Journal of Applied Microbiology 1997, 82, 783–790

DNA probe and PCR-specific reaction for Lactobacillus

plantarum
F. Quere1,2, A. Deschamps1 and M. C. Urdaci1
1
Laboratoire de Microbiologie et Biotechnologie (ISTAB-ENITA), Université Bordeaux I, Talence, and 2UNICOPA
Nutrition Animale, Languidic, France
5872/07/96: received 31 July 1996, revised 30 October 1996 and accepted 1 November 1996

F . Q UE R E, A. D ES CH A MP S A N D M . C . UR DA C I. 1997. A 300 bp DNA fragment of Lactobacillus

plantarum isolated by randomly amplified polymorphic DNA (RAPD) analysis was cloned
and sequenced. This fragment was tested using a dot-blot DNA hybridization technique
for its ability to identify Lact. plantarum strains. This probe hybridized with all
Lact. plantarum strains tested and with some strains of Lact. pentosus, albeit more
weakly. Two internal primers of this probe were selected (LbPl1 and LbPl2) and
polymerase chain reaction (PCR) was carried out. All Lact. plantarum strains tested
amplified a 250 bp fragment contrary to the other LAB species tested. This specific PCR for
Lact. plantarum was also performed from colonies grown on MRS medium with similar
results. These methods enabled the rapid and specific detection and identification of Lact.
plantarum.

INTRODUCTION increasing number of LAB species which vary on a small

number of these characters. Pot et al. (1994a) and Johansson
Food preserving and flavour development is often carried out
et al. (1995) have described Lact. plantarum as having a highly
by lactic acid bacteria (LAB). The specific environmental
variable phenotype. This variability leads to a very difficult
conditions prevailing in a fermenting food promote the
discrimination between Lact. plantarum and a closely related
growth of certain species of these bacteria. Lactobacillus plan-
species Lact. pentosus (Dellaglio et al. 1973; Abazinge et al.
tarum is predominantly found (also used as a starter) in fer-
1993).
mented food and feed products. Lactobacillus plantarum is
Lactobacillus species are identified using a variety of
implicated in processed food for human consumption like
methods other than phenotypic methods. These include phy-
sauerkraut (Pederson 1979), dry fermented sausage (Lücke
sico-chemical methods such as SDS-PAGE protein patterns
1994), green olive fermentations (Ruiz-Barba et al. 1994) and
(Pot et al. 1994b) and Fourier transformed infrared spec-
cheese making (Tzanetakis and Litopoulou-Tzanetakis 1992)
troscopy (Naumann et al. 1991), or genetic methods which
as well as in animal nutrition such as crop preservation (Wein-
include DNA/DNA hybridizations (Johnson et al. 1980;
berg et al. 1993; Merry et al. 1995), fish and crab waste
Fujisawa et al. 1992), the analysis of rRNA sequences (Collins
fermentation (Abazinge et al. 1993; Lassén 1994; Mauguin
et al. 1991) and 16S and 23S rRNA-target oligonucleotide
and Novel 1994) and poultry by-product fermentation
probes (Hertel et al. 1991; Castellanos et al. 1993; Pot et
(Urlings et al. 1993).
al. 1993; Richter et al. 1995), nucleic acid hybridization by
The fermentation of these food products usually results
PyrDFE genes (Bringel et al. 1995), ribotyping (Rodtong and
from growth association and interaction between different
Tannock 1993), restriction endonuclease patterns (Stahl et
LAB. Identification of these bacteria is essential in both basic
al. 1990; Abazinge et al. 1993; Roussel et al. 1993) and the
and applied research. However, a clear identification of spec-
randomly amplified polymorphic DNA (RAPD) method
ies, particularly within the genus Lactobacillus, may some-
(Johansson et al. 1995).
times be very ambiguous and complicated using phenotypic
Nucleic acid DNA probes are known to be useful for
methods such as sugar fermentation patterns due to an
the detection and identification of bacteria (Schleifer 1990).
Correspondence to: Dr M. C. Urdaci, Laboratoire de Microbiologie et Specific oligonucleotidic probes have been described for Lact.
Biotechnologie (ISTAB), Université Bordeaux I, avenue des Facultés, 33405 plantarum based on 16S or 23S rRNA sequences (Hertel et
Talence, France (e-mail: urdaci@istab.u-bordeaux.fr). al. 1991; Klijn et al. 1991) but they are not discriminative
© 1997 The Society for Applied Bacteriology
784 F . Q UE R E E T A L .
for Lact. pentosus. In fact, identification at the species level
requires the back-up of a large database of rRNA sequences
and, in the case of very closely related species, even rRNA
sequence analysis may not be sufficient (Pot et al. 1993).
DNA probes have also been described for the Lact. acidophilus
group (Pot et al. 1993), Lact. helveticus (Pilloud and Mollet
1990), Lact. curvatus (Petrick et al. 1988; Vogel et al. 1993)
and Lact. delbrueckii (Delley et al. 1990) but PCR methods
are not usually employed to identify Lactobacillus species
(Nakagawa et al. 1994). This method certainly would be of use
in the food industry to identify rapidly and unambiguously
relevant strains in fermentation processes.
This study was undertaken to develop a quick method for
the identification of Lact. plantarum and, in particular, to
perfect a probe which could be used in hybridization pro-
cedures to specifically identify Lact. plantarum strains and
to provide a PCR-specific reaction for quick detection or
identification of Lact. plantarum.
MATERIALS AND METHODS
Bacterial strains and growth conditions
The bacterial strains employed in this study are listed in
Table 1. Strains were either derived from culture collections
or isolated from a wide variety of products. The Escherichia
coli strain used for cloning was DH5a [F⌧supE44thi-1 recA1
gyrA96 relA1 hsdR17 (rK⌧mK ) endA1 f80dlacZDM15
D(lacZYA-argF)U169].
Growth of LAB and Sporolactobacillus was performed in
MRS broth (Difco) at 37°C under anaerobic conditions. Esch-
erichia coli was grown in YT medium (Gibco BRL) at 37°C
and Bacillus cereus was grown in PCA medium (Difco) at
30°C under aerobic conditions.
DNA isolation
Bacterial DNA was extracted according to the method of
Luchansky et al. (1991). After centrifugation and two washes
in TE buffer (10 mmol l⌧1 Tris–HCl, pH 8·0; 1 mmol l⌧1
EDTA), cells were resuspended in 1 ml of a lysis buffer
(50 mmol l⌧1 Tris, pH 8·0; 1 mmol l⌧1 EDTA; 25% sac-
charose) containing 40 mg ml⌧1 of mutanolysine (Sigma) and
20 mg ml⌧1 of lysozyme (Merck) and incubated for 45 min
at 37°C. The reaction was stopped using 1 ml of EDTA
(250 mmol l⌧1, pH 8·0) for 5 min. The samples were then
treated with 400 ml of 20% (w/v) SDS and 20 ml of a
20 mg ml⌧1 Proteinase K (Sigma) solution. The mixture was
incubated at 65°C until it became clear and less viscous, and
then was treated by phenol–chloroform extraction. DNA was
precipitated in ethanol and resuspended in 100 ml of TE
buffer 10 ml of RNase (10 mg ml⌧1).
© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
Oligonucleotides and RAPD or PCR-specific
reaction
Oligonucleotides were synthesized by Eurogentec (Seraing,
Belgium). The OPA3 primer (5?-AGTCAGCCAC-3?) was
used in the RAPD reaction. The OPA3-EcoRI primer (5?-
CCGAATTCAGTCAGCCAC-3?) was used for re-ampli-
fication of the 300 bp RAPD OPA3-DNA fragment for clon-
ing. The PCR-specific reaction of Lact. plantarum was
performed using the specific primers LbPl1 (5?-
AATTGAGGCAGCTGGCCA-3?) and LbPl2 (5?-GAT-
TACGGGAGTCCAAGC-3?) primers. The semi-universal
primers designated Lb1 (5?-AGAGTTTGATCATGGC
TCAG-3?) and Lb2 (5?-CGGTATTAGCATCTGT
TTCC-3?) in the present study were designed by Klijn
(1993). These primers amplified a variable loop in 16S rRNA
sequences of Lactobacillus species and were employed as a
positive control of PCR.
Twenty-five ml of reaction mixture containing 50 ng of
template DNA, 5 pmol l⌧1 of a 10-mer primer OPA3 (in
RAPD reaction), or LbPl1/LbPl2 and Lb1/Lb2 primers (in
PCR-specific reaction), 50 mmol l⌧1 of each dNTP and 0·8
U of Taq DNA polymerase (Appligene) with 2·5 ml of 10
PCR reaction buffer (Appligene) were overlaid with mineral
oil. The amplification reaction was performed in a DNA
thermal cycler (Own E, Hybaid). The RAPD reaction was
adapted from a method described by Meunier and Grimont
(1993). Each sample was subjected to a primary denaturation
cycle at 95°C for 5 min and at 94°C for 30 s, 36°C for 1 min
and 72°C for 1 min during 45 cycles. After a denaturation
cycle at 95°C for 5 min, PCR specific amplification with
LbPl1/LbPl2 plus Lb1/Lb2 primers was performed with
template denaturation at 94°C for 30 s, primer annealing at
54°C for 1 min and primer extension at 72°C for 1 min. In
both cases the reactions were terminated at 72°C for 10 min.
Gel electrophoresis
Gel electrophoresis was carried out by applying 25 ml of sam-
ple to submerged horizontal 2% agarose (PCR) or 1·5%
(RAPD) slab gel. Gels were run for 30 min at 50 V in TEB
electrophoresis buffer (89 mmol l⌧1 boric acid, 89 mmol l⌧1
Tris, 2 mmol l⌧1 EDTA) without cooling. A DNA molecular
weight marker (superladder mid-1, Eurogentec) was used
as standard. Gels were stained with ethidium bromide and
visualized at 312 nm with a u.v. transilluminator (Fluo-Link,
Vilbert Lourmat, Marne-La-Vallée, France).
Isolation of the amplified DNA
The 300 bp DNA fragment was extracted from the gel by
electrolution. An oligonucleotide (EcoRI-OPA3) containing
the restriction enzyme site EcoRI was synthesized. The iso-

lated fragment was amplified with the EcoRI-OPA3 primer
to obtain additional DNA for the cloning.
Cloning and sequencing
The amplified DNA fragment was cloned in pCR-ScriptTM
SK( ) cloning vector (Stratagene). The DNA fragment
digested by EcoRI was inserted into the EcoRI site of the
plasmid. Escherichia coli was transformed by the CaCl2
method described by Okayama and Berg (1982). Plasmid
DNA from E. coli was extracted according to the method of
Birnboim and Doly (1979). The sequence was determined by
the dideoxy chain termination method (Sanger et al. 1977)
using the T7 sequencing kit (Pharmacia, Biotech) and [a33P]
dCTP (Amersham) according to the manufacturer’s instruc-
tions. Sequencing reactions were analysed on 6% poly-
acrylamide, 8M urea gels. Research for DNA homologies was
performed with the GenBank and EMBL databases.
The nucleotide sequence data reported here appear in the
GenBank nucleotide sequence databases with the following
accession number: U75315.
Probe labelling and DNA dot-blot hybridization
A 300 bp DNA probe was labelled with [a32P] dATP (Amer-
sham) using random priming (Feinberg and Vogelstein 1984)
with a commercially available kit (Appligene).
Total DNA (300 ng) was denatured with 0·8 mol l⌧1 NaOH
and 1·5 mol l⌧1 NaCl and transferred to a nylon membrane
(Hybond-N , Amersham) using Hybri-slotTM Mannifold
BRL. Membranes were rinsed in 2 SSC, dried and DNA
fixed by u.v. irradiation for 4 min at 254 nm. Prehybridization
was performed at 65°C for 1 h in the hybridization solution
without the DNA probe. Hybridization of the probe was
performed overnight at 65°C in a hybridization solution
containing 5 SSC (1 SSC 0·1 mol l⌧1 NaCl,
⌧1
0·015 mol l trisodium citrate, pH 7·0), 5 Denhardt’s
solution, 0·5% (w/v) SDS (Sambrook et al. 1989) and
0·2 mg ml⌧1 denatured salmon sperm DNA. After incu-
bation, membranes were washed twice at room temperature
for 10 min with 2 SSC, 0·1% SDS, followed by two washes
at 65°C for 15 min with 1 SSC, 0·1% SDS and one final
wash at 65°C for 15 min in 0·2 SSC, 0·1% SDS. The
membranes were air dried for 1 h and exposed to Kodak Min-
RE 100 autoradiography film (Kodak) for up to 6 h.
RESULTS
RAPD analysis and DNA probe
In a preliminary study, a large number of primers from the
OPA, OPM and OPR kit (Operon Technologies Inc.) were
© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
D NA PR O BE AN D PC R F O R L AC T . P LA N TA RU M 785
Fig. 1 Band patterns obtained after RAPD amplifications of
Lactobacillus strains with the oligonucleotide OPA3. Lanes: 1, DNA
molecular weight marker 100 bp; 2–17, Lactobacillus strains listed
in Table 1
tested in our laboratory using RAPD on DNA extracts of
Lactobacillus species.
The band patterns resulting from RAPD on the DNA
extracts of Lact. plantarum, Lact. pentosus and other species
with OPA3 primer are shown in Fig. 1. All the Lact. plan-
tarum strains tested with OPA3 primer exhibited a DNA
fragment amplified at about 300 bp. The 300 bp fragment was
not apparent in any of the other Lactobacillus species tested.
The gel locations of strains tested are listed in Table 1.
A dot-blot hybridization method was used to test the speci-
ficity of the 300 bp probe for a large number of strains belong-
ing to the following genera: Lactobacillus, Carnobacterium,
Lactococcus, Enterococcus, Escherichia, Sporolactobacillus and
Bacillus. The results of the hybridization of the radiolabelled
300 bp probe with the Lactobacillus and Carnobacterium spec-
ies are shown in Fig. 2. The membrane locations of all the
strains tested are listed in Table 1. All Lact. plantarum strains
tested showed a high hybridization response to the 300 bp
DNA. A weaker response was observed with two of the five
Lact. pentosus strains tested. Other Lactobacillus and Car-
nobacterium species did not show any hybridization with the
probe. No response was observed when 300 bp DNA probe
hybridization was carried out with DNA from members of
the genera Lactococcus, Enterococcus, Escherichia, Spo-
rolactobacillus and Bacillus (data not shown).
The amplified 300 bp DNA fragment from Lact. plantarum
DSM 20174T was sequenced. The nucleotide sequence of the
DNA fragment is represented in Fig. 3.
Analysis of the 300 bp DNA fragment revealed no hom-
ology to any known sequences contained in standard data-
bases. The 300 bp sequence was found to be part of a potential
ORF which specifies a protein of at least 50 amino acids (data
not shown). This potential product encoded by the PCR
amplified fragment showed no significant similarity to any
known proteins in the protein data banks.
786 F . Q UE R E E T A L .

Table 1 Bacterial strains utilized in this study

––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
PCR PCR
Dot-blot specific specific
membrane RAPD location location
Species and source location location (Fig. 4a) (Fig. 4b)
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
Lactobacillus
plantarum ATCC 8014 2, 7, 51, 52 2 6 1
plantarum DSM 20174T 41, 50 — — 2
plantarum* 1, 13, 25, 64 3 9 3
plantarum* 59 — — 4
plantarum* 61 — — 5
plantarum* — — — 6
plantarum F&B 9106 — — — 7
plantarum F&B 8402 — — — 8
plantarum F&B 9532 — — — 9
plantarum F&B 9113 — — — 10
pentosus NCFB 363T 54 4 2 11
pentosus NCIMB 8531 55 — 3 12
pentosus† 56 — — 13
pentosus† 57, 60 — — 14
pentosus† 58 — — 15
pentosus† — — — 16
pentosus† — — — 17
pentosus† — — — 18
casei DSM 20011T 8, 40 9 — —
casei rhamnosus DSM 20021T 3, 9, 35 5 5 —
casei* 27, 53 — — —
paracasei paracasei DSM 20008T 36, 62 — — —
paracasei paracasei DSM 20020 30 — — —
paracasei paracasei ATCC 25302 33 10 — —
paracasei tolerans DSM 20258T 18, 37 — 8 —
acidophilus ATCC 4356T 17, 63 11 — —
acidophilus CNRZ 204 23 — — —
alimentarius DSM 20249T 39, 24 12 — —
alimentarius* 31 — — —
aviarus spp. aviarus DSM 20655T 14 — — —
aviarus spp. araffinosus DSM 20653T 15 — — —
bifermentans DSM 20003T 20 — — —
brevis DSM 20054T 11, 47 7 10 —
brevis* 26, 45 — — —
buchneri* 32 13 — —
bulgaricus* 28 14 — —
cellobiosus DSM 20055T 22 — — —
coryneformis spp. coryneformis DSM 20001T 29 — — —
curvatus DSM 20019T 10 6 11 —
curvatus* 43 — — —
delbrueckii spp. delbrueckii DSM 20074T 34 — — —
farciminis DSM 20184T 4, 49 — 7 —
fermentum CNRZ 209 5 — 4 —
fermentum DSM 20052T 6 — — —
halotolerans* 46 — — —
helveticus DSM 20075T 21 — — —
leichmanii* 38 — — —
sake DSM 20017T 12 8 — —
sake* 42 — — —
viridescens* 19 — — —

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
 D NA PR O BE AN D PC R F O R L AC T . P LA N TA RU M 787

Table 1 (continued)
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
PCR PCR
Dot-blot specific specific
membrane RAPD location location
Species and source location location (Fig. 4a) (Fig. 4b)
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
Carnobacterium
piscicola DSM 20722 48 16 — —
piscicola DSM 20730T 65 — — —
divergens DSM 20623T 66 — — —
mobile DSM 4848T 67 — — —
Sporolactobacillus laevus IAM 12384T 68 — — —
Lactococcus lactis spp. lactis ATCC 11454T 16, 44 — — —
Pediococcus pentosaceus ATCC 33316T 70 — — —
Bacillus cereus* 69 — — —
Enterococcus faecalis CIP 76117T 71 — — —
Escherichia coli K 12* 72 — — —
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
* This laboratory; † University of Seville, Spain; ATCC, American Type Culture Collection; DSM, Deutsche Sammlung von
Mikroorganismen; CNRZ, Centre National de Recherches Zootechniques; CIP, Collection Nationale de Cultures de Microorganismes de
l’Institut Pasteur, Paris, France; IAM, Institute of Applied Microbiology, University of Tokyo, Japan; F&B, Faculté d’'nologie de
Bordeaux; NCIMB, National Collection of Industrial and Marine Bacteria, Aberdeen, UK; NCFB, National Collection of Food Bacteria,
Reading, UK.

Oligonucleotide primer selection and Lact.

plantarum PCR-specific determination
A pair of primers were designated from the 300 bp sequence.
The forward (LbPl1) and reverse (LbPl2) primers are 253 bp
apart. Their exact location within the 300 bp fragment is
shown in Fig. 3.
The PCR amplification using LbPl1/LbPl2 plus Lb1/Lb2
primers as control generated an approximated 200 bp ampli-
fied DNA fragment for all Lactobacillus species tested and a
253 bp amplified DNA band for Lact. plantarum exclusively
(Fig. 4). All strains listed in Table 1 were tested for PCR
specificity with these primers. The 253 bp fragment was
amplified from Lact. plantarum strains and not from the other
bacteria listed in Table 1 (data not shown). Identical results
were obtained when this specific PCR was performed from
colonies grown on MRS medium.

DISCUSSION
In modern taxonomy of bacteria, 16S and 23S rRNA
Fig. 2 Dot-blot hybridization with different Lactobacillus strains sequence analysis is a standard method for the investigation
and other genera; 300 ng of purified DNA were applied per spot of phylogenetic relationship (Fox et al. 1980) and can also
and processed as described in Materials and Methods. As probe: be used to design genus- or species-specific oligonucleotide
the a32P-labelled 300 bp fragment generated with OPA3 primer by probes for rapid identification and detection (Kingler and
RAPD. The strain membrane locations are listed in Table 1 Johnson 1988). Furthermore, this approach can be enhanced
© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
788 F . Q UE R E E T A L .

Fig. 3 Nucleotide sequence of the

300 bp band cloned from the
RAPD products of Lactobacillus
plantarum (see Fig. 1). The sense
and antisense sequences cor-
5?-AGTCAGCCACCAACCAGTTATTATTCGAATAAATACTAATTGAGGCAGCTGGCCAATCAT responding to the oligonucleotide
GAGCTACTACCGTTTGCACAGCTTGTGCTAGTTTGGGATCAACGGCTTGCTTGCTCCTCAAACA OPA3 are in italics. The two
CGGTCAGTCGATCATTCACATCAGTCGTGGCCGTTAGCGCGCCATTATAGGCAATCAATCATGG sequences corresponding to the
TCGAATTGATTCCTAGTTGTTGCGCAATTCCAAACATCCCTTTAGGCGAACGTGCTGACG specific oligonucleotides LbPl1
CTAACACCATTTGGGCACCCCGGGCCACCGCCGCTTGGACTCCCGTAATCGTGGCTGACT-3? and LbPl2 are underlined

Fig. 4 (a) PCR-specific reaction with LbPl1/LbPl2 and Lb1/Lb2 primers. Lanes: 1 and 12, DNA molecular weight marker 100 bp;
2–11, Lactobacillus strains listed in Table 1. A 253 bp fragment amplified with LbPl1/LbPl2 primers was detected in lanes 6 and 9. The
194 bp fragment amplified with Lb1/Lb2 primers was present in every lane. (b) PCR-specific reaction with LbPl1/LbPl2 and Lb1/Lb2
primers. Lanes: PM, DNA molecular weight marker 100 bp; 0, negative control (without DNA); 1–10, Lact. plantarum strains as listed in
Table 1; 11–18, Lact. pentosus strains as listed in Table 1. A 253 bp fragment amplified with LbPl1/LbPl2 primers was detected in
lanes 1 and 10. The 194 bp fragment amplified with Lb1/Lb2 primers was present in every lane

by the application of the PCR which can be used to amplify
rDNA sequences with specific primer sets. Nevertheless, the
difference in 16S rRNA sequences between Lact. plantarum
and Lact. pentosus was small. Only three nucleotides were
different when the 16S rRNA sequences of the two Lacto-
bacillus species were compared (data not shown). The 23S
rRNA sequences for Lact. plantarum and Lact. pentosus are
not yet available. For closely related species it may be difficult
to generate specific oligonucleotide probes or specific primer
sets based on 16S rRNA.
DNA probes for lactobacilli other than those based on 16S
or 23S rRNA (Hertel et al. 1991; Castellanos et al. 1993; Pot
© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
et al. 1993; Richter et al. 1995) or plasmids (Cocconcelli et al.
1991) are rare. Specific DNA probes for Lact. curvatus, Lact.
helveticus and Lact. delbrueckii based on random screening of
genomic DNA library and subsequent analysis of clones by
dot-blot hybridization are described but the fragments have
not been sequenced (Petrick et al. 1988; Delley et al. 1990;
Pilloud and Mollet 1990).
We used random amplification of the DNA (RAPD) to
develop a specific probe for Lact. plantarum. The RAPD
method reported here may be useful for the rapid devel-
opment of specific probes.
The 300 bp fragment isolated from Lact. plantarum DSM

20174 seemed to be conserved among the other strains of
Lact. plantarum species. A large number of strains belonging
to the Lact. plantarum species isolated in this laboratory from
a wide environmental diversity showed a high hybridization
level with our specific DNA probe (data not shown).
Weak hybridization signals were observed with two of the
five Lact. pentosus strains tested. However, these signals could
be clearly differentiated from the stronger hybridization
obtained with the Lact. plantarum strains. A weak sequence
homology located in the 300 bp region may exist between
Lact. plantarum and Lact. pentosus. This probably reflects
the close phylogenetic relationship of these two Lactobacillus
species. The determination of the 300 bp DNA probe speci-
ficity was confirmed by further results obtained with the
primer set selected. In fact, a PCR-specific identification of
Lact. plantarum is now available.
The use of the PCR for bacterial identification and detec-
tion offers a considerable potential as a rapid method and
combines speed, specificity, simplicity and sensitivity criteria.
It would be particularly useful when the species are pheno-
typically closely related and hard to distinguish by con-
ventional microbiological approaches. DNA probes have been
used in combination with PCR to detect specific bacteria.
One of the applications of this technology is the identification
of human pathogens in food (Yamamoto and Harayama 1995).
The probes were able to detect PCR products which were
not visible on the agarose gel (i.e. less that 1 ng of DNA)
(Wernars et al. 1991). PCR with Lbp1-Lbp2 primers or
followed by specific probe hybridization may offer a very
sensitive detection of Lact. plantarum and should be a con-
siderable advantage in analysis of fermented food and silage.
Direct PCR on colonies selected with a toothpick can be
advantageous in terms of time and labour costs. Many col-
onies could be analysed in a short time and the average of
Lact. plantarum in the analysed product could be determined.
A DNA probe may also be used, for instance, to monitor the
specific bacteria in food fermentations and silage processes
by colony hybridization.
In conclusion, a DNA probe and a PCR specific to Lact.
plantarum are described here. The use of this PCR, DNA
probe or PCR-DNA probe offers a rapid method for the
identification and detection of Lact. plantarum and could be
employed in analysis and monitoring of fermented foods and
feeds where Lact. plantarum is usually implicated.
ACKNOWLEDGEMENT
This work was partly financed by the Conseil Régional de
Bretagne, France, Project Britta No. 41 56 156.
REFERENCES
Abazinge, M.D.A., Fontenot, J.P., Allen, V.G. and Flick, G.J.
© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
D NA PR O BE AN D PC R F O R L AC T . P LA N TA RU M 789
(1993) Ensiling characteristics of crab waste and wheat straw
treated with different additives. Journal of Agricultural and Food
Chemistry 41, 657–661.
Birnboim, H.C. and Doly, J. (1979) A rapid alkaline extraction
procedure for screening recombinant plasmid DNA. Nucleic Acids
Research 7, 1513–1523.
Bringel, F., Curk, M.C. and Hubert, J.C. (1995) Characterization
of Lactobacilli species by nucleic acid hybridizations. Proposition
for a new species related with L. plantarum: L. paraplantarum.
Book of Abstracts. Lactic Acid Bacteria Conference, Cork, Ireland.
Castellanos, I., Vékris, A. and Deschamps, A. (1993) Elaboration of
strain-specific probe for probiotic lactobacilli. FEMS Micro-
biology Reviews 12, 153.
Cocconcelli, P.S., Triban, E., Basso, M. and Bottazzi, V. (1991)
Use of DNA probes in the study of silage colonization by Lacto-
bacillus and Pediococcus strains. Journal of Applied Bacteriology 71,
296–301.
Collins, M.D., Rodrigues, U., Ash, C., Aguirre, M., Farrow, J.A.E.,
Martinez-Murcia, A. et al. (1991) Phylogenetic analysis of the
genus Lactobacillus and related lactic acid bacteria as determined
by reverse transcriptase sequencing of 16S rRNA. FEMS Micro-
biology Letters 77, 5–12.
Dellaglio, F., Botazzi, V. and Trovatelli, L.D. (1973) Deoxy-
ribonucleic acid homology and base composition in some thermo-
philic lactobacilli. Journal of General Microbiology 74, 289–297.
Delley, M., Mollet, B. and Hottinger, H. (1990) DNA probe for
Lactobacillus delbrueckii. Applied and Environmental Microbiology
56, 1967–1970.
Feinberg, A.P. and Vogelstein, B. (1984) A technique for radio-
labelling DNA restriction endonuclease fragments to high specific
activity. Analytical Biochemistry 132, 6–13.
Fox, G.E., Stackebrandt, R.B., Hespell, J., Gibson, J., Maniloff,
T.A., Dyer, R.S. et al. (1980) The phylogeny of prokaryotes.
Science 209, 457–463.
Fujisawa, T., Benno, Y., Yaeshima, T. and Mitsuoka, T. (1992)
Taxonomic study of the Lactobacillus acidophilus group, with
recognition of Lactobacillus gallinarum sp. nov. and Lactobacillus
johnsonii sp. nov. and synonymy of Lactobacillus acidophilus group
A3 (Johnson et al. 1980) with the type strain of Lactobacillus
amylovorus (Nakamura 1981). International Journal of Systematic
Bacteriology 32, 487–491.
Hertel, C., Ludwig, W., Obst, M., Vogel, R.F., Hammes, W.P.
and Schleifer, K.-H. (1991) 23S rRNA-targeted oligonucleotide
probes for the rapid identification of meat Lactobacilli. Systematic
and Applied Microbiology 14, 173–177.
Johansson, M.L., Quednau, M., Molin, G. and Ahrné, S. (1995)
Randomly amplified polymorphic DNA (RAPD) for rapid typing
of Lactobacillus strains. Letters in Applied Microbiology 21, 155–
159.
Johnson, J.L., Phelps, C.F., Cummins, C.S., London, J. and Gasser,
F. (1980) Taxonomy of the Lactobacillus acidophilus group. Inter-
national Journal of Systematic Bacteriology 30, 53–68.
Kingler, J.D. and Johnson, A.R. (1988) A rapid nucleic acid hybrid-
ization assay for Listeria in foods. Food Technology 42, 66–70.
Klijn, N., Weerkamp, A.H. and de Vos, W.M. (1991) Identification
of mesophilic lactic acid bacteria by using polymerase chain reac-
tion-amplified variable regions of 16S rRNA and specific DNA
probes. Applied and Environmental Microbiology 57, 3390–3393.
790 F . Q UE R E E T A L .
Lassén, T.M. (1994) Evaluation of conditions for fermentation of
fish offal. Agricultural Science in Finland 4, 11–17.
Luchansky, J.B., Tennant, M.C. and Klaenhammer, T.R. (1991)
Molecular cloning and DNA polymorphisms in Lactobacillus
acidophilus and Lactobacillus gasseri. Journal of Dairy Science 74,
3293–3302.
Lücke, F.K. (1994) Fermented meat products. Food Research Inter-
national 27, 299–307.
Mauguin, S. and Novel, G. (1994) Characterization of lactic acid
bacteria isolated from seafood. Journal of Applied Bacteriology 76,
616–625.
Merry, R.J., Dhanoa, M.S. and Theodorou, M.K. (1995) Use of
freshly cultured lactic acid bacteria as silage inoculants. Grass and
Forage Science 50, 112–123.
Meunier, J.R. and Grimont, P.A. (1993) Factors affecting repro-
ducibility of random amplified polymorphic DNA fingerprinting.
Research Microbiology 144, 373–379.
Nakagawa, T., Shimada, M., Mukai, H., Asada, K., Kato, I., Fujino,
K. and Sato, T. (1994) Detection of alcohol-tolerant Hiochi bac-
teria by PCR. Applied and Environmental Microbiology 60, 637–
640.
Naumann, D., Helm, D. and Labischinski, H. (1991) Micro-
biological characterization by FT-IR spectroscopy. Nature 351,
81–82.
Okayama, H. and Berg, P. (1982) High efficiency cloning of full-
length cDNA. Molecular and Cellular Biology 2, 161–170.
Pederson, C.S. (1979) Microbiology of Food Fermentations. Westport,
CT: AVI Publishing Co.
Petrick, H.A.R., Ambrosio, R.E. and Holzapfel, W.H. (1988) Iso-
lation of a DNA probe for Lactobacillus curvatus. Applied and
Environmental Microbiology 54, 405–408.
Pilloud, N. and Mollet, B. (1990) DNA probes for the detection of
Lactobacillus helveticus. Systematic and Applied Microbiology 13,
345–349.
Pot, B., Hertel, C., Ludwig, W., Descheemaeker, P., Kersters, K.
and Schleifer, K.-H. (1993) Identification and classification of
Lactobacillus acidophilus, L. gasseri and L. johnsonii strains by
SDS-PAGE and RNA-targeted oligonucleotide probe hybrid-
ization. Journal of General Microbiology 139, 513–517.
Pot, B., Ludwig, W., Kersters, K. and Schleifer, K.-H. (1994a)
Taxonomy of lactic acid bacteria. In Bacteriocins in Lactic Acid
Bacteria ed. De Vuyst, L. and Vandamme, E.J. pp. 13–90. Glas-
gow, UK: Blackie Academic and Professional.
Pot, B., Vandamme, P. and Kersters, K. (1994b) Analysis of elec-
trophoretic whole-organism protein fingerprints. In Chemical
Methods in Prokaryotic Systematics ed. Goodfellow, M. and
O’Donnell, A.G. pp. 493–521. New York : John Wiley and Sons
Ltd.
Richter, L., Ehrmann, M., Fanta, D., Bohak, I. and Ludwig, W.
(1995) Comparative RNA sequence analysis of lactic acid bacteria
© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790
isolated from beer. Book of Abstracts. Lactic Acid Bacteria Con-
ference, Cork, Ireland.
Rodtong, S. and Tannock, G.W. (1993) Differentiation of Lacto-
bacillus strains by ribotyping. Applied and Environmental Micro-
biology 59, 3480–3484.
Roussel, Y., Colmin, C., Simonet, J.M. and Decaris, B. (1993)
Strain characterization, genome size and plasmid content in the
Lactobacillus acidophilus group. Journal of Applied Bacteriology 74,
549–556.
Ruiz-Barba, J.L., Cathcart, D.P., Warner, P.J. and Jiménez-Diaz,
R. (1994) Use of Lactobacillus plantarum LPCO10, a bacteriocin
producer, as a starter culture in spanish-style green olive fer-
mentations. Applied and Environmental Microbiology 60, 2059–
2064.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Clon-
ing: A Laboratory Manual ed. Ford, N., Nolan, C. and Ferguson,
M. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press.
Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing
with chain terminating inhibitors. Proceedings of the National
Academy of Sciences USA 74, 5463–5467.
Schleifer, K.-H. (1990) DNA probes in food microbiology. Food
Biotechnology 4, 585–589.
Stahl, M., Molin, F., Persson, A., Ahrné, S. and Stahl, S. (1990)
Restriction endonuclease patterns and multivariate analysis as a
classification tool for Lactobacillus spp. International Journal of
Systematic Bacteriology 40, 189–193.
Tzanetakis, N. and Litopoulou-Tzanetakis, E. (1992) Changes in
numbers and kinds of lactic acid bacteria in Feta and Teleme,
two greek cheeses from ewes’ milk. Journal of Dairy Science 75,
1389–1393.
Urlings, H.A.P., Bijker, P.G.H. and Van Logtestijn, J.G. (1993)
Fermentation of raw poultry by-products for animal nutrition.
Journal of Animal Science 71, 2420–2426.
Vogel, R.F., Lohmann, M., Nguyen, M., Weller, A.N. and
Hammes, W.P. (1993) Molecular characterization of Lactobacillus
curvatus and Lact. sake isolated from sauerkraut and their appli-
cation in sausage fermentations. Journal of Applied Bacteriology
74, 295–300.
Weinberg, Z.G., Ashbell, G., Yaira Hen and Azrieli, A. (1993) The
effect of applying lactic acid bacteria at ensiling on the aerobic
stability of silages. Journal of Applied Bacteriology 75, 512–518.
Wernars, K., Heuvelman, C.J., Chakraborty, T. and Notermans,
S.H.W. (1991) Use of the PCR for the direct detection of Listeria
monocytogenes in soft cheese. Journal of Applied Bacteriology 70,
121–126.
Yamamoto, S. and Harayama, S. (1995) PCR amplification and
direct sequencing of gyrB genes with universal primers and their
application to the detection and taxonomic analysis of Pseudo-
monas putida strains. Applied and Environmental Microbiology 61,
1104–1109.