Vous êtes sur la page 1sur 16

See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/323249504

Notch expressed by osteocytes plays a critical


role in mineralisation

Article in Journal of Molecular Medicine · February 2018


DOI: 10.1007/s00109-018-1625-x

CITATIONS READS

0 57

9 authors, including:

Jin Shao Dung Nguyen


Queensland University of Technology Dartmouth College
5 PUBLICATIONS 35 CITATIONS 20 PUBLICATIONS 44 CITATIONS

SEE PROFILE SEE PROFILE

Rong Huang
Queensland University of Technology
6 PUBLICATIONS 23 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Dietary fats and Osteoarthritis View project

OCT4; inflammation; dental pulp cell View project

All content following this page was uploaded by Jin Shao on 23 February 2018.

The user has requested enhancement of the downloaded file.


Journal of Molecular Medicine
https://doi.org/10.1007/s00109-018-1625-x

ORIGINAL ARTICLE

Notch expressed by osteocytes plays a critical role in mineralisation


Jin Shao 1,2 & Yinghong Zhou 1,2 & Jinying Lin 2,3 & Trung Dung Nguyen 4,5 & Rong Huang 1,2 & Yuantong Gu 2,4 &
Thor Friis 1,2 & Ross Crawford 1,2,6 & Yin Xiao 1,2

Received: 20 August 2017 / Revised: 4 January 2018 / Accepted: 5 February 2018


# Springer-Verlag GmbH Germany, part of Springer Nature 2018

Abstract
Notch is actively involved in various life processes including osteogenesis; however, the role of Notch signalling in
the terminal mineralisation of bone is largely unknown. In this study, it was noted that Hey1, a downstream target of
Notch signalling was highly expressed in mature osteocytes compared to osteoblasts, indicating a potential role of
Notch in osteocytes. Using a recently developed thermosensitive cell line (IDG-SW3), we demonstrated that dentin
matrix acidic phosphoprotein 1 (DMP1) expression was inhibited and mineralisation process was significantly altered
when Notch pathway was inactivated via administration of N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine
t-butyl ester (DAPT), an inhibitor of Notch. Dysregulation of Notch in osteocyte differentiation can result in
spontaneous deposition of calcium phosphate on collagen fibrils, disturbed transportation of intracellular mineral
vesicles, alteration of mineral crystal structure, decreased bonding force between minerals and organic matrix, and
suppression of dendrite development coupled with decreased expression of E11. In conclusion, the evidence pre-
sented here suggests that Notch plays a critical role in osteocyte differentiation and biomineralisation process.

Key messages
& Notch plays a regulatory role in osteocyte phenotype.
& Notch modulates the mineralisation mediated by
osteocytes.
& Notch activity influences the ultrastructural properties of
bone mineralisation.

Keywords Notch . Mineralisation . Osteocytes . DMP1 . Osteoblasts

Jin Shao and Yinghong Zhou contributed equally to this work.


Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s00109-018-1625-x) contains supplementary
material, which is available to authorized users.

* Yin Xiao 4
School of Chemistry, Physics and Mechanical Engineering, Science
yin.xiao@qut.edu.au and Engineering Faculty, Queensland University of Technology,
Brisbane, QLD 4059, Australia
1
Institute of Health and Biomedical Innovation, Queensland 5
Present address: Department of Aerospace and Mechanical
University of Technology, 60 Musk Avenue, Kelvin Grove, Engineering, College of Engineering, University of Notre Dame,
Brisbane, QLD 4059, Australia Notre Dame, IN 46556, USA
2
The Australia–China Centre for Tissue Engineering and Regenerative 6
The Prince Charles Hospital, Brisbane, QLD 4059, Australia
Medicine (ACCTERM), Queensland University of Technology,
Brisbane, QLD 4059, Australia
3
Department of Implantology, Xiamen Stomatological Research
Institute, Xiamen Stomatological Hospital, Fujian 361000, China
J Mol Med

Introduction the average number of osteocytes in adult human is around 42


billion and those cells form 23 trillion connections via den-
Bone is composed of 50 to 70% mineral which provides it drites [21]. The widely accepted view is that osteocytes com-
with mechanical rigidity and strength. It is osteocyte that mod- municate with each other by direct gap junction and indirect
ulates the mineralisation of organic bone matrix, also called secreting signalling [22]. In addition to this direct cell-to-cell
osteoid, which is secreted by osteoblasts [1, 2]. Osteocyte, contact, osteocytes also deliver some signalling molecules in-
which is derived from osteoblast, composes the most abun- cluding prostaglandin E2 and ATP to communicate with adja-
dant cell type in bone. The definition between osteoblast and cent cells [23, 24]. Apart from those well-documented signal
osteocyte is ambiguous as the transition is a successive pro- propagation mechanisms, another important type of signalling
cess. Here, we define osteocyte as the cell being embedded or pathway bound on the cell membrane is Notch signalling
have been embedded in bone matrix. This expression is more pathway. Notch signalling pathway in mammals contains
accurate because as long as the osteoblast stops secreting ma- single-pass transmembrane ligands (Jagged 1, 2 and Delta-
trix and is buried by matrix secreted by the adjacent cells, it like 1, 3 and 4) and four epidermal growth factor (EGF)-like
simultaneously stops proliferation and generates cell process- Notch receptors (Notch 1–4) that display both redundant and
es to begin a new cell fate. Under this definition, even the distinct functions [25]. The activation of receptors initiates a
mature osteoblasts are still located on the bone surface, al- sequence of proteolytic events with the assistance of ADAM
though mature osteoblasts are regarded to be buried in bone metalloprotease and γ-secretase and eventually releases
matrix at early stage in other literatures. Notch intracellular domain (NICD). NICD then translocates
Recent observations have revealed that an intracellular into nucleus and binds to the DNA-binding protein compound
amorphous calcium phosphate precursor is transiently secret- of RBP-jκ and MAML 1–3 [26, 27] to control specific gene
ed by bone cells and deposited within the gap zones inside the transcription, through transcriptional repressors hairy and en-
type-I collagen fibril where it transforms into hydroxyapatite hancer of split (Hes1–7) and hairy and enhancer of split relat-
[3–5]. It is well known that dentin matrix acidic phosphopro- ed with YRPW motif 1 (Hey1, 2 and L) [28, 29].
tein 1 (DMP1) secreted by osteocytes plays a crucial role in A live imaging experiment has shown that osteocytes are
mineralisation. Toyosama et al. have provided in situ informa- not static; actually, they perpetually expand and retract the
tion that DMP1 mRNA can be found mainly in osteocytes but dendrites suggesting a hand-shake manner of communication
not in osteoblasts, which agrees with our definition mentioned [30]. The motions of dendrites provide topological basis to
above [6]. DMP1 belongs to the SIBLING (small integrin- Notch signalling regulation [29, 31, 32]. However, Notch
binding ligand N-linked glycoproteins) family which com- functions in osteocytes are largely unknown and this study
poses the majority of non-collagenous proteins in bone. The investigated the role of Notch in the regulation of osteocyte
highly phosphorylated property of DMP1 makes it possible to mineralisation.
regulate mineral formation and organisation, as well as phos-
phate homeostasis [7–9]. This fact shows that osteoblast and
osteocyte may play strikingly different roles in osteogenesis. It Materials and methods
appears that osteoblasts produce a large amount of phosphate
(Pi) through ALP activity and then osteocytes utilise the phos- Immunohistochemistry
phate to phosphorylate matrix proteins including DMP1 [10].
The phosphate transfer actually provides an explanation of The study is approved by the Animal Ethics Committee of
phosphate resource for mineralised tissues, which also indi- Queensland University of Technology. Six femoral samples
cates osteocytes actively regulate the mineralisation processes. from 6-month female Wistar rats were collected and
DMP1 is expressed by relatively mature osteocytes, however, decalcified in 10% ethylenediaminetetraacetate (EDTA), then
osteocytes also express an early marker, E11, also known as embedded in paraffin. Serial sections of 5-μm-thick were cut
gp38 or podoplanin which is not expressed by osteoblasts [11, from the paraffin blocks with a microtome for immunohisto-
12]. It has been reported that E11 is required for the mainte- chemical study [33]. Briefly, after dewaxing and hydration,
nance of podocyte processes [13] and overexpression of E11 slides were heated at 75 °C in pressure cooker for antigen
causes cell membrane extensions in keratinocytes [14]. This retrieval. The endogenous peroxidase activity was eliminated
data together indicate that E11 regulates the dendrites forma- by incubating in 3% H2O2 for 15 min. Non-specific protein
tion during the transition from osteoblast to osteocyte. The binding was blocked with 10% swine serum for 1 h. Samples
dendritic shape is not only the morphological characteristic were incubated with primary antibodies against Hes1
of osteocytes, but also plays a role in the mechanosensing, (ab71559, Abcam; 1:100) overnight at 4 °C, followed by in-
signals communication and mineral homeostasis [15–19]. cubation with a biotinylated swine-anti-mouse, rabbit, goat
The network composed by osteocytes is complex and rem- secondary antibody (DAKO) for 15 min at room temperature,
iniscent of a neuronal system [20]. A recent research estimated and then with streptavidin peroxidase (DAKO) for 15 min.
J Mol Med

Diaminobenzidine (DAB) solution (DAKO) was then added a 21G needle. Single cell suspension was prepared by
for 3 min to visualise the antibody complexes. The samples passing the cell clumps through an 18G needle. The ob-
were counterstained with Mayer’s haematoxylin for 15 s. tained cells were blended and seeded into the tissue cul-
Images of the stained slides were then captured using Axion ture flasks containing DMEM with 100 U/mL of penicil-
software under a light microscope (Carl Zeiss Microimaging) lin, 100 μg/mL of streptomycin and 10% FBS. On day 2,
at various magnifications. half of the medium containing non-adherent cells was
replaced with fresh medium. The remaining attached cells
Immunofluorescence study were bone marrow cells according to the direct plastic
adhesion method which is widely used in isolation of
IDG-SW3 cells (EKC001, Kerafast) and rat bone marrow BMCs [36, 37]. Medium was changed completely on
cells (BMCs) were plated on 8-well chamber slides day 4. Only cells at an early passage (P1–P2) were used
(177,445, Lab-Tek) at a density of 4000 cells per well. in this study. After cells reached 70–80% confluence, me-
The cells were washed three times with ice-cold PBS dium was changed completely with DMEM containing
followed by fixing with 2% paraformaldehyde (PFA) for 100 U/mL of penicillin, 100 μg/mL of streptomycin and
10 min at room temperature. The cells were then incubat- 10% FBS supplemented with 50 μg/mL of ascorbic acid,
ed with 0.2% triton for cell permeabilisation. Non-specific 10 nM of dexamethasone and 8 mM of β-
proteins were blocked with the incubation of 1% BSA in glycerophosphate (1,043,003, D4902 and G9891, Sigma-
PBST for 30 min at room temperature. Actin cytoskeleton Aldrich). Medium was changed every 2–3 days for the
was stained with Alexa Fluor 568 phalloidin (Life duration of the experiment.
Technologies Pty Ltd., Australia) in permeabilised IDG- IDG-SW3 cells were expanded in proliferation conditions
SW3 cells. The primary antibodies, rabbit anti-Hes1 at 33 °C in α-MEM (12,571, Gibco) with 10% FBS, 100 U/
(ab71559, Abcam; 1:100) and mouse anti-E11 (ab10288, mL of penicillin, 50 μg/mL of streptomycin and 50 U/mL of
Abcam; 1:100), in PBS with 1% BSA were applied and IFN-γ (PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/
incubated at room temperature for 1 h. The samples were mL in 0.2 M acetic acid)-coated plates. To induce differentia-
then incubated with goat anti-mouse Alex Fluor 488 tion towards osteocytes, IDG-SW3 cells were plated at
(A31560, Life Technologies) and goat anti-rabbit Alex 80,000 cells/cm2 in osteogenic differentiation conditions at
Fluor 647 (A21246, Life Technologies) at room tempera- 37 °C with the supplementation of 50 μg/mL of ascorbic acid
ture for 30 min to detect the primary antibodies. The and 4 mM β-glycerophosphate in the absence of IFN-γ.
slides were counterstained with DAPI (D1306, Life Collagen-coated plates were necessary for both proliferation
Technologies) and mounted with ProLong® Gold and differentiation culture [38]. To inhibit Notch signalling
Antifad e Reagent (P10144 , L ife Tec hnologies). pathway, N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-
Phalloidin (A12379, Life Technologies) staining was per- phenylglycine t-butyl ester (DAPT) (D5942, Sigma) diluted
formed to detect cytoskeleton changes. The images were
captured using Nikon EclipseTi-S microscope and Leica
SP5 confocal microscope. Cell counting was performed
Table 1 The primers used for RT-qPCR
using Image J software. The DAPT-treated cells and con-
trol group stained with E11 were also used for quantita- Fwd_DMP1 GCATCCTGCTCATGTTCCTTTG
tive analysis of cell dendrites. The procedure and param- Rev_DMP1 GAGCCAAATGACCCTTCCATTC
eters settings were described previously by Ren et al. Fwd_E11 GTCCAGGCGCAAGAACAAAG
[34]. Unpaired Student’s t test was performed to deter- Rev_E11 GGTCACTGTTGACAAACCATCT
mine the statistical significance. Fwd_Hes1 CAGCTGACAAGGAGGACTGA
Rev_Hes1 GTCACCTCGTTCATGCACTC
Cell culture Fwd_Notch1 TGTTGTGCTCCTGAAGAACG
Rev_Notch1 TCCATGTGATCCGTGATGTC
Rat BMCs were isolated and cultured based on protocols Fwd_Rbpj CTCCACCCAAACGACTCACT
from our previously published study [35]. Briefly, six 12- Rev_Rbpj CATCCATCTCGCTTCCATTT
week-old female Wistar rats were sacrificed by CO2 as- Fwd_SOST TTCAGGAATGATGCCACAGA
phyxiation. Femurs and tibias were dissected from sur- Rev_SOST GTCAGGAAGCGGGTGTAGTG
rounding tissues. The epiphyseal growth plates were re- Fwd_MEPE CATGAAGATGCAGGCTGTGT
moved and the marrow was collected by flushing with Rev_MEPE TCCTCTTTGCCTTCATCCAC
Dulbecco’s Modified Eagle Medium (DMEM) (11,885, Fwd_Universal_GAPDH TCAGCAATGCCTCCTGCAC
Gibco), containing 100 U/mL of penicillin, 100 μg/mL Rev_Universal_GAPDH TCTGGGTGGCAGTGATGGC
of streptomycin and 10% fetal bovine serum (FBS) with
J Mol Med

in DMSO was added into the culture at concentrations indi- RNAimax (Invitrogen) according to the manufacturer’s in-
cated. The same amount of DMSO was applied in control. structions and previous research [39]. Briefly, IDG-SW3 cells
were seeded on 6-well plates at 1 × 106 cells per well 1 day
siRNA-mediated knockdown of Hes1 before transfection. Fifty nanometer siRNA targeting Hes1
and fluorescent universal negative Control siRNA (Sigma-
IDG-SW3 cells were transfected with mouse siRNA oligonu- Aldrich) were transfected with RNAimax reagent
cleotides targeting Hes1 (NM_008235 Sigma-Aldrich) using (Invitrogen) in opti-MEM (Gibco) without serum for 6 h
J Mol Med

ƒFig. 1 Notch expression in osteocytes. a Immunohistochemistry staining spectrophotometer (Thermo Fisher Scientific).
of Hes1 in rat femur showed positive staining in osteocytes (black arrow) Complementary DNA was synthesised from 500 ng of total
and negative staining in osteoblasts (black arrowhead) (scale bar 20 μm).
H&E staining image shows that the black arrow indicates the osteocytes
RNA using DyNAmo™ cDNA Synthesis Kit (F-470L,
embedded in bone matrix, while the white arrow shows the typical cubic Finnzymes, Thermo Scientific) following the manufacturer’s
osteoblasts located on the bone surface (scale bar 50 μm). b instructions [40]. RT-qPCR primers (Table 1) were designed
Immunofluorescence staining of Hes1 in rBMCs in osteogenic culture based on cDNA sequences from the NCBI Sequence data-
of 7 and 14 days. The rBMCs cultured in osteogenic conditions for
14 days representing late differentiation stage expressed high level of
base. SYBR Green qPCR Master Mix (4,344,463,
Hes1 (scale bar 100 μm). c Bar graph counted Hes1-positive cells ratio Invitrogen) was used for detection and the target mRNA ex-
according the immunofluorescence staining results. The number of Hes1- pressions were assayed on the 7500 fast real-time PCR system
positive cells significantly increased when rBMCs were osteogenically (Applied Biosystems). Experiments were performed in tripli-
differentiated for 14 days in comparison with 7 days. n = 3. *p < 0.05. d
and e Western blots of Hes1 in rBMCs and IDG-SW3 cell line. Hes1
cate. The mean cycle threshold (Ct) value of each target gene
expression at protein level increased during late osteogenic differentiation was normalised against the Ct value of the house keeping gene
of rBMCs and IDG-SW3 cell line. Bar graph represented relative bands GAPDH.
intensity. *p < 0.05, compared with day 7. f RT-qPCR results of IDG-
SW3 cell line in osteogenic culture. Hes1, Notch1 and Rbpj all increased
during differentiation. n = 3 wells per group. *p < 0.05, compared with
Rbpj luciferase reporter assay
day 1. g Luciferase reporter test showed Rbpj activity also increased in
IDG-SW3 cell line. n = 3 wells per group. **p < 0.01, compared with day In order to monitor the Notch signalling activity, a Rbpj lucif-
1. (one-way ANOVA with Bonferroni post-hoc test) erase reporter kit (CCS-014L, QIAGEN) was used in IDG-
SW3 cell culture. The Rbpj protein is a direct co-modulator of
before cells were washed with PBS and changed to osteogenic Notch signalling; therefore, its activity can represent canonical
medium. Samples were collected at 1, 3 and 7 days after Notch signalling. This reporter construct encodes a firefly lu-
transfection. ciferase gene under the control of tandem repeats of Rbpj
transcriptional response element; therefore, the Notch signal-
Western blot ling can be quantitatively analysed via measurement of lucif-
erase intensity. IDG-SW3 cells were seeded on 96-well plates
The whole cell lysates were collected by adding 250 μL cell and transfected with 0.2 μg of reporter pre-mixed with 1.2 μl
lysis buffers with protease inhibitor (cOmplete, EDTA-free Lipofectamine 2000 (11,668,019, Thermo Fisher) in 25 μl
04693132001, Roche) and phosphatase inhibitor Opti-MEM (31,985,070, Gibco) according to manufacturer’s
(PhosSTOP, 04906845001, Roche) for the Western blotting instructions. Luciferase activity was detected by Dual-
detection. A total of 15 μg of proteins from each sample were Luciferase® Reporter Assay System (E1910, Promega) and
separated on SDS-PAGE gels and then transferred onto a ni- measured using a POLARstar Omega microplate reader
trocellulose membrane (Pall Corporation). After being (BMG Labtech). Three independent experiments were per-
blocked in Odyssey blocking buffer for 1 h (P/N 927– formed in triplicate.
40,000, LI-COR Biosciences), the membranes were incubated
with primary antibodies against Hes1 (1:1000, ab71559, Intracellular calcium concentration assay
Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a
kind gift from Professor Jerry Feng of the Texas A&M The calcium concentration of cells was determined by the
University College of Dentistry) and α-Tubulin (1:2000, calcium detection kit (ab102505, Abcam) following the man-
ab15246, Abcam) overnight at 4 °C. The membranes were ufacturer’s instructions. The optical densities (ODs) were test-
then incubated with anti-mouse/rabbit fluorescence conjugat- ed on a Bio-Rad microplate reader at 575 nm. All the results
ed secondary antibodies at 1:10,000 dilutions for 1 h at room were normalised to the (-DPAT) group. Three independent
temperature. The protein bands were visualised using the experiments were performed in triplicate.
Odyssey Infrared Imaging System (LI-COR Biosciences).
The relative intensity of protein bands was quantified using Scanning electron microscope
Image J software. The experiments were repeated three times
and a representative blot was displayed. SEM was used to examine the surface structure of IDG-SW3
cells. The previously described critical point drying protocol
Quantitative reverse transcription polymerase chain was chosen in this study [41, 42]. The cells cultured for
reaction 3 weeks were completely rinsed and fixed in 2.5% glutaralde-
hyde at 4 °C for 1 h. Then post-fixation was carried out with
Total RNA was extracted using TRIzol reagent (15596-018, 1% osmium tetroxide followed by dehydration through a se-
Life Technologies) for RT-qPCR detection. Measurement of ries of increasing concentrations of ethanol (50, 70, 90, 100
RNA yield was performed using NanoDrop 1000 and 100% vol/vol) for 10 min each. After drying with 100%
J Mol Med
J Mol Med

ƒFig. 2 Inhibition of Notch disturbed osteocyte marker expression. a removal. The AFM system Nanosurf FlexAFM
Representative images of Western blots showed IDG-SW3 cell line (Nanosurf AG, Switzerland) and the rectangular cantilever
expressed DMP1 and E11. The expression of DMP1 and E11 was
inhibited remarkably after Notch signaling was blocked by DAPT appli-
ACLA (AppNano) were used. The cantilever tip has py-
cation. b Relative band intensity was calculated based on Western blotting ramidal tip with the front angle of 9°. The cantilever
results. n = 3, *p < 0.05, **p < 0.01, comparisons between the −DAPT spring constant was determined to be around 40.46 N/m.
and +DAPT groups. c RT-qPCR results were consistent with Western The sensitivity calibration S of the cantilever was per-
blots. n = 3, *p < 0.05, **p < 0.01, comparisons between the −DAPT
and +DAPT groups. d Live cell fluorescent images showed GFP activity
formed by indenting a hard surface to measure the slope
representing DMP1 expression gradually increased during IDG-SW3 cell of the force-height curve. The lateral detachment force
osteogenic differentiation. The increasing concentrations of DAPT added was determined based on the total compression of the
into the culture system led to a gradual decrease of GFP intensities. There cantilever, probe geometry and cantilever orientation. In
was nearly no GFP expression when the concentration of DAPT reached
50 μM. The phase images of osteogenic culture at 14 days showed min-
addition, the detachment forces required to complete high,
eral nodules formed in normal IDG-SW3 cells, while the mineralisation medium and low levels of mineral removal which had
was impeded after the application of DAPT (scale bar 50 μm) been defined as 42, 18 and 8% removal, respectively,
were recorded and statistically analysed.

hexamethyldisilazane (HMDS), samples were coated with 1– Statistical analysis


2 nm gold-palladium and measured under Zeiss Sigma
variable-pressure (VP) field-emission scanning electron mi- Different statistical methods and comparisons used as in-
croscope (SEM). dicated in the figures and legends. Briefly, for two-sample
data sets (control vs. experimental condition) unpaired
Transmission electron microscope and selected area Student’s t test was performed in this study. For data sets
electron diffraction with more than two conditions or different time points,
two-way ANOVA with Bonferroni post-hoc test was per-
Transmission electron microscope (TEM) generates high res- formed. All statistical analyses were conducted with
olution images of ultra-thin specimen which makes it an ap- Prism v6.05. p ≤ 0.05 was set as statistical significance.
propriate method to observe the combination of mineral crys-
tals and collagen and intracellular ultrastructure like mineral
particles in our project [43]. The fixation and dehydration Results
process for the TEM was performed similarly to that for
SEM mentioned above. Briefly, mineralised cultures were Notch target genes are expressed by osteocytes
fixed in 2.5% glutaraldehyde at 4 °C for 1 h, postfixed in
osmium tetroxide, dehydrated in a graded ethanol series, treat- In order to examine the Notch expression pattern in osteo-
ed with acetonitrile and finally infiltrated with a Quetol-based cytes, we chose Hes1, a downstream target of Notch signal-
resin. Embedded samples were polymerised at 60 °C for 24 h, ling, for immunohistochemistry staining of rat femur. We
sectioned (75 nm) using Leica EM UC7 ultramicrotome and found that Hes1 is highly expressed in the osteocytes buried
collected on bare 300 mesh copper TEM grids followed by in bone matrix, while osteoblasts located at the surface of bone
post-staining with uranyl acetate and lead citrate. TEM obser- matrix were almost negatively stained. H&E staining was per-
vation was performed using JOEL 1400 at 80 kV. Selected formed to further indicate the location of osteoblasts on the
area electron diffraction (SAED) is useful in distinguishing the bone surface and osteocytes embedded in bone matrix
crystal orientation to elucidate the arrangement of mineral, (Fig. 1a). We also used in vitro osteogenic culture of rat bone
especially hydroxyapatite (HA) in bone tissue [44]. The sam- marrow cells (rBMCs) to confirm the expression of Hes1.
ples for SAED were prepared as described for TEM. The After 14 days of osteogenic culture, which represented the late
diffraction pattern of normal bone was set as the standard stage of osteogenesis with mineral nodule formation, Hes1
control [45]. was highly expressed in rBMCs compared with 7-day culture
as shown in immunofluorescent staining (Fig. 1b, c). This
Atomic force microscopy result was consistent with the Western blot of rBMCs in oste-
ogenic culture which showed Hes1 was upregulated after
To obtain new insights of the mechanical property of the 10 days, representing the late stage of differentiation (Fig.
mineral nodules, the bond between mineral and collagen 1d). The IDG-SW3 cells under osteogenic conditions also
were measured using atomic force microscopy (AFM) as showed the same expression pattern of Hes1 (Fig. 1e, f). To
described previously [46]. Briefly, samples were prepared further confirm these findings, we used the Rbpj luciferase
as the protocol for SEM, images were taken before and reporter to transfect the IDG-SW3 cells, and a significant in-
after the AFM testing to calculate the level of mineral crease of Rbpj activities was observed in the late
J Mol Med

differentiation stage of osteocytes (Fig. 1g), indicating the particles were closely attached to collagen fibrils (Fig. 3b,
canonical Notch signalling pathway was activated in these c); in contrast, the mineral particles were randomly deposited
osteocytes. and showed lack of tight contacts to collagen (Fig. 3E, F).
Intracellular mineralisation is a key step for normal
Inhibition of Notch signalling negatively affects biomineralisation. In this study, it was noted that intracellular
expression of osteocyte markers mineral vesicles with appropriate size were observed in the
plasma of IDG-SW3 cells (Fig. 3g, h). However, when cul-
For a decade, DMP1 has been considered as a critical tured with the supplementation of DAPT, the intracellular
marker of osteocyte which has an important role in mineral particles were much smaller and sparsely distributed
mineralisation. The IDG-SW3 cells express GFP under in limited localisation in the plasma (Fig. 3i, j). The calcium
the direction of DMP1 promotor. Moreover, this cell line concentration in cells had been determined and the results
maintains proliferation at 33 °C while exits from cell cy- showed a decrease of it in Notch-inhibited IDG-SW3 cells
cle at 37 °C of culture and differentiates to osteocytes. (Fig. 3k).
Those properties make this cell line a powerful tool for
osteocyte research. We blocked Notch signalling in IDG- Notch signalling influences the mechanical properties
SW3 cells by adding gradient concentration of DAPT, a of mineralisation
γ-secretase inhibitor to test whether Notch regulates
DMP1 expression. The cell viability after treatment with Mechanical property of tissue mineralisation is critical for
DAPT was not changed and DAPT inhibited Hes1 expres- bone function. In this study, we tested the bonding force of
sion in a dose-dependent manner (Supplementary Fig. 1A the nodules formed by osteocytes using AFM. After a detach-
and B). In normal condition, IDG-SW3 cells expressed ment force of 35 μN was applied, there was nearly no nodules
intensive GFP after 14 days of culture in osteogenic dif- that could be removed in the normal group (Fig. 4a, b).
ferentiation medium; however, the intensity of GFP grad- However, evidently most nodules were removed from cell
ually decreased in correlation with the increasing concen- culture plates in the DAPT-treated group after the same de-
tration of DAPT. The GFP could not be detected when tachment force was applied (Fig. 4c, d). For quantitative anal-
IDG-SW3 cells were cultured with 50 μM DAPT ysis, three levels of mineral nodule removal were established
(Fig. 2a). This down-regulation of DMP1 by Notch signal according to the percentage of mineral nodules removed as
inhibition, as well as another early osteocyte marker, E11, high (42%), medium (18%) and low (8%), respectively. In all
which regulates the formation of dendrites, had been con- three removal levels, significantly higher detachment forces
firmed at both protein and mRNA levels (Fig. 2b–d). The were required to remove mineral nodules in the IDG-SW3
transcription of other osteocyte-related genes, SOST and normal mineralisation group, in other words, normal mineral
MEPE, were also reduced after DAPT treatment nodules bound more tightly to collagen (Fig. 4e). In order to
(Supplementary Fig. 1C). explore the mineral structure that contributes to the changes of
To further confirm the changes of osteocyte markers were mechanical properties, the crystal structure of the mineral nod-
attributed to the Notch signalling blockage, siRNA-mediated ules was evaluated using SAED. The nodules formed by IDG-
knockdown of Hes1 was performed (Supplementary Fig. 2A) SW3 cells in normal differentiation condition presented simi-
with a demonstrated knockdown of Notch1 (Supplementary lar diffraction pattern to that of normal bone, which was
Fig. 2B) in the siHes1 treatment. Consistent with our expec- characterised by sharp and distinct diffraction rings, indicating
tations, the DMP1 (Supplementary Fig. 2C) and E11 the crystal structure of normal nodules resembled normal bone
(Supplementary Fig. 2D) expressions were down-regulated which is well organised (Fig. 4f, h). After Notch was inhibited,
after Hes1 transcriptional inhibition by siRNA. in contrast, the diffraction pattern was less distinct, suggesting
that the arrangement of crystal was impacted due to the lack of
Inhibition of Notch signalling disturbs both Notch signalling (Fig. 4g).
extracellular and intracellular mineralisation
mediated by osteocytes Inhibition of Notch signalling alters E11 expression
and osteocyte dendrite formation
The general mineralisation levels were examined by von
Kossa staining. After 14-day osteogenic differentiation, a E11 is an early marker of osteocytes and plays a role in the
large number of mineral nodules were formed by IDG-SW3 development of dendrites, which is a unique morphological
cells (Fig. 3a), while the number and diameter of the nodules characteristic of osteocytes. To test the expression of E11 and
were significantly reduced in the DAPT group (Fig. 3d). The the cell morphology, we conducted immunofluorescent (IF)
ultrastructure of the mineral nodules was further observed staining of E11 in IDG-SW3 cells. Confocal images con-
under TEM. In normal mineralisation, plenty of mineral firmed that E11 was strongly expressed in cytoplasm as well
J Mol Med

Fig. 3 The structure of


mineralised nodules formed by
IDG-SW3 cells. a and d IDG-
SW3 cells (−DAPT) formed more
mineralised nodules compared
with the group of (+DAPT) as
shown in von Kossa staining. b, c,
d and f TEM images showed
(−DAPT) minerals were pene-
trated into and closely bound to
collagen fibrils as indicated by red
arrow in (c), while (+DAPT)
minerals were deposited on the
surface of collagen as indicated
by red arrow in (f). Scale bar 1 μm
in (b) and 6 μm in (e). g–j TEM
images of IDG-SW3 (−DAPT)
cells showed aggregated minerals
located in cytoplasm (g and h). In
contrast, there were only sparse
and small minerals observed in
(+DAPT) cells (i and j). K
Intracellular calcium concentra-
tion also decreased in (+DAPT)
cells. n = 3, *p < 0.05, normalised
to the (−DAPT) group

as the dendrites of IDG-SW3 cells cultured in differentiation TEM results mentioned above that mineral could not be de-
medium (Fig. 5a), while the expression was obviously livered into the gap zone of collagen without the regulation of
inhibited when DAPT was added (Fig. 5d). The decreased Notch signalling. Quantitative analysis confirmed a signifi-
expression of E11 in the DAPT treatment was not due to the cant decline of both dendrite length and dendrite number
alteration/damage of cell cytoskeleton (Supplementary when Notch signalling was inhibited (Fig. 5g).
Fig. 3). SEM was utilised to directly observe the cell morphol-
ogy. The normal IDG-SW3 cells presented with multi-
dendritic structure (Fig. 5b, c). In contrast, the Notch- Discussion
deficient IDG-SW3 cells were unable to generate enough den-
drites. And it is of note that a lot of spontaneous mineral Bone matrix is deposited by osteoblasts, followed by
deposition was found in this condition (Fig. 5e, f, as osteocyte-mediated mineralisation. As osteoblasts are far
indicated by red arrowhead), which is consistent with the away from the mineral frontline, it is believed that the
J Mol Med

osteocytes embedded in osteoid have an important role in the boundary between two fluorochromes [9]. Quantitative infor-
mineralisation process [47]. Feng and colleagues have dem- mation has also revealed that 60% of the minerals reside with-
onstrated that the mineralisation started at the proximal sites of in a distance less than 1 μm from the canaliculi and 80% of the
osteocytes, then extended to the distal sites, and there is a clear minerals are located in a distance of 1.4 μm [48]. Even after
J Mol Med

ƒFig. 4 Mechanical properties and crystal structure of mineralisation were those reports might be that they neglected the different Notch
damaged in the absence of Notch. a–d The microscope images showed expression levels during osteogenesis. More specifically,
mineral nodules before and after the application of 35-μN detachment
force. The mineral nodules in the (−DAPT) group remained intact after
Notch signalling inhibits the osteoblastic progenitor differen-
force application as shown in the red circles in a and b. In the (+DAPT) tiation. It is not surprising, therefore, that osteoblasts express
group, the minerals were evidently removed as shown in c and d (scale low level of Notch signalling in physiological conditions [54,
bar 500 μm). e For quantitative analysis, three levels of mineral removal 58, 59]. However, the increase of Notch during the transition
were defined as high (42%), medium (18%) and low (8%). The forces
applied to detach minerals to the same removal level were higher in the
from osteoblasts to osteocytes is quite a new topic. It has been
(−DAPT) group than in the (+DAPT) group, indicating the bonding force reported that Hey 1, a downstream target of Notch signalling,
of minerals were greater in the (−DAPT) group. All the data are shown as is upregulated more than 10-fold during cell differentiation
mean ± standard deviation; *p < 0.05 indicated the significant difference towards osteocytes [60]. Another recent observation on trans-
of the applied forces between the (−DAPT) and (+DAPT) groups. f–h
SAED analysis revealed the diffraction patterns of minerals formed by
genic Notch reporter mice models has shown that Notch is
IDG-SW3 (−DAPT) cells resembled to that of normal bone, which were expressed in osteocytes [61]. Consistent with those observa-
distinct and clear, and quite different from the patterns of the (+DAPT) tions, we have also demonstrated that Rbpj, a nuclear effector
group. White arrows indicated crystalline standard diffraction planes of for canonical Notch signalling transduction, is increased in
002, 211 and 004, which are characteristics of native bone
osteocytes. This suggests that Notch plays a role in terminal
differentiation and mineralisation process.
apoptosis, due to the non-existence of access for other cell In our present study, we tested the relationship of Notch
types, the lacuno-canalicular space is infilled with minerals pathway and the structure and mechanical properties of min-
and the remnant osteocytes become mineralised by them- eral nodules in details. In order to achieve this aim, TEM,
selves, leaving the dead osteocytes as fossil [49]. Taken to- SAED and AFM were used for observation and analysis in
gether, all the evidence reviewed above indicates it is osteo- our study. Those methods illustrate the properties of mineral in
cyte that mediates mineralisation. terms of appearance, crystal arrangement and bond strength,
Osteoblasts and osteocytes belong to the same lineage and respectively. Ideal bones need both rigidity and resilience to
represent continuous differentiation stages [50]. The maintain physiological function. The compromise between
mineralisation process accompanies the transition from oste- rigidity and resilience can be attributed to the proper ratio of
oblasts to osteocytes and fundamental epigenetic changes. As organic collagen to mineral component, as well as the struc-
mentioned earlier, osteoblasts express high ALP but no CK II, ture of mineral crystallite in terms of shape, size and crystal-
while osteocytes express high CK II but no ALP. The opposite linity [62]. The collagen acts as the scaffold and template to
phenomenon in protein expression reflects that the osteoblasts guide mineralisation. Moreover, it also positively promotes
and osteocytes exert different but consecutive functions in the infiltration of amorphous calcium phosphate [63]. The
osteogenesis. Specifically, osteoblasts provide organic frame major mineral component in bone is hydroxyapatite, which
and phosphate, and then osteocytes utilise the phosphate to does not crystallise spontaneously as it depends on specific
mineralise the organic matrix. Those changes in cell functions extracellular matrix proteins, such as DMP1 produced by os-
are likely controlled by cell signalling pathways including the teocyte, to form nucleated amorphous calcium phosphate
Notch signalling pathway. (ACP) particles. ACP particles then ripen and expand into
Notch has been intensively studied in bone modelling and larger scale, eventually, form hydroxyapatite [64]. Intensive
remodelling [51, 52]. More specifically, Notch maintains bone studies have focused on the mineral regulatory functions of
marrow mesenchymal progenitor cell pool and regulates oste- non-collagenous proteins, among which DMP1 is the best-
oclastogenesis directly or indirectly through modulating oste- known player in matrix-mediated mineralisation. DMP1 has
oblasts [53, 54]. As the major cell type in bone tissue, osteo- binding sites to both calcium phosphate and collagen [65]. It
cyte plays a central role in orchestrating bone formation and has been reported that the c-terminal fragment of DMP1 me-
resorption. It senses mechanical loading, secrets non- diates osteocyte maturation and mineralisation [64]. In an
collagenous protein related to mineralisation and regulates in vitro study, DMP1 has been shown to prevent unregulated
activities of both osteoblasts and osteoclasts [55]. However, calcium phosphate precipitation in solution and promote con-
there are limited studies that focus on Notch’s function in trolled nucleation of mineral particles by stabilising calcium
osteocyte and the existing results are quite controversial. It phosphate and transferring it to the gap region of collagen
has been reported that Notch expression in osteocytes leads where it would then be deposited and crystallised. This pro-
to a reduction of bone resorption and an increase in cancellous cess can also be attributed to that phosphorylated DMP1 can
bone mass [56]. Another study by the same group suggests form negatively charged mineral complexes and this property
that inactivation of Notch can also increase cancellous bone helps mineral to infiltrate into collagen fibrils carrying a pos-
mass [56]. A most recent research has demonstrated that over- itive charge [63, 66]. Consistent with this observation, an un-
expression of Notch in osteocytes causes osteopetrosis regulated spontaneous mineral precipitation which is random-
through upregulating Wnt signalling [57]. The limitations of ly deposited without a strong bond to the collagen has been
J Mol Med

Fig. 5 Cell morphology


investigation. a
Immunofluorescent staining of
E11 (green) and DAPI (blue).
IDG-SW3 (-DAPT) cells pre-
sented with clear dendrite struc-
ture and strong expression of E11.
d No clear dendrite structure was
found in IDG-SW3 (+DAPT)
cells (scale bar 75 μm). b–f SEM
images revealed similar morpho-
logical changes in osteocytes.
Specifically, b and c the normal
IDG-SW3 cells presented with
multi-dendritic structure. The red
arrows indicate the cell bodies,
the yellow arrows indicate the
dendrites. e and f The Notch-
deficient IDG-SW3 cells present-
ed with round cell body and were
lack of dendrites as indicated by
red arrows. Red arrowheads indi-
cate spontaneously deposited
minerals. c and f were enlarged
images of selected areas of (b and
e). Scale bar 10 μm in (b and e),
5 μm in (c and f). g Both length
and number of dendrites were
significantly reduced in the
(+DAPT) group. n = 3,
**p < 0.01, comparisons between
the (−DAPT) and (+DAPT)
groups

found in osteocytes lacking DMP1. Although the relationship An abnormal intracellular mineralisation has also been ob-
between DMP1 and mineralisation has been well reported, the served in osteocytes with the blockage of Notch signalling.
specific mechanism involved in this process in vivo is yet Normally, calcium phosphate deposits are located intracellu-
unknown. We have presented solid evidence in this study that larly, especially in mitochondria with average size of
Notch is required for the expression of DMP1, and established 50~80 nm. However, in Notch-inhibited osteocytes, the glob-
clear relationships between Notch and cellular mineralisation. ules are smaller with disordered morphologies [5, 67]. These
J Mol Med

abnormal mineral particles are secreted into the extracellular the Australian Microscopy & Microanalysis Research Facility at the
Central Analytical Research Facility operated by the Institute for Future
matrix delivered by calcium phosphate containing vesicles.
Environments at the Queensland University of Technology.
Hence, the intracellular mineralisation is a key step in normal
biomineralisation. The specific mechanism which controls this
Compliance with ethical standards
process remains unknown [3]. We have provided evidence
which shows that the intracellular mineralisation is disturbed The study is approved by the Animal Ethics Committee of Queensland
when Notch signalling is inhibited. It is speculated that Notch University of Technology
not only affects extracellular mineralisation by inhibiting
DMP1, but also interferes intracellular mineralisation via un-
known mechanisms. Narayanan et al. suggested that non- References
phosphorylated DMP1 can active intracellular calcium ion ac-
cumulation [68]. It is possible that DMP1 can regulate both 1. Clarke B (2008) Normal bone anatomy and physiology. Clin J Am
extracellular and intracellular mineral activities, which may ex- Soc Nephrol 3:S131–S139
plain our observations of disordered intracellular mineralisation 2. Canalis E, Giustina A, Bilezikian JP (2007) Mechanisms of ana-
bolic therapies for osteoporosis. N Engl J Med 357:905–916
in osteocytes with inhibited Notch signalling. 3. Boonrungsiman S, Gentleman E, Carzaniga R, Evans ND,
We have also demonstrated that the morphological abnor- McComb DW, Porter AE, Stevens MM (2012) The role of intra-
mality in Notch-deficient osteocytes lacking typical dendrites cellular calcium phosphate in osteoblast-mediated bone apatite for-
based on SEM and immunofluorescent observations. The ex- mation. Proc Natl Acad Sci 109:14170–14175
4. Mahamid J, Sharir A, Addadi L, Weiner S (2008) Amorphous cal-
pression of an early osteocyte marker, E11, which is responsi-
cium phosphate is a major component of the forming fin bones of
ble for the generation of cell processes, was also inhibited after zebrafish: indications for an amorphous precursor phase. Proc Natl
Notch blockage. Those results clearly demonstrate that Notch Acad Sci 105:12748–12753
signalling controls the protrusion of processes during the tran- 5. Mahamid J, Sharir A, Gur D, Zelzer E, Addadi L, Weiner S (2011)
sition from osteoblasts to osteocytes. These long and slender Bone mineralization proceeds through intracellular calcium phos-
phate loaded vesicles: a cryo-electron microscopy study. J Struct
processes not only compose a huge network linking each indi- Biol 174:527–535
vidual osteocyte together, but also play an important role in 6. Toyosawa S, Shintani S, Fujiwara T, Ooshima T, Sato A, Ijuhin N,
mineral and matrix protein delivery, as there appears to be an Komori T (2001) Dentin matrix protein 1 is predominantly
abundant distribution of DMP1 along canalicular walls [69]. expressed in chicken and rat osteocytes but not in osteoblasts. J
Bone Miner Res 16:2017–2026
Further studies are required to explore the mechanism of how
7. Deshpande AS, Fang P-A, Zhang X, Jayaraman T, Sfeir C, Beniash
Notch regulates the expression of osteocyte-related genes. E (2011) Primary structure and phosphorylation of dentin matrix
The collagen matrix secreted by osteoblasts and the protein 1 (DMP1) and dentin phosphophoryn (DPP) uniquely de-
minerals infiltrated into collagen under strict direction by termine their role in biomineralization. Biomacromolecules 12:
osteocytes are essential to normal mineralised tissues with 2933–2945
8. Feng JQ, Ward LM, Liu S, Lu Y, Xie Y, Yuan B, Yu X, Rauch F,
physiological function—reaching an equilibrium between Davis SI, Zhang S, Rios H, Drezner MK, Quarles LD, Bonewald
rigidity and resilience. Our study has demonstrated that LF, White KE (2006) Loss of DMP1 causes rickets and osteoma-
Notch signalling promotes highly organised integration of lacia and identifies a role for osteocytes in mineral metabolism. Nat
collagen and mineral through activating DMP1 expression Genet 38:1310–1315
9. Lu Y, Yuan B, Qin C, Cao Z, Xie Y, Dallas SL, McKee MD,
with the possible involvement of other non-collagenous
Drezner MK, Bonewald LF, Feng JQ (2011) The biological func-
proteins. Further research on the relationship between tion of DMP-1 in osteocyte maturation is mediated by its 57-kDa C-
Notch signalling and mineralisation is warranted in order terminal fragment. J Bone Miner Res 26:331–340
to provide new knowledge in this understudied area, and 10. Orimo H (2010) The mechanism of mineralization and the role of
form a cornerstone for the development of novel ap- alkaline phosphatase in health and disease. Journal of Nippon
Medical School=Nippon Ika Daigaku zasshi 77:4–12
proaches and biomaterials for bone regeneration. 11. Zhang K, Barragan-Adjemian C, Ye L, Kotha S, Dallas M, Lu Y,
In conclusion, the evidence presented here suggests that Zhao S, Harris M, Harris SE, Feng JQ, Bonewald LF (2006) E11/
Notch plays a critical role in osteocyte differentiation and gp38 selective expression in osteocytes: regulation by mechanical
biomineralisation from intracellular mineral package to extra- strain and role in dendrite elongation. Mol Cell Biol 26:4539–4552
12. Schulze E, Witt M, Kasper M, Lowik CW, Funk RH (1999)
cellular mineral deposition.
Immunohistochemical investigations on the differentiation marker
protein E11 in rat calvaria, calvaria cell culture and the osteoblastic
Acknowledgements This study was supported by the National Health cell line ROS 17/2.8. Histochem Cell Biol 111:61–69
and Medical Research Council (NHMRC) of Australia Early Career 13. Matsui K, Breiteneder-Geleff S, Kerjaschki D (1998) Epitope-
Fellowship (1105035) to YZ, QUT Tuition Waiver Scholarship to JS, specific antibodies to the 43-kD glomerular membrane protein
and Science and Technology Project Grants funded by Xiamen Science podoplanin cause proteinuria and rapid flattening of podocytes.
and Technology Bureau (3502Z20161247) to JL, YZ and YX. The au- Journal of the American Society of Nephrology: JASN 9:2013–2026
thors acknowledge the facilities, and the scientific and technical assis-
14. Scholl FG, Gamallo C, Vilaro S, Quintanilla M (1999)
tance of Dr. Jamie Riches, Ms. Rachel Hancock and Ms. Ning Liu, of
Identification of PA2.26 antigen as a novel cell-surface mucin-type
J Mol Med

glycoprotein that induces plasma membrane extensions and in- cells causes recruitment of host cells. J Tissue Eng Regen Med 9:
creased motility in keratinocytes. J Cell Sci 112(Pt 24):4601–4613 118–126
15. Burra S, Nicolella DP, Francis WL, Freitas CJ, Mueschke NJ, Poole 34. Ren Y, Lin S, Jing Y, Dechow PC, Feng JQ (2014) A novel way to
K, Jiang JX (2010) Dendritic processes of osteocytes are statistically analyze morphologic changes in Dmp1-null osteocytes.
mechanotransducers that induce the opening of hemichannels. Connect Tissue Res 55:129–133
Proc Natl Acad Sci 107:13648–13653 35. Shi M, Zhou Y, Shao J, Chen Z, Song B, Chang J, Wu C, Xiao Y
16. Piemontese M, Onal M, Xiong J, Han L, Thostenson JD, Almeida (2015) Stimulation of osteogenesis and angiogenesis of hBMSCs
M, O’Brien CA (2016) Low bone mass and changes in the osteo- by delivering Si ions and functional drug from mesoporous silica
cyte network in mice lacking autophagy in the osteoblast lineage. nanospheres. Acta Biomater 21:178–189
Sci Rep 6:24262 http://dharmasastra.live.cf.private.springer.com/ 36. Kalajzic I, Kalajzic Z, Kaliterna M, Gronowicz G, Clark SH,
articles/srep24262#supplementary-information Lichtler AC, Rowe D (2002) Use of type I collagen green fluores-
17. Thompson WR, Uzer G, Brobst KE, Xie Z, Sen B, Yen SS, Styner cent protein transgenes to identify subpopulations of cells at differ-
M, Rubin J (2015) Osteocyte specific responses to soluble and ent stages of the osteoblast lineage. J Bone Miner Res 17:15–25
mechanical stimuli in a stem cell derived culture model. Sci Rep 37. Li X, Liu P, Liu W, Maye P, Zhang J, Zhang Y, Hurley M, Guo C,
5:11049 http://dharmasastra.live.cf.private.springer.com/articles/ Boskey A, Sun L, Harris SE, Rowe DW, Ke HZ, Wu D (2005)
srep11049#supplementary-information Dkk2 has a role in terminal osteoblast differentiation and mineral-
18. Hesse B, Varga P, Langer M, Pacureanu A, Schrof S, Mannicke N, ized matrix formation. Nat Genet 37:945–952 http://www.nature.
Suhonen H, Maurer P, Cloetens P, Peyrin F et al (2015) Canalicular com/ng/journal/v37/n9/suppinfo/ng1614_S1.html
network morphology is the major determinant of the spatial distri- 38. Woo SM, Rosser J, Dusevich V, Kalajzic I, Bonewald LF (2011)
bution of mass density in human bone tissue: evidence by means of Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differen-
synchrotron radiation phase-contrast nano-CT. J Bone and Mineral tiation in vitro and accelerates bone formation in vivo. J Bone Miner
Res:Off J Am Soc Bone Mineral Res 30:346–356 Res 26:2634–2646
19. Nango N, Kubota S, Hasegawa T, Yashiro W, Momose A, Matsuo 39. Shih Y-RV, Hwang Y, Phadke A, Kang H, Hwang NS, Caro EJ,
K (2016) Osteocyte-directed bone demineralization along canalic- Nguyen S, Siu M, Theodorakis EA, Gianneschi NC, Vecchio KS,
uli. Bone 84:279–288 Chien S, Lee OK, Varghese S (2014) Calcium phosphate-bearing
20. Turner CH, Robling AG, Duncan RL, Burr DB (2002) Do bone matrices induce osteogenic differentiation of stem cells through
cells behave like a neuronal network? Calcif Tissue Int 70:435–442 adenosine signaling. Proc Natl Acad Sci 111:990–995
21. Buenzli PR, Sims NA (2015) Quantifying the osteocyte network in 40. Li S, Shao J, Zhou Y, Friis T, Yao J, Shi B, Xiao Y (2016) The
the human skeleton. Bone 75:144–150 impact of Wnt signalling and hypoxia on osteogenic and
22. Schaffler MB, Cheung WY, Majeska R, Kennedy O (2014) cementogenic differentiation in human periodontal ligament cells.
Osteocytes: master orchestrators of bone. Calcif Tissue Int 94:5–24 Mol Med Rep 14:4975–4982
23. Genetos DC, Kephart CJ, Zhang Y, Yellowley CE, Donahue HJ 41. Moran P, Coats B (2012) Biological sample preparation for SEM
(2007) Oscillating fluid flow activation of gap junction hemichan- imaging of porcine retina. Microscopy Today 20:28–31
nels induces atp release from MLO-Y4 osteocytes. J Cell Physiol 42. Fischer ER, Hansen BT, Nair V, Hoyt FH, Dorward DW (2012)
212:207–214 Scanning electron microscopy. Curr Protoc Microbiol Chapter 2:
24. Cherian PP, Siller-Jackson AJ, Gu S, Wang X, Bonewald LF, Unit2B.2. DOI https://doi.org/10.1002/9780471729259.
Sprague E, Jiang JX (2005) Mechanical strain opens connexin 43 mc02b02s25
hemichannels in osteocytes: a novel mechanism for the release of 43. Keene DR, Tufa SF (2010) Transmission electron microscopy of
prostaglandin. Mol Biol Cell 16:3100–3106 cartilage and bone. Methods Cell Biol 96:443–473
25. Andersson ER, Sandberg R, Lendahl U (2011) Notch signaling: 44. Williams DB, Carter CB (2009) Diffraction from crystals transmis-
simplicity in design, versatility in function. Development 138: sion electron microscopy: a textbook for materials science. Springer
3593–3612 US, Boston, pp 257–269
26. Nam Y, Sliz P, Song L, Aster JC, Blacklow SC (2006) Structural 45. Zuo Q, Lu S, Du Z, Friis T, Yao J, Crawford R, Prasadam I, Xiao Y
basis for cooperativity in recruitment of MAML coactivators to (2016) Characterization of nano-structural and nano-mechanical
Notch transcription complexes. Cell 124:973–983 properties o f osteoarthritic subchond ral bon e. BMC
27. Wilson JJ, Kovall RA (2006) Crystal structure of the CSL-Notch- Musculoskelet Disord 17:367
mastermind ternary complex bound to DNA. Cell 124:985–996 46. Nguyen TD, Gu Y (2016) Investigation of cell-substrate adhesion
28. Kopan R, Ilagan MXG (2009) The canonical Notch signaling path- properties of living chondrocyte by measuring adhesive shear force
way: unfolding the activation mechanism. Cell 137:216–233 and detachment using AFM and inverse FEA. Sci Rep 6:38059
29. Bray SJ (2016) Notch signalling in context. Nat Rev Mol Cell Biol. https://www.nature.com/articles/srep38059#supplementary-
advance online publication 17:722–735 information
30. Veno PND, Sivakumar P, Kalajzic I, Rowe D, Harris SE, Bonewald 47. Mikuni-Takagaki Y, Kakai Y, Satoyoshi M, Kawano E, Suzuki Y,
L, Dallas SL (2006) Live imaging of osteocytes within their lacunae Kawase T, Saito S (1995) Matrix mineralization and the differenti-
reveals cell body and dendrite motions. J Bone Miner Res 21 ation of osteocyte-like cells in culture. Journal of bone and mineral
31. Sprinzak D, Lakhanpal A, LeBon L, Santat LA, Fontes ME, research: the official journal of the American Society for Bone and
Anderson GA, Garcia-Ojalvo J, Elowitz MB (2010) Cis- Mineral Research 10:231–242
interactions between Notch and Delta generate mutually exclusive 48. Kerschnitzki M, Kollmannsberger P, Burghammer M, Duda GN,
signalling states. Nature 465:86–90 http://www.nature.com/nature/ Weinkamer R, Wagermaier W, Fratzl P (2013) Architecture of the
journal/v465/n7294/suppinfo/nature08959_S1.html osteocyte network correlates with bone material quality. Journal of
32. Rios AC, Serralbo O, Salgado D, Marcelle C (2011) Neural crest regu- bone and mineral research: the official journal of the American
lates myogenesis through the transient activation of NOTCH. Nature Society for Bone and Mineral Research 28:1837–1845
473:532–535 http://www.nature.com/nature/journal/v473/n7348/abs/ 49. Bell LS, Kayser M, Jones C (2008) The mineralized osteocyte: a
10.1038-nature09970-unlocked.html#supplementary-information living fossil. Am J Phys Anthropol 137:449–456
33. Zhou Y, Fan W, Prasadam I, Crawford R, Xiao Y (2015) 50. Bonewald LF (2011) The amazing osteocyte. J Bone Miner Res 26:
Implantation of osteogenic differentiated donor mesenchymal stem 229–238
J Mol Med

51. Zanotti S, Canalis E (2010) Notch and the skeleton. Mol Cell Biol mineralization in murine MC3T3-E1 osteoblast cultures: an ultra-
30:886–896 structural, compositional and comparative analysis with mouse
52. Zanotti S, Canalis E (2011) Notch regulation of bone development and bone. Bone 71:244–256
remodeling and related skeletal disorders. Calcif Tissue Int 90:69–75 63. Nudelman F, Pieterse K, George A, Bomans PHH, Friedrich H,
53. Engin F, Yao Z, Yang T, Zhou G, Bertin T, Jiang MM, Chen Y, Wang Brylka LJ, Hilbers PAJ, de With G, Sommerdijk NAJM (2010)
L, Zheng H, Sutton RE, Boyce BF, Lee B (2008) Dimorphic effects The role of collagen in bone apatite formation in the presence of
of Notch signaling in bone homeostasis. Nat Med 14:299–305 hydroxyapatite nucleation inhibitors. Nat Mater 9:1004–1009
54. Hilton MJ, Tu X, Wu X, Bai S, Zhao H, Kobayashi T, Kronenberg http://www.nature.com/nmat/journal/v9/n12/abs/nmat2875.html#
HM, Teitelbaum SL, Ross FP, Kopan R, Long F (2008) Notch supplementary-information
signaling maintains bone marrow mesenchymal progenitors by sup- 64. He G, Dahl T, Veis A, George A (2003) Nucleation of apatite
pressing osteoblast differentiation. Nat Med 14:306–314 crystals in vitro by self-assembled dentin matrix protein 1. Nat
55. Dallas SL, Prideaux M, Bonewald LF (2013) The osteocyte: an Mater 2:552–558 http://www.nature.com/nmat/journal/v2/n8/
endocrine cell…and more. Endocr Rev 34:658–690 suppinfo/nmat945_S1.html
56. Canalis E, Parker K, Feng JQ, Zanotti S (2013) Osteoblast lineage- 65. He G, George A (2004) Dentin matrix protein 1 immobilized on
specific effects of Notch activation in the skeleton. Endocrinology type I collagen fibrils facilitates apatite deposition in vitro. J Biol
154:623–634 Chem 279:11649–11656
57. Canalis E, Bridgewater D, Schilling L, Zanotti S (2016) Canonical 66. He G, Gajjeraman S, Schultz D, Cookson D, Qin C, Butler WT,
Notch activation in osteocytes causes osteopetrosis. Am J Physiol Hao J, George A (2005) Spatially and temporally controlled bio-
Endocrinol Metab 310:E171–E182 mineralization is facilitated by interaction between self-assembled
58. Zanotti S, Smerdel-Ramoya A, Stadmeyer L, Durant D, Radtke F, dentin matrix protein 1 and calcium phosphate nuclei in solution.
Canalis E (2008) Notch inhibits osteoblast differentiation and Biochemistry 44:16140–16148
causes osteopenia. Endocrinology 149:3890–3899
67. Dey A, Bomans PHH, Müller FA, Will J, Frederik PM, de With G,
59. Deregowski V, Gazzerro E, Priest L, Rydziel S, Canalis E (2006)
Sommerdijk NAJM (2010) The role of prenucleation clusters in
Notch 1 overexpression inhibits osteoblastogenesis by suppressing
surface-induced calcium phosphate crystallization. Nat Mater 9:
Wnt/β-catenin but not bone morphogenetic protein signaling. J
1010–1014 http://www.nature.com/nmat/journal/v9/n12/abs/
Biol Chem 281:6203–6210
nmat2900.html#supplementary-information
60. John HCS, Bishop KA, Meyer MB, Benkusky NA, Leng N,
Kendziorski C, Bonewald LF, Pike JW (2014) The osteoblast to 68. Narayanan K, Ramachandran A, Hao J, He G, Park KW, Cho M,
osteocyte transition: epigenetic changes and response to the vitamin George A (2003) Dual functional roles of dentin matrix protein 1:
D3 hormone. Mol Endocrinol 28:1150–1165 implications in biomineralization and gene transcription by activa-
61. Liu P, Ping Y, Ma M, Zhang D, Liu C, Zaidi S, Gao S, Ji Y, Lou F, Yu tion of intracellular Ca2+ store. J Biol Chem 278:17500–17508
F, Lu P, Stachnik A, Bai M, Wei C, Zhang L, Wang K, Chen R, New 69. Harris SE, Gluhak-Heinrich J, Harris MA, Yang W, Bonewald LF,
MI, Rowe DW, Yuen T, Sun L, Zaidi M (2016) Anabolic actions of Riha D, Rowe PSN, Robling AG, Turner CH, Feng JQ, McKee M,
Notch on mature bone. Proc Natl Acad Sci 113:E2152–E2161 Nicollela D (2007) DMP1 and MEPE expression are elevated in
62. Addison WN, Nelea V, Chicatun F, Chien YC, Tran-Khanh N, osteocytes after mechanical loading in vivo: theoretical role in con-
Buschmann MD, Nazhat SN, Kaartinen MT, Vali H, Tecklenburg trolling mineral quality in the perilacunar matrix. J Musculoskelet
MM, Franceschi RT, McKee MD (2015) Extracellular matrix Neuronal Interact 7:313–315

View publication stats