Vous êtes sur la page 1sur 23

Piroplasmosis por Babesia microti (syn. Babesia vulpes ) en zorros rojos ( Vulpes vulpes ) en el noroeste de España (Galicia) y su relación con Ixodes hexagonus

Abstracto La Piroplasmosis es causada por varias especies de protozoos tales como la Babesia microti (Bml), un protozoo de la sangre emergente también conocido como Theileria annae o vulpes Babesia. La infección por Bml se informó por primera vez en perros en España, donde es endémica en la actualidad. Recientemente, se ha detectado una alta prevalencia de Bml en zorros rojos ( Vulpes vulpes) en los países europeos. El objetivo de este estudio fue determinar los niveles de infección de este parásito en zorros de Galicia, noroeste de España, y la infestación de especies de garrapatas en estos carnívoros, donde hasta ahora se desconocen. Se tomaron muestras de sangre, bazo y garrapatas (si estaban presentes) de 237 zorros rojos cazados en la región de Galicia. Se prepararon frotis de sangre para observación directa del parásito y se examinaron muestras de bazo y garrapata mediante PCR anidada . Las prevalencias de infección por Bml en zorros rojos gallegos se estimaron en 72% (171/237) por PCR y 38.23% (26/68) por observación directa. Entre 837 garrapatas recolectadas, la garrapata principal identificada fue Ixodes hexagonus (presente en el 82.4% de los zorros) seguida de Ixodes ricinus (12.3%) ,Dermacentor reticulatus(12.3%) y Rhipicephalus sanguineuss en su lato (3.5%). De 34 zorros que dieron positivo para Bml, se recolectaron 616 garrapatas: se obtuvieron resultados positivos de Bml PCR en 55.6% (227/408) de garrapatas recolectadas de 9 zorros, mientras que 208 garrapatas de los 25 zorros infectados restantes arrojaron resultados de PCR negativos. Dado que la piroplasmosis canina es endémica en esta área, nuestras observaciones

apuntan al zorro rojo como el principal reservorio para la infección Bml y la alta proporción deI. Hexagonus entre garrapatas recolectadas de zorros rojos sugiere su probable papel como vectores de B.microti-like piroplasma en esta región. Se necesitan más estudios para una mejor comprensión del vínculo entre los ciclos de vida silvestre y doméstico de este piroplasma.

apuntan al zorro rojo como el principal reservorio para la infección Bml y la alta proporcióno vectores d e B. m icroti-like piroplasma en esta región. Se necesitan más estudios para una mejor comprensión del vínculo entre los ciclos de vida silvestre y doméstico de este piroplasma. Palabras clave Piroplasma tipo Babesia microti Theileria annae Zorros rojos Vulpes vulpes Ixodes hexagonus NO España 1 . Introducción Los piroplasmas ( Apicomplexa, Piroplasmida) son parásitos protozoarios intraeritrocíticos de los géneros Babesia , Theileria y Cytauxzoon , que pueden afectar a los carnívoros salvajes y domésticos ( Otranto et al., 2015 ) . En base a la morfología de los parásitos en los glóbulos rojos , los piroplasmas se han dividido tradicionalmente en piroplasmas grandes (3- 5 μm) y pequeños (0.5 - 2.5 μm). Aunque todas las formas grandes reportadas hasta la fecha pertenecen al género Babesia , las pequeñas Babesia spp. y Theileria spp. difícilmente se distingue por microscopía óptica s olo (necesita un especialista), y se necesitan técnicas moleculares basadas en ADN para su identificación precisa a nivel de especie ( Irwin, 2010 ) . En muchas partes del mundo, diferentes especies de piroplasmas grandes y pequeños se han identificado morfológica y g enéticamente tanto en cánidos domésticos como silvestres ( Cardoso et al., 2013 ). El piroplasmosis por Babesia microti (Bml), generalmente considerado como sinónimo de Theileria annae , es un piroplasma pequeño descrito por primera vez en perros en España. Hoy en día, se considera que Bml es endémica en el noroeste del país ( Camacho et al., 2001 ; García, " id="pdf-obj-1-13" src="pdf-obj-1-13.jpg">

Palabras clave

Piroplasma tipo Babesia microti Theileria annae

Zorros rojos

Vulpes vulpes Ixodes hexagonus

NO España

1 . Introducción

Los piroplasmas (Apicomplexa, Piroplasmida) son parásitos protozoarios intraeritrocíticos de los géneros Babesia , Theileria y Cytauxzoon , que pueden afectar a los carnívoros salvajes y domésticos ( Otranto et al., 2015 ). En base a la morfología de los parásitos en los glóbulos rojos , los piroplasmas se han dividido tradicionalmente en piroplasmas grandes (3-5 μm) y pequeños (0.5-2.5 μm). Aunque todas las formas grandes reportadas hasta la fecha pertenecen al género Babesia , las pequeñas Babesia spp. y Theileria spp. difícilmente se distingue por microscopía ópticasolo (necesita un especialista), y se necesitan técnicas moleculares basadas en ADN para su identificación precisa a nivel de especie ( Irwin, 2010 ). En muchas partes del mundo, diferentes especies de piroplasmas grandes y pequeños se han identificado morfológica y genéticamente tanto en cánidos domésticos como silvestres ( Cardoso et al., 2013 ). El piroplasmosis por Babesia microti (Bml), generalmente considerado como sinónimo de Theileria annae , es un piroplasma pequeño descrito por primera vez en perros en España. Hoy en día, se considera que Bml es endémica en el noroeste del país ( Camacho et al., 2001 ; García,

vulpes debido a la alta prevalencia reportada en su hospedero natural, el

zorro colorado ( Vulpes vulpes ), y la aparente falta de una etapa de infección preeritrocítica en los linfocitos ( Baneth et al.,

  • 2015 ). Actualmente no está claro si el protozoario Bml pertenece al

géneroTheileria o Babesia , ya que todavía no hay evidencia de una etapa

infecciosa extraeritrocítica o de la falta de transmisión transovárica en las garrapatas (características distintivas de Theileria spp.) ( Miró et al.,

  • 2015 ). En este documento, nos referiremos a este piroplasma

como Babesia microti (Bml).

Cuando los perros están clínicamente infectados con Bml, muestran signos clínicos graves, como membranas mucosas pálidas , anorexia, apatía y fiebre. Los recuentos de glóbulos blancos indican anemia regenerativa y macrocítica grave / hipocrómica y trombocitopenia ( Guitián et al., 2003 ; Miró et al., 2015 ). Si bien el vector de este pequeño piroplasma aún no se ha identificado, se cree que se transmite por garrapatas del género Ixodes como para muchos otros pequeños piroplasmas. La garrapata erizo Ixodes hexagonus parece un candidato probable debido a que las áreas endémicas de la infección Bml coinciden estrechamente con su rango de distribución ( Camacho et al.,

  • 2003 ). Aparte deI. hexagonus , el ADN Bml también se ha detectado en

otras especies de garrapatas como Ixodes ricinus ( Lledó et al., 2010 ) ,

Ixodes canisuga y Rhipicephalus sanguineuss en su lato ( Solano-Gallego et al., 2016 ). Sin embargo, aún nos faltan datos para sugerir su competencia como vectores para Bml. Durante los últimos 10 años, Bml se ha detectado cada vez más en carnívoros y se han recibido informes de su presencia en perros y zorros en Europa y América del Norte. Utilizando técnicas moleculares, Bml también se ha detectado en perros en España en regiones fuera de

Galicia, como Asturias ( Miró et al., 2015 ) o Barcelona ( Tabar et al.,

Francia ( René-Martellet et al., 2015 ) y Estados Unidos ( Yeagley et al.,

2009)) Sin embargo, en la mayoría de estos estudios, el historial de viaje de los perros era desconocido. Algunos autores han informado casos de zorros infectantes Bml en el centro y norte de España ( Criado-Fornelio et

al., 2003 ; Gimenez et al., 2009 ), en algunos países europeos (Portugal Croacia, Italia, Austria, Alemania y Hungría) ( Cardoso et al.,

reportadas en Europa, Bml parece mostrar una fuerte preferencia por los zorros. Por lo tanto, Bml es la principal especie de piroplasma confirmada molecularmente en zorros, mientras que Babesia canis se ha identificado muy pocas veces en estos animales ( Cardoso et al., 2013 ). El zorro rojo es el carnívoro más común en Europa y muestra un gran rango de distribución y tamaño de población. Las abundancias de zorro en Europa dependen del hábitat, la alimentación, la estación, la competencia con otras especies, otras enfermedades y medidas de control (por ejemplo, la caza), así como las interacciones entre estos factores. Las estimaciones para la región de Galicia (NW España) sugieren una densidad de población promedio de 2.7 zorras / km 2 en invierno, con las densidades más altas (5.6 zorras / km 2 ) en áreas periurbanas cercanas a grandes poblaciones humanas, como la industrial áreas, granjas, mataderos y basurales incontrolados ( Fidalgo et al., 2009 ). En el centro y sur de España, las densidades son más bajas que en el noroeste de España (0.8 y 2.5 fox / km 2 , respectivamente) ( Gortázar, 1997 ). Las abundancias locales de zorro se benefician de la presencia de personas. En las zonas urbanas, la disponibilidad de alimentos y lugares de descanso, la tolerancia humana y la ausencia de depredadores / competidores hacen que el zorro rojo sea una especie muy exitosa ( Otranto et al., 2015).) La gran región de Galicia es especialmente adecuada en términos de sus características demográficas y ecológicas para la alta proliferación de zorros. Algunos estudios han informado la incidencia y el manejo clínico de la infección Bml en perros domésticos en el noroeste de España ( Camacho et al., 2001 ; Miró et al., 2015 ; Checa et al., 2017 ) como el único área endémica reconocida en Europa. En contraste con la situación de los perros domésticos, la información sobre la ocurrencia y prevalencia de piroplasmas en zorros rojos en el noroeste de España sigue siendo limitada.

El presente estudio buscó examinar utilizando herramientas moleculares la prevalencia de Bml y para describir las especies de garrapatas (Ixodidae) que infestan zorros rojos en el noroeste de España.

  • 2 . materiales y métodos

2.1 . Área de estudio, muestreo y recopilación de datos

En este estudio se incluyeron los cadáveres de 237 zorros colorados silvestres aparentemente sanos encontrados en Galicia (noroeste de España). Los zorros habían sido disparados durante la temporada oficial de caza (por miembros de la Federación Galega de Caza y otras sociedades cazadoras de esta región) en enero y febrero de 2016. No más de 6 horas después de la muerte de cada animal, muestras de bazo y sangre se obtuvieron. Durante la necropsia, se recogió sangre o suero hemolizado utilizando una técnica estéril de la aurícula derecha o la cavidad torácica y se colocó en tubos de EDTA para frotis de sangre . Las muestras de bazo también se recogieron con instrumentos estériles y se colocaron en tubos estériles para detectar Bml siguiendo aislamiento de ADN genómico , PCR y secuenciación. Las

muestras de bazo se mantuvieron a -20 ° C y las muestras de sangre a

  • 4 ° C hasta su procesamiento posterior.

En un archivo clínico, registramos: número de identificación, fecha, sitio de captura, edad, sexo y presencia de ectoparásitos visibles . Los signos clínicos también se evaluaron en el momento del muestreo, como los cambios en el color de las membranas mucosas , la condición corporal, la condición de la piel o la linfadenomegalia. Las edades de los animales se estimaron de acuerdo con varios factores:

desarrollo corporal (completo o no), apariencia externa, etapa de desarrollo de los genitales (externos e internos) y dentición (presencia, desarrollo y desgaste de los dientes, enfermedad periodontal). Establecimos tres grupos de edad: inmaduros o jóvenes, definidos como individuos menores de 1 año de edad; adultos o zorros entre 1 y 5 años con capacidad reproductiva; y adultos mayores zorros mayores de 5 años, que muestran mayor desgaste de todos los dientes y, a menudo, un grado variable de enfermedad periodontal o incluso pérdida de dientes.

2.2

. Detección de parásitos microscópicos

Los frotis de sangre fina teñidos con Giemsa se examinaron mediante microscopía óptica (LM) para detectar formas intraeritrocíticas consistentes con pequeños merozoitos de Babesia . Los frotis se secaron al aire, se fijaron en metanol absoluto durante 5 minutos, se tiñeron con Giemsa al 20% y luego se observaron mediante microscopía óptica (LM) usando un objetivo de aumento x1000 en aceite de inmersión. Todas las muestras fueron examinadas por la misma persona. De 237 muestras de sangre recogidas, se prepararon frotis de sangre a partir de solo 68. Esto se debió a que la sangre no siempre se pudo recoger en condiciones óptimas después de la muerte del animal por la caza.

  • 2.3 . Selección e identificación de garrapatas

Las garrapatas obtenidas de zorros después del examen clínico se almacenaron en etanol al 70% en viales individuales para cada zorro. Las garrapatas fueron identificadas a nivel de especie y sexuadas usando claves morfológicas ( Gil Collado et al., 1979 ; Manilla e Iori, 1992 ; Estrada-Peña et al., 2004 ). Antes de aislar el ADN de las garrapatas, se clasificaron según la etapa (adultos, larvas o ninfas) y el grado de alimentación (hembras adultas hinchadas, ninfas alimentadas y larvas alimentadas). En nuestro estudio, debido a restricciones económicas, decidimos analizar solo garrapatas recolectadas de zorros Bml-positivos.

  • 2.4 . Aislamiento de ADN

ADN genómico se aisló a partir de bazo (10 mg) y de las garrapatas utilizando el QIAamp ® Mini ADN kit (Qiagen ® , EE.UU.). El ADN de los bazos se extrajo como se describe por el fabricante y se eluyó en agua de calidad molecular (200 μl) y se almacenó a -20 ° C hasta su uso posterior. Para aislar el ADN de las garrapatas se introdujeron algunas modificaciones al protocolo original. Brevemente, cada garrapata se lavó en etanol al 70% y luego una vez en agua destilada. Utilizando un bisturí limpio y cuentas de acero inoxidable (Werfren, España), las garrapatas se presionaron contra las perlas afiladas para derramar su contenido abdominal. Cada muestra se mantuvo en 360 μl del tampón de

lisis tisular incluido en el kit y se trató con 40 μl de proteinasa K durante la noche a 56ºC. ° C. Las etapas posteriores se llevaron a cabo de acuerdo con las instrucciones del fabricante (protocolo de tejido).

2.5 . PCR anidada para detección de bml en muestras de bazo y garrapata

Las muestras de ADN de bazo y garrapata se mediante ensayos específicos basados en PCR dirigidos al gen de la subunidad de ARN ribosomal pequeño (18S rDNA), recientemente validado para la detección de Bml, utilizando cebadores Babesia-Theileria universales BT1- F y BTH-1R ( Criado-Fornelio et al., 2003 ) para la ronda de amplificación primaria y los cebadores específicos de Bml BTFox1F y BTFox1R para la

segunda ronda de amplificación ( Bartley et al., 2016 ) ( Tabla 1 ). La mezcla de reacción se adaptó a la descrita previamente por Bartley et al. (2016) y las condiciones de amplificación fueron las siguientes; Se añadieron 2 μl de ADN extraído a una mezcla de reacción de 23 μl que contenía 0,75 unidades de ADN polimerasaTth Plus.5U / μl (Biotools B & M Labs., SA, España), 200 μM (cada uno) deoxirribonucleótidos (dATP,

dTTP, dGTP, dCTP) (Biotools B & M Labs.), 10 pmol de cada cebador (Invitrogen, EE. UU.), 2,5 μl 10X Tampón de PCR y MgCl _ {2 } 1,5 mM (Biotools B & M Labs.). Se incluyeron muestras de controlnegativas (2 μl dH2O) y positivas ( B. canis y Bml DNA) en cada ensayo de PCR. Las identidades de estos controles positivos se habían confirmado previamente mediante amplificación por PCR, secuenciación y análisis BLASTN del gen 18S rRNA. Las reacciones de amplificación para BML PCR anidada específica se llevaron a cabo en un termociclador GenAmp ® PCR System 2700 (Applied Biosystems, España). Se realizaron 10 μl de productos de PCR en un gel de agarosa al 1,5% que contiene SYBR Safe Gel Stain (Invitrogen, EE. UU.) y se visualiza con un

lector transiluminador oscuro (Clare Chemicals, EE. UU.).

Tabla 1 . Conjuntos de cebadores externos e internos utilizados para amplificar una región del gen rRNA 18S del piroplasma de Babesia microti (Bml) .

Primer nombre

Secuencia (5'-3 ')

BT1-F Universal Babesia-Theileria BTH-1R Universal Babesia-Theileria BTFox1F (Bml) BTFox1R (Bml)

  • 2.6 . secuencia ADN

5'GGTTGATCCTGCCAGTAGT 3 ' 5'TTGCGACCATACTCCCCCCA 3 ' 5'AGTTATAAGCTTTTATACAGC 3 ' 5'CACTCTAGTTTTCTCAAAGTAAAATA 3 '

Productos de PCR correspondientes a la longitud esperada se purificaron (15 l) usando un kit de purificación QIAquick (Qiagen ® ) como se describe por el fabricante y se secuenció en el servicio de secuenciación del departamento Genomics, UCM, utilizando un sistema ABI Prism 3730 (Applied Biosystems) . Los archivos del cromatograma de secuencia se analizaron usando Chromas 2.1.1 y se importaron en BioEdit v7.0.5 para edición, ensamblaje y alineaciones. Las secuencias obtenidas se alinearon con secuencias disponibles de GenBank usando Clustal W y se compararon con secuencias de piroplasma adicionales disponibles de GenBank usando el programa BLAST para determinar identidades porcentuales de las secuencias generadas contra secuencias publicadas.

  • 2.7 . análisis estadístico

Los resultados se analizaron utilizando el paquete de software SAS versión 9.4. Las asociaciones entre la infección Bml (detectada por PCR) y las variables categóricas restantes como la edad, el sexo, la condición corporal, las garrapatas y la ubicación del zorro se evaluaron mediante la prueba Chi-cuadrado. Los resultados moleculares se compararon con los resultados de LM a través de coeficientes Kappa simples para evaluar el acuerdo entre estas dos técnicas de diagnóstico. La significancia se estableció en p ≤ 0.05.

3 . Resultados

De las 237 muestras de bazo examinadas por PCR específica para Bml , 171 (72,2%) arrojaron resultados positivos. De estos, 14 muestras se enviaron para la secuenciación con cebadores BTFox1F y BTFox1R. Todas las secuencias mostraron 99-100% de identidad con varios aislamientos delpiroplasma tipo B.microti ( Babesia annae , Babesia cf. microti y Babesia Spanish dog aislate, números de acceso KT580785.1, KJ871351.1 y EU583387.1 , respectivamente ) En este estudio, se recolectaron 816 garrapatas de 50 zorros con resultado positivo para Bml. De estos, 616 garrapatas de 34 zorros con resultado positivo para Bml se analizaron agrupados en 57 lotes según su etapa (adultos individuales, grupos de hasta 100 larvas o grupos de 23 ninfas). Nueve de estos lotes fueron Bml positivos por PCR anidada específica (BTFox1F / R): dos lotes de hembras adultas I. hexagonus (n = 2), cuatro grupos de ninfas alimentadas con I. hexagonus (n = 66) y tres grupos de I. hexagonus alimentado larvas (n = 159). El ADN Bml no se detectó en otras garrapatas especies analizadas (I. ricinus y D. reticulatus) (Archivo adicional). De 34 zorros que dieron positivo para Bml, se recolectaron 616 garrapatas: se obtuvieron resultados positivos de Bml PCR en 55.6% (227/408) de garrapatas recolectadas de 9 zorros, mientras que 208 garrapatas de los 25 zorros infectados restantes arrojaron resultados de PCR negativos. Además, el 6,4% (2/31), el 23,5% (4/17) y el 37,5% (3/8) de los grupos de adultos, ninfas y larvas fueron Bml positivos, respectivamente.

3.2 . Microscopía

De las 237 muestras de sangre obtenidas, solo 68 fueron válidas para el examen de microscopía óptica . Debido a que en la mayoría de los zorros, la muestra de sangre después de la muerte no se recogió en condiciones estériles o se coaguló. Los cuerpos intraeritrocíticos en forma de anillo, morfológicamente compatibles con pequeños piroplasmas, fueron detectados por LM en 26 de las 68 muestras de sangre (38.2%). Observamos mala concordancia entre un resultado positivo de LM y PCR. El valor de kappa fue bajo (0,213, acuerdo justo), lo que indica un acuerdo del 54,4% y una discrepancia del 45,6%. Todos los frotis de

sangre LM positivos fueron PCR positivos. Sin embargo, 31 zorros que probaron LM negativo para Bml fueron PCR positivos para el parásito.

3.3 . Epidemiología

Zorros de prueba Bml positivos se distribuyeron ampliamente en toda Galicia ( Fig. 1 ). Así, se detectó Bml en el 61% (36/59) de los zorros de la costa noroeste (provincia de A Coruña), en el 70,9% (56/79) de los zorros de la costa suroccidental (provincia de Pontevedra) y en el 79,8% ( 79/99) de los zorros del noreste de Galicia (provincia de Lugo). Por regiones geográficas, se observaron diferencias significativas entre las provincias de Lugo y A Coruña (p = 0,037), siendo la prevalencia de Bml la mayor en zorros de Lugo (79,8%).

Fig. 1 . Distribución geográfica de Bml en zorros rojos en el noroeste de España (Galicia). (Para la interpretación de las referencias al color en

esta leyenda de la figura, se remite al lector a la versión web de este artículo). Orotemperato = T 3-7 ° C; m -7 a -4 ° C; M 0-3 ° C Supratemperato = T 7-12 ° C; m -4 a 2 ° C; M 3-10 ° C Mesotemperato = T> 12 ° C; m> 2 ° C; M> 10 ° C Oromediterranean = T 4-8 ° C; m -7 a -4 ° C; M 0-3 ° C Supramediterráneo = T 8-13 ° C; m -4 a -1 ° C; M 3-8 ° C Mesomediterráneo = T 13-17 ° C; m -1 a 5 ° C; M 8-14 ° C Parámetros de temperatura: T = temperatura mensual promedio; m = temperatura promedio de los mínimos del mes más frío; M = temperaturas promedio de los máximos del mes más frío.

De los 237 zorros examinados, 125 mujeres y 112 hombres, 67 fueron clasificados como jóvenes, 143 como adultos y 27 como zorros adultos mayores. Los puntajes de condición corporal (de 5 puntos) en 197 zorros variaron de 1 a 4, con una mediana de 2.9 puntos. En base a los resultados de PCR específicos de Bml, 95 (76%) mujeres y 75 (67.9%) hombres fueron positivos. Entre estos zorros con resultado positivo, 52 (77.6%) eran jóvenes, 102 (71.3%) eran adultos y 17 (63%) eran adultos mayores. Los puntajes de condición corporal en zorros infectados con Bml fueron de 1-2 en 41 (74.5%), 3 en 76 (71.7%) y 4 en 20 (55.6%) de los animales. No hubo diferencias significativas en la prevalencia de Bml entre los sexos (p = 0,16), y entre los grupos de edad (p = 0,34) o los grupos de puntuación de la condición corporal (p = 0,21). De 837 garrapatas de cuatro especies diferentes recolectadas, 72% fueron larvas, 21.5% fueron ninfas y 6.5% fueron adultos. El número mínimo y máximo de garrapatas en un solo zorro fue uno y 212 garrapatas, respectivamente. Las larvas de Ixodes hexagonus fueron las formas predominantes detectadas. Estas garrapatas fueron identificadas

como I. hexagonus (90.7%), I. ricinus(1.3%),

Dermacentor reticulatus(1.3%), Rhipicephalus sanguineus (0.3%) e Ixodes spp. (6.3%) ( Fig. 2 ).

Fig. 2 . Distribución geográfica de garrapatas recolectadas de zorros rojos ( Vulpes vulpes) en tres provincias de Galicia (noroeste de España). (Para la interpretación de las referencias al color en esta leyenda de la figura, se remite al lector a la versión web de este artículo).

De 139 de los 237 zorros que podrían ser examinados externamente, 57 garrapatas albergadas (41%) ( Tabla 2 ). Mientras que 87.7% (50/57) de los zorros con garrapatas fueron Bml positivos, 76.8% (63/82) de los zorros sin infestación de garrapatas resultaron Bml positivos. No se encontraron diferencias significativas en la infección Bml según la infestación por garrapatas (p = 0.1). Ixodes hexagonus fue la garrapata más abundante entre los zorros (82,4%; 47/57) y se identificó en 41 de los 50 zorros infectados Bml (82%). Sin embargo, no se observó una relación significativa entre los zorros infectados y la presencia de I.

hexagonus (p = 0,8). Menos abundantes entre los zorros fueron D. reticulatus (12.3%; 7/57), I. ricinus (12.3%; 7/57) y R. sanguineussl (3.5%; 2/57). Además, 5.2% de los zorros tenían Ixodes spp. larvas (no identificadas a nivel de especie).

Tabla 2 . Infección por Babesia microti e infestación por garrapatas en zorros rojos ( Vulpes vulpes ) según se determina mediante PCR específica en muestras de bazo y garrapata.

Garrapatas,

especie

I.

hexagonus

I.

ricinus

Ixodes spp.

D.

reticulatus

R.

sanguineussl

Total

Zorros

No.

(PCR

+)

47

41

7

7

3

3

7

6

2

1

57 a

50 a

Ticks

Total

No.

Etapas

32F, 1M,

759

177N,

549L

7F, 3N,

11

1L

53

53L

11

8F, 3M

3

2F, 1M

49F, 5M,

837

180N,

603L

De los zorros positivos

No.

Etapas

28F, 1M,

741

163N,

549L

7F, 3N,

11

1L

53

53L

10

7F, 3M

1

1F

42F, 4M,

816

166N,

603L

Resultados

positivos

No.

Etapas

2F,

227

66N,

159L

0

0

Dakota

Dakota

del

del

Norte

Norte

0

0

Dakota

Dakota

del

del

Norte

Norte

2F,

227

66N,

159L

Analizado

No.

Etapas

22F,

606

146N,

438L

5

4F, 1N

Dakota

Dakota

del

del

Norte

Norte

5

5F

Dakota

Dakota

del

del

Norte

Norte

31F,

616

147N,

438L

4 . Discusión Los hallazgos de este estudio indican claramente la amplia presencia de ADN Bml en la población de zorro rojo del noroeste de España. Se encontraron animales cazados que dieron positivo para este piroplasma en todas las regiones de Galicia, excepto en la provincia de Ourense, donde no se tomaron muestras de zorros. Hasta donde sabemos, este es el primer estudio para abordar la infección Bml en zorros salvajes en Galicia. Esta región noroeste de España fue la primera área donde se informó que la infección Bml causaba enfermedad grave en perros ( Camacho et al., 2001 ; García,

  • 2006 ). Se informó sobre perros infectados posteriores de Croacia y

Portugal ( Simões et al., 2011 ; Farkas et al., 2015 ). Hoy, noroeste de

España es la principal área considerada endémicade la infección Bml en

perros, que rara vez se detecta en las áreas vecinas ( Miró et al.,

  • 2015 ). El interés en este parásito emergente entre los carnívoros

salvajes ha aumentado recientemente ( Clancey et al., 2010 ; Cardoso et al., 2013 ;Baneth et al., 2015 ). La infección por Bml en zorros se describió por primera vez en dos estudios independientes realizados en el norte (provincia de Burgos) y el centro de España (provincia de

Guadalajara), donde el 20% (1/5) y el 50% (5/10) de los zorros resultaron positivos, respectivamente ( Criado-Fornelio et al., 2003 ; Gimenez et al.,

  • 2009 ). Más recientemente, en un estudio llevado a cabo en dos regiones

del norte de España (País Vasco y región de Asturias), Bml fue el único

hemoparásito detectado en 35.4% (17/48) de los zorros rojos analizados ( Barandika et al., 2016)) Sin embargo, estas cifras pueden no reflejar las prevalencias actuales en toda España, ya que se tomaron muestras de un número muy bajo de zorros. En este estudio más amplio, detectamos una prevalencia de Bml en zorros rojos del 72,2% (171/237), que es más alta que las prevalencias reportadas en estudios españoles previos y más similar a la reportada para zorros en Portugal (69.2%) ( Cardoso et al., 2013 ). El piroplasma tipo Babesia microti se está detectando cada vez más en

zorros en Europa y se ha informado en 50% de zorros en Austria ( Duscher et al., 2014 ), 46,4% en Alemania ( Najm et al., 2014 ), 20% en Hungría ( Farkas et al., 2015 ), 14.6% en Gran Bretaña ( Bartley et al.,

et al., 2014 ) . Además, el protozoo también se ha detectado en zorros en América del Norte ( Birkenheuer et al., 2010 ; Clancey et al., 2010).) Estos hallazgos sugieren que los zorros rojos son un reservorio importante de Bml en España y otros países europeos y también en los EE. UU. Nuestros datos epidemiológicos indicaron que no existe correlación entre la infección por Bml y la edad, el sexo o el estado corporal de los zorros rojos examinados. Bartley et al. (2016) describieron un mayor porcentaje de zorros machos infectados que hembras, mientras que nuestros datos apuntan a las hembras más afectadas, aunque las diferencias no fueron

significativas en ninguno de los casos. Las edades positivas del zorro (es decir, los animales más jóvenes) están de acuerdo con las observaciones de Zanet et al. (2014) en zorros en Italia. Otros autores también han informado un mayor riesgo de infección Bml en perros más jóvenes en áreas endémicas ( Miró et al., 2015) Los perros de caza están en estrecho contacto con zorros rojos en áreas con una alta densidad de este carnívoro salvaje como el noroeste de España. Ambas especies de animales comparten el mismo hábitat y pueden tener contacto directo durante las actividades de caza. En efecto, se ha descrito una mayor prevalencia de Bml en la caza que en los perros de compañía o guardia ( Guitián et al., 2003 ; Miró et al., 2015 ). La transferencia de parásitos de carnívoros salvajes a domésticos y viceversa depende principalmente de las variantes ecológicas que caracterizan a un área determinada. Por ejemplo, la caza podría promover el contagio de infecciones parasitarias de cánidos domésticos y felinos a poblaciones silvestres ( Otranto et al., 2015 ). En nuestro estudio, se encontraron cuatro especies de garrapatas

infestando zorros: I. hexagonus , I. ricinus , D. reticulatus y R. sanguineus sl.

Sin embargo, con mucho, las garrapatas más numerosas encontradas en los zorros rojos en el noroeste de España fueron las etapas inmadura y adulta de I. hexagonus. Estos hallazgos son similares a los de otro estudio en el norte de España en el que los zorros rojos fueron parasitados principalmente por I. hexagonus ( Barandika et al., 2016 ). Prevalencia similar de esta garrapata ha sido proporcionada por grandes estudios realizados en Rumania y en países con un clima húmedo del Atlántico (Reino Unido o norte de Alemania) ( Sándor et al., 2017) Las condiciones climáticas y ambientales en el norte y el noroeste de España (climas húmedos) son capaces de soportar altas cargas de garrapatas ixodídicas ( Barandika et al., 2006 ). En base a las áreas coincidentes de altas prevalencias de Bml e I. hexagonus en España, esta garrapata ha sido sugerida como el vector de Bml ( Camacho et al., 2003 ). En nuestro estudio, la alta proporción de I. hexagonus entre garrapatas recolectadas de zorros rojos sugiere su probable papel como vectores de piroplasma tipo B. microti en esta región. Sin embargo, esta especie de garrapata no se conoce en otros países europeos donde se ha informado de la infección Bml en zorros como Croacia ( Beck et al.,

2009).) o los EE. UU. Esto plantea la posibilidad de vectores distintos de I. hexagonus . Se necesitan más estudios para identificar otros posibles vectores o rutas de transmisión para Bml particularmente en regiones en las que I. hexagonus está ausente. Examinamos la infección por Bml por PCR y LM en el bazo y muestras de sangre obtenidas de 68 zorros en el noroeste de España. Nuestros resultados indican una mala concordancia entre la observación directa del parásito y la PCR (54,4% de las muestras). Miró et al. (2015) notaron un acuerdo moderado (valor Kappa: 0.6680) entre LM y PCR en muestras de perros analizados en la fase clínica de la infección Bml cuando la observación microscópica de piroplasmas es más fácil que en animales con baja parasitemia niveles debido a la enfermedad crónica. Por LM, solo pudimos detectar cuerpos en forma de anillo intraeritrocíticos que eran morfológicamente compatibles con piroplasmas pequeños en 26 (38.2%) de las 68 muestras de sangre. En contraste, el ADN Bml fue detectado por PCR en 57 (83.8%) de las 68 muestras de sangre. En un estudio similar, la PCR pudo detectar el parásito tanto en una etapa más temprana de la infección como en etapas posteriores, cuando los niveles de parasitemia son bajos y los frotis de sangre delgados teñidos con Giemsa sonnegativos ( Fukumoto et al., 2001 ). De hecho, el enfoque molecular se ha propuesto como el método estándar de oro para la detección de pequeñas infecciones por piroplasma ( Miró et al., 2015).) En consecuencia, utilizando la prueba de diagnóstico molecular, se detectó un mayor número de zorros positivos para la infección Bml (57/68, 83,8%) en animales sometidos a prueba mediante ambas técnicas. Todos los frotis de sangre positivos mostraron un bajo nivel de parasitemia. Esto podría explicarse por la ausencia de signos clínicos compatibles con la infección Bml observada en los zorros con resultado positivo. Todos los zorros examinados externamente mostraron un buen estado clínico de acuerdo con estudios previos ( Cardoso et al., 2013 ). Hasta la fecha, no hay datos disponibles sobre los impactos clínicos en los zorros, y más estudios serían útiles para definir el impacto clínico de la infección Bml en zorros rojos.

5 . Conclusiones

Nuestros hallazgos indican que el piroplasma tipo B. microti está muy extendido entre los zorros rojos en el noroeste de España, y sugieren que las prevalencias de infección por Bml en zorros son algo más altas que las registradas en perros de la misma región. Nuestras observaciones también apuntan a I. hexagonus como el vector más probable para la propagación de Bml a los zorros y otros carnívoros, incluidos los perros en el noroeste de España. Sin embargo, no debemos subestimar la posibilidad de que otros tics o modos de transmisión puedan jugar un papel importante en la transmisión de Bml en otras regiones donde esta especie de garrapata está ausente. Debido a su hábitat suburbano, su capacidad de adaptación y su amplia distribución geográfica, el zorro rojo es la clave en la difusión de Bml en toda Europa.

Expresiones de gratitud Los zorros rojos utilizados en este estudio fueron proporcionados por los Centros de Recuperación de Vida Silvestre de Galicia, la Dirección Xeral de Patrimonio Natural (Xunta de Galicia, España) y la Federación Galega de Caza.

Apéndice A . Dato suplementario La siguiente es información suplementaria a este artículo:

Referencias

Baneth et al., 2015 G. Baneth , M. Florin-Christensen , L. Cardoso , L. Schnittger Reclasificación de Theileria annae como Babesia vulpes sp. nov Parasites Vectors , 8 ( 2015 ) , p. 207

Barandika et al., 2006 JF Barandika , E. Berriatua , M. Barral , RA Juste , P. Anda , AL García-Pérez Factores de riesgo asociados con la distribución de especies de garrapatas ixodídicas en el País Vasco en España Medicina. Veterinario. Entomol. , 20 ( 2006 ) , pp. 177 - 188 CrossRef Ver registro en Scopus

Barandika et al., 2016 JF Barandika , A. Espí , B. Oporto , AD Cerro , M. Barral , I. Povedano , AL García-Pérez , A. Hurtado Ocurrencia y diversidad genética de piroplasmas y otras apicomplexias en carnívoros salvajes Parasitol. Abierto , 2 ( 2016 )

Bartley et al., 2016 PM Bartley , C. Hamilton , C. Wilson , EA Innes , F. Katzer Detección del ADN de Babesia annae en muestras de exudados pulmonares de zorros Rojos ( Vulpes vulpes ) en Gran Bretaña Parasites Vectors , 9 ( 2016 ) , p. 84

Beck et al., 2009 R. Beck , L. Vojta , V. Mrljak , A. Marinculić , A. Beck , T. Zivicnjak , SM Cacciò Diversidad de Babesia y especies de Theileria en perros sintomáticos y asintomáticos en Croacia En t. J. Parasitol. , 39 ( 2009 ) , pp. 843 - 848 Artículo Descargar PDF Ver registro en Scopus

Birkenheuer et al., 2010 AJ Birkenheuer , B. Horney , M. Bailey , M. Scott , B. Sherbert , V. Catto , HS Marr , AT Camacho , AE Ballman Babesia infecciones similares a microti son frecuentes en zorros de América del Norte Veterinario. Parasitol. , 172 ( 2010 ) , pp. 179 - 182 Artículo Descargar PDF Ver registro en Scopus

Camacho et al., 2001 AT Camacho , E. Pallas , JJ Gestal , FJ Guitián , AS Olmeda , HK Goethert , SR Telford Infección de perros en el noroeste de España con un agente tipo Babesia microti Veterinario. Rec. , 149 ( 2001 ) , pp. 552 555 CrossRef Ver registro en Scopus Camacho et al., 2003

AT Camacho , E. Pallas , JJ Gestal , FJ Guitián , AS Olmeda , SR Telford , A. Spielman Ixodes hexagonus es el principal candidato como vector de Theileria annae en el noroeste de España Veterinario. Parasitol. , 112 ( 2003 ) , pp. 157 - 163 Artículo Descargar PDF Ver registro en Scopus

Cardoso et al., 2013

  • L. Cardoso , HC Cortés , A. Reis , P. Rodrigues , M. Simões , AP Lopes , MJ Vila-Viçosa , D.

Talmi-Frank , O. Eyal , L. Solano-Gallego , G. Baneth Prevalencia de Babesia microti -como infección en zorros rojos ( Vulpes vulpes ) de Portugal Veterinario. Parasitol. , 196 ( 2013 ) , pp. 90 - 95 Artículo Descargar PDF Ver registro en Scopus

Checa et al., 2017

  • R. Checa , A. Montoya , N. Ortega , JL González-Fraga , A. Bartolomé , R. Gálvez , V. Marino , G.

Miró Eficacia, seguridad y tolerancia del dipropionato de imidocarb versus atovacuona o buparvacuona más azitromicina utilizada para tratar enfermedades perros infectados naturalmente con el piroplasma tipo Babesia microti Parásitos Vectores , 10 ( 2017 )

Clancey et al., 2010

  • N. Clancey , B. Horney , S. Burton , A. Birkenheuer , S. McBurney , K. Tefft

Babesia ( Theileria ) annae en un zorro rojo ( Vulpes vulpes ) de la isla del príncipe Eduardo

Poder. J. Wildl. Dis. , 46 ( 2010 ) , pp. 615 - 621 CrossRef Ver registro en Scopus

Criado-Fornelio et al., 2003

  • A. Criado-Fornelio , A. Martínez-Marcos , A. Buling-Saraña , JC Barba-Carretero

Estudios moleculares sobre Babesia , Theileria y Hepatozoon en el sur de Europa: parte I

Epizootiol. Aspectos Vet. Parasitol. , 113 ( 2003 ) , pp. 189 - 201 Artículo Descargar PDF Ver registro en Scopus

Dezdek et al., 2010

  • D. Dezdek , L. Vojta , S. Curković , Z. Lipej , Z. Mihaljević , Z. Cvetnić , R. Beck

Detección molecular de Theileria annae y Hepatozoon canis en zorros ( Vulpes vulpes ) en Croacia

Veterinario. Parasitol. , 172 ( 2010 ) , pp. 333 - 336 Artículo Descargar PDF

Duscher et al., 2014

GG Duscher , H.-P. Führer , A. Kübber-Heiss Fox en la vigilancia molecular de la sangre y el tejido de zorro para la aparición de patógenos transmitidos por garrapatas en Austria Parasites Vectors , 7 ( 2014 ) , p. 521 CrossRef

Estrada-Peña et al., 2004

  • A. Estrada-Peña , A. Bouattour , JL Camicas , AR Walker

Garrapatas de animales domésticos en la región mediterránea Una guía para la identificación de especies , 131 ( 2004 )

Falkenö et al., 2013

  • U. Falkenö , S. Tasker , E. Osterman-Lind , HW Tvedten

Theileria annae en un joven perro sueco Acta Vet. Scand. , 55 ( 2013 ) , p. 50 CrossRef Ver registro en Scopus

Farkas et al., 2015

  • R. Farkas , N. Takács , Á. Hornyák , Y. Nachum-Biala , S. Hornok , G. Baneth

Primer informe sobre Babesia cf. infección microti de zorros rojos ( Vulpes vulpes ) de Hungría Parasites Vectors , 8 ( 2015 ) , p. 55 CrossRef

Fidalgo et al., 2009 LE Fidalgo , A. López-Beceiro , L. Rigueira , L. Espino O raposo en Galicia Observatorio Galego da Caza ( 2009 ) Santiago de Compostela

Fukumoto et al., 2001

  • S. Fukumoto , X. Xuan , S. Shigeno , E. Kimbita , I. Igarashi , H. Nagasawa , K. Fujisaki , T.

Mikami Desarrollo de un método de reacción en cadena de la polimerasa para diagnosticar la infección por Babesia gibsoni en perros

  • J. Vet. Medicina. Sci. , 63 ( 2001 ) , pp. 977 - 981

CrossRef Ver registro en Scopus

García, 2006

AT García

Piroplasma infección en perros en el norte de España

Veterinario. Parasitol. , 138 ( 2006 ) , pp. 97 - 102 Artículo Descargar PDF Ver registro en Scopus Gil Collado et al., 1979

  • J. Gil Collado , JL Guillén Llera , LM Zapatero Ramos

Claves para la identificación de los Ixodidea españoles (adultos) , 39 ( 1979 ) , pp. 107 - 118 Ver registro en Scopus

Gimenez et al., 2009

  • C. Giménez , N. Casado , A. Criado-Fornelio , FA de Miguel , G. Domínguez-Peñafiel

Un estudio molecular de Piroplasmida y Hepatozoon aislado de animales domésticos y salvajes en

Burgos (norte de España) Veterinario. Parasitol. , 162 ( 2009 ) , pp. 147 - 150 Artículo Descargar PDF Ver registro en Scopus

Gortázar, 1997 Gortázar, C., Ecología y Patología del Zorro (Vulpes Vulpes, L.) en el Valle Medio del Ebro. Facultad de Veterinaria. Universidad de Zaragoza, Zaragoza 1997. Guitián et al., 2003 FJ Guitián , AT Camacho , SR Telford Estudio de control de casos de infección canina por un piroplasma de Babesia microti -like recientemente reconocido Prev. Veterinario. Medicina. , 61 ( 2003 ) , pp. 137 - 145 Artículo Descargar PDF Ver registro en Scopus

Irwin, 2010 PJ Irwin Canbes babesiosis Veterinario. Clin. North Am. Pequeño Anim. Pract. , 40 ( 2010 ) , pp. 1141 - 1156 Artículo Descargar PDF Ver registro en Scopus

Lledó et al., 2010

  • L. Lledó , C. Giménez-Pardo , G. Domínguez-Peñafiel , R. Sousa , MI Gegúndez , N. Casado , A.

Criado Detección molecular de hemoprotozoos y especies de Rickettsia en artrópodos recolectados de animales salvajes en la provincia de Burgos, España Vector Bordo Zoonotic Dis. , 10 ( 2010 ) , pp. 735 - 738 CrossRef Ver registro en Scopus

 

Manilla e Iori, 1992

G.

Manilla , A. Iori

[Clave ilustrada de las garrapatas de Italia. I. Etapas larvales de las especies de la subfamilia

Ixodinae (Acari Ixodoidea, Ixodidae)] Parassitologia , 34 ( 1992 ) , pp. 83 - 95 Ver registro en Scopus

 

Miró et al., 2015

G.

Miró , R. Checa , A. Paparini , N. Ortega , JL González-Fraga , A. Gofton , A. Bartolomé , A.

Montoya , R. Gálvez , PP Mayo , P. Irwin T heileria annae (sin contar Babesia infección por microti- like) en perros en el noroeste de España

detectada mediante técnicas de diagnóstico directo e indirecto: informe clínico de 75 casos Parasites Vectors , 8 ( 2015 ) , p. 217 Ver registro en Scopus

Najm et al., 2014 N / A. Najm , E. Meyer-Kayser , L. Hoffmann , I. Herb , V. Fensterer , K. Pfister , C. Silaghi Un estudio molecular de Babesia spp. y Theileria spp. en zorros rojos ( Vulpes vulpes ) y sus garrapatas de Thuringi, Alemania Ticks Tick-Borne Dis. , 5 ( 2014 ) , pp. 386 - 391 Artículo Descargar PDF Ver registro en Scopus

 

Otranto et al., 2015

D.

Otranto , C. Cantacessi , M. Pfeffer , F. Dantas-Torres , E. Brianti , P. Deplazes , C. Genchi , V.

Guberti , G. Capelli El papel de los cánidos silvestres y los felinos en la propagación de parásitos a los perros y gatos en Europa. Parte I: protozoos y agentes transmitidos por garrapatas Veterinario. Parasitol. , 213 ( 2015 ) , pp. 12 - 23 Artículo Descargar PDF Ver registro en Scopus

René-Martellet et al., 2015

M.

René-Martellet , CV Moro , J. Chêne , G. Bourdoiseau , L. Chabanne , P. Mavingui

Actualización sobre la epidemiología de la babesiosis canina en el sur de Francia BMC Vet. Res. , 11 ( 2015 ) , p. 223 Sándor et al., 2017 AD Sándor , G. D'Amico , CM Gherman , MO Dumitrache , C. Domsa , AD Mihalca Mesocarnívoros y macroparasitos: la altitud y el uso de la tierra predicen las garrapatas que se producen en zorros rojos ( Vulpes vulpes ). Parasit Vectores , 10 ( 2017 ) , p. 173

Simões et al., 2011 PB Simões , L. Cardoso , M. Araújo , Y. Yisaschar-Mekuzas , G. Baneth Babesiosis debido al canino Babesia microti -como pequeño piroplasma en perros- primer informe de Portugal y posible transmisión vertical Parasites Vectors , 4 ( 2011 ) , p. 50

CrossRef Solano-Gallego et al., 2016

  • L. Solano-Gallego , Á. Sainz , X. Roura , A. Estrada-Peña , G. Miró

Una revisión de la babesiosis canina: la perspectiva europea Parasites Vectors , 9 ( 2016 ) , p. 336

Tabar et al., 2009 MD Tabar , O. Francino , L. Altet , A. Sánchez , L. Ferrer , X. Roura Estudio de PCR de patógenos transmitidos por vectores en perros que viven en y alrededor de Barcelona, un área endémica para la leishmaniasis Veterinario. Rec. , 164 ( 2009 ) , pp. 112 116

CrossRef Ver registro en Scopus Yeagley et al., 2009 TJ Yeagley , MV Reichard , JE Hempstead , KE Allen , LM Parsons , MA White , SE Little , JH Meinkoth Detección de Babesia gibsoni y el pequeño canino Babesia español aislado en muestras de sangre obtenidas de perros confiscados de operaciones de peleas de perros Mermelada. Veterinario. Medicina. Assoc. , 235 ( 2009 ) , pp. 535 539

CrossRef Ver registro en Scopus Zanet et al., 2014

  • S. Zanet , A. Trisciuoglio , E. Bottero , IG de Mera , C. Gortazar , MG Carpignano , E. Ferroglio

Piroplasmosis en la vida silvestre: Babesia y Theileria afectan a los ungulados libres y carnívoros en

los Alpes italianos Parasites Vectors , 7 ( 2014 ) , p. 70

CrossRef