the question “who” it is that will lead them to Moab was Judah. "Come. Moab women intermarry with Israel Ezra 9:1-2 After these things had been done. And in this faithlessness the hand of the officials and chief men has been foremost. so that the holy race has mixed itself with the peoples of the lands. they are the strong arm of the children of Lot. and the Mo'abites became servants to David and brought tribute. the officials approached me and said. thy enemies are in tumult. 8 Assyria also has joined them. 2 For they have taken some of their daughters to be wives for themselves and for their sons. as all nations there will be brought into the inheritance of Messiah. O God! 2 For lo. Edom and Ishmael will all be dealt with in the Last Days.David subdued Moab When Israel was given rest under David the surrounding nations were subjugated. A Psalm of Asaph. E'phraim is my helmet. the Ammonites. 3 They lay crafty plans against thy people. they conspire with one accord. Moab and the Hagrites. do not keep silence. the Jeb'usites. 8 Moab is my washbasin. against thee they make a covenant – 6 the tents of Edom and the Ish'maelites. "The people of Israel and the priests and the Levites have not separated themselves from the peoples of the lands with their abominations. This action points towards the restoration under Messiah. Judah is my scepter. 7 Gebal and Ammon and Am'alek. 1Chronicles 18:2 And he defeated Moab. Philistia with the inhabitants of Tyre. Psalm 60:7-9 Gilead is mine. do not hold thy peace or be still.

says the LORD. 12 He will raise an ensign for the nations. and will wave his hand over the River with his scorching wind. and from the coastlands of the sea. 9 Moab is my washbasin. Edom. E'phraim shall not be jealous of Judah. The nation of Jordan will become a part of Israel in its entirety by 2027. The Burden of Moab Moab had been subdued by Saul (1Sam. from Ethiopia. Jeremiah 9:25-26 "Behold. and his dwellings shall be glorious. 3:4. Jehoshaphat gained victories (2Chr. and Judah shall not harass E'phraim. from Elam. and together they shall plunder the people of the east. 2:9. upon Edom I cast my shoe. 20:1-30. but in fact not being true to the Faith and circumcised in heart. Isaiah 11:10-16 In that day the root of Jesse shall stand as an ensign to the peoples.Repeat of the sentiments of Psalm 60:8 Psalm 108:8-10 Gilead is mine. 1:1." Judah does not escape this punishment and will be cleansed of these mystics and traditions. 13 The jealousy of E'phraim shall depart. and those who harass Judah shall be cut off. him shall the nations seek. Judah. They shall put forth their hand against Edom and Moab. from Shinar. 14:47) and David (2Sam. 14 But they shall swoop down upon the shoulder of the Philistines in the west. from Assyria. Moab. from Egypt. and all the house of Israel is uncircumcised in heart. 15 And the LORD will utterly destroy the tongue of the sea of Egypt. and the Ammonites shall obey them. 16 And there will be a highway from Assyria for the remnant which is left of his people. Judah my scepter. from Hamath.5). when I will punish all those who are circumcised but yet uncircumcised -. the days are coming." 10 Who will bring me to the fortified city? Who will lead me to Edom? They will be joined to Israel as allied nations under Messiah. Tiglath-pileser . the sons of Ammon. The entire people of Israel will be returned to the Holy Land. for all these nations are uncircumcised. And the surrounding nations will assist them and be in alliance with them. 8:2). The Second Exodus Edom. provides punishment in the Last Days and over time. that is. 3:9). Manas'seh is mine.26 Egypt. 11 In that day the Lord will extend his hand yet a second time to recover the remnant which is left of his people. and gather the dispersed of Judah from the four corners of the earth. and paid tribute to Ahab (2Kgs. and will assemble the outcasts of Israel. 3:4-27). E'phraim is my helmet. 2Kgs. over Philistia I shout in triumph. Prophecy against Moab: They say they are circumcised but are not The punishment for claiming to be of the circumcision of the sons of Abraham. to those who say they are Jews but are not but are of the synagogue of Satan (Rev. from Pathros. and all who dwell in the desert that cut the corners of their hair. They will be made to prostrate themselves in adoration before the true Church of God. as there was for Israel when they came up from the land of Egypt. Moab and Ammon will obey Judah. and smite it into seven channels that men may cross dryshod. This punishment extended also to the Jews.

16:10). 9 For the waters of Dibon are full of blood. 3 "Give counsel. 15:1) Isaiah 15:1-9 An oracle concerning Moab." Judgment on Moab . Israel is to be a refuge to the outcasts of Moab. 4 Heshbon and Ele-a'leh cry out. 2 The daughter of Dibon has gone up to the high places to weep.his boasts are false. O Heshbon and Ele- a'leh. 7 Therefore the abundance they have gained and what they have laid up they carry away over the Brook of the Willows. 8 For the fields of Heshbon languish. and those who survive will be very few and feeble. hide the outcasts. utterly stricken. betray not the fugitive. the grass is withered. 11 Therefore my soul moans like a lyre for Moab. the wailing reaches to Egla'im. he will not prevail. when he comes to his sanctuary to pray. On every head is baldness. for the remnant of the land. and he who tramples under foot has vanished from the land. 6 the waters of Nimrim are a desolation." 6 We have heard of the pride of Moab. no treader treads out wine in the presses. 5 My heart cries out for Moab. Isaiah 16:1-14 They have sent lambs to the ruler of the land. the verdure is no more. 10 And joy and gladness are taken away from the fruitful field. the lords of the nations have struck down its branches. like the years of a hireling. its shoots spread abroad and passed over the sea. their voice is heard as far as Jahaz. 2 Like fluttering birds. and my heart for Kir-he'res. over Nebo and over Med'eba Moab wails. to Eg'lath-shelish'iyah. 9 Therefore I weep with the weeping of Jazer for the vine of Sibmah.carried away tribes east of Jordan and received tribute from Moab as well as from Ahaz (2Kgs. make your shade like night at the height of noon. Because Ar is laid waste in a night Moab is undone. on the housetops and in the squares every one wails and melts in tears. his soul trembles. a lion for those of Moab who escape. and destruction has ceased. the glory of Moab will be brought into contempt. for upon your fruit and your harvest the battle shout has fallen. the wailing reaches to Beer-e'lim. (see Bullinger’s notes on Isa. his fugitives flee to Zo'ar. every beard is shorn. 5 then a throne will be established in steadfast love and on it will sit in faithfulness in the tent of David one who judges and seeks justice and is swift to do righteousness. 3 in the streets they gird on sackcloth. "In three years. grant justice. the new growth fails. For at the ascent of Luhith they go up weeping. of his arrogance. and in the vineyards no songs are sung. the vintage shout is hushed. 7 Therefore let Moab wail. and the vine of Sibmah. 13 This is the word which the LORD spoke concerning Moab in the past. when he wearies himself upon the high place. They are taken from a land under siege but they are protected and set aside for the Messiah. be a refuge to them from the destroyer. to the mount of the daughter of Zion. in spite of all his great multitude. for the raisin-cakes of Kir-har'eseth. Mourn. When the oppressor is no more. his pride. how proud he was. like scattered nestlings. yet I will bring upon Dibon even more. 14 But now the LORD says. because Kir is laid waste in a night Moab is undone. which reached to Jazer and strayed to the desert. therefore the armed men of Moab cry aloud. so are the daughters of Moab at the fords of the Arnon. let every one wail for Moab. 8 For a cry has gone round the land of Moab. and his insolence -. no shouts are raised. Prophecy – reference to Petra This text refers to the conversion of Moab and the people of what is now Jordan. from Sela. by way of the desert. 12 And when Moab presents himself. on the road to Horona'im they raise a cry of destruction. They escape out of the hands of the King of the North in the occupation but they are all persecuted for the Faith. I drench you with my tears. 4 let the outcasts of Moab sojourn among you.

11 And he will spread out his hands in the midst of it as a swimmer spreads his hands out to swim. seek righteousness. 3 I will cut off the ruler from its midst. and the survivors of my nation shall possess them. the glory of the country. Behold. amid shouting and the sound of the trumpet. because they scoffed and boasted against the people of the LORD of hosts. but the LORD will lay low his pride together with the skill of his hands. lay low. This subjugation before Messiah in the Last Days is complete. Moab and Ammon given to the people from the East – Ishmaelites/Arabs The sequence was to reduce Moab and Ammon and then bring them into subjugation to the Eastern tribes until the times of the end. that it may be remembered no more among the nations. Prophecy – Last Days Zephaniah 2:1-3." says the LORD of hosts. because he burned to lime the bones of the king of Edom. he will famish all the gods of the earth. and it shall devour the strongholds of Ker'ioth. before there comes upon you the day of the wrath of the LORD. "Moab shall become like Sodom. even to the dust. 3 Seek the LORD. and the Ammonites like Gomor'rah. No promises of Moab’s survival In that subjugation their identity as nations would be blurred. the God of Israel. 12 And the high fortifications of his walls he will bring down. Amos 2:1-3 Thus says the LORD: "For three transgressions of Moab. yea. all you humble of the land. 2 before you are driven away like the drifting chaff. Then they will know that I am the LORD. Divine Judgment of the Last Days . the house of Judah is like all the other nations. and to him shall bow down. God warns them and then states what He will do with them. and Moab shall be trodden down in his place. and for four. 2 So I will send a fire upon Moab." 10 This shall be their lot in return for their pride. who do his commands. and will slay all its princes with him. and Kiriatha'im. each in its place. O shameless nation. Against Moab and Ammon 8 "I have heard the taunts of Moab and the revilings of the Ammonites. as I live. a land possessed by nettles and salt pits. 10 I will give it along with the Ammonites to the people of the East as a possession. before there comes upon you the fierce anger of the LORD. and Moab shall die amid uproar." says the LORD. Isaiah 25:10-12 For the hand of the LORD will rest on this mountain. as straw is trodden down in a dung-pit. 9 Therefore. and a waste for ever. and cast to the ground. perhaps you may be hidden on the day of the wrath of the LORD. seek humility. Beth-jesh'imoth. all the lands of the nations. Ba'al-me'on. Ezekiel 25:8-11 "Thus says the Lord GOD: Because Moab said. 9 therefore I will lay open the flank of Moab from the cities on its frontier. The remnant of my people shall plunder them. 8-11 Come together and hold assembly. how they have taunted my people and made boasts against their territory. I will not revoke the punishment. 11 The LORD will be terrible against them. 11 and I will execute judgments upon Moab.

to till it and dwell there. it does not refer to that as we see here. with the result that you will be removed far from your land. And after them the king of Babylon shall drink. your diviners. a hissing and a curse. and I have given him also the beasts of the field to serve him. this word came to Jeremiah from the LORD. 27 "Then you shall say to them. your dreamers. and put them on your neck. I will leave on its own land. The entire Kings of the North are to be summoned against Jerusalem. said to me: "Take from my hand this cup of the wine of wrath. who are saying to you. This was first done when Babylon was conquered by the Medes and Persians. I begin to work evil at the city which is called by my name. 24 all the kings of Arabia and all the kings of the mixed tribes that dwell in the desert. says the LORD of hosts. and I will drive you out. Jeremiah 25:15-29 Thus the LORD. Moab. 23 Dedan. and all who cut the corners of their hair. and you will perish. 11 But any nation which will bring its neck under the yoke of the king of Babylon and serve him. 8 "`"But if any nation or kingdom will not serve this Nebuchadnez'zar king of Babylon. fall and rise no more. 3 Send word to the king of Edom. because of the sword which I am sending among you. Ekron. the God of Israel.' This prophecy covers from Egypt to Arabia and the end of the Persian Empire. We are speaking of a religious and administrative system in the Last Days being brought into subjection and destroyed. then you shall say to them. and put its neck under the yoke of the king of Babylon. as foretold in Daniel Chapter 2. 21 Edom. However. king of Judah. 7 All the nations shall serve him and his son and his grandson. 22 all the kings of Tyre. `You shall not serve the king of Babylon. and with pestilence. until the time of his own land comes. says the LORD. his servants. 19 Pharaoh king of Egypt. to make them a desolation and a waste. and make all the nations to whom I send you drink it. with the men and animals that are on the earth. and all the kingdoms of the world which are on the face of the earth. and made all the nations to whom the Lord sent me drink it: 18 Jerusalem and the cities of Judah. be drunk and vomit. Babylon was conquered but here it is still the dominant factor. the king of Babylon. or your sorcerers. Gaza. until I have consumed it by his hand. then many nations and great kings shall make him their slave. Buz. my servant. its kings and princes. as at this day. 16 They shall drink and stagger and be crazed because of the sword which I am sending among them. far and near. all the kings of Elam. and the kings of the coastland across the sea. all the kings of the land of Uz and all the kings of the land of the Philistines (Ash'kelon."'" . with famine. 6 Now I have given all these lands into the hand of Nebuchadnez'zar. and I give it to whomever it seems right to me. and the king of Sidon by the hand of the envoys who have come to Jerusalem to Zedeki'ah king of Judah. I will punish that nation with the sword. and the sons of Ammon. all his people.' 10 For it is a lie which they are prophesying to you. `Thus says the LORD of hosts: You must drink! 29 For behold. his princes. Order of Captivity: Babylon and then through the nations Jeremiah 27:1-11 In the beginning of the reign of Zedeki'ah the son of Josi'ah. 2 Thus the LORD said to me: "Make yourself thongs and yoke-bars. for I am summoning a sword against all the inhabitants of the earth." 17 So I took the cup from the LORD's hand. 4 Give them this charge for their masters: `Thus says the LORD of hosts. the king of Moab. one after another. and all the kings of Media. the king of the sons of Ammon. your soothsayers. 26 all the kings of the north. Tema.' 28 "And if they refuse to accept the cup from your hand to drink. and the remnant of Ashdod). says the LORD. `Thus says the LORD of hosts. 20 and all the foreign folk among them. the God of Israel: This is what you shall say to your masters: 5 "It is I who by my great power and my outstretched arm have made the earth. 25 all the kings of Zimri. all the kings of Sidon. the God of Israel: Drink. and shall you go unpunished? You shall not go unpunished. the king of Tyre. 9 So do not listen to your prophets.

so his taste remains in him. says the King. their confidence. `How the mighty scepter is broken. you also shall be taken. and Chemosh shall go forth into exile. the days are coming. when I shall send to him tilters who will tilt him. all you who are round about him. 19 Stand by the way and watch. O inhabitant of Dibon! For the destroyer of Moab has come up against you. From then Messiah reigns and hands the Kingdom back to God and God becomes all in all. and cursed is he who keeps back his sword from bloodshed. a cry is heard as far as Zo'ar. 10 "Cursed is he who does the work of the LORD with slackness. . for she would fly away. The real reason that God dealt with Moab was idolatry and the horrors of Chemosh.Compare Daniel Chapter 2 God decreed that this system would rule until the end of days and be replaced by the Messiah. 5 For at the ascent of Luhith they go up weeping. Thus says the LORD of hosts. In Heshbon they planned evil against her: `Come. it is taken. the valley shall perish. says the LORD. as the house of Israel was ashamed of Bethel. 2 the renown of Moab is no more. 3 "Hark! a cry from Horona'im. shall be brought to silence. Jeremiah 48:1-47 Concerning Moab. for at the descent of Horona'im they have heard the cry of destruction. 14 "How do you say. But their corruption in adopting Hadithic Islam has not helped them either. and break his jars in pieces. O inhabitant of Aro'er! Ask him who flees and her who escapes. 16 The calamity of Moab is near at hand and his affliction hastens apace. and his scent is not changed. and the choicest of his young men have gone down to slaughter. her cities shall become a desolation. 13 Then Moab shall be ashamed of Chemosh. and all who know his name. and sit on the parched ground. which is the last empire of the Last Days. 11 "Moab has been at ease from his youth and has settled on his lees. From the head of gold. the glorious staff. and empty his vessels. 12 "Therefore. They are still corrupt. nor has he gone into exile. the sword shall pursue you. 8 The destroyer shall come upon every city. and the plain shall be destroyed. the fortress is put to shame and broken down. the God of Israel: "Woe to Nebo. 9 "Give wings to Moab. let us cut her off from being a nation!' You also. with his priests and his princes. as the LORD has spoken. and to the Holy Roman or Trinitarian Empire ruling from Europe. Message about Moab God revealed through Jeremiah a number if things that would happen concerning Moab. he has destroyed your strongholds. and no city shall escape. to Hellenised systems. because you trusted in your strongholds and your treasures. `Desolation and great destruction!' 4 Moab is destroyed. behold. O Madmen. he has not been emptied from vessel to vessel. whose name is the LORD of hosts. 6 Flee! Save yourselves! Be like a wild ass in the desert! 7 For. to the Romans. which is finally smashed by the stone uncut by human hands which falls from Heaven and strikes this empire of the feet of iron and clay. for it is laid waste! Kiriatha'im is put to shame. which was Babylon. 17 Bemoan him. say.' 18 "Come down from your glory. with no inhabitant in them. we saw a sequence of kingdoms degenerating in the purity of their systems through Medes and Persians to Greco-Macedonian. `We are heroes and mighty men of war'? 15 The destroyer of Moab and his cities has come up.

27 Was not Israel a derision to you? Was he found among thieves. wail and cry! Tell it by the Arnon. and Beth-me'on. for it is broken. I have made the wine cease from the wine presses. 35 And I will bring to an end in Moab. and Nebo. and his arm is broken. and spread his wings against Moab. 29 We have heard of the pride of Moab -. and snare are before you. 34 "Heshbon and Ele-a'leh cry out. for a fire has gone forth from Heshbon. as far as Jahaz they utter their voice. for I have broken Moab like a vessel for which no one cares. 43 Terror. says the LORD. his pride. the crown of the sons of tumult. and his arrogance. O vine of Sibmah! Your branches passed over the sea. Restoration of Moab Jordan is to be restored in the latter days. 44 He who flees from the terror shall fall into the pit. 21 "Judgment has come upon the tableland. 32 More than for Jazer I weep for you. Daniel 11:40-45 "At the time of the end the king of the south shall attack him. O inhabitant of Moab! says the LORD. him who offers sacrifice in the high place and burns incense to his god. 36 Therefore my heart moans for Moab like a flute. So we see that in order to rid the lands and the sons of Lot and Edom from idolatry they had to be sent into captivity. 38 On all the housetops of Moab and in the squares there is nothing but lamentation. 24 and Ker'i-oth. upon your summer fruits and your vintage the destroyer has fallen. 22 and Dibon. and all the cities of the land of Moab. says the LORD." 40 For thus says the LORD: "Behold. pit. says the LORD. so that Moab shall wallow in his vomit. it has destroyed the forehead of Moab. upon Holon. for the men of Kir-he'res I mourn. yet God makes a promise of Restoration in the Last Days. 26 "Make him drunk. and dwell in the rock. O Moab! The people of Chemosh is undone.he is very proud -. Ammon and Edom. and the haughtiness of his heart. For I will bring these things upon Moab in the year of their punishment. and Meph'a-ath. his boasts are false. 42 Moab shall be destroyed and be no longer a people. and he who climbs out of the pit shall be caught in the snare. `What has happened?' 20 Moab is put to shame. 37 "For every head is shaved and every beard cut off. upon all the hands are gashes. one shall fly swiftly like an eagle. says the LORD. his deeds are false. far and near. a flame from the house of Sihon. O inhabitants of Moab! Be like the dove that nests in the sides of the mouth of a gorge. This will be the end result for Moab. say. that Moab is laid waste. from Zo'ar to Horona'im and Eg'lath-shelish'iyah. The heart of the warriors of Moab shall be in that day like the heart of a woman in her pangs. 47 Yet I will restore the fortunes of Moab in the latter days. and my heart moans like a flute for the men of Kir-he'res. says the LORD. 46 Woe to you. and Bozrah. and he too shall be held in derision. 39 How it is broken! How they wail! How Moab has turned his back in shame! So Moab has become a derision and a horror to all that are round about him. 33 Gladness and joy have been taken away from the fruitful land of Moab. and Jahzah. therefore the riches they gained have perished." Thus far is the judgment on Moab. no one treads them with shouts of joy.of his loftiness. that whenever you spoke of him you wagged your head? 28 "Leave the cities. because he magnified himself against the LORD. 23 and Kiriatha'im. 41 the cities shall be taken and the strongholds seized. says the LORD. They were given into the hands of the tribes of the East to rid themselves of Chemosh and of Milcom in Ammon. and your daughters into captivity. 30 I know his insolence. and Beth-ga'mul. reached as far as Jazer. because he magnified himself against the LORD. but the king of the north shall rush upon him like a whirlwind. and Beth-diblatha'im. For the waters of Nimrim also have become desolate. 25 The horn of Moab is cut off. for your sons have been taken captive. the shouting is not the shout of joy. 31 Therefore I wail for Moab. 45 "In the shadow of Heshbon fugitives stop without strength. and with many . They will be delivered from Hadithic Islam as they were delivered from Chemosh. with chariots and horsemen. I cry out for all Moab. and on the loins is sackcloth.

e. 11) and of David (2Sam. Sihon was said to have been found by the Israelites.whence the designation "city of waters" The city of Amman. the Ammonites are supposed to have been expelled by Sihon. 41 He shall come into the glorious land. Ptolemy Philadelphus changed its name to Philadelphia.org/wiki/Ammon The International Standard Bible Encyclopedia states: We know from the records of Egypt. [For Kedar see also the paper Descendants of Abraham Part III: Ishmael (No. This may account for the cruel treatment meted out to them in the war that followed (2Sam. situated on both sides of a branch of the Jabbok. it may have met that of the king of Geshur. 10). the metropolis of the Ammonites. on the north. where it flows from south to north. They were defeated. called Rabbathammana by the later Greeks. the river of Ammon -. By this invasion. after their deliverance from Egypt. and some of them settled east of the Jordan. and on the east it may have melted away into the desert peopled by Kedarites and other nomadic tribes. as in the days of Saul (1Sam. and the Libyans and the Ethiopians shall follow in his train. that is. On the south. yet he shall come to his end. especially Tell el-Amarna Letters. Israel helped Ammonites by destroying their old enemies. in possession of Gilead. . the whole country on the left bank of the Jordan. i. claiming that the latter had deprived them of their territory when they came from Egypt. the Ammonites were driven out of Gilead across the upper waters of the Jabbok. 45 And he shall pitch his palatial tents between the sea and the glorious holy mountain. and their conduct toward the Israelites was particularly shameful. 44 But tidings from the east and the north shall alarm him. Thus. http://en. They were pressed on the north by the Hittites who forced them upon the tribes of the south. 43 He shall become ruler of the treasures of gold and of silver. 212C)] The chief city of the country was Rabbah or Rabbath Ammon. And tens of thousands shall fall. 11:1-28). Jordan is located on roughly the same site. and he shall go forth with great fury to exterminate and utterly destroy many. and made it a large and strong city with an acropolis. which continued to be their western boundary. and all the precious things of Egypt. ships. 42 He shall stretch out his hand against the countries. BC). but their hostility did not cease.wikipedia. whereas it was the possessions of the Amorites they took (Jdg. with none to help him. and this makes their conduct at a later period the more reprehensible. and he shall come into countries and shall overflow and pass through. In the days of Jephthah they oppressed the Israelites east of the Jordan. AMMON Territory From their original territory. the approximate date of the Amorite invasion (14th and 13th centuries. but these shall be delivered out of his hand: Edom and Moab and the main part of the Ammonites. king of the Amorites. 12:26-31). to the north of the Arnon. today known as Nahr `Amman. and the land of Egypt shall not escape. it probably adjoined the land of Moab.

and David slew of the Syrians the men of seven hundred chariots. "I will deal loyally with Hanun the son of Nahash. then I will come and help you.org/enc/isb/view. 25:22-26. he chose some of the picked men of Israel. he sent Jo'ab and all the host of the mighty men. and came to Helam. for Nahash of Rabbah showed kindness to him when a fugitive (2Sam. "Remain at Jericho until your beards have grown. and let us play the man for our people. "If the Syrians are too strong for me. he sent to meet them. 3 But the princes of the Ammonites said to Hanun their lord. And the Syrians arrayed themselves against David. twelve thousand men. so . he gathered all Israel together. because David has sent comforters to you. and their opposition to the Jews did not cease with the establishment of the latter in Judea. And David's servants came into the land of the Ammonites. 12 Be of good courage. twenty thousand foot soldiers. In the days of Jehoshaphat they joined with the Moabites in an attack upon him. http://www. with Shobach the commander of the army of Hadade'zer at their head. but met with disaster (2 Chronicles 20). and to overthrow it?" 4 So Hanun took David's servants. 15 But when the Syrians saw that they had been defeated by Israel. and the men of Tob. Jeremiah 40:14) was a dastardly act. and when the Syrians of Damascus deprived the kingdom of Israel of their possessions east of the Jordan. for the men were greatly ashamed. the Ammonites became subjects of Benhadad. and the Syrians of Zobah. and then return. and cut off their garments in the middle. 10 the rest of his men he put in the charge of Abi'shai his brother. Their murder of Gedaliah (2Kgs. 5 When it was told David. and the king of Ma'acah with a thousand men. 9 When Jo'ab saw that the battle was set against him both in front and in the rear. and their destruction by Jeremiah 49:1-6. and crossed the Jordan. 4). and came to Jerusalem. that he is honoring your father? Has not David sent his servants to you to search the city. 17 And when it was told David. at their hips. and fought with him. 2 And David said. Tobiah the Ammonites united with Sanballat to oppose Ne (Neh. and they came to Helam. they gathered themselves together.studylight. and may the LORD do what seems good to him. but if the Ammonites are too strong for you. and they fled before him. and for the cities of our God. and forty thousand horsemen. 17:27-29). Ezekiel 21:28-32.They seem to have been completely subdued by David and their capital was taken. and entered the city. 18 And the Syrians fled before Israel. the Ammonites sent and hired the Syrians of Beth- re'hob. Zechariah 2:8. 16 And Hadade'zer sent. they likewise fled before Abi'shai. and we find a better spirit manifested afterward. and to spy it out. and arrayed them against the Syrians. 11 And he said. They paid tribute to Jotham (2 Chronicles 27:5). and the men of Tob and Ma'acah. on the division of the kingdom. were by themselves in the open country." So David sent by his servants to console him concerning his father. and he arrayed them against the Ammonites. Judah and Israel. Their country came into the possession of Jeroboam. 8 And the Ammonites came out and drew up in battle array at the entrance of the gate. Their cruelty is denounced by the prophet Amos 1:13. Their hostility to both kingdoms. 14 And when the Ammonites saw that the Syrians fled. and brought out the Syrians who were beyond the Euphra'tes. "Do you think.9. and shaved off half the beard of each. and the Syrians of Zobah and of Rehob. was often manifested." 6 When the Ammonites saw that they had become odious to David. And the king said.cgi?number=T475 David defeats the Ammonites 2Samuel 10:1-19 After this the king of the Ammonites died. and Hanun his son reigned in his stead. Then Jo'ab returned from fighting against the Ammonites. and wounded Shobach the commander of their army. as his father dealt loyally with me. then you shall help me. 7 And when David heard of it. and sent them away." 13 So Jo'ab and the people who were with him drew near to battle against the Syrians.

(cf. `Who will come against me?' 5 Behold. O faithless daughter. Jeremiah 49:1-6 Concerning the Ammonites. Prophecy – Exclusion from the assembly The exclusion of Moab and Ammon from the congregation was because of their idolatry. behold. Deuteronomy 23:3-6 "No Ammonite or Moabite shall enter the assembly of the LORD. but the LORD your God turned the curse into a blessing for you. 4 Why do you boast of your valleys. 3 "Wail. who trusted in her treasures. from all who are round about you. 5 Nevertheless the LORD your God would not hearken to Balaam. with his priests and his princes. when I will cause the battle cry to be heard against Rabbah of the Ammonites. to curse you. They had to be sent into captivity for centuries to deal with that idolatry. they made peace with Israel. They were a horrific version of the Baal sacrifices where children were sacrificed and then immolated in order to appease the gods of the grain. when you came forth out of Egypt. 6 You shall not seek their peace or their prosperity all your days for ever. 4 because they did not meet you with bread and with water on the way. and became subject to them. The Phoenicians were also followers of this form of god of the sacrifices and they joined with the sons of Esau in this practice (cf. says the LORD. and run to and fro among the hedges! For Milcom shall go into exile. says the LORD. as we saw the God of Moab was Chemosh. In names such as Malcom. saying. James/Shamus/Saun (for Shams the sun god/goddess). 11:7).19:1-19) The Bible set the sequence of conquest from David but that was to point forwards to the times of the end in the Last Days and to the coming of the Messiah. I will bring terror upon you. for Ai is laid waste! Cry. says the Lord GOD of hosts. the days are coming. and its villages shall be burned with fire. Milcom and Chemosh are to be destroyed. and you shall be driven . that he died there. oil and wine. The ancient gods of the Middle East were carried in with the tribes to Europe. Thus says the LORD: "Has Israel no sons? Has he no heir? Why then has Milcom dispossessed Gad. which is what Islam has become through the corruption by the Hadith. Gods of the sons of Lot Lot’s sons went after strange gods they developed in the land. O daughters of Rabbah! Gird yourselves with sackcloth. and because they hired against you Balaam the son of Be'or from Pethor of Mesopota'mia. Only at the return of the Messiah will they be truly healed and free of their idolatry. The god of Ammon was Milcom. even to the tenth generation none belonging to them shall enter the assembly of the LORD for ever. because the LORD your God loved you. and his people settled in its cities? 2 Therefore. It was for this reason that a Moabite man could not enter the congregation of the Lord God of Israel. also 1Chr. then Israel shall dispossess those who dispossessed him. it shall become a desolate mound. lament. 19 And when all the kings who were servants of Hadade'zer saw that they had been defeated by Israel. So the Syrians feared to help the Ammonites any more. 1Kgs. O Heshbon.

say.' Thus they are to become part of Israel under Messiah but they are to retain their lands as part of that final alliance. Israel was expressly forbidden to disturb their inheritance." Ezekiel 25:1-11 The word of the LORD came to me: 2 "Son of man.' 20 (That also is known as a land of Reph'aim. when he destroyed the Horites before them. son of man. `Aha!' over my sanctuary when it was profaned. that is. every man straight before him. Restoration and Reconciliation As with Moab. Rabbah and Ammon are to be reconciled. 31 And I will pour out my indignation upon you. and settled in their stead even to this day. to all the banks of the river Jabbok and the cities of the hill country. Thus says the Lord GOD concerning the Ammonites. whose day has come. in the land of your origin. and I will deliver you into the hands of brutal men. the time of their final punishment. Israel forbidden to disturb the inheritance of Lot In spite of the punishment of the sons of Lot. it is polished to glitter and to flash like lightning -. who live in Se'ir. your blood shall be in the midst of the land. and prophesy against them. do not harass them or contend with them. 28-32 mark a way for the sword to come to Rabbah of the Ammonites and to Judah and to Jerusalem the fortified. because I have given it to the sons of Lot for a possession." Inheritance of Ammon Deuteronomy 2:16-22 "So when all the men of war had perished and were dead from among the people. 37 Only to the land of the sons of Ammon you did not draw near. 18 `This day you are to pass over the boundary of Moab at Ar. and wherever the LORD our God forbade us. 32 You shall be fuel for the fire. That was the blessing of God to Abraham. 17 the LORD said to me. while they divine lies for you -. for I will not give you any of the land of the sons of Ammon as a possession. do not harass them or contend with them. prophesy. Abraham honoured Lot’s choice of lands. and over the land of Israel when it was made . with none to gather the fugitives. Hear the word of the Lord GOD: Thus says the Lord GOD. Deuteronomy 2:19. and they dispossessed them. set your face toward the Ammonites. In the place where you were created.to be laid on the necks of the unhallowed wicked. 28 "And you. 3 Say to the Ammonites. I will blow upon you with the fire of my wrath. out.29 while they see for you false visions. Ammon is also to be restored. 37 and when you approach the frontier of the sons of Ammon. I will judge you. 30 Return it to its sheath. because I have given it to the sons of Lot for a possession. but the LORD destroyed them before them. and concerning their reproach. 19 and when you approach the frontier of the sons of Ammon. but the Ammonites call them Zamzum'mim. for I will not give you any of the land of the sons of Ammon as a possession. a sword is drawn for the slaughter. and Lot was both his nephew and his adopted son. Reph'aim formerly lived there. A sword. and they dispossessed them. and tall as the Anakim. and say. for I the LORD have spoken. 22 as he did for the sons of Esau. Ezekiel 21:20. skilful to destroy. and settled in their stead. Because you said. 21 a people great and many. says the LORD. 6: But afterward I will restore the fortunes of the Ammonites. you shall be no more remembered.

and I will cut you off from the peoples and will make you perish out of the countries. which is the capital of Jordan. and will hand you over as spoil to the nations. behold. Amos 1:13-15 Thus says the LORD: "For three transgressions of the Ammonites. Beth-jesh'imoth. The remembrance is only of Ammon. 7 therefore. 10 I will give it along with the Ammonites to the people of the East as a possession. Daniel 11:41 He shall come into the glorious land. Ammon and Moab and the Amorites Prophecy says that Ammon and Moab and the main part of the Amorites shall escape out of the hand of the King of the North. 9 therefore I will lay open the flank of Moab from the cities on its frontier. and they shall drink your milk. Remember Amalek is also a descendant of Abraham. Then you will know that I am the LORD. and it shall devour her strongholds. he and his princes together. Their king in the Last Days will be the Messiah who comes. Restoration of the Last Days Zephaniah 2:8-11 "I have heard the taunts of Moab and the revilings of the Ammonites. 6 For thus says the Lord GOD: Because you have clapped your hands and stamped your feet and rejoiced with all the malice within you against the land of Israel. of Ishmael and Amalek and others." . 8 "Thus says the Lord GOD: Because Moab said." says the LORD. It is under the Kingdom of Jordan. 14 So I will kindle a fire in the wall of Rabbah. as I live. with shouting in the day of battle. in the name of Amman. Then they will know that I am the LORD. and Kiriatha'im. and they shall set their encampments among you and make their dwellings in your midst. 15 and their king shall go into exile. that they might enlarge their border. as we see above. they shall eat your fruit. and over the house of Judah when it went into exile. and it was given with Ammon to the Arab nation and was joined with Ammon. 4 therefore I am handing you over to the people of the East for a possession. 11 and I will execute judgments upon Moab. Moab was no longer to be named. Together with Edom and the Midianites they made up the Shepherd Kings of the Hyksos in Egypt. This royal family extended from Damascus to Iraq after WWII and was replaced by the republic there under the Baath party and Saddam Hussein. the house of Judah is like all the other nations. and for four. because they have ripped up women with child in Gilead. desolate. the glory of the country. These are the Arabs. I will not revoke the punishment. with a tempest in the day of the whirlwind. how they have taunted my people and made boasts against their territory. 5 I will make Rabbah a pasture for camels and the cities of the Ammonites a fold for flocks. I will destroy you. I have stretched out my hand against you. but Moab carries no remembrance. that it may be remembered no more among the nations. Then you will know that I am the LORD. Ba'al-me'on. And tens of thousands shall fall. but these shall be delivered out of his hand: Edom and Moab and the main part of the Ammonites. Behold. 9 Therefore. the younger. which will be placed under Messiah as King in the near future.

14:7). 8:20). 5:65). was taken by Judas Maccabees in 165 BC (1 Macc 4:29. David prosecuted the war with terrific energy.000 Edomites (so read instead of "Syrians") in the Valley of Salt (2Sam. their chief city. he will famish all the gods of the earth. as indicated in Numbers 34:3 f: a line running from the Salt Sea southward of the Ascent of Akrabbim to Zin and Kadesh-barnea. yea. 11 The LORD will be terrible against them. which was garrisoned by Israelites. Samaria and Galilee by Julius Caesar.61. Seir with its capital Petra fell into the hands of the Nabateans. Hebron. Ezek. says the LORD of hosts. Edom revolted. but was unable to quell the rebellion (2Kgs. ESAU/EDOM From The International Standard Bible Encyclopedia The boundaries of Edom may be traced with some approach to accuracy. or Wady el-Chasa. 14:47). 11:14. The southern border ran by Elath and Ezion-geber (Deut. because they scoffed and boasted against the people of the LORD of hosts. On the East it marched with the desert. and exulted in the destruction of Jerusalem. and later became a source of trouble to Solomon (1Kgs. The Edomites pressed into the now empty lands in the South of Judah. 14:22). 11:15). Hadad of the blood royal of Edom escaped to Egypt.studylight. On the East of the `Arabah the northern border ran from the Dead Sea. was made procurator of Judea. we are told. lay in the "uttermost" of the border of Edom (Num. all the lands of the nations. "until he had cut off every male in Edom" (1Kgs.cgi?number=T2891 . Amaziah invaded the country. The line may be generally indicated by the course of Wady el-Fiqrah.org/enc/isb/view. 2:8).000 in the Valley of Salt. each in its place. Joab remaining for six months in the country. On the West of the `Arabah the north boundary of Edom is determined by the south border of Israel. and took Sela which he named Joktheel (2Kgs. a land possessed by nettles and salt pits. the God of Israel. 1:10). stirring the bitterest indignation in the hearts of the Jews (Lam. How much of the uplands West of the `Arabah southward to the Gulf of `Aqaba was included in Edom it is impossible to say. and was marked by Wady el-Kurachi. slew 10. 4:21. and the Ammonites like Gomor'rah. governor of Idumaea. With the fall of Judah under the Romans. Uzziah restored the Edomite port of Elath (2Kgs. In 300 BC Mt. slaying 18. 25:12. "Moab shall become like Sodom. Idumaea and the Idumeans West of the `Arabah the country they occupied came to be known by the Greek name Idumaea.25). Jehoram defeated them at Zair. This last. Obad. In 126 BC the country was subdued by John Hyrcanus. Antipater. and a waste for ever. 35:3. Under Jehoram son of Jehoshaphat. and the survivors of my nation shall possess them. 20:16). He paved the way to the throne for his son Herod the Great. and to him shall bow down. http://www. Idumaea disappears from history. History We first hear of war between Israel and Edom under Saul (1Sam. 8:13). and the people as Idumeans. The remnant of my people shall plunder them. who compelled the people to become Jews and to submit to circumcision." 10 This shall be their lot in return for their pride. They gave what help they could to Nebuchadnezzar.

Because the region was part mountainous. From Obad 1:9 we gather that Teman was in the land of Esau (Edom). 1 Ch 1:45). 22 The children struggled together within her. being "completed" and not infantile. Genesis 23:21-23 And Isaac prayed to the LORD for his wife. "south". and two peoples. and the twin brother of Jacob.Esau first-born of Isaac and Rebekah Esau was the eldest son of Isaac and Rebekah. why do I live?" So she went to inquire of the LORD. Teman must be sought in the North Eusebius. and Rebekah his wife conceived. the son of his firstborn. A duke Teman is named among the chiefs or clans of Edom (Gen 36:42.te'-man (teman. "on the right. because she was barren. it was also known as "the mountains of Esau" or "the mountain of Seir" (Obad. Edom (Gen. now by itself. Thaiman): The name of a district and town in the land of Edom. 15 miles from Petra. "Two nations are in your womb. shows how important it must have been in their time. 1 Ch 1:36). The root of the name in Hebrew is derived from the word asuy denoting "completion". the elder shall serve the younger. Onomasticon knows a district in the Gebalene region called Theman." i. The Temani extended east also as did the other tribes into other nations. Unfortunately no indication of direction is given. The manner in which the city is mentioned by the prophets. born of you. and again as standing for Edom. and left it to his brother and dwelt in Seir. and called the country after his own name. W. and also a town with the same name.e.21). TEMAN [ISBE] TEMAN . In Am 1:12 it is named along with Bozrah. made and complete. Eliphaz the Temanite was chief of the comforters of Job (2:11. Ezek. They are mentioned in conjunction with Dedan in the south of Edom. and she said.19. In Ezek 25:13 desolation is denounced upon Edom: "From Teman even unto Dedan shall they fall by the sword. and the LORD granted his prayer. He does not however appear first. shall be divided. 32:3). Adom/Edom in Hebrew means red but the Greeks named it Idumea (Isa. Obad 1:8 f). The inhabitants of Teman seem to have been famous for their wisdom (Jer 49:7.). 34:5-6. the capital of Edom. the Lord told Rebekah that her older son would serve the younger son. The southern part of Edom was known as Teman." Dedan being in the South. No trace of the name has yet been found. It was also known as "the field of Edom" (Gen. 23 And the LORD said to her. etc. "If it is thus. It may have been on the road from Elath to Bozrah. Eliphaz (Gen 36:11. named after Teman the grandson of Esau. Husham of the land of the Temanites was one of the ancient kings of Edom (Gen 36:34.9. The ISBE has this to say about them. since Esau was born hairy and very strong. in the place of the firstborn. 1 Ch 1:53). 35:15). occupied by a Roman garrison. 36:16)." Esau departed from the city of Hebron. Prophecy concerning Edom Before Esau's birth. Ewing . the one shall be stronger than the other. 1:8.

2 Esau took his wives from the Canaanites: Adah the daughter of Elon the Hittite. 40 By your sword you shall live." 36 Esau said. and said to his father. 8 So Esau dwelt in the hill country of Se'ir. it was also in the east and separated from the hills of Paran by the Arabah. he cried out with an exceedingly great and bitter cry. Genesis 36: The Family of Esau Esau married three wives: Adah. 39 Then Isaac his father answered him: "Behold." 41 Now Esau hated Jacob because of the blessing with which his father had blessed him. and all the members of his household. Oholiba'mah the daughter of Anah the son of Zib'eon the Hivite. Oholibamah/Judith and Basemath/Mahalath. Bas'emath bore Reu'el. 9 These are the descendants of Esau the father of the E'domites in the hill country of Se'ir." And Esau lifted up his voice and wept. These woman were also known by a second name: Adah/Bashemath. O my father!" 35 But he said. and Esau said to himself. He took away my birthright. Jalam. and away from the dew of heaven on high. and he went into a land away from his brother Jacob. These are the sons of Esau who were born to him in the land of Canaan. and all his property which he had acquired in the land of Canaan." This prophecy was to be fulfilled when the Edomites were conquered by Judah under John Hyrcanus in the Second Century BCE. but when you break loose you shall break his yoke from your neck. now he has taken away my blessing. the sister of Neba'ioth. away from the fatness of the earth shall your dwelling be.Whilst Teman was in the North near Petra. and behold. and you shall serve your brother. "Behold. Esau is Edom. thus extending around Edom to Dedan. and they were absorbed into Judah in Judea as opposed to Judah in Galilee. Oholibamah and Basemath. O my father. my father? Bless me. all his beasts. and Korah. 4 And Adah bore to Esau. 5 and Oholiba'mah bore Je'ush. "The days of mourning for my father are approaching. even me also. The Edomites also mingled with the Phoenicians. We will see more of this later (see also the paper War with Rome and the Fall of the Temple (No. "Have you not reserved a blessing for me?" 37 Isaac answered Esau. Edom). my son?" 38 Esau said to his father. and all his brothers I have given to him for servants. and with grain and wine I have sustained him. Herod was an Edomite of the Hasmoneans. then I will kill my brother Jacob. the land of their sojournings could not support them because of their cattle. Ish'mael's daughter." Then he said. "Have you but one blessing. his cattle. I have made him your lord. 3 and Bas'emath. "Your brother came with guile. . What then can I do for you. Isaac’s blessing to Esau Genesis 27:34-41 When Esau heard the words of his father. "Bless me. 298)). "Is he not rightly named Jacob? For he has supplanted me these two times. and he has taken away your blessing. 6 Then Esau took his wives. El'iphaz. Esau’s sons These are the descendants of Esau (that is. his daughters. 7 For their possessions were too great for them to dwell together. even me also. his sons.

18 These are the sons of Oholiba'mah. 15 These are the chiefs of the sons of Esau. Sons of Eliphaz – Esau’s grandsons and chiefs Teman (SHD 8487. Zepho. and these are their chiefs. 14:6. Shammah. The sons of El'iphaz the first-born of Esau: the chiefs Teman. Gatam. and Kenaz. 17 These are the sons of Reu'el. Esau's son: the chiefs Nahath. Esau's wife. Esau's wife. 13 These are the sons of Reu'el: Nahath. Omar. these are the chiefs of El'iphaz in the land of Edom. these are the chiefs born of Oholiba'mah the daughter of Anah. and Korah. Zepho. Esau's son.e. 2:12). they are the sons of Adah. Zerah. Shammah. 12 (Timna was a concubine of El'iphaz. from 8486) meaning from the south (being on the right-hand side of a person facing east) Omar (SHD 201): talkative Zepho (SHD 6825): observant Gatam (SHD 1609): uncertain derivation Kenaz (SHD 7073): to hunt. hunter . Zerah. smooth) Esau’s grandsons 11 The sons of El'iphaz were Teman. Gatam. 19 These are the sons of Esau (that is. and Mizzah.Seir is another name for Edom. Esau's wife. Adah (1) Eliphaz: firstborn son (SHD 646) means god of gold. Bashemath (Ishmael’s daughter) (1) Reuel (SHD 7467) means friend of God Oholibamah (1) Jeush/Jehush (SHD) 3266) means hasty (2) Jalam/Jaalam (SHD 3281) occult (3) Korah (SHD) 7141 means ice (as if bald i. Edom). and Am'alek. these are the chiefs of Reu'el in the land of Edom. Esau had five sons from his three wives. These are the sons of Bas'emath. Jalam. Esau's wife. she bore Am'alek to El'iphaz. Esau's wife: the chiefs Je'ush. Jalam. and Korah.) These are the sons of Adah. 16 Korah. Deut. and Mizzah. It appears Esau’s clan must have driven away the original Horite inhabitants of Seir (Gen. Kenaz. Omar. they are the sons of Bas'emath. 14 These are the sons of Oholiba'mah the daughter of Anah the son of Zib'eon. Esau's wife: she bore to Esau Je'ush.

Jalan. according to their clans in the land of Se'ir. Ezer. and Onam. Seir is a name for the mountain and its aboriginal occupants. these are the chiefs of the Horites. his note to Gen. the sons of Se'ir in the land of Edom. 36:40 and 1Chr. Shobal. Eshban. Lotan’s sister was Timna. Their sub-tribes are thus of lesser significance in terms of prophecy. 28 These are the sons of Dishan: Uz and Aran. . 28:12-14) and also a city in Dan (Josh. and Dishan. 23 These are the sons of Shobal: Alvan. 15:10. 27 These are the sons of Ezer: Bilhan. Zib'eon. 25 These are the children of Anah: Dishon and Oholiba'mah the daughter of Anah. Gen. Timnah was also the name of a Duke of Edom (cf. The Dukes of the Horites were listed. Shepho. 24 These are the sons of Zib'eon: A'iah and Anah. Zib'eon. 26 These are the sons of Dishon: Hemdan. Sons of Seir the Horite 20 These are the sons of Se'ir the Horite. 1:51) and a city in Judah (Gen. Jdg. these are the chiefs of the Horites. and Dishan. The Horites were alleged by Bullinger to be a branch of the Nephilim (cf. and Cheran. 28:18). the inhabitants of the land: Lotan. 2Chr. 30: Dishon. 22 The sons of Lotan were Hori and Heman. Za'avan. Korah are also listed as chiefs. The name may be thus of Canaanite derivation. Anah. 14:1-5. waste Mizzah (SHD 4199): to faint with fear No grandsons from Oholibamah are listed but her sons Jeush. Ebal. Shobal. 36:20 and his Appendices 23 and 25 in The Companion Bible).Amalek (SHD 6002): descendant of Esau (from Eliphaz's concubine Timna) Sons of Reuel – Esau’s grandsons and chiefs Nahath (SHD 5184): quiet(ness) Zerah (SHD 2226): a rising of light Shammah (SHD 8040): ruin. Ithran. as he pastured the asses of Zib'eon his father. astonishment dislocate(ion). These are also termed Horites from his grandson Hori who was the son of Lotan son of Seir. 21 Dishon. What is certain is that they dwelt in the land of Edom and were the original inhabitants. Man'ahath. It might be assumed that she was the Timna who was a concubine of Eliphaz and she was the mother of Amalek but this has enormous repercussions for Esau. and Akan. Ezer. Anah. 29 These are the chiefs of the Horites: the chiefs Lotan. he is the Anah who found the hot springs in the wilderness. and Lotan's sister was Timna.

by their names: the chiefs Timna. and who had to be destroyed (see the paper The Nephilim (No. 43 Mag'diel. Emim and Zamzumim and Horim all of whom have no resurrection. YDNA easily identifies the lineages of humans today and they are all from one lineage and the mtDNA is from one female. cf. these are the chiefs of Edom (that is. Alvah. 36 Hadad died. and Ba'al-ha'nan the son of Achbor reigned in his stead. 32 Bela the son of Be'or reigned in Edom. 39 Ba'al-ha'nan the son of Achbor died. If Timna. 265)). 31 These are the kings who reigned in the land of Edom. 33 Bela died. 14:5) were as great and tall as the Anakim and accounted among the giants. according to their dwelling places . and Hadad the son of Bedad. and Iram. 35 Husham died. The Horim are in effect the same as the Horites and are thus Nephilim. Anakim. 34 Jobab died. 63)) and why God ordered the destruction of Agag and the Amalekites and why Saul was rebuked and Agag was killed by Samuel. 37 Samlah died. Deuteronomy 2:10 and 11 says that the Emim (or Terrible Ones. according to their families and their dwelling places. but the Moabites called them Emim. 38 Shaul died. From the account in Deuteronomy 2 in verse 9 the Moabites were given the lands of Ar for a possession. concubine of Eliphaz. Deuteronomy 2:12 says that the Horim also dwelt in Mt. Gen. is the sister of Lotan then she is a Horite and if indeed the Horites were Nephilim then the Amalekites are part Nephilim and the later irruptions resulted in the orders for the exterminations of some Canaanite tribes due to contamination with the Rephaim. and Shaul of Reho'both on the Euphra'tes reigned in his stead. 35:11 and Deuteronomy 17:14-20. Esau. and thus the Nephilim have been exterminated (see the paper Genetic Origin of the Nations (No.Listed as living among the Canaanites are also the Rephaim and the Anakim who were sons of Rapha and of Anak of the Nephilim. and Samlah of Masre'kah reigned in his stead. 41 Oholiba'mah. Mibzar. before any king reigned over the Israelites. who defeated Mid'ian in the country of Moab. the name of his city being Din'habah. Jetheth. the name of his city being Pau. That is why they were allowed to be destroyed by order of the king of Persia as we see in Esther (see the Commentary on Esther (No. also 1Chr. the daughter of Matred. 134)). and Jobab the son of Zerah of Bozrah reigned in his stead. The Ammonites called the Nephilim in their area Zamzumim and in the same way they destroyed them. Teman. his wife's name was Mehet'abel. Pinon. Seir before Esau took it over and destroyed them and lived in their land. the father of Edom). daughter of Me'zahab. and Husham of the land of the Te'manites reigned in his stead. Elah. reigned in his stead. and Hadar reigned in his stead. the name of his city being Avith. 42 Kenaz. The Kings of Edom Bullinger notes that verse 31 (below) refers to Genesis 17:6. 1:43-50) Chiefs descended from Esau 40 These are the names of the chiefs of Esau. (cf.

for I will not give you any of their land. these forty years the LORD your God has been with you. trembling seizes them. for he is your brother. the leaders of Moab. 1Chronicles 1:51-54 And Hadad died. 5 do not contend with them. as Israel did to the land of their possession.) Children of the third generation could be received into the congregation of Israel Deuteronomy 23:7-8 "You shall not abhor an E'domite. 54 Mag'di-el. which thou hast made for thy abode. which the LORD gave to them. The Israelites were to take over the lands that were in the hands of the Amorites. LORD. You are about to pass through the territory of your brethren the sons of Esau. Amalek had become a powerful force and they lay in the path of Israel to their Promised Land. 8 The children of the third generation that are born to them may enter the assembly of the LORD. "And we turned and went in the direction of the wilderness of Moab. The chiefs of Edom were: chiefs Timna. and Iram. and settled in their stead. not so much as for the sole of the foot to tread on. till thy people. a people great and many. away from our brethren the sons of Esau who live in Se'ir. The Lord had given the descendants of Esau and Lot (Moabites and Ammonites) their lands just as He was giving the Israelites theirs. and they will be afraid of you. till the people pass by whom thou hast purchased. and plant them on thy own mountain. Deuteronomy 2:4-12 And command the people. . away from the Arabah road from Elath and E'zion- ge'ber. because I have given Mount Se'ir to Esau as a possession. Jetheth.' 10 (The Emim formerly lived there. 52 Oholiba'mah. Mibzar. that you may eat. but the sons of Esau dispossessed them. 16 Terror and dread fall upon them. Land of Edom Moses was told to bypass Edom. Moab and Ammon because of their blood relationship to Israel. who live in Se'ir. because I have given Ar to the sons of Lot for a possession. These people will be part of the conflict against Israel all the way to the end of the Last Days and the establishment of the Kingdom of God in the Millennium. because you were a sojourner in his land. and destroyed them from before them.' 8 So we went on. 7 For the LORD your God has blessed you in all the work of your hands. 9 And the LORD said to me. 17 Thou wilt bring them in. you shall not abhor an Egyptian. 12 The Horites also lived in Se'ir formerly. O LORD. the place. which thy hands have established. Elah. they are as still as a stone. but the Moabites call them Emim. `Do not harass Moab or contend with them in battle. because of the greatness of thy arm. for I will not give you any of their land for a possession. no. Exodus 15:15-17 Now are the chiefs of Edom dismayed. and tall as the Anakim. Teman. From the Song of Moses When Israel was taken from Egypt they had become a great multitude and the sons of Lot and Esau saw them as a great threat. the sanctuary. that you may drink. pass by. you have lacked nothing. he knows your going through this great wilderness. 11 like the Anakim they are also known as Reph'aim. So take good heed. Al'iah. O LORD. and you shall also buy water of them for money. 6 You shall purchase food from them for money. all the inhabitants of Canaan have melted away. Pinon. 53 Kenaz. these are the chiefs of Edom.

O God! 2 For lo. 10 who were destroyed at En-dor. those who hate thee have raised their heads. A Psalm of Asaph. they have driven you to the border. says the LORD. 2 Behold. art the Most High over all the earth.there is no understanding of it. whose name is the LORD. would they not leave gleanings? 6 How Esau has been pillaged. let us wipe them out as a nation. O LORD. as the flame sets the mountains ablaze. do not hold thy peace or be still. whose dwelling is high. This is what the sovereign Lord says about Edom. though your nest is set among the stars. his treasures sought out! 7 All your allies have deceived you. they consult together against thy protected ones. Psalm 83 is a statement made by David of the enemies of Israel in his day. O God. "Come. like chaff before the wind. 4 They say. your confederates have prevailed against you. Edom was to be destroyed and Israel would be delivered. 5 If thieves came to you.how you have been destroyed! -- would they not steal only enough for themselves? If grape gatherers came to you. Moab and the Hagrites. 8:14). against thee they make a covenant -. you shall be utterly despised. if plunderers by night -. [Selah] 9 Do to them as thou didst to Mid'ian." 13 O my God. as to Sis'era and Jabin at the river Kishon. and David established garrisons there (2Sam. 15 so do thou pursue them with thy tempest and terrify them with thy hurricane! 16 Fill their faces with shame. do not keep silence. 0: A Song. they conspire with one accord. 14 As fire consumes the forest. you who live in the clefts of the rock. and understanding . 17 Let them be put to shame and dismayed for ever. 3 They lay crafty plans against thy people. We can notice that the same combination is against Israel today and it is thus prophecy. your trusted friends have set a trap under you -. let the name of Israel be remembered no more!" 5 Yea. Edom’s hostile activities against Israel had spanned centuries and God’s wrath was upon them. they are the strong arm of the children of Lot.6 the tents of Edom and the Ish'maelites. They remained independent until the subjugation of John Hyrcanus when they joined with Israel in part in Judea. "Let us take possession for ourselves of the pastures of God. 8 Will I not on that day. thence I will bring you down. Obadiah concerning Edom The entire book of Obadiah records an extended prophecy against Edom. make them like whirling dust. 14:47). says the LORD. Philistia with the inhabitants of Tyre. in the days of Joram. But later. An envoy was sent to the nations calling them to battle against Edom. all their princes like Zebah and Zalmun'na. thy enemies are in tumult. 18 Let them know that thou alone.In the days of Saul. who say in your heart. destroy the wise men out of Edom. 3 The pride of your heart has deceived you. 8:16-22). who became dung for the ground. 8 Assyria also has joined them. 7 Gebal and Ammon and Am'alek. the son of Ahab. the Edomites became independent of Israel (2Kgs. I will make you small among the nations. "Who will bring me down to the ground?" 4 Though you soar aloft like the eagle. Edom was made subject to Israel (1Sam. let them perish in disgrace. 12 who said. that they may seek thy name. 11 Make their nobles like Oreb and Zeeb.

out of Mount Esau? 9 And your mighty men shall be dismayed, O Teman, so that every man
from Mount Esau will be cut off by slaughter. 10 For the violence done to your brother Jacob,
shame shall cover you, and you shall be cut off for ever. 11 On the day that you stood aloof, on
the day that strangers carried off his wealth, and foreigners entered his gates and cast lots for
Jerusalem, you were like one of them. 12 But you should not have gloated over the day of your
brother in the day of his misfortune; you should not have rejoiced over the people of Judah in
the day of their ruin; you should not have boasted in the day of distress. 13 You should not have
entered the gate of my people in the day of his calamity; you should not have gloated over his
disaster in the day of his calamity; you should not have looted his goods in the day of his
calamity. 14 You should not have stood at the parting of the ways to cut off his fugitives; you
should not have delivered up his survivors in the day of distress. 15 For the day of the LORD is
near upon all the nations. As you have done, it shall be done to you, your deeds shall return on
your own head. 16 For as you have drunk upon my holy mountain, all the nations round about
shall drink; they shall drink, and stagger, and shall be as though they had not been. 17 But in
Mount Zion there shall be those that escape, and it shall be holy; and the house of Jacob shall
possess their own possessions. 18 The house of Jacob shall be a fire, and the house of Joseph a
flame, and the house of Esau stubble; they shall burn them and consume them, and there shall
be no survivor to the house of Esau; for the LORD has spoken. 19 Those of the Negeb shall
possess Mount Esau, and those of the Shephe'lah the land of the Philistines; they shall possess
the land of E'phraim and the land of Sama'ria and Benjamin shall possess Gilead. 20 The exiles
in Halah who are of the people of Israel shall possess Phoenicia as far as Zar'ephath; and the
exiles of Jerusalem who are in Sephar'ad shall possess the cities of the Negeb. 21 Saviors shall
go up to Mount Zion to rule Mount Esau; and the kingdom shall be the LORD's.
Note that at the end of this verse it says that Saviours will go up to Mt. Zion to rule Mt. Esau. This
text refers to the Messiah and the Church of the First Resurrection. They will take their place for
the millennial rule and the judgment of the nations.

Jacob loved, Esau hated
Paul explains God’s love for Jacob and hatred for Esau on the basis of election (Rom. 9:10-13).
Likewise Leah was “hated” in that Jacob loved Rachel more (Gen. 29:31-33). Also believers are to
hate their mother and father, etc. (Lk. 14:26) in the sense that they must love God more than
anyone or anything else.

Malachi 1:1-5 The oracle of the word of the LORD to Israel by Mal'achi. 2 "I have loved you,"
says the LORD. But you say, "How hast thou loved us?" "Is not Esau Jacob's brother?" says
the LORD. "Yet I have loved Jacob 3 but I have hated Esau; I have laid waste his hill country
and left his heritage to jackals of the desert." 4 If Edom says, "We are shattered but we will
rebuild the ruins," the LORD of hosts says, "They may build, but I will tear down, till they are
called the wicked country, the people with whom the LORD is angry for ever." 5 Your own
eyes shall see this, and you shall say, "Great is the LORD, beyond the border of Israel!"
This tearing down was to continue to this day and Edom is still a waste under Jordan. These days
will end and the area will become part of the land that passes to Israel with Jordan as part of the
greater nation under Messiah.

Edom refuses the Israelites passage through their country
Moses’ attempt to pass through the territory of Edom in a peaceful manner was met with
hostility.

Numbers 20:18-21 But Edom said to him, "You shall not pass through, lest I come out with the
sword against you." 19 And the people of Israel said to him, "We will go up by the highway;
and if we drink of your water, I and my cattle, then I will pay for it; let me only pass through
on foot, nothing more." 20 But he said, "You shall not pass through." And Edom came out
against them with many men, and with a strong force. 21 Thus Edom refused to give Israel
passage through his territory; so Israel turned away from him.

David makes conquest of Edom
1Chronicles 18:11-13 these also King David dedicated to the LORD, together with the silver and
gold which he had carried off from all the nations, from Edom, Moab, the Ammonites, the
Philistines, and Am'alek. 12 And Abi'shai, the son of Zeru'iah, slew eighteen thousand E'domites
in the Valley of Salt. 13 And he put garrisons in Edom; and all the E'domites became David's
servants. And the LORD gave victory to David wherever he went.
Their destiny was to become part of Israel under the Messiah.

The Lord raised up Hadad the Edomite against Solomon
They were subdued by David but used by God against Solomon when he sinned.

1Kings 11:14-16: And the LORD raised up an adversary against Solomon, Hadad the
E'domite; he was of the royal house in Edom. 15 For when David was in Edom, and Jo'ab the
commander of the army went up to bury the slain, he slew every male in Edom 16 (for Jo'ab and
all Israel remained there six months, until he had cut off every male in Edom);

Battle songs concerning conquest of Edom
Psalm 60:8-9 Moab is my washbasin; upon Edom I cast my shoe; over Philistia I shout in
triumph." 9 Who will bring me to the fortified city? Who will lead me to Edom?
To cast one’s shoe means to take possession as an estate (cf. also Psa. 108:9-10).

The Lord delivered the army of Edom into the hands of Jehoshaphat
2Chronicles 19:20-23 And the Levites, of the Ko'hathites and the Kor'ahites, stood up to praise
the LORD, the God of Israel, with a very loud voice. 20 And they rose early in the morning and
went out into the wilderness of Teko'a; and as they went out, Jehosh'aphat stood and said,
"Hear me, Judah and inhabitants of Jerusalem! Believe in the LORD your God, and you will be
established; believe his prophets, and you will succeed." 21 And when he had taken counsel
with the people, he appointed those who were to sing to the LORD and praise him in holy
array, as they went before the army, and say, "Give thanks to the LORD, for his steadfast love
endures for ever." 22 And when they began to sing and praise, the LORD set an ambush against
the men of Ammon, Moab, and Mount Se'ir, who had come against Judah, so that they were
routed. 23 For the men of Ammon and Moab rose against the inhabitants of Mount Se'ir,
destroying them utterly, and when they had made an end of the inhabitants of Se'ir, they all
helped to destroy one another.

The Edomites thus became confederates of Jehoshaphat (2Kgs. 3:8-9, 26-27).
8
Then he said, "By which way shall we march?" Jeho'ram answered, "By the way of the
wilderness of Edom." 9 So the king of Israel went with the king of Judah and the king of Edom.

And when they had made a circuitous march of seven days, there was no water for the army or
for the beasts which followed them.
26
When the king of Moab saw that the battle was going against him, he took with him seven
hundred swordsmen to break through, opposite the king of Edom; but they could not. 27 Then
he took his eldest son who was to reign in his stead, and offered him for a burnt offering upon
the wall. And there came great wrath upon Israel; and they withdrew from him and returned to
their own land.

Reading this we see that the sacrifice to Chemosh of the son of the king of Moab was followed by
great wrath coming upon Israel. We are not told how the wrath came about but God detests the
sacrifice to an idol of the Moabites. However, it seems to have rallied the Moabite troops.

Revolt in the days of Joram
Edomites were often in a state of war with the neighbouring Kings of Israel and Judah.

2Kings 8:20-22 In his days Edom revolted from the rule of Judah, and set up a king of their
own. 21 Then Joram passed over to Za'ir with all his chariots, and rose by night, and he and his
chariot commanders smote the E'domites who had surrounded him; but his army fled home. 22
So Edom revolted from the rule of Judah to this day. Then Libnah revolted at the same time.

(cf. also 2Chr. 21:8-10; 28:17)

Amaziah, king of Judah, invades the territory of Edom
Amaziah defeated Edom and then became so proud he decided to attack Israel. He was defeated
by a more worthy opponent.

2Kings 14:7-12 He killed ten thousand E'domites in the Valley of Salt and took Sela by storm,
and called it Jok'the-el, which is its name to this day. 8 Then Amazi'ah sent messengers to
Jeho'ash the son of Jeho'ahaz, son of Jehu, king of Israel, saying, "Come, let us look one
another in the face." 9 And Jeho'ash king of Israel sent word to Amazi'ah king of Judah, "A
thistle on Lebanon sent to a cedar on Lebanon, saying, `Give your daughter to my son for a
wife'; and a wild beast of Lebanon passed by and trampled down the thistle. 10 You have
indeed smitten Edom, and your heart has lifted you up. Be content with your glory, and stay at
home; for why should you provoke trouble so that you fall, you and Judah with you?" 11 But
Amazi'ah would not listen. So Jeho'ash king of Israel went up, and he and Amazi'ah king of
Judah faced one another in battle at Beth-she'mesh, which belongs to Judah. 12 And Judah was
defeated by Israel, and every man fled to his home.
The reason he did not listen was because like all corrupt people they had taken the Edomites and
then gone after their gods when they conquered them.

Amaziah threw down ten thousand men of Edom, or Seir, at the cliffs of Petra in vengeance but
God punished him with the defeat by Israel.

2Chronicles 25:11-12 But Amazi'ah took courage, and led out his people, and went to the
Valley of Salt and smote ten thousand men of Se'ir. 12 The men of Judah captured another ten
thousand alive, and took them to the top of a rock and threw them down from the top of the
rock; and they were all dashed to pieces.
This was not to end hostilities. The harsh treatment of enemies inspires greater hatred as we see
today in the Middle East. The women were taken and the gods of Edom, similar to Milcom and
Chemosh of the Ammonites and Moabites, entered Judah. Amaziah was taken in a conspiracy
against him after he fled from Jerusalem to Lachish. They sent a force there and killed him and
brought his body back to Jerusalem and buried it there in the city of Judah (2Chr. 25:25-28).

His son Uzziah was made king at 16 years of age and he sought The God (Ha Elohim, The One
True God) in the days of Zechariah and God strengthened him against the Philistines of the coast
in the cities of Gath, Jabneh (Yebah between Joppa and Ashdod) and also Ashdod. He defeated
the Arabians at Gur-Baal and Mehunims (or Maonites of the sons of Ham). The Ammonites
became tributary to him and he fortified Jerusalem with towers (2Chr. 26:1-9). Uzziah became
arrogant and took incense into the Temple of God to burn it and was resisted by Azariah and
eighty of the priests. He went out of the Temple but while the censer was in his hands he was
struck with leprosy (2Chr. 26:16-21). He was confined to a separate dwelling and Jotham his son
presided over the people and their worship from that time forward.

Jotham obeyed God and likewise made the Ammonites tributary to him while he obeyed God. He
fortified the countryside with cities and towers or castles in the forests. He reigned sixteen years
and died and was replaced by Ahaz his son who did not do what was right in the eyes of the Lord.
He walked in the ways of the kings of Israel and made Baalim or images of Baal and worshipped
them (2Chr. 28:1-8). Judah was then sent into captivity and defeated first by the Syrians and then
by Israel and many hundreds of thousands were taken captive. The prophet Oded commanded
Israel to clothe and return the captives of Judah and they did that when the army returned with
them, refusing to allow them to be kept.

Ahaz had brought Judah very low and made it weak through his idolatry and his sacrificing the
children to the gods of the Edomites and of Milcom and Chemosh. They were weakened and the
Edomites then invaded.

2Chronicles 28:17 For the E'domites had again invaded and defeated Judah, and carried away
captives.
After the Edomites plundered Judah in the east, the Philistines also invaded from the coasts and
took Beth Shemesh, Ajalon, Gederoth, Shocho, Timna and Gimzo.

This was to be a lesson and will repeat itself when Judah is in sin. So too they have lost Gaza and
the coastlands and are under pressure and attack from the east.

Israel had distressed Judah and removed a portion of the House of God and the King of Judah and
gave it to Tiglath-pileser, the King of Assyria, but the Assyrian did not assist Israel.

Ahaz, king of Judah, then sacrificed to the gods of Damascus and the Syrians. And Ahaz took the
vessels of the Temple and sealed the Temple up and cut the vessels in pieces and erected altars
to idols on every street corner in Jerusalem. He provoked God to wrath and he died and was
replaced by Hezekiah his son, who brought the land back to the Lord God in his restoration (2Chr.
28:22-27; 29:1-2).

When Judah sins it is punished. In the same way the Assyrians took Israel into captivity. Even
though they had weakened Judah and given spoil to the Assyrians the Assyrians despised them
for it.

When Judah is weak and is attacked it is because they sin. Their traditions cause them to
transgress the Laws of God and these aspects will be addressed and corrected in the Last Days.

The Lord uses Ammon, Moab and Edom to correct Israel and Judah and punishes them when they
turn from God. These nations were all to be punished and placed under Israel while it was the
vineyard of the Lord and faithful to Him. They are one people dedicated to the Lord God of
Abraham and in the end they will be together as one people. Edom is already joined to Israel in a
major way from the subjugation in the Second Century BCE.

A Jewish prophet in Babylon denounces Edom

Psalm 137:7 Remember, O LORD, against the E'domites the day of Jerusalem, how they said,
"Rase it, rase it! Down to its foundations!"

Prophecies concerning Edom
Genesis 25:23 And the LORD said to her, "Two nations are in your womb, and two peoples,
born of you, shall be divided; the one shall be stronger than the other, the elder shall serve the
younger."

Genesis 27:29,37-40 Let peoples serve you, and nations bow down to you. Be lord over your
brothers, and may your mother's sons bow down to you. Cursed be every one who curses you,
and blessed be every one who blesses you!"

and all his brothers I have given to him for servants. The question to the prophet. but when you break loose you shall break his yoke from your neck. What then can I do for you. 37 Isaac answered Esau. Numbers 24:18 Edom shall be dispossessed. The term “in Arabia” (ba’rab) has the meaning of at the sunset or the evening and carries with it the same significance as does Dumah meaning the silence. which is the Kingdom of Edom. away from the fatness of the earth shall your dwelling be. This prophecy refers to the fall of Babylon (the religious system) in the Last Days and the burdens placed on these people. and away from the dew of heaven on high. This was the Sixth burden of Isaiah and the Seventh burden follows this text concerning Arabia. Se'ir also. until they are resettled by Messiah as a part of the confederacy. The prophecy concerns Revelation 18 when Babylon is fallen and all her idols are broken and cast to the ground. shall be dispossessed." And Esau lifted up his voice and wept. 39 Then Isaac his father answered him: "Behold. I have made him your lord. my son?" 38 Esau said to his father. Isaiah seems to be using this to refer to the composite in the Last Days. We can see from this reference that Edom is interbred with Dumah as well as with Judah. inquire. Herod was an Idumean. Their lands shall form part of Israel also. while Israel does valiantly. Isaiah 11:14 But they shall swoop down upon the shoulder of the Philistines in the west. and with grain and wine I have sustained him. They have not broken loose from Israel and are in fact part of Israel. O my father. seemingly by Edom or Dumah. and you shall serve your brother. when is the dawn of the Millennial Day? When is the Shabbat of Messiah? How much . come back again. This section concerns the sons of Keturah through Midian to Dedan – a son of Midian – who had occupied the area east of Edom and were part of this confederacy. They shall put forth their hand against Edom and Moab. 40 By your sword you shall live." Dumah is held to be a shortening of Idumea. "Watchman. Some of this tribe is understood to have taken occupation of part of Mt. what of the night? Watchman. even me also. "Behold. his enemies. my father? Bless me. is: “how far gone is the night?” In other words. One is calling to me from Se'ir. If you will inquire. and also the night. It means silence and the word is used for the silence of the Last Days. Isaiah 21:11-12 The oracle concerning Dumah. 212C)). and together they shall plunder the people of the east." So the children of Esau were to live by the sword. what of the night?" 12 The watchman says: "Morning comes. "Have you but one blessing. and the Ammonites shall obey them. The problem we have is that Dumah is also the name of one of the tribes of Ishmael (see Descendants of Abraham Part III: Ishmael (No. Seir when Edom moved northwest to occupy some of the vacant lands of Israel after the captivity of the Babylonians.

” After the war in the heavens and the subjugation of the Host the descent on the Earth commences with the Middle East and with Edom. it is sated with blood. 6 The LORD has a sword. 25:13. behold. Messiah is travelling as bending forward in marching. The Septuagint and the Arabic version render “Valley of Vision” as “Jerusalem. The word used here for winepress is Gath. In other words. and of Isaac through Esau. it descends for judgment upon Edom. The tribes that are involved in this conflict are the sons of Dedan.longer have we to go? The answer is given: “The morning comes and also the night. Isaiah 34:5-6 For my sword has drunk its fill in the heavens. We know that this action is undertaken by Messiah on his return in the execution of vengeance in judgment. Media is the area occupied by the Kurds or Kurdistan. Tema brought bread and water to those fleeing the grievousness of war. This is his return in might and power and not in weakness. in endurance and strength (Heb. If you will return then return. 21:9) but this also looks forward in prophecy to the false religions that come undone in this final conflict. Come!” This is the morning of the millennial dawn and the repentant will see it and the invitation is given. Tema and Kedar are also sons of Ishmael as is Dumah (Gen. The word red here is ‘adom and is a reference to Edom. It sees the fall of Babylon (Isa. Isaiah chapter 21 deals with the conquests of the Medes and the Persians and the fall of Babylon and its effects on the sons of Abraham through Hagar and Keturah. ch. with the fat of the kidneys of rams. This conflict will last one year and in that year all the glory of Kedar will fail. which includes Turkey and Iraq and into Georgia and Iran. This year sees the coming of the Messiah and the resurrection of the elect. it is gorged with fat. Tema and Kedar are also mentioned. but they will be helped and restored in the end process of the Millennial Restoration (cf. upon the people I have doomed. Elam is Persia or modern-day Iran. a great slaughter in the land of Edom. For the LORD has a sacrifice in Bozrah. “The day of my vengeance is in my heart and the year of my redeemed is come”. 25:3.15. with the blood of lambs and goats. son of Midian. 1Chr. son of Abraham by Keturah (Gen. Koah). 34:5). Chapter 22 then goes on to deal with the Valley of the Vision. 1:30). 1Chr. 21:14-16). which is the valley around Jerusalem where Abraham first saw his vision and the prophets have done ever since. The garments of the Messiah will all be stained with blood and Messiah says here that. a section of the sons of Ishmael through Kedar will be devastated by the conflict as will be their land. They are mentioned in Jeremiah 49:28 and Job 6:13. Bozrah means vintage (cf. 1:32). Isa. .

Lam. Isaiah 63:1-4 Who is this that comes from Edom. . Where the r is used in his name the reference is to the King of the North acting. he that is glorious in his apparel. Jeremiah 25:21-23 Edom. Tema. and all the house of Israel is uncircumcised in heart. The land of Uz is mentioned. God says He will send “the cup of the wrath of His fury” to a number of nations and. announcing vindication. 4 For the day of vengeance was in my heart. 22 all the kings of Tyre. Bullinger. Esau and Ishmael will be brought to conversion and subjection in might and power. 2:43. Ps. when I will punish all those who are circumcised but yet uncircumcised -. fn." The unconverted.From this year he subjugates the Middle East. Buz. for all these nations are uncircumcised. Moab. the sons of Ammon. 50:37. will be dealt with. Ezek. I trod them in my anger and trampled them in my wrath." 2 Why is thy apparel red. Dan. all the kings of Sidon. Bible. Note the system now extends north to Lebanon and they are included in the subjugation. but not acting as directed by God when using the term Nebuchadnezzar. the days are coming. mighty to save. and my year of redemption has come. in Jeremiah 25 when God is prophesying through Jeremiah what is to happen. and from the peoples no one was with me. as are those across the sea in the coastlands. and all who dwell in the desert that cut the corners of their hair. and the sons of Ammon. This text in chapter 25 refers to the cup of the wrath of God and it is to be spilled out on Jerusalem and the cities of Judah and its administration. Judah. and all who cut the corners of their hair.26 Egypt. Comp. Jerusalem was made an astonishment and a hissing and a curse to the end. So also shall Egypt be struck. 4:2). Ezra 9:2. The tribes are to be attacked in the Last Days Jeremiah 9:25-26 "Behold. to v. marching in the greatness of his strength? "It is I. and thy garments like his that treads in the wine press? 3 "I have trodden the wine press alone. and the sons of Lot. the Urbi are joined with the Aramaens who are the nomad tribes west of the Euphrates. In the Inscription of Sennacharib (Bellino’s Cylinder line 13). their lifeblood is sprinkled upon my garments. He uses the Babylonians as a reference to Nebuchadrezzar. and it shall be rebuilt at the return of Messiah. 20). In verse 20 Jeremiah refers to the ‘ereb which is rendered Mingled people in the KJV (cf. that is the uncircumcised of heart. This refers to the influence of the Babylonian system of sun worship and those also who make tonsures of their hair. 106:35). Moab. in crimsoned garments from Bozrah. says the LORD. 30:5. Sennacharib says that Hezekiah had some Urbi soldiers with him in Jerusalem (cf. which is Job’s country near Idumea (cf. and I have stained all my raiment. and the kings of the coastland across the sea. 23 Dedan. Edom.

the king of Moab. The same area is sent into captivity and the prophecy is against the same nations. 3 Send word to the king of Edom. In Jeremiah chapter 26 we see that the Lord God spoke through the prophet Jeremiah and the people were told to walk in the ways of the Law of God and to listen to the prophets. Ekron (now ‘Akir) and Ashdod (now ‘Esdud). and the king of Sidon by the hand . This region is the entire area from Syria to Lebanon and south to Egypt and east to Saudi Arabia. with n not r). Dedan is also on the borders of Idumea.The Philistines are mentioned at Azzah or Gaza and Ashkelon. this word came to Jeremiah from the LORD. God sent Jeremiah to call the people to repentance. the priests and the prophets and the people seized him saying. as will be the case in the Last Days. king of Judah. Jeremiah was not then put to death. Zimri is also mentioned and it is thought that this name refers to Zimran the son of Abraham by Keturah (Gen. 2 Thus the LORD said to me: "Make yourself thongs and yoke-bars. All were to serve him. 25:2). but that time is to cease and Isaiah shows that Babylon is to fall and then these nations will be subject to and dealt with by Messiah. Tema and Buz are the country of Elihu (Job 32:2). The princes were invoked and Jeremiah again said what he was commanded to say. the king of the sons of Ammon. For a long while it was given to the King of the North (Nebuchadnezzar. as He will send the Two Witnesses in the Last Days to speak again and call these people to repentance. After he had spoken what the Lord had commanded him to speak. and put them on your neck. It will all be brought under subjection to Messiah as part of greater Israel. the king of Tyre. Jeremiah 27:1-11 In the beginning of the reign of Zedeki'ah the son of Josi'ah. This text was written in the reign of Jehoiakin on the fourth year of Zedekiah. The KJV follows some codices and the Syriac in placing the word Zedekiah in the text. “You will surely die”.

your dreamers. I will punish that nation with the sword. and put its neck under the yoke of the king of Babylon. and I have given him also the beasts of the field to serve him. until the time of his own land comes. 9 So do not listen to your prophets. 6 Now I have given all these lands into the hand of Nebuchadnez'zar. and you will perish. I have uncovered his hiding places. Thus says the LORD of hosts: "Is wisdom no more in Teman? Has counsel perished from the prudent? Has their wisdom vanished? 8 Flee. and I will drive you out. says the LORD. and I will appoint over her whomever I choose. and his brothers. with the men and animals that are on the earth. 17 "Edom shall become a horror. with the result that you will be removed far from your land." 12 For thus says the LORD: "If those who did not deserve to drink the cup must drink it. no man shall dwell there. and a messenger has been sent among the nations: "Gather yourselves together and come against her. 7 All the nations shall serve him and his son and his grandson. that Bozrah shall become a horror. would they not destroy only enough for themselves? 10 But I have stripped Esau bare. my servant. I will keep them alive. turn back. and with pestilence. but you must drink. you who live in the clefts of the rock. I will bring you down from there. O inhabitants of Dedan! For I will bring the calamity of Esau upon him. For who is like me? Who will summon me? What shepherd can stand before me? 20 Therefore hear the plan which the LORD has made against Edom and the purposes which he has formed against the inhabitants of Teman: Even the little ones of the flock shall be dragged away. surely their fold shall be appalled at their fate. says the LORD. every one who passes by it will be horrified and will hiss because of all its disasters. 18 As when Sodom and Gomor'rah and their neighbor cities were overthrown. 9 If grape-gatherers came to you. a taunt. dwell in the depths. and he is no more. who are saying to you. and his neighbors. one shall mount up and fly swiftly like an eagle. will you go unpunished? You shall not go unpunished. and spread his wings against Bozrah. the king of Babylon. I will suddenly make them run away from her. like a lion coming up from the jungle of the Jordan against a strong sheepfold. and I give it to whomever it seems right to me.' 10 For it is a lie which they are prophesying to you. 21 At the sound of their fall the earth shall tremble. Though you make your nest as high as the eagle's. the sound of their cry shall be heard at the Red Sea. 11 But any nation which will bring its neck under the yoke of the king of Babylon and serve him. says the LORD. a waste." The wars of the end . 19 Behold. and a curse. and all her cities shall be perpetual wastes. 22 Behold. the God of Israel: This is what you shall say to your masters: 5 "It is I who by my great power and my outstretched arm have made the earth. until I have consumed it by his hand. 4 Give them this charge for their masters: `Thus says the LORD of hosts. 13 For I have sworn by myself. to till it and dwell there. His children are destroyed. says the LORD. and the heart of the warriors of Edom shall be in that day like the heart of a woman in her pangs. would they not leave gleanings? If thieves came by night. Jeremiah 49:7-22 Concerning Edom. `You shall not serve the king of Babylon. I will make you small among the nations." 14 I have heard tidings from the LORD. your soothsayers. no man shall sojourn in her. of the envoys who have come to Jerusalem to Zedeki'ah king of Judah. 11 Leave your fatherless children. or your sorcerers. the time when I punish him. 16 The horror you inspire has deceived you. and the pride of your heart. and he is not able to conceal himself. and let your widows trust in me. 8 "`"But if any nation or kingdom will not serve this Nebuchadnez'zar king of Babylon."'" Jeremiah confirms Isaiah regarding the coming punishment of the sons of Lot and Esau along with Dedan and Teman. with famine. says the LORD. despised among men. who hold the height of the hill. then many nations and great kings shall make him their slave. I will leave on its own land. and rise up for battle!" 15 For behold. your diviners.

I will prepare you for blood. 30 "The princes of the north are there. 41 He shall come into the glorious land. from Teman even to Dedan they shall fall by the sword. and gave over the people of Israel to the power of the sword at the time of their calamity. Thus says the Lord GOD: Behold. 3 and say to it. he will uncover your sins. O daughter of Zion. Ezekiel 25:12-14 "Thus says the Lord GOD: Because Edom acted revengefully against the house of Judah and has grievously offended in taking vengeance upon them. Remember also that many of Edom are in Judah now. with those who go down to the Pit. 6 therefore. her kings and all her princes. 5 Because you cherished perpetual enmity. as I live. 14 And I will lay my vengeance upon Edom by the hand of my people Israel. but these shall be delivered out of his hand: Edom and Moab and the main part of the Ammonites. who for all their might are laid with those who are slain by the sword. you shall become drunk and strip yourself bare. says the Lord GOD.As we have seen. and cut off from it man and beast. on your hills and in your valleys and in all your . because you are guilty of blood. i. 7 I will make Mount Se'ir a waste and a desolation. 13 therefore thus says the Lord GOD. for all the terror which they caused by their might. 4 I will lay your cities waste. but your iniquity. they lie with the uncircumcised. set your face against Mount Se'ir. O daughter of Edom. and prophesy against it. Edom had to be dealt with before Israel could find peace Ezekiel 35:1-15 The word of the LORD came to me: 2 "Son of man. they lie uncircumcised with those who are slain by the sword. and he shall come into countries and shall overflow and pass through. Many of the sons of Kedar will be killed in this war. O daughter of Edom. he will keep you in exile no longer. Egypt and the Islamic system. is accomplished. When Israel’s exile is over and she returns then Edom will be subjugated and the people’s sins will be made bare. and blood shall pursue you. Daniel 11: 40-41 "At the time of the end the king of the south shall attack him. and bear their shame with those who go down to the Pit. Ezekiel 32:29-30 "Edom is there. 8 And I will fill your mountains with the slain. The text shows that the people in charge of the South. This action is in the Last Days. Mount Se'ir. all of them. and I will stretch out my hand against you. who have gone down in shame with the slain. and you shall become a desolation. the King of the South shall push at the King of the North. at the time of their final punishment. will push at or invade the King of the North and they will be repulsed and in turn invaded. and I will make you a desolation and a waste. I will stretch out my hand against Edom. with chariots and horsemen.e. and they shall know my vengeance. and all the Sido'nians. therefore blood shall pursue you. dweller in the land of Uz. says the Lord GOD. he will punish. but the king of the north shall rush upon him like a whirlwind. 22 The punishment of your iniquity. and with many ships. and I will cut off from it all who come and go. I am against you. And tens of thousands shall fall. This subjugation includes the Sidonians and all the princes of the North Country. and they shall do in Edom according to my anger and according to my wrath. The King of the North shall enter a number of countries and overflow the Middle East and take possession of the Middle East and Israel. but to you also the cup shall pass. Lamentations 4:21-22 Rejoice and be glad. and you shall know that I am the LORD. and I will make it desolate.

and raise up its ruins. and I will make myself known among you. Edom was persistently hostile and would be punished Amos 1:11-12 Thus says the LORD: "For three transgressions of Edom. 10 "Because you said. `These two nations and these two countries shall be mine. I will deal with you according to the anger and envy which you showed because of your hatred against them. I heard it. and the Law of the Lord God of Israel will be placed among them and they will be part of the inheritance of the Messiah as promised to their father Abraham. so I will deal with you. `They are laid desolate. and multiplied your words against me. and your cities shall not be inhabited. that they might possess it and plunder it. 12 And you shall know that I. because they have shed innocent blood in their land. I will not revoke the punishment. and we will take possession of them. ravines those slain with the sword shall fall.' -. 15 As you rejoiced over the inheritance of the house of Israel. because he pursued his brother with the sword. God blesses His people by destroying their enemies Joel 3:19 "Egypt shall become a desolation and Edom a desolate wilderness. as I live. and for four. and he kept his wrath for ever. and rebuild it as in the days of old.  . Ezekiel 36:5 therefore thus says the Lord GOD: I speak in my hot jealousy against the rest of the nations. says the Lord GOD. 12 So I will send a fire upon Teman. These prophecies are the reason Hadithic Muslims attacks the veracity of the Bible texts. the LORD. Then you will know that I am the LORD. and cast off all pity. and it shall devour the strongholds of Bozrah. 12 that they may possess the remnant of Edom and all the nations who are called by my name. all of it. 9 I will make you a perpetual desolation. saying. The fact is that they are both now part of Jordan and will be combined in the Last Days. when I judge you. and all Edom. have heard all the revilings which you uttered against the mountains of Israel. and against all Edom. Then they will know that I am the LORD. before the Millennium.although the LORD was there – 11 therefore." Note that Bosrah is referred to as being in both Edom and in the inheritance of Lot amongst Moab. for the violence done to the people of Judah. because it was desolate. Mount Se'ir. who gave my land to themselves as a possession with wholehearted joy and utter contempt. and his anger tore perpetually." says the LORD who does this. you shall be desolate. they are given us to devour. Thus the word of God is quite clear that these nations will be dealt with and joined to Israel in the Last Days.' 13 And you magnified yourselves against me with your mouth. Israel’s future restoration Amos 9:11-12 "In that day I will raise up the booth of David that is fallen and repair its breaches. 14 Thus says the Lord GOD: For the rejoicing of the whole earth I will make you desolate.

.

it may be that I shall obtain children by her. They decided not to wait for Sarai to bear a child so Hagar. "Behold. 5 And Sar'ai said to Abram. Sar'ai. and she fled from her. Abram's wife. and gave her to Abram her husband as a wife. 7 The angel of the LORD found her by a . Abram's wife. 2 and Sar'ai said to Abram." And Abram hearkened to the voice of Sar'ai. she looked on me with contempt. his mother was Hagar. and when she saw that she had conceived. May the LORD judge between you and me!" 6 But Abram said to Sar'ai. go in to my maid. took Hagar the Egyptian. 4 And he went in to Hagar. The King James Version at Genesis 16:3 states that Hagar was given to Abraham by Sarai to be his wife. she gave Hagar to Abraham for the purpose of giving him a child. Descendants of Abraham Part III: Ishmael (Edition 1. Genesis 16:1-10 Now Sar'ai." Then Sar'ai dealt harshly with her. but as yet Abram had no children of his own.1 20070203-20070203-20070417) Abram and Lot were a tribe. do to her as you please. and when she saw that she had conceived. and she conceived. Sarai had been given Hagar whilst in Egypt and it is alleged by Arabs that the Pharaoh gave Hagar to Sarai from the Royal household in recompense for his sin. bore him no children. As Sarai had not been able to have children and was then over childbearing age. an Egyptian who was the servant of Sarai (later named Sarah). your maid is in your power. "Behold now. she looked with contempt on her mistress. 3 So. her handmaiden. was given to Abraham and he had Ishmael by Hagar. the LORD has prevented me from bearing children. "May the wrong done to me be on you! I gave my maid to your embrace. her maid. Ishmael Background Ishmael was Abraham’s first son. after Abram had dwelt ten years in the land of Canaan. She had an Egyptian maid whose name was Hagar.

and he shall dwell over against all his kinsmen. also Isa. Bible). Ezra 8:31. "I will so greatly multiply your descendants that they cannot be numbered for multitude. God blessed the lad and he dwelt in the wilderness of Paran and became an archer. maid of Sar'ai. 3:2. the spring on the way to Shur. However." Yishma’el (SHD 3458) means God will hear. Ish'mael. "Behold. Genesis 16:11-16 And the angel of the LORD said to her. and it is at this time that he is given the promise that he would become the father of many nations and his name is changed to Abraham." 10 The angel of the LORD also said to her. Jer. Hagar took a wife from Egypt for him (Gen. 12 He shall be a wild ass of a man. his hand against every man and every man's hand against him. "Have I really seen God and remained alive after seeing him?"14 Therefore the well was called Beer-la'hai-roi. "Thou art a God of seeing". where have you come from and where are you going?" She said. 13 So she called the name of the LORD who spoke to her. while being the firstborn. This was not the only occasion where the greater blessings were given to the younger son. and Abram called the name of his son." 9 The angel of the LORD said to her. It is important to note here that God. "I am fleeing from my mistress Sar'ai. 16 Abram was eighty-six years old when Hagar bore Ish'mael to Abram. Ps. through the Angel of the Lord. The traditional explanation of this event based on the text in Galatians 3:19 was that he was born through the weakness of Sarah’s faith and thus the Law came to represent the transgression. you are with child. "Hagar." (RSV) Sarai did not wait for the promise of God but tried to pre-empt the birth of a male heir through her servant Hagar. because the LORD has given heed to your affliction. it lies between Kadesh and Bered. "Return to your mistress. the Angel of the Lord appeared to him. made a covenant at this time to greatly multiply Hagar’s descendants. and the Levitical priesthood also became the precursor to the Messiah and the Church (e. The name Abram (SHD 87) means high father and points to the very fact of God extending Himself to become the . you shall call his name Ish'mael. Ishmael. 15 And Hagar bore Abram a son. whom Hagar bore. which was customary in those days. 8 And he said. spring of water in the wilderness. 21:13. 15 in The Comp. God’s Promise to Abraham When Abraham was ninety-nine years old. This promise was not simply to point to a genetic inheritance but also to the fact that through his son Isaac he would be the ancestor of the Messiah and salvation would be extended to the nations. and shall bear a son. 21:20).g. Note at this stage he is still called Abram. for she said. 10:8-9). and submit to her. was not given the same promise as given to Isaac later. However. Sarai was held in contempt by Hagar when she did conceive and bear a child. The wild ass of a man refers to the fact of his dwelling in the wilderness of a fiercely independent spirit over against his brethren. see Bullinger’s note to v. This is even more so today and he will not be truly free until Messiah comes (cf. He was prophesied to become a wild man (or wild ass of a man) with his hand against all men.

walk before me. and be blameless. and God said to him. between me and you and your descendants after you: Every male among you shall be circumcised.Father of many nations (or a multitude (SHD 85) as the Ha Elohim. you and your descendants after you throughout their generations. 10 This is my covenant. "As for you. and you shall be the father of a multitude of nations. 2 And I will make my covenant between me and you. the land of your sojournings. and I will make nations of you. but your name shall be Abraham. "As for Sar'ai your wife. I will bless her. the prince of the Elohim. and will multiply you exceedingly. and I will be their God. we saw that change of name was also a change of status. my covenant is with you. God also promised that Ishmael would also be the father of many." 3 Then Abram fell on his face. the covenant was with Isaac. but Sarah shall be her name. He would be the father of twelve princes and he would be a great nation. ." 15 And God said to Abraham. every male throughout your generations. The names given to God’s servants are very important. you shall keep my covenant. 13 both he that is born in your house and he that is bought with your money. So shall my covenant be in your flesh an everlasting covenant. It was in this act and promise that God revealed His Plan to the world. 12 He that is eight days old among you shall be circumcised. In the same way Sarai means my lady or my princess. 14 Any uncircumcised male who is not circumcised in the flesh of his foreskin shall be cut off from his people. 5 No longer shall your name be Abram. he has broken my covenant. Genesis 17:1-16 When Abram was ninety-nine years old the LORD appeared to Abram." 9 And God said to Abraham. and said to him. kings of peoples shall come from her. and it shall be a sign of the covenant between me and you. 7 And I will establish my covenant between me and you and your descendants after you throughout their generations for an everlasting covenant. 11 You shall be circumcised in the flesh of your foreskins. and she shall be a mother of nations. or bought with your money from any foreigner who is not of your offspring. Thus there exists a covenant with Ishmael as an extension of Isaac under the Messiah. 6 I will make you exceedingly fruitful. However. and to your descendants after you. 4 "Behold. Abraham was concerned for Ishmael and asked God that Ishmael might live in His sight. for I have made you the father of a multitude of nations. Just as Abram means high father and Abraham means father of a great multitude." Circumcision was a sign of God’s Covenant with the sons of Abraham and the elect. whether born in your house. Nevertheless. and kings shall come forth from you. which you shall keep. all the land of Canaan. 8 And I will give to you. for an everlasting possession. and moreover I will give you a son by her. to be God to you and to your descendants after you. "I am God Almighty. you shall not call her name Sar'ai. 16 I will bless her. shall be circumcised. while Sarah means lady or princess and princess of the multitude. again showing the change of status and the extension of this covenant between God and His people and the extension of salvation to the Gentiles through His Church.

however his descendants are listed at Genesis 25:12-18. . I have heard you. "O that Ish'mael might live in thy sight!" 19 God said. God went up from Abraham. 9 Isaac and Ish'mael his sons buried him in the cave of Mach- pe'lah. east of Mamre. every male among the men of Abraham's house. an old man and full of years. Genesis 25:7-10 These are the days of the years of Abraham's life. and 212C respectively. with Sarah his wife. 20 As for Ish'mael. The descendants of Isaac went to war against the descendants of Hagar. At the end of his life. 8 Abraham breathed his last and died in a good old age. 24 Abraham was ninety-nine years old when he was circumcised in the flesh of his foreskin. There Abraham was buried. He was 175 years old. Abraham was buried by his two elder sons. These descendants were known as Hagrites. those born in the house and those bought with money from a foreigner. "Shall a child be born to a man who is a hundred years old? Shall Sarah. 21 But I will establish my covenant with Isaac. 23 Then Abraham took Ish'mael his son and all the slaves born in his house or bought with his money. 26 That very day Abraham and his son Ish'mael were circumcised. Hagarites or Hagarenes. Bas'emath. She was an Egyptian. and I will make him a great nation. I will establish my covenant with him as an everlasting covenant for his descendants after him. as God had said to him. behold. but Sarah your wife shall bear you a son. a concubine of Abram and the mother of Ishmael. Genesis 17:17-27 Then Abraham fell on his face and laughed. one that fears. He also had a daughter. he shall be the father of twelve princes. which is indicative of a continuing relationship between him and the brothers. in the field of Ephron the son of Zohar the Hittite. 27 and all the men of his house. were circumcised with him. a slave to Sarai. a hundred and seventy-five years. Bas'emath later married Esau (Gen. The Bible does not give a great deal of information regarding Ishmael. who is ninety years old. 212F. The meaning of her name is a stranger. and said to himself. I will bless him and make him fruitful and multiply him exceedingly. "No. and you shall call his name Isaac. 25 And Ish'mael his son was thirteen years old when he was circumcised in the flesh of his foreskin. 36:2-3). 10 the field which Abraham purchased from the Hittites. whom Sarah shall bear to you at this season next year. The story of Isaac and that of the sons of Keturah are dealt with in paper Numbers 212E. and he circumcised the flesh of their foreskins that very day. bear a child?" 18 And Abraham said to God." 22 When he had finished talking with him. who was the sister of Neba'ioth. Hagar We will deal firstly with Hagar. We know little from the Bible apart from the basic details of the birth of Ishmael. and was gathered to his people. He lived to 137 years of age and indeed had 12 sons as was prophesied. 1Chronicles 5:10-20 deals with wars against the Hagarites during the time of Saul.

66. p. Moab and the Hagrites. mentions in a poem the “nomads of Gerrha and those who plough their fields by the Euphrates” (A. 4. Gow and A.W. Emil G. Philistia with the inhabitants of Tyre. against thee they make a covenant -. The Hagarites lived east of Gilead. however.6 the tents of Edom and the Ish'maelites. The Hagarites have been identified with the Agraioi mentioned by Strabo (xvi. states: There are in various passages in Chronicles. but later moved to present day Iraq. Scholfield. but seems to treat it as genuine in the second regarding Ezra (ibid. Gotthard Deutsch Executive Committee of the Editorial Board. who were neighbors of the transJordanic tribes of Israel and were driven from their homes by them (I Chron. xi. in its article on Hagar (by Solomon Schechter. It is also noted that H. It notes that W. 18-22. writing in the third century BCE. v. Cambridge. Psalm 83:5-8 Yea.F. 38. 10. .. Muller held the view that a city of the people of Hagar would have been written as han-Hagar in Aramaic and possibly Hagara. Nicander of Colophon.Psalm 83:6 indicates that the Ishmaelites and the Hagarites were two separate peoples. Here Ishmael and the Hagrites are denoted separately. Using these theories archaeologists have speculated that the east Arabian Kingdom of the Gerrhaeans can be attributed to the descendants of Hagar. 2. History tells us much more of the people known as Gerrhaeans in the Greek world.net has an article on the subject of Hagar. they conspire with one accord. xxvii.129). Vol. references to the tribe of Hagarites. pp. It is generally assumed that the Ishmaelites became the Arabs of the Middle East. Nicander. There are thus two groups. 8 Assyria also has joined them. Thus it is argued that when this name is Hellenised it would have become Gerrha.F. 7 Gebal and Ammon and Am'alek. Hirsch Hartwig Hirschfeld). The Poems and Poetical Fragments. The Historians’ History of the World makes the Hagarites an Ishmaelite clan but mythologises their ancestry along with that of Ishmael in the first reference. 2). von Wissmann proposed that the term Hagar could be used to describe a walled city with towers and bastions. Nabataea.S. one being the nomads of Gerrha and the other a sedentary farming community on the Euphrates nearby. they do not belong to the Ishmaelites. This appears to indicate that Hagar went on to have other children later who became a ‘people’ or nation in their own right. they are the strong arm of the children of Lot. 31). 1952.com. and though Arabians. which is in the hills near Amman Jordan. [Selah] The online Jewish Encylopedia at JewishEncyclopedia. 111).

and of men a hundred thousand. pp. Under Saul. 5:19) (The Interpreter’s Dictionary of the Bible. That may have forced their move north towards the Euphrates after the conquests of David. and Naphish and Nodab. art. Vol. Importantly. the Ishmaelites. Movers. Obadiah 8 (ibid. 308). and the Hagarites were delivered into their hand. they were conquered by Reuben and Trans-Jordanian Israel. mentioned also in 1Kings 4:30-5:10. in keeping with the tradition of the East. However. they have the children of Lot Thus we must assume that at least by the time of David the Ishmaelites and the Hagarites had split into a minimum of two identifiable groups. 22 For there fell down many slain. and he was entreated by them because they put their trust in him. two thousand. Das phonizische Alterthum. and all who were with them. Assyria also is joined with them. F. C. for they cried to God in the battle. who extended their boundaries to the desert and occupied their lands. p. And they dwelt in their stead until the captivity. the Philistines with the inhabitants of Tyre. 21 And they took away their cattle. but the text is not considered significant and. 20 And they were helped against them. Ammon. 511). R. Schnell in his article on the Hagrites also says the link is not certain but considers that they are likely the “Agraioi referred to by the Greek geographers Strabo. and of sheep two hundred and fifty thousand. . The biblical account tells us in 1Chronicles 5 that: 1Chronicles 5:19-22 And they made war with the Hagarites. 19- 20. Ptolemy and Pliny” (ibid. Psalm 83:6-H83:7 is not certain but seems likely since two of the sons of Ishmael (Gen. ‘Hagar’. of their camels fifty thousand. iii. Amalek. Movers suggested that it might have been Nebuchadnezzar who exiled the nomadic Gerrhaeans as part of a policy to protect his country from menacing Arab tribes (F. with Jetur. (KJV) This might be read two ways but the text in Psalm 83:6-8 says plainly: The temples of Edom. Jeremiah 49:7. Berlin 1856. Moab and the Hagarenes. Schnell notes that the Sons of Hagar or ‘Agarenes (KJV) are mentioned in connection with Teman in Baruch 3:23. Gebal. 508-9). 2. many historians have put forward theories about them. because the war was of God. and of asses. art.). ‘Hagrite’. 25:15) are Hagrites (1Chr.There is little mention of them in either Assyrian or Chaldean records. Newman says that whether there is a connection between the Hagrites of 1Chronicles 5:10.

5 believed that the Chaldaeans left Babylon after Darius I re-conquered the city in 488 BC. The expulsion of the Gerrha nomads Rawlinson dates the expulsion of the Nomads of Gerrha to the Neo-Assyrian period after Sennacharib had exterminated the Chaldeans in 694 BCE and suggests he expelled a number of people (including the nomadic Gerrha) and relocated the Chaldeans there (Rawlinson. H. 188.80) records: "For this trade (with Elymais and Marmania) they opened the city of Carra (Gerrha) where their market was held. p. Because Gerrha is not mentioned by Herodotus. 64) who suggested that the expulsion of the Chaldaeans took place during the reign of Xerxes following the brutal repression of the revolt in Babylon of Megabyzus in 482 BC. S.. Inauguraldiss. Heeren. Stiffe. iii: Pre-Mohammedan Settlements". For they all used to set out on the twenty-day march to Babba and Syria-Palestine. The Early Commerce of Babylon".3.000 talents of incense yearly to the kings of Persia. 1878. L. Geschichte und Morphologie... GJ9 (1897).3 records: "The Gerrhaeans import most of their cargo on rafts to Babylonia and thence sail up the Euphrates with them.It was obvious at the time of Baruch that the sons of Hagar were considered to be associated with Teman.19 tells us that "from their trafficking both the Sabaeans and the Gerrhaeans have become richest of all (the Arabians).6).W.131 BC) tells us ". Der Persische Meerbusen." . Tkac. Genthe. they began later for the same reason to go to the empire of the Parthians. and their aromatic products. Cf Shiwek. Kiepert. have favored a date either in line with the fall of the Chaldaean supremacy a the hands of Achaemenids (eg. Petra and Palestine where the Gerrhaeans and Minaeans and all the Arabs who live in the region bring incense from the highlands. 10. Kennedy. H. 1271) or else at some point in the Achaemenid era. it is said. Blau 'Altarabische Sprachstudien: 2 Theil' ZDMG 27 (1873)." 135 Strabo 16. O. however." and "The Gerrhaeans traffic by land for the most part.. M. 328. who says "the Arabs paid 1. 1926. G." which Herodotus confirms." Agatharchides (200 . Lehrbuch der alten Geographie' Berlin.25 AD) and Pliny (AD 77)(NH 12. (Oxford 1833). (e. 'Ancient Trading Centres of the Persian Gulf. A. Gerrha.H. It seems to me that still earlier they brought their goods to the Persians rather than to Syria and Egypt.40. In an article titled The Twelve Lost Tribes of Ishmael we read the comments and then the quotations from the ancient writers we see as follows: “Most writers. and then convey them by land to all parts of the country.g. (Marburg. 311. Intercourse between India and the Western World from the Earliest Times to the Fall of Rome.4. 18896)." Juba (25 BC . A. Amer proposed an even later foundation in 'The Ancient Trans-Peninsular Routes of Arabia. According to Juba's report. A manual of Ancient History. " Strabo 16. in the Arabian merchandise and aromatics. Cambridge. 'Der Persische Golf'.. 271 and n.

The question as to whether the Hagarites are the descendants of Ishmael. The Jews. it is doubtful that a tribe would call itself after a female descendant. lumping together Ishmael's children and any other children that Hagar may have had. or the sons of another tribe altogether is still to be solved. and places them along the shores of the Euphrates River. They expanded and later the name Gerrha was applied to the entire eastern coast of Arabia. Clarendon Press. may have gladly done this in a derogatory sense. Nicander of Colophon mentions the nomads of Gerrha. (cf. however. It is Potts suggestion that there was both a city of Gerrha and also a port of Gerrha and that they were located some twenty miles apart.com/alhaj/twelvetribesofishmael. Writing in the third century BCE. They were nomadic but they also kept a reasonably comprehensive genetic record. We are going to attempt to identify the Twelve Tribes of Ishmael and their previous and current locations. Oxford. Strabo said that that Gerrha was located two hundred stadia distant from the sea. Potts. The Mystery The question as to whether Hagar remarried and had other children is considered by some to be a matter of conjecture. Some students such as those at Nabataea. From Alexander the Great to the Coming of Islam. Perhaps the advances in DNA will tell us the definite solution once the tribes are properly identified and tested. 1990) using Strabo’s description. Hagar’s first-born or only son.net assume that the Hagarites and subsequently the Gerrhaeans (their Greek name) refer to the twelve tribes that came from Ishmael.balaams-ass.” . They consider it to be very probable that the Jews simply referred to them as the descendants of Hagar. and subsequently from Hagar.400 stadia from Teredon (which would have been located near modern-day Basra). They say: “In the male dominated culture of the Middle East. http://www. The biblical record places the Hagarites in the desert east of Palestine and towards Babylon. and 2. suggests that Gerrha would have been located in the region of the modern port of al- Jubayl in eastern Saudi Arabia.htm#anchor78633 Location of the later Gerrha D.T. in his two-volume series entitled The Arabian Gulf in Antiquity (Volume II.

Jetur. being a free woman. Galatians 4:21-31 Tell me. 27 For it is written. and the sons of Lot and Esau but to all the nations of the world as part of the Israel of God in Christ. break forth and shout. she is Hagar. Mibsam. for the son of the slave shall not inherit with the son of the free woman. 1Chronicles 1:29-31 These are their genealogies: the first-born of Ish'mael. The comparison by Paul is aimed directly at Judah. one by a slave and one by a free woman. brethren. Neba'ioth. O barren one who does not bear. are children of promise. The entire covenant was established with Abraham to point towards Christ and ultimately would rest in the Church. Genesis 25:12-18 These are the descendants of Ish'mael. the son of the free woman through promise. Mibsam. These are the sons of Ish'mael. 16 These are the sons of Ish'mael and these are their names. 25 Now Hagar is Mount Sinai in Arabia. Massa. whom Hagar the Egyptian. he breathed his last and died. 24 Now this is an allegory: these women are two covenants. a hundred and thirty-seven years. Tema. Adbeel. 30 Mishma. we are not children of the slave but of the free woman. and was gathered to his kindred. like Isaac. named in the order of their birth: Neba'ioth. brethren. you who are not in travail. Naphish. 13 These are the names of the sons of Ish'mael. do you not hear the law? 22 For it is written that Abraham had two sons. The Sons of Ishmael The sons of Ishmael became the Arab Bedouin also. and she is our mother. 14 Mishma. you who desire to be under law. 31 Jetur. 23 But the son of the slave was born according to the flesh. We will now examine those tribes. bore to Abraham. Sarah's maid." 28 Now we. which is opposite Egypt in the direction of Assyria. . represents the New Covenant. 17 (These are the years of the life of Ish'mael. and Kedar. twelve princes according to their tribes. Dumah.) 18 They dwelt from Hav'ilah to Shur. 15 Hadad. for she is in slavery with her children.Paul in Galatians 4:21-31 says that Hagar as a slave represents the Old Covenant while Sarah. Dumah. "Rejoice. by their villages and by their encampments. bearing children for slavery. Paul uses the analogy of the conflict between Ishmael and Isaac to illustrate the fact that the Church is to Judah what Judah considered itself to be towards Ishmael. 29 But as at that time he who was born according to the flesh persecuted him who was born according to the Spirit. and we now have many tribes named that consider themselves distinct from the Bedouin. 26 But the Jerusalem above is free. 30 But what does the scripture say? "Cast out the slave and her son. It claims Jerusalem as its centre and relies on the physical aspects of its descent from Isaac and the promise of salvation as a physical one. and Kedar. Massa. he settled over against all his people. Chronicles also lists the sons of Ishmael. One is from Mount Sinai. which was open to the Gentiles and not just to Ishmael. Adbeel. and Ked'emah. and Ked'emah. so it is now. Tema. she corresponds to the present Jerusalem. Hadad. Abraham's son." 31 So. for the children of the desolate one are many more than the children of her that is married. Naphish. the first-born of Ish'mael.

the records of Tiglath- pileser III lists the Nabatu (possible descendants of Nebayoth. and I will glorify my glorious house. They are an Arabian Nation. Among the rebels. Then in 652 BCE when conflict broke out between the two brothers. 60:7). the rams of Nebai'oth shall minister to you. He and his brother Kedar were renowned for sheep rearing in the time of Isaiah (Isa.4. From Assyrian records we learn that King Ashurbanipal (668-662 BCE) fought with the Nabataeans. All the flocks of Kedar shall be gathered to you. and fled to the leader of the Nabayat for safety. and called it Nabatene. the Assyrian ruler. the Kedarites supported the Babylonian king in an invasion of western Assyria. Chapter 12. both because of their own virtue. These tribes were not conquered and they were recorded as fleeing from Assyria into the Arabian Desert. rebelled against Sennacharib. The “rams of Nebai’oth ministering to you” is an allusion to the function of the first-born of Ishmael as part of the priesthood under the Messiah. Ishmael’s eldest son) and the Kedarites (descendants of Ishmael’s second son). Neba'ioth Nebaioth. in 703 BCE. and because of the dignity of Abraham their father. However. the International Standard Bible Encyclopedia (ISBE) says that the fact of a spelling difference makes this theory unacceptable. . including some neighbouring tribes. and they name their tribes from these. Book 1. a group of Chaldeans.” He was the head of the tribe named after him.As noted above. They were defeated. As might be expected the Assyrian kingdom was eventually divided as the two brothers began to rule – one as King of Babylonia and the other King of Assyria. Josephus notes this in Antiquities of the Jews. This verse shows the two tribes of the sons of Ishmael that will be converted and they will offer sacrifice to God in Jerusalem as part of the millennial Restoration. The Jewish Encyclopaedia also discards this theory. but she was also called Basemath. or Nabajoth. and his brothers settled in Arabia. they shall come up with acceptance on my altar. “These inhabited all the country from the Euphrates to the Red Sea. When the Kedarites and the Nabayat later attacked the western borders of Assyria they were defeated. Ishmael also had a daughter whose name was Mahalath. While Josephus and other scholars have previously identified Nebaioth with the Nabataeans.

in Syria. Historical records clearly state that in 586 BCE the Edomites began to move north into the Jewish lands that Nebuchadnezzar had emptied. However. on the other hand. and in parts of modern Jordan. From this evidence it has therefore been concluded that they were Arabs who. Yet. it is now considered that they should be identified with the Kadmonites of Genesis 15:19.. and T. was also utilised as a royal city. et al. Bostra. mention that the Nabatu were trading Gerrhean and Minaean frankincense. Barton states that while it was initially thought that the Nabatæans were the same people as the Nebajoth of Genesis 25:13. they were repeatedly spoken of as Arabs by ancient writers. While the city of Petra was the original capital. Clark Edinburgh. transporting it to Gaza and Syria through the Kedarite centres of northern Arabia. Schurer.Some three hundred years later the Zenon papyri. As inscriptions have been found written in Aramaic. the Jewish Encyclopedia in its article by George A Barton on the Nabataeans states that they are not identical with Nebayoth. 574ff.) says that so little is known of the Nabateans that not even their ethnic origin is certain. which date from 259 BCE. which indicates they were Aramaeans. made use of Aramaic which was the civilised language of the time for literary purposes. the Nabataeans went on to build an impressive civilization. Vermes. In time the Nabatu began to occupy the vacant land left by the Edomites and eventually make it the centre of the Nabataean Empire. Their language on inscriptions and coins was without exception Aramaic. Other cities were also built in the Negev. not only by those remote from them in time but also by Josephus who is expected to know full well the difference between the two. in The History of the Jewish People in the Age of Jesus Christ. However. and also with the Naba-a-a-ti of the annals of Assurbanipal. it appears that the Nabataeans were of Arabian background but possibly they were Arabs under Arabian influence. Jauf. pp. in northern Saudi Arabia today. So also the Arabian tribes began to move northward. T. and Tayma. (ed. because Arabic was not yet developed into a written language. in 106 CE the Nabataeans seceded their empire to the Romans and over time they lost their individuality. 1987. Based on merchant trade. Appendix II. Schurer considers their identification with the .

It is only from the beginning of the Hellenistic period that a coherent picture of them emerges. c. in the region of Petra which Schurer says is probably not identical with the old Sela of the Edomites (ibid. It is possible that they are both. 5:25. The Palestinians and Syrians were defeated a number of times by the Arabs seemingly under the king of the Nabataeans from 93 BCE (Alexander Jannaeus) to 87 BCE (Antiochus XII) perhaps both times under Obodat or Obodas I. they were primitive pastoral nomads who had not developed a kingship. Obodas II. (Haretath). They are not Edomites of the sons of Esau. 36:3. 2-50 CE. they reached their greatest power under Erotimus (Aretas II?) ca. Thus we have a fair idea of the strength and power and we know their location. (Maliku). Aretas III. he sent his general Athenaeus against the Nabataeans with 4000 infantry and 600 cavalry and attacked their fortress at Petra by surprise. his army was virtually annihilated in a night assault by the Nabataeans (ibid. 9:35). 145 BCE. Thus he discounts them as being sons of Ishmael. and Rabel. due to his own carelessness. c. They traded from Egypt and Gaza through Petra to central Arabia and as far as Babylonia. The High Priest Jason sought refuge with him in 168 BCE (2Mac. Antiochus XII fell in the battle at Cana. In the end of the second century BCE when the Ptolemaic and Seleucid empires collapsed. 5:8). p. Malchus III. and Isaiah 60:7 as an Arab tribe as very improbable. . According to Diodorus who wrote the account..Nebayoth of Genesis 25:13. The first known dynasty of these people was Aretas who was described as Tyrannos or tyrant. c. (Obodath Melek Nabatu). (Haretath Melek Nabatu). 85-62.). Obodas I. However. 97-85. 1Chronicles 1:29. 50-70. They developed a coinage in the 2 nd century BCE bearing the names of the following rulers: Malchus I. Antigonus then sent his son Demetrius to subdue them but without success. They were friendly with the Jewish party in the Maccabean revolt in 164 and 160 BCE (see 1Mac. 70-95. 28:9. 110-100 BCE. (Obodath). Their power reached as far as east of the Jordan. 576). After Antigonus had driven Ptolemy Lagus from Coele-Syria in 312 BCE. They were at that time settled where the Edomites lived between the Dead Sea and the Gulf of Aqaba. but if Schurer is to be followed they are not Ishmaelites but are Arabs of the sons of Keturah. There they erected a temple to their native deity. Aretas IV. Other trade routes were also available to them and a colony was established at the Italian port of Puteoli.

” It was to the land of Qedem that Abraham sent the sons of Keturah and that was believed to have been in the Syrian Desert. 585). Jews. the Kenites and the Kenizzites were given to the descendants of Abraham and thus they were absorbed into the sons of Keturah. of the land of Qedem which is the east country (Gen. . 5. under the Romans. However. as did the Judean kingdom. in other words Nabataean Arabia was made a Roman province by Cornelius Palma. p. 18:20). The sons of Qedem are identified as “the people of the east” which was to include Job a son of Issachar of Israel (Job 1:3. The Nabatæans provided assistance to the army of Titus during the siege of Jerusalem (Josephus. In the time of Augustus the Nabatæan kingdom became dependent on Rome. art. 10. We can thus assume that if the Nabataeans were not originally Arab but Aramaic (sons of Aram) the region and its people were subsequently absorbed into and. they were able to maintain a line of fortresses linking their southern dominions with the region around Damascus. If the Nabataeans were indeed the Kadmonites of Genesis 15:19 then we are dealing with the Qedem. 2. 9) (see also the paper War with Rome and the Fall of the Temple (No. The Messiah will always come from the east and hence the orientation of the Hebrews was to the east as being to the “front. Vol. 25:6 RSV). xvii. l. xviii.. The Nabatæan kingdom ended under Trajan with the nearer portions of it brought into the Roman province of Arabia. Malchus III. so Schurer records. cf. 26) and the wise men who bore names of Arabian association (1Kgs. and the camel-riding Midianite Kings (Jdg. 21. p. Mat. It was during this same rule that Paul escaped from Damascus (2Cor. The lands of the Kadmonites. Most of the extant dated Nabatæan inscriptions come from Aretas IV.).Aramaic inscriptions show that the Nabataeans controlled the area from the Arnon to Damascus early in the First Century and later lost the Hauran and Peræa to Herod. governor of Syria on the orders of Trajan (ibid. formed part of the province of Arabia. 8:10-12. and Rabel. In 106 CE. 3. over which they still held a protectorate. ‘Kadmonites’).c. 11:32). 4:30-31 (H5:10 see Interpreter’s Dictionary of the Bible. 14:3ff. Arabia belonging to Petra. Ant. 298)).. 1. kings of this period and interestingly it was Aretas’ (Haretath) daughter who was divorced by Herod Antipas in favour of Herodias (Josephus. east of Byblos.

LXX) among whom are those named as residing in the cities of the Kenites (1Sam. Dict. tracing their ancestry from Hammath father of the house of Rechab. The reference in Numbers 24:21 says they are “set in the rock” which places them at the time of Balaam in the Wadi Arabah. However. 27:10) and then David sent spoil to the elders of Judah and to his kinsmen (cf. plundered clans living in the Negeb of the Kenites (1Sam. Jdg. At that time they had become associated with the Amalekites and Saul warned them to separate if they wished to avoid destruction. as the term is also applied on occasion to Jethro. 24:21. p. 1Chronicles 2:55 describes as Kenite certain families of scribes who dwelt in Jabez in southern Judah. 30:29). whilst he was living in Gath of the Philistines.. The Kenites to the east became absorbed into the Arabs. . They were originally living in Canaan.). In the period of the Judges a nomadic branch of the Kenites under Heber inhabited Galilee (Jdg. The Arabic Sleib. In Judges 4:11 the Kenites are designated as descendants of Hobab (cf. who are nomadic metalworkers. 7). 15:19). Jdg. (ibid. The Interpreter’s Dictionary considers that they may have been living among the Midianites and taught them metal work and it is thought that Moses learned metal work while among the Kenites and Midianites. ibid. Moses’ father-in-law. 5:24) (Int. There is a significant E3b YDNA composition among Jews. which probably came from the Canaanites.. which land was promised to Abraham and his descendants (Gen.The Kenites were a tribe of semi-nomadic smiths or metalworkers and occupied the rock country south of Tell Arad on the western slopes of the mineral rich Wadi Arabah above Tamar (Num. 1:16).. are not held in the same respect as these Kenites were from as early as 1300 BCE. the postulated relationship between the Kenites and the Arab tribe of the Banu’l-Qayn living in the region between Teima and Hauran in the sixth century CE just before the time of the Prophet cannot be demonstrated (ibid. 4:11. 6). Shortly after this the Kenites entered Palestine as part of Israel in the tribe of Judah and this relationship seems to be reaffirmed in 1Samuel 15:6 where the Kenites were described as showing loyalty to Israel in the Exodus. p. 1:16). The last mention of the Kenites in the Bible is when David.

under Nebuchadnezzar. are placed within the restoration amongst the flock. Kedar (blackness. “Genealogists tell lies” (cf. The Arabs refer to them as Qidar They became a powerful tribe of Arabs in the northwest Arabian Peninsula. The name also applies to the sons of Eliphaz. In these records Kedar and Nebai’oth are in close association. fought a battle against them in 599 BCE. This was part of the subjugation of the southern Semites. Rahmat-ul-lil’alameen 2/7-17). 14:6-14. The tribe of Kedar had a long history of conflict with the sons of Asshur and they are mentioned in the Assyrian records of Ashurbanipal and in those of various other Assyrian kings with whom they were in conflict. The second group were the Othnielites who occupied Debir (modern Tell Beit Mirsim?) (Jos. which were well known in the ancient world. The Kenizzites are a non-Israelite composite group that moved into the Negeb from the southeast before the main body of the conquest. Kedar. They were a nomadic people trading particularly in sheep and goats and living in tents. and are dealt with in that section. Thus the Prophet was not a “Pure” or al-‘Ariba Arab. Thus the southern group associated with the Nabataeans that has later Arab association is also associated with Edom and Judah. The first-born plays a lead roll in the ministry but also the sons of the second- born. which actually is a term applied to sons of Shem both from Aram and Arphaxad (see also Descendants of Abraham Part IV: Sons of Keturah (No.The Kenizzites mentioned are a composite group that were present in Canaan when their lands were promised to be given to the descendants of Abraham. They were composed of the clans of the Calebites who occupied Hebron (modern El Khalil) (Jos. Prophecies in Isaiah and Jeremiah indicate wars and defeat but that in the end times they will be restored and placed within Israel as part of the Messianic Kingdom. Kedar also lived at Mecca (Makkah). but may actually derive from none of them but rather from early Canaan and have association with Aram and hence Aramaic as well as with the Arabs and Jews. the final part of which was the destruction of Jerusalem and Judah. Jeremiah foretold the battle in Jeremiah 49:28-29. 1:11-15). The third possible group may have been the Jerahmeelites. first-born of Esau. The Babylonians. 15:15-19. 15:52-54). The Hadith says that the Prophet only traced his ancestry back to ‘Adnan and stopped there as he held the uncertainty of the genealogy from that date. sorrow) There are a few allusions to Kedar in the Bible. The name Kedar was rendered by the Hebrews as Qedar and by the Assyrians as Qidri. They were associated with the Edomites and the Kenites. 212D)). . They dwelt in black tents. Jdg. who must have occupied the southernmost hill country of Judah. which is the Church of God. The Arab genealogists say there are 40 generations from Kedar to ‘Adnan and his son Ma’ad from whom ‘Adnanian Arabs trace their ancestry. He is quoted as saying.

Rabi’a’s son. Rabi’a 4. These were: 1. The time-frame of forty generations is 1600 years. Some famous noble ‘Ananaite families from the Quriesh group are Alnazi. had two sons Bakr and Taghlib. Altamimi. Bani hashim etc. Nizar. Ma’ad son of ‘Adnan had only one son. being some time in the end of the period of Judges and the fall of Troy. If we only allow twenty years per generation it is still 800 years until ‘Adnan.The Prophet was an Arabicised Arab or al-Musta’ribah of the sons of Ishmael. Bani Kolab. Hanifa and others. Mudar The last two formed a variety of septs. ‘Abdul. Qais. Almaleek. Eyad 2. Thus the wars with the Assyrians and the expansion of the Spartans into Laconia were all before ’Adnan and the wars were fought by the sons of Kedar and Nabai’oth. The septs of Elias bin Mudar. Nizar had four sons who branched out to form four great tribes. Rabi’a fathered Asad. The term al-Musta’ribah is also used for non-Ishmaelites or the Mixed Arabs of both groups The forty generations of Kedar between him and ‘Adanad are no doubt also dispersed into a great people and later absorbed into other tribes. Anazah. The Mudar tribes formed into two great divisions: 1. The expansion of the Edomites occurred after the fall of Israel and Judah. From Qais ‘Ailan came: . Wa’il. If thirty years are allowed we are at the period after the fall of Israel and at about the time of the Babylonian Captivity. The septs from Qais ‘Ailan bin Mudar 2. Bani Khaled. Anmar 3. The expansion occurred from ‘Adnan at Mecca. and these tribes were subjugated by David as were those of Meshech and the Syrians before what became Sparta was conquered.

Asad bin ‘Abdul ‘Uzza bin Qusai and ‘Abd Manaf bin Qusai. From them came also the tribe of ‘Abdul Qais with the septs of Bakr bin Wa’il and Tamim who emigrated to Bahrain. Abu Qasim. ‘Abd Shams 2. (cf. the most notable being Jumah. ‘Adi. the Banu Hawazin. bin An- Nadr bin Kinana. ‘Abd Manaf branched out into four tribes: 1. Muslim 2/245. from whom came the famous Quraish. and three septs of the Qusai bin Kilab. the Prophet of Arabia. being Qasim bin ‘Abdullah. Hudhail bin Mudrika.org/vil/Books/SM_tsn/ch1s1. a compilation of traditions and false interpretation that was later used to establish the religion of Islam. from whom descended.witnesss-pioneer. Zahra. The Quraish branched out into various tribes. Ashja’ and Gani bin A’sur. to Hashim to Qasim known as Muhammed (cf. Makhzum. ‘Abdud-Dar bin Qusai. and the Banu Ghatafan. The line is Ishmael to Kinana to Quraish.html) Thus Kedar’s most well-known contribution was when one of the descendants of Kedar. is descended. Zubyan.The Banu Saleem. the banu Asad bin Khuzaimah and the septs of the Kinana bin Khuzaimah. Tirmidhi 2/201). The children of ‘Adnan spread out over Arabia. Nawfal 3. bin ‘Abdul-Muttalib bin Hashim. was converted to the Christian faith. Muttalib 4. called Muhammed. Tayim. ‘Abs. From Elias came: Tamim bin Murra. also www. . His followers later corrupted the faith with what became known as the Hadith. Sahm. the descendants of Fahr bin Malik. Hashim It is from the family of Hashim that the man Abu Qasim.

The Banu Saleem lived in the vicinity of Madinah (Medinah) between Wadi Al-Qura to Khaibar to the eastern mountains of Harrah. The Banu Tamim lived in the Basra semi-desert. 212D).The Banu Hanifa bin Sa’b bin Ali bin Bakr settled in Hijr the capital of Yamama. For the movement of the sons of Keturah into Mecca and Medina under the Roman occupation of Arabia see the paper Descendants of Abraham Part IV: Sons of Keturah (No. which recognised their status and importance as a tribe. Most of the tribe of Tahglib lived in the Euphrates area and some of them lived with the Bakr. Ablah and Hait. The Taqif lived in Ta’if and Hwazin east of Mecca near Autas on the Mecca-Basra road. Saif Kazima. The importance of the Qureish was increased significantly and many of the sons of Kedar trace their origins through his family. to the sea’s shore and to the outer borders of Iraq. Bahrain. Thus all the tribes of Bakr bin Wa’ol lived in the area of land which included Yamama. Whilst some septs of Kinana lived in Tihama. Mudadrat Tareekh Al-Umam Al-Islamiyah 1/15-16). The Banu Asad lived on the east of Taim and west of Kufa with the Banu Tai’ living between them and Taim. The Quraish were finally united on honourable terms. some five days walk from Kufa. the septs of Quraish lived in Mecca and were disunited completely. by Qusai bin Kilab who rallied their ranks thus making them a force (cf. Zubyan lived on the lands between Taim and Hawran. .

an everlasting waste. Prophecy under the Babylonians Jeremiah speaks of Kedar under the Babylonians. that dwells securely. The full list of the septs or tribes of the family of the Prophet in Iraq are given at Annex A. advance against Kedar! Destroy the people of the east! 29 Their tents and their flocks shall be taken. no man shall sojourn in her. There are altogether 150 tribes in Iraq. and I will bring their calamity from every side of them. Thus says the LORD: "Rise up. in the beginning of the reign of Zedeki'ah king of Judah. thirty of which are the most important.For example: there are two families descended from the Prophet in Basra. 35 Thus says the LORD of hosts: "Behold. I will scatter to every wind those who cut the corners of their hair. that dwells alone." 34 The word of the LORD that came to Jeremiah the prophet concerning Elam. no man shall dwell there. Most of these tribes or clans regard loyalty to their clan as being more important than any national loyalty. O inhabitants of Hazor! says the LORD. the mainstay of their might. being the Barakat and the al-Naqib. The Arab Federations and their locations in Iraq are in Appendix A. 31 "Rise up. For Nebuchadrez'zar king of Babylon has made a plan against you. their camels shall be borne away from them. I will break the bow of Elam. 33 Hazor shall become a haunt of jackals. 36 and I will bring upon Elam the four winds from the four . However there are many of the sons of Ishmael through Kedar in Iraq. The Bani (Banu) Tamim are in central and southern Iraq with  Al-Suhail clan as the tribal leaders near Abu Ghuraib  Al-Turshan section centred in the Diyala governorate  Al-Kan’an section in the Basra governorate and across the borders in Iran in Kuzestan Province. says the LORD. that has no gates or bars. Jeremiah 49:28-39 Concerning Kedar and the kingdoms of Hazor which Nebuchadrez'zar king of Babylon smote. their herds of cattle a spoil. The Rabi’a are centred around the Kut city area. advance against a nation at ease. dwell in the depths. their curtains and all their goods. There are seventy-two septs or sub-tribes claiming descent from the Prophet in Iraq alone. 32 Their camels shall become booty. says the LORD. and men shall cry to them: `Terror on every side!' 30 Flee. The Bani Ka’b Federation are also in Basra and in the Kurdestan Province in Iran. wander far away. and formed a purpose against you.

Cohen says they were identical with the Idiba’ileans that were conquered by Tiglath-pileser III (some attribute as II) and then appointed as guards on the Egyptian frontier (Interp. in relation to the . Ezekiel 27:21 Arabia and all the princes of Kedar were your favored dealers in lambs. from the bent bow.." These wars will come to an end and the Messiah will establish the men of Kedar and use those of the first-born Nebai’oth to convert all of the Arabs and the sons of the Middle East. These Idiba’ileans are the Idibi’ilu of Arubu. 37 I will terrify Elam before their enemies. and there shall be no nation to which those driven out of Elam shall not come. Tyre was a great trading centre and Kedar was a favoured resource for trade in sheep and goats. my fierce anger. and before those who seek their life. meet the fugitive with bread. 1. O caravans of De'danites. quarters of heaven. 17 and the remainder of the archers of the mighty men of the sons of Kedar will be few. from the drawn sword. says the LORD. p. says the LORD. and they will be brought to peace and ruled from Jerusalem. Vol. Mibsam (smelling sweet) and Mishma (hearing. Isaiah states that the nation of Kedar. The International Standard Bible Encyclopedia says that as these two names are also noted in 1Chronicles 4:25ff. "Within a year. has spoken. and from the press of battle. and I will scatter them to all those winds. who were mighty men and skilled archers. in these they trafficked with you. the God of Israel. Adbeel (vapour. until I have consumed them. I will bring evil upon them. 45). They are mentioned in Genesis 25:13 and 1Chronicles 1:20. for the LORD. 39 "But in the latter days I will restore the fortunes of Elam. Some authorities attempt to locate the tribe in the Sinai because they dwelt in the west. Dict. I will send the sword after them. 38 and I will set my throne in Elam." Ezekiel 27 deals with the lamentation of Tyre. says the LORD. O inhabitants of the land of Tema. would be defeated. 14 To the thirsty bring water. rams. according to the years of a hireling. 15 For they have fled from the swords. also servant of God). there is little information about these two tribes. Isaiah 21:14-17 The oracle concerning Arabia. or cloud of God. and destroy their king and princes. S. 16 For thus the Lord said to me. all the glory of Kedar will come to an end. obeying) Again. and goats. In the thickets in Arabia you will lodge. This tribe was located in the northwest of Arabia close to Kedar and Nebaioth.

It may be that they became affiliated from Egypt even before the Exodus perhaps even under the Hyksos. ‘Mibsam’. . However. 3. Now this cannot be correct as Dumah is a son of Ishmael but is also used to refer to Mt. in his article ‘Mishma’ on p. and that they were two Arabian tribes. but the southern expansion of Simeon seems a very plausible explanation. Seir and seemingly absorbed into Edom but. 404 he notes that there is a Jebel Mishma between Teima and Jebel Shamar. as Edom moved northwest into the lands of depopulated Israel and Judah. were prophesied against by Isaiah. as the text in Genesis would seem to require an early connection. Dict. Dumah (silence) The Dumah are held to be the Idumaeans. p.sons of Simione. Thus we must assume that a section of the tribe of Dumah was connected with Edom in Mt. art. He then goes on to say that the presence of the two names here and in the Ishmaelite genealogies may indicate that the two were Arabian tribes that had become affiliated with Simeon in the course of the latter’s expansion southward (vv. 38-43). Cohen identifies Mibsam as a descendant of Simeon and the father of Mishma from 1Chronicles 4:25 and appears to make them distinct from the Ishmaelites (Interp. 369). Vol. The explanation is probably that. but the reading is uncertain. which was the capital of the tribe. at the very least. These tribes would thus also be Jews and perhaps scattered in Israel as well. The name of Dumah is still preserved in the modern Arab city of Dumat-al-Jandal. Seir. Seir while the northern section of Dumah lived in the area in Mesopotamia to the north. which is the home of the son of Esau. Isaiah 21:11 makes that connection. which may have become affiliated with the Simionites. The accuracy of this is not fully known. These two tribes appear to have been associated with the Idiba’ileans in the same area. S. the Dumah moved into the lands of Mt.

Therefore. 32. Stephanus Byzantius. Haza'il. before proceeding on to Syria or Babylonia. From Nabataean. like the name Hadramaut (Gen. 11). This area has water. Travels in Syria. who paid him tribute. to some legend of Hades (cf. The Dumathii are mentioned in Porphyry. p. 56). in its article by Emil G. the war against Nabayat and the war against Massaa. De Abstinentia (ii..net: Dumah is generally identified by historians with the Addyrian Adummatu people. and the Septuagint have "Rouma". it is the name of a city of Judah (Josh. 440). Esarhaddon related how. xxi. Burkhardt. King of the Arabs. p.. and comp.).v. located about fourteen kilometers south of Tayma. Massa (a burden. and often denotes the whole lower region of Wadi as Sirhan. 662). Historia Naturalis. mention a village of the name of "Dumah". in connection with Dedan and Nebayot. Dumat el Jandal is at the southeastern end of Al Jawf. the Vulgate. The name Dumah seems to point. who is called. prophecy) From the Nabataean website: The records of Tiglath Pileser III mentions the inhabitants of Mas'a and of Tema. From a geographical standpoint. 1890. these tribes appear to have . which is a desert basin. This strategic location effectively made Dumah the entrance to north Arabia. Glaser. Dumah is mentioned in the biblical records as a city in Canaan (Josh. xv. s. It is also associated with Edom and Seir in Isaiah 21:11.v. On the summit of Jebal Ghunaym. in his attempt to subdue the Arabs. which has been identified with "Khirbat Daumah" in the neighbourhood of Bait Jibrin. Sennacherib struck against their capital. as an Arabian tribe which sacrifices a boy every year and buries him under the altar of its idol. and compared with Domatha (Pliny. Also. states that in biblical literature Dumah has been found in Dumat al-Jandal in Arabia. It goes on to say that it is the name of a land probably identical with the territory of the tribe of Ishmael (Isa. but Jerome's and Eusebius' Onomastica. x. vi. which was in ancient times a very important and strategic junction on the major trade route between Syria.v.. Kaza'il is also referred to in one inscription of Ashurbanipal as King of the Kedarites. archeologists Winnett and Reed discovered some graffiti texts mentioning the tribe Massaa. and was a stopping place for caravan traders coming from Tayma. as related to us in Assyrian records. called Jauf today (Yakut. the famous depression situated half way between Syria and Mesopotamia. These texts refer to the war against Dedan. Najd and the Hijaz area..The Jewish Encyclopedia. s. 52). ). Solomon Schechter and Kaufmann Kohler. s. 15:52). Adummatu is often associated with the medieval Arabic Dumat el-Jandal. The Septuagint substitutes Idumea (see commentaries ad loc. Sennacherib captured their king. which he called the stronghold of the Arabs. Hirsch. This oasis was the center of rule for many north Arabian kings and queens. Abu al-Walid's Dictionary. Skizze der Gesch. 26). Adummatu. The Ginsburg MS. und Geographie Arabiens.v. s. his father. Babylon.

as did other oases. 46). i. 250 miles SE of Aqaba on the road to the head of the Persian Gulf and about 200 miles NNE of Medina on the road to Damascus. "Hadar"]. Seligsohn states that it is the … “name of several Idumean kings. 51). These caravans are mention in Job 6:19 and headed to that city. Vol. Syria. 49:28-33). or the Hararina people. Jewish Encyclopedia article by Emil G. and are located throughout the Levant (e. who reigned before the time of the first king of Israel. xxxvi. xxv.g. xxxvi. which bids the inhabitants of Tema help their fugitive brethren with food and drink. i. A member of the royal house of Edom. 25:23. art." The name was borne by: 1.). 4. Cohen says that he was a son of Ishmael and hence the name of an Arabian locality (Gen. p." 3. Jordan. I Chron. that lived near the mountains northwest of Palmyra. 533). the meaning of which is "a loud noise. It is also interesting to notice that there is a Hadad tribe in Arabia. The tribe of Massaa is possibly connected with the Masanoi in the vicinity of Tema. Lebanon. However. 1:30). 1Chr. Although parts of Northern Arabia were conquered. The third Idumean king. of the Bible. 25:15. Tema (admiration. ‘Tema’. 39 the name occurs as "Hadar. is thought to refer to the campaign of Tiglath- pileser III of Assyria in 738 BCE. noise. V. The oracle in Isaiah 21:14. In view of its strategic location at the junction of the two main caravan routes it was an important caravansary (Interp. 30)”. cf. Tema escaped destruction by paying tribute to the Assyrians. . 14 et seq. perfection." It was primitively the name of an Aramean divinity and formed a part of various Aramean theophorous names. i. To the west lies the Nefud Desert which separates Tema from Dumah and Edom. Hadad (joy. Dict. The last Idumean king (I Chron. It is the same as the modern Teima which is an oasis located ca. as "Hadadrimmon" and "Hadadezer.: see Edom. 15 [A. Hirsch and M. clamour) Some historians speculate that this tribe may have become known as the Harar. been close to each other at this time. I Chron. Jeremiah issued dire warnings against them (Jer. Nebuchadnezzar of Babylon waged campaigns against the region and the prophecy may have referred to that campaign or had a dual aspect. Most of the Hadads are now Christians. 2. consummation). Palestine). 4. ( ) One of the sons of Ishmael (Gen. who escaped the massacre under Joab and fled to Egypt (I Kings xi. and who gained an important victory over the Midianites (Gen. In Gen. 35.

p.Nabonidus (555-539) was the last king of Babylonia and was in danger from the Medes and Persians. 25:15. 533-534). The coalition was made up of Massaa. However. The Assyrian records also show that a coalition headed by Samsi. 7:1) and destroyed the city of Tema and its populace. queen of the Arabs. 2. Jetur (order. The region was included in the Tetrachy of . 773) places it NE of Galilee in the Anti-Lebanon country settled by Arab people of Ishmaelite stock.. which lay far to the west. Those people lived at Tawilan NE of Elji on a shelf of land above Elji and below Jebel Heidan. ‘Iturea’. 1Chr. 1:45). Vol. it seems to have been of considerable importance (ibid. The Assyrian Sennacharib named the great gate at Nineveh the Desert Gate because the tribute of the Sumu’anites and the Temaites entered through it. was defeated and made to pay significant tribute. Female rulers among the ancient Arabs were not uncommon as we saw with the Queen of Sheba. art. Dict.. One of the kings there was Husham of the Temanites (Gen. ‘Teman’. art. which rises above it to the NE. 549-539) probably to consolidate the region and consolidate his links with Egypt.). and Idiba'il. Hatti. He lived there for ten years (ca. 1200- 600 BCE) found there. then rebuilt it and repopulated the city with a large range of different people. Badana. mountainous) This tribe of Ishmael (Gen. pp. the city of Tayma. Hajappa. succession. 5:19). 36:34. he left his son Belshazzar to rule in Babylon (cf. the tribes of Saba.15). Dan. which was his only ally against the Persians. This was a very fertile area and thickly populated. with Babylon itself falling a year later (ibid. According to Xenophon Cyrus conquered all that region of Arabia. 1Chr. Saunders (Interp. Note the names of the coalition and their relationship to the sub-tribes of Ishmael and also of Keturah to the south-east and to the far west of Tema. God raised Cyrus in 540 BCE to conquer the Babylonians. From the Early Iron Age I-II pottery (ca. These people are not to be confused with the Temani or Temanites who are a clan of the people of Esau (Gen. In 552 BCE (following Cohen). 36:11. 1:31) was one of the tribes at war with Israel in the Tranjordan (1Chr.

It is thus the lowlands east of the Jordan from its source to the southern tip of Lake Genessaret. 5:19). XIII. 337 n. Josephus describes a campaign against them by Aristobulus I in 105-104 BCE (Saunders. Appendix 1. It is not certain whether Iturea and Trachonitis were wholly distinct districts or overlapped or were identical. After the death of Lysanius in 36 BCE the kingdom may have been divided into several smaller districts. was located on the town of Panias at the source of the Jordan (Vol. Jos. 4:43. The exact boundaries of the Itureans of northern Palestine are difficult to define. and carefully distinguishes it from the territory of the Trachons. p. Vermes et al. Schurer says exactly the same thing in his work (The History of the Jewish People in the Age of Jesus Christ. The district of Panias. In the First Century BCE under Ptolemy and Lysanius the kingdom developed lands to its greatest extent. The Itureans were regarded by both Greeks and Romans as an uncivilised bandit people and they designated them . 561). Gad and Manasseh (1Chr. which was occupied by the Itureans.1 (37)) and Gaulanitis provided the eastern boundary of Galilee (vol. Strabo (Geography XVI. Edinburgh. Schurer details the extent of Iturea in his work. Originally they were a hill people living on the western slope of Anti-Lebanon and perhaps in the larger Lebanon region towards Phoenicia. Saunders holds that the people known from the Second Century BCE (by the Hellenised form) as ‘Itouraoi are undoubtedly the same tribe as the descendants of Jetur mentions in Genesis 25:15 and as being the enemies of Reuben. It belonged in earlier times to Zenodorus and before that it was the kingdom of the Itureans. II. 1Chr.Philip (Lk. 3:1). 1987. 1. p.16.). The comment by Luke referred in fact to only a small part of what was once a far greater kingdom..). xi.2. J. Vol. Clark. ibid. 6:56). He notes Gaulanitis to be to the east of the Jordan and taking its name from the Golon and was the ancient Bashan (Deut. 23:1).18) locates the kingdom of the Itureans in Anti-Lebanon in the Beqa’ valley with its capital at Chalcis. iii 3. ed. They were forcibly annexed by Judea and the men were forcibly circumcised (A of J. 20:8. 1. Josephus distinguishes upper and lower Gaulanitis and says Gamal lay in lower Gaulanitis east of Lake Genessaret (B. T. extending from the sea in the west to Damascus in the east and included the lands of Panias and Ulatha in the south. 21:27. and T. down to and perhaps including the northern borders of Galilee. 3).

Cicero and Strabo all mention their skill as bowman. The Hellenized name first appears in the second century BCE before Roman rule in Palestine. who was successor to Lysanius as a vassal of Cleopatra.vii.as both Syrians and Arabians. 85-40 BCE) and Strabo says he possessed “Massyas and the Mountainous country of the Itureans” (Geography XVI. XV. p.iv. loc. The Lysanius son of Ptolemy is not the Lysanius referred to in Luke and Josephus. Lucan.v. south of the Hauran. xv. Dict. Ant. The town contains the place of the tomb of the Prophet Abel. ibid.567).10). 10. The subsequent history is confused but it was probably divided into four parts. The references in Vergil. XIX.).). The tetrarchy centred on Abila was conferred by Claudius on Herod Agrippa I in 41 CE (see also Josephus. Antiq. Abila lay 18 Roman miles from Damascus on the road to Heliopolis and is now the village of Suk on the Barada and which lies on the remains of the ancient town. and archaeological evidence both at Abila (Corpus Inscriptorium Graecarun 4521) and Heliopolis (4523) has now confirmed that both Josephus and Luke are referring to this younger tetrarch who ruled Abila before 47 CE. It is a much younger Lysanius that Josephus is referring to. The southern borders of Philip’s territory also excluded the cities of Bosra and Salcah. cit.ii.1). hence Abila or Abilene (Schurer. which was the tetrarchy of Arca (Saunders. as we have inscriptions placing the Nabataean kings Malchus and Aretas over them. They formed a strong confederacy scattered throughout Lebanon. 3) (see also Saunders. At the instigation of Mark Antony large portions were given to Cleopatra. he ruled the principality until his death in 36 BCE. In 20 BCE Augustus conferred the tetrarchy of Zenodorus. Interp.. Pompey destroyed many of the fortified strongholds and reduced the area. His son Lysanius inherited the tribal principality and is referred to as a King of the Itureans by Dio Cassius (XLIX.32).1-2) confirm this. In 38 CE the territory of Soemus of the Itureans was seized by Caligula and later incorporated into the province of Syria. In the First Century BCE they were ruled by Ptolemy the son of Mennaeus (ca. and both Plutarch (Antony 36) and Josephus (Antiq.1 and XX. Saunders considers that it probably consisted of the northern territory below Heliopolis to Laodicea. . on Herod the Great who in turn bequeathed it to his son Philip (Josephus.

Naphish (the soul. cit. Auranitis.). Æmilius Secundus relates that he was sent by Quirinius against the Itureans in Mount Lebanon. Aemelius Secundus undertook a military expedition against the Itureans (Schurer. loc. p. xii. Iturea (Lk. That Iturea was in the region of Mount Lebanon is confirmed by an inscription of about the year 6 CE (Ephemeris Epigraphica. from an Aramaic inscription Schurer says that Hebran on the southern slope of the Hauran belonged to Philip (op. The Wikipedia states that Itureans are first mentioned by Eupolemus – as one of the tribes conquered by David (Eusebius. Philippics.However. Panias and also. p. Druze.. Pliny the Elder. 3:1) was a mixture of re-settled Jews. 112). 1881. Greeks. Syrians and Arabs. The tribe was defeated by the Transjordan Israelite tribes and survivors . 569). 12) and by Tacitus (Annals. and their cohorts and cavalry served all over the Empire. 30) – and subsequently by Strabo.cit. In 38 CE Caligula placed the Itureans under a Soaemus who died in 49 CE and the Itureans were incorporated into Syria. and the designations "Ala I. YDNA K2 Tarshish Phoenicians. The name of Massyas may also indicate another Arab or Syrian tribe. pp. After this incorporation the Itureans furnished soldiers for the Roman army. ix.. Gaulanitis. cit. Augusta Ituræorum" and "Cohors I. Augusta Ituræorum" are met with in the inscriptions (Ephemeris Epigraphica. Herod the Great settled Jews from Babylon in Batanea (Schurer. pp. p. he that rests. as Luke says. Certainly under Claudius the kingdoms of Chalcis and Iturea existed side by side. 194). refreshes himself. 537-542). They were known to the Romans as a predatory people (Cicero. Præparatio Evangelica. Josephus.. in which Q. The actual break-up of the area of the Itureans is placed by Schurer as most probably in the governorship of Quirinius when his praefectus Q. ii. Thus the Syrians were a composite of Ishmaelites and Aramites who are not descendants of Abraham and other nations. 338 n. some of whom designate the Itureans as Arabs and others as Syrians. In 38 Caligula gave Iturea to a certain Soemus. The Romans then raised auxiliaries from the Itureans once they were in Syria. and others. 1884. 337-338) and the populace in these areas of Batanea. who is called by Dio Cassius (lix. or rests) The ISBE records Naphish as the 11th son of Ishmael and the chief prince of the Arabian tribe that descended from him.). and were appreciated by them for their great skill in archery (Cæsar. Bellum Africanum. loc. Trachonitis. 23) "king of the Itureans.c. 20)." After the death of Soemus (49) his kingdom was incorporated into the province of Syria (Tacitus. l.

were taken captive. a people of the east. Oholiba'mah the daughter of Anah the son of Zib'eon the Hivite. the sister of Neba'ioth. but he is not the Ishmael discussed here. but they can be identified by their YDNA. They are also dealt with elsewhere in the papers dealing with Edom and the other sons of Abraham. They have moved all over the Middle East and all over the world. ancient. Ish'mael's daughter. first) They are identified as the Kadmonites. This tribe can be considered as a part of Judah today. Ked'emah (oriental. 7:52). Some became temple slaves and are listed among the families that returned from exile (Ezra 2:50. listed with the Kenites and Kenizzites of Edom. Marriage into Edom Genesis 36:2-3 Esau took his wives from the Canaanites: Adah the daughter of Elon the Hittite. chapters 40 and 41 mention Ish'mael the son of Nethani'ah.  . Thus we have identified the sons of Ishmael and their various movements and the likely places of their residence. 3 and Bas'emath. Jeremiah. Neh.

Appendix A Descendants of Abraham Arab Tribes in Iraq Tribe Sub Group Place of Settlement Federations (qabila) AL-BU MUHAMMAD centred in the Maysan governorate ‘ANZA (pronounced ‘Aniza) federation ‘AZZA federation around Balad DULAYM centred in the Anbar governorate Al-Bu Fahd group Al-Bu Nimr (from al-Ramadi) Al-Mahamda Al-Falahat Al-Bu Fahad Al-Bu Dhiyab Al-Bu Mahhal Al-Bu Issa (in Fallujah) Al-Jumeilat (in Fallujah) Al-Karabla Al-Bu Assaf Al-Bu Risha Al-Bu Aiwan Al-Bu Farraj Al-Karabla JUBOUR BANI KA’B federation centred south of the city of Basra .

and across the border in the Khuzestan province of Iran KHAZA’IL BANI LAM MUNTAFIQ A1-Sa’dun clan (tribal leaders) BaniMalik Bani Khalid (plural al- Khawalid) Bani Qais (Al-Qaisiyun) Bani Sa’id Bani Hassan (southern Iraq) Bani Khafaja Abbouda Al-Bu Salih A1-Mayyah Al-Izayrij Bani Zaid Al-Sharifat (An-Naasriya. south of Iraq) Al-Ghizi Al-Hameed RABI’A (pronounced centred around the Kut city area Rubai’a) Shammar the Ninawa governorate BANI TAMIM central and southern Iraq (sometimes written Timim or Temim) al-Suhail clan (tribal near Abu Uhuraib .

leaders) al-Turshan section centred in the Diyala governorate al-Kan’an section in the Basra governorate and across the border in the [[Arabs of Khuzestan/Khuzestanl] province of Iran Tikriti federation Al-Bu Nasir (includes Saddam Hussein) Al-Bu Ajeel Al-Shaya’isha ‘UBAYD al-’Alam and Tarmiya ZUBAYD Note: The ‘AZZA. JABUR. Janabi and ‘UBAYD federations above are all subsections of the ZUBAYD Baghdad area BANI TAMIM Shammar SHAMMAR is a subsection of the Tayy Tikrit area Shammer Jarba (Sunni) Shammer Toga (Shia) Zoba Al-Dulaym Al-Janabi Al-Nidawat Al-Ubayd . DULAYM.

Al-Azza Al-Akabi Al-Bu Mohammed Al-Bu Aitha Al-Bu Amir Al-Jubour Al-Muj ama’ Al-Ghrair Al-Ugaydat Al-Anbariyeen Al-Qarraghul Al-Dafaf a Al-Bu Muhyi Bani Saad Bani Lam Rubai’a Khazraj Shammar Toga Mosul area Al-Dulaim 100. most of them in western Anbar province Al-Hayali Al-Jubour Al-Lihaib Al-Bu Hamad Al-Bu Hamdan .000.

Al-Bu Badran Al-Bu Mitaywit Al-Ugaydat Al-Jihaysh Hadid Bayyat Khazraj Descendants of the Khazraj section of the Ansar Shammar subsection of the Tayy Tayy Tikrit area Al-Bu Nasir Tikrit Al-Bu Latif Hadithiyyin Rifa’iyyin Al-Ubayd Al-Azza Al-Bu Farraj Jawa’ina Baiji Lihayb Sharqat Al-Mushahadah An individual from this tribe will have the name of Mash-hadani Al-Mashayikh Tarmiya and in Al-Hawejah (The individual called Al-Mashayikhi) .

Najaf area Al-Bu Dush Al-Fatla Al-Ghazalat Al-Jaryu Al-’Isa Al-Shibil Al-Zagarit Bani Hassan Bani Assad Kaab Abu Gulal Hilla area Al-Bu Sultan Al-Bu Amir Al-Masoud Al-Jubour Al-Janabi Al-Ma’amra Al-Dulaym Al-Qarraghul Shammar Zoba’a Zubayd .

Jihaysh Khafaja Arnarah area Bani Lam Al-Bu Mohammed Al-Izayrij Al-Bu Darraj Al-Sudan Al-Beidhan Al-Sarai Al-Bahadil Al-Suwa’id Al-Issa Al-Maryan Al-Bazzoun Basra area BANI KAB Bani Malik Bani Assad Bani Mansour BANI TAMIM Bani Khalid Al-Shirish Al-Sayamur Al-Mayyah .

Nassrallah) AI-Sa’eed Al-Abbouda Al-Jawabir Al-Dhufayr Al-Dulaym Al-Qanaghul Al-Husseinat Al-Sharifat Al-Shuwailat Al-Ghizi .Al-Duwasir (Bedouin) Al-Mutawr Al-Mutayr (Bedouin) Al-Halaf Al-Eidan Al-Gatarna Al-Garamsha Al-Suwa’id Al-Ghanim Khafaja Rubai’a Nasfriyah area Al-Bu Salih (Alrumaieth.

Al-Bidor Al-Jubour Bani Rikab Bani Hassan Bani Khaigan Bani Assad Bani Zaid Chinana Hacham Al-Sa’doun (Tribal leaders of the Muntafiq federation that ruled southern Iraq. Kuwait and northern Arabia) Al Diwaniyah area Khaza’il Al-Bidayr Al-Jubour Al-Agra’ Al-Zeyad Al-Ibrahim Al-Bahahtha Al-Dulaym Al-Zirfat Al-Kurd Al-A’ajeeb Al-Ardhiyat .

Al-Izayrij Bani Hacheem Afaj Zubayd Chabsha Kut area Rubai’a A1-Shohman Zubayd Shammar Toga Bani Lam Giraish Al-Mayyah Al-Magasis Al-Dulaym Al-Jubour Kirkuk area Al-Ubayd Al-Jubour A1-Ni’aim Al-Bayyat Al-Azza Al-Tamimi Bani Zaid .

Shammar Harb Qays Jibari (Kurdish) Dawoudi (Kurdish) Salehi (Kurdish) Shwann (Kurdish) Zengena (Kurdish) Baquba area Shammar Bani Tamim Bani Zaid Bani Ways Bani Lam Al-Azza Al-Ubayd A1-Ambakiya A1-Bayyat Al-Girtan Al-Tatran Al-Ma’amra Al-Jubour A1-Mujama’ Al-Dafafa Al-Sigoug Al-Karkhiya .

Al-Khishalat Al-Maghamis A1-Zuhairiya A1-Dainiya A1-Suwa’id A1-Dilfiya Al-Ridainiya Al-Nida A1-Sumaida’ Al-Bu Jawari Qays Khafaja Rubia’a Shammar Toga Ramadi area Al-Dulaym Al-Ugaydat Al-Jaghayfa Al-Lihaib Al-Halabsa Al-Ma’adhid Al-Jubour Shammar Zoba’a (Zoba is a subsection of Shammer) Aniza .

Other northern tribes Al-Bayyat It is said that this was originally a Turkmnen tribe that later mixed with the al-’UBAYD Al-Hadid (plural al- Hadidiyun) The Bani Harb A1-Saadun Al-Shammawi UBAYD southern Haweeja plains Basra Families Descendants of the noble family of the Prophet Muhammad Barakat al-Naqib From the Bani Khalid (Khawalid) Muhammad A1-‘lsa Al-’Abdul-Wahid Najdi families al-Zuhair Other families al-Khudairy al-Mandeel al-Nama .

Kuwait and Bahrain are traced to this tribe. Kuwait. al-Rasheed al-Thukair Baraak Basha-Ayan Bacha-Chi Sheikh Khaz’al Khan (Mohammed Khan Family) Bedouin tribes ‘ANIZA (pronounced ‘Iniza) (The Royal families of Saudi Arabia. with clans in Saudi Arabia. Palestine. Iraq. Syria. Gulf countries. Turkey and Egypt. This is one of the largest Arab Bedouin tribes. The sheikh general lives in western Iraq.) Al-Dhufayr Al-Ghalal Al-Hassan Al-Mutayr Al-Sulayb Al-Bu Mitaywit Harb Shammar Al-Kharsa Sinjara Zoba Al-Sayih . Jordan.

Bani Khalid (plural Al- Khawalid) Al-Noor Descendants of the family of the Islamic prophet Muhammad Al-Awadi (Najaf) Al-Mossawi Al Yaseen (Najaf) A1-Mushahadah in Tarmiya Al-Ni’aym Kirkuk. Hawija and Baghdad Al-Bu Milais Samarra Al-Bu Badri Samarra Al-Bu Baz Samarra Al-Bu Aswad Samarra Al-Bu Abbas Samarra Al-Bu Darraj Samarra Al-Bu Issa Samarra Al-Bu Nissan Samarra Al-Bu Udhaym Samarra Al-Marasma Balad. Samarra and Baquba Al-Tarabla Tikrit Al-Bu Nasir Tikrit Al-Hadid (plural al- Hadidiyun) Al-Naqib family in Basra Al-Sadoun Basra Al-Ridaini in Basra .

Barakat family Basra Al-Hakim family Naj af Kamuna family Najaf Al-Qizwini family Najaf Al-Tabataba’i family Najaf Bahr Al-Uloom family Najaf Al-Khoei family Najaf Al-Kharsan family Najaf Al-Zuwain family Najaf Al-Zaini family Najaf Al-Taliqani family Najaf Al-Allaq family Najaf A1-Faqih family Najaf Al-Jazatiri family Najaf A1-Keshwan family Najaf Al-Hilu family Najaf Al-Safi family Najaf Al-Ghraifi family Najaf Al-Sharmuti family Najaf Al-Hamami family Najaf Al-Abu Tubikh family Najaf Al-Yasir Najaf Shubbar family Najaf Al-Saraf family Najaf Al-Adhari Al Diwaniyah Al-Suwafi Diwaniyah .

Baghdad. descendants of the former royal family Al-Gailani family Baghdad Al-Haideri family Baghdad Al-Alusi family Baghdad Al-Tatar family Baghdad Al-Wa’idh family Baghdad Al-Witri family Baghdad Al-Shahristani family Baghdad Al-Sadr family Baghdad and Najaf Al-Haboubi family Baghdad and Najaf Utayfa family Baghdad Witwit family Hilla Al-Rifa’i family Basra. Samarra and Ana Al-Muwashit Ad-Dawr A1-Mishayikhoun Dujail A1-A’raji family Mosul. Baghdad and Najaf Al-Husseini family Mosul Al-Bu Sab’a Mosul Al-Sada Tal Afar Al-Barzanchi family Sulaimaniya and Arbil Al-Naqshabandi family Sulaimaniya Al-Kasnazani family Kirkuk Al-Talabani family Kirkuk Al-Dawudi family Kirkuk Al-Rijaibat Kirkuk and Baquba Al-Kaysey Baghdad .Hashimi family Baghdad.

to be classified Harb (in ad-Dur) Al-Fallujiyyin (in Falluja) .Others.

.

Brief quotations may be embodied in critical articles and reviews without breaching copyright.) This paper may be freely copied and distributed provided it is copied in total with no alterations or deletions. . The truth is important to understanding the destiny of the sons of Abraham in prophecy.0 20070302-20070303-20070417) The identity of the sons of Keturah is not well known and is often confused with the sons of Ishmael. No charge may be levied on recipients of distributed copies. 212D Descendants of Abraham Part IV: Sons of Keturah (Edition 2. WODEN ACT 2606. AUSTRALIA Email: secretary@ccg. Christian Churches of God No. The publisher’s name and address and the copyright notice must be included. Christian Churches of God PO Box 369.org (Copyright © 2007 Wade Cox & anor.

ccg.org .This paper is available from the World Wide Web page: http://www.org and http://www.logon.

Descendants of Abraham Part V: Sons of Keturah .

Medan. was “removed from sight” – perhaps until these Last Days. Genesis 25:1-4 Abraham took another wife. Letu'shim. Midian is then shown as being removed after a catastrophe that befell the unjust. more will be written about Midian and the tribes descended from him. 3 Jokshan was the father of Sheba and Dedan. Midian was the most notable son. in that his descendants are mentioned more often in the Bible. Ishbak. whose name was Ketu'rah. and Le-um'mim. there are some clues in the historical records. Epher. and Shuah. The Tribe of Midian was used to effect that process through Moses’ sojourn in Midian and the preparation for the Exodus. The Surahs of the Qur’an. The Surah 11 “Hud” refers to the Arabian prophet Hud not mentioned in the Bible. written about four years before the Hijrah. The identities of their descendants down to the present day have largely remained a mystery. He was of the tribe of A’ad. The sons of Dedan were Asshu'rim. Surah 11:95 in the Qur’an says that one of the sons. Abi'da. the Qur’an and in secular records than any of his brothers’ descendants. Hanoch. who Pickthall says is identified with Jethro. (RSV) The six sons were probably born in the first half of the 1800s BCE. Surah 10 titled “Jonah” draws its name from the reference to the people that Jonah witnessed to and who believed (S. 4 The sons of Mid'ian were Ephah. Mid'ian. If Shu’eyb is indeed Jethro. Jokshan. 10:99). The Surah also mentions two other prophets. Salih of the tribe of Thamud. 2 She bore him Zimran. Both Surahs then devolve authority on Moses and Aaron.Perhaps the most enigmatic of all the descendants of Abraham are the Sons of Keturah. Their names are recorded in Genesis 25:2-4 and 1Chronicles 1:32-33. All these were the children of Ketu'rah. however. and Elda'ah. Midian. and Shu’eyb of Midian. deal with the concept of the revelation of God through the prophets. Hence. the Qur’an is explaining further the transfer of authority of the Scriptures to Israel through Moses and Aaron. The next Surah deals with the transmission of prophecy through the Arab prophets and also through the sons of Keturah in Midian. The basis is that Midian was the tribe of the father-in-law of Moses and thus closest to Israel in importance and location. saving only Shu’eyb and those .

who followed him. a daughter of Japheth. for the children of Ishmael and the children of Keturah are kept distinct in the story of their complaints against the Jews before Alexander the Macedonian (Sanh. Here Hagar and Keturah are each referred to as concubine. some of whom were Medes and sons of Japheth rather than the sons of Cush (see below). Hirsch and M. The Yakult Midrash makes a not unreasonable assertion concerning all three wives of Abraham. a Cushite. RSV). however. 12:1.e. Seligsohn. the concubine/wife of Abraham and mother of Ishmael. Still it seems that such was not the opinion of the Talmudic doctors. Abraham married three wives – Sarah. were continually paganised for millennia. H. from 6989). Sel. and Hagar. as with Moses’ wife in Num. Thus the reference to Kushite must refer to the robber tribes that inhabited the area of Babylonia. The Arabs. dismiss the idea of her being synonymous with Hagar. found only in Deuteronomy 33:10. namely piylegesh (SHD 6370). The Arabic name for Keturah is Saffurah.. chpt.E. 8) . for example. only the faithful were saved at that time. a daughter of Ham. It means perfumed or incense (SHD 6989). We will deal more with Jethro below. M. Keturah. including rabbinic literature. In other words. Some commentaries. a daughter of Shem. (ibid. claim that Keturah is simply another name for Hagar. Traditionally the Temple records also claim that Keturah was descended from Japheth. who was described as a Kushiyat (i. 91a). However. Keturah Keturah is one of the most evocative names in the Bible. the two women and their various offspring are mentioned quite separately on several occasions – in Genesis 25:6. and brings to mind the burning aroma of the sacrifices and the incense smoke that ascended as a sweet offering to the Lord. The word qetorah (SHD 6988. G. Messrs E. also means smoke of sacrifice or incense. It appears also that Abraham married Keturah about 65 years after taking Hagar as concubine. in their article on Keturah in the Jewish Encyclopedia.

5:15). publ. Selbie in A Dictionary of the Bible (James Hastings. with all the fragrant powders of the merchant? (RSV) Psalm 45:7b-8 Therefore God. 490-425 BCE) stated that: “Arabia is the last of inhabited lands towards the south. Song of Solomon 3:6 What is that coming up from the wilderness. has anointed you with the oil of gladness above your fellows. Edin. 24:5-7). myrrh. and it is the only country which produces frankincense. 15:23. Lk. 113). It was to be burned for a memorial. and exhales an odour marvellously sweet” (ibid. Arab. 25 1ff. The whole country is scented with them. but its use was forbidden with sin offerings (Lev. Myrrh is often referred to in conjunction with frankincense. According to Selbie. 30:34) used in both the Tabernacle and the Temple (cf. 2:1-2). III. 2:11. cinnamon. Sprenger [in Geog. an offering made by fire on the two piles of 6 loaves each of unleavened bread upon the ‘pure’ table within the Tabernacle and the Temple (Lev. perfumed with myrrh and frankincense. 6:20). Jn. Frankincense (lebonah: SHD 3828) was found almost exclusively in Arabia. The prophet Jeremiah mentions incense coming from Sheba (Jer. and adds: “Concerning the spices of Arabia let no more be said. (RSV) . and is associated with both the birth and death of Messiah (see Mat. 19:39-40). 1899) adds this comment on the sons of Keturah: From the meaning of the name Keturah. Arab genealogists maintain there was a tribe called Katura living in the neighbourhood of Mecca. cassia. 107). Frankincense was also uniquely used with the sacrifice offerings along with fine flour and oil (Lev. 5:11) or jealousy offerings (Num. and ledanum” (Histories.. 8 your robes are all fragrant with myrrh and aloes and cassia.A. 295] suggests that the ‘sons of Keturah’ were so named because the author of Gn. Herodotus (ca.. by T & T Clark. Mk. It was one of the four ingredients of the specially prepared holy incense (Ex. like a column of smoke. 1:9-10). ‘frankincense’. your God. knew them as traders in that commodity.J.

(p. It is thought to be the same as the Zimri of Jeremiah 25:25. Ishbak. Gen. 8). Thus we are dealing with the destruction of the Saudi Arabian coastlands. Zimran Zimran was the first son of Abraham by Keturah. The name is derived from zemer. a major element of which was Midian that occupied the east and south of the area of Palestine. Jeremiah 25 deals with the entire destruction of the Middle East commencing with Jerusalem and the princes of Judah to make them a hissing and a curse and from there on to Egypt and all the Middle East. and Elda'ah. 982) . Vol. his name means musical or musician (SHD 2175). art. We may perhaps compare also ZIMRI of Jer 2525. and Shu'ah. 33 The sons of Mid'ian: Ephah. All these were the descendants of Ketu'rah.5). It is mentioned by Jeremiah for destruction along with Elam and the kings of the Medes. This view was adopted as fact by the Hebrews and we may thus take it as reasonably certain (see Interpreter’s Dictionary of the Bible. We see also in Nehemiah 13:5 that frankincense was considered one of the Temple treasures. Abraham's concubine: she bore Zimran. Hastings’ Dictionary says of the place name Zimran: Possibly Knobel is right in connecting it with Zabram of Ptolemy (VI. “Keturah’. supposedly located west of Mecca. Hanoch. in this particular case. but it may have been beforehand. nation by nation.’ this animal having doubtless been the totem of the clan. meaning a woman taken for the purpose of bearing sons. of Mecca.This refers to the normal custom in the East of perfuming a bridegroom. Medan. The main city occupied by Zimran and his descendants was called Zabram. She obviously became Abraham’s second wife perhaps on the death of Sarah. the Messiah has been anointed above his fellow elohim. Abida. W. Jokshan. Sons of Abraham by Keturah In Chronicles 1. 1Chronicles 1:32-33 The sons of Ketu'rah. Epher. Mid'ian. ‘mountain-sheep or -goat. p.vii. She is later referred to as a wife showing a change in status (cf. on the Red Sea. 25:1). 3. (RSV) The sons of Keturah came to be organised into a sub-group of six tribes. We will examine this aspect separately. The sons of Jokshan: Sheba and Dedan. Keturah is referred to as Abraham’s concubine.

2. this is biblically impossible and Cohen finds the equation phonetically difficult. and the tribes from these brothers settled in northern Arabia. The major Arab tribes are the Qahtan Arabs who came from the Yemen. insidious (Strong: SHD 3370). Vol. These Arabized Arabs are the progeny of Ishmael and are regarded as being adopted into the progeny of the pure Arabs and these Ishmaelites from Northwest Arabia are called ‘Adnanian Arabs. He does however identify him as the father of Sheba and Dedan (Interpreter’s Dictionary of the Bible. Dedan is recorded as being the progenitor of the Asshurim. The error. had two sons Sheba and Dedan. Sheba and Dedan The second son of Keturah by Abraham. as mentioned previously. Jokshan. On Cohen’s analysis Jokshan may also be the person called Kahtan or Qahtan by the Arabs. 212A)). 963). 22) who was a son of Cush. 1:32). whose name can mean snarer (BDB). while the sons of Ishmael are called Arabized Arabs. They are not Ishmaelites. . ‘Jokshan’. Sheba and Dedan (Gen. They regard themselves as pure Arabs. being the sons of Raamah (cf. may explain another link made between two areas.. p. However. alternatively. the Letushim and the Leummim (Gen. v. p. Hastings’ Dictionary thinks it is quite plausible that Jokshan is identical with Joktan (see Tuch): “The two forms might represent respectively the Hebrew and the Aramaic pronunciation of the same word …” (ibid. 25:2-3. Joktan was the brother of Peleg and the Hebrews descended from him moved much further abroad. Another Sheba and Dedan are mentioned together in Ezekiel 27. however. one in Arabia and the other in the Hindu Cush (see the paper Sons of Shem: Part I (No. however. and some remained there at least until Jeremiah. Jokshan produced two sons. 743). They are the sons of Ya’rub bin Yashjub bin Qahtan. these are of a different lineage. hence by implication a birdcatcher. art. 1Chr. Jokshan He was the second-born son.We can see that the sons of Keturah moved into the Arabian peninsular before Israel even went into Egypt. 25:3).

Himyar of whom the most famous septs were: Zaid Al-Jamhur. son of Eber (from whom the Hebrews are named). Judham. Aws. and those who became the kings of old Syria. Kahlan whose most famous septs were: Hamdan. whet (BDB). although we can demonstrate their Semitic origin (see the paper Sons of Shem: Part I (No. namely the descendants of Jafna. the Letushim were occupied in the sharpening of cutlery and weaponry. Similarly. merchants and tinkers. Anmar. hammer. who were descendants of Asshur son of Shem. it refers to a different people from the Assyrians (also 804). In later Jewish literature the Asshurim are described as ‘travelling merchants’. Letushim (SHD 3912) means hammered or oppressed (Strong). cannot be tied to the sons of Keturah. Origin of the Name Arab These sons of Keturah who were to become the Pure Arabs were divided into many tribes. Lakhm.Confusion can arise with several of these names. Azd. Quda’a and Sakasic. however. Khazraj. This would also help to further explain the two major Semitic Haplogroups of the Greeks being J and I with the later major haplogroup being the Hamitic E3b from North African occupation there. Asshurim (SHD 805) means steps in the sense of taking steps to go somewhere. Sheba was the name given generations earlier to one of thirteen sons of Joktan. Thus two branches of the sons of Keturah may be involved in Greece. 212A)). The Gypsies. Leummim (SHD 3817) means peoples or communities. . Kinda. In later Jewish writings the Leummim are described as the ‘chief of those who inhabit the isles’. from a root word meaning to gather. Tai’. 2. For instance: although the term Asshurim here is related to Asshur (SHD 804). perhaps alluding to the Greek islands. These sons of Keturah may be the Laconian Greeks or Spartans although they did not inhabit the islands rather the mainland. directly related to a word (3913) meaning to sharpen. Mudhhij. that is. but the ones we know as the main two lineages of the sons of Ya’rub or the Arab sons of Jokshan were: 1. We see with the Asshurim and Letushim that they are travellers. all terms which could be applied to the modern-day Roma[ny] people or Gypsies.

Kinda The Azd. Joskshan was the father of Sheba and his lands were centred on the area and his people built that dam. 600 BCE and collapsed ca. under the leadership of ‘Imran bin ‘Amr Muzaiqb (ca. 146). On gaining strength he headed for Madinah (Medina) where he remained and his descendant Haritha bin Tha’labah had two sons. The last repairs to the dam wall were built from part of the town buildings. The dam was built ca. This immigration broke into four main sections. but known as Khuza’a. Lakhm and Judham 3. These Kahlan septs were forced to relocate because of Roman occupation of Egypt and Syria and the disruption of the long-standing trade routes under Roman pressure. it also controlled the land across the Red Sea in the Horn of Africa and that accounts for the extension of the legends of Sheba into Africa. by which time it and the culture there were no longer of importance. The first section under Tha’labah bin ‘Amr moved to Hijaz and lived between Tha’labiyah and Dhi Qar. Kahlan septs emigrated from the Yemen into the different parts of the Arabian peninsular prior to the breach of the Ma’rib Dam. who were famous at Madinah. The area of the Queen of Sheba in Southwest Arabia in that part of the Yemen was very rich while the dam there was operational. During its rule from before the Kingdom of Israel until the Romans suppressed its influence. He wandered with his people in Hijaz and settled in Mar Az-Zahran subsequently . We will now divide the Kahlan septs into four groups: 1. Banu Tai’ 4. The second section or group was headed by the son of ‘Amr named Halitha bin’Amr. which is referred to as the Great Flood (Sail Al’’Arim). wandered in the Yemen and after despatching pioneer scouts moved north. 600 CE. This shows that the city and area was in decline even then. with the nearby town buildings in varying states of decomposition. Azd 2. Its gates are still there today. Aws and Khazraj.A tribe of the Himyar called the Quda’a moved from the Yemen and on to the Samawa semi- desert on the borders of Iraq.

Thus the major section of the inhabitants of Mecca and Medina and Oman and the rulers of Syria are all of the sept of the Azd of the sons of Jokshan. These were ‘Ad. Some are certainly from the other sons of Keturah but draw their names from this founder of the Arabs who are named for him (see also the table to the paper Descendants of Abraham Part III: Ishmael (No. for example. after driving the original occupants of Makkah. These are the sons of Jokshan from whom the Arabs are named. which were subsequently renamed the Tai’ mountains. Emlaq. The fourth group. from where the tribe faded into oblivion. Thus the Perishing Arabs are older and from less successful tribes and even from the Canaanites that are also mislabelled Kushites. and others. The sons of Keturah fit into this amalgam and are perhaps often misclassed as sons of Ishmael or as sons of Ya’rub bin Yashub. Of the other two groups the one under Jafna bin’Amr went to Syria where he established the Kingdom of Ghassan. dwelt in Bahrain until they were expelled to Hadramout and Najd. The Palestinians. are not all the same people and . Jadis. 212C)). son of Abraham by Keturah. then settled in Makkah (Mecca).conquering the Harram and. the tribe of Jurhum. The Banu Tai’ also moved north to the Aja and Salma mountains. the Kinda. which was named for a spring of water in Hijaz where they had stopped for a time. we see the kings of Heerah established by Nasr bin Rabi’a. Early Arabs The earliest Arabs are called the Perishing Arabs of whose history little is known. The fourth group under ‘Imran bin ‘Amr went to ‘Oman where the tribe of the Azd became entrenched. Thamasam. and the descendants inhabited Tihama and became known as Azd of Shanu’a. father of Manadhira. bin Qahtan. Of the second major group Lakhm and Judham.

Religions Before the coming of Islam the Arabs were crossed between paganised Arabs and Christianised Arabs. The most prominent Christian kingdoms were found among the sons of Keturah in the Ghassanid and Lakhmid Kingdoms. Many were Nestorians. son of Abraham. Minaic. Wadd. the allies of the Phoenicians of Tyre and Sidon.” In medieval times ibn Kaldun defined as Arab only the nomadic Bedouin that can trace themselves to one of the original tribes. Ishmael is subject to the sons of Keturah who form the ruling class of the Arabs and will be liberated when Messiah comes. some Berbers might also call themselves “Arabs. son of Keturah. Some individuals such as the hanifs had adopted a monotheism and rejected the polytheism of the paganised Arabs. Qatabanic and Hadramatic (cf. both Muslims and Copts. However. Our job is to unravel this broad-brush picture and trace the origins of the people. Q1)). Aws and Khazraj (Alansari or Ansar). Islam is itself a version of Unitarian Christianity and the founders of Islam were Christians (see the Introduction to the Commentary on the Koran (No. Instead they spoke the South Semitic languages such as Sabaic (from Sheba). The same holds true for the Lebanese who are also K2 descendants of Japhethite Tarshish seamen. Alghamedey. Alkhoza’a. These sons of Keturah did not speak the early forms of Arabic such as East Aramaic. who is in sympathy with the aspirations of the Arabic speaking peoples”. article ‘Arab’ on Wikipedia). Morra. Other groups that reject the label Arab are the Berbers of North Africa and many branches of the Lebanese and the Egyptians. . Al-lat. These pagans worshipped a number of deities such as Hubal. The prophecy of Ishmael breaking free of his brethren has a new meaning. Alzahrani. Kurds do not define themselves as Arabs.are comprised of at least three groups of genetic diversity. such as the Saudi Arabians and those in the modern Gulf States. who lives in an Arabic speaking country. He contrasted this with the urban lifestyles where people were likely to be of Arabized descent. On its formation in 1946 the Arab League defined an “Arab” as follows: “An Arab is a person whose language is Arabic. The Pure Arabs we now know as Qahtanian Arabs are from the grandson of Jokshan. Aldosari. Manat and Uzza. Alharbi. Likewise. Alojman and so on. And the prophet ‘Muhammed’ was a baptised Christian of one sect where he was referred to as Abu Qasim before he was baptised into the Unitarian faith of the Churches of God. Famous Arab families of the Qahtanite groups can be recognised by the surnames such as: Alqahtani. Such distinction is still widely used.

Jews in Iraq and elsewhere considered themselves as Arabs of the Jewish faith. northern Yemen and the Al-Batinah region of Oman. southern Lebanon.2% of the population of the Near East and 39% of Lebanon and 10 to 15% of Syria. Christians make up some 9. Ibadhite. Two thirds of Arabs who migrate to the Americas and Australia are Christians. Proto-Arabic. others do not. That began in the 8th century BCE with the Hasaean inscriptions of eastern Saudi Arabia and the Thamudic texts of Arabia and the Sinai which were not connected with the Thamud. Some Arabs are also Jews. Christians comprise roughly 10% of the Arab Israeli population and 6% of the Egyptian population. Today Jews such as Mizrahi and Yemenite Jews are not considered as Arabs.” The term is rarely used today. The Kindite kingdom of Central Arabia allied with the Himyarite Empire of South Arabia. was not written in Arabic script but in the epigraphic South Arabian Musnad. Safaitic inscriptions did not emerge until the first century BCE. southern Iraq and southern Iran and adjacent parts of Saudi Arabia. There is a large section of J1 YDNA Haplotypes among both Arabs and Jews. Sunni Islam dominates completely in North Africa while Shi’a Islam is prevalent in Bahrain. In the late 4th century the Himyarite kings were converted to Judaism and their vassals. It was this rise in power there in the fourth century that saw the reaction of Arab Jews to the Unitarian Christian faith in the seventh century and the rise of Islam. Until the pro-Nazi and anti-Jewish actions of the 1930s and 1940s. The Lakhmids allied with the Sassanid Empire and the Ghassanids allied with the Byzantine Empire. the Kindites. Modern Christian Arabs are Coptic. 740 CE. parts of Syria. Language The Hebrew Bible refers to the Arvi (or Arabs) in connection with the inhabitants of the Syrian Desert and in Arabia long before the Qahtanian Arabs of South Arabia emerged. . Arab Jews were called Yehudin ‘Aravim or “Arab Jews. These Arabs converted to Judaism and had extensive influence across the Red Sea in Africa.Modern Muslims are broken into Sunni. Pre-classical Arabic emerged in the second century BCE from Qaryat-al-Faw near Sulayyil. which was ancient North Arabian. From the fourth century CE we see the emergence of the Christian kingdoms of the Lakhmids of southern Iraq and the Ghassanids in southern Syria. Shiite. or Greek Catholic. Maronite. Alawite and Ismaili. also converted to Judaism. The immense success of Islam saw the Khazars decide to convert to Judaism in the Russian Steppes ca. The Unitarian faith became absorbed into Islam. Some consider the Druze as a Muslim sect. Nestorianism disappeared. The Nabatean inscriptions are written in Aramaic but contain many Arab names. Greek Orthodox. Before Mizrahi was coined as a term.

The consonants b and m are often interchanged in Arabic and its predecessors. while the later Northern Arabs.. Some commentators say that Midian’s name may in fact be derived from the Semitic word for judgment. were the sons of Ishmael. 946). and Abd-al-Madan is commonly seen in the Arab systems as a family name. (cf. The Medans did not speak Chaldean but the Assyro-Babylonians did. discord or strife (SHD 4091). which was a Sabaean dialect of the sons of Keturah. There seems also to be a link with Midian as seen below. The Himyarite language. . Thus Arabic became the language of the Arabs from its use in the Qur’an. Arabic thus was spread through Arabization under conquest from France to China. The prophet says the Clear Book was rendered in Arabic so that they might understand. Interp. 318). art. Now back to the sons of Keturah. He apparently founded a number of northern Arabian tribes. 732 BCE).It is important to note that the Qur’an does not use the word ‘Arab. which lay slightly west of south of modern Taima.g. only the adjective ‘arabiyyun where is refers to itself as clear mubinun (Clear) Book in ‘arabiyyun (Arabic) (e. They were thus regarded as the true Arabs as sons of Keturah. and his name is preserved in the town of Madan. brawling or contention (SHD 4080). ‘Medan’. seems to be the north Arabic dialect probably of the Qays. This term carried a negative connotation from the text in the Qur’an. Midian was the progenitor of perhaps the most important of all six-brother tribes. Medan The third of Keturah’s six sons. including the tribes of Mecca. Madan or Medan is also mentioned in the inscriptions from the reign of the Babylonian Tiglath-pileser III (ca. This distinction was to lead to real enmity between the northern Qays and the southern Kalb especially in Spain. which became spoken in the south. Madan was perhaps turned into an Arabian god under the ancient system of ancestor worship. The Qur’an refers to the Lost Arabs al-‘Arab al-ba’ida and says that they were lost as a punishment for their idolatry or disbelief. Medan carries a name meaning contention. and influenced by Old South Arabic. also S. The nomadic Arabs or Bedouin were referred to as ‘a’rab. Vol. as with his brother Medan. Midian Although he was the fourth son of Abraham and Keturah. which was described by Al-Hamdani (d. Midian’s name means strife. where it was referred to as Badan. Dict. 3. Identifying these groups and tribes is a difficult task. Ayyat 43:2-3). The terminology used referred to sedentary Arabs living in cities such as Mecca and Media as ‘arab. Cohen. As such his descendants will be dealt with in greater detail than any of the others. being Arabized Arabs. p. Chaldean and Eastern Aramaic.

The term circumciser is first used in the Bible in the sense of the future father-in-law. The Wydah and Coast region of West Africa wait until 12 to 16 years and sometimes as late as 20. he sought to kill Moses. and Muslims circumcise from two years of age onwards. No Semites circumcise later than this age. She bore two sons to Moses: Gershom.The Midianite tribes were referred to in Egyptian and other literature.25ff. "And where is he? Why have you left the man? Call him. generally up to eight years in Kashgar and up to ten years in Turkistan. as it was not done by Moses initially." 20 He said to his daughters. 662). The term circumciser and circumcised for father-in-law and son-in-law seems to have entered the Hebrew language without retaining the connotation of which it originally had (see Encyclopaedia of Religion and Ethics (ERE) Vol. that he may eat bread. and stayed in the land of Mid'ian. (RSV) Zipporah means a bird (SHD 6855). 2:15. 19:13. "How is it that you have come so soon today?" 19 They said. and circumcised in the sense of “daughter’s husband” in relations to both the Midianites (Ex. 1:18. 18 When they came to their father Reu'el. It should also be noted that the south-western Arabs circumcise in multiples of seven days from birth. Thus we can infer that circumcision was performed by the father-in-law in both these people being the sons of Canaan and the sons of Shem. 4:11) and also the Sodomites (Gen. 4:25) shows a reinforcement of the act as performed on Isaac at the eighth day. It is only the sons of Ishmael among the Arabs that circumcise at the later age of twelve to thirteen years. 3. The incident with Moses and the circumcision of his son (Ex. 10:29 and Jdg.) Exodus 2:15-21 When Pharaoh heard of it." 21 And Moses was content to dwell with the man. The story of Moses’ flight to Midian is provided in Exodus 2. The Sarakolese of West Africa do likewise and the Mandingo of the Sudan wait for between twelve and fourteen years.14). meaning exile (SHD 1648). 23:15). 4:18. 17 The shepherds came and drove them away. and they came and drew water. It is also recounted in the Qur’an at Surah 28:22-28. The Turks circumcise between six and thirteen years. he said. . for example. and he sat down by a well. meaning God is help (SHD 461) (see 1Chr. 3:1. Num. 661. 16 Now the priest of Mid'ian had seven daughters. and Eliezer. and he gave Moses his daughter Zippo'rah. Yet that was not the precedent set by Abraham and seemingly Jethro did not perform that rite and certainly not on his grandsons. Ptolemy. "An Egyptian delivered us out of the hand of the shepherds. But Moses fled from Pharaoh. Ex. and filled the troughs to water their father's flock. calls them Modiana. and Moses was going to be punished for that negligence. but Moses stood up and helped them. pp. (See also Acts 7:29 cf. and even drew water for us and watered the flock. and watered their flock.

He was the progenitor of the Shuhites. 747). 859 B. and for the profession of the true religion. Dict. however. This may be correct as the two Septuagint sources use Iesbok (LXXA) or eosbak (LXXB) (cf. where it is mentioned as a land (mat) whose king was allied with Sangara (Shamgar?) of Gargamis (Carchemish) and others against Assur-nazir-pal and Shalmaneser II (c. p. Delitzsch (Z SKF ii. incline (Strong: SHD 7744). as shown above. reprint by Banner of Truth Trust. very little else is known about this tribe from either the Bible or secular sources. being probably of the posterity of Abraham. His name means he releases (BDB) or he will leave (Strong: SHD 3435). Apparently he and his descendants settled in the lands to the east of Canaan. art. Ishbak Ishbak was the fifth son of Abraham by Keturah.. Only the ancient Egyptians circumcised at 14 years and the Angaardi of the Murchison River in Western Australia do likewise from 14-16 years.Thus the circumcision practice among Semites also provides clues as to their origins. . and akin to Job.C. Most people assume Arabs are sons of Ishmael and circumcise at thirteen years of age. for wisdom and knowledge. however. Interp. London. Some South Australian tribes have adopted to wait until hairs appear on the face. Matthew Poole makes some interesting comments on this verse in Job. ‘Ishbak’. and one of Job’s ‘comforters’ (Job 2:11). Shuah Also called Shuach.92) identifies it with Iasbuk of the cuneiform inscriptions.). (A Commentary on the Holy Bible. that is very far from the truth. 2. Vol. emphasis added). 1685. Hastings’ Dictionary has this to say about Ishbak on page 501: Frd. son of Shuach. They were persons then eminent for birth and quality. the most notable of whom was Bildad. and living in the same country with him. this sixth and last of Keturah’s sons has a name meaning variously wealth (BDB) or dell. sink. 1962.

). chapter 10 where the main areas of habitation of the various children of Abraham are given. for the children by Keturah were gone to their own remote habitations. Dillmann. Keturah’s sons had moved away. ibid. as also to his sons by Ketura. This is repeated in Book II. Jews. The name Shuhite is Sauchaioon in Greek. The lineage of all six brothers is further extended in Chapter 25 of the apocryphal and perhaps spurious Book of Jasher and includes several names not found in the Bible.. these may have displaced the descendants of these sons of Keturah. Troglodytis. Ptolemy calls the latter Chaboras. . south of Carchemish and between the Balikh and Khabur rivers (cf. (Ant. et al). Josephus claims that the descendants of Abraham by Keturah went into Arabia and into a land called Troglodytes (from which we get the term Troglodyte.Shuah’s descendants were also well known to the Assyrians. According to Jasher. which is probably one of the two Chebar rivers referred to by Ezekiel (Ezek. Kegan Paul & Co. Keturah is said to have come from the land of Canaan and is therefore most likely descended from the Patriarch Ham rather than Japheth. 16. and described their land as being on the right bank of the Euphrates River. 1:1ff. or they may in fact have been descended from them. Holzinger. Accordingly Isaac married her. Canaan. Thus their lands are well known. according to Josephus. the inheritance being now come to him. presumably the sons of Keturah had already relocated elsewhere. meaning a cave-dweller).) The Victorian explorer Richard Burton says that a race called the Beni Thamud were also described as Troglodytes (The God-Mines of Midian. and to Isaac. who referred to them as Suhu. 1878). London. iii) This is confirmed somewhat by the Scripture saying that only Ishmael and Isaac buried their father Abraham (Gen. Jews. (Ant. That he left to Ismael and to his posterity the country of Arabia. I. 25:9). Josephus claims that by the time of Isaac’s wedding. a view in line with Arabic opinion that she was a Cushite (also from Ham) but which is contradicted by most other authorities. Bk. In his Antiquities of the Jews.

(p. children of the East … descendants (?Gn 256) of Abraham by Keturah (Gn 291. Hastings’ Dictionary has this to say about them: Kadmonites … Ewald [in History of Israel] and many following him regard the Kadmonites as equivalent to the Bene Kedem.The Kadmonites There is another tribe of interest when discussing possible descendants of Keturah: the Kadmonites. Bullinger lists them as part of the Nephilim in Appendix 25 to The Companion Bible from Genesis 15:18-21. 1879). We can. Job 13. Ezk 254-10). however. Whether they are to be viewed as a branch of the Ishmaelitish or of the Keturaean Arabs is not clear (p. 1 K 430. London. son of Jacob. Any Nephilim were exterminated. at times. The Land of Midian In his second book The Land of Midian (Revisited) (C. Jer 4928. associated with the Midianites and Amalekites. It seems better to regard the Kadmonites as a particular tribe like the other nations named in this list. Speculation that Job was a Kadmonite may be misplaced as he is listed in Genesis as being either the grandson or great-grandson of the Patriarch Issachar.295) In Genesis 25 we see that Abraham sent the sons of Hagar and Keturah away from Isaac presumably in order not to confuse their inheritances. … Job is regarded as one of them. Jg 712. Burton estimated that Midianite territory at one time covered quite an extensive area. as distinguished from the Ishmaelites. In the days of the ancient Midianites the frontiers were so elastic that. Kadmonite would be the designation of no particular tribe. Is 1114. In that case. coupled with the Egyptians in their fame for wisdom. but of the Keturaean Arabs. neighbours and conquerors of the children of Ammon. 154)). and the people there were absorbed into the sons of Abraham from the text in question. This view is quite incorrect as the tribes mentioned are other tribes of the sons of Noah and only one or two are Nephilim (see also the paper The Nephilim (No. . If he was also a Kadmonite it could only be by association with the Midianites and other sons of Keturah among whom he lived.. be sure that Kadmonite became an area term rather than a specific tribal group. but never for a continuity. The children of the East are represented in the passages referred to as occupying Paddan-aram. and were pushed forward even into Central Palestine. inhabiting Kedar. Kegan Paul & Co. they embraced Sinai. 831).

the Gulf of Aqaba. Num. The land loosely referred to as “Midian” in Bible atlases extends for up to 200 miles in a coastal strip alongside the Gulf of Aqaba and the Red Sea.e. which was found to be very rich in minerals and in turquoise stones. 31:22). so that by sending them “east” they would have to move in either a north-easterly or south-easterly direction to avoid the Salt (Dead) Sea. copper. (RSV) The same Hebrew word qedem (SHD 6924) is used for both eastward and east which seems an unnecessary repetition. as well as zinc. It may therefore have been much later and perhaps as a result of tribal over-crowding to the east of Jordan that at least one of the Keturan tribes. As Abraham was later buried at Mamre it could be speculated that he and his offspring were living near Hebron at the time. 7). and varies between 24 and 70 miles (40-110 km) in depth. eastward to the east country. i. Burton and his party took many geological samples from the land of Midian. He also refers to another city Modiama but this is situated inland in northern Midian. antimony and titanium ores. Genesis 25:5-6 Abraham gave all he had to Isaac. who were dominant in northern Arabia at the time. Ptolemy locates Modiana on the eastern shore of the Red Sea. Burton also maintained there were vast iron ore deposits to be found in the area. lead (cf. relocated directly south toward the Red Sea. which would have effectively sent them towards Ammon and Edom respectively. p. When analysed the samples were found to contain gold. The domination was finished by aid of a friendly clan of Kenizzites. In 1Chronicles 1:46 we also see Midian being defeated in the land of Moab. and while he was still living he sent them away from his son Isaac. holds that Cushan-Rishathain of Judges 3:8-11 was named for a tribe and was in fact a Jerahmeelite king who they identify with the Amalekites and Edomites. unless the latter when combined with country is intended to signify an unspecified ancient land. it appears that the Egyptians had operated gold mines and smelters in the area for centuries. In fact. It is said of Hadad the Edomite that he “arose out of Midian” (1Kgs. iron. Apparently . The Historians’ History of the World (Vol. 6 But to the sons of his concubines Abraham gave gifts. 11:18). Extensive remains of industrial activity such as gold extraction were noted by him. Midian. wolfram (tungsten). hence there was great fluidity of movement and perhaps some overlapping in the tribal areas. silver. 2.

south-west of Tebuk. Palmer’s exploration of the area identified the city of Midian (Madyan) with the extensive ruins of El Midayen.Modiama was second only in importance to Petra. Epher. No further lineages are mentioned in the Bible. and was known to the Arabs as ’Ofr. they apparently settled in the area of south-western Arabia. Ephah. meaning my father knows or father of knowledge (SHD 28). meaning a calf (SHD 6081). from the Arabic name for Jethro. however. . Epher. meaning God has known or called of God (SHD 420). the time of Sargon II. The ancient pre-Islamic city of Madyan is now Magha’ir Shu’aib. was the father of the tribes which settled in the northwest of the Arabian peninsula.47). the name Epher appears in the genealogy of Judah (1Chr. 715 BCE. 5:24). still carries the name of its founder. roughly in modern Ghuwafa. Sons of Midian Midian was the father of five sons: Ephah. The Epherite city of Ghifar. Hanoch. at the south-west foot of the Arabian peninsula. or the Khayappa Arabs. He was purported to be the father of the Kenites. 9th century BCE which refer to these people as the Abiyadi’. although local tradition during E. was the second son of Midian. meaning darkness or gloomy (SHD 5891). 2:46. was the progenitor of tribes referred to as the Yada’il in ancient Sabean inscriptions. His descendants in turn were called the Apparu as inscriptions from the time of King Assurbani-pal of Assyria show. 4:17). who were famed metalworkers or smiths. In Yemen. as well as among the half-tribe of Manasseh across the Jordan (1Chr. The Babylonian king Tiglath-pileser III calls this tribe the ’Ayappa. Abida(h). Eldaah. the Book of Jasher adds numerous sons produced by these five grandsons of Abraham. now modern Yemen. Another Ephah is also mentioned twice in the genealogical records of the tribe of Judah (1Chr. there are Minean inscriptions of ca. which was described as being Pharaoh’s Treasury at one time.H. As with their brother tribe. As with Ephah above. These tribes originally settled in the south-west region beside the Gulf of Aqaba. was the fourth son of Midian. about ‘three days distant’ from Mecca. as noted above. Abida(h) and Eldaah. Henoch (Chanoch). has the notable meaning of dedicated or [God’s] follower (SHD 2585). The last known reference to them is found in an inscription dated to ca. close to Medina.

on their way to carry it down to Egypt. an officer of Pharaoh. there was no water in it. which refers to Midyan himself. 25:1ff. 22:1ff. the sons of Keturah regarded as the Pure Arabs and the sons of Ishmael regarded as the Arabized Arabs. they stripped him of his robe. . the Midianites were cattle herders in accordance with the biblical account in Judges 6. which included Ishmaelites and also perhaps Medanites. 26 Then Judah said to his brothers.36 So when Joseph came to his brothers. 28 Then Mid'ianite [SHD 4084] traders passed by. and looking up they saw a caravan of Ishmaelites [SHD 3459] coming from Gilead.). The term used for these merchants in Genesis 37:28 is Midyaniy (SHD 4084) which is a native of the land of Midian. The first recorded contact between the Israelites and the Midianites is noted in Genesis 37. 25 Then they sat down to eat. and let not our hand be upon him. In Genesis 37:36 we see that the Midianites (SHD 4092. (RSV) We see here an apparent contradiction in that the Midianites are referred to as Ishmaelites. balm. and expands a little upon the text in Exodus 2. the son of Abraham. By the time of Joseph and the other tribal Patriarchs. Num. and sold him to the Ish'maelites for twenty shekels of silver. Genesis 37:23-28. the long robe with sleeves that he wore. II. 13:21). Medaniy) sold him in Egypt. we see the intermixing of the two main branches of the Arabs referred to above. for he is our brother. There are two different Hebrew words used for Midianite in the text. We can thus assume that the caravan that took Joseph to Egypt was made up of people dwelling in the land of Midian. chp. 36:35. with the ancient Arab tribes now disappearing and the Amorites. and myrrh.. … 36 Menwhile the Mid'ianites [SHD 4092] had sold him in Egypt to Pot'i-phar. This is a version of Midianite according to Strong but may well be another of the sons of Keturah of the Medani or sons of Medan. in every other instance in the OT texts the use of the word translated as Midianite is SHD 4080. They are mentioned in the Bible as being allied with the Moabites against Israel (Gen. These. our own flesh.The Early Midianites Josephus’ Antiquities of the Jews (Bk. may be the ancient Hyksos we see later in Egyptian history in the Nile Delta. and perhaps with the Amorites as well (Jos." And his brothers heeded him. Numbers 25:17 and 31:2-3 both use SHD 4084 in referring to Midianites. The pit was empty. 11) describes Moses’ introduction to Midian. let us sell him to the Ish'maelites. "What profit is it if we slay our brother and conceal his blood? 27 Come. the captain of the guard. 24 and they took him and cast him into a pit. and they took Joseph to Egypt. However. with their camels bearing gum. According to Josephus. and they drew Joseph up and lifted him out of the pit.

15:78. Surah 22.54 If they deny thee (Muhammad). as a sub-tribe of Midianites. if ye believe. who were forced at times to become cave-dwellers (Troglodytes) like the Kenites. then I seized them.42-44. denied (Our messengers). and several Surahs highlight the disasters that befell them after their rejection of the messengers. One of their crimes was in deceitful business practices. Lo! Allah verily is guiding those who believe unto a right path. 50:14. and turning aside from the path of GOD him who believeth in him. Surah 11 makes an interesting comment concerning the Midianites. and seeking to make it crooked. 44 (And) the dwellers in Midian. are seen as metal-smiths from their very name. threatening the passenger. 26:175. whereas in Exodus they are noted as being pastoralists (Ex. 37). or a combination of the two tribes.6a The people of Israel did what was evil in the sight of the LORD. when ye were few and God multiplied you: and behold what hath been the end of those who acted corruptly. Prov. In Genesis the Midianites are similarly portrayed as traders (Gen. The Midianites were to prove a troublesome people to Israel. Midian is mentioned in the following Surahs: 9:70. (Pickthal) We see here that those inhabiting Midian had been given the true teachings of God at one time. The person Shu’eyb here is Jethro. and (the tribes of) A'ad and Thamud. the Kenites. and God often used them purposely to punish the Israelites. 28:45. 2). Judges 6:1-2. 19:36. and how (terrible) was My abhorrence! … 54 And that those who have been given knowledge may know that it is the truth from thy Lord. Therefore give full measure and just weight. Although it is difficult to know whether the Prophet is speaking to the original Midianites or to the Ishmaelites. priest of Midian and Moses’ father-in-law. And remember.The people of Midian are mentioned many times in the Qur’an. 43 And the folk of Abraham and the folk of Lot. even so the folk of Noah. so that they may believe therein and their hearts may submit humbly unto Him. and diminish not unto men aught of their matters: neither act corruptly in the earth after its reformation. Baidhawi. 11:84 cf.71. 2 And the hand of Mid'ian prevailed over . but I indulged the disbelievers a long while. and the LORD gave them into the hand of Mid'ian seven years. In addition. 87 And beset not every way. et al. before thee. 86 Now hath an evident demonstration come unto you from your LORD. And Moses was denied. both angelic and human. in that they used two different kinds of weights and measures – buying by one and selling by the other (cf. it appears that a distinctive feature of some known as ‘Midianites’ is that they are merchants or traders. This will be better for you. The above injunction in the Qur’an to deal only in lawful and just weights and measures echoes that in the Bible (Lev. sent by God. 20:10). Tafsir-i-Raufi).

Hur. Zur of Midian was the father of princess Cozbi. 52).1). seventy-two thousand cattle. who are called kings (melek: SHD 4428) in Numbers 31. The telling comment of the Bible text was who dwelt in the land and thus we are dealing with the Midianites that dwelt in the land there. Jews. and by the Greeks.6 And Israel was brought very low because of Mid'ian. the cliff (2Kgs. Rekem. Hur and Reba. Israel. Verse 15 says that Zur was “head over a people and of a chief house of Midian”. Petra” (Ant. (RSV) Princes and Kings of Midian As recorded in Numbers 31:1ff. 32-34). however. iv. God subsequently blessed Phinehas for his decisive action on behalf of Israel (Num. Zur. and in so doing he turned away God’s wrath. who dwelt in the land. shortly before his death Moses was told to “take vengeance on the Midianites for the children of Israel”. Joshua 13:21 that is. whom Moses defeated with the leaders of Mid'ian. Rekem. earrings and necklaces (v. and because of Mid'ian the people of Israel made for themselves the dens which are in the mountains. The Midianites stretched along the coast for 200 miles and the army that was defeated was not all of the Arabian forces and families of Midian but those mustered there and the families from Petra living there. including their five kings. 14:7).. Arecema [El-Rekem]. called to our day under every King. Zur. who reigned in Heshbon. Rekem. namely Evi. sixty-one thousand donkeys (vv. The text in Joshua 13:21 also mentions the princes (nasiy: SHD 5387) of Midian. Petra was the ‘chief city and capital of all Arabia’ called in Hebrew Ha-Sela. and Reba. The Midianites were very rich in livestock as the booty taken from them showed: six hundred and seventy-five thousand sheep. all the cities of the tableland. gave his name to the “most conspicuous city among the Arabs. 25:11-15). bracelets.7. signet rings. (RSV) Josephus claims that the second of these kings or sheiks. Both were killed by Phinehas in righteous indignation. as the portion of plunder that the Israelites offered to the Lord amounted to sixteen-thousand seven-hundred and fifty shekels in the form of fashioned ornaments. such as armlets. and the caves and the strongholds…. the princes of Sihon. Evi. All the male Midianites and most of their females were killed. They also possessed much gold. the one who consorted provocatively with a prince of Israel. Evi and Rekem and Zur and Hur and Reba. . and all the kingdom of Sihon king of the Amorites.

Bantam rev. ed. I will depart to my own land and to my kindred. That they all slipped from the Faith is a matter of record. and Zeeb they killed at the wine press of Zeeb. following the Egyptians. Oreb and Zeeb. (RSV) There are also two kings of Midian mentioned in Judges 8:5. … this small bronze serpent was found in the Holy of Holies of a tabernacle! … It was found on the site of an older. They were killed by the Ephraimites after being pursued by Gideon and the other Israelite warriors. who had tried to invade Palestine but were defeated by Gideon. `I will give it to you'. "I will not go. Numbers 10:29-32 And Moses said to Hobab the son of Reu'el the Mid'ianite. The Midianites who. Oreb (meaning raven) and Zeeb (wolf). New York. and we will do you good. respectively). It is not without a touch of dramatic effect that we note that it was at an archaeological site showing signs of Midianite occupation that Benno Rothenberg found an idol in the form of a brazen serpent five inches in length and partly decorated with gold. "We are setting out for the place of which the LORD said." 31 And he said. are mentioned in Judges 7:25. converted this place of worship into a shrine of their own religion. (p. 147-8) The fact that Abraham instructed all his sons in the worship of the One True God makes it hardly surprising that monotheism and the worship of Yahovah of Hosts was found amongst them. Although there is much confusion over these names. it seems that Hobab was also known as Jethro (meaning his excellence). Judges 7:25 And they took the two princes of Mid'ian. "Do not . Egyptian place of worship dedicated to the goddess Hathor.. Moses' father- in-law. as they pursued Mid'ian. The Israelites are supposed to owe the strange cult of the brazen serpent to Reuel [aka Jethro]. 1982) briefly touched on some aspects of the Midianite religious system. Thus Midian occupied territory from the lands of Edom along the coast of Arabia south and east from Aqaba for 200 miles." 30 But he said to him. were mining copper on their own account at Timna. Early Midianite Religion Werner Keller in The Bible as History (Hodder & Stoughton Ltd. Other sub-tribes were linked to them. come with us. for the LORD has promised good to Israel.Two other princes of the Midianites. and they brought the heads of Oreb and Zeeb to Gideon beyond the Jordan. namely Zebah and Zalmunnah (meaning sacrifice and deprived of protection. 10:29). who was the son of Reuel or Raguel (Num. they killed Oreb at the rock of Oreb. Jethro: priest of Midian Moses’ father-in-law was called Hobab.

Chobab (SHD 2246) means cherished and is derived from 2245: hide as in the bosom. Reuel (SHD 7467. His Excellence." (RSV) Exodus 3:1a Now Moses was keeping the flock of his father-in-law. however. III. Jethro. son of Midian. Reuel or Reguel. It was obviously carried by the Priest of Midian as it was carried by the father of Hobab and by Hobab/Jethro himself. son of Abraham. According to Josephus. son of Rawail. Hobab. the priest of Mid'ian. which would explain the inspired advice he later gave to Moses regarding judgments given to the Israelites. perhaps by God. Jews. Hence. just as much as his own people. Yithrow (SHD 3503) means His excellence coming from Yithrah (SHD 3502. to cherish. there is some contradictory opinion over identity and this perhaps sums up the rather mysterious nature of the sons of Keturah and their descendants. as with the Keturah/Hagar question. It is thus beyond doubt that he was sheik and High Priest of Midian and hereditary religious leader of the tribe. 29) was Moses’ father-in-law. the Friend of God is the rendering of the names of Jethro. leave us. I pray you. Matthew Poole gives a reasonable explanation for this discrepancy in his comment on Exodus 2:18 below. 32 And if you go with us. Raguel is simply another version of this title (see Strong’s Hebrew Dictionary). while Reuel was his personal name. Re’uw’el) means Friend of God and is a title given to Abraham and was carried by Jethro as Priest of Midian.e. for you know how we are to encamp in the wilderness. Hobab had “Iothor [i. Jethro] for a surname”. son of Anka. Hobab. excellence). the same will we do to you. as in v. Jethro’s descent is given as: son of Nawil. whatever good the LORD will do to us. . and you will serve as eyes for us. Josephus (Ant. (RSV) The name Hobab (SHD 2246) means cherished or loved fervently. iii) claimed that Raguel (also Reuel. Other commentators claim that Jethro was an honorary title. son of Mour. Thus we are looking at Hobab the name and Jethro the title. Judges 4:11 (see below) clearly states that he was known as Hobab.

2 Now Jethro. how the LORD had brought Israel out of Egypt.).H. 1871) repeats the assertion that Jethro/Hobab was blind. notwithstanding which infirmity he was divinely commissioned to preach the true religion lately revealed unto Abraham. Moses' father-in-law. with Israel as the people of God (Ex. ii. El-Kesai states that his original name was Boyun. and to convert the people of his native city Midian. after he had sent her away. Other commentators add that he was old and blind. 1871). "The God of my father was my help. the priest of Mid'ian.. ibn Madyan. Moses' father-in-law. had taken Zippo'rah. affiliated to Israel on account of their good deeds (p. 117). p. came with his sons and his wife to Moses in the wilderness where he . daughter of Ishmael (Gen. and is said to be buried near Safed. but they are charged with ignorance by Ahmed ibn Abd el-Halim. The Kuturah or Pure Arabs. Sho‘eib. M. He fled to Palestine. Moses' father-in-law. but spare and lean. emphasis added) It appears that Jethro/Hobab. very thoughtful. 539. 36:4ff. Paris: Imprimerie Nationale. resent that birthright to this very day. as well as the sons of Ishmael. that he was comely of person. for which sin they were destroyed by fire from heaven. and delivered me from the sword of Pharaoh"). The Friend of God (Raguel: Josephus) took the fact of the supremacy over the Egyptians in the Red Sea as proof positive of the power of the Angel of Yahovah acting for the One True God. 48. See the paper Law and the Seventh Commandment (No. or strangers. They rejected his doctrine and mocked the blind prophet. Exodus 18:1-12 Jethro. Cambridge. Moses' wife. Moses’ father-in-law. Schwab’s version.” Jetro [sic. Elie'zer (for he said. Jethro alone escaping alive. and of few words (Sale’s Koran. Palmer in The Desert of the Exodus (Deighton.Another Reuel mentioned in the Bible is a son of Esau by Bashemath. while Midian was laid waste by an earthquake. "I have been a sojourner in a foreign land"). p. In the “Berakhoth. 3 and her two sons. as the Arabs call Jethro. Bell & Co. 260). 18:11). 18) … Some writers have made him the son of Mikhail. He was already a priest of Midian and it is obvious that he is observing the activities of the Being sent to Israel as proof of the birthright promises given to Isaac. is said to have been blind. (ftnt.] and Rahab are Gentiles. Burton in The Gold-Mines of Midian has this to say in his footnote on page 332: Jethro’s Moslem title is “Khatib el-Anbiya. of whom the name of the one was Gershom (for he said. E. ibn Yashjar. That view was to continue down to the writing of the Qur’an and is reflected in the Qur’an. on account of the words of wisdom which he bestowed upon his son-in-law (Exod. 4 and the name of the other. and had been given a commission to preach the true Faith. 5 And Jethro. heard of all that God had done for Moses and for Israel his people. UK.” or Preacher to the Prophets.

who has delivered you out of the hand of the Egyptians and out of the hand of Pharaoh. Exodus 4:18 Moses went back to Jethro his father-in-law and said to him. while Moses had earlier witnessed the defeat of Pharaoh. I pray. "Blessed be the LORD. 18:10). cf. and went into the tent. Jethro was the priest of Midian. the king of Sodom went out to meet him at the Valley of Shaveh (that is. verse 20 above and Ex. he was priest of God Most High. while Jethro and Moses are said to have exchanged Shaloms (SHD 7965. 19 And he blessed him and said.  Melchizedek was the priest of the Most High God. and how the LORD had delivered them. 20 and blessed be God Most High. "Blessed be Abram by God Most High. 11 Now I know that the LORD is greater than all gods." (RSV) ." And Jethro said to Moses. 10 And Jethro said. from 7999) blessed Abraham. "Let me go back.  Both Melchizedek and Jethro ‘blessed’/gave praises to God for their deliverance using very similar language (cf. 8 Then Moses told his father-in-law all that the LORD had done to Pharaoh and to the Egyptians for Israel's sake. and did obeisance and kissed him." 12 And Jethro. maker of heaven and earth. who has delivered your enemies into your hand! (RSV)  Abraham had just defeated Chedorlaomer. was encamped at the mountain of God. the King's Valley). 9 And Jethro rejoiced for all the good which the LORD had done to Israel. 6 And when one told Moses. and they asked each other of their welfare. (RSV) There are also some noteworthy parallels in the encounter between Moses and Jethro (Ex. when they dealt arrogantly with them. "Lo.  Melchizedek brought bread and wine for a ceremonial meal with Abraham. king of Egypt.  There is a general theme of “peace” and friendship in the two encounters: the king of Salem (SHD 8004. "Go in peace. 18:7. king of Elam. 18 And Mel-chiz'edek king of Salem brought out bread and wine. and Aaron came with all the elders of Israel to eat bread with Moses' father- in-law before God. Moses' father-in-law. to my kinsmen in Egypt and see whether they are still alive. all the hardship that had come upon them in the way. Jethro also arranged a sacrificial meal and bread to be eaten with Moses. from 7999) or Salaams in the typical Middle-eastern manner (Ex. offered a burnt offering and sacrifices to God. 18:1ff. because he delivered the people from under the hand of the Egyptians." 7 Moses went out to meet his father-in-law.) and the one between Abraham and Melchisedek recorded in Genesis 14. your father-in-law Jethro is coming to you with your wife and her two sons with her. in that he had delivered them out of the hand of the Egyptians. Aaron and all the elders of Israel. Genesis 14:17-20 After his return from the defeat of Ched-or-lao'mer and the kings who were with him. also 4:18).

16 when they have a dispute. 22 And let them judge the people at all times. but any small matter they shall decide themselves. they come to me and I decide between a man and his neighbor. "Because the people come to me to inquire of God. 18 You and the people with you will wear yourselves out. 19 Listen now to my voice. and place such men over the people as rulers of thousands. both for Moses’ sake and so that “all this people shall also go to their place in peace” (v. What was remaining of it at the time of the prophet was demolished in the following wars. and I make them know the statutes of God and his decisions. rulers of thousands. and of tens. hard cases they brought to Moses. ye have no GOD but Him … Sale says Midian was a city on Hijaz on the Red Sea. of fifties. and the people stood about Moses from morning till evening. then you will be able to endure. 25 Moses chose able men out of all Israel. and God be with you! You shall represent the people before God. and made them heads over the people. 23 If you do this. and they will bear the burden with you." 24 So Moses gave heed to the voice of his father-in-law and did all that he had said. of hundreds. and all this people also will go to their place in peace. of hundreds. O my people. 27 Then Moses let his father-in-law depart. Jethro advised Moses on a more practical way of doing this. of fifties. and all the people stand about you from morning till evening?" 15 And Moses said to his father-in-law. south east of Sinai and the same as the Modiana of Ptolemy. Surah 11:86 And unto Madian we sent their brother Shuaib. for the thing is too heavy for you. he said. "What is this that you are doing for the people? Why do you sit alone." 17 Moses' father-in-law said to him. and he went his way to his own country.). "What you are doing is not good. 14 When Moses' father-in-law saw all that he was doing for the people. Moses sat down among the Israelites to make judgment upon a number of matters (Ex. I will give you counsel. 21 Moreover choose able men from all the people. so it will be easier for you. men who are trustworthy and who hate a bribe. 20 and you shall teach them the statutes and the decisions. and of tens. you are not able to perform it alone.We see that on the day after these pleasantries. (RSV) Jethro in the Qur’an The Qur’an has much to say about Jethro (Shuaib) and the Midianites. and God so commands you. but any small matter they decided themselves. and make them know the way in which they must walk and what they must do. . such as fear God. worship GOD. every great matter they shall bring to you. 18:13ff. and bring their cases to God. 23). He said unto them. as is also shown when his wise counsel is heeded by Moses. Exodus 18:13-27 On the morrow Moses sat to judge the people. Jethro is depicted as specially favoured and directed by God. 26 And they judged the people at all times.

and the Tafsir-i- Raufi relates that he was descended from Lot. (89) O my people. to the utmost of my power? My support is from GOD alone: on him do I trust. "In the commentary of the Syrian Ephream. … However they say (after the Jews) that he gave his son-in-law that wonder-working rod with which he performed all those miracles in Egypt and the desert. the father-in-law of Moses. and be turned unto him: for my LORD is merciful and loving. (90) Ask pardon. What! though we be averse thereto? We will surely cast thee . He said. and he hath bestowed on me an excellent provision. out of our city: or else thou shalt certainly return unto our religion. . 13). the son of Midian. . and this was the reason he was cast out of the city along with other believers. 11:88 He [Shuaib] said. Jethro is called Shuaib" (Notes on the Roman Urdu Quran). whence he had the surname of Khatib al anbiyah. neither couldst thou have prevailed against us. we understand not much of what thou sayest. He was a priest of the Most High in Midian. let not your opposing of me draw on you a vengeance like unto that which fell on the people of Noah. Baidhawi says he was the son of Mikail. and I will not consent unto you in that which I forbid you.. (ibid.(92) Shuaib said. This is indicative of a schism in the religious beliefs of Midian and the beginning of the paganisation of the Arabs from the surrounding tribes. S. who were elated with pride. is my family more worthy in your opinion than GOD? and do ye cast him behind you with neglect? Verily my LORD comprehendeth that which ye do. out of our city. O my people. and also excellent advice and instructions (Exod. 223) It can be inferred from this that Shuaib (Jethro) had the true Faith. the son of Yashjar. xviii. we had surely stoned thee. Notes on the Roman Urdu Quran) 89The chiefs of his people. Rodwell relates a Jewish tradition of similar import regarding Jethro. tell me: if I have received an evident declaration from my LORD. Origin of the Arabic name of Hobab No miracles wrought by Shuaib are described either in the Quran or the Traditions. of your LORD. (91) They answered. or the people of Hud." (222. and unto him do I turn me. answered. We will surely cast thee. We see from verse 88 that at the very least he worshipped God. or the people of Salih: neither was the people of Lot far distant from you. or the preacher to the prophets. do I seek any other than your reformation. O Shuaib. Muslim writers generally identify Shuaib with Jethro. and we see thee to be a man of no power among us: if it had not been for the sake of thy family. Midian having married the daughter of Lot. O my people. and those who believe with thee. therefore.Shuaib. O Shuaib.

The ‘south country’ (KJV.". Judges 4:11 Now Heber the Ken'ite had separated from the Ken'ites. (363) The elohim speak of the destruction of the city of Madian/Midian in Surah 11:96.(91) A man of no power. and they went and settled with the people. Notably. Cinaeus or simply Kain (cf.g. (RSV) The Kedesh mentioned here is within the tribal lands of Naphtali in the northern part of Israel. Hence it appears that part of the Kenite tribe at some time became closely associated with or even incorporated into the tribe of Judah. which lies in the Negeb near Arad. in the Himyaritic dialect. 34:3) to the south of the former Canaanite city of Arad. The Kenites are variously referred to by classical historians as the Kenaioi. as we shall see. travelled with the children of Judah from Jericho (? cf. The Kenites The Kenites or Kainites (SHD 7017) were a tribe of smiths descended from Midian. Judges 1:16 And the descendants of the Ken'ite. they tend to receive favourable mention in the Bible. signifying also. some suppose that Shuaib was so. 24:22). the descendants of Hobab the father-in-law of Moses. hence Heber removed himself quite some distance from his fellow-Kenites. The Book of Judges tells us that the descendants of Jethro. 35:6-10) were also a clan of the Kenites and whose . Deut. son of Keturah. weak. or Negeb: RSV) of Genesis 20:1 is recognised as the land south of Palestine and adjoining Midian. went up with the people of Judah from the city of palms into the wilderness of Judah. (RSV) Arad was also the location for the Jewish town of Kinah (Jos. Moses' father-in-law. Num. The name Za-anan’nim in verse 11 appropriately means removings or wanderings. Jer. and had pitched his tent as far away as the oak in Za- anan'nim. as a defect which disqualified him for the prophetic office.Sale. which lay beyond the northern wilderness of Judah. blind. 15:22). which is near Kedesh. Jerahmeel was the great-grandson of the Patriarch Judah. "The Arabic word dhaif. and that the Midianites objected that to him. It is noted that the Rechabites (e. an event referred to earlier in verse 71 of Surah 9 concerning repentance. Kinaiaoi. Moses’ father-in-law. Their main area of habitation was probably in the south-east of Aqaba but they were to be found much further afield.

1Chronicles 2:55 The families also of the scribes that dwelt at Jabez: the Ti'rathites. therefore. VI. the father of the house of Rechab.” may have been teachers. and demolished the house of Ba'al.vii. from Salma. The Targums transform the name into Salmaite.16.. 15." So he had him ride in his chariot. "Is your heart true to my heart as mine is to yours?" And Jehon'adab answered." 25 So as soon as he had made an end of offering the burnt offering." 24 Then he went in to offer sacrifices and burnt offerings. and said to him. and said. This accounts for Jehu’s action in 2Kings 10. speaks of them as ‘the race of the Shechemites’ (Sikimitoon) in his account of Saul’s expedition (Ant. 28 Thus Jehu wiped out Ba'al from Israel. "If it is. "The man who allows any of those whom I give into your hands to escape shall forfeit his life. And Jehu took him up with him into the chariot. the guard and the officers cast them out and went into the inner room of the house of Ba'al 26 and they brought out the pillar that was in the house of Ba'al. p. who elsewhere calls the Kenites kentides. Bullinger (The Companion Bible) says of the Kenites: They became an ascetic people. by being mentioned here in connection with “scribes. and. he met Jehon'adab the son of Rechab coming to meet him. "Go in and slay them. 834. Now Jehu had stationed eighty men outside.55. Jehu said to the guard and to the officers." Jehu said. In a note to this verse. ‘the father of Beth-lehem’. 2Kings 10:15-16. The following text is from the end of one genealogical record of the House of Judah. give me your hand. that at least some of the so-called ‘Jewish’ scribes may have been originally Kenites who had become fully integrated with Judah. and he greeted him. (RSV) The scribes here are the sopherim (SHD 5608). and see my zeal for the LORD. and see that there is no servant of the LORD here among you. but only the worshipers of Ba'al. "Search. II. (Vol. 16 And he said. and burned it." So he gave him his hand. and the Su'cathites. 23-28 And when he departed from there. and made it a latrine to this day. who seems to be termed a Kenite in 1Ch 254. (RSV) Josephus.progenitor was Hammath. emphasis added) . It is possible. "It is. 27 And they demolished the pillar of Ba'al. These are the Ken'ites who came from Hammath. and he said to the worshipers of Ba'al." So when they put them to the sword. "Come with me.3). let not a man escape. … 23 Then Jehu went into the house of Ba'al with Jehon'adab the son of Rechab. The Sam. the Shim'e-athites.VS of Gn 1519 inserts the same name before ‘Kenite’.

Judges 5:24-27.42). 1:28. It is of note that Jael’s decisive action helped usher in a period of forty years of peace for Israel. he lay still at her feet. 26:29-31). In another incident we see that. of tent- dwelling women most blessed. "Am'alek was the first of the nations. 15:6). Saul honourably advised the Kenites to move away from their former associates in order not to be killed along with them (1Sam. Numbers 24:20-22 Then he looked on Am'alek. and your . she shattered and pierced his temple. mother of Joshua the Messiah (cf. Lk. she brought him curds in a lordly bowl. In 1Samuel 30:29 some elders of Judah are to be found in Kenite cities. where he sank. 27 He sank. he fell. at her feet he sank.31 "Most blessed of women be Ja'el. … 31 "So perish all thine enemies. (RSV) This blessing is reminiscent of the one upon Mariam. Heber and his family apparently went to Kedesh in northern Israel following Sisera’s defeat. the fate of the Amalekites and the Kenites was prophesied together in Numbers 24. Deborah the prophetess and ‘mother’ of Israel blessed Jael in her victory song because of Jael’s courage and resolve in killing Sisera. Saul gave the people the chance to save themselves in view of their help to Israel on previous occasions. 27:10). she crushed his head. there he fell dead. H. and said. the enemy of Israel. A. However. so Josephus’ comment may refer to the period before Manasseh’s occupation of that city. and took up his discourse. the Shechemites were at one time a sub-tribe of Manasseh (Num. Alternatively. Sayce notes that the Kenites were nomads like the Bedawin (Bedouin). 4:17). but in the end he shall come to destruction. and took up his discourse. although he claims that the latter are descendants of the Amalekites spoken of in Scripture. Jael was the wife of Heber a Kenite (Jdg.However. "Enduring is your dwelling place. the Kenites may have intermarried with the Manassites. 25 He asked water and she gave him milk. the wife of Heber the Ken'ite. and said." And the land had rest for forty years. she struck Sis'era a blow. The Kenites inhabited the Negev desert south of Judah (1Sam. after he was commanded to destroy the Amalekites." 21 And he looked on the Ken'ite. O LORD! But thy friends be like the sun as he rises in his might. he fell. 26 She put her hand to the tent peg and her right hand to the workmen's mallet.

Unlike other Greek cities. 22 nevertheless Kain shall be wasted. Solomon ruled with those lands under subjugation for a further 40 years to 938. The mention of nest in the rock here is a play on the word ken or qen (SHD 7064) and the tribal name Kenite. from Lacedaemon (or Laconia). 282C)). Tristram in The Land of Israel (op. 282B) and Rule of the Kings Part III: Solomon and the Key of David (No. the southern Peloponnese was Spartan territory. strictly-speaking the city-state of Sparta the capital. The Spartans Although there is some debate as to the true origin of the Spartans. 978 BCE. We will recall that David conquered Jerusalem and occupied it from Hebron ca.) claims that the caves of the Kenites were located around Engedi. the ‘father of history’. Mesoa. Earliest archeological evidence testifying settlement in Sparta dates from around 950 BC. which were later united under one government. It consisted of the four villages of Pitane. . 1005 BCE and ruled there for 33 years. probably at the same time that the Kingdom of Israel was conquered. in about 733 BCE. which were separated by the Taygetos mountain range. nest is set in the rock. also known as Petra. Laconia and Messenia. Sparta controlled much arable land. and Josephus claim that they were also descended from Keturah. 2Chr. Limnai and Konooura. cit. They occupied the better agricultural land of the Hellenes (see also the papers Rule of the Kings Part II: David (No. 20:2) which was originally occupied by the Amorites and is claimed by some to be the oldest city in the world. The rock is thought by some to be Sela. even older than Hebron with its very long record of continuous occupation. This is identified with Hazazon-tamar (dividing the palm tree. both Herodotus. A section of the sons of Kedar and Nabai’oth in northern Arabia near the Euphrates probably moved into the Hellenes on the expansion of David and established Sparta under the rule of Solomon before 950 BCE. … Classical sources [also] tell us that Sparta was founded in the 10th century BC. The territory was divided into two parts. The beginnings of this important city and state are given in the Wikipedia article on Sparta. Around the middle of the 6th century BC. He had occupied the lands of Kedar and of Mesech in Cappadocia and the control of those lands was extended to his son Solomon ca. They are often referred to as the Lacedaemonians. How long shall Asshur take you away captive?" (RSV) The northern Kenites (Kain) were thus to be taken captive by the Assyrians. that is.

He was supplanted also by the ephors in the control of foreign policy…. with an epistle. And [now] Hyrcanus's father. the king lost the right to declare war. "We have met with a certain writing. and left the high priesthood to his son Simeon. Ephors themselves had more power than anyone in Sparta. 12. died. Because most Spartan laws were passed down orally and committed to memory. died. and esteem your concerns as our own. chp. who brings you this letter. Demoteles. were the executive branch of the state. and was accompanied on the field by two ephors. a council consisting of 28 elders over the age of 65. 4) Other references to the Spartans or Lacedaemonians being of the same stock as the Jews are found in Antiquities Book 13: 5. I285a) … Dating from the period of the Persian wars. should send to us about any of your concerns as you please. Onias. reigned over Asia. iii. the collective body of Spartan citizenry. the gerousia. After the ephors were introduced. being the son of Antiochus the Great. and will look upon our concerns as in common with yours. Society The following are further selective extracts from the Wikipedia article. although the fact that they only stayed in power for a single year reduced their ability to conflict with already established powers in the state. High state policy decisions were discussed by this council who could then propose action alternatives to the Damos. elected for life and usually part of the royal households. and the two kings. who would select one of the alternatives by voting. Joseph. … The difference with today's states is that Sparta had a special policy maker. KING OF THE LACEDEMONIANS. 8 and in the apocryphal 1Maccabees 12:6. … His uncle also. Spartan society was considered primitive even by Greek standards. whereby we have discovered that both the Jews and the Lacedemonians are of one stock. who are our brethren. To him it was that Areus. sent an embassage. king of the Lacedemonians. At this time Seleucus. SENDETH GREETING. Onias his son succeeded him in that dignity. with a dragon in his claws. We will also do the same thing.Josephus gave credence to the claimed descent of the Spartans from Abraham when he wrote the following in his Antiquities of the Jews: 10. and the seal is an eagle. will bring your answer back to us. together with the two kings. This letter is four-square. little is known about Spartan society. and are derived from the kindred of Abraham (14) It is but just therefore that you. Aristotle describes the kingship at Sparta as "a kind of unlimited and perpetual generalship" (Pol. ." (Bk. TO ONIAS. they. And when he was dead. who was called Soter. the copy whereof here follows: "AREUS.

Not all inhabitants of the Spartan state were considered to be citizens (part of Damos). Only
the ones that had followed the military training, called the agoge, were eligible. However, the
only people eligible to receive the agoge were Spartiates, or people who could trace their
ancestry to the original inhabitants of the city. … The Spartan exercised the full rights and
duties of a citizen at the age of thirty.

A strong emphasis was placed on honor and carrying out acts because it was the 'right thing
to do.' Xenophon wrote about the Spartans as he observed them during an Olympic game:

"An elderly man was trying to find a place to sit and observe the Olympic Games, as he went
to each section. All the other Greeks laughed as he tried to make his way through. Some
ignored him. Upon entering the Spartan section all the Spartans stood and offered the
elderly man their seats. Suddenly the entire stadium applauded. All the Greeks knew what
was the right thing to do, but the Spartans were the only ones who did it." (emphasis
added)

Training in music and literature occupied a subordinate position. The tireless emphasis on
physical training gave Spartans the reputation for being “laconic”, economical with words, a
word derived from the name of their homeland of Laconia. Education was also extended to
girls, in the belief that strong and intelligent mothers would produce strong and intelligent
children. Thus modern day historians, with the corroboration of ancient writers, tend to
conclude that Spartan women were among the most educated in the ancient Greek world.

The term "Spartan" still remains synonymous for anyone rigorously self-disciplined or
courageous in the face of pain, danger, or adversity. … Sparta did not suffer under the rule of
any tyrant or dictator, and its phalanxes were considered undefeatable.

Interestingly, we see above that the Spartans were governed by a council consisting of 28 elders
plus the 2 kings, thereby unconsciously(?) mirroring the Inner Council of the 30 Beings in Heaven.

Military
The military prowess of the Spartans was unrivalled. The Battle of Thermopylae of 480 BCE is also
famous. 300 Spartan warriors under King Leonidas held the pass of Thermopylae for a number of
days against the might of King Xerxes’ Persian army (estimated by Herodotus to total 5.28 million
– although modern historians naturally dispute that figure and claim perhaps 400,000) as it was
attempting to invade Greece. 700 Thespian warriors were the only others who fought to the
death alongside the Spartans from a total of 6000 Greeks, the bulk of whom had been ordered to

retreat. Xerxes (the Ahasuerus of Esther) even sent his crack troops the Immortals against the
Spartans – they were also unable to break through. The Spartans were finally defeated by Greek
treachery, although the outcome was inevitable, and the Persians subsequently gained control
over central Greece. Herodotus gives a full account of this battle in his Histories (Bk. VII, 172-234).

The Spartans appear to have had a particular interest in the number 300. G. Rawlinson, in his
notes to the Histories, says that the Spartan bodyguard usually consisted of 300 men (VI, 56). In
Book I, 82 we also find 300 Spartans engaged in mortal combat with an equal number of Argive
warriors in order to determine the outcome of a battle without the main armies having to engage
– thereby limiting the bloodshed.

This common type of early combat was seen when Goliath of Gath challenged any single Israelite
warrior to come out against him (1Sam. 17:4-10); also, when 12 Israelites competed with David’s
12 warriors of Judah in single combat and with far deadlier import than merely rising up “to play”
as in the KJV (2Sam. 2:14-16); again, it was to avoid major bloodshed, although a full-scale battle
did ensue.

In Histories we are told that Aeimnestus the Spartan fought and died “with but 300 men against
the whole force of the Messenians” at a battle near Stenyclerus (Bk. IX, 64). This regular
reference to 300 fighting men may well be that Spartan folklore recalled the act some centuries
earlier of God through Gideon routing their Midianite cousins with the well-chosen band of
Gideon’s 300 men (see Jdg. chapter 7).

The Spartans themselves were a military society and accomplished warriors, so it could be
speculated that, out of admiration for the exploits of Gideon’s 300, they modelled themselves on
such men (see the paper Gideon’s Force and the Last Days (No. 22)). Their military society was
finally to be their undoing. However, until their defeat by the Romans they were unsurpassed.

Immediately before Thermopylae, Xerxes was advised by Demaratus a Greek with the Persian
army: “Thou hast now to deal with the first kingdom and town in Greece, and with the bravest
men” (ibid., VII, 209). Demaratus had earlier said:

So likewise the Lacedaemonians, when they fight singly, are as good men as any in the world,
and when they fight in a body, are the bravest of all. For though they be free-men, they are
not in all respects free; Law is the master whom they own; and this master they fear more
than thy subjects fear thee. Whatever he commands they do; and his commandment is
always the same: it forbids them to flee in battle, whatever the number of their foes, and
requires them to stand firm, and either to conquer or die (ibid., VII, 104; emphasis added).

The Spartan kings were supposedly descended from the hero Heracles (Hercules) who
conquered Sparta two generations after the Trojan War. The Trojan War was in 1054 at the last
years of Eli judge in Israel and two generations later placed them squarely in the rule of David
King of Israel.

Along with the Thracians, Scyths, Persians, Lydians and most Greeks, the Spartans in particular
were known for their love of war and their aversion to trade and ‘handicrafts’ (Histories, II,
167).

It is said that Laconia was eventually overrun by the Goths and Huns arriving from the east, and in
396 CE Alaric destroyed the city of Sparta. Sparta was finally defeated by Rome in about 195 BCE.

The paper titled The Genetic Origin of the Nations (No. 265) gives further information on various
tribes under the heading ‘Sons of Abraham’. To quote:

We know from the authority of Josephus that the Spartans were sons of Keturah. Thus the
large amount of YDNA Hg. I in Greece may be from the Sons of Keturah with the J coming in
later from the conquests in Asia Minor and from the Arabs in later centuries. There are
significant Semitic Hg. J populations around the Mediterranean but I is greater in incidence all
over Europe. Greece also has the largest percentage E3b population outside of Africa.

However, we now know that the IJ combined group based on S2 and S22 split into the two groups
and may have split in Greece also from the one IJ basic group that went in there.

The Druze

Several modern commentators claim that descendants of the Kenites are to be found today
among the Druze people of Lebanon, Syria and Israel.

The Wikipedia article states

The Druze call themselves The People of Monotheism or Muwahhidūn ("Monotheists"). The
origin of the name Druze is traced to Nashtakin ad-Darazi, one of the first preachers of the
religion.

The Druze reside primarily in Lebanon, with smaller communities in Israel, Syria, and Jordan.
While most Druze consider themselves Arabs, some living in Israel do not.[2] There are thought to
be as many as 1 million Druze worldwide, the vast majority in the Levant or East
Mediterranean.[3] However, some estimates of the total Druze population have been as low as
450,000.[4] … About 50,000 Druze live in the United States.

In 1167, noted traveller Benjamin of Tudela wrote about the Druze in his diary. He describes the
Druze as "Mountain dwellers, monotheists, believe in soul transfigurations and are good friends
with the Jews".

The Druze have played major roles in the history of the Levant. They were mostly scattered in the
Chouf Mountains, which are part of Mount Lebanon (known for some time as the Mount of the
Druzes), and later the eponymous Jabal al-Durūz (Mount of the Druzes) in Syria. … However,
many Druze living in the Golan Heights consider themselves Syrian and refuse Israeli citizenship,
while the remainder consider themselves Israeli. In general elections, the majority of Druze
villages have similar voting patterns as the general public. Israeli Druze also serve in the Israeli
army, voluntarily since 1948 …

The Druze community reveres the non-Jewish father-in-law of Moses, Jethro, whom Muslims call
Shu’ayb. According to the biblical narrative, Jethro joined and assisted the Jewish people in the
desert during the Exodus, accepted monotheism, but ultimately rejoined his own people. In fact,
the tomb of Jethro near Tiberias is the most important religious site for the Druze community.[7]

Beliefs of the Druze

The Druze believe in the unity of God, hence their preference for the name "People of
Monotheism" or "Monotheists". Their theology has a Neo-Platonic view about how God interacts
with the world through emanations and is similar to some gnostic and other esoteric sects. They
are not, however, influenced by the Sufi philosophy, as many believe. The Druze believe in
reincarnation and are pantheistic.

The principles of the Druze faith are: guarding one's tongue (honesty), protecting one's brother,
respecting the elderly, helping others, protecting one's homeland, and belief in one God. Another
well-known feature of the Druze religion is a fervent belief in human-only reincarnation for all the
members of the community. They reject polygamy, tobacco smoking, alcohol, or consumption of
pork, although pork and alcohol may be consumed in many non-religious and/or al-Juhl
households. Druze religion does not allow them to intermarry with Muslims, Jews, or members of
any other religions.

The Druze believe in prophets like Adam, Noah (Nū), Abraham (Ibrāhīm), Sarah, Jacob (Ya’qub),
Moses (Mūsā), Solomon (Sulaymān), John the Baptist (Yahya), and Jesus (Isā) (as mentioned
above, in contrast to members of the other monotheistic faiths, they also elevate Jethro, or
Shu’ayb, father-in-law of Mūsā, to the status of major prophet). They also believe in the wisdom
of classical Greek philosophers such as Plato and Pythagoras, who have the same stature as other
prophets. In addition, they have an array of "wise men" that founded the religion in the 11th
century.

...Druze are not required to follow the Muslim duties of prayer, fasting, or pilgrimage to Mecca.
However, they may should they be inclined to. One of the faith's holy books is called the Kitābu l-
Hikma or "Book of Wisdom", largely compiled by a mysterious figure called al-Muqtana. It has six
volumes and is compiled in chapters, each covering a specific issue. The teachings denounce
materialism, especially materialism relative to religion. The sacred books of the Druzes,
successfully hidden from the world for eight centuries, have since the middle of the 19th century
found their way into European libraries. [8]

Druze places of worship are usually very modest and the Ajawīd lead very modest lifestyles.
Prayer is usually conducted discreetly, among family and friends. There is little official hierarchy in
the religious community except for the Shaykh al-‘Aql, whose role is more political and social than
religious. A religious figure is admired for his wisdom and lifestyle. (emphasis added)

(Retrieved from http://en.wikipedia.org/wiki/Druze)

As with Judah and Ishmael, the strict monotheism of the Druze could point to these people being
direct descendants of Abraham by Keturah. And the fact that they venerate Jethro would strongly
indicate descent from this particular priest and prophet of Midian who also appeared well-
acquainted with the One True God. However, much like Christianity, the Druze’s faith has
apparently been infiltrated by Gnosticism and a belief in such ideas as reincarnation.

Their YDNA structure identifies them as the second largest ethnic group with Haplogroup G,
which is 19% and indicated they may have Assyrian bloodlines or they may have developed
Haplogroup G in isolation from the original F. The highest group of G are Georgians, and the
Assyrians are similar. The Georgians might be assumed to be a core of the ancient Assyrians.
However, that will be examined in the paper on the Sons of Shem. The Druze also have 33% L
which is indicative of Japhethite origin. The K2 structure in Lebanon is also Japhethite.

K2 also in Lebanon is derived from Tarshish traders in Phoenician systems. Midian is mentioned three times by the prophet Isaiah. shows some L in Kurds but not in Jews or Arabs. but no L among Jews or Palestinians. The Druze are thus not homogenous sons of Abraham. 10 F*. 34 J2. 1000 BCE at the time of David.Some samples of Lebanese YDNA are as follows (from Capelli 2005): Muslim Lebanese (39 people) 18% E3b. 4 I. 6 JxJ2. 21 J2. 4 K*. Malta (90p) 9 E3b. Cutheans and Medes placed in Israel by the Assyrians after the capture and deportation of the ten tribes of Israel in 722 BCE. 12% (F*xIJK. 30% JxJ2. and incidence among Kurds and Druze indicate that the Druze are probably a composite people that relate to the replacements sent in by the Assyrians on the removal of Israel rather than being descended from Jews or Arabs. 6 I. before the main Aryan conquests ca. The Samaritan results. The references to Midian in Isaiah 9:4 and 10:26 are in a negative light and concern the punishment meted out to his descendants as an example to Israel. shows 35% L haplogroup among a sample of Druze. The Kurds are Medes with some composite mixture. 18 F*. on the other hand. 32 R1b Sicily (200p) roughly averaging: E3b 23%. Thus the Druze are probably descended from the Assyrians. were similar to the Jewish results but just as varied. 7 P*(xR1) Compare these with the samples of Malta and Sicily. 4K*. G). 6 F*. 12 I. that is. 8 JxJ2. 22 R1b Reconstruction of patrilineages and matrilineages of the Samaritans by Shen et al. They appear to be related to the Aryans that went into India and formed the L Haplogroup there from as early as the Assyrian contact at Harappa and Mohenjo Daro. The Y chromosome of Jews The Y Chromosome of Jews by Nebel et al. 25% J2. 5 K*(xP) Christian Lebanese (43 p) 16% E3b. (See also Psalm . 21 J2. 4 K*. 9 JxJ2. Prophecies concerning the sons of Keturah Midianites As the most ubiquitous descendant of Abraham by Keturah.

His ways were as of old. Surah 29:36 And unto Midian We sent Shu'eyb [Jethro]. . and thy work. Cohen (Interp. 6 He stood and measured the earth. and do not evil. in the earth. Vol.) The Qur’an also has many injunctions directed at the Midianites. as linked by Habakkuk 3:7. 265) 2nd ed. the curtains of the land of Mid'ian did tremble. The term is also used to refer to the Kassites of Babylonia. Habakkuk 3:1-7 A prayer of Habak'kuk the prophet. I have heard the report of thee..). There is also a connection with the Land of Midian. 1. one in particular speaking of the end times. Selah 4 His brightness was like the light. The early YDNA of the Cushites is from HG C and develops from there but the YDNA groups of the Arab sons of Keturah and Midianites are not C or E3b but Semitic haplogroups (see the paper Genetic Origin of the Nations (No. In the midst of the years renew it. and the earth was full of his praise. in wrath remember mercy. 3 God came from Teman. 12:1). and the Holy One from Mount Paran. in the midst of the years make it known. 751) also holds this view and says it may be an older and poetical name for Midian based on the presence of tribes descended form Cush. ‘Cushan’.83:1-18. O LORD. 2 O LORD. their brother. and there he veiled his power. 5 Before him went pestilence. making mischief. Burton suggests that Cushan is possibly a more general term equivalent to Midian. and plague followed close behind. art. He said: O my people! Serve Allah. the everlasting hills sank low. he looked and shook the nations. (Pickthal) The Book by the so-called minor prophet Habakkuk contains a prophecy concerning the coming of Messiah in great glory. and the lands near there were traditionally called the Kingdom of Khus or Cush. He thinks it is probable that the word Cushite applied to the wife of Moses does not mean Ethiopian but rather refers to the Midianitess (Num. Cusham-Rishathaim) thinks the term is most likely related to a Midianite tribe near Edom. which ties in with the Arab conception of Keturah being a Cushite woman. 7 I saw the tents of Cushan in affliction. according to Shigion'oth.. Kraft (ibid. p. then the eternal mountains were scattered. rays flashed from his hand. Dict. art. (RSV) As noted earlier. do I fear. and look forward to the Last Day. His glory covered the heavens.

“dwelt beyond Arabia” (A Commentary on the Holy Bible. 4 Lift up your eyes round about. they come to you. They disappeared and consequently the Historians at that time thought they were a myth. 10:8). and thick darkness the peoples. son of Midian. shine. all those from Sheba shall come. They shall bring gold and frankincense. He also makes an interesting comment on Isaiah 60:6.). for your light has come. the rams of Nebai'oth shall minister to you. and shall proclaim the praise of the LORD. The power and wealth of this area lies in the hands of the Arabs. We now know from DNA that a branch of the same C YDNA groups have spread all over the world from Asia to Australia and to New Zealand and Polynesia and to the Mongols and into the Americas with the Nadene or Chippewa and down to the Apache and even to some sections of the Mayans who are Q3. 2:13. cit. . 7 All the flocks of Kedar shall be gathered to you. and your daughters shall be carried in the arms. they shall come up with acceptance on my altar. and is also prophetic. of which the Edomites and the sons of Keturah were no doubt part.The Historians’ History of the World points to the complex problem of the Cushites being both in Ethiopia and the Sudan and in Babylonia by pointing out that the confusion stems from the fact that the tribe in Babylonia was the robber tribe of the Kasshu or the Kossaeans and they dominated Babylonia for centuries. 6 A multitude of camels shall cover you. Here we see that Ephah and Midian are listed as two separate tribes. darkness shall cover the earth. your heart shall thrill and rejoice. The confusion with the early Midianites probably comes from the association of the Hyksos. op. and the glory of the LORD has risen upon you. 5 Then you shall see and be radiant. which we have identified now as the sons of Keturah and not the sons of Ishmael. The third mention of Midian by Isaiah is in chapter 60. they all gather together. The tents of Kedar and Nabaioth were in the northwest and extend to the Euphrates. nomadic marauders. the wealth of the nations shall come to you. The sluice gates are still there but the wall has never been rebuilt. but the LORD will arise upon you. and I will glorify my glorious house. and kings to the brightness of your rising. Q and C3 in that order of incidence. Isaiah 60:1-7 Arise. the young camels of Mid'ian and Ephah. 3 And nations shall come to your light. Matthew Poole states that Ephah. and his glory will be seen upon you. your sons shall come from far. and see. because the abundance of the sea shall be turned to you. Gen. 2 For behold. (RSV) They are mentioned as coming from Sheba which we now know is in Southern Arabia and was once the great oasis fed by the immense dams that deteriorated just as the Romans reduced Sheba in power by their occupation of Arabia and the dominance of trade. The Bible identifies them with the African branch also (cf.

4 I brought them to the house of the LORD into the chamber of the sons of Hanan the son of Igdali'ah.vi. or our daughters. you shall not plant or have a vineyard. and by them is implied the coming in of all nations unto Christ. Those concerning the Kenites are found in Jeremiah 35. namely the Kenites and Rechabites. for by these and such-like figuratively and borrowed expressions in several verses of this chapter is particularized several nations. as the Arabians and the bordering countries. this being the creature the Eastern people used for carriage of their gold and spice. that you may live many days in the land where you sojourn. son of Habazzini'ah. "Drink wine. 5 Then I set before the Re'chabites pitchers full of wine." (RSV) Jonadab or Jehonadab (meaning Jehovah is willing. the abundance of wealth and treasure that is brought upon camels. and therefore they are brought in as presenting the chiefest commodities of their respective countries … The dromedaries.' 8 We have obeyed the voice of Jon'adab the son of Rechab. 11 But when Nebuchadrez'zar king of Babylon came up against the land. the man of God. and other rich treasure. Jeremiah 35:1-11 The word which came to Jeremiah from the LORD in the days of Jehoi'akim the son of Josi'ah. our father. 9 and not to build houses to dwell in. and the whole house of the Re'chabites. and bring them to the house of the LORD. our father. and all his sons. (SHD 3082 and 3122)." 3 So I took Ja-azani'ah the son of Jeremiah. 10 but we have lived in tents. who were a branch of the Kenite tribe of which Jethro was the most eminent member. so called from their swiftness in running. Kenites and Rechabites Some of the descendants of Midian. We have no vineyard or field or seed. 7 you shall not build a house.' So we are living in Jerusalem. because. to which are the better enabled. hence these animals appear indicative of riches generally in a Middle-Eastern context. The multitude of camels. into one of the chambers. king of Judah: 2 "Go to the house of the Re'chabites. then offer them wine to drink. which are said to cover them. was noted as a reformer who kept himself pure” (Key Word Study Bible). and cups. for Jon'adab the son of Rechab. "We will drink no wine. above the chamber of Ma-asei'ah the son of Shallum. which was near the chamber of the princes. but you shall live in tents all your days. also or even the dromedaries. we said. keeper of the threshold. in all that he commanded us. our sons. and have obeyed and done all that Jon'adab our father commanded us. or. which are lesser sort of camel. `You shall not drink wine. to drink no wine all our days. `Come. you shall not sow seed. as “a later descendant of Rechab. i. commanded us. and his brothers." 6 But they answered. our wives.5: or whereby is understood those people that did use to ride on camels. Job 1:3 also mentions camels when describing Job’s great wealth (see also 1Chr. neither you nor your sons for ever.. are mentioned in certain end-time prophecies. emphasis in bold added). Bullinger also . and speak with them. cit.e. and let us go to Jerusalem for fear of the army of the Chalde'ans and the army of the Syrians. 5:21). This prophet was told to go to the house of the Rechabites. ourselves. and I said to them. the like phrase with that Judg. they can endure thirst four days together: (op. as Pliny observes.

a Bedouin tribe located near the Dead Sea also professed to be descendants of the same Kenite sheik.says that Jonadab became the sheik and lawgiver of the Rechabites. 26:5). Bullinger says of the Rechabites: They were descended from Hobab. In the sense it is used of Jacob it means Highlander or someone coming from the Syrian plains and the hills of Canaan. incidentally. Dr. Several distinctive features of the Rechabites are that they would build no homes and plant no crops. by inference. 21) We see from verse 2 in Jeremiah 35 that God calls for the Rechabites to be brought into His House. The assumption that the term Arab derives from Aram is incorrect. and the Arabs are not sons of Aram. Abraham was not descended from Aram but from Arphaxad. who migrated with Israel to Canaan … They were proselytes. . He was a man of Ur of the Chaldees in Akkadia. the landless who longs for land. 14:2). the pious who finds a palliative in God for his endlessly painful life. Jacob was described as a Syrian or Aramaean (Deut. London. Bruce Feiler. Wolff found a tribe near Mecca in Arabia which claimed to be descended from J[eh]onadab. inhabiting the wilderness south of Judah. In 1839. He’s a combination. It is possible that both are correct in their assumptions due to the habitual wandering of these people. On verse 2. as we saw earlier in 2Kings 10. or a wandering man. 2002). Their Patriarch Abraham was described as a Hebrew (Gen. others not) thus: Abraham is not a settled man. Aram does not mean semi- nomad. the brother-in-law [sic. It must be remembered that Jehonadab of the Rechabites assisted Jehu king of Judah in the destruction of the Baal system in Judah. not idolators. in which there are many chambers (cf. (p. the outsider who longs to be the insider. in his book Abraham: In Search of the Father of Civilisation (Judy Piatkus (Publ.) Ltd. his descendants (some of whom would be settled. as we see above. Jn. who embodies in his upbringing a message he will come to represent: the perpetual stranger in a strange land. However. ‘Aram (SHD means the highland or elevated plain and also was the name given to the son of Shem. summed up the semi-nomadic life of the Patriarch and. that verses 1-11 represent Jeremiah’s 30th prophecy in a series (The Companion Bible). A Kenite tribe. 14:13). but rather would live a nomadic lifestyle. He states.] of Moses. The real progenitor and the source of the name as a pure identity are with the son of Jokshan.

who resided near Mecca and played so important a part in the early history of Islam. Will you not receive instruction and listen to my words? says the LORD.H. and a branch of the Kheibari Jews. I have called to them and they have not answered. I have spoken to you persistently. cit. `Turn now every one of you from his evil way.' But you did not incline your ear or listen to me. which is in effect that they should assimilate their mode of life to that of the Arabs amongst whom they dwelt. and amend your doings.. but many of the customs of the Jews. to drink no wine. I am bringing on Judah and all the inhabitants of Jerusalem all the evil that I have pronounced against them. 432-433) Continuing with the text in Jeremiah: Jeremiah 35:12-17 Then the word of the LORD came to Jeremiah: 13 "Thus says the LORD of hosts. E. has been kept. they are laxer in their religious discipline than even the Bedawin themselves. and do not go after other gods to serve them.In The Desert of the Exodus. thus says the LORD. but you have not listened to me. 15 I have sent to you all my servants the prophets." (RSV) The purpose of referring to Jonadab’s prohibition on drinking wine by his people throughout their generations was not to condone this stricture. the God of hosts. sending them persistently. they have obeyed to the present day. 188)) – apart from applying to those in former times who were under a God-ordained Nazirite vow. a lineal descendant of Ka’ab. such as wearing the Pharisaic love-locks. 14 The command which Jon'adab the son of Rechab gave to his sons. which is generally unbiblical and unnecessary (cf.6. 16 The sons of Jon'adab the son of Rechab have kept the command which their father gave tem. The Kheibari are still found in large numbers about Mecca and Medina … by Dr Wolff and other learned travellers they have been identified with the Rechabites mentioned in Jeremiah xxxv. 17 Therefore. for they drink no wine and dwell in tents. Palmer. whose observances are really more Sabaean than Muslim. gives his opinion as to the identity of the Rechabites and their descendants. the paper Wine in the Bible (No. and then you shall dwell in the land which I gave to you and your fathers. Although professing themselves to be Mohammedans. but this people has not obeyed me. The immediate neighbourhood of Wady Musa is in the hands of Fellahin called the Liyatheneh … They are the sons of Leith [lion: Arabic]. who explored much of the Sinai Peninsula. because I have spoken to them and they have not listened. the God of Israel: Behold.7 … This precept. The Liyatheneh retain not only the distinctive physiognomy. the God of Israel: Go and say to the men of Judah and the inhabitants of Jerusalem. for they have obeyed their father's command. pp. and they drink none to this day. saying. (op. The modern Rechabites will most certainly be required to break their vow concerning abstinence by partaking of a small amount of wine at the annual .

1Samuel 15:22 And Samuel said. were not obedient to God in many other respects (see Isa. the God of Israel: Jon'adab the son of Rechab shall never lack a man to stand before me. the Rechabites would perhaps have fewer problems than most. (RSV) Having already demonstrated their compliance with a relatively minor injunction from their earthly father Jonadab. as in obeying the voice of the LORD? Behold. 1:13-14). 11:25). 15:1. otherwise they have no place in the Churches of God or in the First Resurrection. 18:15). along with the prophet Elijah (1Kgs. the obedience of the Rechabites was mentioned in order to shame Judah and Benjamin who. truly. to obey is better than sacrifice. as Christ himself said in John 6 (cf. with unquestioning obedience to God the Father once they are awakened to or become reacquainted with His Laws. I say to you. 19 therefore thus says the LORD of hosts. New Moons and Holy Days. cf. "Truly. The tribe of Levi was similarly required to “stand before the Lord” (Deut. (RSV) Rather. you have no life in you. for all their apparent piety and devotion in performing the requisite animal sacrifices on Sabbaths. unless you eat the flesh of the Son of man and drink his blood. John 6:53-54 So Jesus said to them. 10:8) to perform service as a type of first-born of all the children of Israel. 15:19).Lord’s Supper. and I will raise him up at the last day." (RSV) This is a signal honour for the Rechabites in having at least one of their descendants standing before the Lord forever. the God of Israel: Because you have obeyed the command of Jon'adab your father. as David did with Saul (1Sam. Jeremiah 35:18-19 But to the house of the Re'chabites Jeremiah said. 54 he who eats my flesh and drinks my blood has eternal life. and done all that he commanded you. It is noteworthy that they have already been given a high-value reward. "Thus says the LORD of hosts. and kept all his precepts. To stand before someone is obviously to enjoy special favour from them. 16:22) and Moses and Samuel did with God (Jer. also Jer. . and to hearken than the fat of rams. also 1Cor. "Has the LORD as great delight in burnt offerings and sacrifices. And God says He requires obedience (from the heart) rather than the sacrifice of rams (from the hand only).

Jeremiah speaks of a future time which resonates with that spoken of by another great prophet in Isaiah 2:1-5. The prophecy of Isaiah may well refer also to these men of Jokshan who dwelt in Sheba just before the dam was destroyed. and then by assisting the end-time work of publishing the Gospel to all nations starting with their respective tribes in the House of Abraham. the majority remaining largely undiscovered. These two most important spices were traded in early times by Arabians including Jokshan and Midianite merchants. However. A Call to Keturah’s Sons The tribes mentioned above are but a select few of those extant today that are descended from Abraham and his wife Keturah. from the land of Benjamin. along with the Jews and the Cherethites (Philistines). from the Shephe'lah. On current science. It would have to be demonstrated that K was a composite of Shem and Japheth for this to be even plausible. (RSV) This verse seems to speak primarily to Judah (also encompassing Benjamin and Simeon). the Kenites were known to be occupants of the Negeb. the “wise men” or magos of the East (to which vague area Keturah’s sons had been sent centuries earlier) arrived after Christ’s birth to present him with gold. Huns The Huns have sometimes claimed to be descended from the sons of Keturah although their YDNA structure is predominantly N. As descendants of Keturah and a sub-tribe of Midian. . from the hill country. As recorded in Matthew 2:1-11. and bringing thank offerings to the house of the LORD. hence an altogether strong Midianite connection. as the various areas mentioned equate roughly to the four quadrants of the extended land of Judah. as is the Finns’. Jeremiah 17:26 And people shall come from the cities of Judah and the places round about Jerusalem. cereal offerings and frankincense. All have their part to play by firstly responding to the call for a return to God and His Laws. frankincense and myrrh. bringing burnt offerings and sacrifices. and from the Negeb. We saw also in Judges 8:27 that the captured gold of Midian was used by Gideon to make an ephod. N is a derivative of F though K and related to the known sons of Japheth probably through Togarmah from its distribution. they will be part of this calling. and gold itself was found in abundance in the ancient Land of Midian. including the Negeb desert.

whether or not they might be sons of Keturah or otherwise we see that God very often favours the outcasts and weak of this world. In Hosea a call is made ostensibly to Israel. Hosea 2:16 And in that day. you will call me. 60:6 above). has been without the “water springing up to eternal life” (Jn. (RSV)] Just as Israel was typified by idolatry. Lamentations 3:45-46 Thou hast made us offscouring and refuse among the peoples. ‘My Baal’ [Baali]. ‘My husband’ [Heb. for this also is said of God’s beloved Israel – as long as the wandering results in all people finding their way back to Him. says the LORD. With respect to the plight of the Druze and the Roma or Gypsies. but with broad application to all who are willing to return to God. The Druze and all Islam have to alter their ways also. which to the Roma sounds depressingly familiar. This may be the time for those of Kenite descent to embrace and preach the true religion as zealously as did their ancestor Jethro. 46 "All our enemies rail against us. 9:17). (RSV) Like all other sons of Abraham and followers of Christ no matter from what tribe or nation. 4:14) for close on 4000 years (on “a thousand years is as a day” basis) and presumably would therefore have a great thirst for the Spirit of God in these Latter Days – together with the rest of mankind. the off-scouring of all things” (1Cor. it is prophesied that the descendants of these same people will one day remember God in far countries (Zech. the Roma would be required to put aside their false gods. who appears to have been directly commissioned by God. their dealing with the spirit world as “fortune-tellers” and become instead true prophets and servants of the God Most High. And the prophet Jeremiah noted that God’s people were often brought low and made contemptible in the sight of others. It is no permanent hardship to be an outcast or a “wanderer among the nations” (Hos. we could apply it spiritually and say that most of Midian. Ishi]. father-in-law of Moses. or any of the sons of Keturah for that matter. 4:13). Paul said that the true apostles and people of God are also considered “as the refuse of the world. 10:9). and no longer will you call me.If we accept Pliny’s observation that dromedaries can endure thirst for up to four days (see Poole’s comment on Isa. naturally. .

6 being ready to punish every disobedience. 2Corinthians 10:3-6 For though we live in the world we are not carrying on a worldly war. the end-time Churches of God. and live up to her name by becoming a truly sweet aroma to your Father in Heaven. 4 for the weapons of our warfare are not worldly but have divine power to destroy strongholds. Descendants of Abraham Part V: Judah . the father of all nations now being brought into the House of God. "every one who calls upon the name of the Lord will be saved. the same Lord is Lord of all and bestows his riches upon all who call upon him. and as lovers of law. "How beautiful are the feet of those who preach good news!" (RSV) You Sons of Keturah are called to return to the One True God whom your fathers knew. Once informed of the truth and fully convinced of it. Romans 10:12-15 For there is no distinction between Jew and Greek. Allied with their remarkable military prowess – demonstrated in the fierce defence of their nation against overwhelming might – it seems likely that their descendants would make unrivalled soldiers in the army of the Lord. to follow the example of your mother Keturah’s piety and nobility. 5 We destroy arguments and every proud obstacle to the knowledge of God." 14 But how are men to call upon him in whom they have not believed? And how are they to believe in him of whom they have never heard? And how are they to hear without a preacher? 15 And how can men preach unless they are sent? As it is written. and to eventually become known as ‘friends of God’ like your illustrious and blessed Patriarch Abraham. they would presumably act upon it and help carry the message without fear or favour to their fellow Keturites and beyond. when your obedience is complete. and take every thought captive to obey Christ. (RSV) The skills of the Spartans could be put to better use spiritually in the service of God today. 13 For.Those of Spartan descent may have retained their forebears’ nobility of spirit and sense of knowing and (more importantly) of doing what is right (as in the example of giving place and honour to an old man at the Games).

In the Last Days the blindness will be lifted and the Holy Spirit will be poured out on Judah so that they are converted and the Plan of God is implemented. Soon they will repent and their eyes will be opened. Descendants of Abraham Part V: Judah Introduction It is a matter of Scripture that Judah will be converted in the Last Days and the hardening of their hearts will be removed. They need not have suffered as much outside of the Plan of God but they are a stiff-necked people and a hardness did come upon their hearts. . The sequence of the changes of Judah’s beliefs and the trials they have suffered when seen in context of Scripture and prophecy are recognisable as fitting into the overall structure. 298). 13). Judah had to be removed from Israel and the physical Temple destroyed because of their blindness on the first part and the Plan of God in relation to the Temple on the second part. A hardening came upon the hearts of Judah. The blindness that came upon Judah is detailed in the paper War with Rome and the Fall of the Temple (No. and the Messiah had to be killed in accordance with prophecy.Scripture tells us that a hardening came over the hearts of Judah and that in the Last Days they will turn and be converted so that Messiah might return to his own people and his own inheritance. The sequence was done in accordance with prophecy we see from Daniel regarding the Temple and as explained in the paper The Sign of Jonah and the History of the Reconstruction of the Temple (No.

that Jews in Britain received full and equal rights as citizens. There has always been a question of freedom and persecution for Jews. and the right to operate under Mosaic Law – and calling for the revocation of all anti- Jewish laws. including Egypt. Cromwell. It wasn’t until over 200 years later in 1858. In the same way. marked the 350th anniversary (equal to 7 Jubilees) of the decision by Oliver Cromwell as Lord Protector to readmit the Jews to England. England was thus the first European country to formally expel the Jews following several hundred years of persecution. hence there was no actual law of expulsion to revoke. Their story is Scripture and Scripture cannot be broken (Jn. or 29/120. Most of the members of that committee of judges. Persia. freedom of religion – including their own synagogues and cemeteries. sought to readmit the Jews for a number of reasons. However. Their expulsion. Rabbi Menasseh ben Israel of Amsterdam. In 1655 he presented a petition to the Council of State in England asking that the Jews be granted freedom of trade. For an example of their handling we will turn to England. lasting about 366 years. Judah will survive and they will overcome and be restored. or placing themselves in league with. It was noted that the ban by Edward was by royal prerogative only and not by any Act of Parliament. had been by edict of King Edward I enacted on All Saints’ Day in 1290. those nations. Cromwell and his Puritans had also sensibly supported an earlier parliamentary ban on the celebration of Christmas. Their readmission came about mainly through the efforts of one man. and the nations allied with. merchants and clergymen were in fact opposed to the idea. Saints’ days and other non-biblical holy days. 294)). however. 10:34-35). The prophecies cover the Middle East. However. who died in 1658. Many of his fellow . The Jews in England The year 2006. no decision was made by the committee formed to look at the question of their readmission. but Cromwell himself gave permission in 1656.They still have a number of trials to endure (see the paper War of Hamon-Gog (No. prophecy deals with the Church and with the other nations surrounding the Holy Land.

Someone who visited the Sephardi Synagogue in Creechurch Lane. Bevis Marks. In that sense the Jews are being reunited with Israel and the nation called Israel is really a section of the Commonwealth. the Jews had set up business in Amsterdam and had been instrumental in making the city one of the busiest ports in the world at that time.000 Jews in the UK. . The primary reason was apparently for straightforward commercial advantage.she admitted afterwards that what had amazed her most was not the Hebrew or the rituals. Since their formal readmission. It is ironic that Israel and Australia are grouped together in the same division of the world by the Rome agreements.” In October 1663. it has been a long-standing tradition to ask for God’s blessing on the monarch as the symbol of national stability. There are more Jews in the USA than in Israel and the US and British Commonwealth is the true home for the majority of Judah today. … It is not just the present Queen for whom the Jews have prayed. Rabbi Jonathan Romain wrote an article entitled ‘Pariahs. while for others it was a matter of political expediency. Expelled earlier from Spain and Portugal during the Catholic Inquisition. but the discovery that Jews recited a Prayer for the Royal Family at every Sabbath service. Today there are about 300. some kings and queens have deserved it less than others. the Jews have become fully integrated into British society and have proven themselves loyal servants of the Crown and an invaluable asset to the country in a great number of ways. they did build booths on the other side of the Thames and keep the Feast of Tabernacles in them. London in 1662 was told: “One year in Oliver’s time. as there was a lucrative trade operating between Holland and England at the time and the Jews were recognised as master traders and merchants who could facilitate that trade. In The Times (London) of 1 June 2002. founder of the Anglo-Jewish Historical Society. although. frankly.” And settle they did. part of which reads as follows. out of an estimated 13-14 million scattered throughout the world. When the late Princess Margaret visited Maidenhead Synagogue ten years ago . in ever-growing numbers. as early as 1643 … suggested to Cromwell the desirability of settling Jewish merchants in London. wrote early in the 20th century on what he considered was the motive for readmission: “It was really the deficiency of bullion in the country which. Lucien Wolf.the first Jewish worship she had attended .Puritans had a sincere interest in the Hebrew language and literature and felt a certain sympathy for the ‘people of the Old Testament’. remains the oldest in Britain today. the immediate successor of which. the famous diarist Samuel Pepys also visited this Sephardi Synagogue. Following Cromwell’s decision many of these Sephardi and other Jews began moving to England and reintroducing some aspects of Torah-observance to Britain. heroes and a loyal people: how England’s monarchs saw their Jewish subjects’.

the Jews … were formally declared to be “the chattels” of the Crown. giving Jews rights of residence and protection. as there is a genealogical table in Windsor Castle actually showing their descent from King David. Perhaps unknowingly. Their relations with William II were even more cordial and he even jested that he would consider converting to Judaism if they could out-debate his bishops . The majority of the subjects of the Crown. Such dedication and respect for the Monarchy is rarely to be seen among the most loyal of her other subjects. although it was never put to the test.org/_domain/ccg.htm Many royals know this fact. 7:13. however. This definition held many advantages. 2Samuel 7:12-17 When your days are fulfilled and you lie down with your fathers.org/Sabbath/2004/S_07_03_04. levying punitive taxes on the Jews … For her part. remain in ignorance to this day.ccg.16. See the paper From David and the Exilarchs to the House of Windsor (No. Elizabeth II.much to the horror of the latter. Her silver jubilee coincided with the true year of Jubilee. but for now they are more than happy to join in the acclaims of ‘Long live the Queen’ (emphasis added). 67) and the Sabbath Message 16/4/27/120 at: http://www. began her reign in February 1952. the Jews are actually praying for their own kin. As newcomers to the country. so that the year 1977 was her official jubilee (albeit a silver one. They were seen as a trustworthy element in an otherwise unstable population. … Subsequent kings abused this special power. Elizabeth II has treated her Jewish subjects as they would wish: exactly the same as everyone else. the present Queen. responsible directly to the Throne and belonging to it. David’s everlasting throne Both kings David and Solomon were told that the throne they had been given would be everlasting (2Sam. Christian or otherwise. i. who shall come forth from your body. The relationship between the Crown and the Jews started with William I. when a settled community was established here after he brought across Jews from Normandy to help colonise his new kingdom. a half jubilee). 33:17). with Orthodox and Progressive rabbis participating alongside other religious leaders. As a point of interest. Jer. Queen Victoria (reigned 1837-1901) was fully aware that she occupied the throne of David. with Anglo-Saxons wishing to be rid of him and his own nobles vying for power. The first year of the new jubilee in 1978 was the beginning of the true 120th Jubilee of God’s Calendar. I will raise up your offspring after you. … Most Jews would be delighted to see a multi-faith element to any future coronations.e. and I will establish his . as it has been proven that members of the present Royal Family are direct descendants of King David of Israel and are therefore of the tribe of Judah.

'" 17 In accordance with all these words. only to become enforceable.g.' … 45 But King Solomon shall be blessed. When he commits iniquity. but the promise regarding the continuity of the royal line on Israel’s throne would never be revoked. Neither has the physical throne of David disappeared for 2600 years or so (i. and his testimonies. saying." (RSV) And again in the Psalms: Psalm 89:35-37 Once for all I have sworn by my holiness. 2Chr. I will chasten him with the rod of men. with the stripes of the sons of men. 4 that the LORD may establish his word which he spoke concerning me. there shall not fail you a man on the throne of Israel. as Scripture unequivocally indicates they will. (RSV) It could be inferred from some Scriptures that total obedience to God and His Laws was required for the promise to remain in force regarding the physical throne of Israel (e.e. The latter have not been repealed for the last two thousand years since the death of Messiah. your throne shall be established for ever. 13 He shall build a house for my name. in the coming Kingdom of God. 1Kgs. 3 and keep the charge of the LORD your God. 132:11-12). 2 "I am about to go the way of all the earth. irrespective of obedience by the kings (and queens) who would ascend it. 14 I will be his father. 16 And your house and your kingdom shall be made sure for ever before me. to walk before me in faithfulness with all their heart and with all their soul. 37 Like the moon it shall be established for ever. his commandments. 1Kings 2:1-4. as it is written in the law of Moses. and I will establish the throne of his kingdom for ever. he charged Solomon his son. 2:1-4. However.45 When David's time to die drew near. his throne as long as the sun before me. 'If your sons take heed to their way. saying. and in accordance with all this vision. as I took it from Saul. only to reappear when Messiah comes to take up his kingship. In verse 14 of 2Samuel 7 above. Nathan spoke to David." (RSV) An analogy can be made between the throne of David and God’s Laws. his ordinances. 15 but I will not take my steadfast love from him. and the throne of David shall be established before the LORD for ever. it appears that Solomon and the kings after him would be chastised severely for their sins. walking in his ways and keeping his statutes. Be strong. Rather. both the royal line on the throne and God’s royal Law have been in continuous operation from their inception. and he shall be my son. 36 His line shall endure for ever. whom I put away from before you. that you may prosper in all that you do and wherever you turn. Ps. 6:16. kingdom. . I will not lie to David. verse 45 of 1Kings 2 suggests the throne would be established forever from its inception. it shall stand firm while the skies endure. and show yourself a man. since the captivity of Judah in 586 BCE).

The elect in fact are of the superior Melchisedek priesthood. 21 then also my covenant with David my servant may be broken." 23 The word of the LORD came to Jeremiah: 24 "Have you not observed what these people are saying. and the Levitical priests who minister to me. The Levitical priesthood mentioned is now (since the destruction of the Temple at Jerusalem) the elect among the Churches of God. The Law of God is similarly called royal (Jas. which the present Queen in particular has consistently demonstrated. Day and night have come at their appointed time with absolute certainty since the Earth was renewed. 26 then I will reject the descendantsof Jacob and David my servant and will not choose one of his descendants to rule over the seed of Abraham. Royal obligations This royal aspect brings with it certain privileges as well as duties. God offers a challenge in verses 20 and 21. 16 In those days Judah will be saved and Jerusalem will dwell securely. so I will multiply the descendants of David my servant. 25 Thus says the LORD: If I have not established my covenant with day and night and the ordinances of heaven and earth. She was born to a job she never wished for and which is thankless at the best of times. of which the Levitical was only a temporary subset. in the same way that the present Royal Family has obligations to the United Kingdom and the entire Commonwealth. so that he shall not have a son [or sons] to reign on his throne. If there are any ‘privileges’ of royalty they are ones associated with selfless dedication and service to the nation. says the LORD. vv. and he shall execute justice and righteousness in the land. unlike that of Melchisedek (1Pet. 25-26). 2:8). 15 In those days and at that time I will cause a righteous Branch to spring forth for David. and my covenant with the Levitical priests my ministers. Isaac. and Jacob.' 17 "For thus says the LORD: David shall never lack a man to sit on the throne of the house of Israel. For I will restore their fortunes. and will have mercy upon them. of noblesse oblige. 22 As the host of heaven cannot be numbered and the sands of the sea cannot be measured. which currently consists of about 54 nations and is undoubtedly the Ephraimite company of nations spoken of in Genesis 48:19. Jeremiah 33:14-26 "Behold. when I will fulfil the promise I made to the house of Israel and the house of Judah. starring Helen Mirren in the title role. And this is the name by which it will be called: 'The LORD is our righteousness. 2:9). hence God’s covenant concerning them has never been broken – and neither has His covenant of putting an unbroken line of David’s descendants on the throne of Israel (cf. . the days are coming. 18 and the Levitical priests shall never lack a man in my presence to offer burnt offerings." (RSV) In anticipation of widespread scepticism. as alluded to in a recently-released film The Queen. We see also that the Levitical priesthood is never referred to as royal." 19 The word of the LORD came to Jeremiah: 20 "Thus says the LORD: If you can break my covenant with the day and my covenant with the night. who have performed the continuous spiritual service since the Holy Spirit was given in the new era. and to make sacrifices for ever. to burn cereal offerings. so that day and night will not come at their appointed time. 'The LORD has rejected the two families which he chose'? Thus they have despised my people so that they are no longer a nation in their sight.

as a result of their accomplishments.23% of the world’s population. but the fight for justice and freedom. They are about recognising God’s image in the weak. the afflicted. in his book To Life! A Celebration of Jewish Being and Thinking (Warner Books. in which he tried to prove that Moses was actually an Egyptian] … failed to see that he had come face to face with one of the most powerful moral truths the Bible ever taught. the suffering. NY. about 25% of the world’s scientists have been Jewish). either individually or collectively. to invention and commerce. A child of slaves can be greater than a prince. It’s moral courage. However. it is that Jews are just as flawed. dealing professionally with Jewish families. must surely rank as the most talented and productive group of people. and fighting for their cause. 23 June 2001). Only by being true to his people and to God did he become a hero. God’s standards are not power and privilege. I was a congregational rabbi for thirty years. Moses. though we are all their spiritual descendants. Freud [author of Moses and Monotheism. From an objective and unprejudiced viewpoint we see that the Jews. has helped them to literally make ‘the desert bloom as a rose’ in the State of Israel. … . God loves. Had Moses been an Egyptian prince. had something to say about things ‘royal’ from a biblical perspective. and to the law.The Chief Rabbi of the United Hebrew Congregations of the Commonwealth. in discovering that he is the child of slaves. just as imperfect as anyone else. The Bible suggests that royalty isn’t about privilege and wealth. They thereby invite envy if not outright hatred from less-energetic and less-creative peoples. had this to say about the Jews who. Judah’s pre-eminence As mentioned earlier. Kushner. in marked contrast with many of its neighbouring states. splendour and palaces. finds greatness. It’s not power that matters. Rabbi Harold S. They possess natural intelligence and great energy which. … the story of Moses is one of the great narratives of hope in the literature of mankind (The Times (London). bar none. Those whom the world despises. from science and medicine (since the mid-1800s. Professor Jonathan Sacks. the powerless. he would have been eminently forgettable. They have been pioneers in virtually every field. who together account for only about 0. just as average. for instance. might consider themselves to be superior to other people: What does it mean for us as Jews to consider ourselves a “chosen people”? It certainly does not mean that we think we are better than other people. art and music (both as composers and performers). There is no claim of Jewish biological superiority … We have no way of knowing how many of today’s Jews are the pure biological descendants of Abraham and Sarah. the Jews have made an enormous contribution to the UK and most other countries as well. and if there is one thing I know beyond the shadow of a doubt. 1993).

The key there is that God chose. I will bring into the land into which he went. The origin of the Jews is detailed in the paper Genetic Origin of the Nations (No. Judah’s pre-eminence and pioneering spirit were demonstrated in former times by the fact that they were required to march in the vanguard of the armies of Israel (Num. But it is a historical fact that the Jews. It is estimated that Judah actually occupied one-third of the entire western side of the Jordan once all the tribes had been settled in their respective areas. The tribe of Simeon also came to be incorporated or enfolded into Judah’s territory (Jos. Numbers 14:24 But my servant Caleb. and were the first to move out of the camp following the Ark of the Covenant. chose to make the Jewish people the instrument of His self-revelation to the world (p. the representative of the tribe of Judah. 32). and it is no one’s right to question that or be envious toward those whom He has chosen. Messiah is referred to as a Lion of the Tribe of Judah. so . The fact is that only about a third of Jews are actually even Semitic let alone Jews. During the wars of conquest and possession in the Promised Land. gave the world the Bible … God. 15:13-17). although it retained a separate identity. because he has a different spirit and has followed me fully. and his descendants shall possess it. and no one else. as this tribe is included with Judah in their inheritance and was scattered amongst Israel. Their ensign or standard was a young lion (cf. Judaism is a religion now and not a single people. 19:9).9 and 14. his descendants were not to possess the land on a continuous basis. as noted also in the Book of Numbers. (cf. it appears that when Judah is spoken of in Deuteronomy 33 it includes Simeon. Gen.9). 64:8). 49:9). 1:3). (RSV) Even though Joshua the Ephraimite was also loyal and apparently had the right spirit. 265) 2nd edition. 19:1. as were the generations of Caleb. and was essentially because Caleb the son of Jephunneh (of the tribe of Judah) had “wholly followed the Lord God”. Jos. and is himself set in the vanguard of spiritual Israel. The reason for this is contained in verses 8. as He is the Master Potter who fashions and selects human vessels for use according to His will (Isa. 2:2-3. There was also the close historical relationship between Simeon and Levi (Gen. Jdg. for reasons of His own. They should be and will be praised. 49:5). Just as the term Joseph most often applies to the combined tribes of Ephraim and Manasseh. Judah uniquely was given its inheritance in the territory which that tribe had conquered (Jos. 14:6-15.

More recently. It is purely a political matter. all descendants of the Patriarch Abraham: We are both the same race. Judah’s enemies Just as spiritual Israel. Israel is not going to go away. . in the 20th century. whose plan was thwarted by Esther and Mordecai (Est. the true Unitarian Law-keeping Church of God. and secondly. The origins of these people and the determinations of what is to happen to them is dealt with in the other papers in the series dealing with those countries. and more recently between the differing sects of Islam. And shared tears do bring people closer together. and perhaps suggests that this tribe will one day be praised by its brother tribes and the rest of the world as having been a vital instrument of God’s salvation. quite apart from Judah having provided the Messiah through King David. as if this would somehow solve the chronic and intractable problems in the Middle East. along with the mass extermination in Hitler’s Germany and its occupied (and often complicit) territories in Europe. has suffered intense persecution over the centuries. On several infamous occasions Judah has even been the target for attempted annihilation by its enemies: once by the Amalekite Haman. It is a call which conveniently overlooks the fact that the most vicious wars in that region have been fought (and continue to be fought) between so-called Muslim brothers. Much of the conflict is between sons of Shem and between Elam and Ishmael and Keturah as well as Judah. 3-9). Iran is dealt with in Sons of Shem: Part I (No. Palestine is not going to go away. so too Judah. If Jews and Christians can live together.there is a great deal of interconnection between the tribes. 212A) and in the papers concerning the coming of the Messiah and also World War III. namely Shia and Sunni. we have seen the unequivocal call by President Ahmadinejad of Iran for the extermination of the State of Israel (and presumably all the Jews with it). both Semites. but we never give up hope for Israel. as the most readily-identifiable part of physical Israel. within modern Iraq. there’s no reason why Jews and Muslims can’t. with the anti-Jewish pogroms in both Tsarist and Communist Russia. The name Judah means praised (SHD 3063). On the Middle East question. such as Iraq and Iran in the 1980s. but even then the Jews had to fight for their lives. Islam is closer to Jewry than Christianity. it is worth reading what Rabbi Sacks wrote in The Times (London) of 7 September 2001 regarding the permanent and often violent friction between the Jews and the sons of Ishmael. We have to co-exist. has suffered horribly. Jews are not optimists.

“I have been very zealous for Your sake.000 years of history. it has also allowed them to be singled out from much of the rest of the population. that God lives in the still small voice of reason. 20 April 2002). God asked him. 59:8). It is certain that God arranged the separateness of the Jews that way for a number of reasons.Professor Sacks said in a subsequent article: It is not that religion is intolerant.” He then witnessed a whirlwind. when Christ gets here he most certainly will take power and enforce a religion and one that is not kept on this planet at present except for a very few people who are persecuted for that faith. the Russian author and dissident Alexander Solzhenitsyn said that the Jews were unique in never assimilating with another nation in 2. That is why zealots must learn. But “the Lord was not in” the wind or the earthquake or the fire. however. However. and that they thereby invite persecution upon themselves. if not arrogant. adding that this was their most striking and admirable characteristic (The Times. The zealot believes that God is power. an earthquake and a fire. The fact is that only very few people are actual Jews of those claiming Judaism and when they cease to practise the religion they are simply Gentiles within Judah claiming protection under the Laws of God. Words of wisdom. 20 June 2001). The Holocaust . Nowhere is this told more dramatically than in the story of Elijah. Then came the “still small voice” that was the voice of God. they have absorbed a number of people and their diverse DNA structure proves that fact. Elijah?” The prophet replied. Under the headline “The Burning Question”. “What are you doing here. However. as evidenced by man’s entire history. and therefore almost certainly bound not to be heeded in this age at least (and without divine help) for “the way of peace they know not” (Isa. as on the occasions mentioned. It may seem to many that the Jews remain insular and aloof. He had come to the mountain fresh from a decisive and bloody victory over the prophets of Baal. Rather. whether through a vision or a tragedy of history. not just that of the chronically troubled Middle East. compassion and peace (The Times. we must learn the hard way that religion must never have recourse to power.

many asked where God was at a time like that and how He could allow them to suffer as horrifically as they did if they were His chosen people. although an unfortunate analogy. 1:13) which. As a result of what they’d witnessed. Judah and his brothers sold their half-brother Joseph into slavery in ca. 28:3). Those in the State of Israel take the view that their country has survived for nearly 60 years in a supremely hostile environment due to their own efforts and a particularly effective military force.org The Jews had been sent like lambs to the slaughter. see the Holocaust Revealed website at: http://www. have left in the Jewish soul. The Jewish adults and children were literally made to pass through the fire. by a not-unjustified pride in their own power. I don’t know of . Rabbi Kushner had this to say on the subject: It is nearly impossible for non-Jews to appreciate the meaning of the scar that the Holocaust. including the State of Israel. God may choose to remove His protection from individuals or from a nation. to be ‘holocausted’ in their millions in the crematoria like so many animals of the burnt offering (cf. 10:12ff.ccg. many who survived these death camps simply deserted their faith altogether. They were punished by God for exalting themselves and their own abilities without reference to their Creator and the fact that they were merely a tool in His hands. Judah itself was sent into captivity in the Third Reich and brother Joseph (basically modern America and the British Commonwealth) was instrumental in rescuing their remnant from the death camps. is nevertheless fitting. the term Holocaust is not used in some modern Hebrew texts. as even the Gentile Assyrians were to discover (Isa.1727 BCE.org/_domain/holocaustrevealed. This is a rather dangerous position to take. in other words. At any time. and the centuries of persecution leading up to it.Many secular Jews today consider themselves either atheistic or agnostic.). as their forebears had unwisely done with their own children during the worship of pagan gods centuries earlier (2Chr. instead. but without acknowledging God’s undoubted help and protection during their many battles for survival. About 3664 years later. Many faithful Torah-observant Jews in those camps prayed to God for deliverance and even marched into the crematoria praising Him. The secular Jewish rejection of the God of their fathers is perhaps understandable considering the number of deaths in the concentration camps both immediately before and during the Second World War in Europe. because of an arrogant attitude on their part. For more information. In order not to compare these more recent events with the burnt offerings of the sacrifices. Lev. it is often referred to as the Shoah or Calamity.

Why does God permit evil? Sometimes bad things happen to good people because laws of Nature can’t tell a good person from a bad one. any other people that wakes up virtually on a daily basis wondering if the world will let them live. Kushner and others may not blame God. as they also have left their first love – Eloah. … This. Jews understand that no matter how economically successful or socially integrated we are. about this most unpleasant episode in Jewish history. “Why did God let it happen?” Because God determined at the outset that He would not compromise our human freedom to choose between good and evil. Hence. it is a psychological issue: “How could human beings have so grossly misused their freedom to decide how to treat each other?” It does not challenge my faith in God. Even something as monstrous as the Holocaust comes to be seen as Man’s doing. not God’s. we would go on hurting and killing each other. pp. there are those who demonstrate a certain dignity in being able to be more understanding. in fact. 162-3. “Nevertheless. pp. because you have left your first love” (Rev. Quite the contrary. He did allow it to happen). the Holocaust is not a theological issue: “Why didn’t God stop it?” For me. is why so many of us react so defensively when Israel is criticized: because we are always afraid that criticism will lead to a withdrawal of approval of Israel’s right to exist at all … It is not hypersensitivity on our part to notice that no other country is called on continually to justify its right to exist. … But after the Nazi experience. If anything. it makes it harder for me to believe in man without God (ibid. as any loving parent chastises his son for the son’s ultimate benefit.. despite the understandably horrific memories and intense grief engendered by the Holocaust (or Calamity). To quote the words that Jesus Christ gave to the angel assigned to the Church at Ephesus in Asia Minor. 247-9). no matter how atrociously we misused it.. this should not be construed as His hatred for or abandonment of the Jewish people. as God says through His prophets and in the Writings that He chastens those whom He loves. However. the One True God – . If we didn’t learn from history. from experience. God’s displeasure with Judah While R. 2:4). we can never feel totally secure. I have somewhat against you. emphasis added). He could just as easily be speaking to Judah or the Jews today. and sometimes they happen because God will not interfere to take away our human freedom. to save so many millions of lives?’ … would that mean He should also have intervened to stop Stalin and Pol Pot from killing millions of people in Russia and Cambodia? … on what grounds would God suspend the rules in one case and not in others? For me. the chronic persecution of the Jews and the Holocaust itself may actually have been direct punishment from God (for. cit. ‘Couldn’t God have made an exception to that rule in this one case. I suspect. irrespective of how harsh that punishment may appear at the time. (Does anyone call for the dismantling of Pakistan and giving the land back to the tens of millions of Hindus who were displaced when a Moslem state was created there in 1947?) (op. no matter how destructively we intend to use it. at the very least. from the voice of conscience. Earlier in his book Rabbi Kushner dealt with the age-old question. if not forgiving.

156) and The New Moons (No. small voice behind us saying. and I will make you ride upon the heights of the earth. “This is the way. for the mouth of the LORD has spoken. if you honor it. and there are definite consequences for devising one’s own agenda. instead. the holiest day of the year. When God tells us to keep the Sabbath holy. as King Jeroboam of Israel was to discover when he commissioned a festival one month later than the God-ordained Feast of Tabernacles.and have suffered for it. when He will once again have mercy upon them. We are told rather that it will be as a still. 14 then you shall take delight in the LORD.) The correct days for worship do seem to matter to God and His Messiah. from doing your pleasure on my holy day. For all Judah. He requires our ‘hearts and minds’ as exemplified by adherence to the spirit of the Law. 30:21). 125). . Jesus. as He says quite plainly.e. Among the called of God. 2:13-17). (See the papers God's Calendar (No. or Yehoshua ben Yoseph. However. should have been a time for reflection and re-evaluation along with Godly repentance." (RSV) Neither does He want people exchanging financial advice and business ideas on the Sabbath like modern-day equivalents of the money-changers in the Temple. Isaiah 58:13-14 "If you turn back your foot from the sabbath. or seeking your own pleasure. Maybe as a result of the postponements of His ordained Holy Days and Sabbaths and non- observance of the New Moons for centuries past. More importantly. Yom Kippur. and call the sabbath a delight and the holy day of the LORD honorable. The same could apply in many Synagogues today where a good deal of worldly business is conducted on the Sabbath. the Holy Spirit is presently conducting ‘a campaign to win hearts and minds’. It’s not a matter of simply observing the Sabbath as a duty or weekly ritual. adhered to this injunction when he forcibly drove the money-changers and other Sabbath-breakers from the Temple precinct (Jn. not going your own ways. God is clear that He doesn’t only want our ‘hands’. this fast wasn’t actually being observed on the correct day according to the original Temple calendar anyway. walk you in it” (Isa. However. his whole house or heritage was later cut off (see 1Kgs. with far greater meaning than the present clichéd military term. 12:32-33 and 13:33-34). i. merely following the letter of the Law as many adherents to Judaism do. That task can be done on any other day of the week. which includes not speaking idle gossip. it won’t do so by loud insistence. I will feed you with the heritage of Jacob your father. it is the spirit in which it is kept that most pleases God. God has postponed the deliverance and salvation of Judah … until these Last Days. He means just that. or talking idly.

or Yehoshua. and he went away sorrowful. all these I have observed from my youth.'" 20 And he said to him. and said to him. The undoubted money-making ability of the Jews today was evident much earlier in their history. "How hard it will be for those who have riches to enter the kingdom of God!" 24 And the disciples were amazed at his words. 1Timothy 6:6-11 There is great gain in godliness with contentment." 22 At that saying his countenance fell. Honor your father and mother. You cannot serve God and mammon. where materialism and love of money hold unprecedented sway. . Do not steal. It may have been to save Joseph’s life. had a great deal to say on the subject of money and riches. a man ran up and knelt before him. go. for he had great possessions. financial gain seems to have played a large part in Judah’s motivation and thinking … and perhaps still does. "Children. although they are far from alone in that in today’s world. how hard it is to enter the kingdom of God! 25 It is easier for a camel to go through the eye of a needle than for a rich man to enter the kingdom of God." 21 And Jesus looking upon him loved him. Matthew 6:24 "No one can serve two masters. 8 but if we have food and clothing. and come. Do not defraud. 37:26-28). follow me. Jesus. or he will be devoted to the one and despise the other. 2:20). when the Patriarch Judah suggested to his brothers that they sell Joseph into captivity rather than kill him (Gen. and we cannot take anything out of the world. "Why do you call me good? No one is good but God alone. and give to the poor.The Qur’an also forbids trading on the Sabbath yet on both Friday and Sabbath on the Temple Mount to this very day money-changers charge people access to the Al Aksah mosque in direct violation of the Koran and the Scriptures." (RSV) Rabbi Saul/Paul of Tarsus. into many senseless and hurtful desires that plunge men into ruin and destruction. however. "Good Teacher [didaskalos. 7 for we brought nothing into the world. when they are finally recognised as being of so little real value (Isa. Do not bear false witness. 19 You know the commandments: 'Do not kill. into a snare. "Teacher. But Jesus said to them again. SGD 1320. God promises that our idols of silver and gold –the riches and possessions that have become our little gods – will be thrown to the bats and moles at the culmination of this age. for either he will hate the one and love the other. Do not commit adultery. and asked him. "You lack one thing. Through His prophets. who apparently studied under Gamaliel the Elder. sell what you have. or Rabbi]. 9 But those who desire to be rich fall into temptation. and you will have treasure in heaven. (RSV) Mark 10:17-25 And as he was setting out on his journey. 23 And Jesus looked around and said to his disciples. was also certain that love of money was a primary cause of people separating themselves from God and forsaking their Faith. what must I do to inherit eternal life?" 18 And Jesus said to him. with these we shall be content.

when led astray through money. and it causeth him who hath it to fall into madness. shun all this. (Known interpolations have been removed from the text. 5 And he hindereth the sacrifices of God. for there is hope for all them who hold fast unto His ways. not to love money. contains some incisive observations and warnings. 11 But as for you. because I did it in ignorance. and the love of money. And now I command you. Charles. and I sinned as a man and as flesh. man of God. Of particular relevance here are those made by the Patriarch Judah.) XVII. and had not my repentance. 2. which was supposedly written in the second century BCE and was therefore contemporary with the Dead Sea Scrolls. My children. There is an obvious theme here. They rob his soul of all goodness. XXVI. therefore. godliness. all the law of the Lord. Observe. the love of money leadeth to idolatry. But the God of my fathers had mercy on me. and hearken to Judah your father. For these things withdraw you from the law of God. gentleness. 1917. 4. 3. it is through this craving that some have wandered away from the faith and pierced their hearts with many pangs. translated from Armenian). And devour his flesh. my children. the fourth son of Jacob and his first wife Leah. Rabbi Kushner then ties this issue to the perennial problem of latent anti-Semitism often arising from envy. and the writer of the Book of Ecclesiastes had this to say on the same subject: Ecclesiastes 5:10 He who loves money will not be satisfied with money. For the sake of money I lost my children. XIX. I should have died childless. because for the sake of money and beauty I was led astray to Bathshua the Canaanite. nor to gaze upon the beauty of women. therefore. If some Jews are loud and aggressive or guilty of unethical business practices (as are lots of gentiles). XVIII. 3. one is entitled to dislike them as individuals but has no right to extend that dislike to . (RSV) Similarly. with gain: this also is vanity. 10 For the love of money is the root of all evils. And suffer not a man to have compassion upon his neighbour. men name as gods those who are not gods. SPCK. because. London. The Testaments are based upon the supposed deathbed comments of the sons of Jacob to their children. 4. Beware. aim at righteousness. And teach arrogance. love. (RSV) However. And blind the inclination of the soul. faith. the pseudepigraphical work called The Testaments of the Twelve Patriarchs (R. my children. And resenteth the words of godliness. 2. steadfastness. being corrupted through sins. And the prince of deceit blinded me. He hearkeneth not to a prophet when he speaketh. nor he who loves wealth.H. And oppress him with toils and troubles. my children. of fornication. and the prayers of my father been accepted.

Antisemitism. Job 8:3. to the detriment of a nation’s system of justice and of the society in general. by deliberately flouting the spirit of the law. It is not incumbent upon any lawyer to search out and exploit legal loopholes or defend the indefensible. 36:17). like all racial and religious prejudice. The name Benjamin means son of the right hand. is a sign that something is wrong with the hater. justice must also be swift and the truly guilty punished as a warning to others. Judah nobly took upon himself the role of protector. The basic purpose of advocacy was supposed to be the defence of the innocent and needy (Ps. 7 Keep far from a false charge. will be punished by God in the Last Days. as might be expected. it was assuredly not to get the guilty off on a legal technicality. at the break-up of the Kingdom following Solomon’s death. for I will not acquit the wicked. and do not slay the innocent and righteous. as recorded in 1Samuel 20:42. The right also means the South. in the same way the Talmud perverts the Laws of God and will be destroyed. He says He hates injustice and the perversion of the justice system (cf. It is interesting that the royal city of Jerusalem was apparently located within the historical boundary of the tribe of Benjamin rather than Judah. 82:2-4) or to try and mitigate the sentence of a guilty person. 44:16-34). 262). That sort of unethical behaviour. so it seems he and his descendants were always destined to be the right-hand man of Judah. This arrangement had been ratified and given permanence earlier by David (of Judah) and King Saul’s son Jonathan (of Benjamin). cit. so much so that he melted Joseph’s heart in Egypt. Jewish advocacy The Patriarch Judah showed great compassion and impressive verbal skills as the advocate for his half-brother Benjamin (Gen. It is ironic that they were predominantly left handed-people and were almost destroyed for their perversity. Joseph may have had the primacy in Egypt. and his Christ-like act of intercession on behalf of his brother probably bound the two so closely that. Benjamin became allied with Judah (along with half the tribe of Levi) rather than with his full-brother Joseph’s tribe.. p. innocent members of the larger group. Exodus 23:6-8 "You shall not pervert the justice due to your poor in his suit. In order to be most effective. It was obviously God’s doing as part of His unfolding plan. 8 And . as the ‘front’ is always facing the East in Hebrew. The Torah is quite specific on the need for true justice for all people. not with his victim (op. Justice must be done and done correctly and the perversion of justice by Judah or the other tribes will be punished. Also. but it seems Judah is to have the ascendancy in Jerusalem (metaphorically referred to as Egypt).

and do righteousness. 45:9). Jer. justice and equitable treatment are extremely important to God as such requirements of the leaders and the people are mentioned often enough in Scripture (e. and vice versa. whereby each letter was considered . for a bribe blinds the officials. SHD 5608) since Ezra’s time. It is recorded that the Jews and Levites were appointed custodians of the Oracles of God from the beginning (Rom. Some Kenites also had this task." (RSV) Again. that was only until the death of Messiah and the formation of the Churches of God from the Apostles onwards (see the paper The Oracles of God (No. and my deliverance be revealed. in line with the dual application of much of Scripture. however. By tradition. It was perhaps the Jews’ and Levites’ natural abilities. 60:7 and 108:8). 184)). and keeps his hand from doing any evil. and subverts the cause of those who are in the right. they conceive mischief and bring forth iniquity. a detailed and reverent ritual for copying the Scriptures was required. For without justice (tsedek. which particularly fitted them for the task of transcribing the holy texts. you shall take no bribe. Proverbs 21:3 To do justice and judgment is more acceptable to the LORD than sacrifice. Isaiah 59:4 No one enters suit justly. Torah observance It appears that Judah or Levi was assigned to be God’s scribes or lawgivers (chaqaq. (RSV) It would appear that truth. no one goes to law honestly. Scribes have been referred to as Sopherim (from saphar. (RSV) The prophet Isaiah was aware of the situation in his time and foresaw the same thing happening in these Last Days. And as the writer of Ecclesiastes warns and the prophet Isaiah enjoins: Ecclesiastes 5:8 If you see in a province the poor oppressed and justice and right violently taken away. (RSV) Isaiah 56:1-2 Thus says the LORD: "Keep justice. SHD 6664) there can be no righteousness (tsedek). they rely on empty pleas. 3:1-2). not profaning it. with their dedication and thoroughness. justice and righteousness here are synonymous and interchangeable. do not be amazed at the matter. they speak lies. for soon my salvation will come. 23:5. and the son of man who holds it fast. who keeps the sabbath. and there are yet higher ones over them. for the high official is watched by a higher. 2 Blessed is the man who does this. SHD 2710). and were given the task of faithfully preserving Scripture down through the centuries (Pss. Ezek.g.

until finally deciding that these Laws had been done away with altogether and that we are solely under “grace” within the new Christian dispensation. each word was to be read aloud from an original version of the text. yet had been ignominiously killed. take liberties with the Scriptures but preserved those texts for a permanent record and which we know today (see for example The Companion Bible notes to the texts). they might be translated into all the languages of the world. for example. located both within Judaea and in the Diaspora. at the appropriate time. albeit with noble intent. in accordance with the injunction in the Torah (Deut. In Acts 24. They had a tendency to introduce more and more man- made ordinances and restrictions. I worship the God of our fathers. that according to the Way. they have forgotten that the majority of first-generation Christians were Jews or Hebrews of all twelve tribes of Israel. as is still being done today. They continued to worship in their local Synagogues.holy in itself. It seems pseudo-Christianity is in such a rush to disassociate itself from everything Jewish and the Jews (even until fairly recently known as “Christ-killers”). few of which bear any . They did. so that. Judah often went to the other extreme. so no adjoining letters were permitted to touch. also Jn. cf. the rest of Israel seemed more inclined to water down the Laws of God. however. Certain strands of Judaism also saw the need to put a fence around the Laws of God as shown. which they call a sect [heresy: KJV]. believing everything laid down by the law or written in the prophets. although many were later expelled as Jesus/Yehoshua said they would be (Jn. 7). by their 39 Sabbath prohibitions. claiming these were part of the Oral Law given to Moses. 9:22). and who didn’t suddenly give up their keeping of Torah when they became baptised Christians. and his statement here refutes the antinomian opinion that Paul denigrated the Law in his numerous other epistles. Paul stated unequivocally before the Roman governor Felix and many eminent Jews that he still observed the Law. It wasn’t the sort of information that many people wanted to know (see Acts chap. It was quite the opposite in fact. 4:2). In contrast to the pseudo-Christians’ willingness within just a few centuries to abrogate the Law. perhaps for mentioning the “heresy” that the long-awaited Messiah of their liberation had already appeared. perhaps. and every letter and word were counted to ensure that none had been added or omitted. Acts 24:14 But this I admit to you. Christians naturally owe a huge debt of gratitude to the Scribes for faithfully copying and preserving the Hebrew Scriptures (the Tanakh) for hundreds of years. (RSV) It simply wasn’t a case of Paul believing everything in the Law but then not acting upon that belief. In addition. 16:2.

and by sharing with us His precious Torah. with its myriad regulations and prohibitions. restrictive. cit. in his book The Religion of Jesus the Jew (SCN Press. The idea that giving us laws is a sign of God’s love is one of the fundamental theological differences between Judaism and [mainstream] Christianity. It may seem strange to speak of the Torah. long after the fall of the Temple. 23:1ff. In our view. but of a more important kind of freedom. insight. London. pp. 7. as a source of freedom. We tend to think of laws as restricting our freedom. punishing God. Kushner gave the Jewish perspective on God’s Law or Torah and why it is still binding upon all who claim to love God and act as His servants today.resemblance to the original injunctions regarding the Sabbath in the Torah as given directly by the Angel of the Covenant (who became the Messiah). Judaism – while admiring love and forgiveness … – sees the role of the Law totally differently. “Do whatever you want. … . This making of laws more binding and unnecessarily burdensome was what Yehoshua condemned (cf.” (fn. before encountering the first attempts at systematization. … The freedom the Law offers is the freedom of the athlete who disciplines his body so that he is free to do things physically that you and I are incapable of. and I will still love you.6-9) in mid-second century BC.” (op. … Laws are seen [by the latter] as the instrument of a harsh. and often hypocritical. had this to say about the prohibitions.12) The Mishnah was compiled about 200 CE. Mat. It offered advice..” That is not love but an abdication of responsibility. He shows His love for us by inviting us to enter into a Covenant with Him. God shows His love for us by reaching down to bridge the immense gap between Him and us. R. religious types. Hence it was long after the written Torah was produced that this so-called Oral Law was codified. He obviously recognised the difference between the Laws he had given to Moses and those added afterwards by over-zealous. and need to be superseded by the rule of love and forgiveness.6) half a century later. 47-8) He goes on to share a few thoughts that should be noted by the antinomian Christians in particular. … The freedom the Torah offers us is the freedom to say no to appetite. a loving parent does not show his or her love by telling a child.2) before receiving a detailed list of thirty-nine classes of proscribed action.). 1993). … But Judaism insists that living by God’s laws is a matter not only of obedience. … Jews have understood from the beginning that ours was a religion of love because it did not leave us to find our way through life unaided. Geza Vermes. “We have to wait until the Book of Jubilees (50. and guidelines.14-12. p. “We learn two lessons from the stories we tell about ourselves: that God loves us and that God needs us. and until the relevant section of the Mishnah (Shab. It is the freedom of being the master of appetite rather than its slave. and the statutes of the Damascus Document (10.

Yehoshua as a Torah-observant Jew Geza Vermes was also unequivocal with regard to Jesus/Yehoshua’s observance of the Law of Moses: … Jesus not only was not hostile to the Torah in principle or refused to abide by it in practice. the above author made the following comment. ready when necessary to choose between conflicting obligations. intensified and sought boldly to inject into the Judaism of ordinary people the magnificent prophetic teaching of the religion of the heart (cf. pp. ‘Thy Kingdom come’. cit. proclamations and sayings has shown that. the survey of Jesus’ preaching in parables. which concurs with the views expressed above by Rabbi Kushner regarding Torah observance. or interfere with. however. To be brief. 29. a divine will seen by Judaism of all ages . Vermes continues with this theme on page 194: As has been clearly demonstrated in chapter 2. he adopted. is followed by. sleeping. It is approval of his recapitulation of the Torah as love of God and love of men that brings the sympathetic scribe ‘near to the Kingdom’ (Mark 12. Perhaps even more pregnantly. Jesus made no attempt to restrict. but that he acknowledged the Law of Moses as the foundation-stone of his Judaism (op. The Law tries to make us strong enough to resist the many temptations to sin to which the human being is subject daily. What he strove to emphasize was inward piety for the individual devotee of the Kingdom of heaven. we are able to keep the Law in its physical aspect. Earlier in his book. 50-4). The Law does not make us sinners. That practice must be stopped and Judah’s and Levi’s conduct corrected. It’s true that. ‘Thy will be done’. there is still the more important spiritual application that needs to be addressed. the Torah.. the essential requisites are detachment from possessions. he rather embraced it as the recognized framework of Judaism.13) (emphasis added).10) the petition. and working habits is to take the most common and mundane activities and invest them with deeper meaning. Isa. 188-9). unquestioning trust in God and absolute submission to him. … But what the Jewish way of life does by imposing rules on our eating.. This is certainly good advice for taking care of most aspects of life. In brief. pp. turning every one of them into an occasion for obeying (or disobeying) God (ibid. The problem is that Judaism as a religion has corrupted the Laws of God by tradition. 6. … The second gift of the Law is the reassuring message that we and our moral choices are taken seriously at the highest level. The fact that the duties imposed are generally expressed in ethical rather than ‘legal’ terms should not lead one to imagining that Jesus’ eschatological preaching conflicts with his attachment to the Law.34). through self- discipline and self-denial. in the Lord’s Prayer (Matt.

emphasis added) The one known as Jesus Christ was referred to by his fellow Jews as a Rabbi on numerous occasions (Mat. 237). As a Rabbi he was speaking almost exclusively to other Jews of his day. he did not “shatter the letter of the Law” as claimed by Ernst Kaesemann in Essays on New Testament Themes (transl. Jesus’ antitheses do not differ structurally from that which.).” (ibid. debate the nature of the contrasts in question. p. for everyone will come under grace from that time forward” (see Luke 18:18-30). Montague. It is known absolutely that he didn’t abrogate Torah either when he was alive or by his death and resurrection. 148-9. Messiah came to introduce the vital spiritual dimension that is impossible to engender within ourselves.. Akiba or Rashi. ‘God commanded … but you say’ (Matt. They were given God’s Spirit and were led by it. the power of God. in order to allow a more faithful keeping of the Law than ever before possible.E. the Pharisees are said to have propounded their doctrine concerning qorban: ‘Moses said … but you [Jesus] say’ (Mark). that of the Pharisees seems to do the same.10-13 (Matt. it was a matter of ‘the Son elucidating its real meaning’ (C. that my death and resurrection will abolish all those Laws of God that most people find so burdensome and difficult anyway. He didn’t say to the wealthy Jewish leader who was seeking the best way to eternal life.. etc. 23:7-8. or even more strongly. 31. according to Mark 7. 1964). whereas in the case of Jesus. pp. such as Gamaliel.). This is the reason that Messiah had his Advent and began his teaching about the higher aspects of the Law and the availability of the Holy Spirit to a far greater number of people than the mere handful of specially-favoured men and women who had received it up until that time. as being expressed and manifested in the commandments received by Moses on Mount Sinai (Vermes.. but the point at issue is that if Jesus’ teaching ‘shatters the letter of the Law’. Lond.4-6). emphasis added). however. The Gospel according to Saint Mark (1959). It is worthy of note also that the Fourth Commandment requiring seventh- day Sabbath observance was too obvious to be mentioned here at all. 20:7). They were among the first to receive the Spirit but were to be far from unique in this. Vermes countered Kaesemann as follows. as so many Christians incorrectly claim today. 15. 20:16. ibid. by W.J. the scribes and Pharisees were ‘tampering with God’s Law’.B. and his footnote speaks of Jesus explaining the true meaning of the Law: Incidentally. . and may have been the expected Teacher of Righteousness mentioned by the Essenes.49. needless to say. Jn. know this. Abraham was called “a friend of God” (2Chr. “Keep all the Commandments for now but. One can.28 Footnote 28: In the words of a well-known New Testament scholar. In doing so. while David was known as “a man after God’s own heart” (1Sam. yet could in no way be considered abolished by Christ’s silence on the matter. which is of course nonsense. Cranfield. The Patriarchs and prophets were among the few people in the Hebrew Scriptures recorded as having received God’s Spirit. 13:14). 1:38. so perhaps respect is due for his wisdom and teaching ability as for any other Rabbi before or since.

Zechariah 12:10 "And I will pour out on the house of David and the inhabitants of Jerusalem a spirit of compassion and supplication. then resurrected to life in order to be seen again by those who pierced him at some time in the future. as one mourns for an only child. will come under judgment before him. was the promised Messiah. The Advent of Messiah Jews generally have never accepted that the man called Jesus Christ. This is dealt with in the paper Advent of the Messiah (No. where the Messiah is prophesied as one who is to be killed by being pierced. knew it not or refused to accept it. 297). Another Scripture that implies two Advents from an historical point of view is found in Daniel 2:31-45. given the Spirit so that they are better able to keep the full intent (i. the disciple whom Jesus loved. or Yehoshua ben Yoseph. and that the stone uncut by human hands is Messiah himself. and thereafter have eternal life. who was a Levite. God is actually giving all of us the chance to become “a friend” of His and “a person after His own heart”. It is His intention that all human beings who ever existed are to be called into the Body of Israel at some point. "They shall look on him whom they have pierced. John 19:37 And again another scripture says. the spirit) of the Law. then and now. or who called for that to happen. (RSV) He is not about to be pierced at his glorious Advent as King-Messiah. 210). When they arise in the Second Resurrection of the dead. John. when they look on him whom they have pierced. He is the same one pierced by the Jews (by proxy) and the Gentile Romans (by commission). when he will appear as an all-conquering King-Messiah.Through the Messiah. (See also Commentary on Zechariah (No.) Hence his first Advent according to Judah will actually be his second.e. so it seems logical that the person spoken of here must have been pierced in the past. they shall mourn for him. It is generally acknowledged that the iron legs of this image represent the Roman Empire. the fourth kingdom extant in Messiah’s time. and weep bitterly over him. the person whom the first Jewish converts and all subsequent Christians have acknowledged as the long- awaited Messiah. so that. and then to be finally transformed into spirit beings on a par with the angels in Heaven and thus become full Sons of God. The stone is shown striking the great image on its feet of mixed iron and clay . thus he has already had one Advent … and most of the Jews. all those who pierced Messiah." (RSV) The text in Zechariah undeniably alludes to two separate Advents of the one person. despite many references to him in the Tanakh. stated categorically that the above Scripture referred to this same Jesus or Yehoshua ben Yoseph. One example is from Zechariah. as one weeps over a first-born.

the prophet Zechariah (Ezekiel also) talks about a definite raising of the dead to life.rather than on the legs. Lk. Messiah didn’t destroy the Roman Empire and the occupiers of Judaea at his first Advent as Jesus Christ. 5 and from Jesus Christ the faithful witness. Lk. and he sent for Paul and heard him speak upon faith in Christ Jesus. And the understanding that he would set up the physical Kingdom there and then. KJV] and self-control and future judgment. spoke to the Roman governor of Judaea. and raised some uncomfortable issues regarding justice and a resurrection to judgment. Revelation 1:7 contains a dual meaning. Acts 24:24-25a After some days Felix came with his wife Drusil'la. Revelation 1:4-7 John to the seven churches that are in Asia: Grace to you and peace from him who is and who was and who is to come. and his Jewish wife. so the Sadducees are without excuse when attempting to deny any future resurrection (cf. they and everyone else will most certainly see him sometime after they’ve been resurrected to life again. every one who pierced him. in either the First or Second Resurrection. Felix. he is coming with the clouds. priests to his God and Father. and from the seven spirits who are before his throne. the first-born of the dead. and every eye will see him. so it is quite conceivable . Amen. Incidentally. the Gentile centurion verbally acknowledged Jesus/Yehoshua as the Son of God. Amen. 20:27ff. 22:23. That Empire was to last several hundred years after his death and resurrection. who was a Jewess.). It is even possible that some of the Roman soldiers and others who had a part in the death of Messiah will be in the First Resurrection and thus will literally meet him in the air at his second Advent. without the promised physical Kingdom being set up on Earth during that period. 23:47). 27:54. 15:39. 7 Behold. and the ruler of kings on earth. Even so. For instance. To him who loves us and has freed us from our sins by his blood 6 and made us a kingdom. (RSV) Again. Felix was alarmed … (RSV) At some stage we are all required to acknowledge that Messiah has indeed already come once to this Earth. is erroneous. Also. “Every one who pierced him” may not be there to personally witness Messiah coming in great glory in the clouds. who was of the tribe of Benjamin. and therefore that Yehoshua ben Yoseph could not have been the promised Messiah. in other words. besides speaking of two Advents of Messiah. Mk. 25 And as he argued about justice [righteousness. to him be glory and dominion for ever and ever. Several Scriptures hint at this (Mat. Instead. and all tribes of the earth will wail on account of him. Mat. with the millennial Kingdom on Earth not to be set up until after his Second Advent. Paul. however. he set up the Kingdom spiritually in the hearts and minds of a number of faithful disciples at that time.

. of a Messianic figure who would perform all these functions in one.that he was later converted and became a disciple along with many other witnesses to the crucifixion. and in some cases. 89). 27:18). we are horror-stricken. Talmud. in Hebrew. Isa. and there is none to justify us.). also mentioned this possibility. The Dead Sea Scrolls show that the understanding of the community there was that the Messiah was the same person. this was the second recorded occasion on which a Gentile knew Christ to be the Messiah. Our iniquities and the yoke of our transgressions he carries. keeping watch over Jesus. Among the ancient prayers said for the Day of Atonement may be found the words of Eleazar ben Qalir (perhaps as late as AD 1000): ‘Our righteous Messiah has departed from us. The first Advent was as the Priest.e. tractate Sanhedrin 98b]. in Revealing Jesus as Messiah (Christian Focus Publ. Matthew 27:54 When the centurion and those who were with him. 1998. The Servant Songs Another Jewish author. they were filled with awe. Messianic brooding and reflection went hand in hand with the belief that the Anointed had already come. and said. p. Hence it appears that some Jewish writers acknowledged (albeit rather quietly) the fact that the Messiah had actually come and gone. As the saying goes. ‘What goes around. 135). On occasions. Messianic speculation in ancient Judaism included notions of a priestly and prophetic Messiah. Scotland. Geza Vermes. Many of the leaders of Judah were jealous of Yehoshua ben Yoseph. the other being when he spoke to the Samaritan woman at the well (Jn. In addition to the royal concept. In fact. "Truly this was the Son of God!" (RSV) It seems strange that a Gentile should recognise the Messiah when so many Jews of the time didn’t. in his book Jesus the Jew (SCM Press Ltd. being of two Advents.’ (cf. and this was perhaps a major reason for wanting him dead (see Mat. p. He bears on his shoulders our sins to find pardon for our iniquities. i.Messiah. 4:4ff. The Jews persecuted the Church endlessly and that was why they wanted the prophet Muhammed and the small group in Arabia killed so that it was wiped out. saw the earthquake and what took place. furthermore. 53:4-5). and is wounded for our transgressions. the repayment in kind by God for good or evil). made this observation: Some Talmudic writers have recognized the likelihood that suffering is bound up with Messiah’s work [Babyl. This envy and murder was to be returned with interest upon their own descendants’ heads over two millennia leading up to the Holocaust of the 20th century. Lond. The texts are examined in the symbolism of the High Priest on . 1983. mida keneged mida (lit.. ‘measure for measure’. comes around’ or. Stuart Sacks.Messiah and the second was as the King.

4 who desires all men to be saved and to come to the knowledge of the truth. as High Priest in the Melchisedek priesthood. 1Timothy 2:3-6 This is good. p. 214).. so to speak. These holes in his scalp allowed blood to trickle down his face and settle on his earlobes. and the person known as “Jesus (Yeshua) is the perfect embodiment of the word yasha” (meaning to save). God thereby arranged for Yehoshua ben Yoseph to be fully consecrated as a Priest. if they do not refer to Jesus. Even now. the Psalmist gave a specific description of the hallmarks. Stuart Sacks had this to say about the last of these Songs: Although the Jewish community has traditionally thought of this final Servant Song in messianic terms. Psalm 22:16 Yea. for it is recorded that Jesus (Gk: Iesous) will save his people from their sins (Mat. Isaiah 53 is one of a small series of texts recorded by the prophet Isaiah and usually known as the Servant Songs (also Isa. emphasis added). we do not have the remotest idea of whom Isaiah is speaking (ibid. The fact remains that the final Song’s fifteen verses [52:1-53:12] fit none other so well as the Messiah as he was revealed in first century Palestine. 52:13-15. 68. 5 For there is one God. while the wounds in his hands and feet allowed blood to run down onto his thumbs and big toes. 1:21). as Timothy showed. Acts 8:34-35]. how wonderful it will be in that day when multitudes of the household of Israel accept the Scripture’s reliable witness through such men as Luke and Philip [cf. dogs are round about me. 42. a company of evildoers encircle me. Returning to the Tanakh. and there . of the Messiah who was to come. and it is acceptable in the sight of God our Savior. in accordance with the solemn ordination ceremony of Aaron and his sons (and all their priestly descendants) as described in Leviticus 8:23-24 (see also the paper Wave Sheaf Offering (No. part 40 and 61 also). This author added that the latter Song “clearly identifies individual suffering in place of a rebellious people”. Yehoshua is willing and able to make intercession directly to God the Father on behalf of the called-out and chosen ones alive on the Earth. Besides the piercing of his hands and feet by the nails. 106b)). 138) and Azazel and Atonement (No. 49. there were also puncture marks around the head of this crucified one from the crown of thorns that had been jammed onto his head. 50.Yom Kippur and are examined in the paper Day of Atonement (No. they have pierced my hands and feet (RSV) That is just one small example from a whole set of criteria required for Yehoshua/Jesus to be fully acknowledged as the promised Messiah.

The only pattern which can be discerned. (RSV) Jews for Jesus God surely wants everyone of Judah to become “a Jew for Jesus”. i. If we have accepted that Messiah has already had one Advent and died for the salvation of all people in the world. If this belief takes some swallowing and appears to run contrary to the ‘Shema Ysrael. But He certainly doesn’t want the Jews to dispense with their Monotheism and embrace the false gods of the Trinitarian concept adhered to by the overwhelming majority of ‘Christians’. whose Jesus is one of three co- equal members of an exclusive Godhead. That is not so. that the New Testament contains the materials out of which the doctrine of the Trinity took shape. though perhaps with a little less honesty than found in the opening sentence. The paper Consubstantial with the Father (No. This is actually a rather brave admission considering the Trinity concept is supposed to be pivotal to Christian belief. . found in neither the Tanakh nor. especially in the thought of Paul and the Fourth Evangelist (The Holy Spirit in Christian Theology. is analogous to the pattern of DNA found in all living creatures. we use the same scriptural texts in expounding doctrine. one would reasonably expect the doctrine to be plainly laid out in the New Testament Scriptures. One such point concerns the use of the term echad instead of yachid in the ‘Shema Ysrael when speaking of the ‘one and only’ God. 6 who gave himself as a ransom for all. it is more commonly recognized than it has sometimes been.30). A typical Trinitarian thesis might include the following. As Christians are also meant to be People of the Book. that is because it most certainly is at odds with it. not so much in the texts in which the names of the three “persons” occur together …. when that is not the case at all. Hendry. then there is no longer a need to struggle with the alien concept of the Trinity of ‘Father. The basic building blocks are the same. the man Christ Jesus. apart from in men’s fertile imaginations. but the conclusions reached can be totally different. just as a human and a gorilla possess a similar make-up of DNA (sharing about 98% of genes) but only one will inherit eternal life. p. the testimony to which was borne at the proper time. in the books of the Christian New Testament. as rather in the outlines of a Trinitarian pattern which can be discerned. and these are to be found. surprisingly. Son and Holy Ghost’ as it is totally unscriptural. At the same time. Some pseudo-Christians have even claimed that the idea of a Trinity is implicit in the Old Testament or Tanakh.e.. 1965. George S. 81) should be studied for an explanation of the use of the term echad in the ‘Shema. is one mediator between God and men. SCM Press Ltd. Lond. It is now generally acknowledged that the doctrine of the Trinity is not found in the New Testament.

'For Joseph (the stick of E'phraim) and all the house of Israel associated with him'. Reconciliation of Judah and Israel Despite its persistent sinfulness. for great shall be the day of Jezreel. then take another stick and write upon it. there will be a foretold reconciliation of Judah and Israel. and they shall go up from the land. and they shall appoint for themselves one head. and those who harass Judah shall be cut off. out of Judah and from the lineage of Jesse and David. Although God was angry with Judah and allowed them to be defeated. Some time soon. Israel his dominion. for to be magnanimous in victory is a Godly characteristic.The original Christian faith. Messiah was born for the salvation of the entire world. 13 The jealousy of E'phraim shall depart. 'Will you not show us what you mean by these?' 19 say to them. and his dwellings shall be glorious. Hosea 1:11 And the people of Judah and the people of Israel shall be gathered together. We are often judged on how we treat our enemies. and I will join with it the stick of . sacredness]. from Assyria. and the children of Israel associated with him'. Isaiah 11:10-13 In that day the root of Jesse shall stand as an ensign to the peoples. I am about to take the stick of Joseph (which is in the hand of E'phraim) and the tribes of Israel associated with him. (RSV) And. and from the coastlands of the sea. from Pathros. Thus says the Lord GOD: Behold. Israel had been over-zealous in its treatment of the captured Jews. from Ethiopia. it appears that Judah holds a special place of affection in God’s heart. 18 And when your people say to you. E'phraim shall not be jealous of Judah. Psalm 114:2 Judah became his sanctuary [SHD 6944: holiness. as we see in Hosea 1:11 and Ezekiel 37:15-22. (RSV) Ezekiel 37:15-22 The word of the LORD came to me: 16 "Son of man. (RSV) We see in 2Chronicles 28:9-15 that Ephraim had a change of heart when it and the other tribes had warred with Judah and taken many captives. and Judah shall not harass E'phraim. 17 and join them together into one stick. from Shinar. from Egypt. and will assemble the outcasts of Israel. that they may become one in your hand. rebellion and an unhealthy love of wealth and status. 12 He will raise an ensign for the nations. from Hamath. of course. 'For Judah. such as being expounded by the Christian Churches of God. 11 In that day the Lord will extend his hand yet a second time to recover the remnant which is left of his people. him shall the nations seek. from Elam. take a stick and write on it. provides a scripturally-based alternative to the paganised and syncretic or pick-and-mix beliefs of the so- called Christians. and gather the dispersed of Judah from the four corners of the earth. Therefore God strongly advised them to show compassion.

10:36). and make them one stick. he washes his garments in wine and his vesture in the blood of grapes. Judah. 7:6.e. Genesis 49:8-12 Judah. R. and they shall be no longer two nations. Isa. (RSV) The last verses of this text refer to the death of the Messiah in Jerusalem. By his death he accomplished the washing of his vestments and the vestments of all of his people as the vineyard of the House of God (cf. it appears that the reference here is to Judah’s hand being on the neck or back of his brothers also (as former enemies) in order to draw them to him. Jer. upon the mountains of Israel. and bring them to their own land. Similarly. Everything we do can be transformed into a Sinai . 21 then say to them. He stooped down. and one king shall be king over them all. your hand shall be on the neck of your enemies. you have gone up. 11 Binding his foal to the vine and his ass's colt to the choice vine. 20 When the sticks on which you write are in your hand before their eyes. is not confined to the synagogue. 22 and I will make them one nation in the land. (RSV) In the prophecy given by Jacob/Israel to his sons on his deathbed. and will gather them from all sides. 27:40. Mat. one’s own blood relatives. or a yoke of bondage upon their necks (Gen. just as Judah may have envied Joseph (father of Ephraim) as the favourite son of their father. i. Gen. 45:14) in a spirit of reconciliation rather than enmity. Thus says the Lord GOD: Behold. the Patriarch Jacob. and Judah shall not vex Ephraim”. from the prey. your father's sons shall bow down before you. One of the fundamental teachings of Judaism is that the search for holiness. to embrace them and to weep upon each other’s necks (cf. The term enemies thus appears to be in the same sense as enemies shall be of one’s own household (Mic. that they may be one in my hand. he couched as a lion. 5:7). As mentioned earlier. and no longer divided into two kingdoms. while speaking primarily to fellow Jews. The Just of the Nation of God We know that the essence of Torah is the love of God and the love of man. as Geza Vermes restated above. your brothers shall praise you. 12 his eyes shall be red with wine. it would probably have spoken of Judah having his foot upon the necks of his enemies (Jos. this alludes to the jealousy and dislike of a group of people (in this case a brother tribe) toward Judah (the Jews). 10:24). Had there been a negative connotation to this part of verse 8. Judah’s hand is said to be on the neck (or back) of his ‘enemies’. Kushner sees the need for all of us to imbue everything in our daily lives with holiness in order to please God. my son. 33:4. until he comes to whom it belongs. I will take the people of Israel from the nations among which they have gone. 9 Judah is a lion's whelp. “Ephraim [representing the 10 Tribes] shall not envy Judah. nor the ruler's staff from between his feet. and as a lioness. and to him shall be the obedience of the peoples. that is. 27:12). Isaiah 11:13 states prophetically that. In view of the words brothers and father’s sons elsewhere in verse 8. for the encounter with God. and his teeth white with milk. who dares rouse him up? 10 The scepter shall not depart from Judah.

Speaking as an American Jew. namely kosmos (SGD 2889): 5) the inhabitants of the earth. And having resolved to live differently. there is a nobler way in which to make a personal and positive impact upon the world: through study and implementation of all that we have learned. as R. making it an orderly. And if we love God. to love and care for other human beings as God Himself loves all His creation. Judaism has always insisted that knowledge has the power not only to make people smart but to make them good. endowments riches. who came not to condemn the world but ultimately to save it. etc. how to take the ordinary and make it holy. p. 44-45) As the Rabbi would have it. right here and now. 10:18). beautiful.. but to teach us how to bring God into the world. the New Testament Scriptures concur with R. So what if there is rampant crime and disease? So what if widows and other poor people are taken advantage of by the rich and powerful? This world is only God’s waiting room. but are certainly allowed by Him to exist) of this world yet.304) While no one is good but God alone (Mk. Having studied. people will get what they deserve and the last shall be first. experience. 49) It is not a matter of washing our hands of this world because of its seemingly insoluble problems. However. But the danger of believing too fervently in a World to Come is that you may come to care less about the imperfections of this world. we should commit ourselves to live differently as a result of what we have learned.. Rabbi Kushner made this observation: . or … 7) world affairs. stir desire. the human family. The goal of Judaism is not to teach us how to escape from the profane world to the cleansing presence of God. p.. Kushner by telling us that God so loved the world that He gave up to a violent death His only human-born Son (Jn. This is quite a different concept John later gave at 1John 2:15 and which apparently contradicts the former text by telling us not to love the world. men. seduce from God and are obstacles to the cause of Christ. it can be explained simply as an injunction to hate the man-made and Satan-inspired systems (which are not of God. at the same time. cit. we should feel obliged to treat with love the world He loves so much … the reader of the Bible is told that the abstract concept of justice is meaningless unless it is translated into the lives of every citizen. pleasures. advantages. Jews reject that perspective. Almost universally. to make it a better place. (ibid. or simply waiting for the promised Kingdom to come in order to have Messiah clean up the mess on the Earth and solve everything for us.” (ibid. In Eternity. pp. precious place. (op. There has often been a certain high-principled idealism exhibited by the Jewish people. an encounter with the sacred. 3:16-17). the aggregate of things earthly 7a) the whole circle of earthly goods. at least as a place from which to start. Kushner would attest. Our creed would seem to be that God so loved the world that He lavished upon it immense care in creating it. we should then go forth to bless God’s world and sanctify it. which although hollow and frail and fleeting. Brown-Driver-Briggs (BDB) make the distinction in their definition of the Greek term for world. There is a vital need to work in this world.

because they believed that the purpose of human beings on earth was to do for God the one thing He could not do for Himself. pp. It is our obligation to be a role model for all nations. (ibid. "He who through faith is righteous shall live. the Kingdom of God. viciously antisemitic czar in Russia. The foundation story of Judaism [and all biblical Israel] teaches us these two lessons. Jewish voters tend to support the candidate who seems most committed to making the world a better place. God depends on us to complete and sanctify His world. 46-7) That is obviously a very worthy view to hold. although it must be increasingly obvious that man alone will not be able to solve the multitude of problems this world faces. and we disappoint Him cosmically if we fail to respond to His challenge. but because it promised to make the world better. we are empowered. beginning with the 42-plus years from the preaching of John the Baptist until the destruction of the Temple in Jerusalem in 70 CE. Romans 1:16-17 For I am not ashamed of the gospel: it is the power of God for salvation to every one who has faith. they withdrew their loyalty.12)." (RSV) . to crown His creation with goodness. cit.. We are called on to do something for God and for the world. 17 For in it the righteousness of God is revealed through faith for faith. or for the most pro-Israel candidate. loving peace and pursuing peace.. The claim that God needs us is not so much a statement about God as it is about us. not some other far-off world. loving mankind (ha-beriyot) and bringing them near to the Torah (mAb 1. and make this world.6f. showing them what the God-oriented life looks like. Geza Vermes states: Here the coming of the Kingdom entails an element of mystery: the salvation of Israel is presented as a magnet attracting the rest of mankind to God (ibid. an older contemporary of Jesus/Yehoshua: Be of the disciples of Aaron. However. Salvation was open to them first. In his comment on Isaiah 60:3. there is a saying attributed to Hillel.. In the early part of the twentieth century.. pp. But they continued to look for a cause to follow. as it is written. many Jews were attracted to the Communist party not only because it replaced a cruel. We tend not to vote for Jewish candidates. 123-4). it demonstrates that Jews (among many others) often have a highly-developed sense of justice and empathy for their fellow man. Paul reiterated this fact. to the Jew first and also to the Greek.” when Stalin’s Russia turned out to be as brutal and as antisemitic as any czarist regime. and certainly not because Jews are by nature revolutionaries. We are important. Salvation to the Jews first Again we see the pre-eminent position in God’s grand scheme given to Judah. 48) In the Mishnah. and it is our obligation to make God’s world complete by giving Him the one thing He cannot do for Himself. by freely choosing to do good. p. When communism turned out to be a “god that failed.” (op.

26 So. (RSV) When Paul spoke about the true circumcision (i. O men of Judah and inhabitants of Jerusalem. a teacher of children. pre-eminence was to prove a two-edged sword. and all who have sinned under the law will be judged by the law. lest my wrath go forth like fire. and burn with none to quench it. not just the Jews. and sow not among thorns. 19 and if you are sure that you are a guide to the blind. however. 17 But if you call yourself a Jew and rely upon the law and boast of your relation to God 18 and know his will and approve what is excellent. His praise is not from men but from God. 13 For it is not the hearers of the law who are righteous before God.Judah was thus given ‘first refusal’ on the truth and salvation through Jesus the Messiah. a light to those who are in darkness. the Jew first and also the Greek. 29 He is a Jew who is one inwardly. . 4 Circumcise yourselves to the LORD. remove the foreskin of your hearts.e. The call is going out at present. 10 but glory and honor and peace for every one who does good. 28 For he is not a real Jew who is one outwardly. 17-29 There will be tribulation and distress for every human being who does evil." 25 Circumcision indeed is of value if you obey the law. do you commit adultery? You who abhor idols. will you not teach yourself? While you preach against stealing. because you are instructed in the law. spiritual and not literal. The rest of Israel may yet have to experience their own punishment. Yehoshua restated Jeremiah’s words when he gave the parable of the sower in Matthew 13:3ff. do you rob temples? 23 You who boast in the law. at the time of the destruction of the Temple and in the Holocaust centuries later.. because of the evil of your doings. for example. 11 For God shows no partiality. if a man who is uncircumcised keeps the precepts of the law. having in the law the embodiment of knowledge and truth-. will not his uncircumcision be regarded as circumcision? 27 Then those who are physically uncircumcised but keep the law will condemn you who have the written code and circumcision but break the law. nor is true circumcision something external and physical. in that it meant Judah would also be the first to be punished for rebellion such as. of the heart) required of all people. and it is up to individuals within Judah to allow those words to take root in their hearts and minds and to respond to that call. Jeremiah 4:3-4 For thus says the LORD to the men of Judah and to the inhabitants of Jerusalem: "Break up your fallow ground. which speaks of the seed or the word of God being broadcast or distributed abroad and whether or not it finds root in fertile ground. but if you break the law. as it is written. do you dishonor God by breaking the law? 24 For. he was echoing Jeremiah’s words. but the doers of the law who will be justified…. 12 All who have sinned without the law will also perish without the law. "The name of God is blasphemed among the Gentiles because of you. do you steal? 22 You who say that one must not commit adultery. your circumcision becomes uncircumcision." (RSV) Similarly. Romans 2:9-13. 20 a corrector of the foolish. and real circumcision is a matter of the heart. the Jew first and also the Greek.21 you then who teach others.

It connected them to their biblical origins. 252-3) Like all of God’s children.. And while it is noble and right to have a strong connection with the physical land of Israel. uncompromised ethical monotheism looks like. they undoubtedly have a strong innate desire ‘to find their way back home’ to Him. But Judaism needs Christianity to remind us that the word of God is not meant to be kept for ourselves alone. . (Kushner. They are ‘prodigal sons’… as are we all. until a certain number from the tribe of Judah are brought into God’s true Church. Israel is not a new. Christianity needs Judaism to remind it of what pure. there remains the more vital connection we are required to have with spiritual Israel. We are called on not merely to live by God’s ways. had come to Jerusalem to pray at the Western Wall. It has already been decided that a full 12. but to do it in such a manner that the world will be persuaded to turn to God.. Within two months of the end of the Six-Day War. fully half the population of Israel. R. Rabbi Kushner gave a hint of the latent spirituality in many secular Jews. but is in fact one of the oldest countries in the world … That explains why Jews were moved to tears in June 1967 when the Old City of Jerusalem. (ibid. … Christianity needs the example of the Jewish community actually striving to do what the Torah calls upon us to do.000 people from the tribe of Judah will be inducted into the central core of God’s chosen or elect. 7:3-5). most of them non-religious Jews. ch. and other biblical sites became part of Israel. and even non-religious Jews were thrilled by that. p. Awaiting Judah The elect cannot be sealed.. the Christian Churches of God bring together those vital strands of religious belief and practice. and the world in general cannot be saved. numbering 144.. ibid. Kushner in To Life! explains how (mainstream) Christianity and Judaism can learn valuable lessons from each other. by being both Torah-observant and by promulgating God’s ways as widely as possible with the ultimate aim of encouraging the whole world to turn to Him. We know that forgiveness from God is available at any time and not just on a . the Tomb of the Patriarchs in Hebron.It seems that when we scratch the skin of a self-confessed atheistic or agnostic Jew we find not too far below the surface a rather spiritual person who might readily respond to God’s calling of him or her.000 in total (Rev. the Western Wall of the Temple. forty-year old country. The Great Multitude of the First Resurrection (Rev. pp. 7) is to consist of members of all tribes and nations of the Earth. 290) In point of fact.

and all Judah and the inhabitants of Jerusalem fell down before the LORD. the God of Israel: Regarding the words which you have heard. I also have heard you. worshiping the LORD. 2Kings 22:18-19 But as to the king [Josiah] of Judah. "Hear me. even today. Saul repented and was baptised and renamed Paul. and he stood above the people. and a certain Pharisee named Saul of Tarsus was consenting to his death (Acts 8:1). Judah and inhabitants of Jerusalem! Believe in the LORD your God. the God of their fathers. "Give thanks to the LORD. as they went before the army. these testified against them. and you have rent your clothes and wept before me. 20 Then the Spirit of God took possession of Zechari'ah the son of Jehoi'ada the priest. but in His own time He will deal with each person to their own good. "Thus says God. and you will succeed. who sent you to inquire of the LORD. and as they went out. and you will be established. Jehosh'aphat stood and said. believe his prophets. And He eventually deals with all people’s games and their refusal to acknowledge Him or listen to His servants. God is not mocked. as when Stephen made the truth known to Jews from many parts of the Near and Middle East in the first century CE (Acts 6:5-7:60). He doesn’t want to see His prophets. thus shall you say to him. `Why do you transgress the commandments of the LORD. that they should become a desolation and a curse. he has forsaken you. (RSV) 2Chronicles 20:3. 20 And they rose early in the morning and went out into the wilderness of Teko'a. and proclaimed a fast throughout all Judah…. 19 Yet he sent prophets among them to bring them back to the LORD. he appointed those who were to sing to the LORD and praise him in holy array. Thus says the LORD. those bringing the message of the recall to God. And wrath came upon Judah and Jerusalem for this their guilt.'" 21 But they conspired against him. stood up to praise the LORD.specific day of the year such as Yom Kippur. and said to them. He too was stoned to death for his efforts. ignored. although this led inexorably to Saul’s belief in Jesus/Yehoshua as the Messiah and to his miraculous conversion on the road to Damascus. provided that repentance is genuine. 18 Then Jehosh'aphat bowed his head with his face to the ground. so that you cannot prosper? Because you have forsaken the LORD." (RSV) A prophet of Judah was once used by God to warn Israel’s king of impending disaster (1Kgs. 19 And the Levites. and against its inhabitants. and you humbled yourself before the LORD. and set himself to seek the LORD. 2Chronicles 24:18-21 And they forsook the house of the LORD. and say." 21 And when he had taken counsel with the people. but they would not give heed. when you heard how I spoke against this place. of the Ko'hathites and the Kor'ahites. This has been demonstrated many times throughout the history of Israel and Judah. 19 because your heart was penitent. the God of Israel.18-21 Then Jehosh'aphat feared. abused or even murdered as happened on numerous occasions in the past. 13:1- 3). Yet. for his steadfast love endures for ever. says the LORD. and by command of the king they stoned him with stones in the court of the house of the LORD. with a very loud voice. when God calls Judah to return to Him through Yehoshua the Messiah. and served the Ashe'rim and the idols. (RSV) Little was to change in subsequent years. .

and put away the abominable idols from all the land of Judah and Benjamin and from the cities which he had taken in the hill country of E'phraim. and Micai'ah. the prophecy of Azari'ah the son of Oded. he took courage. he was found by them. and said to him. Nethan'el. If you seek him. Ben-hail. city by city. Shemi'ramoth. for God troubled them with every sort of distress. A more successful campaign had been implemented by King Asa of Judah. and he repaired the altar of the LORD that was in front of the vestibule of the house of the LORD. (RSV) Jehoshaphat later set judges in all Judah to administer righteous judgment and thereby true justice for all. Judah’s renowned advocacy skills could be useful also in persuading the rest of Israel to return to God. Zebadi'ah. and those from E'phraim. 7 In the third year of his reign he sent his princes.It is perhaps appropriate that Second Chronicles is the last book in the Jewish Tanakh. nation against nation and city against city. and without a teaching priest. And. 5 He appointed judges in the land in all the fortified cities of Judah. 10 And the fear of the LORD fell upon all the kingdoms of the lands that were round about Judah. as they tried to do before with limited success (see 2Chronicles 29 and 30). and brought them back to the LORD. Asa. and Simeon who were sojourning with them. "Consider what you do. 2Chronicles 15:1-9 The Spirit of God came upon Azari'ah the son of Oded. and he went out again among the people. and furthermore he took the high places and the Ashe'rim out of Judah. for you judge not for man but for the LORD. the God of their fathers. 3 For a long time Israel was without the true God. 7 But you. he is with you in giving judgment. as so often before. 4 but when in their distress they turned to the LORD. 6 and said to the judges. the priests Eli'shama and Jeho'ram. they went about through all the cities of Judah and taught among the people. Nethani'ah. and Tobadoni'jah. and all Judah and Benjamin: The LORD is with you. 2 and he went out to meet Asa. while you are with him. for great numbers had deserted to him from Israel when they saw that the LORD his God was with him. 2Chronicles 17:6-10 His heart was courageous in the ways of the LORD. take courage! Do not let your hands be weak. and sought him. 7 Now then. . and with these Levites. 6 They were broken in pieces. "Hear me. and without law. 9 And they taught in Judah. for great disturbances afflicted all the inhabitants of the lands. Judah may be required to set the example and march in the vanguard." 8 When Asa heard these words. 2Chronicles 19:4-11 Jehosh'aphat dwelt at Jerusalem. (RSV) Similarly. Adoni'jah. As'ahel. the God of Israel. King Jehoshaphat of Judah finally saw the need to teach and implement the Laws of God throughout Israel as an essential part of any restoration process. and they made no war against Jehosh'aphat. he will forsake you. 9 And he gathered all Judah and Benjamin. this time in the much more-important campaign to deliver the true message of salvation to all. Zechari'ah. Manas'seh. to teach in the cities of Judah. for your wrk shall be rewarded. he will be found by you. 8 and with them the Levites. let the fear of the LORD be upon you. as it contains pertinent messages for these Last Days of the present age. 5 In those times there was no peace to him who went out or to him who came in. Tobi'jah. having the book of the law of the LORD with them. Jehon'athan. Shemai'ah. Obadi'ah. from Beer-sheba to the hill country of E'phraim. but if you forsake him.

because they were harassed and helpless. 9 And he charged them: "Thus you shall do in the fear of the LORD. who saw that Judah was a lost nation: Matthew 9:36 When he saw the crowds. “I saw all Israel scattered upon the mountains. concerning bloodshed. like sheep without a shepherd. (RSV) However. was directionless and lacking a shepherd or guide. 215). They had their seat at Jerusalem. at his next Advent. Messiah will come as the Redeemer from enslavement to sin as a result of rebellion to God. The writer of Chronicles noted that all Israel. says the LORD. to give judgment for the LORD and to decide disputed cases. to those in Jacob who turn from transgression. cit. and Zebadi'ah the son of Ish'mael. for there is no perversion of justice with the LORD our God. Thus you shall do. Amari'ah the chief priest is over you in all matters of the LORD. an with your whole heart: 10 whenever a case comes to you from your brethren who live in their cities. justice and peace lived in as children of God (The Religion of Jesus the Jew. the governor of the house of Judah. The overall mission of Yehoshua the Messiah was put very succinctly by Geza Vermes. in all the king's matters. and the fact that the prophet Micah “saw” this hints at a prophetic significance for today.. 2Chronicles 18:16a And he said. then you shall instruct them. (RSV) Of vital importance though. and may the LORD be with the upright!" (RSV) Thus the restoration must be according to the Laws of God. the stray sheep of mankind. 11 And behold. and the Levites will serve you as officers. Deal courageously. as sheep that have no shepherd. it will be rather too late for us to be included in the First (and greater) Resurrection." 8 Moreover in Jerusalem Jehosh'aphat appointed certain Levites and priests and heads of families of Israel. he had compassion for them. For the magnetic appeal of the teaching and example of Jesus holds out hope and guidance to those outside of the fold of organized religion. p. 8:11-12). who yearn for a world of mercy. law or commandment. take heed what you do. (RSV) This was echoed later by Yehoshua/Jesus. and you will not incur guilt. Which is why Christ says there will be a weeping and gnashing of teeth (Mat. statutes or ordinances. Isaiah 59:20 "And he will come to Zion as Redeemer. in faithfulness. including Judah. or taking bribes. that they may not incur guilt before the LORD and wrath may not come upon you and your brethren. or partiality. disbelief or lack of a repentant attitude when they knew the Truth and . is the fact that if we wait until Messiah makes his appearance upon the Earth before we finally commit to recognising and acclaiming him as the expected Anointed One. op. as those who didn’t accept him in the period between his two Advents will be distraught at having ‘missed the boat’ through their indecision.

But it is when he is out of sight right now that we are expected to believe the reports about him and to walk by faith. and is willing to act upon it. It will be easy enough to accept the King-Messiah as the Anointed One when we are standing before him. Solomon’s prayer at the dedication of the Temple is arguably the most beautiful and moving in the entire Bible (1Kgs. For Forgiveness: Forgive us. 6. presumably with a genuine desire to return to God instead of merely going through the motions of religiosity. for we have sinned. not without some trepidation perhaps. O our King. to Your Instruction. with a heart far from God (Isa. Blessed are You. (RSV) A particularly relevant part of the Amidah Prayer may be worth remembering here also. when you seek me with all your heart. says the LORD. that is. pardon us. draw us near. O our Father. . We don’t need faith to believe in someone or something that is in front of us. 15:8). and I will hear you. We are told that the proud or haughty of Judah will be removed. and I will restore your fortunes and gather you from all the nations and all the places where I have driven you. for You pardon and forgive. Refer to the paper Rule of the Kings Part III: Solomon and the Key of David (No. including the Rabbis and the Zionists teaching untruths (Zeph. O Lord. For Repentance: Bring us back. 14 I will be found by you. 2Chr. O our King. (RSV) He is also in a state of readiness to listen to heartfelt prayer. for we have transgressed. Blessed are You. 29:13. or smugly imagined themselves to be sons of Abraham by heritage and thus with one foot in the Kingdom already. O our Father. and the Jews will be converted in spite of their unbiblical traditions. 5. Mat. 3:11).where to find it. who is merciful and always ready to forgive. who delights in repentance. 137). 8:22-53. 2Chronicles 16:9a For the eyes of the LORD run to and fro throughout the whole earth. O Lord. 13 You will seek me and find me. Just as God listened and heeded Solomon’s prayer. 6:12-42). 282C) for the full text of Solomon’s Temple prayer and the fact of its application to the Gentiles as well as to Israel. Jeremiah 29:12-14 Then you will call upon me and come and pray to me. to Your service. and cause us to return to You in perfect repentance. to show his might in behalf of those whose heart is blameless toward him. says the LORD. and I will bring you back to the place from which I sent you into exile. we are reminded that He sees all and rewards accordingly. These aspects are also covered in the paper Measuring the Temple (No. Of particular note is the verse: “whenever they call upon you”.

The world awaits you. Judah.To you who have given mankind so much already: God can certainly use your undoubted talents in His work for the salvation of the world. You have to be prepared so that Messiah can return to His own tribe and people in due process.  . You are encouraged to take up your position in the vanguard of Israel’s return to the Promised Land and to God’s favour.

In other words he was a convert to Judaism. E1b is not Semitic and certainly not a son of Judah. from both sides of his ancestry. tracked down the Fuhrer’s relatives. What we do know now beyond doubt is that Adolph Hitler was a Jew of ancient lineage that was of itself not of the sons of Judah. a Belgian journalist. . whether Sephardi or Ashkenazi is not yet certain.APPENDIX Some time ago I wrote on the aspect of Hitler being a Jew. earlier this year. a historian. "One can from this postulate that Hitler was related to people whom he despised.uk/news/newstopics/world-war-2/7961211/Hitler- had-Jewish-and-African-roots-DNA-tests-show. Since that time the scientific evidence has been collected and we can now say with certainty that he was a Jew.co. The Gestapo in Austria imprisoned his cousin.telegraph. one Alois V. including an Austrian farmer who was his cousin. The YDNA comes from Egyptian/North African or Canaanite YDNA. Knack. What is understood to be the case is that his father Alois Hitler was the illegitimate son of the maid Maria Schickelgruber and a 19-year-old Jewish man named Frankenberger." Mr Mulders wrote in the Belgian magazine. Jean-Paul Mulders. We can determine that from the YDNA structure of his family. Schikelgruber in an Austrian death camp. and Marc Vermeeren. He was however not a son of Judah but rather of an early convert to Judaism.html Hg. Heidi Blake wrote an article on it on 24 August 2010 in the Telegraph: http://www. It is most probably of ancient Egyptian stock that led into the Phoenician stock of Carthage. 39 of his relatives had DNA tests done and he has proven to be of the Hamitic YDNA E1b1b1.

What is the most amazing and appalling fact is that a full-blooded “Jew” assumed rulership of Germany.6 per cent to 30 per cent of Sephardic Y-chromosomes.Haplogroup E1b1b1." said Ronny Decorte. It is quite a serious possibility that Hitler’s family were Egyptian slaves that left Egypt as part of the Mixed Multitude and were allocated to Judah or Levi in the allocation of workers in the . He had his own relatives killed in an Austrian death camp. appears to be one of the major founding lineages of the Jewish population. E and Hg. Haplogroup E1b1b1 which showed up in the samples of Hitler’s family is rare in Western Europe and is most commonly found in the Berbers of Morocco. Some 25% of all European Jews are of Hg. a nation to which he did not even really belong although he fought for it and was decorated by them. which accounts for approximately 18 to 20 per cent of Ashkenazi and 8. What sort of a mind are we dealing with? A very sick one is the obvious conclusion. says the DNA was tested under stringent laboratory conditions. a genetic specialist at the Catholic University of Leuven. E1b1b1 may stem from an early group of north Africans that came into Israel from Egypt even as early as the Exodus or who were Canaanites or were converted from North African Berbers at a later date into the Jewish community there. Knack. So also is E3b. E1b is a foundational stock of Judaism. Certainly they had come in by 1215. He mobilised that nation and imbued it with the express desire to wipe out an ethnic group of people that comprised a large part of the intelligentsia of his own people and to which the sordid little man himself belonged in an extended family that still live there in Austria to this day. The Jews there in Austria may have even come into Europe with Punic forces but it is far more likely that they came in with the Ashkenazi Jews that went west even as early as the Tenth Century with the founders of Austria. Algeria and Tunisia. "This is a surprising result. as well as among Ashkenazi and Sephardic Jews. which published the findings.

The only possibility of any Semite blood in them is through the female lineages. Be very careful because you never know who your brother might be. This section deals with the nation of Israel often referred to as the Lost Ten Tribes and their role in prophecy. The correction of the second resurrection will confront literally millions of people with an awful truth that they will have great difficulty in dealing with. They were persecuting their own brethren and when they found out the truth they were furious. Every two bit Nazi loving hater of Jews and other races will have to be faced with the fact of what they followed and who they were. We now know beyond any doubt what Hitler was and what family structure he came from and what he did to his own people. . They were not repentant. Their YDNA completely eliminates the possibility that they were Semites. They thought they were white and they were not. The command is to love all men and show thereby that you love God whom you have not seen.Temple system. One of the funniest things I was told about the Klansmen in the US was that there were a number of families that went to be YDNA tested and they were furious when they found out that they were descended from African slaves that may well have come in as early as the Roman period. Descendants of Abraham Part VI: Israel The nation of Israel was divided into two kingdoms: one of Judah and the other of Israel proper.

from the tribe of Ephraim. and it was periodically invaded and most of its inhabitants were sent into captivity. his son Rehoboam was proclaimed king. Many in Israel showed their displeasure by supporting his rival. . The final Assyrian invasion and deportation of Israel occurred in 722 BCE. The Northern Kingdom soon became idolatrous also. the Ephraimite. The restoration of a united Kingdom is prophesied. Jeroboam The first ruler of the breakaway Kingdom of Israel was Jeroboam the son of Nebath. God ordained the resulting division of Solomon’s Kingdom as punishment for his idolatry Upon Solomon’s death in 932 BCE. These events can be seen ultimately as a means of preserving both Israel and Judah. 282C). This work is concerned with the fate of Israel after the division. A suggested Chronology of the Kings of Israel is also appended. is dealt with in the paper Jeroboam and the Hillel Calendar (No. The reigns of all 20 kings of the Northern Kingdom will be examined chronologically. as recorded in 1Kings 12 and 13. Descendants of Abraham Part VI: Israel Introduction The story of the kingdom of Israel up until the death of Solomon is contained in the paper Rule of the Kings Part III: Solomon and the Key of David (No. 191). Jeroboam. The complete story of his life and reign.

Mat. thou and thy brother. However. Surah 20:42 Go. 1Kings 12:7 And they said to him. even to an oppressive and hard-hearted Pharaoh let alone the people of Israel. and their great men exercise authority over them. On his return from exile following the death of Solomon. 2Chr.We saw that Jeroboam had been involved in a rebellion against Solomon whereby.. (RSV) The need sometimes to speak a good or gentle word. Rehoboam. 44 and whoever would be first among you must be slave of all. (Pickthal) According to God’s purpose. to ask that he lighten the hard service imposed by his father (2Chr. but whoever would be great among you must be your servant. and speak good words to them when you answer them. . that peradventure he may heed or fear. 2:15). hence. In 1Kings 11:28 it is said that Jeroboam was a very industrious and capable man who had been put in charge of the forced labour of the House of Joseph during Solomon’s extensive building programs. “there was war between Rehoboam and Jeroboam all the days of his life” (1Kgs. Hos. as the Qur’an records. 43 But it shall not be so among you. with My tokens. was enjoined upon Moses by the Angel of Yahovah. 15:6). "If you will be a servant to this people today and serve them. just as many others had done before and since. civil war was narrowly averted … for the time being. Lo! he hath transgressed (the bounds). 10:2ff. 11:26ff. 44 And speak unto him a gentle word. and be not faint in remembrance of Me. including Messiah’s parents (cf.). decisive and permanent. “he lifted up his hand against the king” (1Kgs. then they will be your servants for ever. the burden upon the Israelites was not lightened by Rehoboam. so that the division between Judah and Israel was inevitably swift. Judah was told that the division of the kingdom had been ordered by God. 43 Go. He then fled to Egypt for sanctuary. 11:1. however. Mark 10:42b-44 "You know that those who are supposed to rule over the Gentiles lord it over them. both of you. unto Pharaoh. Jeroboam and the congregation of Israel came before the new king." (RSV) This fundamental principle of service to one’s people was reinforced by Christ in a rebuke to his disciples. 2:6). The older and more experienced advisers approached Rehoboam with a plea on behalf of Israel.

and the Levites. and said. while the Northern Kingdom of Israel was to survive for a further 210 years.The united Kingdom of Saul. 7 and certain worthless scoundrels gathered about him and defied Rehobo'am the son of Solomon. because you are a great multitude and have with you the golden calves which Jerobo'am made you for gods. and made priests for yourselves like the peoples of other lands? Whoever comes to consecrate himself with a young bull or seven rams becomes a priest of what are no gods. 3 Abi'jah went out to battle having an army of valiant men of war. 2Chronicles 11:13-16 And the priests and the Levites that were in all Israel resorted to him from all places where they lived. 14 For the Levites left their common lands and their holdings and came to Judah and Jerusalem. Such a covenant is further explained in the paper Passover Questions and the Reasons for Our Faith (No. where Jeroboam and Abijah. and Jerobo'am drew up his line of battle against him with eight hundred thousand picked mighty warriors. 9 Have you not driven out the priests of the LORD. 16 And those who had set their hearts to seek the . Now there was war between Abi'jah and Jerobo'am. As a direct result of Jeroboam’s slide into idolatry many of the former priests and Levites found themselves destitute and deserted the Northern Kingdom for Jerusalem. 35). 51) under the heading ‘Salt’. 8 "And now you think to withstand the kingdom of the LORD in the hand of the sons of David. O Jerobo'am and all Israel! 5 Ought you not to know that the LORD God of Israel gave the kingship over Israel for ever to David and his sons by a covenant of salt? The covenant of salt could not be altered or rescinded (Num. are preparing for battle. 2 He reigned for three years in Jerusalem. 18:19) and Abijah is reminding Israel of this fact. The story of the Northern Kingdom continues in 2Chronicles 13. "Hear me. when Rehobo'am was young and irresolute and could not withstand them. 6 Yet Jerobo'am the son of Nebat. His mother's name was Micai'ah the daughter of U'riel of Gib'e-ah. and for the satyrs. because Jerobo'am and his sons cast them out from serving as priests of the LORD. a servant of Solomon the son of David. 15 and he appointed his own priests for the high places. from 1052 to 932 BCE. four hundred thousand picked men. 2Chronicles 13:1-22 In the eighteenth year of King Jerobo'am Abi'jah began to reign over Judah. Ahijah the prophet had already informed Jeroboam that he was to be given leadership over these northern ten tribes (v. 4 Then Abi'jah stood up on Mount Zemara'im which is in the hill country of E'phraim. rose up and rebelled against his lord. and for the calves which he had made. the new king of Judah. the sons of Aaron. David and Solomon had lasted exactly 120 years.

and his priests with their battle trumpets to sound the call to battle against you. and we have not forsaken him. 19 And Abi'jah pursued Jerobo'am. firstly by taking to themselves the priestly duties reserved for those of Aaronic or Levitical descent and. 14 And when Judah looked. The ultimate defeat of the northern Israelites was sealed. Although the army of Judah was outnumbered two-to-one by the other Israelites in this battle. the battle was before and behind them. and Levites for their service. however.000 men killed upon Israel – more than half of its warrior strength. the God of their fathers. 11 They offer to the LORD every morning and every evening burnt offerings and incense of sweet spices. 16 The men of Israel fled before Judah. they correctly deduced that they had God (and moral right) on their side. O sons of Israel. God is with us at our head. Continuing in 2Chronicles 13: 10 But as for us. and the priests blew the trumpets. 15 Then the men of Judah raised the battle shout. the God of their fathers. 12 Behold. 13 Jerobo'am had sent an ambush around to come on them from behind. and took cities from him. from their idolatry in worship of the golden calves. and they cried to the LORD. And when the men of Judah shouted. for you cannot succeed. and that remained the case after the Babylonian captivity also. thus his troops were in front of Judah. and care for the golden lampstand that its lamps may burn every evening. 20 Jerobo'am did not recover his power . 14:5). the LORD is our God. the God of your fathers. The fact is. Bethel with its villages and Jesha'nah with its villages and Ephron with its villages. King Asa had also removed the sun images (Heb. for we keep the charge of the LORD our God. set out the showbread on the table of pure gold. 18 Thus the men of Israel were subdued at that time. and the ambush was behind them. 17 Abi'jah and his people slew them with a great slaughter. God defeated Jerobo'am and all Israel before Abi'jah and Judah. Thus Judah was able to encroach upon Ephraim’s territory to the north and create a buffer zone. but you have forsaken him." Judah continued to uphold the correct Temple service and was favoured by God for so doing. and so prevailed. LORD God of Israel came after them from all the tribes of Israel to Jerusalem to sacrifice to the LORD. and God gave them into their hand. chamman) from all the cities of Judah (2Chr. We have priests ministering to the LORD who are sons of Aaron. do not fight against the LORD. secondly. (RSV) It may be that fully two-thirds of the people – a great multitude – sided with Jeroboam in his rebellion (cf. that the Levites did not all remove to Jerusalem and the twenty-four divisions of the Levites had to be reconstituted from the three full divisions left in Judah plus some returnees. also the size of the armies). because they relied upon the LORD. behold. and the men of Judah prevailed. They inflicted losses of 500. so there fell slain of Israel five hundred thousand picked men.

21 But Abi'jah grew mighty. and reigned twenty-four years. 1Kings 15:25-31 Nadab the son of Jerobo'am began to reign over Israel in the second year of Asa king of Judah. the God of Israel. his ways and his sayings. and reigned in his stead. 34 He did what was evil in the sight of the LORD. the Hebrew word ra‘ or ra‘ah (SHD 7451) used can mean disaster or calamity (resulting from sin) and not just moral wickedness. until he had destroyed it. Jeroboam’s reign. Nadab Jeroboam was followed on the throne of Israel by his son Nadab (meaning generous) who reigned for only 2 years. and had twenty-two sons and sixteen daughters. and he reigned over Israel two years. are they not written in the Book of the Chronicles of the Kings of Israel? (RSV) Little else is known of Nadab from either the Bible or secular sources. 1Kings 15:32-34 And there was war between Asa and Ba'asha king of Israel all their days. 28 So Ba'asha killed him in the third year of Asa king of Judah. . generally proved disastrous. conspired against him. and walked in the way of his father. 31 Now the rest of the acts of Nadab. 22 The rest of the acts of Abi'jah. And he took fourteen wives. in the days of Abi'jah. 909-886 BCE following its relocation from Shechem. and Ba'asha struck him down at Gib'bethon. 29 And as soon as he was king. he left to the house of Jerobo'am not one that breathed. and because of the anger to which he provoked the LORD. and he died. are written in the story of the prophet Iddo. 30 it was for the sins of Jerobo'am which he sinned and which he made Israel to sin. and in his sin which he made Israel to sin. which belonged to the Philistines. Baasha The second dynasty in Israel began with Baasha. 33 In the third year of Asa king of Judah. (RSV) He reigned in the new capital Tirzah in the period ca. and all that he did. for Nadab and all Israel were laying siege to Gib'bethon. Although his name is forever synonymous with “evil”. and walked in the way of Jerobo'am and in his sin which he made Israel to sin. according to the word of the LORD which he spoke by his servant Ahi'jah the Shi'lonite. 27 Ba'asha the son of Ahi'jah. 26 He did what was evil in the sight of the LORD. of the house of Is'sachar. son of Ahijah of the tribe of Issachar and from humble beginnings. Baasha’s idolatry was merely a continuation of what Jeroboam had begun. He was killed by Baasha at a place called Gibbethon just inside the border with Philistia. who would certainly live up to his name (meaning wicked). Ba'asha the son of Ahi'jah began to reign over all Israel at Tirzah. and the LORD smote him. he killed all the house of Jerobo'am. as well as those of subsequent kings. (RSV) King Jeroboam was finally struck down by God and died.

16:1ff. in being like the house of Jerobo'am. Darmesek) who attacked several Israelite cities in order to relieve the pressure on Judah (v. both because of all the evil that he did in the sight of the LORD. it was still a regicide that had to be punished (see the paper Genealogy of the Messiah (No. 4 Any one belonging to Ba'asha who dies in the city the dogs shall eat. provoking him to anger with the work of his hands. and while that kingdom was enjoying relative peace. However. Asa called for help from the Syrian king Ben-hadad of Damascus (Heb. you shall have wars!” (v. and any one of his who dies in the field the birds of the air shall eat. seven miles (11 km) north of Jerusalem. and Elah his son reigned in his stead. It was built partly from the materials Baasha had been using to fortify Ramah of Benjamin on the same road. 7 Moreover the word of the LORD came by the prophet Jehu the son of Hana'ni against Ba'asha and his house. 2Chr. Elah . and also because he destroyed it. During this turbulent period King Asa built a fortress at Mizpah on the main route north from Jerusalem (1Kgs. and was buried at Tirzah. and I will make your house like the house of Jerobo'am the son of Nebat. I will utterly sweep away Ba'asha and his house. The walls of Mizpah were discovered to be an impressive 26 feet (8 metres) thick in a 1930s American excavation of the site – now Tell en- Nasbe. and you have walked in the way of Jerobo'am. Baasha began a military campaign against him (2Chr. This massive construction hints at the intensity and bitterness of the wars between the rival kingdoms. consequently. 3 behold. he was told by the prophet Hanani: “henceforth. 4). 1Kings 16:1-7 And the word of the LORD came to Jehu the son of Hana'ni against Ba'asha. It was subsequently returned upon Baasha’s own family by his ‘servant’ Zimri when he became king. Asa had forgotten his covenant of reliance upon God. Baasha enjoyed the third longest reign in Israel’s history (24 years) and died a natural death.). and have made my people Israel to sin.). 15:22. saying.In King Asa’s 36th year on the throne of Judah. (RSV) Although Baasha was the instrument for fulfilling Ahijah’s prophecy by killing Nadab (14:1ff. and his might. are they not written in the Book of the Chronicles of the Kings of Israel? 6 And Ba'asha slept with his fathers. provoking me to anger with their sins. 16:6). 2 "Since I exalted you out of the dust and made you leader over my people Israel. 9). and what he did. Despite his wickedness." 5 Now the rest of the acts of Ba'asha. 119)).

It is now called Tell el-Farah and lies about 9 miles (14 km) north of modern Sabastiyeh (formerly Samaria). Zimri. which he spoke against Ba'asha by Jehu the prophet. according to the word of the LORD. In fact. he killed all the house of Ba'asha. who was over the household in Tirzah. as soon as he had seated himself on his throne. 1Kings 16:8-10 In the twenty-sixth year of Asa king of Judah. 145)). 1Kings 16:11-20 When he began to reign. drinking himself drunk in the house of Arza. While Judah at this time was enjoying relative stability under King Asa (who reigned a total of 41 years). When he was at Tirzah. during a bout of drunkenness. Zimri Zimri was a successful cavalry officer and commanded half of Israel’s chariot force. Israel experienced the second murder of their incumbent king. and which they made Israel to sin. and reigned in his stead. Zimri belied his melodious name and set about fulfilling Jehu’s prophecy concerning the house of Baasha with ruthless efficiency. It is not unreasonable to suppose that Arza was party to the conspiracy to murder Elah. 12 Thus Zimri destroyed all the house of Ba'asha. 14 Now the rest of the acts of Elah. 9 But his servant Zimri. and reigned two years. Elah the son of Ba'asha began to reign over Israel in Tirzah.Elah the son of Baasha became the fourth king on Israel’s throne. and all that he did. His reign of two years was cut short by his own chariot-force commander. 10 Zimri came in and struck him down and killed him. . during his reign Asa saw no fewer than seven kings come and go on the throne of Israel. Once he became king. conspired against him. are they not written in the Book of the Chronicles of the Kings of Israel? 15a In the twenty- seventh year of Asa king of Judah. commander of half his chariots. His name means my music. Solomon had compared his Shulammite woman to Tirzah in Song of Songs 6:4 (see the paper Song of Songs (No. 13 for all the sins of Ba'asha and the sins of Elah his son which they sinned. he did not leave him a single male of his kinsmen or his friends. When Israel heard that Zimri had murdered the king in a conspiracy the army commander Omri was declared king and they took the city. in the twenty-seventh year of Asa king of Judah. provoking the LORD God of Israel to anger with their idols. (RSV) Tirzah was an ancient Canaanite city of particular beauty. however. Zimri reigned seven days in Tirzah.

and all Israel with him. Vol. The destruction of the palace may have been one reason for the subsequent transfer of the capital to Samaria (renamed Sebaste by the Romans). being made king by all Israel. It was the same city of the siege in which Nadab was killed by Baasha. Sama'ria. . 641) says the civil war was three years. and died. ‘Zimri’). six years he reigned in Tirzah. and he fortified the hill. and burned the king's house over him with fire. doing evil in the sight of the LORD. 18). half of the people followed Tibni the son of Ginath. 18 And when Zimri saw that the city was taken. Omri began to reign over Israel. and for his sin which he committed. and the conspiracy which he made. ‘Tibni’. What followed was a three-year civil war where Tibni was killed and Omri ascended the throne of all Israel. 24 He bought the hill of Sama'ria from Shemer for two talents of silver. for which site at Shomeron he paid a mere two talents of silver. the Philistine city in the tribal lands of Dan that was given to the Kohathite Levites. 22 But the people who followed Omri overcame the people who followed Tibni the son of Ginath. 19 because of his sins which he committed. to make him king. walking in the way of Jerobo'am. "Zimri has conspired. 16 and the troops who were encamped heard it said. says in The Lost Testament (Century. and they besieged Tirzah. The Bible states simply that he “died”. which belonged to the Philistines. The Jewish Encyclopedia claims that he “was regent over half the kingdom of Israel for a period of four years” (art. the Egyptologist and historian. 23 In the thirty-first year of Asa king of Judah. and he has killed the king". 2002) that Tibni reigned for 2 years and died in battle. while David Rohl. London. 4. he went into the citadel of the king's house. the commander of the army. garnered enough support from half of Israel to also be proclaimed king.Zimri committed suicide by deliberately setting fire to the king’s house while still inside (v. the owner of the hill. the son of Ginath. are they not written in the Book of the Chronicles of the Kings of Israel? (RSV) Gibbethon (the mound). so Tibni died. 1Kings 16:21-28 Then the people of Israel were divided into two parts. and reigned for twelve years. 17 So Omri went up from Gib'bethon. Tibni and Omri In verse 16 we saw another military commander. Ward (The Interpreter’s Dictionary of the Bible art. making Israel to sin. 20 Now the rest of the acts of Zimri. The most notable achievement of Omri was the building of a new capital at Samaria. and called the name of the city which he built. 15b Now the troops were encamped against Gib'bethon. 5:23). and Omri became king. king over Israel that day in the camp. However. the same amount given by Naaman to Elisha’s mercenary servant Gehazi (2Kgs. p. Omri (heaping). after the name of Shemer. and half followed Omri. again figured in the story of transfer of the kingship. Tibni (probably originally Tabni). therefore all Israel made Omri.

’ In my days Che[mosh] said. the modern Kerak/Karak. 25 Omri did what was evil in the sight of the LORD. I destroyed. Chemosh here is the god associated with the golden calves that Jeroboam erected and to which children were sacrificed (see the paper The Golden Calf (No. A local spring makes the place ideal for defence. Sidon and Byblos. pp. before relocating to Samaria in about 880 BCE. I burned. 222)). ‘I will oppress Moab. Samaria lies on a solitary hill. to anger by their idols. (Bantam Books. Part of the inscription on the stone reads: Omri [was] king of Israel. excepting Jeroboam perhaps. for Chemosh was angry with his land. and he oppressed Moab many days. Hodder & Stoughton. In The Bible as History. provoking the LORD. He was the Omri mentioned in the inscription on the famous Moabite Stone (now in the Louvre Museum. which rises gently out of a broad and fertile valley and is surrounded by a semi-circle of higher mountains. Omri found little favour with God. about 300 feet high. I settled Assyrians in their place … I washed my weapons in the Great Sea. His son followed him and he also said. I took their warriors prisoner and impaled them on stakes before their cities. ‘I will see my desire on him and his house. the God of Israel. And Israel surely perished forever! (lines 4- 7) Israel was indeed effectively ‘to perish’ from off their land when they were deported by their Assyrian conquerors beyond the Araxes River. I demolished. 243-4) Great military planner or not. and in the sins which he made Israel to sin. . He has the distinction of having done more evil than all previous kings. 26 For he walked in all the way of Jerobo'am the son of Nebat. An inscription of King Ashurnasir-pal II proclaimed triumphantly: I marched from the Orontes … I conquered the cities … I caused great slaughter. The choice of a site revealed the expert who was guided by strategic considerations. and did more evil than all who were before him. Paris) attributed to King Mesha of Moab whose capital was at Kir-Haresheth. Werner Keller gives details of the site of the new city.Omri reigned six years in Tirzah. The Assyrians had already shown their intentions during Omri’s reign by attacking and pillaging the Phoenician cities of Tyre. 1980.

He had the singular dishonour of doing more evil than all that were before him (vv. 30 And Ahab the son of Omri did evil in the sight of the LORD more than all that were before him. The more evil they became the more prone to invasions they were to become. 874 to 853 BCE. and your inhabitants a hissing. although the invasions had actually begun as early as Menahem’s reign. 1Kings 16:29-34 In the thirty-eighth year of Asa king of Judah. and all the works of the house of Ahab. as seen below. 30. and Ahab the son of Omri reigned over Israel in Sama'ria twenty-two years. and you have walked in their counsels. (RSV) Unlike several of his predecessors and despite being an unrepentant idolatrous king it seems that Omri died in peace. Ahab did more to provoke the LORD. and worshiped him. which he spoke by Joshua the son of Nun. and was buried in Sama'ria. which he built in Sama'ria. Ahab Although one of the most notorious of all the kings of Israel. are they not written in the Book of the Chronicles of the Kings of Israel? 28 And Omri slept with his fathers. Ahab the son of Omri began to reign over Israel." (RSV) 1Kings 15 ends: 27 Now the rest of the acts of Omri which he did. so you shall bear the scorn of the peoples. and set up its gates at the cost of his youngest son Segub. to anger than all the kings of Israel who were before him. and went and served Ba'al.33) and was also the first king to come into conflict with the Assyrians in the time of Shalmaneser III. Both Israel and Syria were to suffer the same fate at the hands of the determined Assyrians during the reign of Hoshea. 33 And Ahab made an Ashe'rah. The moral corruption that was to develop in Israel included adherence to the so-called statutes of Omri and the wicked ways of his successor. 34 In his days Hi'el of Bethel built Jericho. 31 And as if it had been a light thing for him to walk in the sins of Jerobo'am the son of Nebat. that I may make you a desolation. the God of Israel.The Orontes is the main river flowing through Syria and is about 400 miles (640 km) long. 32 He erected an altar for Ba'al in the house of Ba'al. Perhaps the two events were linked. Ahab had one of the longest reigns at 22 years. King Ahab. (RSV) . from ca. he took for wife Jez'ebel the daughter of Ethba'al king of the Sido'nians. Micah 6:16 For you have kept the statutes of Omri. and Ahab his son reigned in his stead. and was denounced by the prophet Micah. and the might that he showed. he laid its foundation at the cost of Abi'ram his first- born. according to the word of the LORD.

with the prophesied penalty. ‘king of Tyre’ (or king of the underworld). that is east of the Jordan. p. or Moon City. not for himself but for his two sons when he planned to rebuild the foundations and raise the gates of Jericho (see the curse in Jos. 11th and 14th years of his reign. … Hiel’s new town is represented in the archaeological record by Iron Age pottery found at Jericho. before whom I stand. He refers to Ahab of Israel as Akhabbu of Sir’ala in these campaign records.. said to Ahab. in the same way that Solomon had been enticed by his foreign wives. As had been the custom for centuries in the ancient Levant.401). as in to cut a covenant. 34). Ahab’s Phoenician wife inevitably led him into serving her gods. Elijah’s Prophecy The significance of Elijah being a Gileadite or Gadite is explained in the paper Measuring the Temple (No. "As the LORD the God of Israel lives. there shall be neither dew nor rain these years. cit. 6:26). 1Kings 17:1-24 Now Eli'jah the Tishbite. except by my word." 2 And the word of the LORD came to him. 4 You shall drink . which was forced to pay annual tribute to avoid immediate conquest.Ahab (whose name means brother/friend of his father) married Jezebel (Yezebul) the daughter of Ethbaal (Ittobaal) king of Sidon. 137) and is shown to have relevance to the Last Days. Hiel (God lives) of Bethel seems to have had a literal death-wish (v. namely Baal and Astarte/Ishtar. The brook Cherith (SHD 3747) has the meaning cutting. It was to be that Jericho was not to be rebuilt but the words of God were disobeyed. Shalmaneser reigned ca. Now that the Holy Land stratigraphical timeline has been re-synchronised [by Rohl] with the New Chronology historical timeline (and therefore biblical history). of Tishbe in Gilead. In The Lost Testament he gives an alternative and plausible reason for Hiel’s sacrifice of his sons. David Rohl states that from this time onwards “the ruin-mound of Jericho was reoccupied on a permanent basis”. Hiel ritually sacrificed his eldest and youngest sons. 3 "Depart from here and turn eastward. the succeeding phases of which continue on down into Byzantine times. in order to lay their bodies as foundation deposits beneath the chieftain’s new residence and town gate. The Subjugation of Israel King Shalmaneser III was sent against Israel. The Baal here has been identified as either Baal Shamem (lord of heaven) or Melqart. was a rebuilt on these ancient practices and sacrifices. and hide yourself by the brook Cherith. the pattern of archaeological remains at Tell es-Sultan (the ruin-mound of Jericho) corresponds remarkably with the biblical narrative (op. Abiram and Segub. derived from karath (3772). 858-824 BCE and his Annals record that he came up against Ahab and Israel in the 6th. Jericho.

" 12 And she said. `The jar of meal shall not be spent. Its name means refinery. the mistress of the house. and the cruse of oil shall not fail. Behold. and that the word of the LORD in your mouth is truth. and the soul of the child came into him again. 49:10). and a little oil in a cruse. 6 And the ravens brought him bread and meat in the morning. both physical and spiritual (cf. and laid him upon his own bed. I have nothing baked." In this text we see a demonstration of the promise by God that he would feed His servants even in times of famine. who stops his ears from hearing of bloodshed and shuts his eyes from looking upon evil. "O LORD my God." (RSV) . "As the LORD your God lives. "What have you against me. refine or test. 8 Then the word of the LORD came to him." 24 And the woman said to Eli'jah. who shakes his hands. I have commanded a widow there to feed you. "Give me your son." 5 So he went and did according to the word of the LORD. and delivered him to his mother. a widow was there gathering sticks. hast thou brought calamity even upon the widow with whom I sojourn. only a handful of meal in a jar. go and do as you have said. and die. and to cause the death of my son!" 19 And he said to her. from the root meaning to smelt. but first make me a little cake of it and bring it to me. and carried him up into the upper chamber. and now. became ill. "Now I know that you are a man of God. "O LORD my God. 20 And he cried to the LORD." And he took him from her bosom. 23 And Eli'jah took the child. who despises the gain of oppressions. and I have commanded the ravens to feed you there. he called to her and said. let this child's soul come into him again. now known as Surafend." 22 And the LORD hearkened to the voice of Eli'jah. and Eli'jah said. the Sarepta of Luke 4:26. that I may go in and prepare it for myself and my son. 7 And after a while the brook dried up. according to the word of the LORD which he spoke by Eli'jah." 11 And as she was going to bring it. 9 "Arise. and she. "Bring me a morsel of bread in your hand. and he revived. go to Zar'ephath. "See. 17 After this the son of the woman. and afterward make for yourself and your son. Isaiah 33:15-16 He who walks righteously and speaks uprightly. his bread will be given him. also Isa. and dwellthere. and his illness was so severe that there was no breath left in him. he went and dwelt by the brook Cherith that is east of the Jordan. until the day that the LORD sends rain upon the earth. behold. 10 So he arose and went to Zar'ephath." 13 And Eli'jah said to her. and he called to her and said. that I may drink. from the brook. 16 he will dwell on the heights. 16 The jar of meal was not spent. and brought him down from the upper chamber into the house. his place of defense will be the fortresses of rocks. where he lodged. your son lives. Isaiah 33 confirms that the righteous will have their bread and water supplied. his water will be sure. because there was no rain in the land.'" 15 And she went and did as Eli'jah said. "Bring me a little water in a vessel. and he. and there were none more righteous than Elijah at this time. lest they hold a bribe. and bread and meat in the evening. that we may eat it. and when he came to the gate of the city. (RSV) Elijah was then sent to Zarephath. O man of God? You have come to me to bring my sin to remembrance. 14 For thus says the LORD the God of Israel. and he drank from the brook. I am gathering a couple of sticks. which belongs to Sidon. "Fear not. 18 And she said to Eli'jah. and her household ate for many days. and cried to the LORD. neither did the cruse of oil fail. by slaying her son?" 21 Then he stretched himself upon the child three times.

God also ensures that His servants are fed and watered at all times. and fed them with bread and water." 2 So Eli'jah went to show himself to Ahab. "Go. behold. 4 and when Jez'ebel cut off the prophets of the LORD. and I will send rain upon the earth. As noted earlier. 7 And as Obadi'ah was on the way. This was to continue for centuries wherever Israel was established.) Bullinger notes that this is the first recorded instance of civil power being used against the true religion (Companion Bible). However. His spokesman rather than simply a prophet as a foreteller of events. Eli'jah met him. such as Elijah here and Jeremiah (Jer. This incident also shows that even God’s greatest prophets are required to be persistent in prayer. God responds according to His own timing. 5) and an angel (19:5-6). "Go through the land to all the springs of water and to all the valleys.e. "Wherein have I sinned. It is here being used to suppress the prophets of God within Israel itself. We see here the lengths to which the false religious system goes to find (and. Now the famine was severe in Sama'ria. and said. Obadi'ah took a hundred prophets and hid them by fifties in a cave. there is no nation or kingdom whither my lord has not sent to seek you. but also by birds (v. that you would give your servant into the hand of Ahab. in the third year. . who was over the household. my lord Eli'jah?" 8 And he answered him. 5 And Ahab said to Obadi'ah. and Obadi'ah went in another direction by himself. He may also choose to delegate power over the nations to His prophets. 1Kings 18:1-46 After many days the word of the LORD came to Eli'jah.' he would take an oath of the kingdom or nation. tell your lord. i. and fell on his face. the system is only permitted certain power for a specific time as all nations and peoples are ultimately in God’s hands. 1:10). `He is not here. kill) the prophets of God. and that an answer may not be given immediately. "It is I. saying. "Is it you. show yourself to Ahab. that they had not found you. 3 And Ahab called Obadi'ah. Although He hears all prayer. Ahab went in one direction by himself." 6 So they divided the land between them to pass through it. to kill me? 10 As the LORD your God lives.The city lived up to its name by being a place of testing for the widow: she was shown undeniably who was the man of God.'" 9 And he said. Eli'jah is here. perhaps we may find grass and save the horses and mules alive. Go. `Behold. where possible. in this case by a woman. and Obadi'ah recognized him. and when they would say. (Now Obadi'ah revered the LORD greatly. although the civil power was used in Egypt against the covenant people. either along with or mingled with other nations. and not lose some of the animals.

the Spirit of the LORD will carry you whither I know not. tell your lord. tell your lord. so that none is able to withstand thee. "Go again seven times. 46 And the hand of the LORD was on Eli'jah. and so has always had some spiritual significance. 20-40) of Elijah’s test of spiritual strength with the 450 priests of Baal is given in the paper Law and the Second Commandment (No. "Go up. `Prepare your chariot and go down. I will surely show myself to him today. because you have forsaken the commandments of the LORD and followed the Ba'als. and there was a great rain. was referred to in the records of Pharaoh Thutmosis III in the 15th century BCE as Holy Head. art thou not God in heaven? Dost thou not rule over all the kingdoms of the nations? In thy hand are power and might. "Behold. and the four hundred and fifty prophets of Ba'al and the four hundred prophets of Ashe'rah. 1Kings 18:41-46 And Eli'jah said to Ahab. "Go up now. (RSV) Carmel. but you have. "There is nothing. for there is a sound of the rushing of rain. Eli'jah is here"'. 2Chronicles 20:6 "O LORD.'" 45 And in a little while the heavens grew black with clouds and wind. 43 And he said to his servant. "Is it you. who eat at Jez'ebel's table. how I hid a hundred men of the LORD'S prophets by fifties in a cave. you troubler of Israel?" 18 And he answered. and Ahab went to meet Eli'jah. 19 Now therefore send and gather all Israel to me at Mount Carmel. 254). and he bowed himself down upon the earth. and he girded up his loins and ran before Ahab to the entrance of Jezreel. Ahab said to him. and put his face between his knees. meaning garden-land and hence a particularly fertile area of Israel." And he went up and looked. lest the rain stop you. God of our fathers. There is also a perennial fountain on the Carmel range said to be . 17 When Ahab saw Eli'jah."' 12 And as soon as I have gone from you. and fed them with bread and water? 14 And now you say. Even today the cave is a place of pilgrimage and prayer for Jews. Christians and Muslims alike. 13 Has it not been told my lord what I did when Jez'ebel killed the prophets of the LORD. "I have not troubled Israel. say to Ahab. Following the killing of all these idolatrous priests by Elijah and the people at the brook Kishon. and he will kill me." And he said. the prophet appeared again before King Ahab.19:9). "Behold." 16 So Obadi'ah went to meet Ahab." (RSV) The full text (vv." 42 So Ahab went up to eat and to drink. 1Kgs. and your father's house. a little cloud like a man's hand is rising out of the sea. look toward the sea. `Go. and told him. Elijah is said to have lived in a particular cave (of the Sons of the Prophet. Mount Carmel was supposedly the location of an oracle. and said. And Eli'jah went up to the top of Carmel. he will kill me. and so."15 And Eli'jah said. And Ahab rode and went to Jezreel. eat and drink. (RSV) Continuing in 1Kings 18: 11 And now you say. which the Roman Emperor Vespasian consulted before besieging Jerusalem. "Go up." And he said. when I come and tell Ahab and he cannot find you. `Go. before whom I stand." 44 And at the seventh time he said. although I your servant have revered the LORD from my youth. "Behold. Eli'jah is here. located on the outskirts of modern Haifa. "As the LORD of hosts lives.

O LORD. and he arose and went for his life. I say to you. and more also. else the journey will be too great for you. take away my life. and touched him. called in Arabic. 2 Then Jez'ebel sent a messenger to Eli'jah. and ate and drank. for I am no better than my fathers. now." 2 And after six days Jesus took with him Peter and James and John. who literally ran for his life into a remote area." 5 And he lay down and slept under a broom tree. Exactly as Moses had done and Christ would do in the future. saying. She was determined to take revenge on Elijah. "Arise and eat. Elijah fasted for 40 days and nights in the wilderness (cf. Tabor and empties into the Mediterranean. El-Muhraka. In the strength and power of God he will rebuke Israel and the nations of the world following that. and said. and came to Beer-sheba. and led them up a high mountain apart by themselves. It is significant that these three met together in the transfiguration scene witnessed by a select few disciples during the demonstration of the Kingdom of God in power (Mk. "It is enough. who is separate to the nation of Israel but is to be rejoined to it. Ex." 3 Then he was afraid. and behold. and came and sat down under a broom tree." 8 And he arose. there are some standing here who will not taste death before they see that the kingdom of God has come with power. and went in the strength of that food forty days and forty nights to Horeb the mount of God. "So may the gods do to me. And he ate and drank. 9:1-4). 4 But he himself went a day's journey into the wilderness. an angel touched him. The nearby river Kishon rises in Mt. which belongs to Judah. 34:28. 1Kings 19:1-21 Ahab told Jez'ebel all that Eli'jah had done. and how he had slain all the prophets with the sword.that used by Elijah. 24). saying. "Truly. See also the paper The Angel of YHVH (No. culminating in the Laws of God being developed and the nexus of the Law being restored (see the paper Seven Spirits of God (No." 6 And he looked. The symbols of the rain and the power exercised by Elijah are important to the function of the elect in the Last Days. and he was transfigured before them. 3 and his garments became glistening. and said to him. and left his servant there. 64)). if I do not make your life as the life of one of them by this time tomorrow. Mark 9:1-4 And he said to them. and behold. the place of burning. and lay down again. Elijah will again be sent to Israel in the Last Days and he will exercise the power of the Holy Spirit as the Seven Spirits of God in command of the Seven Churches. Queen Jezebel was now extremely vexed because her prophets had not only been shown to be powerless before the single priest of God but also had been destroyed. 7 And the angel of the LORD came again a second time. 4:1-2). and he asked that he might die. there was at his head a cake baked on hot stones and a jar of water. Mat. and in the southeast tip of the range is the supposed site of the testing of Baal. Why then did Elijah run to Judah from Israel after performing such a miracle? Was he entirely afraid or simply weary of the work of God? The symbol is that He will deal with Israel and the false religions and then also with Judah. . "Arise and eat.

even I only. 11 And he said. and said. Eli'jah?" 14 He said. for the people of Israel have forsaken thy covenant. and one prophet. These had no horns. "What are you doing here. and lodged there. for the people of Israel have forsaken thy covenant. And behold. and slain thy prophets with the sword. all the knees that have not bowed to Ba'al. and I. and every mouth that has not kissed him.” (ibid. even I only.14). Eli'jah?" 10 He said. "I have been very jealous for the LORD. to take it away. 10." Elijah is given the task of anointing two kings. thrown down thy altars. "I have been very jealous for the LORD." And behold. the God of hosts.) The tribes of Israel sacrificed locally and conducted prayer services locally while their priestly divisions were on duty at the Tabernacle and later at the Temple under Solomon. The word for word repetition of Elijah’s explanation to this Angel indicates its importance (vv. "Go forth. return on your way to the wilderness of Damascus. 4 And there appeared to them Eli'jah with Moses. and he said to him. and after the fire a still small voice. there came a voice to him. "What are you doing here. am left. and slain thy prophets with the sword. intensely white. and they were talking to Jesus. to take it away. Elisha. and after the wind an earthquake. but the LORD was not in the wind. 13 And when Eli'jah heard it. 24)). (RSV) Continuing in 1Kings 19: 9 And there he came to a cave. 18 Yet I will leave seven thousand in Israel. and a great and strong wind rent the mountains. "Go. 12 and after the earthquake a fire. thrown down thy altars. and they seek my life. who was eventually to take over from him. . as well as at Jerusalem. of Syria and Israel. the word of the LORD came to him. The Angel of YHVH (No. and when you arrive. and behold. 17 And him who escapes from the sword of Haz'ael shall Jehu slay." The still small voice was that of an angelic being (cf. and I. the God of hosts. you shall anoint Haz'ael to be king over Syria. as no fuller on earth could bleach them. and him who escapes from the sword of Jehu shall Eli'sha slay. but the LORD was not in the earthquake. am left. 16 and Jehu the son of Nimshi you shall anoint to be king over Israel. and broke in pieces the rocks before the LORD. and Eli'sha the son of Shaphat of A'bel-meho'lah you shall anoint to be prophet in your place. the LORD passed by. and stand upon the mount before the LORD. but the LORD was not in the fire. 15 And the LORD said to him." Bullinger’s comment here is that “there were lay altars (local) for customary individual offerings by laymen. he wrapped his face in his mantle and went out and stood at the entrance of the cave. and they seek my life.

and boiled their flesh with the yokes of the oxen. is found in the parable of the two sons (Mat. "Let me kiss my father and my mother. "Thus says the LORD." 8 And all the elders and all the people said to him. and I did not refuse him. with twelve yoke of oxen before him. Elisha anointed 19 So he departed from there. "As you say. saying. "Tell my lord the king. "Do not heed or consent. `Let not him that girds on his armor boast himself as he that puts it off. O king. and you shall know that I am the LORD. 6 nevertheless I will send my servants to you tomorrow about this time." 11 And the king of Israel answered.). but this thing I cannot do. 10 Ben-ha'dad sent to him and said." And he said to him. and ministered to him. and took the yoke of oxen. who was plowing. and then I will follow you.'" 7 Then the king of Israel called all the elders of the land." 5 The messengers came again. and said. a prophet came near to Ahab king of Israel and said. 13 And behold. as did some of Jesus’ potential disciples (Lk. "The gods do so to me. "Deliver to me your silver and your gold. 21:28ff. and they shall search your house and the houses of your servants. "Tell him. and take it away." 14 And . thirty-two kings were with him. 9:57-62). for what have I done to you?" 21 And he returned from following him. 2 And he sent messengers into the city to Ahab king of Israel. and for my silver and my gold. and said to him. 1Kings 20:1-43 Ben-ha'dad the king of Syria gathered all his army together.'" 4 And the king of Israel answered. "Take your positions. for he sent to me for my wives and my children. Eli'jah passed by him and cast his mantle upon him. and he was with the twelfth. 20 And he left the oxen." 9 So he said to the messengers of Ben-ha'dad. and lay hands on whatever pleases them. and ran after Eli'jah. Elisha demonstrated the same unwillingness to go immediately with Elijah. I will give it into your hand this day. "Mark. and horses and chariots. A similar reluctance followed by obedience. I am yours. and said. if the dust of Sama'ria shall suffice for handfuls for all the people who follow me. "Thus says Ben-ha'dad: 3 `Your silver and your gold are mine.'" 12 When Ben-ha'dad heard this message as he was drinking with the kings in the booths. Israel’s War with Syria Syria was also known as Aram or the Aramaean Kingdom of Damascus. and fought against it. Have you seen all this great multitude? Behold." And they took their positions against the city. "Thus says Ben-ha'dad: `I sent to you. and more also. and found Eli'sha the son of Shaphat. now. your fairest wives and children also are mine. (RSV) Elisha the son of Shaphat has the composite meaning of “God is salvation: He has judged”. as required by God.'" And the messengers departed and brought him word again. and said. my lord. and they ate. 1Kings 20 details the war that developed between Ben-hadad of Syria and his thirty-two allies on one side and Israel on the other. Then he arose and went after Eli'jah. and see how this man is seeking trouble. and all that I have. and he went up and besieged Sama'ria. your wives and your children".The practice of bending the knee and kissing the images of Baal is carried on to this day in a number of religions including the churches that purport to be Christian. `All that you first demanded of your servant I will do. and slew them. and gave it to the people. he said to his men. "Go back again.

Ahab said, "By whom?" He said, "Thus says the LORD, By the servants of the governors of
the districts." Then he said, "Who shall begin the battle?" He answered, "You." 15 Then he
mustered the servants of the governors of the districts, and they were two hundred and thirty-
two; and after them he mustered all the people of Israel, seven thousand. 16 And they went out
at noon, while Ben-ha'dad was drinking himself drunk in the booths, he and the thirty-two
kings who helped him. 17 The servants of the governors of the districts went out first. And
Ben-ha'dad sent out scouts, and they reported to him, "Men are coming out from Sama'ria." 18
He said, "If they have come out for peace, take them live; or if they have come out for war,
take them alive." 19 So these went out of the city, the servants of the governors of the districts,
and the army which followed them. 20 And each killed his man; the Syrians fled and Israel
pursued them, but Ben-ha'dad king of Syria escaped on a horse with horsemen. 21 And the
king of Israel went out, and captured the horses and chariots, and killed the Syrians with a
great slaughter. 22 Then the prophet came near to the king of Israel, and said to him, "Come,
strengthen yourself, and consider well what you have to do; for in the spring the king of Syria
will come up against you."

Springtime was traditionally the time to begin military campaigning. 2Samuel 11:1 reads: “In the
spring of the year, the time when kings go forth to battle …” (RSV); although the literal Hebrew is
at the return of the year, indicating precisely when the year begins in God’s true Calendar,
namely, March/April in the northern hemisphere. It will be so also in the Last Days that the
Spring-offensives will determine the conduct of some theatre operations such as of the Taliban
in Afghanistan in 2007. The major offensives will be from Spring to Summer and the King of the
South will push at the King of the North from Spring to Summer, and many of the sons of Shem
will die in that war.

23
And the servants of the king of Syria said to him, "Their gods are gods of the hills, and so
they were stronger than we; but let us fight against them in the plain, and surely we shall be
stronger than they. 24 And do this: remove the kings, each from his post, and put commanders
in their places; 25 and muster an army like the army that you have lost, horse for horse, and
chariot for chariot; then we will fight against them in the plain, and surely we shall be stronger
than they." And he hearkened to their voice, and did so. 26 In the spring Ben-ha'dad mustered
the Syrians, and went up to Aphek, to fight against Israel. 27 And the people of Israel were
mustered, and were provisioned, and went against them; the people of Israel encamped before
them like two little flocks of goats, but the Syrians filled the country. 28 And a man of God
came near and said to the king of Israel, "Thus says the LORD, `Because the Syrians have
said, "The LORD is a god of the hills but he is not a god of the valleys," therefore I will give
all this great multitude into your hand, and you shall know that I am the LORD.'" 29 And they
encamped opposite one another seven days. Then on the seventh day the battle was joined;
and the people of Israel smote of the Syrians a hundred thousand foot soldiers in one day. 30
And the rest fled into the city of Aphek; and the wall fell upon twenty-seven thousand men
that were left. Ben-ha'dad also fled, and entered an inner chamber in the city. 31 And his
servants said to him, "Behold now, we have heard that the kings of the house of Israel are
merciful kings; let us put sackcloth on our loins and ropes upon our heads, and go out to the
king of Israel; perhaps he will spare your life." 32 So they girded sackcloth on their loins, and
put ropes on their heads, and went to the king of Israel and said, "Your servant Ben-ha'dad
says, `Pray, let me live.'" And he said, "Does he still live? He is my brother." 33 Now the men
were watching for an omen, and they quickly took it up from him and said, "Yes, your brother
Ben-ha'dad." Then he said, "Go and bring him." Then Ben-ha'dad came forth to him; and he
caused him to come up into the chariot. 34 And Ben-ha'dad said to him, "The cities which my

father took from your father I will restore; and you may establish bazaars for yourself in
Damascus, as my father did in Sama'ria." And Ahab said, "I will let you go on these terms."
So he made a covenant with him and let him go.
Note that they encamped seven days and joined battle on the seventh day. This is the same as it
was at Jericho and has a similar symbolism (see the paper The Fall of Jericho (No. 42)).

Ahab actually sinned by sparing the defeated Ben-hadad’s life and this subsequently brought
great trouble to the whole of Israel (1Kgs. 20:20-43).

The story continues in verse 35.
35
And a certain man of the sons of the prophets said to his fellow at the command of the
LORD, "Strike me, I pray." But the man refused to strike him. 36 Then he said to him,
"Because you have not obeyed the voice of the LORD, behold, as soon as you have gone from
me, a lion shall kill you." And as soon as he had departed from him, a lion met him and killed
him.

Josephus identified this certain man with Micaiah in 1Kings 22:8. Severe and sometimes
immediate consequences result from failure to obey a directive from God through His servants
the prophets.

37
Then he found another man, and said, "Strike me, I pray." And the man struck him, smiting
and wounding him. 38 So the prophet departed, and waited for the king by the way, disguising
himself with a bandage over his eyes. 39 And as the king passed, he cried to the king and said,
"Your servant went out into the midst of the battle; and behold, a soldier turned and brought a
man to me, and said, `Keep this man; if by any means he be missing, your life shall be for his
life, or else you shall pay a talent of silver.' 40 And as your servant was busy here and there, he
was gone." The king of Israel said to him, "So shall your judgment be; you yourself have
decided it." 41 Then he made haste to take the bandage away from his eyes; and the king of
Israel recognized him as one of the prophets. 42 And he said to him, "Thus says the LORD,
`Because you have let go out of your hand the man whom I had devoted to destruction,
therefore your life shall go for his life, and your people for his people.'" 43 And the king of
Israel went to his house resentful and sullen, and came to Sama'ria. (RSV)

Naboth’s Vineyard

1Kings 21:1-29 Now Naboth the Jezreelite had a vineyard in Jezreel, beside the palace of
Ahab king of Sama'ria. 2 And after this Ahab said to Naboth, "Give me your vineyard, that I
may have it for a vegetable garden, because it is near my house; and I will give you a better
vineyard for it; or, if it seems good to you, I will give you its value in money."

This is precisely the type of situation that Samuel had warned Israel about when, in their
faithlessness, they had asked for a flesh-and-blood king like the surrounding nations (1Sam.

8:11,14). In accordance with the Law (Lev. 25:23; Num. 36:7,8), Naboth quite rightly refused to
part with his inheritance, even to a king of Israel.

3
But Naboth said to Ahab, "The LORD forbid that I should give you the inheritance of my
fathers." 4 And Ahab went into his house vexed and sullen because of what Naboth the
Jezreelite had said to him; for he had said, "I will not give you the inheritance of my fathers."
And he lay down on his bed, and turned away his face, and would eat no food. 5 But Jez'ebel
his wife came to him, and said to him, "Why is your spirit so vexed that you eat no food?" 6
And he said to her, "Because I spoke to Naboth the Jezreelite, and said to him, `Give me your
vineyard for money; or else, if it please you, I will give you another vineyard for it'; and he
answered, `I will not give you my vineyard.'" 7 And Jez'ebel his wife said to him, "Do you
now govern Israel? Arise, and eat bread, and let your heart be cheerful; I will give you the
vineyard of Naboth the Jezreelite." 8 So she wrote letters in Ahab's name and sealed them with
his seal, and she sent the letters to the elders and the nobles who dwelt with Naboth in his city.
9
And she wrote in the letters, "Proclaim a fast, and set Naboth on high among the people; 10
and set two base fellows opposite him, and let them bring a charge against him, saying, `You
have cursed God and the king.' Then take him out, and stone him to death." 11 And the men of
his city, the elders and the nobles who dwelt in his city, did as Jez'ebel had sent word to them.
As it was written in the letters which she had sent to them, 12 they proclaimed a fast, and set
Naboth on high among the people. 13 And the two base fellows came in and sat opposite him;
and the base fellows brought a charge against Naboth, in the presence of the people, saying,
"Naboth cursed God and the king." So they took him outside the city, and stoned him to death
with stones.

The matter of swearing an oath falsely (vv. 10-13) is dealt with in the paper Law and the Third
Commandment (No. 255).

14
Then they sent to Jez'ebel, saying, "Naboth has been stoned; he is dead." 15 As soon as
Jez'ebel heard that Naboth had been stoned and was dead, Jez'ebel said to Ahab, "Arise, take
possession of the vineyard of Naboth the Jezreelite, which he refused to give you for money;
for Naboth is not alive, but dead." 16 And as soon as Ahab heard that Naboth was dead, Ahab
arose to go down to the vineyard of Naboth the Jezreelite, to take possession of it. 17 Then the
word of the LORD came to Eli'jah the Tishbite, saying, 18 "Arise, go down to meet Ahab king
of Israel, who is in Sama'ria; behold, he is in the vineyard of Naboth, where he has gone to
take possession. 19 And you shall say to him, `Thus says the LORD, "Have you killed, and
also taken possession?"' And you shall say to him, `Thus says the LORD: "In the place where
dogs licked up the blood of Naboth shall dogs lick your own blood."'" 20 Ahab said to Eli'jah,
"Have you found me, O my enemy?" He answered, "I have found you, because you have sold
yourself to do what is evil in the sight of the LORD. 21 Behold, I will bring evil upon you; I
will utterly sweep you away, and will cut off from Ahab every male, bond or free, in Israel; 22
and I will make your house like the house of Jerobo'am the son of Nebat, and like the house of
Ba'asha the son of Ahi'jah, for the anger to which you have provoked me, and because you
have made Israel to sin. 23 And of Jez'ebel the LORD also said, `The dogs shall eat Jez'ebel
within the bounds of Jezreel.' 24 Any one belonging to Ahab who dies in the city the dogs shall
eat; and any one of his who dies in the open country the birds of the air shall eat."

Jezebel’s blood was thus to join Naboth’s in the dust of Jezreel rather than in her capital city of
Samaria.

25
(There was none who sold himself to do what was evil in the sight of the LORD like Ahab,
whom Jez'ebel his wife incited. 26 He did very abominably in going after idols, as the
Amorites had done, whom the LORD cast out before the people of Israel.) 27 And when Ahab
heard those words, he rent his clothes, and put sackcloth upon his flesh, and fasted and lay in
sackcloth, and went about dejectedly. 28 And the word of the LORD came to Eli'jah the
Tishbite, saying, 29 "Have you seen how Ahab has humbled himself before me? Because he
has humbled himself before me, I will not bring the evil in his days; but in his son's days I will
bring the evil upon his house." (RSV)

In spite of the multitude of Ahab’s evil deeds, as soon as he fasted and humbled himself before
God, his repentance (however brief) was accepted and the intended retribution was put upon
his son’s head instead. Ahab’s repentance can be compared with that of King Manasseh of Judah
(2Chr. 33:12-13).

Assuming Ahab as a devotee of Baal was a type of Satan, we can deduce from this that even the
present ‘king’ of this Earth will one day repent and find acceptance from God. The Great Whore
of the religious systems of this world, typified by his consort Jezebel, will be totally cut off and
destroyed, however. She typifies the religion of the god of this world for whom the name King of
Tyre is an epithet. Her death represents the cutting of Tyre and Sidon, symbols of religious
power on this Earth.

In his book, The History and Religion of Israel, Dr. G.W. Anderson linked the breakdown in social
justice with the introduction of the Baal system to Israel.

As the importation of Baal worship involved a denial of the supreme lordship of Yahweh in
Israel, so the ruthless removal of Naboth and his sons was an outrage against the status and
rights of the ordinary Israelite within the covenant community and against the sanctity of the
administration of justice. Developments had already begun which were to be increasingly
evident in the kingdoms of Israel and Judah: the pressure, not only of Canaanite fertility
religion, but of the cults of foreign kingdoms; the threat to traditional norms of equity brought
about by economic and social changes; and the corruption of judges and witnesses in the
interests of the rich and powerful. Later prophets inveighed against these abuses. (Oxford
University Press, 1966; p.94)

Anderson could hardly better describe the situation in the nations descended from Israel today,
nearly 2900 years later.

In its article ‘Ahab’, the Jewish Encyclopedia gives a more favourable view of this particular king
of Israel.

Though held up as a warning to sinners, Ahab is also described as displaying noble traits of
character (Sanh. 102b; Yer. Sanh. xi. 29b). Talmudic literature represents him as an
enthusiastic idolater who left no hilltop in Palestine without an idol before which he bowed,
and to which he or his wife, Jezebel, brought his weight in gold as a daily offering. So defiant
in his apostasy was he that he had inscribed on all the doors of the city of Samaria the words,
"Ahab hath abjured the living God of Israel." Nevertheless, he paid great respect to the
representatives of learning, "to the Torah given in twenty-two letters," for which reason he
was permitted to reign for twenty-two successive years. He generously supported the students
of the Law out of his royal treasury, in consequence of which half his sins were forgiven him.

This belies the persecution of his wife of the prophets. Ahab supported both sides to cover
contingencies, as it were.

Israel and Judah at War with Syria

We see that there had been a peace of sorts between Israel and Syria for three years (cf. 20:34).
However, the warlike tendencies of the kings of Israel soon surfaced with an attempt to retake
Ramoth-gilead from the Syrians, with Judah’s help. This was a City of Refuge, probably taken in
the former war (16:34; 20:43) by Ben-hadad I from Ahab’s father Omri; however, his son Ben-
hadad II agreed to restore it to Israel. During this time Jehoshaphat “strengthened himself
against Israel” (2Chr. 17.1).

1Kings 22:1-39 For three years Syria and Israel continued without war. 2 But in the third year
Jehosh'aphat the king of Judah came down to the king of Israel. 3 And the king of Israel said to
his servants, "Do you know that Ramoth-gilead belongs to us, and we keep quiet and do not
take it out of the hand of the king of Syria?" 4 And he said to Jehosh'aphat, "Will you go with
me to battle at Ramoth-gilead?" And Jehosh'aphat said to the king of Israel, "I am as you are,
my people as your people, my horses as your horses." 5 And Jehosh'aphat said to the king of
Israel, "Inquire first for the word of the LORD." 6 Then the king of Israel gathered the
prophets together, about four hundred men, and said to them, "Shall I go to battle against
Ramoth-gilead, or shall I forbear?" And they said, "Go up; for the Lord will give it into the
hand of the king." 7 But Jehosh'aphat said, "Is there not here another prophet of the LORD of
whom we may inquire?" 8 And the king of Israel said to Jehosh'aphat, "There is yet one man
by whom we may inquire of the LORD, Micai'ah the son of Imlah; but I hate him, for he
never prophesies good concerning me, but evil." And Jehosh'aphat said, "Let not the king say
so." 9 Then the king of Israel summoned an officer and said, "Bring quickly Micai'ah the son
of Imlah." 10 Now the king of Israel and Jehosh'aphat the king of Judah were sitting on their
thrones, arrayed in their robes, at the threshing floor at the entrance of the gate of Sama'ria;
and all the prophets were prophesying before them. 11 And Zedeki'ah the son of Chena'anah
made for himself horns of iron, and said, "Thus says the LORD, `With these you shall push
the Syrians until they are destroyed.'" 12 And all the prophets prophesied so, and said, "Go up
to Ramoth-gilead and triumph; the LORD will give it into the hand of the king." 13 And the
messenger who went to summon Micai'ah said to him, "Behold, the words of the prophets

" 24 Then Zedeki'ah the son of Chena'anah came near and struck Micai'ah on the cheek. 29 So the king of Israel and Jehosh'aphat the king of Judah went up to Ramoth-gilead. saying."'" 28 And Micai'ah said. "Hear. and all the host of heaven standing beside him on his right hand and on his left. "Seize Micai'ah. because they were harassed and helpless. and feed him with scant fare of bread and water. and will be a lying spirit in the mouth of all his prophets.'" The forthcoming battle against the Syrians is also described in 2Chronicles 18:2ff. 36 When he saw the crowds.' 23 Now therefore behold. let your word be like the word of one of them. and another said another." 32 And when the captains of the chariots saw . to obey or be obedient. 6:4)." And he said. 37 Then he said to his disciples. "Did I not tell you that he would not prophesy good concerning me. 20 and the LORD said. the LORD will give it into the hand of the king. and the LORD said. that I will speak. you shall see on that day when you go into an inner chamber to hide yourself. `By what means?' And he said." And the king of Israel disguised himself and went into battle. the LORD has not spoken by me." 26 And the king of Israel said. 27 and say. let each return to his home in peace. until I come in peace. "Fight with neither small nor great. shall we go to Ramoth-gilead to battle. all you peoples!" The word for hear is shama‘ (SHD 8085) meaning not just to listen with one’s ears but. like sheep without a shepherd." 14 But Micai'ah said. more importantly. what the LORD says to me. "The harvest is plentiful. teaching in their synagogues and preaching the gospel of the kingdom. 31 Now the king of Syria had commanded the thirty-two captains of his chariots. "How did the Spirit of the LORD go from me to speak to you?" 25 And Micai'ah said. `I will entice him. Christ himself spoke of similar lost souls in Israel in his day. "Put this fellow in prison. "Behold. or shall we forbear?" And he answered him. "As the LORD lives. `Who will entice Ahab. `I will go forth. 30 And the king of Israel said to Jehosh'aphat. `Thus says the king.' 22 And the LORD said to him. that he may go up and fall at Ramoth-gilead?' And one said one thing. with one accord are favorable to the king. as sheep that have no shepherd. and take him back to Amon the governor of the city and to Jo'ash the king's son. "I saw all Israel scattered upon the mountains. but the laborers are few. 21 Then a spirit came forward and stood before the LORD. "Micai'ah. "If you return in peace. "How many times shall I adjure you that you speak to me nothing but the truth in the name of the LORD?" 17 And he said. "I will disguise myself and go into battle. `These have no master. 38 pray therefore the Lord of the harvest to send out laborers into his harvest. and healing every disease and every infirmity. he had compassion for them. "Therefore hear the word of the LORD: I saw the LORD sitting on his throne. "Go up and triumph. and speak favorably. `You are to entice him. but evil?" 19 And Micai'ah said. but only with the king of Israel. go forth and do so." (RSV) Continuing in 1Kings 22: 18 And the king of Israel said to Jehosh'aphat." 16 But the king said to him. the LORD has spoken evil concerning you. the king said to him. Matthew 9:35-38 And Jesus went about all the cities and villages." 15 And when he had come to the king. and said. the LORD has put a lying spirit in the mouth of all these your prophets. but you wear your robes.' And he said. and you shall succeed. It is the same term used for the ‘Shema Ysrael (Deut.

… As the rubble was being carted off the diggers very quickly noticed the innumerable splinters of ivory that it contained. At every step. and the blood of the wound flowed into the bottom of the chariot. they came across these yellowish brown chips and flakes. and they buried the king in Sama'ria. 245-6). 39 Now the rest of the acts of Ahab. "Every man to his city. they turned back from pursuing him. and every man to his country!" 37 So the king died. 17:1] and for Ahab’s father-in-law Ethbaal of Sidon were provided by Menander of Ephesus. During two archaeological excavations in 1908-10 and 1931-35.. cit. … It is now quite clear what happened: Ahab had the rooms of the palace decorated with this wonderful material and filled them with ivory furniture (Keller.246) . p. Once again. according to the Talmud). Jehosh'aphat." 35 And the battle grew hot that day. are they not written in the Book of the Chronicles of the Kings of Israel? The ivory houses mentioned in verse 39 were long thought to have been inventions by the writer of the Book of Kings (i. however. a Phoenician historian. for I am wounded. and all that he did. the site of the former capital of Samaria revealed some surprising finds. they said. and the ivory house which he built. Jeremiah. 38 And they washed the chariot by the pool of Sama'ria.e. Finds of ivory in itself are nothing unusual in Palestinian excavation. op. On almost every site this expensive material is encountered.. and the king was propped up in his chariot facing the Syrians. … Obviously this monarch did not build his entire palace of ivory. p. and the dogs licked up his blood." So they turned to fight against him. (ibid. as well as fragments which still showed the marvellous craftsmanship of these elegant reliefs carved by Phoenician masters. but always in isolated pieces. until at evening he died. the Bible record stands up to the most minute scrutiny when viewed alongside archaeological finds and in the light of secular historical records. … Menander records the catastrophic drought which set in throughout Palestine and Syria during the reign of Ittobaal [Ethbaal] and lasted a whole year. every square yard. and struck the king of Israel between the scale armor and the breastplate. and the harlots washed themselves in it. and all the cities that he built. therefore he said to the driver of his chariot. 33 And when the captains of the chariots saw that it was not the king of Israel. according to the word of the LORD which he had spoken. and was brought to Sama'ria. This enclosed a wide courtyard and was a royal palace of the northern kingdom of Israel. On the acropolis on the west side of the hill foundations and walls of a building were exposed. Werner Keller concurs with this sentiment (hence the title of his book) by adding: The proofs of the historical basis for the drought [1Kgs. "It is surely the king of Israel. and carry me out o the battle. 36 And about sunset a cry went through the army. The Bible as History. 34 But a certain man drew his bow at a venture. and Jehosh'aphat cried out. "Turn about. yet in Samaria the ground is literally covered with them.

(RSV) We can see the evil influence that Israel had exerted upon Judah from 2Kings 8:26-27. yet the high places were not taken away. who made Israel to sin. 52 He did what was evil in the sight of the LORD. and Ahazi'ah his son reigned in his stead. the LORD will destroy what you have made. doing what was right in the sight of the LORD. and provoked the LORD. Ahaziah. saying. a deputy was king. "Because you have joined with Ahazi'ah. and his might that he showed." but Jehosh'aphat was not willing.” 2Kings 1:1-18 After the death of Ahab. . Ahaziah The fourth dynasty in Israel continued with its ninth king. and was buried with his fathers in the city of David his father. and walked in the way of his father. (RSV) 1Kings 22 continues: 50 And Jehosh'aphat slept with his fathers. son of the infamous Ahab. "Let my servants go with your servants in the ships. He ascended the throne in the 17th year of Jehoshaphat of Judah. where Ahaziah “did evil in the sight of the Lord as did the house of Ahab: for he was the son-in-law of the house of Ahab. 1Kings 22:40-53 So Ahab slept with his fathers. 37 Then Elie'zer the son of Do-dav'ahu of Mare'shah prophesied against Jehosh'aphat. and he reigned two years over Israel. and in the way of Jerobo'am the son of Nebat. he exterminated from the land. and he reigned twenty- five years in Jerusalem. to anger in every way that his father had done. 2Chronicles 20:35-37 expands upon the story and highlights inappropriate alliances. and Jeho'ram his son reigned in his stead." And the ships were wrecked and were not able to go to Tarshish. 47 There was no king in Edom. His mother's name was Azu'bah the daughter of Shilhi. and the people still sacrificed and burned incense on the high places. are they not written in the Book of the Chronicles of the Kings of Judah? 46 And the remnant of the male cult prostitutes who remained in the days of his father Asa. 41 Jehosh'aphat the son of Asa began to reign over Judah in the fourth year of Ahab king of Israel. 49 Then Ahazi'ah the son of Ahab said to Jehosh'aphat. after Ahab was killed in battle his body was taken to Samaria and buried in that city. He thus suffered a less ignominious end than either his wife or son. 42 Jehosh'aphat was thirty-five years old when he began to reign. Moab rebelled against Israel. the God of Israel. and in the way of his mother. for the ships were wrecked at E'zion- ge'ber. 53 He served Ba'al and worshiped him. he did not turn aside from it.As we saw in 1Kings 22:37. but they did not go. and how he warred. 45 Now the rest of the acts of Jehosh'aphat. 51 Ahazi'ah the son of Ahab began to reign over Israel in Sama'ria in the seventeenth year of Jehosh'aphat king of Judah. 43 He walked in all the way of Asa his father. but reigned for only two years. 44 Jehosh'aphat also made peace with the king of Israel. 48 Jehosh'aphat made ships of Tarshish to go to Ophir for gold.

8:2) and." Then fire came down from heaven. 26). "O man of God. 13:4) as a token of their humility perhaps or as a kind of permanent sackcloth in mourning for their nation and its inhabitants. and was identified with Satan (v. 9 Then the king sent to him a captain of fifty men with his fifty. "Go. and came and fell on his knees before Eli'jah. with a girdle of leather about his loins. let fire come down from heaven and consume you and your fifty.'" So Eli'jah went. etc. "There came a man to meet us. and he said to them. this became the Greek Baal-zebul (lord of abominable idols) as in Matthew 12:24. Thus says the LORD.David had previously subdued Moab (2Sam." A fatal mistake … as we see in verse 4. The Moabite Stone records the rebellion of Moab following the death of King Ahab. 11:8). inquire of Ba'al-ze'bub. but you shall surely die. this is the king's order. He went up to Eli'jah. the pagan lord of the flies. who was sitting on the top of a hill. but shall surely die. let my life. `Go back to the king who sent you. who was likened to Elijah. "If I am a man of God. and consumed the two former captains of fifty men with their fifties. the king says. "What kind of man was he who came to meet you and told you these things?" 8 They answered him. 3 But the angel of the LORD said to Eli'jah the Tishbite. at the break-up of the united Kingdom. and lay sick. And the third captain of fifty went up. "It is Eli'jah the Tishbite. "He wore a garment of haircloth. and entreated him. 11 Again the king sent to him another captain of fifty men with his fifty. telling them. "Why have you returned?" 6 And they said to him. 23:13. Baal-zebub. 14 Lo.'" 7 He said to them. and consumed him and his fifty. `You shall not come down from the bed to which you have gone. and said to us. `Is it because there is no God in Israel that you are going to inquire of Ba'al-ze'bub. 5 The messengers returned to the king.'" 10 But Eli'jah answered the captain of fifty. whether I shall recover from this sickness. had its name changed by the Jews to Beel-zebul (lord of dung)." And he said. go up to meet the messengers of the king of Sama'ria. "Arise. Consulting or serving ‘gods that are not gods’ or demons was strictly forbidden (Ex. "If I am a man of God. fire came down from heaven. The text in 2Kings 1 continues: 2 Now Ahazi'ah fell through the lattice in his upper chamber in Sama'ria. 2Kgs.). "O man of God. control over them passed to Israel. let fire come down from heaven and consume you and your fifty." The true prophets of God often wore rough or hairy clothing (cf. the god of Ekron. I pray you." Then the fire of God came down from heaven and consumed him and his fifty." . and say to them. the god of Ekron?' 4 Now therefore thus says the LORD. Is it because there is no God in Israel that you are sending to inquire of Ba'al-ze'bub. and say to him. And he went up and said to him. 17:35. `Come down. `Come down quickly!'" 12 But Eli'jah answered them. the god of Ekron? Therefore you shall not come down from the bed to which you have gone.3:4. "O man of God. be precious in your sight. Zech. and the life of these fifty servants of yours. was another prophet clothed in rough garments (Mat. but now let my life be precious in your sight. John the Baptist. and said to him. 13 Again the king sent the captain of a third fifty with his fifty. so he sent messengers.

"Bring me a new bowl. "Thus says the LORD. as my lord sees. are they not written in the Book of the Chronicles of the Kings of Israel? (RSV) The taking of Elijah by a whirlwind (2Kgs. The term Father is now forbidden to the Church by Christ. 23 He went up from there to Bethel.Elijah’s calling down of fire from heaven was considered an historical event worth repeating – at least to the disciples James and John. and thence he returned to Sama'ria. the repetition of this term (2:12) giving an implied meaning of revered or beloved father-figure or mentor. 135). the situation of this city is pleasant. – is it because there is no God in Israel to inquire of his word? – therefore you shall not come down from the bed to which you have gone. "Did I not say to you. 15 Then the angel of the LORD said to Eli'jah. Bullinger suggests that this was fulfilled in the number of recorded miracles the two prophets performed: Elijah performed eight miracles." 22 So the water has been wholesome to this day. Bible). I have made this water wholesome. 2:1-17) is covered in the paper The Witnesses (including the Two Witnesses) (No. according to the word which Eli'sha spoke. but the water is bad. who had been called by God about ten years earlier (1Kgs. He was succeeded in the chief prophet-ship of Israel by Elisha (God is salvation). "Go down with him." So he arose and went down with him to the king. do not be afraid of him. 16 and said to him. 25 From there he went on to Mount Carmel. and while he was going up on the way. as per Bullinger’s note (Comp. because Ahazi'ah had no son. became king in his stead in the second year of Jeho'ram the son of Jehosh'aphat. but you shall surely die." 20 He said. Elisha sixteen miracles. He referred to Elijah as my father. 18 Now the rest of the acts of Ahazi'ah which he did. "Behold. It was noted also that Elisha had asked for a double portion of Elijah’s spirit before the latter was “taken” by God. Do not go?" 19 Now the men of the city said to Eli'sha. you baldhead! Go up. `Because you have sent messengers to inquire of Ba'al-ze'bub. you baldhead!" 24 And he turned around. who happened to be in the “Samaria” of Elijah at the time of their request to Jesus (Lk. some small boys came out of the city and jeered at him.'" 17 So he died according to the word of the LORD which Eli'jah had spoken. and said. while he tarried at Jericho. henceforth neither death nor miscarriage shall come from it. "Thus says the LORD. and when he saw them. and the land is unfruitful. the god of Ekron. saying. 9:54). It means youth and covers the same broad meaning. and he said to them. and put salt in it." So they brought it to him. 2Kings 2:18-25 And they came back to him. (RSV) The Hebrew word na’ar used here was also applied to Isaac (28 years old). it is to be used of God and of no priest. And two she-bears came out of the woods and tore forty-two of the boys. "Go up. . king of Judah. Jeho'ram. his brother. he cursed them in the name of the LORD. 19:16). 21 Then he went to the spring of water and threw salt in it. Joseph (39) and Rehoboam (40).

Jeho'ram the son of Ahab became king over Israel in Sama'ria. will you go with me to battle against Moab?" And he said." 9 So the king of Israel went with the king of Judah and the king of Edom. "Alas! The LORD has called these three kings to give them into the hand of Moab." In this case God arranged for the Moabites to succeed in the battle against an unlikely alliance of Israel. and he had to deliver annually to the king of Israel a hundred thousand lambs. who were better than yourself. as the house of Ahab led Israel into unfaithfulness.Jehoram The tenth king to reign in Israel was Jehoram or Joram. "By the way of the wilderness of Edom. 10 Then the king of Israel said. he had all his brothers killed as potential rivals (2Chr. "I will go. daughter of Ahab and Jezebel. 3 Nevertheless he clung to the sin of Jerobo'am the son of Nebat. 21:4). of your father's house. Jehoram’s evil was tempered somewhat by the fact that he got rid of the pillar dedicated to Baal worship in Samaria. (RSV) Israel was consistently held up as an example that Judah ought not to follow (also 2Chr. 21:5-6). and by so doing effectively introduced idolatry into Judah from Israel (cf. 2Kings 3:1-27 In the eighteenth year of Jehosh'aphat king of Judah. Ahab’s son by Jezebel and the brother of the previous king Ahaziah who produced no male heir (v. the king of Moab rebelled against the king of Israel. which he made Israel to sin. 17). 142)). Coincidentally. my horses as your horses. 2 He did what was evil in the sight of the LORD. my people as your people. and have led Judah and the inhabitants of Jerusalem into unfaithfulness. and the wool of a hundred thousand rams. and he reigned twelve years. 6 So King Jeho'ram marched out of Sama'ria at that time and mustered all Israel. 2Chr. 7 And he went and sent word to Jehosh'aphat king of Judah. there was a king named Jehoram on the throne of Judah at the same time. and also you have killed your brothers. 4 Now Mesha king of Moab was a sheep breeder. though not like his father and mother." 8 Then he said. 5 But when Ahab died. "By which way shall we march?" Jeho'ram answered. 2Chronicles 21:13 but have walked in the way of the kings of Israel. . Judah and Edom. there was no water for the army or for the beasts which followed them. I am as you are. he did not depart from it. 17:4). The latter’s seven-day circuit through the wilderness was not to have the positive result achieved by Joshua and the Israelites when they circled around Jericho in seven days (see the paper The Fall of Jericho (No. for he put away the pillar of Ba'al which his father had made. And when they had made a circuitous march of seven days. This Jehoram also married Athaliah. "The king of Moab has rebelled against me.

whom I serve. Moab. the paper The Angel and Abraham’s Sacrifice (No. were called out. the power of the LORD came upon him. who poured water on the hands of Eli'jah. and offered him for a burnt offering upon the wall. The great wrath upon Israel may have reflected the demons being permitted to punish Israel and allow the Moabites to gain their freedom. "As the LORD of hosts lives. And there came great wrath upon Israel. and they withdrew from him and returned to their own land. the Moabites saw the water opposite them as red as blood. and every choice city.g. 22 And when they rose early in the morning." And when the minstrel played. it is the LORD who has called these three kings to give them into the hand of Moab.Elisha’s Prophecy 11 And Jehosh'aphat said. `You shall not see wind or rain. 19 and you shall conquer every fortified city. 13 And Eli'sha said to the king of Israel. 21 When all the Moabites heard that the kings had come up to fight against them. "Is there no prophet of the LORD here. 16 And he said. The Israelites had to be told specifically to desist from such an abomination (Lev." 14 And Eli'sha said. he will also give the Moabites into your hand. "What have I to do with you? Go to the prophets of your father and the prophets of your mother. Aroer. "No. till the country was filled with water. and stop up all springs of water. 2Chr. 33:6). but that stream-bed shall be filled with water. about the time of offering the sacrifice. 16:3." But the king of Israel said to him. till only its stones were left in Kir-har'eseth. water came from the direction of Edom. He took many cities belonging to Reuben and Gad (e. till they fled before them. I would neither look at you. Dibon and Kerioth) as a sort of prelude to what would happen under the Assyrians." 20 The next morning. you. which is perhaps why Abraham was not fazed by the Angel’s request to sacrifice his son Isaac (cf. behold. and felled all the good trees. and slain one another. and ruin every good piece of land with stones. until it was covered.' 17 For thus says the LORD. and your beasts. "Thus says the LORD. to the spoil!" 24 But when they came to the camp of Israel. were it not that I have regard for Jehosh'aphat the king of Judah. the kings have surely fought together. the Israelites rose and attacked the Moabites. opposite the king of Edom. Israel’s joint expedition to bring Moab to heel had failed. and they went forward. although many ignored the injunction. "Eli'sha the son of Shaphat is here. but they could not. Chemosh) was apparently endemic in the Middle East. nor see you. 23 And they said. and it was King Mesha who gained the ascendancy. and the sun shone upon the water.' 18 This is a light thing in the sight of the LORD. 18:21). and were drawn up at the frontier.g. and on every good piece of land every man threw a stone. 27 Then he took his eldest son who was to reign in his stead. and the slingers surrounded and conquered it. . 26 When the king of Moab saw that the battle was going against him. through whom we may inquire of the LORD?" Then one of the king of Israel's servants answered. "The word of the LORD is with him. all who were able to put on armor. from the youngest to the oldest. your cattle. they stopped every spring of water. he took with him seven hundred swordsmen to break through. so that you shall drink." 12 And Jehosh'aphat said. 71))." So the king of Israel and Jehosh'aphat and the king of Edom went down to him. "This is blood. 15 But now bring me a minstrel. Now then. when these tribes to the east of the Jordan would be among the first to go into captivity. and shall fell every good tree. 25 And they overthrew the cities. The kings of Israel appeared particularly prone (2Kgs. `I will make this dry stream-bed full of pools. (RSV) This barbaric practice of burning one’s first-born son in offering to a god (e. slaughtering the Moabites as they went.

and boil pottage for the sons of the prophets. and said. "Set on the great pot. I perceive that this is a holy man of God. where a wealthy woman lived. 17:10ff." Then the oil stopped flowing. "Your maidservant has nothing in the house. not knowing what they were. who urged him to eat some food. 4:21. 41 He said. 2Kings 4:1-44 Now the wife of one of the sons of the prophets cried to Eli'sha. and a lamp. 40 And they poured out for the men to eat. and pour into all these vessels. 10 Let us make a small roof chamber with walls. and shut the door upon yourself and your sons. 4 Then go in. a chair. hence. "Bring me another vessel. they cried out. he would turn in there to eat food. except a jar of oil. what have you in the house?" And she said. It was almost as if Elisha’s bed also became a holy thing as it had played a part in healings (2Kgs." 3 Then he said.). a type of Tabernacle. also Elijah’s bed in 1Kgs 17:19) and before which the prophet offered up his prayers. 8 One day Eli'sha went on to Shunem. 2Kings 4:38-44 And Eli'sha came again to Gilgal when there was a famine in the land. sell the oil and pay your debts. 6 When the vessels were full. The chamber given to Elisha became a safe haven or sanctuary for him. and came and cut them up into the pot of pottage. "Go." (RSV) The word used to describe the woman can mean either monetarily wealthy or a person of high standing in the community. and you and your sons can live on the rest." Elisha and the Shunemite The following story has a number of parallels with that of Elijah and the poor widow of Zarephath (1Kgs." 5 So she went from him and shut the door upon herself and her sons. with its table (cf." And he said to her. The rest of the story of Elisha and the Shunemite woman (2Kgs. 145). a table. he can go in there. "There is not another. she said to her son. But while they were eating of the pottage. So whenever he passed that way. cf." And he threw it into the pot." 39 One of them went out into the field to gather herbs. empty vessels and not too few. and when one is full. there is death in the pot!" And they could not eat it. that they may eat. and found a wild vine and gathered from it his lap full of wild gourds. he said to his servant. it could perhaps be likened to the altar of incense. and as she poured they brought the vessels to her. 7 She came and told the man of God. "Then bring meal. and put there for him a bed. "Behold now. so that whenever he comes to us. who is continually passing our way. "Pour out for the men. 9 And she said to her husband. and you know that your servant feared the LORD. 4:11-37) is dealt with in the paper Song of Songs (No. "Go outside. "What shall I do for you? Tell me. set it aside. "O man of God." 2 And Eli'sha said to her. borrow vessels of all your neighbors. shewbread) and lamp stand. "Your servant my husband is dead. but the creditor has come to take my two children to be his slaves. and he said. And as the sons of the prophets were sitting before him." And there was no .

"O LORD." 14 So he sent there horses and chariots and a great army. "Go and see where he is." It was told him. and he saw. my lord. they cut down trees." So the LORD opened the eyes of the young man. "See. and behold.38). I pray thee. 20:1). "How am I to set this before a hundred men?" So he repeated. Elisha’s servant saw an angelic army that more . for the Syrians are going down there. "Beware that you do not pass this place. "Be pleased to go with your servants. And the servant said." And he answered. saying. "Give to the man. he took counsel with his servants. The complete text of 2Kings 5 concerning Naaman. Elisha was forewarned by the Angel of God of the intent of the king of Syria (probably Ben-hadad of 1Kgs. meaning thrice-great lord (BDB). tells the king of Israel the words that you speak in your bedchamber. However. and let us make a place for us to dwell there. my master! What shall we do?" 16 He said. The town in Ephraim from which the man came was Baal-shalishah." And he answered. his axe head fell into the water." 13 And he said. The Army of God 2Kings 6:1-33 Now the sons of the prophets said to Eli'sha. that they may eat. "Fear not." 17 Then Eli'sha prayed. 8 Once when the king of Syria was warring against Israel. open his eyes that he may see. `They shall eat and have some left. "At such and such a place shall be my camp. And they ate. and surrounded the city. and had some left. "Alas. 270). "Behold. 2 Let us go to the Jordan and each of us get there a log. according to the word of the LORD. the mountain was full of horses and chariots of fire round about Eli'sha. and fresh ears of grain in his sack. and made the iron float." So he reached out his hand and took it. 15:34." 10 And the king of Israel sent to the place of which the man of God told him. but Eli'sha. "Go." 9 But the man of God sent word to the king of Israel. is dealt with in the paper The Messages of Revelation 14 (No. for thus says the LORD. and they came by night. "Alas. "Where did it fall?" When he showed him the place. 7 And he said. that I may send and seize him. "Will you not show me who of us is for the king of Israel [Jehoram]?" 12 And one of his servants said. that they may eat. the place where we dwell under your charge is too small for us. This event took place during the Passover season as the first-fruits of the barley harvest are mentioned (see The Passover (No. my master! It was borrowed." 3 Then one of them said. 42 A man came from Ba'al-shal'ishah. the Syrian leper. harm in the pot. the prophet who is in Israel. bringing the man of God bread of the first fruits." 6 Then the man of God said. behold." 4 So he went with them. Thus he used to warn him. 98)). and said. an army with horses and chariots was round about the city. And Eli'sha said. And when they came to the Jordan. and threw it in there.'" 44 So he set it before them. 14:20. for those who are with us are more than those who are with them. "Take it up. and he called his servants and said to them. and he cried out. so that he saved himself there more than once or twice. "Give them to the men. he cut off a stick. 5 But as one was felling a log. who became so frustrated that his plans were being revealed in advance to Israel that he set out to capture the prophet. (RSV) The feeding of the hundred men here is one of three miracles in the Bible concerned with feeding a multitude (see Mat. he is in Dothan. 11 And the mind of the king of Syria was greatly troubled because of this thing." 43 But his servant said. O king. twenty loaves of barley. 15 When the servant of the man of God rose early in the morning and went out. "I will go. "None.

we saw it break! Before our astonished eyes. … Outlined on the slight rise by the La Bassee village. … I was responsible for the intelligence on this sector of the battle area." I followed him shortly afterwards. in mass formation. As I made my way over the scattered debris of the ruined houses. see. which had been largely directed against the shattered town of Bethune. and. haversacks. I suppose they must be cavalry of one of their Colonial Forces. and therefore made my headquarters in the bright little town of Bethune … The British troops had been in the trenches fighting for weeks without rest or relief owing to the fact that reserves were practically exhausted. these English." I replied. It was not long before my Sergeant arrived with two German officer prisoners … Briefly." said the Sergeant. … the enemy shellfire. and as far as we could see. suddenly lifted and began to burst on a slight rise beyond its outskirts. just look at that open ground behind Bethune. being eager to see for myself. as there were obviously no troops within sight against whom the Germans could be directing their fire. coats and anything which might impede their flight. and our troops were marching behind us singing their way to victory. as witnessed by British Captain Cecil Hayward. as we watched. to advance against such a force as ours in the open. throwing down their arms. the statement the senior German officer made was as follows: The order had been given to advance in mass formation. 34:7). The incident concerned the so-called White Cavalry. "Get along down to the canal and see what is happening there. for. This line suddenly halted. Such a Host is alluded to in Isaiah 66 (cf. rifles. and was augmented by heavy bursts of massed machine guns which raked it backward and forward with a hail of lead. The following account of what occurred between the months of April and August. also Ps." . They must be mad. There is a brigade of cavalry coming up through the smoke drifting across it. when Friedrich my lieutenant here said: "Herr Kapitan. We stood looking in astonishment. yet the enemy gunfire broke on it with increasing fury. "What in the world is he peppering the naked ground for?" "I can't think. that well-drilled and seemingly victorious army broke up into groups of frightened men who were fleeing from us. who a short time before had commenced a forward movement to victory. the enemy's fire suddenly ceased. I can personally vouch for as being true. The above incident had a remarkable parallel during a First World War battle in France when the British and their allies were in danger of being overrun by the Germans. and a curious calm fell on everything. houses or human beings. was a dense line of German troops.than matched the Syrian army surrounding the city of Dothan. 1918. "Fritz has gone barmy. they are all in white uniform and are mounted on white horses. sir. This open ground was absolutely bare of trees.

but on they came and not a single man or horse fell. the British soldiers saw nothing. Steadily they advanced. We are beaten – by the White Cavalry … I cannot understand … I cannot understand. and said. they are in khaki. all of whom came forward at a quiet walk-trot. There may be fighting. Obviously enough men had died on both sides and the Host had intervened to shorten the conflict. the whole of the German Army was able to see the White Cavalry. like the incoming tide surging over a sandy beach. They have all been fighting on foot for several years past. at that particular time. their accounts tallied with the one given here. remorseless as fate. yes. 18 And when the Syrians came down against him. throwing away their arms and accoutrements in order not to have their movements impeded … all running. "Strange. and this is not the city. whose hair. above all from their awe-inspiring leader whose hair shone like a golden aureole. raking the advancing cavalry with a hail of lead. follow me. as his huge white charger bore him proudly forward. 19 And Eli'sha said to them. and in substance. "I have never heard of the English having any white-uniformed cavalry. I pray thee. fled." I said. "Strike this people. The story of Elisha and the Syrian host continues in 2Kings 6. whether Colonial or not. In this instance. here or elsewhere. and I turned to flee. whimpering like children. We are beaten. While this incident may sound mythical. the fact that it was recorded by the British from German eyewitnesses and the British involved saw nothing would tend to indicate its authenticity. That is all I have to tell you. panic stricken. I. but his hands lay quietly holding the reins. each man and horse in his exact place. but we have lost the war. and a few paces in front of them rode their leader." And he led . not white." So he struck them with blindness in accordance with the prayer of Eli'sha. By his side was a great sword. in parade-ground formation. with blindness. In spite of heavy shell and concentrated machine-gun fire. shone in an aura round his head. a fine figure of a man. "This is not the way. and around me were hundreds of terrified men. The German Army is broken. and anyway. like spun gold. Eli'sha prayed to the LORD. clear in the shining sunlight. Their one desire was to get away from that advancing White Cavalry. an Officer of the Prussian Guard. the White Cavalry advanced. … Then a great fear fell on me." During the following few days I examined many prisoners. But it was not necessary for us to do so. the evidence of their presence had to come from the enemy. This is in spite of the fact that at least two of us could swear that we saw no cavalry in action. Neither did any of us see so much as a single white horse either with or without a rider." "We saw the shells bursting among the horses and their riders. Shortly afterwards our machine guns opened a heavy fire. and I will bring you to the man whom you seek. It appears that the God of Hosts had indeed dispatched an angelic army (although not a fiery one) at a critical point in the battle.

and the fourth part of a kab of dove's dung for five shekels of silver. Here we see the correct conduct in dealing with prisoners of war when not told specifically by God to extirpate them. whence shall I help you? From the threshing floor. saying. he had sackcloth beneath upon his body – 31 and he said. The curse of Deuteronomy 28:50-57 – promised long before by Moses as an inevitable consequence of disobedience to God – had come upon Samaria. "O LORD. It is normally the sign of a civilised society to be magnanimous in victory. although the decision in this case was to have an unfortunate outcome. but before the messenger arrived Eli'sha said to the elders. "This trouble is from the LORD! Why should I wait for the LORD any longer?" (RSV) It seems beheading was a routine method of killing God’s prophets in these times: Elisha here was threatened with it. if the head of Eli'sha the son of Shaphat remains on his shoulders today. and when they had eaten and drunk. shut the door. shall I slay them? Shall I slay them?" 22 He answered." So the LORD opened their eyes. my lord. they were in the midst of Sama'ria. that they may see. them to Sama'ria." This gruesome incident reflected the dire situation in which the inhabitants of the city of Samaria found themselves. while John the Baptist suffered it. "If the LORD will not help you. a title of honour and affection. "Help. as they besieged it. 30 When the king heard the words of the woman he rent his clothes – now he was passing by upon the wall – and the people looked." 32 Eli'sha was sitting in his house. O king!" 27 And he said. however. and they went to their master. "Do you see how this murderer has sent to take off my head? Look. 20 As soon as they entered Sama'ria. when the messenger comes. "This woman said to me. and behold. 20:4).' 29 So we boiled my son. "My father. Now the king had dispatched a man from his presence. Would you slay those whom you have taken captive with your sword and with your bow? Set bread and water before them. And the Syrians came no more on raids into the land of Israel. and more also. that they may eat and drink and go to their master. and besieged Sama'ria. and hold the door fast against him. We see in verse 21 the king of Israel also deferring to Elisha as his “father”. "You shall not slay them. and lo. "May God do so to me. `Give your son. . a woman cried out to him. but she has hidden her son. that we may eat him'. and the elders were sitting with him. and we will eat my son tomorrow. 26 Now as the king of Israel was passing by upon the wall. and they saw. the king came down to him and said. open the eyes of these men. and ate him. and went up. that we may eat him today." 23 So he prepared for them a great feast. Is not the sound of his master's feet behind him?" 33 And while he was still speaking with them. 25 And there was a great famine in Sama'ria. And on the next day I said to her. Siege and famine in Israel 24 Afterward Ben-ha'dad king of Syria mustered his entire army. Their reward. 21 When the king of Israel saw them he said to Eli'sha. "What is your trouble?" She answered. or from the wine press?" 28 And the king asked her. is pre-eminence in the First Resurrection. until an ass's head was sold for eighty shekels of silver. he sent them away. as did many martyrs for the truth (Rev. Eli'sha said. `Give your son.

and we shall die there.At the height of the siege and consequent famine in the city. leaving the camp as it was. 3 Now there were four men who were lepers at the entrance to the gate." 5 So they arose at twilight to go to the camp of the Syrians. 2Kings 7:1-20 But Eli'sha said. where he comes to an unfortunate end. and a man who stood behind him. but when they came to the edge of the camp of the Syrians. "Why do we sit here till we die? 4 If we say. so that they said to one another." A minor historical point is made by Werner Keller concerning the person known as the captain (lord: KJV) in verse 2. could this thing be?" But he said. In this way he protected the warrior and the driver in the rear and prevented them from being thrown out during those furious sallies in battle when the open car passed over dead and wounded men. They seemed to have forgotten about the angelic army previously sent to unsettle them. This man is mentioned again in verse 17. 9:24). This time it was just the sound of a huge army which caused panic in the Syrian host. we die also. Elisha made the most incredible prophecy: an imminent end to the famine and an abundance of food to follow. and if they kill us we shall but die. behold. "If the LORD himself should make windows in heaven. the king of Israel has hired against us the kings of the Hittites and the kings of Egypt to come upon us. from the root meaning three or triad." 2 Then the captain on whose hand the king leaned said to the man of God. 247) The third man would presumably have carried a shield on his back for his own protection in addition to his armour to avoid the fate suffered by King Jehoram (2Kgs. and if we sit here. as they attributed the sound to the Hittites or Egyptians. (op. So now come. and their asses. `Let us enter the city. let us go over to the camp of the Syrians. and they said to one another. there was no one there. and fled for their lives. and of horses. if they spare our lives we shall live.. 6 For the Lord had made the army of the Syrians hear the sound of chariots. and two measures of barley for a shekel. their horses. . The Hebrew word is shaliysh (SHD 7991). the sound of a great army. "Hear the word of the LORD: thus says the LORD. p. This then was the “third man” … the strap-hanger in King Jehoram’s chariot. "You shall see it with your own eyes." 7 So they fled away in the twilight and forsook their tents. He states: Every chariot was manned by three men: the driver. at the gate of Sama'ria. Tomorrow about this time a measure of fine meal shall be sold for a shekel.' the famine is in the city. "Behold. With outstretched arms he held on to two short straps which were fastened to the right and left sides of the chariot. the fighter. cit. but you shall not eat of it.

3 And at the end of the seven years. let us send and see." 15 So they went after them as far as the Jordan." 10 So they came and called to the gatekeepers of the city. "We are not doing right. just as the Patriarch Jacob had sent his sons there for sustenance during a similar famine in Palestine. "We came to the camp of the Syrians. 2Kings 8:1-15 Now Eli'sha had said to the woman whose son he had restored to life. and ate and drank. could such a thing be?" And he had said. and did according to the word of the man of God. thinking. "Tell me all the great things that Eli'sha has done. So a measure of fine meal was sold for a shekel." 5 And while he was telling the king how Eli'sha had restored the dead to life." 20 And so it happened to him. "Restore all that was hers. "My lord. here is the woman. therefore they have gone out of the camp to hide themselves in the open country. all the way was littered with garments and equipment which the Syrians had thrown away in their haste. "If the LORD himself should make windows in heaven. when the woman returned from the land of the Philistines. now therefore come. and two measures of barley for a shekel. Egypt is represented as a place of sanctuary. and it will come upon the land for seven years. nothing but the horses tied. 17 Now the king had appointed the captain on whose hand he leaned to have charge of the gate. 16 Then the people went out. as the man of God had said when the king came down to him. and the tents as they were. there was no one to be seen or heard there. 9 Then they said to one another. she went with her household and sojourned in the land of the Philistines seven years. for the LORD has called for a famine. lo. and entered another tent. Elisha prepared the Shunemite woman for the approaching seven-year famine by sending her to “Egypt”. and said to his servants." 19 the captain had answered the man of God. "I will tell you what the Syrians have prepared against us. so that he died. and sojourn wherever you can. punishment will overtake us. we shall take them alive and get into the city. and depart with your household. let us go and tell the king's household. saying. and when it was told him. "You shall see it with your own eyes. (RSV) This text seems to represent a fatal lesson in not believing the words of God’s true prophets and in blasphemously suggesting a limit to God’s power. 8 And when these lepers came to the edge of the camp. "Arise. and carried off things from it." 2 So the woman arose. And the messengers returned. but you shall not eat of it. they went into a tent. "Two measures of barley shall be sold for a shekel. and the asses tied. according to the word of the LORD. And Geha'zi said. and went and hid them." 7 Now Eli'sha came to Damascus. for the people trod upon him in the gate and he died. They know that we are hungry. 12 And the king rose in the night. and it was told within the king's household.'" 13 And one of his servants said. and a measure of fine meal for a shekel. Once again. saying. and the king sent them after the army of the Syrians. and told the king. she went forth to appeal to the king for her house and her land. O king. together with all the produce of the fields from the day that she left the land until now. So the king appointed an official for her." 14 So they took two mounted men. and plundered the camp of the Syrians. `When they come out of the city. if we are silent and wait until the morning light. and. This day is a day of good news. and went and hid them. and here is her son whom Eli'sha restored to life. "Let some men take five of the remaining horses. behold. she told him. In this case she went to the land of the Philistines. and told them. the woman whose son he had restored to life appealed to the king for her house and her land. 18 For when the man of God had said to the king. about this time tomorrow in the gate of Sama'ria." 11 Then the gatekeepers called out. "Go and see." 6 And when the king asked the woman. 4 Now the king was talking with Geha'zi the servant of the man of God. seeing that those who are left here will fare like the whole multitude of Israel that have already perished. saying. "The . and the people trod upon him in the gate. and they carried off silver and gold and clothing. then they came back. Ben-ha'dad the king of Syria was sick. and behold.

"Your son Ben- ha'dad king of Syria has sent me to you." 13 And Haz'ael said. and took a present with him. all kinds of goods of Damascus. "To you. saying. an army commander and expert charioteer (2Kgs. "The LORD has shown me that you are to be king over Syria. And the man of God wept. 12 And Haz'ael said. thus providing a reference point for dating before and after. Jehu The eleventh king of Israel was Jehu." 14 Then he departed from Eli'sha. namely his commander. the prophet. who is but a dog. `You shall certainly recover'. and you will slay their young men with the sword.' Then open the door and flee." 15 But on the morrow he took the coverlet and dipped it in water and spread it over his face. and go to Ramoth-gilead. O commander." 4 So the young man. 9:20) who was anointed king by Elisha in Ramoth-gilead while he and his troops waited for an expected Syrian attack. that he should do this great thing?" Eli'sha answered. 2Kings 9:1-37 Then Eli'sha the prophet called one of the sons of the prophets and said to him. "I have an errand to you. look there for Jehu the son of Jehosh'aphat. "What did Eli'sha say to you?" And he answered. who then ascended the throne. "To which of us all?" And he said. 5 And when he came. "Go. I anoint you king over Israel. Jehu began the fourth dynasty. forty camel loads. you will set on fire their fortresses. `Shall I recover from this sickness?'" 10 And Eli'sha said to him. say to him. and went into the house. and pour it on his head. the commanders of the army were in council. "Because I know the evil that you will do to the people of Israel. `Thus says the LORD. Jehu (see below). till he died. went to Ramoth- gilead. "Why does my lord weep?" He answered. and the young man poured the oil on his head. who said to him. "Take a present with you and go to meet the man of God." 8 the king said to Haz'ael. but the LORD has shown me that he shall certainly die. saying. `Shall I recover from this sickness?'" 9 So Haz'ael went to meet him. until he was ashamed. son of Nimshi. and go in and bid him rise from among his fellows. biblical scholars almost universally agree that his reign covered the period 842 to 814 BCE. When he came and stood before him. 2 And when you arrive. "What is your servant." 11 And he fixed his gaze and stared at him." And Jehu said. He was also commissioned by the prophet to wipe out the whole house of Ahab. While varying widely on most of their chronologies of the kings. "He told me that you would certainly recover. he said. and dash in pieces their little ones. "Gird up your loins. king of Israel. and lead him to an inner chamber. and inquire of the LORD through him. behold. which was to last for nearly 90 years. and he said. And Haz'ael became king in his stead. and say. do not tarry. Jehoram had reigned for 12 years. man of God has come here. 3 Then take the flask of oil. (RSV) Ben-hadad of Syria was thus smothered to death by his servant Hazael. saying to him. The dates for the start of Jeroboam’s reign (932 BCE) and the captivity of Israel (722 BCE) are also reasonably certain. I anoint . and came to his master. O commander. "Thus says the LORD the God of Israel. and rip up their women with child. and take this flask of oil in your hand." 6 So he arose. We saw earlier that Jehoram. was also killed by someone close to him.

each in his chariot. 7 And you shall strike down the house of Ahab your master. "Make ready. and they blew the trumpet. 9). "I see a company. he said. "Jehu is king. 1Kgs. 7). and like the house of Ba'asha the son of Ahi'jah. `Is it peace?'" And Jehu answered. the tenth ruler in Israel since the split with Judah." And the watchman reported. Ahaziah was also the grandson of the noble Jehoshaphat of Judah who. 22 And when Joram saw Jehu. saying. bond or free. 22:3). when he fought with Haz'ael king of Syria. "The messenger reached them. And Ahazi'ah king of Judah had come down to visit Joram. and none shall bury her. "Thus says the king. they said to him. and went to meet Jehu. "What have you to do with peace? Turn round and ride behind me. and went to Jezreel. in Israel. and fled. that I may avenge on Jez'ebel the blood of my servants the prophets. (Now Joram with all Israel had been on guard at Ramoth-gilead against Haz'ael king of Syria. Jehu?" He answered. Then Jora king of Israel and Ahazi'ah king of Judah set out. "Take a horseman." 19 Then he sent out a second horseman. "That is not true. and he spied the company of Jehu as he came. 8 For the whole house of Ahab shall perish. and send to meet them. `Thus says the LORD. "You know the fellow and his talk. "He reached them." And they made ready his chariot. and I will cut off from Ahab every male. for he drives furiously." 21 Joram said. "What peace can there be. but he is not coming back. `Is it peace?'" And Jehu said. but he is not coming back. This was the third time that God had arranged for all the males of a king’s house to be slaughtered. Ahaziah was the son of Athaliah and thus the grandson of the infamous Ahab and Jezebel." And Joram said. Again. over Israel. and let him say. Joram here is King Jehoram. and said. "Is all well? Why did this mad fellow come to you?" And he said to them. and put it under him on the bare steps. and said. 10 And the dogs shall eat Jez'ebel in the territory of Jezreel. then let no one slip out of the city to go and tell the news in Jezreel. "Thus the king has said. `Is it peace?'" 18 So a man on horseback went to meet him. and the blood of all the servants of the LORD. "Is it peace. I anoint you king over Israel. for Joram lay there." 14 Thus Jehu the son of Jehosh'aphat the son of Nimshi conspired against Joram." 12 And they said." 16 Then Jehu mounted his chariot. unlike the kings of Israel. Messiah himself suffered the accusation (Jn. who was the one destined to kill Jeroboam’s descendants (cf. and “his mother was his counselor in doing wickedly” (2Chr. "What have you to do with peace? Turn round and ride behind me. and met him at the property of Naboth the Jezreelite." And he said. 11 When Jehu came out to the servants of his master." 20 Again the watchman reported. 15:29. who came to them.) So Jehu said. the others involved Jeroboam and Baasha. and proclaimed. 16:11). "If this is your mind. 10:20). you king over the people of the LORD. And the driving is like the driving of Jehu the son of Nimshi. “sought the Lord with all his heart” (v. "Thus and so he spoke to me. an unrighteous king’s downfall was occasioned by God (v. 9 And I will make the house of Ahab like the house of Jerobo'am the son of Nebat. saying. 15 but King Joram had returned to be healed in Jezreel of the wounds which the Syrians had given him. so long as the harlotries and the sorceries of your mother Jez'ebel are so many?" . tell us now." Then he opened the door.'" 13 Then in haste every man of them took his garment. 17 Now the watchman was standing on the tower in Jezreel. This wasn’t the first time that a prophet of God was called mad. and said.

he said. the two words being used together in Numbers 24:1. you Zimri." So they threw her down. it appears there will be no real peace within or between the nations until all these Babylonian influences have been removed. "Shoot him also". Thus we see Jehu killing both kings Jehoram of Israel and Ahaziah of Judah in quick succession. O Ahazi'ah!" 24 And Jehu drew his bow with his full strength. 25 Jehu said to Bidkar his aide. "Throw her down. Jer. for she is a king's daughter. "Who is on my side? Who?" Two or three eunuchs looked out at him. he fled in the direction of Beth-haggan. and shot Joram between the shoulders. 23 Then Joram reined about and fled. 28 His servants carried him in a chariot to Jerusalem. 30 When Jehu came to Jezreel. then it will be known that the LORD has truly sent the prophet. and he said. which he spoke by his . and sorceries (witchcrafts: KJV) are spiritism." 27 When Ahazi'ah the king of Judah saw this. and they trampled on her.Asking about peace three times was perhaps an earnest desire for a peace that could never come at this juncture (cf. how the LORD uttered this oracle against him: 26 `As surely as I saw yesterday the blood of Naboth and the blood of his sons – says the LORD – I will requite you on this plot of ground. and said." (RSV) As Jezebel personified idolatrous pagan practices. there is to be a day when peace does break out according to the word of God’s true prophets.' Now therefore take him up and cast him on the plot of ground. And Jehu pursued him." 35 But when they went to bury her. “the way of peace they know not” (Isa. Ahazi'ah began to reign over Judah. 25:1 and 31:16. and adorned her head. they found no more of her than the skull and the feet and the palms of her hands. 29 In the eleventh year of Joram the son of Ahab. and died there. 15). but was killed by divine command to avenge the death of Naboth and his sons (vv. However. when the word of that prophet comes to pass. and the wall of separation between God and mankind generally that was built upon this idolatry is torn down. and she painted her eyes. saying to Ahazi'ah. "This is the word of the LORD. and said. "Treachery. And he fled to Megid'do. 34 Then he went in and ate and drank. and looked out of the window. and they shot him in the chariot at the ascent of Gur. for. 8:11). 6:14. murderer of your master?" 32 And he lifted up his face to the window. 59:8). Jehu was commissioned by Elijah to destroy the whole house of Ahab including his wife Jezebel. and buried him in his tomb with his fathers in the city of David. Harlotries represent idolatry. Jez'ebel heard of it. 36 When they came back and told him. in accordance with the earlier prophecy (1Kgs. "Is it peace. when you and I rode side by side behind Ahab his father. "See now to this cursed woman. Jeremiah 28:9 As for the prophet who prophesies peace. so that the arrow pierced his heart. "Take him up. 25-26). 31 And as Jehu entered the gate. she said. and bury her. and some of her blood spattered on the wall and on the horses. for remember. in accordance with the word of the LORD. and cast him on the plot of ground belonging to Naboth the Jezreelite. 33 He said. 21:23). The latter had only just recovered from wounds received while fighting the Syrians (v. It is noted that Jehoram’s body was cast into Naboth’s field. and he sank in his chariot. which is by Ibleam. he thereby joined his mother Jezebel’s blood in the dust of Jezreel.

but who struck down all these? 10 Know then that there shall fall to the earth nothing of the word of the LORD. how then can we stand?" 5 So he who was over the palace. We will not make any one king. and sent them to Sama'ria. This is Jez'ebel. the two kings could not stand before him. fortified cities also. 5 And on that day. when he went out. It was I who conspired against my master. to forgive them at all. do whatever is good in your eyes. he stood." 9 Then in the morning. to the rulers of the city. and if you are ready to obey me. "They have brought the heads of the king's sons. and put their heads in baskets. and said to all the people. until he left him none remaining. 7 But I will have pity on the house of Judah. servant Eli'jah the Tishbite. "If you are on my side. who were bringing them up. and said. possibly including his grandsons and great-grandsons. and we will do all that you bid us. and sent them to him at Jezreel. the prophet Hosea (Hoshea) mentioned the final captivity and deportation of Israel that was to happen during the reign of his namesake. which the LORD spoke concerning the house of Ahab. to the elders. "We are your servants. for the LORD has done what he said by his servant Eli'ah. "Lay them in two heaps at the entrance of the gate until the morning. `In the territory of Jezreel the dogs shall eat the flesh of Jez'ebel." 6 Then he wrote to them a second letter. King Hoshea. all his great men. "Call her name Not pitied. saying. Hosea 1:4-7a And the LORD said to him. 7 And when the letter came to them. and his priests. "Call his name Jezreel." 6 She conceived again and bore a daughter. as soon as this letter comes to you. (RSV) The whole house of Ahab was about to be cut off. for I will no more have pity on the house of Israel. for yet a little while. "You are innocent. and slew them. "Behold.'" (RSV) This signifies that the entire Babylonian mystery religion will one day be brought to remembrance no more." 11 So Jehu slew all that remained of the house of Ahab in Jezreel. 2 "Now then. and his familiar friends." 4 But they were exceedingly afraid. take the heads of your master's sons. seventy persons. saying." Now the king's sons. In connection with Jezreel. 2Kings 10:1-36 Now Ahab had seventy sons in Sama'ria. seventy persons. and I will deliver them by the LORD their God. saying. 3 select the best and fittest of your master's sons and set him on his father's throne. so that no one can say. they took the king's sons. with literal beheadings of his 70 “sons” or descendants. 8 When the messenger came and told him. 37 and the corpse of Jez'ebel shall be as dung upon the face of the field in the territory of Jezreel. and fight for your master's house. and slew him. and there are with you chariots and horses. and weapons. And the LORD said to him. were with the great men of the city. and come to me at Jezreel tomorrow at this time. and to the guardians of the sons of Ahab. together with the elders and the guardians. seeing your master's sons are with you. it is to be thoroughly eliminated. I will break the bow of Israel in the valley of Jezreel. sent to Jehu." he said. . So Jehu wrote letters. and he who was over the city. and I will put an end to the kingdom of the house of Israel. and I will punish the house of Jehu for the blood of Jezreel.

for I have a great sacrifice to offer to Ba'al. "Come with me. And. and see that there is no servant of the LORD here among you. and the house of Ba'al was filled from one end to the other. let not a man escape. was a Kenite and a descendant of Moses’ father-in-law. 12 Then he set out and went to Sama'ria." Jehu said." But Jehu did it with cunning in order to destroy the worshipers of Ba'al. 16 And he said. "It is. "Sanctify a solemn assembly for Ba'al. and said to him. the whole household in Jezreel loyal to King Ahab was killed. according to the prophecy of Elijah (9:8). give me your hand. and slew them at the pit of Beth-eked. and we came down to visit the royal princes and the sons of the queen mother. and he greeted him." So he had him ride in his chariot. This destruction of the Baal system in Israel. And Jehu hadn’t finished yet. "Search. whoever is missing shall not live. 15 And when he departed from there. 22 He said to him who was in charge of the wardrobe. and see my zeal for the LORD. Jethro (see the paper Descendants of Abraham Part IV: Sons of Keturah (No. "Is your heart true to my heart as mine is to yours?" And Jehon'adab answered. he slew all that remained to Ahab in Sama'ria. he met Jehon'adab the son of Rechab coming to meet him." So they proclaimed it." So when they put them to the sword. and he spared none of them. 23 Then Jehu went into the house of Ba'al with Jehon'adab the son of Rechab. and said. He was to prove a loyal assistant to Jehu in the destruction of the Baal system in Israel – with possible repeat application to the Last Days. 20 And Jehu ordered. and demolished the house of Ba'al." 14 He said.Hence. but only the worshipers of Ba'al. forty-two persons. son of Rechab. and made it a latrine to this day. "Ahab served Ba'al a little. Now Jehu had stationed eighty men outside." And they took them alive." 25 So as soon as he had made an end of offering the burnt offering. 27 And they demolished the pillar of Ba'al. 49). so that there was not a man left who did not come. 212D)). let none be missing. Jehu said to the guard and to the officers. 28 Thus Jehu wiped out Ba'al from Israel." 24 Then he went in to offer sacrifices and burnt offerings. is mentioned in the paper Seven Days of the Feasts (No. all his worshipers and all his priests. "Go in and slay them. and all the worshipers of Ba'al came. 19 Now therefore call to me all the prophets of Ba'al." So he gave him his hand. albeit temporary (and seen earlier with the prophet Elijah)." So he brought out the vestments for them. according to the word of the LORD which he spoke to Eli'jah. On the way. And they entered the house of Ba'al. and burned it. but also those who had advised and ministered as priests to Ahab. and said to them. These were not just his blood relatives. Jehonadab. "Who are you?" And they answered. "Take them alive. And Jehu took him up with him into the chariot. but Jehu will serve him much. till he had wiped them out. "The man who allows any of those whom I give into your hands to escape shall forfeit his life. "We are the kinsmen of Ahazi'ah. 18 Then Jehu assembled all the people. 21 And Jehu sent throughout all Israel. and he said. "If it is. in spite of Jehu’s zeal . the guard and the officers cast them out and went into the inner room of the house of Ba'al 26 and they brought out the pillar that was in the house of Ba'al. and he said to the worshipers of Ba'al. 17 And when he came to Sama'ria. "Bring out the vestments for all the worshipers of Ba'al. when he was at Beth-eked of the Shepherds. 13 Jehu met the kinsmen of Ahazi'ah king of Judah.

Jehu’s dynasty was to be the longest in Israel’s history. And Jeho'ahaz his son reigned in his stead. Some commentators suggest that this Shalmaneser had even assisted Jehu to claim the throne of Israel.H. son of Jehu. discovered by A. which he made Israel to sin. His reign lasted 17 years. Jehoahaz The twelfth king of Israel was Jehoahaz (Jehovah has seized). and all his might. he did not turn from the sins of Jerobo'am. London). Tirzah and Samaria. 36 The time that Jehu reigned over Israel in Sama'ria was twenty-eight years. and have done to the house of Ahab according to all that was in my heart. He greatly punished Israel as foretold by Elisha (2Kgs. the Syrians appeared not to have taken the Israelites into captivity as happened later with the Assyrians. he still retained Jeroboam’s golden calves – apparently a separate form of idolatry to the Baal system. your sons of the fourth generation shall sit on the throne of Israel. Ezek. 8:12). 29 But Jehu did not turn aside from the sins of Jerobo'am the son of Nebat. all the land of Gilead. 30 And the LORD said to Jehu. It is of note that the three capitals of the Northern Kingdom after the division. 34 Now the rest of the acts of Jehu. Layard in 1846 during an archaeological excavation at Nimrud. and the Reubenites.and being used in such a mighty way. 21:26-27). and in Dan. from Aro'er. Despite his idolatry. namely Shechem. the golden calves that were in Bethel. In a sense we thus have three “over-turnings” (from Jerusalem) of the capital of the northern tribes (cf. south of Baghdad. "Because you have done well in carrying out what is right in my eyes. such as all of the eastern side of the Jordan by Hazael of Syria. the Gadites. are they not written in the Book of the Chronicles of the Kings of Israel? 35 So Jehu slept with his fathers. and they buried him in Sama'ria. (RSV) It is by God’s will here that parts of Israel are conquered. and all that he did. The Obelisk also mentions King Hazael of Damascus (2Kgs. which he made Israel to sin. 9:14). that is. Gilead and Bashan. 32 In those days the LORD began to cut off parts of Israel. Haz'ael defeated them throughout the territory of Israel: 33 from the Jordan eastward. 8:28. were all located within the tribal territory of Manasseh. Manasseh was cut off because of the sins of Jehu. Jehu had also been forced to pay tribute to King Shalmaneser III of Assyria as noted on the so- called Black Obelisk (now in the British Museum. . and the Manas'sites." 31 But Jehu was not careful to walk in the law of the LORD the God of Israel with all his heart. however. which is by the valley of the Arnon.

or Elisha. 6 Nevertheless they did not depart from the sins of the house of Jerobo'am. "The LORD's arrow of victory. for the king of Syria had destroyed them and made them like the dust at threshing. he did not depart from them. but he walked in them. for he saw the oppression of Israel. and he reigned sixteen years. and the might with which he fought against Amazi'ah king of Judah. 19 Then the man of God was angry with him. 2Kings 13:10-25 In the thirty-seventh year of Jo'ash king of Judah Jeho'ash the son of Jeho'ahaz began to reign over Israel in Sama'ria. but walked in them. and they buried him in Sama'ria. and said. and the LORD hearkened to him. 11 He also did what was evil in the sight of the LORD. and he drew it. "Take a bow and arrows". v. son of the previous king.) 7 For there was not left to Jeho'ahaz an army of more than fifty horsemen and ten chariots and ten thousand footmen. And Eli'sha laid his hands upon the king's hands. 14:27. 2Kings 13:1-9 In the twenty-third year of Jo'ash the son of Ahazi'ah. in this case a saviour – either an angel. "Open the window eastward". he did not depart from all the sins of Jerobo'am the son of Nebat. and he struck three times. 14 Now when Eli'sha had fallen sick with the illness of which he was to die." 18 And he said. which he made Israel to sin. "You should have . how the king of Syria oppressed them. Jeho'ahaz the son of Jehu began to reign over Israel in Sama'ria. Bullinger‘s note). and he took them. my father! The chariots of Israel and its horsemen!" 15 And Eli'sha said to him. are they not written in the Book of the Chronicles of the Kings of Israel? 13 So Jo'ash slept with his fathers. the arrow of victory over Syria! For you shall fight the Syrians in Aphek until you have made an end of them. And he said to the king of Israel. (RSV) Jehoash The thirteenth man to ascend the throne of Israel was Jehoash (given by the Lord: BDB). "Strike the ground with them". and his might. crying. and wept before him. "Draw the bow". "Take the arrows". and he gave them continually into the hand of Haz'ael king of Syria and into the hand of Ben-ha'dad the son of Haz'ael. and Jo'ash his son reigned in his stead. 17 And he said. are they not written in the Book of the Chronicles of the Kings of Israel? 9 So Jeho'ahaz slept with his fathers. Jehoahaz. 2 He did what was evil in the sight of the LORD. which he made Israel to sin. which he made Israel to sin. 12 Now the rest of the acts of Jo'ash. "My father. king of Judah. 8 Now the rest of the acts of Jeho'ahaz and all that he did. And he said. and he reigned seventeen years. It was the typical and oft-repeated cycle of idolatry/punishment/repentance. so that they escaped from the hand of the Syrians. and the Ashe'rah also remained in Sama'ria. and he opened it. or a general of Jehovah (cf. and he shot. 16 Then he said to the king of Israel. but again God took note of the latter and provided a means of deliverance. 5 (Therefore the LORD gave Israel a savior. and stopped. and followed the sins of Jerobo'am the son of Nebat. and Jo'ash was buried in Sama'ria with the kings of Israel. 25. and Jerobo'am sat upon his throne. 4 Then Jeho'ahaz besought the LORD. Jo'ash king of Israel went down to him. "Shoot". and the people of Israel dwelt in their homes as formerly. Then Eli'sha said. 3 And the anger of the LORD was kindled against Israel. and all that he did. so he took a bow and arrows.

This act was to represent the Resurrection of the Dead through the intervention of Messiah in the Holy Spirit. 6 He hired also a hundred . 25 Then Jeho'ash the son of Jeho'ahaz took again from Ben-ha'dad the son of Haz'ael the cities which he had taken from Jeho'ahaz his father in war." This injunction is from Exodus 17:14 and Deuteronomy 24:16. the people still sacrificed and burned incense on the high places. 4 But the high places were not removed. and Jacob. Isaac. and he reigned twenty-nine years in Jerusalem. yet not like David his father. and as soon as the man touched the bones of Eli'sha. Amaziah set out to deal with the Edomites and unwisely enlisted Israel’s aid. The acts of resurrection that were tied to Elisha were to point to the fact that God worked through him and it was not the power of Elisha himself. 11:1). "The fathers shall not be put to death for the children. able to handle spear and shield. king of Judah. because of his covenant with Abraham. Ben-ha'dad his son became king in his stead. and he turned toward them. 23 But the LORD was gracious to them and had compassion on them. 21 And as a man was being buried. 2Kings 14:1-22 In the second year of Jo'ash the son of Jo'ahaz. Amazi'ah the son of Jo'ash. Three times Jo'ash defeated him and recovered the cities of Israel. and would not destroy them. 3 And he did what was right in the eyes of the LORD. 22 Now Haz'ael king of Syria oppressed Israel all the days of Jeho'ahaz. 24 When Haz'ael king of Syria died. lo. 6 But he did not put to death the children of the murderers. according to what is written in the book of the law of Moses. 20 So Eli'sha died. as he remained dead for this last example. king of Israel. and set them by fathers' houses under commanders of thousands and of hundreds for all Judah and Benjamin. but now you will strike down Syria only three times. or the children be put to death for the fathers. to happen three times only. began to reign. where the LORD commanded. As related in 2Chronicles 25. 2 He was twenty-five years old when he began to reign. The arrows represented God’s deliverance. but every man shall die for his own sin. and stood on his feet. and they buried him. Now bands of Moabites used to invade the land in the spring of the year. he revived. then you would have struck down Syria until you had made an end of it. He mustered those twenty years old and upward. His mother's name was Jeho-ad'din of Jerusalem. 2Chronicles 25:5-10 Then Amazi'ah assembled the men of Judah. nor has he cast them from his presence until now. a marauding band was seen and the man was cast into the grave of Eli'sha. struck five or six times. (RSV) Jehoash actually regained territory lost to Syria. 5 And as soon as the royal power was firmly in his hand he killed his servants who had slain the king his father. he did in all things as Jo'ash his father had done. and found that they were three hundred thousand picked men. 2Sam. fit for war. In verse 20 we again see that the spring months were the time for war (cf." We now see an incredible miracle performed by God using the dead body of Elisha.

do not let the army of Israel go with you. which is its name to this day. king of Judah. are they not written in the Book of the Chronicles of the Kings of Israel? 16 And Jeho'ash slept with his fathers. for God has power to help or to cast down. 15:10). and he fled to Lachish. and how he fought with Amazi'ah king of Judah. `Give your daughter to my son for a wife'. king of Israel. 15 Now the rest of the acts of Jeho'ash which he did. are they not written in the Book of the Chronicles of the Kings of Judah? 19 And they made a conspiracy against him in Jerusalem. let us look one another in the face. Beth-shemesh (house of the sun. thousand mighty men of valor from Israel for a hundred talents of silver. now Ain Shems) is on the border between Judah and Dan and lies about 15 miles (24 km) west of Jerusalem (Jos. and Jerobo'am his son reigned in his stead. and every man fled to his home. which belongs to Judah. 7 But a man of God came to him and said. and broke down the wall of Jerusalem for four hundred cubits. 18 Now the rest of the deeds of Amazi'ah. to go home again. and returned home in fierce anger. "O king. and his might. and a wild beast of Lebanon passed by and trampled down the thistle. Israel was given the victory over Judah. 17 Amazi'ah the son of Jo'ash. saying. "A thistle on Lebanon sent to a cedar on Lebanon. they were told they had no part in it. from the E'phraim Gate to the Corner Gate. 10 You have indeed smitten Edom. and was buried in Sama'ria with the kings of Israel." 9 And Jeho'ash king of Israel sent word to Amazi'ah king of Judah. just as the Ephraimites or Israelites above had no part in the army of the Lord because of their sins. king of Israel. with all these E'phraimites. also hostages. for why should you provoke trouble so that you fall. (RSV) This is reminiscent of the time when the foreigners in Jerusalem wanted to assist with reconstruction of the Temple under Ezra and Nehemiah. and he was buried in Jerusalem with his fathers in the city . God will cast you down before the enemy. 12 And Judah was defeated by Israel. 14 And he seized all the gold and silver." 9 And Amazi'ah said to the man of God. for the LORD is not with Israel. and called it Jok'the-el. 21:9). and stay at home. Returning to 2Kings 14: 7 He killed ten thousand E'domites in the Valley of Salt and took Sela by storm. 13 And Jeho'ash king of Israel captured Amazi'ah king of Judah. It was one of the cities of the priests (Jos. and your heart has lifted you up. and all the vessels that were found in the house of the LORD and in the treasuries of the king's house. In this instance. and he and Amazi'ah king of Judah faced one another in battle at Beth-she'mesh. Be content with your glory. "The LORD is able to give you much more than this. So Jeho'ash king of Israel went up. And they became very angry with Judah. "But what shall we do about the hundred talents which I have given to the army of Israel?" The man of God answered. the son of Jeho'ash. son of Ahazi'ah. But they sent after him to Lachish. 20 And they brought him upon horses. "Come. son of Jehu. lived fifteen years after the death of Jeho'ash son of Jeho'ahaz. at Beth- she'mesh. saying. 8 Then Amazi'ah sent messengers to Jeho'ash the son of Jeho'ahaz. 8 But if you suppose that in this way you will be strong for war. however. and came to Jerusalem. and he returned to Sama'ria. and slew him there." 10 Then Amazi'ah discharged the army that had come to him from E'phraim. you and Judah with you?" 11 But Amazi'ah would not listen.

although this 30-year period is still at odds with the biblical figure of 41 years (v. began to reign in Sama'ria. 2Kings 14:23-29 In the fifteenth year of Amazi'ah the son of Jo'ash. (RSV) Lachish is the city that would become famous for the historically important Letters written on potsherds during the Babylonian siege. of David. 29). about 785(3)-745(3) is more probable. according to the word of the . In xv. There is some confusion and seeming contradictions in the length of reign ascribed to Jeroboam in the Bible. The chronological data require emending.C. and he reigned forty-one years. 1 "twenty-seventh year" must be changed to "fifteenth.) is now generally abandoned. Jerobo'am the son of Jo'ash. The synchronism in II Kings xiv. beginning as early as 793 BCE. 8. after the king slept with his fathers. 1 following. king of Judah. ‘Jeroboam’) The likely duration of Jeroboam’s reign over Samaria or Israel is ca. Jehoash’s reign lasted sixteen years. This was during the campaigns that led to the capture of Jerusalem and subsequent exile of Judah. who was sixteen years old." while the "forty-one" in xiv. The most reasonable explanation is that Jeroboam was co-regent with his father for about 11 years. this one being the son of Jehoash. 23 agrees with verse 17 preceding. Again. He then ascended the throne over all Israel upon the death of Jehoash. he did not depart from all the sins of Jerobo'am the son of Nebat. Lachish sat on the frontier between Judah and Philistia. which he made Israel to sin.782-753 BCE. 25 He restored the border of Israel from the entrance of Hamath as far as the Sea of the Arabah. and is known today as Tel el-Hesy. and made him king instead of his father Amazi'ah. as the Jewish Encyclopedia points out. king of Israel. He apparently died in peace and was buried in the capital. and perhaps ruling over a portion of his father’s Kingdom. (art. 22 He built Elath and restored it to Judah. 23 should perhaps be "fifty-one." The dating formerly accepted (825-772 B. but does not harmonize with xv. Samaria. Jeroboam II The fourth dynasty begun by Jehu was continued by accession to Israel’s throne of the second king named Jeroboam. 21 And all the people of Judah took Azari'ah. the length of the reign (41 years) cannot be reconciled with xv. 24 And he did what was evil in the sight of the LORD.

2 And he said: "The LORD roars from Zion. and the top of Carmel withers. and utters his voice from Jerusalem. and the people of Syria shall go into exile to Kir. the kings of Israel. the God of Israel. Amos 1:1-5 The words of Amos. (RSV) Damascus and Hamath were both originally part of the Kingdom under Solomon (1Kgs. and there was none to help Israel. Under Jeroboam. . and it shall devour the strongholds of Ben-ha'dad. Significantly. king of Israel. which he saw concerning Israel in the days of Uzzi'ah king of Judah and in the days of Jerobo'am the son of Jo'ash. LORD. many of whose prophecies were to have dual application." 3 Thus says the LORD: "For three transgressions of Damascus. and cut off the inhabitants from the Valley of Aven. he prophesied during the reign of the second Jeroboam. are they not written in the Book of the Chronicles of the Kings of Israel? 29 And Jerobo'am slept with his fathers. which had belonged to Judah. 11:23-25). He was also a contemporary of the prophets Hosea. The story concerning Israel briefly switches to Judah. bond or free. 5 I will break the bar of Damascus. (RSV) Amos (a burden) was originally from Judah. and him that holds the scepter from Beth-eden. 28 Now the rest of the acts of Jerobo'am. 4 So I will send a fire upon the house of Haz'ael. who was from Gath-he'pher. for there was none left." says the LORD. I will not revoke the punishment. the first having been the originator of serious idolatry in Israel. Israel was able to move across the Jordan again and extend its territory as far north as the border with Syria. but with relevance to the Northern Kingdom. Isaiah. both within a relatively short period of their own time and in the Last Days. and all that he did. The prophet Amos had much to say during this period of Israel’s history. and Zechari'ah his son reigned in his stead. because they have threshed Gilead with threshing sledges of iron. who was among the shepherds of Teko'a. how he fought. Jonah and Micah. however. so he saved them by the hand of Jerobo'am the son of Jo'ash. Damascus was later lost to King Rezin of Syria (1Kgs. however. and his might. which he spoke by his servant Jonah the son of Amit'tai. 26 For the LORD saw that the affliction of Israel was very bitter. 4:21). the pastures of the shepherds mourn. and for four. two years before the earthquake. The Sea of the Arabah (meaning plain) is the same as the Salt (Dead) Sea. most of his ministry was to the Northern Kingdom in the period of about 765-755 BCE. the prophet. 27 But the LORD had not said that he would blot out the name of Israel from under heaven. and how he recovered for Israel Damascus and Hamath.

2Kings 15:1-7 In the twenty-seventh year of Jerobo'am king of Israel Azari'ah the son of
Amazi'ah, king of Judah, began to reign. 2 He was sixteen years old when he began to reign,
and he reigned fifty-two years in Jerusalem. His mother's name was Jecoli'ah of Jerusalem. 3
And he did what was right in the eyes of the LORD, according to all that his father Amazi'ah
had done. 4 Nevertheless the high places were not taken away; the people still sacrificed and
burned incense on the high places. 5 And the LORD smote the king, so that he was a leper to
the day of his death, and he dwelt in a separate house. And Jotham the king's son was over the
household, governing the people of the land. 6 Now the rest of the acts of Azari'ah, and all that
he did, are they not written in the Book of the Chronicles of the Kings of Judah? 7 And
Azari'ah slept with his fathers, and they buried him with his fathers in the city of David, and
Jotham his son reigned in his stead. (RSV)

Bullinger says of King Jotham of Judah:

The first-named of the four kings in whose reign Isaiah prophesied (Isa. 1:1). Micah also
began to prophesy and mourn over the coming dispersion of Israel (Comp. Bible).

Jeroboam II was on the throne during a period of about fifty years when both Israel and Judah
enjoyed relative stability and prosperity. This came at a great price, however, for the people
soon forgot their God when they grew fat, just as Moses had warned (Deut. 31:20).

Zechariah

The fifteenth king of Israel was Zechariah (Jehovah remembers), son of Jeroboam. He reigned for
only six months and was murdered by Shallum who succeeded him.

2Kings 15:8-12 In the thirty-eighth year of Azari'ah king of Judah Zechari'ah the son of
Jerobo'am reigned over Israel in Sama'ria six months. 9 And he did what was evil in the sight
of the LORD, as his fathers had done. He did not depart from the sins of Jerobo'am the son of
Nebat, which he made Israel to sin. 10 Shallum the son of Jabesh conspired against him, and
struck him down at Ibleam [or before the people: KJV], and killed him, and reigned in his
stead. 11 Now the rest of the deeds of Zechari'ah, behold, they are written in the Book of the
Chronicles of the Kings of Israel. 12 (This was the promise of the LORD which he gave to
Jehu, "Your sons shall sit upon the throne of Israel to the fourth generation." And so it came to
pass.) (RSV)

Zechariah was the fourth generation from Jehu (v. 12), whose dynasty ended there as
prophesied.

Shallum

Shallum (retribution), the son of Jabesh, began the second shortest reign of all the kings of Israel,
possibly as a result of ending Jehu’s dynasty by conspiring against and then killing the
incumbent, Zechariah.

2Kings 15:13-15 Shallum the son of Jabesh began to reign in the thirty-ninth year of Uzzi'ah
king of Judah, and he reigned one month in Sama'ria. 14 Then Men'ahem the son of Gadi came
up from Tirzah and came to Sama'ria, and he struck down Shallum the son of Jabesh in
Sama'ria and slew him, and reigned in his stead. 15 Now the rest of the deeds of Shallum, and
the conspiracy which he made, behold, they are written in the Book of the Chronicles of the
Kings of Israel. (RSV)

Shallum reigned for a single month before being killed by Menahem. He thus became a giver and
receiver of what was possibly divine, and certainly swift, retribution.

Menahem

Menahem (meaning comforter!), the seventeenth king of Israel who began the 5th dynasty, was a
violent and merciless man (v. 16). He had slain his predecessor Shallum and taken the crown.

2Kings 15:16-22 At that time Men'ahem sacked Tappuah and all who were in it and its
territory from Tirzah on; because they did not open it to him, therefore he sacked it, and he
ripped up all the women in it who were with child.

The city of Tappuah, which Menahem sacked, was on the border between Ephraim and
Manasseh (Jos. 17:8).

17
In the thirty-ninth year of Azari'ah king of Judah Men'ahem the son of Gadi began to reign
over Israel, and he reigned ten years in Sama'ria. 18 And he did what was evil in the sight of
the LORD; he did not depart all his days from all the sins of Jerobo'am the son of Nebat,
which he made Israel to sin. 19 Pul the king of Assyria came against the land; and Men'ahem
gave Pul a thousand talents of silver, that he might help him to confirm his hold of the royal
power. 20 Men'ahem exacted the money from Israel, that is, from all the wealthy men, fifty
shekels of silver from every man, to give to the king of Assyria. So the king of Assyria turned
back, and did not stay there in the land.

This is the first recorded invasion of the Northern Kingdom by the Assyrians under King Tiglath-
pileser III, or Pul, referred to as God’s “razor” in Isaiah 7:20. In this case he demanded only
tribute of Israel. As with the Syrians earlier, no land was occupied and no one was taken into
captivity. That would come much later.

The biblical account tallies with a record in the Annals of Tiglath-pileser, which reads succinctly:
“I received tribute from Menahem of Samaria.” Werner Keller suggest there were probably
60,000 wealthy men in Israel at the time, so quite a substantial sum was raised to buy off the

Assyrians. The obvious danger was in not knowing how long they would be prepared to demand
only the riches of Israel.

21
Now the rest of the deeds of Men'ahem, and all that he did, are they not written in the Book
of the Chronicles of the Kings of Israel? 22 And Men'ahem slept with his fathers, and
Pekahi'ah his son reigned in his stead. (RSV)

Menahem thus appears to have been the only king of this turbulent period to have died a
natural death. He reigned for 10 years and was a contemporary of the prophets Hosea and
Amos.

Pekahiah

Menahem’s son Pekahiah was next to ascend the throne of Israel. While Azariah was enjoying
his Jubilee year as king of Judah, the rapid turnover of kings on the throne of Israel continued. It
seems the first Jeroboam had a lot to answer for as the ‘original and worst’, his name being
constantly raised as the one who led Israel into sin and idolatry – and from which it never
recovered.

2Kings 15:23-26 In the fiftieth year of Azari'ah king of Judah Pekahi'ah the son of Men'ahem
began to reign over Israel in Sama'ria, and he reigned two years. 24 And he did what was evil
in the sight of the LORD; he did not turn away from the sins of Jerobo'am the son of Nebat,
which he made Israel to sin. 25 And Pekah the son of Remali'ah, his captain, conspired against
him with fifty men of the Gileadites, and slew him in Sama'ria, in the citadel of the king's
house; he slew him, and reigned in his stead. 26 Now the rest of the deeds of Pekahi'ah, and all
that he did, behold, they are written in the Book of the Chronicles of the Kings of Israel.
(RSV)

Pekahiah’s was killed by his successor Pekah, his reign having lasted only 2 years.

Pekah

The nineteenth and penultimate king of Israel was Pekah, son of Remaliah. He was an army
officer and possibly the chief bodyguard and advisor to King Pekahiah. It seems that the regicide
he committed with the 50 men from Gilead against Pekahiah was also to have severe
repercussions, albeit many years later. Unwisely, he had made a pact with King Rezin of Syria
against Assyria.

2Kings 15:27-38 In the fifty-second year of Azari'ah king of Judah Pekah the son of
Remali'ah began to reign over Israel in Sama'ria, and reigned twenty years. 28 And he did what

was evil in the sight of the LORD; he did not depart from the sins of Jerobo'am the son of
Nebat, which he made Israel to sin. 29 In the days of Pekah king of Israel Tig'lath-pile'ser king
of Assyria came and captured I'jon, A'bel-beth-ma'acah, Jan-o'ah, Kedesh, Hazor, Gilead, and
Galilee, all the land of Naph'tali; and he carried the people captive to Assyria.

This was actually the second recorded invasion of Israel by the Assyrians under Tiglath-pileser III,
but with a completely different emphasis than the first, which was about eight years earlier. It
was attested in the Annals of Tiglath-pileser, in particular the one describing his Western and
Gaza/Damascus Campaign of ca. 734-733 BCE, as follows:

Bit Humri [House of Omri, i.e. Israel]: all of whose cities I had added to my territories on my
former campaigns, and I had left out only the city of Samaria. … The whole of Naphtali I took
for Assyria. I put my officials over them as governors. The land of Bit Humri, all its people
and their possessions I took away to Assyria.

The land of Naphtali was one of the richest in Palestine, and Josephus spoke of it as being the
“ambition of nature” or a type of paradise on Earth. It had close commercial and social
connections with Phoenicia; for example, Hiram the master metal-smith in Solomon's time was
half-Tyrian, half-Naphtalite (1Kgs. 7:13-14).

The Assyrians had swept down the coast to Phoenicia, before turning south-east and heading
directly towards the Sea of Chinnereth (Galilee). They overran the northern half of Asher, and
the territories of Naphtali and Dan. The army then crossed the Jordan into Gilead, mopping up
the eastern Manassites and Gadites, then the Reubenites to the south. 1Chronicles 5:26 makes
only a briefly mention of what must have been a major campaign.

1Chronicles 5:26 So the God of Israel stirred up the spirit of Pul king of Assyria, the spirit of
Til'gath-pilne'ser king of Assyria, and he carried them away, namely, the Reubenites, the
Gadites, and the half-tribe of Manas'seh, and brought them to Halah, Habor, Hara, and the
river Gozan, to this day. (RSV)

The first deportation of the tribes on the eastern side of the Jordan (i.e. those that had settled
first in their inheritance) into Halah and Habor occurred in about 741 BCE. Thus we see the
territory administered by Pekah getting rapidly smaller. Eventually, only the capital city of
Samaria was to be left to Hoshea, the last king of Israel.

30
Then Hoshe'a the son of Elah made a conspiracy against Pekah the son of Remali'ah, and
struck him down, and slew him, and reigned in his stead, in the twentieth year of Jotham the
son of Uzzi'ah. 31 Now the rest of the acts of Pekah, and all that he did, behold, they are
written in the Book of the Chronicles of the Kings of Israel. 32 In the second year of Pekah the

son of Remali'ah, king of Israel, Jotham the son of Uzzi'ah, king of Judah, began to reign. 33
He was twenty-five years old when he began to reign, and he reigned sixteen years in
Jerusalem. His mother's name was Jeru'sha the daughter of Zadok. 34 And he did what was
right in the eyes of the LORD, according to all that his father Uzzi'ah had done. 35
Nevertheless the high places were not removed; the people still sacrificed and burned incense
on the high places. He built the upper gate of the house of the LORD. 36 Now the rest of the
acts of Jotham, and all that he did, are they not written in the Book of the Chronicles of the
Kings of Judah? 37 In those days the LORD began to send Rezin the king of Syria and Pekah
the son of Remali'ah against Judah. 38 Jotham slept with his fathers, and was buried with his
fathers in the city of David his father; and Ahaz his son reigned in his stead. (RSV)

We see in 2Chronicles 28 that Pekah is used to rebuke Judah for its idolatry

2Chronicles 28:5b-20 He was also given into the hand of the king of Israel, who defeated him
with great slaughter. 6 For Pekah the son of Remali'ah slew a hundred and twenty thousand in
Judah in one day, all of them men of valor, because they had forsaken the LORD, the God of
their fathers. 7 And Zichri, a mighty man of E'phraim, slew Ma-asei'ah the king's son and
Azri'kam the commander of the palace and Elka'nah the next in authority to the king. 8 The
men of Israel took captive two hundred thousand of their kinsfolk, women, sons, and
daughters; they also took much spoil from them and brought the spoil to Sama'ria. 9 But a
prophet of the LORD was there, whose name was Oded; and he went out to meet the army
that came to Sama'ria, and said to them, "Behold, because the LORD, the God of your fathers,
was angry with Judah, he gave them into your hand, but you have slain them in a rage which
has reached up to heaven. 10 And now you intend to subjugate the people of Judah and
Jerusalem, male and female, as your slaves. Have you not sins of your own against the LORD
your God?

Flushed with the success God had given them in the battle, the Israelites were about to enslave
the captives of Judah (still described as their kinfolk), until the prophet Oded intervened to
remind them of their own less-than-sinless behaviour (cf. Jn. 8:7).

11
Now hear me, and send back the captives from your kinsfolk whom you have taken, for the
fierce wrath of the LORD is upon you." 12 Certain chiefs also of the men of E'phraim, Azari'ah
the son of Joha'nan, Berechi'ah the son of Meshil'lemoth, Jehizki'ah the son of Shallum, and
Ama'sa the son of Hadlai, stood up against those who were coming from the war, 13 and said
to them, "You shall not bring the captives in here, for you propose to bring upon us guilt
against the LORD in addition to our present sins and guilt. For our guilt is already great, and
there is fierce wrath against Israel." 14 So the armed men left the captives and the spoil before
the princes and all the assembly. 15 And the men who have been mentioned by name rose and
took the captives, and with the spoil they clothed all that were naked among them; they
clothed them, gave them sandals, provided them with food and drink, and anointed them; and
carrying all the feeble among them on asses, they brought them to their kinsfolk at Jericho, the
city of palm trees. Then they returned to Sama'ria.

(RSV) Again the Assyrians were used as God’s instrument of punishment. 5 Because Syria. king of Judah. you and She'ar-jash'ub your son. Ahaz still didn’t put his trust in God. 20 So Til'gath-pilne'ser king of Assyria came against him. in the form of the Assyrian king (2Kgs. saying. And he did not do what was right in the eyes of the LORD his God. Isaiah 7:1-9 In the days of Ahaz the son of Jotham. before sending them to Jericho. 2 Ahaz was twenty years old when he began to reign. and under every green tree.). and the head of Damascus is Rezin. 16:1ff. 6 "Let us go up against Judah and terrify it. If you will not believe." his heart and the heart of his people shook as the trees of the forest shake before the wind. 2Kings 16:1-5 In the seventeenth year of Pekah the son of Remali'ah. "Go forth to meet Ahaz. began to reign. Judah’s troubles were not over. therefore the chieftains of Ephraim wisely had the captives clothed and fed and their wounds dressed. Gede'roth. Even so. 17 For the E'domites had again invaded and defeated Judah. 4 and say to him. "Syria is in league with E'phraim. 2 When the house of David was told. Rezin the king of Syria and Pekah the son of Remali'ah the king of Israel came up to Jerusalem to wage war against it. and set up the son of Ta'be-el as king in the midst of it. Judah. and afflicted him instead of strengthening him. He even burned his son as an offering. and they settled there. and the head of Sama'ria is the son of Remali'ah. just as Hoshea of Israel was to run to Egypt for support against Assyria (see below). 8 For the head of Syria is Damascus. (Within sixty-five years E'phraim will be broken to pieces so that it will no longer be a people. according to the abominable practices of the nations whom the LORD drove out before the people of Israel. 4 And he sacrificed and burned incense on the high places. and carried away captives. 16 At that time King Ahaz sent to the king of Assyria for help. for he had dealt wantonly in Judah and had been faithless to the LORD. Ai'jalon. king of Judah. Soco with its villages. at the fierce anger of Rezin and Syria and the son of Remali'ah. has devised evil against you. and Gimzo with its villages." 7 thus says the Lord GOD: It shall not stand. with E'phraim and the son of Remali'ah. 19 For the LORD brought Judah low because of Ahaz king of Israel. Timnah with its villages. son of Uzzi'ah. 3 but he walked in the way of the kings of Israel. and do not let your heart be faint because of these two smoldering stumps of firebrands. 3 And the LORD said to Isaiah. at the end of the conduit of the upper pool on the highway to the Fuller's Field. and on the hills. surely you shall not be established. do not fear. 18 And the Philistines had made raids on the cities in the Shephe'lah and the Negeb of Judah.'" (RSV) In spite of Isaiah’s prophecy that the Israel/Syria alliance would not succeed against Judah. but they could not conquer it. 5 Then Rezin king of Syria and . Ahaz the son of Jotham. and he reigned sixteen years in Jerusalem. and had taken Beth-she'mesh. and let us conquer it for ourselves.) 9 And the head of E'phraim is Sama'ria. `Take heed. be quiet. and it shall not come to pass. as his father David had done.The Israelites were in imminent danger of incurring God’s wrath. this time against their former allies. He showed weakness by ‘supping with the devil’ as it were.

king of Israel.(Ye-) had been removed as a sign of God’s disfavour (see the paper Genealogy of the Messiah (No. an explanation that has some plausibility. it was the beginning of general anarchy in Israel. It appears Hoshea also did evil in God’s sight but not to the same degree as Ahab and other idolatrous kings. hence there is a reasonable concurrence with the accepted dates. son of Nun. and they besieged Ahaz but could not conquer him. From the Annals of the Gaza/Damascus campaign of Tiglath-pileser. with Pekah as king. with the succession of Hoshea in 731 BCE.” The name Hoshea (meaning salvation or deliverer) was part of the name given to Joshua. it appears that Hoshea was merely a puppet ruler and Israel a vassal province of Assyria. 27) to have been twenty years. Pekahiah may have innocently accepted the offer and have thus given Pekah the long-wished-for opportunity to become king of all Israel. Shallum reigned a short time in Samaria. We see also that King Jeconiah of Judah became plain Coniah after the divine prefix Je. Such an explanation would account for the round number of twenty years of kingship (750-731). Hoshea Unbeknown to Hoshea when he acceded to the throne. Also. When Zechariah. . the son of Jeroboam II. but east of the Jordan Pekah and his Gileadite followers assumed independence. and to Messiah: YaHoshua (SHD 3091: Jehovah is salvation) indicating that God was with him. 119)). The same could not be said of King Hoshea. According to the Chronology of the Kings of Israel (Table 1. (RSV) There is more confusion regarding the actual regnal years of King Pekah. At the accession of Pekahiah. Pekah and his valiant followers may have offered their services to the king at Samaria. the twenty years of kingship was perhaps 751-731 BCE. The length of Pekah's reign is stated (II Kings xv. was slain by Shallum. This extent is impossible if reckoned from the usurpation of Pekahiah's throne (736) to the succession of Hoshea (733-31). Pekah the son of Remali'ah. came up to wage war on Jerusalem. That was about 750 or 751. ‘Pekah’) provides a possible explanation. the usurpation of Pekahiah’s throne by Pekah was probably in 740 rather than in 736. The Annals state: “They overthrew Pekah their king and I made Hoshea to be king over them. he would be the twentieth and last of a far from illustrious line of kings of Israel. who was almost an antitype of Messiah by effectively leading his people into captivity. The Jewish Encyclopedia (art. however. appended). There is.

the inhabitants were taken into captivity and exiled. named variously So. Sargon II (the king of Assyria in v. and on the Habor. the Assyrians. He was supposedly blinded (see art. captured the city and.) with a view to avoiding the heavy annual tribute imposed by Assyria. and paid him tribute. the river of Gozan. It was to be Hoshea’s last mistake. and bound him in prison. Shalmaneser died unexpectedly during the first year of the siege of Samaria. and he carried the Israelites away to Assyria. yet not as the kings of Israel who were before him. His successor. perhaps in a spirit of ‘divide and rule’. Sargon claimed in his Annals: “I besieged and conquered Samaria … I led away into captivity 27. was found to be a broken reed to Israel (cf. in particular. Jew. however. 36:6). 2Kings 17:1-6 In the twelfth year of Ahaz king of Judah Hoshe'a the son of Elah began to reign in Sama'ria over Israel. for he had sent messengers to So. together with many of the remnant of Israelite tribes west of the Jordan. Unfortunately for Hoshea. 2 And he did what was evil in the sight of the LORD. This time. therefore the king of Assyria shut him up. and offered no tribute to the king of Assyria. if this were so.290 people who lived there. Isa. Tiglath-pileser. had also transported the northerners and easterners of Israel to the cities of Assyria. 9. Egypt. Jews. and placed them in Halah. 5 Then the king of Assyria invaded all the land and came to Sama'ria. and Hoshe'a became his vassal. Bk.” Josephus states that it was Shalmaneser himself who arranged the deportations (Antiq. and he reigned nine years. and these were a rebellious people after all. or Pul. (RSV) As recorded in 1Chronicles 5:26. 4 But the king of Assyria found treachery in Hoshe'a.) and imprisoned at Shalmaneser’s behest. however. . however. king of Egypt. Sewe or Sib’e (Assyr. ‘Hoshea’. 13) by assuming that the “king of Assyria” was the same person in verses 3. which fell to Sargon. 5 and 6 above. Halah and Hazor. 3 Against him came up Shalmane'ser king of Assyria. as he had done year by year. Encyc. 6 In the ninth year of Hoshe'a the king of Assyria captured Sama'ria. It wouldn’t have made sense to leave them among their previously-exiled brethren in the Assyrian cities to plot rebellion. and in the cities of the Medes. Shalmaneser V (reigned 726-722 BCE) discovered that he had been seeking assistance from a Pharaoh. these could only have been Israelites deported from the area surrounding Samaria and not from the capital itself. and for three years he besieged it. 6). also sent some of the latest contingent farther east into the cities of Media.

Reasons for the Captivity and Exile Second Kings gives a comprehensive list of reasons for Israel’s captivity and exile. from Dan to Beersheba (v. there were still some original inhabitants left in the land after Sargon’s deportations. who had brought them up out of the land of Egypt from under the hand of Pharaoh king of Egypt. from watchtower to fortified city. The people were reminded that their forebears had been taken out of bondage in Egypt but had quickly returned to the worship of pagan gods.Sargon II was the “tartan” (turtaanu: commander-in-chief) of Shalmaneser’s army and supposedly seized the throne of Assyria around the time of the siege of Samaria. 31). It was an intolerable situation that could only be remedied by enslavement once again. 726-697) in Jerusalem (see The Seven Great Passovers of the Bible (No. 11 and there they burned incense on all the high places. They preferred to have gods they could see with their eyes and touch with their hands – their golden calves. This was to be the third and final invasion directed primarily at the Northern Kingdom. is a summary of all that had happened to Israel. however. 2Kings 17:7-23 And this was so. In 2Chronicles 30. basically. And they did wicked things. their Asherah pillars and their Baals – rather than walking by faith before an invisible God Most High as the Patriarch Abraham had done and for which he was honoured and blessed. The northern tribes of Israel had followed their first king Jeroboam just as eagerly into idolatrous worship as their ancestors under Moses had done. 10 they set up for themselves pillars and Ashe'rim on every high hill and under every green tree. However. 9 And the people of Israel did secretly against the LORD their God things that were not right. as noted from their attendance at the fourth Great Passover called by King Hezekiah (who reigned ca. they proved ungrateful for the salvation afforded by their God. because the people of Israel had sinned against the LORD their God. 107)). Thus ended the reigns of 20 kings and 5 dynasties in the Northern Kingdom of Israel. 5). provoking the . only those of Asher. Hezekiah followed this up with a wholesale destruction of the Baal system throughout Israel (2Chr. Manasseh and Zebulun responded positively (v. and in the customs which the kings of Israel had introduced. as the nations did whom the LORD carried away before them. They built for themselves high places at all their towns. and had feared other gods 8 and walked in the customs of the nations whom the LORD drove out before the people of Israel. 11). 2Kings 17:7ff. we see that Hezekiah called all Israel.

and worshiped all the host of heaven. 17 And they burned their sons and their daughters as offerings. 15 They despised his statutes. and afflicted them. Micaiah. concerning whom the LORD had commanded them that they should not do like them. they did not depart from them. So Israel was exiled from their own land to Assyria until this day. LORD to anger. of which the LORD had said to them. Amos 9:9-10 “For lo. 22 The people of Israel walked in all the sins which Jerobo'am did. ‘Evil shall not overtake or meet us. but were stubborn. (RSV) The punishment for their persistent idolatrous practices was to be banished from the land of Israel. 19 Judah also did not keep the commandments of the LORD their God. and gave them into the hand of spoilers. and served Ba'al. and they followed the nations that were round about them. Israel could not say it wasn’t warned by God of the calamities to come as a direct result of its sins. "You shall not do this. and shake the house of Israel among all the nations as one shakes with a sieve. 18 Therefore the LORD was very angry with Israel. many of whom were contemporaneous. and sold themselves to do evil in the sight of the LORD. therefore. I will command." There were a total of nine prophets in the Northern Kingdom of Israel: Ahijah. Jonah. in accordance with all the law which I commanded your fathers. Oded. and his covenant that he made with their fathers. and used divination and sorcery. and removed them out of his sight. Elijah. who did not believe in the LORD their God. 10 All the sinners of my people shall die by the sword. and made for themselves molten images of two calves.’” (RSV) . Jehu (son of Hanani). 7:15) as a representative of all the northern tribes. 23 until the LORD removed Israel out of his sight. Jeremiah reminded them of what had happened to Ephraim (Jer. saying. Amos. and became false. 14 But they would not listen. The prophet Amos predicted the subsequent dispersal of the people of Israel throughout the world – including the self-satisfied and arrogant. 12 and they served idols. and Hosea. but no pebble [grain: KJV] shall fall upon the earth. and the warnings which he gave them. They went after false idols. provoking him to anger. who say. When speaking to Judah. or those who considered themselves immune. Isaiah had foretold something similar in Isaiah 7:8. 20 And the LORD rejected all the descendants of Israel. "Turn from your evil ways and keep my commandments and my statutes. none was left but the tribe of Judah only." 13 Yet the LORD warned Israel and Judah by every prophet and every seer. Elisha. 21 When he had torn Israel from the house of David they made Jerobo'am the son of Nebat king. 16 And they forsook all the commandments of the LORD their God. until he had cast them out of his sight. and they made an Ashe'rah. as their fathers had been. as he had spoken by all his servants the prophets. and which I sent to you by my servants the prophets. And Jerobo'am drove Israel from following the LORD and made them commit great sin. but walked in the customs which Israel had introduced.

Babylonians. KJV).Resettlement and future of Israel 2Kings 17:24-41 And the king of Assyria brought people from Babylon. Sippar sa Samas (the sun-god) and Sippar sa Anuituv. It was an effective means of keeping their vassal state of Samaria in bondage. The two Sippars in Babylonia. An equally diverse contingent was later sent into Israel by Asnapper (Osnappar) or Ashurbani- pal. Susanchites and Tarpelites (Ezra 4:9-10. They were thus the early administrators and couriers. Bullinger’s note to verse 24 details the areas from which the new residents of Israel were brought: Cuthah. By bringing disparate peoples into Israel. The Assyrians showed their typical astuteness. Elamites. Sepharvaim (Dual). Dehavites. Apharsites. Israel’s captivity and deportation was to be followed almost 50 years later by that of her sister Judah. and Sephar-va'im. Archevites.15. Cuthah. he removed many of the remaining Israelites from Samaria and replaced them with more foreigners. . Ava = either the Ivah of 18. Its use in Ezra 4:9 is connected with the Old Persian from frestak meaning messenger. Hamath. and dwelt in its cities. they realised it would take generations (if ever) for them to coalesce and provide any serious opposition. Ten miles north-east of Babylon. The one in Syria. The word Apharsathchites is a Persian loan word denoting a judicial official connected with the Old Persian frasaka.34. The cuneiform is iprasakku. Hamath. Avva. hence rebellion could be minimised for a long time. or the Ahava of Ezra 8. 676 BCE. In the first year of Sargon there was war between Cuthah and Babylon. These were the Apharsathchites. Dinaites. and the people of Cuthah were transported to Syria and Palestine. son of Esar-haddon. indicating an investigator. and placed them in the cities of Sama'ria instead of the people of Israel. and they took possession of Sama'ria. During the Assyrian Esar-haddon’s campaign against Judah in ca.

Herodotus and Josephus describe them briefly (cf. which was the usual Assyrian practice of sending captives to the opposite ends of the empire. Tarpelites is a rendering of an Aramaic word which is translated in the LXX as tarphallaioi and the Vulgate Terphalaei.. Tibarenes. 1. or sons of Tubal. or from the Persian tarapara meaning beyond the River referring to Syrians west of the Euphrates. However. Susanchites are natives of Susa in Persia. the vast extent of the dispersal of the Israelites beyond the Araxes into Parthia and Scythia and into Media and northern Persia does not exclude the first meaning. ibid. Dinaites are mentioned often in the Aramaic papyri and they are judges.. Vol. . 7). Vol. 749-50). Seleucia. The inhabitants there were sons of Keturah called Arabs. It is an official title and is rendered as such in the LXX (Lucianic Recensions). They were identified by Herodotus (I. The resettlement of Israel to the north might well lend credence to the northern captives being sent to the south. Tubal would account for the Japhethite YDNA R in the area. Dict. p. p.Apharsites are identified as a section of Persians (RSV) or undefined Gentilic (see Interp. Elamites are Semitic Persians to the east of the Medes. Dehavites are part of the group that signed the letter to Artaxerxes to stop the rebuilding of Jerusalem. Apamea. 1. 156). as the original inhabitants of Edessa became part of the Parthian Empire and one of its mints. have been suggested along with men of the Tetrapolis. They are thus a Semitic people as well. 844). These judges also wrote to Artaxerxes (Ezra 4:9).. 25) as the Daoi. 1. The Interpreter’s Dictionary of the Bible thinks that the word is dihu and should be read as the men of Susa and that the mispointing created a new tribe. Interp. the Akkadian Uruk or Erech. Schnell. which includes Antioch. pp. Babylonians are obviously the citizens of Babylon before it was split from the Assyrian Empire. It is either a professional name or a tribal name and various meanings have been suggested. Dict. If they come from southern Anatolia in what is now Turkey they may be Arabs. which were a Persian tribe that lived on the shores of the Caspian Sea (Strabo XI. Archevites are the Aramaic Khetibh. and Laodicea (following Strabo XVI.

These foreigners wanted to help with the rebuilding of the Temple under Ezra and Nehemiah. but their hearts . There are now only some 700 left still following the Calendar of Jeroboam and always placing the New Year after 25 March. although some were undoubtedly true Israelites as we now know from the YDNA tests done on the Samaritan families.The R1b YDNA comes directly from the Hittite alliance." (RSV) Here is direct evidence that these people didn’t consider themselves true Israelites. Jacobsen Interp. god of the cult of the dead. Medes are sons of Madai son of Japheth and their homeland is on the mountain country north of Babylon and north-west of Persia. and the Cutheans brought the cult with them to Palestine (cf. for we worship your God as you do. During the Byzantine Empire the vast numbers that inhabited Samaria of the Samaritans were slaughtered systematically by the Byzantine emperors on an ongoing basis because of constant rebellion. 752). They knew their own history (as did the Samaritan woman to whom Christ spoke: Jn. and we have been sacrificing to him ever since the days of E'sar-had'don king of Assyria who brought us here. The operation to replace many of the remaining Israelites in Samaria (not just the capital) may have fulfilled the prophecy of Isaiah 7:8 concerning the 65 years of Ephraim. p. 4:7ff. rather it was left largely empty until the Jews and other tribes returned from captivity 70 years later. 2 they approached Zerub'babel and the heads of fathers' houses and said to them. god of the underworld. Cutheans are Cutha or Kuthu from the city of that name north-east of Babylon at Tell Ibrahim. The mtDNA I haplogroup is prevalent there among the Kurds and in Italy where the sons of Aeneas went after the fall of Troy with a band of the Riphathian Celts of Troy and founded Rome. 1. That group is also present but rare in Britain and in some Egyptians and others in the Middle East. These are the people who became known in NT times as the Samaritans. the God of Israel. "Let us build with you. having close relationship with some Jews. This practice is a great clue to the location of the Israelites before the mid-eighteenth century when the Gregorian calendar was adopted. Dict. Judah itself was never replanted with Gentiles. Ezra spoke of a time following the return from this last captivity. Ezra 4:1-2 Now when the adversaries of Judah and Benjamin heard that the returned exiles were building a temple to the LORD. It would explain the reincarnation aspects of the religion of the Druze and the views of some rabbis in Jerusalem today. that their forebears had been planted in the land by Esar-haddon.. i. It was famous for the cult of Nergal.e. who had conducted the fifth major Assyrian invasion of Palestine (his predecessor Sennacherib had also invaded). Nergal might be identified with Mormo. from 741 to 676 BCE. Vol.).

as the word used for Lord throughout is Yahovah rather than Baal. they are killing them. hence the ‘god of the land (of Israel)’ is Yahovah Elohim. "The nations which you have carried away and placed in the cities of Sama'ria do not know the law of the god of the land. as it seems they were more interested in maintaining social harmony and efficient administration (for which they were renowned) of their vassal states than in eliminating other religions or even restricting their practices. and teach them the law of the god of the land. the land beyond the Jordan. but in the latter time he will make glorious the way of the sea. 26 So the king of Assyria was told. and behold. ." 27 Then the king of Assyria commanded. therefore the LORD sent lions among them. The term god in verses 26 and 27 is Elohim. Galilee of the nations. implicit in the second fulfilment of the dual prophecy. therefore he has sent lions among them. they did not fear the LORD. 27). and was the same area (known then as Galilee of the nations) to which Christ went prior to his crucifixion following his rejection by Judah. where we have the Assyrian king arranging for a priest to return from captivity in order to instruct the foreigners occupying Samaria about the God of Israel. because they do not know the law of the god of the land. Continuing with 2Kings 17: 25 And at the beginning of their dwelling there. In the former time he brought into contempt the land of Zeb'ulun and the land of Naph'tali. It was the first recorded case of someone from Israel (possibly a Levite) preaching to the Gentiles. 250)). Isaiah 9:1 But there will be no gloom for her that was in anguish. (RSV) We saw in the reign of Pekah that Naphtali was the first tribe of Israel to go into captivity. "Send there one of the priests whom you carried away thence. hence being brought into contempt. Bullinger says that the priest here is: ‘An idolatrous Israelite priest from Samaria’ (note to v. A rather remarkable situation. this may be incorrect. however.weren’t right." 28 So one of the priests whom they had carried away from Sama'ria came and dwelt in Bethel. Isaiah 9:1-7 talks about the establishment of God’s Kingdom under Messiah and. and taught them how they should fear the LORD. basically Zebulun and Naphtali. and let him go and dwell there. as Ezra could discern (see the paper Reading the Law with Ezra and Nehemiah (No. is something positive for Galilee. in these Latter Days. or the Angel of Great Counsel. which killed some of them. which occurred during Isaiah’s lifetime. This gesture by the Assyrians was probably done for purely pragmatic reasons.

‘Halah’. and put them in the shrines of the high places which the Samaritans had made. every nation in the cities in which they dwelt. (RSV) This place of exile called Sepharad (appropriately meaning separated) is probably to be identified as Sardis. 2. the men of Cuth[ah] made Nergal. Josiah’s missionary-type activity could also have relevance to these Last Days. See the paper Josiah’s Restoration (No. The term all Israel in verse 3 hints that there were remnants of the original tribes extant. ibid. The prophet Obadiah spoke of a time when the exiles would be returned to the Promised Land from Halah (cf. 1Chronicles 5:26 deals with Pul’s or Tiglath-pileser’s exiling of Israelites to Halah. as had been originally intended. Obadiah 1:20 The exiles in Halah who are of the people of Israel shall possess Phoenicia as far as Zar'ephath. 5:26). Josiah also took his campaign of removing idolatry from his own land into Samaria (2Chr. The RSV in Obadiah 1:20 reads the exiles in Halah for what is termed the exiles of this host (see also Gordon Interp. and the exiles of Jerusalem who are in Sephar'ad shall possess the cities of the Negeb. Good King Josiah of Judah instituted the fifth Great Passover as recorded in 2Chronicles 35 (see The Seven Great Passovers of the Bible (No.It is noteworthy that the men of Naphtali (plus Asher and Manasseh) assisted Gideon against the Midianites (Jdg. the men of Hamath made . with reference again to Samaria: 29 But every nation still made gods of its own. 1Chr. 512). Dict. 245). An Aramaic inscription has been found at Sardis itself in a bilingual inscription of the name and it is identical with the text used in Obadiah. 34:33). Vol. 18:11).. Continuing in 2Kings 17. capital of Lydia in Asia Minor. whereby Judah may be called upon to take the message of salvation to the Gentiles. Halah is an unknown site in the Assyrian Empire or kingdom to which some of the Kingdom of Israel were deported by Shalmaneser in the ninth year of King Hosea (2Kgs. p.. 107)). which was inhabited largely by Gentiles. 7:23) – again with possible end-time connotations. 30 the men of Babylon made Suc'coth-be'noth. The meaning is that Judah shall be returned and inhabit the south to the Negeb and Israel will return and inhabit Phoenicia between Tyre and within six miles from Sidon. 17:6. art.

22. Isa. Adram Melech and Anam Melech. Ashi'ma. This was the ancient northern border of Israel. 19:37.22).20. Nergal we have explained earlier. there is no known Assyrian interpretation of the name.2. 17:31). . cf. 1. In his note to verse 30. 31 and the Av'vites made Nibhaz and Tartak. 2:23. Thus (according to the language of the O. The more modern term for her is Dercato and the fish was held sacred to her and is the origin of the fish symbol attributed to Christianity and the origin of eating fish as a religious symbol. Isa. may be a corruption of a Canaanite goddess worshipped in Syria on the Orontes River at Hamath (now Nahr el Asi). p.23. the Venus Star. p. However.515) says of these five nations: Each brought its own gods. Interp. on the other hand. Vol. The name Tartuk is unknown but appears to be a corruption of Atargatis the mother goddess worshipped in Syria by the Aramaeans. It is considered to be either an unnamed local deity or a version of the god Athtar. the gods of Sephar-va'im. also Ashimah (Amos 8:14). murdered his father in the temple of Nisroch (2Kgs. Dict. 546). Ashima.. Vol. Dict. They were resettled in Samaria.10-12).5 with Isa. It is also the name of the son of Sennacharib who.L. with Sharezar. Nibhaz. is known to be a deity worshipped by the Syrian colonists of Israel from Iwwa.17. Succoth-Benoth means the Booths of Girls and is probably a reference to Sarpanitu the female consort of Marduk. The Sepharvites we see worshipped the version of Melech. Bullinger (Comp. 37:39). The Avvites were allegedly Avvim or aboriginal Canaanites that lived in villages near Gaza and were supposedly destroyed by the Philistines or Caphtorim (Deut. 50).) Samaria committed adultery (idolatry) with five husbands (cp. Repeated individually in John 4. Jos.T. Hos. Gray believes that the name is a wilful Hebrew distortion of the name of the mizbeah or the altar of the deity which itself was worshipped (cf.18. Oppenheim (see Interp. and the Sephar'vites burned their children in the fire to Adram'melech and Anam'melech.54. 3. 13:3.. and thus the Avvim are probably sons of Aram that settled on the coast. The Serpharvaim are believed to be the Sabraim of Syria by A. No wonder the woman worshipped she knew not what (John 4. p. city god of Babylon. Jer. Bible. 2Kgs.

therefore. 41 So these nations feared the LORD. after the manner of the nations from among whom they had been carried away. You shall not fear other gods. you shall always be careful to do. However. 35 The LORD made a covenant with them. and their children's children – as their fathers did. but they did according to their former manner. and to him you shall sacrifice. and observing the pagan winter festival called Christmas – all in the name of God and supposedly to His glory (cf. and appointed from among themselves all sorts of people as priests of the high places. which is probably related to the Hebrew melek or king. which is precisely the situation among the descendants of Israel today. and commanded them. They do not fear the LORD. whom he named Israel. The Bible clearly says they burned children to the deities. 37 And the statutes and the ordinances and the law and the commandment which he wrote for you. Many people ostensibly follow the Bible yet they do not keep the whole Law of God as given therein. (RSV) Hence there was a real mixture of religious practice among the people in Samaria at that time. 33 So they feared the LORD but also served their own gods. 2Tim. The One True God tells them quite unequivocally. And those who purport to be Bible-believing Christians are simultaneously worshipping on the Day of the Sun. 3:4-5). the practice was carried out all over Phoenicia and at Carthage in North Africa. We can see that these numerous Samaritans were not true Israelites but many were Semites with some Japhethites and Hamites among them. but there is no feature of this aspect of the cult in Mesopotamia. "You shall not fear other gods or bow yourselves to them or serve them or sacrifice to them. largely in vain. Thus the Syrians affected by the cult of Moloch would have allocated their own personalised version of the deity. that: “My thoughts are not your thoughts. and also served their graven images. their children likewise. you shall bow yourselves to him. who sacrificed for them in the shrines of the high places. so they do to this day. and he will deliver you out of the hand of all your enemies. 34 To this day they do according to the former manner. however. paying obeisance to the goddess Astarte/Easter. 39 but you shall fear the LORD your God." 40 However they would not listen. You shall not fear other gods. neither are your ways my ways” (Isa.The term Melech seems to convey the name Moloch. 55:8) and hence. these people are worshipping what they know not and. 36 but you shall fear the LORD. 2Kings 17 continues: 32 They also feared the LORD. . 38 and you shall not forget the covenant that I have made with you. The name Anam Melech is probably Anu is king. who brought you out of the land of Egypt with great power and with an outstretched arm. and they do not follow the statutes or the ordinances or the law or the commandment which the LORD commanded the children of Jacob. Moloch may well simply be the Moabite form for Lord or King.

pp. I. Andrew was also crucified on an olive tree. so also were a number of other apostles crucified upside down.iii. Theodoret (Dial. and in appointing its bishops. and Italy and Asia.. He is then held to have been crucified upside down in the time of Nero (ANF. then. Cappadocia and Betania. “Peter is listed by Hippolytus as preaching the gospel in Pontus. Eusebius. Alternatively. Galatia. (Historia Ecclesiastica. Indeed. 254-255). by various routes. Betania is in the area of Tbilisi in the Caucasus. and not to Rome. or he was appointed by instrument of Peter and perhaps ordained by John. It is the area from where the Anglo-Saxons came as part of the Parthian horde and where the Israelites had been banished. Ignatius styled himself Theophoret or bearer of God. he must have been. then went on from there to the north. and appointed Evodius as bishop there in his place. II. well before he died. ultimately for their benefit and certain preservation. The New Testament tells us that the Ten Tribes were scattered abroad (Jas. 1:1) and James addresses his epistle to them. Thus Peter is intimately associated with Antioch. Ignatius may have gone to Rome on the death of Evodius. Immutab. iv. He arranged for the northern tribes to be sent into captivity in Assyria. Peter was originally bishop or patriarch of Antioch. and not with Rome. they were pushed into many lands far to the north and ultimately northwest from Palestine. as John lived and controlled the Church from Ephesus and Ignatius must have had close association with him. The sheer breadth of Peter’s ministry makes it impossible that he could have been bishop of Rome.Conclusion In all of the foregoing history of Israel we can see a divine plan being worked out by God in His omniscience. Peter went to Antioch and established the Church there. 33a) states that Peter himself appointed Ignatius to the see of Antioch. . such as Philip and Bartholomew. The Apostle to the circumcision was Peter. he was an apostle to the circumcision. V. Paul was apostle to the Gentiles not Peter.22) records that Ignatius succeeded Evodius. Peter’s major area of mission was to the Lost Tribes of Israel scattered abroad and there fused with the Scythians and Parthians. However. and he either returned to Rome or was never killed in Rome. That means Peter must have been there in 68 CE on the death of Evodius. and is understood to have been a disciple of Peter and John. Vol. Hippolytus tells us that mission was far to the north. Evodius died ca 68 and was replaced by Ignatius of Antioch as bishop.

Syria. . Parthia at one time occupied areas now in Iran. Parthia stood between Rome and the East. Tajikistan. 266 (ibid. Afghanistan. At its greatest extent Parthia occupied a vast area. However. the Persians who were once part of its empire attacked and defeated the Parthians and caused a portion of its central horde to move north-west into Europe under The Judge who was its leader U’din or Odin or Woden. Armenia. They brought with them the Almanac or calendar based on the New Moons. Their most famous leader was Salah’ u’din or Saladin. and Peter then appointed Clement. Pakistan. Parthia and the surrounding nations that made up its Empire had a large number of Israelites and many made pilgrimages to Jerusalem. Georgia. Linus is specifically mentioned by Hippolytus as being bishop of Rome when Peter is alive. The details are in the Appendix of paper No. The sub-kingdoms of the Parthians were Characene. Turkmenistan. as we know from Acts 2:9-11. Some of the horde that were to become the Kurds remained behind. Iraq. or had given such instructions”(ibid. Such a view must be dismissed unless Linus was martyred shortly before Peter. Almanach means the counting in Arabic. If the tradition is to be accepted that Peter ordained Clement as bishop of Rome on the death of Linus. We can safely say that the Ten Tribes were in the Caucasus in what was Parthia and Scythia at the time of Peter’s missions between 30 and 68 CE. Rome itself is not even mentioned as part of the ministry. Lebanon. Jordan. but weakened by them. There is only a general reference to Italy. Elymais and Persis.). The sheer magnitude of the area of Peter’s administration is to the north and Italy was a minor part of it and barely rates a mention in relation to the other areas.Ignatius was martyred between 98 and 117 CE. Azerbaijan. Palestine and Israel.). then Peter was not martyred in Rome where it is commonly believed he died. the timing of the appointments in Antioch shows that Peter was still overseeing operations there to the tribes in the dispersion. Turkey. After defeating the Romans.

This is probably due to the nature of burial. The tradition that Peter preached to the British comes from his mission to the Israelites among the Anglo-Saxons. Some attribute the Book of Hebrews to Paul and four texts place it after 2Thessalonians. Human and animal bones were found together. as well as Anglo-Saxons and Normans. There have been few Parthian burials reported from Iran. The combination of these people would be of R1b and a Semitic Haplogroup I. too little is known about the relationship between material remains and religion (Hansman and Stronach 1970: 49). The historical record shows they were all from the area of the Russian steppes with some from Assyria. Angles. leading the excavators to speculate on a cultural connection with the Scythians. Some are Goths. there are distinct differences between regions in burial practices. Some are known Anglo-Saxons and Celts. Jutes. but the dating and the intent was within the jurisdiction of Peter. Frisians. Danes. as simple cremation-type burials leave little for archaeology. The I groups are Semites and the divisions of them will no doubt identify the tribes These Gomerites and the I Hg Semites fit the description of Israelites scattered throughout Parthia. Alans and Heruli. We find this combination throughout Western Europe in the Celts. Thus the area contained the groups that went from what is now Armenia and Georgia and the area around the Black Sea and Caspian Sea into Europe. these areas listed by Hippolytus were all parts of the Parthian Empire. West Europe and Denmark are largely a combination of R1b and I Haplogroups. some are Gomerites and some are Magogites. The men also took wives from other racial or sedentary groups. Many Scythians wore kilts. who form the modern German Thuringians. Further west the picture is more complicated. or men of Ur. such as the Hermanduri.Without any doubt at the time of Peter’s mission and at the time of the writing of the text to the Hebrews. . and what was Scythia. They wore trousers and were associated with horsemanship. As with other areas of the Parthian empire. Jutes and other tribes of the Horde while in Parthia and not in Britain itself. and into France and Spain. have predominantly R1b YDNA with a section of Semitic I. Irish and other Celts. and further east they were in the Uigur autonomous region of what is now China. who deposited horse bones with human burials. Norse. YDNA evidence now shows that Scots. Saxons of Britain and Saxony. “Like other aspects of Parthian material culture.” The Parthians were not one tribal group and were nomads. The site of Shahr-I Qumis (northeast of Tehran) yielded evidence for multi-room funerary structures.

or Greater Goths. and these were once no doubt part of the Parthian horde that did not move into Europe with the Anglo-Saxons. . The Massagetae. Thus they were a mixture of Japhethite and Semite lineage. Thus the divisions may be very much later indeed. Jutes. The absence of R1b in North Africa where the Vandals went indicated they either were completely wiped out or were RxR1 basics and settled in Cameroon. but the R1a of the Slavs predominated among them suggesting that the R1 divisions into R1a and R1b occurred after the split. saw the Khazars take up the area once occupied by these nomads and the Israelites and Jews that remained behind with them. Japheth would be the larger or greater people but the birthright promises of Shem would be conferred on him as well due to their intermarriage. or perhaps some of them became R1a and some developed into R1b due to isolation from the same ancestors. perhaps higher up. and Vandals moved in as part of the Horde and all were Unitarian Sabbatarians. There is little doubt that the R1bs come from the one ancestor. or they mutated somehow. the Semitic groups may have settled into four basic stable groups early. Hence the prophecy was fulfilled that Japheth would be enlarged and would dwell in the tents of Shem. and Assyrians and Arphaxadite Hebrews contain multiple types of Hg. On the other hand. Lombards. and ultimately the R1a Slavs also come from the same lineage. Khazars The removal of the Parthians. The Anglo-Saxons and the Lombards that split off from them all wore trousers and fringes around the bottoms of them. The intermingling of the people now has resulted in all of them carrying some Israelite bloodlines whether they are YDNA Israelites or YDNA Celts of the Hittite and later Parthian alliances. Goths and Vandals. The Goths split up into the Ostrogoths (Eastern Goths) who settled in Italy and Austria along with the Lombards and the Visi-Goths (Western Goths) who occupied Spain. that were the Anglo-Saxons. The Khazars were comprised of Ashkenazi Gomerites and Slavs. These people were all predominantly R1b or I haplogroups. I.The Romans recruited the Sarmatians after they managed to defeat them and placed many of them in Britain in the army. In other words. The predominance in Norway and Sweden of R1a indicates that it may have occurred in the first millennium of the Current Era.

I will not be angry for ever. which came soon after the death of the notable Irish Sabbatarian saint. 13 Only acknowledge your guilt. and more Jews now live side by side with the Hg I and R1B Celto/Israelites in the US and British Commonwealth than anywhere else on Earth. faithless Israel. in effect. the descendants of Israel. I will not look on you in anger.The Healing of the Breach The Kingdom of Israel. until about 2500 years later in the Last Days. These began basically with Augustine’s mission to England. and proclaim these words toward the north. Jeremiah 3:11-13a And the LORD said to me. was not to be united again with Judah. `Return.) God has certainly protected these islands in spite of the endemic idolatry and the inroads that Trinitarianism quickly made. (Most of Ireland has since become independent. being transferred by marriage or migration The Union of the Crowns between the royal houses of England and Scotland was effected in 1603. (RSV) The call is presently going out to all nations for all people to repent and become the Israel of God... either through direct YDNA lineage or through cross- breeding with Parthian Anglo-Saxons or Jutes and Lombards or Hittites and other Celts and indeed all nations. says the LORD. "Faithless Israel has shown herself less guilty than false Judah. The YDNA lines of the kings from 1066 were Norman R1b. Many Israelites were in the "Isles of the Sea" or the UK and Ireland. This was a mere seven years after the rise of the so-called Holy Roman Empire. 3:12) or scattered across the globe. the country became known as the United Kingdom for the first time. which will ultimately fill the whole Earth. Wherever they are found in the world today. . it wasn’t until the Act of Union of the Parliaments exactly 300 years ago (in 1707) that the two countries settled their differences long enough to create a new entity called Great Britain. and say. are urged to repent and return to the God who their fathers' knew. says the LORD. for I am merciful. Despite sharing a sovereign. Columba. It was to be in Europe where most of the “lost” Ten Tribes of Israel had surfaced under Haplogroup I. With the inclusion of Ireland in January 1801. perhaps indicating that the British Isles was considered an important bastion that had to be thoroughly infiltrated with the Babylonian mysteries in order to eliminate the worship of the One True God of Columba’s followers and others. whether in the north (Jer. with Hebrew Davidic lines inherited chiefly through the females. which ended with Hoshea. in 597 CE. The union was commenced from West Europe and ultimately the Americas and Australasia and South Africa. 12 Go. however. that you rebelled against the LORD your God .

722 9 years Died .Table 1: Chronology of the Kings of Israel Period of Reign Duration Dynasty: no.753 41 years Died II IV: 15 Zechariah 753 .852 2 years Died III: 10 Jehoram 852 .886/85 24 years Died II: 4 Elah 886/85 .874/73 12 years Died III: 8 Ahab 874/73 . King End (BCE) I: 1 Jeroboam 932 .885/84 2 years Murdered 5 Zimri 885/84 7 days Suicide 6* Tibni 885/84 .742/41 10 years Died V: 18 Pekahiah 742/41 .740/39 2 years Murdered V: 19 Pekah [751] 740/39 .853 22 years Killed in battle III: 9 Ahaziah 853 .909/08 2 years Murdered II: 3 Baasha 909/08 .798 17 years Died IV: 13 Jehoash 798 .732/31 20 years Murdered 20 Hoshea 732/31 .814/13 28 years Died IV: 12 Jehoahaz 814/13 .752 6 months Murdered 16 Shallum 752 1 month Murdered V: 17 Menahem 752 .841 12 years Murdered IV: 11 Jehu 841 .910/09 22 years Died I: 2 Nadab 910/09 .883/82 2 years Died III: 7* Omri 885/84 .782/81 16 years Died IV: 14 Jeroboam [793] 782/81 .

Notes: 1) Discrepancies in the reigns of Jeroboam II and Pekah are examined in the text. 2) * denotes concurrent reign .

Centres d'intérêt liés