Microb Ecol (2011) 61:704–714

DOI 10.1007/s00248-011-9813-z

HOST MICROBE INTERACTIONS

Diversity of Cervicovaginal Microbiota Associated

with Female Lower Genital Tract Infections
Zongxin Ling & Xia Liu & Xiaoyi Chen & Haibin Zhu &
Karen E. Nelson & Yaxian Xia & Lanjuan Li &
Charlie Xiang

Received: 31 October 2010 / Accepted: 28 December 2010 / Published online: 2 February 2011
# Springer Science+Business Media, LLC 2011

Abstract The female genital tract (FGT) harbors very ipants in China, including 30 women with bacterial
large numbers of bacterial species that are known to play vaginosis (BV; BV group), 22 women with cervicitis
an important role on vaginal health. Previous studies (Cer group), 18 women with BV in combination with
have focused on bacterial diversity in the vagina, but cervicitis (BC group) and 30 healthy control women (CN
little is known about the ectocervical microbiota associ- group). The diversity and richness of cervicovaginal
ated with FGT infections. In our study, vaginal swabs microbiota were investigated with culture-independent
and ectocervical swabs were collected from 100 partic- polymerase chain reaction (PCR)-denaturing gradient gel
electrophoresis (DGGE) and quantitative PCR (qPCR)
targeting 11 microorganisms that have been associated
Z. Ling : X. Liu : X. Chen : L. Li (*) : C. Xiang (*) with FGT infections. Despite significant interpersonal
State Key Laboratory for Diagnosis and Treatment of Infectious variations, the PCR-DGGE profiles revealed that vaginal
Diseases, the First Affiliated Hospital, College of Medicine, microbiota and ectocervical microbiota were clearly
Zhejiang University,
Hangzhou, Zhejiang 310003, China
much more complex in the BV group, while the
e-mail: ljli@zju.edu.cn ectocervical microbiota showed no significant difference
e-mail: cxiang@zju.edu.cn between healthy and diseased participants. Using species-
specific qPCR, BV and cervicitis were significantly
Z. Ling
e-mail: lingzongxin_lzx@163.com
associated with a dramatic decrease in Lactobacillus
species (p<0.05), and potential pathogenic species such as
X. Liu Gardnerella, Atopobium, Eggerthella, Leptotrichia/Sneathia,
e-mail: wl.114@163.com and Prevotella were more common and in higher copy
X. Chen
numbers in BV than in CN samples (p values ranged from
e-mail: joicecxy@hotmail.com 0.000 to 0.021). No significant differences were observed
between healthy and cervicitis samples (p>0.05) in ectocer-
H. Zhu : Y. Xia (*) vical microbiota. The total numbers of bacteria were
Department of Obstetrics and Gynecology, the First Affiliated
Hospital, College of Medicine, Zhejiang University,
significantly lower in the ectocervix as compared in the
Hangzhou, Zhejiang 310003, China vagina (p<0.05). Intriguingly, vaginal microbiota from
e-mail: xya55@sohu.com participants with BV in combination with cervicitis was
quite different from that of participants with BV or cervicitis
H. Zhu
e-mail:zhu7215@hotmail.com
alone. Our study demonstrated that the cervicovaginal
microbiota was actively involved in the process of FGT
K. E. Nelson : C. Xiang infections. The predominant bacteria of the cervicovaginal
J. Craig Venter Institute, communities were clearly associated with BV; however,
Rockville, MD 20850, USA
there was not sufficient evidence that the ectocervical
K. E. Nelson microbiota is directly involved in the development of
e-mail: kenelson@jcvi.org cervicitis.
Diversity of Cervicovaginal Microbiota
Introduction
The female genital tract (FGT) possesses unique charac-
teristics and is composed of several microenvironments
which harbor a range of different bacteria in very large
numbers that can have important effects on health. Many
of these bacteria such as H2O2- and lactic acid- producing
Lactobacillus are not simply passive or transient colo-
nizers, but rather appear to be adapted to the specific
environment [1–3]. These resident species effectively
constitute an ecological guild—a group of species that
have similar requirements and play a similar role within a
community—and maintaining high numbers of these
populations is a hallmark of healthy conditions [4]. FGT
and its microbiota form a balanced ecosystem that is an
important health-maintaining biological feature providing
host defense against infection. Dramatic changes in the
types and relative proportions of the microbial species in
FGT can lead to a diseased state [5, 6].
The complex structure of the FGT ecosystem can be
divided into several different microenvironments such as the
lower part of the endocervix in addition to the ectocervix and
the vagina [7]. The size and anatomical complexity of the
FGT ecosystem suggest the possibility that distinct microbial
populations may reside at discrete sites (e.g., cervix, fornix,
outer vaginal canal). Kim et al. have revealed that the
bacterial microbiota is not homogenous throughout the FGT
but differs significantly within an individual with regard to
anatomical site and sampling method used [8]. The disparity
of the bacterial diversity in different microenvironments of
the FGT ecosystem might be associated with FGT infections.
Among FGT infections, bacterial vaginosis (BV) and
cervicitis, which can be classified according to the site of
symptoms and clinical findings, are two of the most
prevalent diseases that affect millions of women annually
[9, 10]. BV, characterized by the microecological imbalance
and the replacement of a Lactobacilli-predominant micro-
biota to facultative and anaerobic vaginal microorganisms, is
the most prevalent lower genital tract infection in women of
reproductive age throughout the world [11–14] and is
strongly associated with several adverse health outcomes
such as pre-term birth and the acquisition of sexually
transmitted infections [15–19]. Observational evidence
increasingly supports the association between abnormal
vaginal microbiota and increased risk of BV. Previous
studies have demonstrated that BV was associated with an
increased risk of objective evidence for upper genital tract
infection including atypical pelvic pain, abnormal uterine
bleeding, endometritis, and so on [15, 20, 21]. Cervicitis, or
inflammation of the uterine cervix, is a frequently asymp-
tomatic inflammatory condition of the cervix that is generally
considered to result from infection with a sexually acquired
microorganism, most commonly Chlamydia trachomatis,
705
Neisseria gonorrhoeae, or Mycoplasma genitalium [10, 22,
23]. However, in many women with cervicitis, these micro-
organisms are not always detected, even when highly
sensitive diagnostic tests are performed [24–26]. Because
cervicitis increases the risk of poor pregnancy outcome,
predicts upper genital tract disease, and is also associated
with increased shedding of HIV-1 from the cervix in the
absence of chlamydial and gonococcal infection, determining
the etiology of this condition should be a priority. A
previous study noted that the disturbance of cervicova-
ginal microbiota, especially the absence of H2O2-producing
Lactobacillus species, were independently associated with an
increased likelihood of cervicitis among women with BV
[27]. In one study, 50% of women attending a clinic for
treatment of sexually transmitted diseases who had BV were
also at a higher risk for C. trachomatis cervicitis [28]. The
association between dysbiosis of cervicovaginal ecosystem
and cervicitis indicated that cervical microbiota might play
an important role in the development of cervicitis. Our
previous study showed that the diversity and richness of
vaginal microbiota was significantly associated with BV,
and several potential pathogenic genera have been found
in these communities [29]. The bacterial microbiota of the
FGT ecosystem might be contributing to the advent of
FGT infections. However, most previous studies focus on
vaginal microbiota, and the diversity of cervicovaginal
microbiota, especially the cervical microbiota has not been
sufficiently explored. The relationship between cervical
microbiota and cervicitis or even other FGT infections
remains unexplored.
The aim in the work reported here was to explore in detail
the bacterial diversity of the cervicovaginal microbiota that is
associated with BV and cervicitis. For this purpose, we
applied polymerase chain reaction-denaturing gradient gel
electrophoresis (PCR-DGGE) with broad range primers
corresponding to the bacterial 16S rRNA hypervariable V3
region to investigate the diversity of bacterial communities in
the FGT. In addition, a quantitative molecular tool targeting
total bacteria and ten predominant microorganisms in
FGT and a human β-Globin quantitative standard was
developed using a specific quantitative real-time PCR
(qPCR) and serial dilutions of a plasmid suspension. Our
findings give us further insight into the relationship
between the diversity and richness of cervicovaginal
microbiota and FGT infections.
Materials and Methods
Subject Selection and Sample Collection
A total of 200 vaginal swabs and 200 ectocervical swabs
were prospectively obtained from 100 women, including 30
706
women with BV (BV group), 22 women with cervicitis
(Cer group), 18 women with BV in combination with
cervicitis (BC group), and 30 healthy control women (CN
group), who came to the First Affiliated Hospital, College
of Medicine, Zhejiang University in China, for routine
gynecology examination from November 2009 through
May 2010. The median age of these participants was
31.6 years old. After informed written consent was
obtained, individuals were examined by two gynecologists.
BV status was assessed using Amsel’s clinical criteria for
all subjects [30] and confirmed using Gram-stain criteria
(Nugent scores) [31]. The participants who met three or
more of the following criteria were clinically diagnosed as
BV: homogenous vaginal discharge, >20% clue cells on
wet mount, elevated pH (≥4.5) of vaginal discharge, and
release of a fishy amine odor upon addition of 10%
potassium hydroxide solution to vaginal fluid (“whiff”
test). Then based on the criteria for BV assessment
developed by Nugent et al. [31], participants with the
Gram-stain score of ≥7 were finally confirmed as BV.
Cervicitis was defined clinically by the presence of either
mucopurulent discharge or easily induced bleeding (friabil-
ity) at the endocervical os; more subtle signs include edema
of the cervical ectropion (edematous ectopy) and the
presence of an elevated number of polymorphonuclear
leukocytes, as detected by Gram staining of a smear of
endocervical secretions under high-power magnification
(×1,000, oil immersion). Participants who qualified the
criteria for both BV and cervicitis were diagnosed with BV
in combination with cervicitis (BC group). Participants
without any of these conditions were defined as the healthy
control group (CN group). Any participant having any of
the following exclusion criteria was excluded: <18 years of
age, pregnancy, diabetes mellitus, use of antibiotics or
vaginal antimicrobials (orally or by topical application in
vulvar/vaginal area) in the previous month, menstruation,
menoxenia, presence of an intrauterine device, known
active coinfection due to Chlamydia, Candida albicans,
N. gonorrhoeae, or Trichomonas vaginalis, or clinically
apparent herpes simplex infection, or defined diagnosed
HPV, HSV-2, HIV infection. Vaginal and ectocervical
swabs were collected from the BV, cervicitis, BV in
combination with cervicitis, and CN groups. When women
underwent a standardized genital examination, vaginal
swabs were taken near the mid-vagina, and the ectocervical
swabs were collected from cervical canal, and these were
packaged and placed in ice packs. Among the swabs
collected, one vaginal swab was rolled onto a slide for
Gram staining; other swabs were used for bacterial genomic
DNA extraction. The vaginal and ectocervical swabs for
bacterial genomic DNA extraction were transferred to the
laboratory immediately in an ice-box, and stored at −80°C
for further analysis.
Z. Ling et al.
Total Bacterial Genomic DNA Extraction
The bacterial cells retrieved on swabs were submerged in 1 ml
of RNase free H2O and vigorously agitated to dislodge cells.
The cells were pelleted by centrifugation (Thermo Electron
Corporation, Boston, MA, USA) at full speed (more than
10,000×g) for 10 min, washed by re-suspending cells in
RNase free H2O and centrifuged at full speed for 5 min.
Bacterial DNA was then extracted from swabs using
QIAamp® DNA Mini Kit (QIAGEN, Hilden, Germany)
modified as follows: samples were agitated with 100 mg
zirconium beads (0.1 mm) and incubated at 56°C for 1 h in
lysis solution containing proteinase K [29]. The DNA was
eluted in 20 μl of elution buffer and stored at −20°C until use.
PCR-DGGE Analysis
For amplification of bacterial DNA, universal bacterial primers
341F and 534R for the V3 regions of 16S rRNA genes and the
reaction conditions described by Ling et al. [29, 32–34].
DGGE of the PCR products were performed as described by
Muyzer et al. [35, 36] and Ling et al. [29, 32–34] with 35% to
50% gradient for vaginal microbiota and 25% to 55% gradient
for ectocervical microbiota, using a D-Code system (Bio-Rad),
and the sequence analysis of the excised DGGE bands was
performed as described [29, 32–34].
qPCR Assay
The qPCR assay was performed with a Power SYBR Green
PCR Master Mix (Takara, Dalian, China) on an ABI 7900
Real-time PCR instrument according to the manufacturer’s
instructions (Applied Biosystems, Foster city, CA).
Species-specific primer sets and the reaction conditions
used for qPCR are shown in Table 1. For each primer set, a
constructed plasmid was chosen to create a 10-log-fold
standard curve for direct quantification of all samples. With
the exception of total Bacteria and Lactobacillus genus, all
standard curve genes were amplified from the vaginal
samples, plasmids constructed, sequenced and confirmed
by BLAST in GenBank. For total Bacteria and Lactoba-
cillus genus, E. coli ATCC 25922 and Lactobacillus casei
ATCC 27139 was used to create the plasmid standards,
respectively. For each, the product was cloned into pMD18-
T vector using the Simple TA Cloning Kit (Takara, Dalian,
China) following the manufacturer’s procedure. Purified
insert-containing plasmids were quantified using a Nano-
Drop ND-1000 spectrophotometer (Thermo Electron
Corporation), and taking into account the size of the
product insert, the number of target gene copies was
calculated from the mass of DNA. Tenfold serial
dilutions ranging from 1×109 to 1 gene copies were
included on each 96-well plate. Each subject’s extracted
Diversity of Cervicovaginal Microbiota 707

Table 1 Species-specific primer sets for detection of cervicovaginal bacteria by qPCR

PCR specificity Primer Sequence (5′→3′) Annealing Temperature Amplicon size (bp) Reference

Total bacteria Bac27F AGAGTTTGATCCTGGCTCAG 65 312 [37]

EUB338R-I GCTGCCTCCCGTAGGAGT
Lactobacillus Bact-0011 AGAGTTTGATYMTGGCTCAG 62 667 [38]
Lab-0677 CACCGCTACACATGGAG
Lactobacillus crispatus Lcris-F AGCGAGCGGAACTAACAGATTTAC 65 154 [39]
Lcris-R AGCTGATCATGCGATCTGCTT
Lactobacillus jensenii Ljens-F AAGTCGAGCGAGCTTGCCTATAGA 60 162 [40]
Ljens-R CTTCTTTCATGCGAAAGTAGC
Lactobacillus iners Liners-F CTCTGCCTTGAAGATCGGAGTGC 65 155 [40]
Liners-R ACAGTTGATAGGCATCATCTG
Gardnerella vaginalis GV1-F TTACTGGTGTATCACTGTAAGG 62 332 [41]
GV3-R CCGTCACAGGCTGAACAGT
Atopobium vaginae AV-F TAGGTCAGGAGTTAAATCTG 62 156 [42]
AV-R TCATGGCCCAGAAGACCGCC
Eggerthella Egger-621F AACCTCGAGCCGGGTTCC 60 239 [5]
Egger-859R TCGGCACGGAAGATGTAATCT
Megasphaera type I MegaE-456F GATGCCAACAGTATCCGTCCG 64 212 [5]
MegaE-667R CCTCTCCGACACTCAAGTTCGA
Leptotrichia/Sneathia Lepto-395F CAATTCTGTGTGTGTGAAGAAG 60 252 [5]
Lepto-646R ACAGTTTTGTAGGCAAGCCTAT
Prevotella Prevo-F CCAGCCAAGTAGCGTGCA 60 151 [43]
Prevo-R TGGACCTTCCGTATTACCGC
β-Globin GH2O GAAGAGCCAAGGACAGGTAC 60 270 [5]
PCO4 CAACTTCATCCACGTTCACC

DNA was subjected to a human β-globin PCR to ensure Statistics Analysis

that amplifiable DNA was successfully extracted from the
sample and to monitor for PCR inhibitors with the same
protocol listed for bacterial PCR [44]. Each qPCR
contained 12.5 μL of 2 × Takara Perfect Real-Time master
mix, 10.9 μL of water, 0.3 μL of a 10 μM F/R primer mix,
and 1 μL (10 ng) of extracted bacterial genomic DNA.
Cycling conditions: 95°C for 3 min; 40 repeats of the
following steps: 94°C for 30 s, 30 s annealing at different
temperature, and 72°C for 30 s. At each cycle, accumu-
lation of PCR products was detected by monitoring the
increase in fluorescence of the reporter dye, dsDNA-
binding SYBR Green. Following amplification, melting
temperature analysis of PCR products was performed to
determine the specificity of the PCR. Melting curves were
obtained from 55°C to 90°C, with continuous fluorescence
measurements taken at every 1°C increase in temperature.
Data analysis was conducted with Sequence Detection
Software version 1.6.3, supplied by Applied Biosystems. All
reactions were carried out in triplicate and a nontemplate
control was performed in every analysis. In addition, the
abundance of each group relative to total domain Bacteria
gene copy number was calculated for each replicate, and the
mean, standard deviation and statistical significance were
determined. The qPCR results were expressed as 16S rRNA
gene copies per 10 ng of bacterial genomic DNA.
The similarities of PCR-DGGE DNA profiles were ana-
lyzed with Quantity One® 1-D Analysis software (version
4.6.2; Bio-Rad Laboratory, Hercules, CA, USA). A
similarity matrix was constructed using Dice’s similarity
coefficient. Dendrograms were constructed by the unweighted
pair group method, using arithmetic averages (UPGMA).
Graphs of the qPCR results were prepared using GraphPad
Prism version 4.0 (GraphPad Software Inc. San Diego, CA).
The quantitative distribution of the microorganisms in
cervicovaginal microbiota was analyzed using the Mann–
Whitney U test in SPSS (SPSS Data Analysis Program
version 16.0, SPSS Inc, Chicago, IL) and were considered
statistically significant if p<0.05.
Results
Comparison of Cervicovaginal Microbiota PCR-DGGE
Fingerprints
PCR-DGGE is a useful tool to examine microbial diversity
and community structure in specific microhabitats and has
been widely applied for comparative analysis of parallel
samples. The differences of DGGE profiles in the same
708
community DNA samples might be caused by different
primer sets targeting the different hypervariable regions of
16S rRNA genes. The hypervariable region(s) chosen for
amplification can greatly influence the PCR-DGGE profiles
and diversity indices produced from community DNA
samples, and even subtle differences in primer sequences
can result in substantially different profiles and assessment of
microbial diversity. By comparing of different hypervariable
regions of 16S rRNA genes for PCR-DGGE, Yu and Morrison
have shown that the DGGE profiles of the V3 region were best
Figure 1 Polymerase chain reaction-denaturing gradient gel electro-
phoresis (PCR-DGGE) analysis of the cervicovaginal microbiota in
vaginal swabs and ectocervical swabs. A-1 PCR-DGGE fingerprints of
the vaginal microbiota of samples from healthy women (CN group),
bacterial vaginosis (BV group), cervicitis (Cer group), and BV in
combination with cervicitis (BC group). Each lane represented one
subject which was selected in its group at random. M represents a
marker constructed in this study with the identified bands to facilitate
the interpretation of the figure. Bands 1, uncultured Sneathia sp.; 2,
Fusobacterium nucleatum subsp. nucleatum ATCC 25586; 3, Clos-
tridium thermocellum ATCC 27405; 4, Lactobacillus iners; 5,
Clostridium acetobutylicum; 6, L. iners; 7, Clostridium thermocellum
ATCC 27405; 8, Atopobium vaginae; 9, uncultured Eggerthella spp.;
Z. Ling et al.
[36]. A band at the same height in different lanes is
considered to be the same bacterial species. At least three
replicate PCRs carried out on the same bacterial genomic
DNA had identical profiles, indicating that the PCR and
DGGE protocols were reproducible. As shown in Fig. 1, the
PCR-DGGE profiles revealed significant differences in the
overall structure and composition of vaginal microbiota and
ectocervical microbiota by targeting the V3 region of 16S
rDNA, although significant interpersonal variations existed
in these DGGE profiles.
10, uncultured Megasphaera spp.; and 11, L. crispatus. A-2
Dendrogram of the DGGE profiles shown in (A-1). B-1 PCR-DGGE
fingerprints of the ectocervical microbiota of samples from the four
groups mentioned above. Bands 1, Sneathia spp.; 2, Megasphaera
spp.; 3, Prevotella spp.; 4, L. iners; 5, Dialister spp.; 6, Lactobacillus
gasseri; 7, Gardnerella vaginalis; 8, Prevotella spp.; 9, A. vaginae;
10, Prevotella spp.; 11, Eggerthella spp.; 12, G. vaginalis; 13:, S.
intermedius. B-2, Dendrogram of the DGGE profiles shown in (B-1).
Dice’s coefficient of similarity with the unweighted pair group method
with arithmetic averages clustering algorithm. DGGE fingerprints
show significant interpersonal variations and obviously difference
between vaginal and ectocervical microbiota
Diversity of Cervicovaginal Microbiota
In general, there was significant consensus of bacterial
diversity in each group, although slightly variability still
existed between different individuals. There was a low level
of bacterial diversity in the healthy women and the genus
Lactobacillus represented the predominant inhabitants of
the healthy vaginal tract, as almost all the samples in the
CN group had at least one band of a Lactobacillus species
(Lactobacillus iners, corresponding to bands 4 and 6 in the
marker lane and Lactobacillus crispatus, corresponding to
band 11) as verified by sequence analysis of the DNA
isolated from the band. Previous studies have also shown
that other Lactobacillus species such as Lactobacillus
gasseri, Lactobacillus acidophilus, and Lactobacillus
vaginalis, which can produce H2O2, organic acids, and
bacteriocins, were also found in the healthy vagina by PCR-
DGGE [45]. The genus of Lactobacillus was a commensal
bacterium in maintaining eubiosis of the vagina [4, 29]. The
bacterial diversity of vaginal microbiota was clearly higher
in BV group than other groups (Fig. 1(A-1)). The relative
lack of H2O2- and acid-producing Lactobacillus and the
overgrowth of anaerobic bacteria such as Gardnerella
vaginalis, Atopobium vaginae, Sneathia sp., Eggerthella
sp., and Megasphaera sp. likely reflect the bacteria and host
interplay resulting in the disruption of the balance of
vaginal microecology and these microbiota alterations were
significantly associated with BV. In contrast, the DGGE
profiles of vaginal microbiota were similar in CN and Cer
groups and the genus of Lactobacillus was also the
predominant bacteria in women with cervicitis, while the
bacterial diversity of the BV group was far more complex.
Figure 1(A) also shows that the diversity of vaginal
microbiota in the BC group was less complex than the
BV group (Dice’s coefficient showed in Fig. 1(A-2)),
which indicates that the structure of the vaginal microbiota
from participants with BV in combination with cervicitis
was quite different from that of participants with BV or
cervicitis alone.
The bacterial diversity of ectocervical microbiota also
showed a significant difference between healthy and
diseased participants (Fig. 1(B-1)). DGGE profiles of the
ectocervical microbiota from the four groups revealed
remarkable differences. Strikingly, DGGE profiles from
the BV group revealed the most complex bacterial
community, while the DGGE profiles from CN group
were relatively simple, with only a few amplicons
detected. The diversity of ectocervical microbiota in Cer
group was more complex than CN samples, but less
complicated than BV samples. Intriguingly, the DGGE
profiles of the BC group were not changed significantly
by comparison with Cer and CN samples. Dice’s coeffi-
cient of similarity with UPGMA showed in Fig. 1(B-2).
Consistent with healthy vaginal microbiota, Lactobacillus
was also the predominant bacteria of CN and Cer groups.
709
However, anaerobic bacteria such as G. vaginalis, A.
vaginae, Prevotella sp., Sneathia sp., and Megasphaera
sp. constituted the overall structure and diversity of
cervical microbiota in BV and BC groups.
Quantitative Analysis of Cervicovaginal Microbiota
by qPCR
Our qPCR results indicated that all bacteria detected in our
study were found in both the vaginal and the ectocervical
microbiota. However, using species-specific qPCR, the
total numbers of bacteria was significantly lower in
ectocervical microbiota, compared with the vaginal microbiota
(p<0.05) (Fig. 2). No differences in total numbers of bacteria
were found in the vaginal microbiota and ectocervical
microbiota, respectively (p>0.05).
In vaginal microbiota, the H2O2- and lactic acid-
producing Lactobacillus spp. such as L. iners, L. crispatus,
and Lactobacillus jensenii were the predominant bacteria in
the CN group and maintained the eubiosis of the specific
microenvironment of FGT, which thus exerted a strong
colonization resistance. This group of bacteria was however
significantly reduced in the BV group (p<0.05). L. iners
was one of the most prevalent and abundant vaginal
Lactobacillus spp. in healthy women, while about 100- to
1,000-fold declines in population or even absence was
observed in the vagina of BV (107 copies/mL vs. 103–105
copies/mL), but not in vagina of cervicitis. This suggests
that L. iners could potentially be used as markers to
evaluate the status of the FGT microhabitat. The relative
abundance of the other two species of Lactobacillus
accounted for only small proportion in the FGT microbiota.
The genera of Gardnerella, Atopobium, Eggerthella,
Leptotrichia/Sneathia, and Prevotella were more common
and present with higher bacterial loads in BV than in CN
samples (p values ranged from 0.000 to 0.021), although
there was significant interpersonal variations (data not
shown). Except for Gardnerella, Atopobium, and
Leptotrichia/Sneathia, the similar change pattern was also
found in Cer group and BC group. Previous studies have
also shown that the combined detection of the overgrowth
of A. vaginae and G. vaginalis can diagnose BV with more
sensitivity and specificity [46]. High copy numbers of A.
vaginae and G. vaginalis (DNA level >105 copies/mL
respectively) were also present in almost all BV samples in
our study. The combined detection of these two species for
BV diagnosis has excellent sensitivity (100%), specificity
(96.7%), and positive (93.8%) and negative (93.3%)
predictive values. Although approximately 105 copies/mL
of the two species was detected in several samples of BC
group (3/18 for A. vaginae and 7/18 for G. vaginalis), there
were still no significant differences among Cer, BC groups
and CN, BV groups (p>0.05).
710
Figure 2 Number of bacteria in cervicovaginal swabs collected from
BV and cervicitis, measured using qPCR assay. a Total bacteria. b
Lactobacillus genus. c Lactobacillus crispatus. d Lactobacillus iners.
e Lactobacillus jensenii. f Eggerthella. g Gardnerella vaginalis.
h Atopobium vaginae. i Prevotella. j Leptotrichia/Sneathia. k
Megasphaera type I. No significant differences in total numbers of
bacteria were found in the vaginal microbiota and ectocervical
microbiota, respectively (p>0.05). All species of bacteria and total
bacteria were significantly different between vaginal microbiota and
Z. Ling et al.
ectocervical microbiota (p<0.05). The commensal bacterium, Lactoba-
cillus, was significantly decreased in BV and cervicitis (p<0.05).
Obvious differences between BV and CN samples were found in A.
vaginae, G. vaginalis, Eggerthella, Leptotrichia/Sneathia, and Prevo-
tella of the vaginal microbiota and ectocervical microbiota (p<0.05).
These bacteria were also significantly different between vaginal micro-
biota and ectocervical microbiota in the BV group (p<0.05). However,
there was no difference between Cer group and other groups in the
ectocervical microbiota (p>0.05)
Diversity of Cervicovaginal Microbiota
Recently, Prevotella species have attracted more and
more attention with respect to the process of FGT
infections. Our data also showed that Prevotella was one
of the most sensitive and specific markers for BV
(Prevotella DNA level ≥105 copies/mL has 100% sensi-
tivity, 92% specificity, and 96.8% positive and 96.7%
negative predictive values). Alternatively, Prevotella
might not be pathogenic, but rather a marker for infection
with other fastidious bacteria, because Prevotella was also
frequent among women without BV [5] and was not
associated with other reproductive morbidity. Compared
with CN group, Prevotella was also found with high
bacterial loads in Cer and BC group (p < 0.001). In
addition, our data also showed that other species in the
pathogenic community, such as Eggerthella and Leptotrichia/
Sneathia, were also common and abundant in the vagina
with BV. Tamrakar et al. reported that the presence of
Eggerthella was an independent risk factor of BV scores
(Nugent score, ≥7) [40]. Leptotrichia/Sneathia, a new genus
recently observed in FGT, was very specific for BV by
bacterium-specific PCR assays [5] and could be a new
marker of BV, but not for cervicitis. Intriguingly, vaginal
microbiota from BV in combination with cervicitis
participants showed significantly variations for these
two species (p<0.05) which were not concordant with
vaginal microbiota from either BV or Cer groups. It might
be indicated that the combination infections in FGT
changed the vaginal microhabitat significantly and dis-
turbed the colonization and growth of not only these
bacteria and Lactobacillus, but also those potentially
pathogenic genera. We also found a clear negative
association between population abundance of Lactobacillus
and these potential pathogenic bacteria mentioned above.
Our quantitative studies of bacterial species in vaginal
communities demonstrated one common finding: increased
numbers of these potential pathogenic bacteria were found
during the advent of BV.
In the ectocervical microbiota, except for Megasphaera,
other species in our study showed similar change patterns
when compared between CN and BV groups, which were
consistent with the vaginal microbiota (p<0.05). However,
no significant differences in population abundance of these
predominant bacteria were found between healthy and Cer,
BC samples (p>0.05), except for the genus of Lactobacillus.
Our results showed that the decrease of Lactobacillus might
involve in the procession of cervicitis. The DNA level of
Gardnerella, Atopobium, Eggerthella, Leptotrichia/Sneathia,
and Prevotella were significantly different between BV and
Cer groups. It was unexpected that species that significantly
associated with BV were not changed dramatically in
cervicitis and BV in combination with cervicitis. Comparison
between vaginal and ectocervical microbiota in the same
group, these predominant bacteria differed significantly in
711
BV cohort. These bacteria especially Lactobacillus, L. iners,
Atopobium, Gardnerella, Eggerthella, Leptotrichia/Sneathia,
and Prevotella might be the potential pathogenic bacteria
that associate with BV significantly. No single bacterium in
the cervicovaginal microbiota could be identified as a
specific marker for BV and cervicitis.
Discussion
Normal as well as abnormal bacterial microbiota in a
specific microhabitat plays a vital role in the progression
and outcome of complex microbial diseases [4, 47, 48]. In
order to better understand the etiology and pathogenesis of
these microbial diseases, it is important to explore the
diversity and richness of the bacterial microbiota in the
specific microhabitat in details. Our present study differs
from previously published studies on the FGT microbiota
that mainly focus on vaginal microbiota and FGT
infections. We have explored the composition and
diversity of cervicovaginal microbiota including vaginal
and ectocervical microbiota that are associated with FGT
infections, specifically BV and cervicitis, and made a direct
comparison between vaginal microbiota and ectocervical
microbiota from the same groups. Each FGT microenviron-
ment hosts its own bacterial population with a slightly
different biochemical and physical profile which are closely
associated with the bacterial microbiota characteristics [49].
Our study analyzed the diversity and abundance of the
cervicovaginal microbiota by PCR-DGGE and qPCR, and
verified this microbiota population difference, which might
be helpful to reveal the microbiota-host interplay deeply.
In the present study, we reported the difference of
diversity and richness of cervicovaginal microbiota (includ-
ing vaginal microbiota and ectocervical microbiota)
between healthy and diseased participants (including BV,
Cer, and BC group). In fact, Kim et al. have already
revealed that the bacterial microbiota is not homogenous
throughout the FGT but differs significantly within an
individual with regard to anatomical site [8]. However, they
only focused on FGT microbiota of healthy participants, the
relationships between these microbiota and microbial
diseases were not investigated deeply. As one of the clinical
studies of the host-microbe interactions, our study repre-
sented the direct comparison of the diversity and abundance
of cervicovaginal microbiota among different FGT infec-
tions. Our data showed that the structure of ectocervical
microbiota was significantly different from vaginal micro-
biota, and the total numbers of bacteria were significantly
lower in the ectocervix as compared in the vagina. In
addition, the composition of ectocervical microbiota was
not concordant with vaginal microbiota even in the same
participant, which might be due to the unique microhabitat
712
of the cervix mentioned above [50]. Our results indicated
that bacterial diversity was much more complex in BV
samples in microbial fingerprints, as demonstrated using
PCR-DGGE, regardless of vaginal microbiota or ectocer-
vical microbiota. The DGGE profiles might imply that the
development of BV disturbed the eubiosis of the FGT
microecosystem significantly. Surprisingly, the diversity of
the cervicovaginal microbiota did not change significantly
between Cer group and other groups. These disparities of
the predominant bacteria of cervicovaginal microbiota
indicated the possible relationships between microbes and
FGT infections. Marrazzo JM et al. have showed that BV
was one of the risk factor of cervicitis, however, the overall
structure of the predominant bacteria in FGT infections
showed no similar pattern in the present study [27]. The
structure of the predominant bacteria in cervicovaginal
microbiota was explored with PCR-DGGE, which could
not detect a population whose relative abundance was less
than approximately 1% of the total cell count [35]. This
might be the limitations of our present study, and the
overall structure and composition of the cervicovaginal
microbiota could not be reached. However, the DGGE
profiles of the predominant bacteria could reflect the status
of the microecology of the FGT microhabitat directly and
these predominant bacterial taxa determined the eubiosis
and dysbiosis of the FGT microecosystem.
Based on our prior research about the diversity of
vaginal microbiota that associated with BV by high-
throughput sequencing technique (454 Roche GS FLX),
total bacteria and ten predominant bacterial species were
selected to evaluate the composition and richness of the
cervicovaginal microbiota [29]. Consistent with previous
study, there was a profound shift of bacterial transition in
vaginal microbiota between healthy and BV participants in
our study, especially the decrease of Lactobacillus and the
increase of potential pathogenic bacteria such as A.
vaginae, G. vaginalis, Eggerthella, Leptotrichia/Sneathia,
Prevotella, and so on. Consistent with previous study, the
genus of Lactobacillus was significantly declined in
participants with cervicitis [27]. The massive upheaval in
microbiota of the vaginal microecosystem might cause
significant dysbiosis and might be associated with the
development of BV [29]. Zozaya-Hinchliffe et al. showed
that the diversity and abundance of the vaginal microbiota
including these bacteria was significantly associated with
Nugent score [51]. Compared with vaginal microbiota, the
dramatic decrease found in the copy number of ectocervical
microbiota might be ascribing to the specific anatomy of
ectocervix, no matter whether the participant suffered from
FGT infections or not (Fig. 2). Although there were
obviously interpersonal variations in the same group from
our small-scale investigations, the copy numbers of the ten
microorganisms from ectocervix group were significantly
Z. Ling et al.
lower than that from vagina group (p<0.05). The bacterial
loads of the ten microorganisms in the ectocervical micro-
biota were similar between cervicitis and healthy partic-
ipants (p>0.05). To our surprise, those potential pathogenic
bacteria mentioned above that actively participated in BV
were not significantly different between cervicitis and
healthy participants. Our findings indicated that the
ectocervical microbiota in the present study was not directly
involved in the process of cervicitis. Other pathogens such
as C. trachomatis, N. gonorrhoeae, M. genitalium or herpes
simplex virus might contribute to the onset of cervicitis but
not significantly disturb the balance of FGT microecosys-
tem. Previous studies have shown that BV might be one of
the important putative etiological agents implicated in
cervicitis and there was a possible association between
BV and cervicitis, independent of concomitant chlamydial
and gonococcal infection [20, 52]. However, our microbi-
ological data showed that there was no significant correla-
tion between the two FGT infections. It might be indicated
that BV was one of the high-susceptibility factors for
cervicitis but does not directly cause cervicitis. While BV
dramatically influenced the FGT microhabitat, other potential
pathogens that were associated with cervicitis broke through
the FGT colonization resistance and overgrew in the ectocer-
vix at the same times. Further studies of the interplay between
cervicitis associated pathogens mentioned above and FGT
microbiota could contribute to a deeper understanding of the
etiology and pathogenesis of cervicitis. Coincident with the
vaginal microbiota above, the ectocervical microbiota in BC
group was significantly different from BV group (p<0.05),
but similar to the CN and Cer groups. The decrease of
Lactobacillus and the overgrowth of A. vaginae, G.
vaginalis, Eggerthella, Leptotrichia/Sneathia, and Prevotella
in the ectocervix were also involved in BV. In combination
with vaginal microbiota and ectocervical microbiota, our
data showed that the FGT microhabitat changed from
eubiosis to dysbiosis and led to the development of BV but
not to cervicitis.
In conclusion, our study demonstrates the cervicovaginal
microbiota plays an important role in the process of FGT
infections, especially in BV. Our results elucidated that the
prevalence and concentration of bacteria in the vaginal
microbiota are more than that in the ectocervical micro-
biota. The cervicovaginal communities including A. vaginae,
G. vaginalis, Eggerthella, Leptotrichia/Sneathia, and
Prevotella were clearly associated with BV. However, there
was not sufficient evidence to support a conclusion that the
cervicovaginal microbiota, especially the ectocervical micro-
biota, is involved in the process of cervicitis. Continuing
exploration of cervicovaginal communities and host interplay
in different healthy and diseased states will shed light on the
FGT infections susceptibility and provide new insights for
treatment.
Diversity of Cervicovaginal Microbiota
Acknowledgments This present work was funded by grant no.
2007CB513001 from the National Basic Research Program of China
(973 program) and partly supported by grants from China’s National
Science and Technology Major Project (nos. 2008ZX10004-002 and
2009ZX10004-105), and a Qiu-Shi Professorship from Zhejiang
University. We thank Dr. William C. Nierman from the J. Craig
Venter Institute in Rockville, Maryland, USA for critical reading.
References
1. Antonio MA, Hawes SE, Hillier SL (1999) The identification of
vaginal Lactobacillus species and the demographic and microbio-
logic characteristics of women colonized by these species. J Infect
Dis 180:1950–1956
2. Boskey ER, Cone RA, Whaley KJ, Moench TR (2001) Origins of
vaginal acidity: high D/L lactate ratio is consistent with bacteria
being the primary source. Hum Reprod 16:1809–1813
3. Redondo-Lopez V, Cook RL, Sobel JD (1990) Emerging role of
Lactobacilli in the control and maintenance of the vaginal
bacterial microflora. Rev Infect Dis 12:856–872
4. Zhou X, Brown CJ, Abdo Z, Davis CC, Hansmann MA, Joyce P,
Foster JA, Forney LJ (2007) Differences in the composition of
vaginal microbial communities found in healthy Caucasian and
black women. ISME J 1:121–133
5. Fredricks DN, Fiedler TL, Marrazzo JM (2005) Molecular
identification of bacteria associated with bacterial vaginosis. N
Engl J Med 353:1899–1911
6. Dethlefsen L, McFall-Ngai M, Relman DA (2007) An ecological
and evolutionary perspective on human-microbe mutualism and
disease. Nature 449:811–818
7. Cole AM (2006) Innate host defense of human vaginal and
cervical mucosae. Curr Top Microbiol Immunol 306:199–230
8. Kim TK, Thomas SM, Ho M, Sharma S, Reich CI, Frank JA,
Yeater KM, Biggs DR, Nakamura N, Stumpf R, Leigh SR,
Tapping RI, Blanke SR, Slauch JM, Gaskins HR, Weisbaum JS,
Olsen GJ, Hoyer LL, Wilson BA (2009) Heterogeneity of vaginal
microbial communities within individuals. J Clin Microbiol
47:1181–1189
9. Wang J (2000) Bacterial vaginosis. Prim Care Update Ob Gyns
7:181–185
10. Gaydos C, Maldeis NE, Hardick A, Hardick J, Quinn TC (2009)
Mycoplasma genitalium as a contributor to the multiple etiologies
of cervicitis in women attending sexually transmitted disease
clinics. Sex Transm Dis 36:598–606
11. Schwebke JR (2009) New concepts in the etiology of bacterial
vaginosis. Curr Infect Dis Rep 11:143–147
12. Kalra A, Palcu CT, Sobel JD, Akins RA (2007) Bacterial
vaginosis: culture- and PCR-based characterizations of a complex
polymicrobial disease’s pathobiology. Curr Infect Dis Rep 9:485–
500
13. Schwebke JR (2000) Bacterial vaginosis. Curr Infect Dis Rep
2:14–17
14. Allsworth JE, Peipert JF (2007) Prevalence of bacterial vaginosis:
2001–2004 national health and nutrition examination survey data.
Obstet Gynecol 109:114–120
15. Haggerty CL, Hillier SL, Bass DC, Ness RB (2004) Bacterial
vaginosis and anaerobic bacteria are associated with endometritis.
Clin Infect Dis 39:990–995
16. Sweet RL (1995) Role of bacterial vaginosis in pelvic inflammatory
disease. Clin Infect Dis 20(Suppl 2):S271–S275
17. Gravett MG, Hummel D, Eschenbach DA, Holmes KK (1986)
Preterm labor associated with subclinical amniotic fluid infection
and with bacterial vaginosis. Obstet Gynecol 67:229–237
713
18. Hillier SL, Nugent RP, Eschenbach DA, Krohn MA, Gibbs RS,
Martin DH, Cotch MF, Edelman R, Pastorek JG 2nd, Rao AV et al
(1995) Association between bacterial vaginosis and preterm
delivery of a low-birth-weight infant. The vaginal infections and
prematurity study group. N Engl J Med 333:1737–1742
19. Ness RB, Kip KE, Hillier SL, Soper DE, Stamm CA, Sweet RL,
Rice P, Richter HE (2005) A cluster analysis of bacterial
vaginosis-associated microflora and pelvic inflammatory disease.
Am J Epidemiol 162:585–590
20. Peipert JF, Montagno AB, Cooper AS, Sung CJ (1997) Bacterial
vaginosis as a risk factor for upper genital tract infection. Am J
Obstet Gynecol 177:1184–1187
21. Schwebke JR, Weiss HL (2002) Interrelationships of bacterial
vaginosis and cervical inflammation. Sex Transm Dis 29:59–64
22. Cohen CR, Manhart LE, Bukusi EA, Astete S, Brunham RC,
Holmes KK, Sinei SK, Bwayo JJ, Totten PA (2002) Association
between Mycoplasma genitalium and acute endometritis. Lancet
359:765–766
23. Marrazzo JM, Celum CL, Hillis SD, Fine D, DeLisle S, Handsfield
HH (1997) Performance and cost-effectiveness of selective screening
criteria for Chlamydia trachomatis infection in women. Implications
for a national Chlamydia control strategy. Sex Transm Dis 24:131–
141
24. Brunham RC, Paavonen J, Stevens CE, Kiviat N, Kuo CC,
Critchlow CW, Holmes KK (1984) Mucopurulent cervicitis—the
ignored counterpart in women of urethritis in men. N Engl J Med
311:1–6
25. Nyirjesy P (2001) Nongonococcal and nonchlamydial cervicitis.
Curr Infect Dis Rep 3:540–545
26. Marrazzo JM, Handsfield HH, Whittington WL (2002) Predicting
chlamydial and gonococcal cervical infection: implications for
management of cervicitis. Obstet Gynecol 100:579–584
27. Marrazzo JM, Wiesenfeld HC, Murray PJ, Busse B, Meyn L,
Krohn M, Hillier SL (2006) Risk factors for cervicitis among
women with bacterial vaginosis. J Infect Dis 193:617–624
28. Yoshimura K, Yoshimura M, Kobayashi T, Kubo T, Hachisuga T,
Kashimura M (2009) Can bacterial vaginosis help to find sexually
transmitted diseases, especially chlamydial cervicitis? Int J STD
AIDS 20:108–111
29. Ling Z, Kong J, Liu F, Zhu H, Chen X, Wang Y, Li L, Nelson KE,
Xia Y, Xiang C (2010) Molecular analysis of the diversity of
vaginal microbiota associated with bacterial vaginosis. BMC
Genomics 11:488
30. Amsel R, Totten PA, Spiegel CA, Chen KC, Eschenbach D,
Holmes KK (1983) Nonspecific vaginitis. Diagnostic criteria and
microbial and epidemiologic associations. Am J Med 74:14–22
31. Nugent RP, Krohn MA, Hillier SL (1991) Reliability of
diagnosing bacterial vaginosis is improved by a standardized
method of gram stain interpretation. J Clin Microbiol 29:297–301
32. Li M, Wang B, Zhang M, Rantalainen M, Wang S, Zhou H,
Zhang Y, Shen J, Pang X, Zhang M, Wei H, Chen Y, Lu H, Zuo J,
Su M, Qiu Y, Jia W, Xiao C, Smith LM, Yang S, Holmes E, Tang
H, Zhao G, Nicholson JK, Li L, Zhao L (2008) Symbiotic gut
microbes modulate human metabolic phenotypes. Proc Natl Acad
Sci USA 105:2117–2122
33. Wei G, Lu H, Zhou Z, Xie H, Wang A, Nelson K, Zhao L (2007)
The microbial community in the feces of the giant panda
(Ailuropoda melanoleuca) as determined by PCR-TGGE profiling
and clone library analysis. Microb Ecol 54:194–202
34. Ling Z, Kong J, Jia P, Wei C, Wang Y, Pan Z, Huang W, Li L,
Chen H, Xiang C (2010) Analysis of oral microbiota in children
with dental caries by PCR-DGGE and barcoded pyrosequencing.
Microb Ecol 60:677–690
35. Muyzer G, de Waal EC, Uitterlinden AG (1993) Profiling of
complex microbial populations by denaturing gradient gel
714
electrophoresis analysis of polymerase chain reaction-amplified
genes coding for 16S rRNA. Appl Environ Microbiol 59:695–700
36. Yu Z, Morrison M (2004) Comparisons of different hypervariable
regions of rrs genes for use in fingerprinting of microbial
communities by PCR-denaturing gradient gel electrophoresis.
Appl Environ Microbiol 70:4800–4806
37. Lipp JS, Morono Y, Inagaki F, Hinrichs KU (2008) Significant
contribution of Archaea to extant biomass in marine subsurface
sediments. Nature 454:991–994
38. Heilig HG, Zoetendal EG, Vaughan EE, Marteau P, Akkermans
AD, de Vos WM (2002) Molecular diversity of Lactobacillus spp.
and other lactic acid bacteria in the human intestine as determined
by specific amplification of 16S ribosomal DNA. Appl Environ
Microbiol 68:114–123
39. Byun R, Nadkarni MA, Chhour KL, Martin FE, Jacques NA, Hunter
N (2004) Quantitative analysis of diverse Lactobacillus species
present in advanced dental caries. J Clin Microbiol 42:3128–3136
40. Tamrakar R, Yamada T, Furuta I, Cho K, Morikawa M, Yamada
H, Sakuragi N, Minakami H (2007) Association between
Lactobacillus species and bacterial vaginosis-related bacteria,
and bacterial vaginosis scores in pregnant Japanese women.
BMC Infect Dis 7:128
41. Zariffard MR, Saifuddin M, Sha BE, Spear GT (2002) Detection
of bacterial vaginosis-related organisms by real-time PCR for
Lactobacilli, Gardnerella vaginalis and Mycoplasma hominis.
FEMS Immunol Med Microbiol 34:277–281
42. Ferris MJ, Masztal A, Martin DH (2004) Use of species-directed 16S
rRNA gene PCR primers for detection of Atopobium vaginae in
patients with bacterial vaginosis. J Clin Microbiol 42:5892–5894
43. Martin FE, Nadkarni MA, Jacques NA, Hunter N (2002)
Quantitative microbiological study of human carious dentine by
culture and real-time PCR: association of anaerobes with
histopathological changes in chronic pulpitis. J Clin Microbiol
40:1698–1704
Z. Ling et al.
44. Fredricks DN, Relman DA (1999) Paraffin removal from tissue
sections for digestion and PCR analysis. Biotechniques 26:198–
200
45. Vitali B, Pugliese C, Biagi E, Candela M, Turroni S, Bellen G,
Donders GG, Brigidi P (2007) Dynamics of vaginal bacterial
communities in women developing bacterial vaginosis, candidiasis,
or no infection, analyzed by PCR-denaturing gradient gel electro-
phoresis and real-time PCR. Appl Environ Microbiol 73:5731–5741
46. Menard JP, Fenollar F, Henry M, Bretelle F, Raoult D (2008)
Molecular quantification of Gardnerella vaginalis and Atopobium
vaginae loads to predict bacterial vaginosis. Clin Infect Dis
47:33–43
47. Ley RE, Knight R, Gordon JI (2007) The human microbiome:
eliminating the biomedical/environmental dichotomy in microbial
ecology. Environ Microbiol 9:3–4
48. Swidsinski A, Loening-Baucke V, Verstraelen H, Osowska S,
Doerffel Y (2008) Biostructure of fecal microbiota in healthy subjects
and patients with chronic idiopathic diarrhea. Gastroenterology
135:568–579
49. Bezirtzoglou E, Voidarou Ch, Papadaki A, Tsiotsias A, Kotsovolou
O, Konstandi M (2008) Hormone therapy alters the composition of
the vaginal microflora in ovariectomized rats. Microb Ecol 55:751–
759
50. Gorodeski GI, Hopfer U, Liu CC, Margles E (2005) Estrogen acidifies
vaginal pH by up-regulation of proton secretion via the apical
membrane of vaginal-ectocervical epithelial cells. Endocrinology
146:816–824
51. Zozaya-Hinchliffe M, Lillis R, Martin DH, Ferris MJ (2010)
Quantitative PCR assessments of bacterial species in women with
and without bacterial vaginosis. J Clin Microbiol 48:1812–1819
52. Keshavarz H, Duffy SW, Sadeghi-Hassanabadi A, Zolghadr Z,
Oboodi B (2001) Risk factors for and relationship between
bacterial vaginosis and cervicitis in a high risk population for
cervicitis in Southern Iran. Eur J Epidemiol 17:89–95