Article

Intranasal insulin treatment restores cognitive deficits and insulin signaling

impairment induced by repeated methamphetamine exposure†
Running title: Methamphetamine and intranasal insulin

Elmira Beirami 1, Shahrbanoo Oryan 1, Seyedeh Masoumeh Seyedhoseini Tamijani 2,

Abolhassan Ahmadiani2, Leila Dargahi 3*

1
Department of Animal Biology, Faculty of Biological Sciences, Kharazmi University, Tehran,
Iran
2
Neuroscience Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3
NeuroBiology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

* Corresponding author:
Leila Dargahi; Neurobiology Research Center, Shahid Beheshti University of Medical Sciences,
Tehran, Iran
Tel.: +98 21 22429768-9
Fax: +98 21 22432047
E-mail address: l.dargahi@sbmu.ac.ir

†
This article has been accepted for publication and undergone full peer review but has not been through the
copyediting, typesetting, pagination and proofreading process, which may lead to differences between this
version and the Version of Record. Please cite this article as doi: [10.1002/jcb.26398]

Received 18 July 2017; Revised 24 August 2017; Accepted 30 August 2017

Journal of Cellular Biochemistry
This article is protected by copyright. All rights reserved
DOI 10.1002/jcb.26398

This article is protected by copyright. All rights reserved

  

Abbreviation:

MA: Methamphetamine

IN: Intranasal

RT-PCR: Real-time polymerase chain reaction

IR: Insulin receptor

IRS2: Insulin receptor substrate 2

PI3K: Phosphatidylinositol 3 kinase

Akt: Protein kinase B

GSK3β: Glycogen synthase kinase 3β

PGC-1α: Peroxisome proliferator-activated receptor gamma coactivator-1α

NRF1: Nuclear respiratory factors 1

TFAM: Mitochondrial transcription factor A

AD: Alzheimer's disease

CNS: Central nervous system

ROS: Reactive oxygen species

NOR: Novel object recognition

PA: Passive avoidance

STM: Short-term memory

LTM: Long-term memory

DAB: 3, 3′-Diamino benzidine tetrahydrochloride

HRP: Horse radish peroxidase

This article is protected by copyright. All rights reserved

  

Abstract

Long-term use of methamphetamine (MA) causes a broad range of cognitive deficits. Recently, it
has been reported insulin signaling and mitochondrial biogenesis are involved in cognitive
processes. This study aimed to examine whether MA induces cognitive deficits concomitant with
insulin signaling impairment and mitochondrial dysfunctions and also intranasal (IN) insulin
treatment can reverse cognitive deficits caused by MA. Rats were repeatedly treated with
increasing doses of MA (1-10 mg/kg) twice a day for 10 days, and their cognitive functions were
assessed using Y-maze, novel object recognition and passive avoidance tasks. The expression of
components involved in insulin signaling (IR/IRS2/PI3K/Akt/GSK3β) and mitochondrial
biogenesis (PGC-1α, NRF1 and TFAM) was measured in the hippocampus. Therapeutic effects of
IN insulin delivery (0.5IU/day, for 7 days after MA discontinuation) were also investigated in MA-
treated animals. Our results showed that repeated MA exposure induced cognitive deficits, and led
to insulin signaling impairment and mitochondrial dysfunction. Interestingly, IN insulin treatment
reduced MA-induced cognitive impairments possibly through activating insulin signaling,
particularly PI3K/Akt/GSK3β pathway, and mitochondrial biogenesis. Thus, insulin and insulin
signaling pathway can be considered as useful targets for the treatment of abnormalities associated
with MA abuse. This article is protected by copyright. All rights reserved

Keywords: Methamphetamine; Insulin; Cognition; Insulin signaling; Mitochondrial biogenesis

This article is protected by copyright. All rights reserved

  

Introduction

Methamphetamine (MA) is a psychostimulant drug that is widely abused (Cretzmeyer et al., 2003). Through
mechanisms that are not yet well understood, long-term use of MA causes a variety of neurocognitive deficits that
may persist after MA discontinuation, are slow to improve, and may not completely reverse (Scott et al., 2007). While
the main site of MA action is on the mesolimbic dopaminergic pathways, its effects on learning and memory raise the
possibility of important actions in the hippocampus. Hippocampus has been recognized as a major integration center
for learning and memory (Samsonovich and Ascoli, 2005) and is a target for psychostimulant drugs (Vorel et al.,
2001) and also is sensitive to change in insulin concentration (McNay et al., 2006). Insulin receptors (IRs) are densely
spread in the olfactory bulb, hypothalamus and hippocampus (Steen et al., 2005). Insulin signaling plays a substantial
role in various brain functions, including neuronal survival, neural plasticity and learning and memory (Banks et al.,
2012). It has been reported that brain insulin deficiency is responsible for neurocognitive disorders such as Alzheimer's
disease (AD) (De la Monte, 2012).

Insulin binding to the IR leads to autophosphorylation of the IR which initiates several signaling cascades. Among
which PI3K/Akt pathway in the brain have been suggested for neuronal protection and learning and memory functions
(Zhao et al., 2004). Autophosphorylation of the IR follows by tyrosine phosphorylation of the insulin receptor substrate
(IRS) protein family. Phosphorylated IRS binds to several effector molecules such as p85 or p55 regulatory subunit
of phosphatidylinositol 3-kinase (PI3K), and triggers activation of PI3K, which in turn phosphorylates and activates
protein kinase B/Akt. Akt phosphorylates (at the serine 9 residues) and consequently inactivates GSK-3β (Perluigi et
al., 2014). GSK-3β is one of the key molecules in downstream of the PI3K/Akt signaling pathway and is implicated
in several pathological conditions including AD related cognitive deficits (Wang et al., 2010). It has been also
indicated that insulin promotes normal functioning of central nervous system (CNS) mitochondria. Mitochondrial
function is modulated by mitochondrial numbers and biogenesis (Lee and Wei, 2005). Various transcription factors
and cofactors are involved in the regulation and activation of mitochondrial biogenesis. Peroxisome proliferator-
activated receptor gamma coactivator-1α (PGC-1α) acts as a main regulator of energy metabolism and mitochondrial
biogenesis by integrating and coordinating the activity of several transcription factors, such as NRF and TFAM
(Nervina et al., 2006). Its physiological importance is substantiated by the fact that suppression of PGC-1α leads to
mitochondrial dysfunction and then neurodegeneration (Cui et al., 2006). It has been shown that stimulation of
PI3K/Akt pathway by insulin preserves mitochondrial membrane integrity and inhibits generation of free radicals that
induce mitochondrial dysfunction (Halestrap et al., 2000). De la Monte and Wands (2005) have indicated that
impairment of insulin signaling induces mitochondrial dysfunction that affects fundamental processes required for
synaptic maintenance and remodeling, which are required for learning and establishing new memory.

So far, the effects of MA on insulin signaling pathway and mitochondrial biogenesis are less studied. So, in the present
study we evaluated the effects of repeated escalating MA regimen on the factors involved in insulin signaling and
mitochondrial function in the hippocampus of rat, to determine whether MA causes cognitive impairments
concomitant with insulin signaling impairment and mitochondrial biogenesis dysfunction. Since, it has been indicated
that intranasal insulin administration, bypasses the blood–brain barrier, delivers insulin directly into the special brain

This article is protected by copyright. All rights reserved

  

areas such as hippocampus (Lochhead and Thorne, 2012) and improves memory in patients with mild cognitive
impairment and AD (Adzovic and Domenici, 2014) without alteration in plasma glucose or insulin levels (Renner et
al., 2012), we evaluated therapeutic effects of IN insulin treatment on the cognitive deficits induced by MA.

Materials and methods

Animals

Adult male Wistar rats weighing 250-300 g at the beginning of the experiments, were used. Animals were housed in
groups of four per cage with free access to water and food under controlled laboratory conditions (a 12 h light/dark
cycle with conditions of constant temperature at 21±2°C). All experimental procedures were approved by the Ethics
Committee of Shahid Beheshti University of Medical Sciences in accordance with international guidelines that were
confirmed by the National Institutes of Health Publication (No. 80-23, revised 1996).

Experimental design and drug administration

Methamphetamine (MA) hydrochloride (synthesized and analyzed by Laboratory of Medicinal Chemistry, School of
Pharmacy, Tehran University of Medical Sciences, Iran) was freshly dissolved in 0.9% saline solution before each
administration. Human recombinant insulin (Exir pharmaceutical company, Tehran, Iran) was used for intranasal
delivery.

According to the schedule depicted in Fig. 1, animals received repeated escalating doses of MA (1-10 mg/kg; twice a
day, at 5 h intervals, for 10 consecutive days). Injections began with 1mg/kg in the first day and increased 1mg/kg per
day. MA-treated animals as well as corresponding controls, treated with saline, were subjected to the Y-maze, novel-
object recognition (NOR) and passive avoidance (PA) tasks, 1 weeks after MA discontinuation. Other two groups,
MA-and saline-treated animals, received intranasal (IN) insulin and then were evaluated for behavioral changes
(n=10/group). Finally, 24 h after last behavioral test, animals were sacrificed and brains removed for real-time
polymerase chain reaction (RT-PCR) (n=3-4/group) and western blot assays (n=4/group).

IN delivery was carried out manually without anesthesia while the animal head was restrained in a supine position
with the neck in extension (Marks et al., 2009). A total of 3.5 IU insulin (0.5 IU/day (0.25 IU/ 2.5 μl/ nostril)) was
delivered for 7 consecutive days after MA discontinuation, using a 10 μl eppendorf pipette. The same volume of saline
was delivered in the control group. Animal was held for an additional 5–10 s to ensure the fluid was inhaled.

This article is protected by copyright. All rights reserved

  

Spontaneous alternation behavior test (Y-maze)

The day after last IN insulin/saline administration (day 18), spatial working memory was evaluated by testing
spontaneous alternation behavior in a Y-maze task. This apparatus consisted of three arms (50×10×30 cm) and an
equilateral triangular central area. Each animal was placed at the end of one arm and allowed to freely explore the
maze for a period of 8 min. An arm entry was defined as the entry of four paws into one arm. Spontaneous alternation
behavior was defined as successive entries into the three arms in overlapping triplet sets. The percentage of
spontaneous alternation was calculated as the ratio of actual to possible alternations (defined as the total number of
arm entries-2) ×100. Also total number of arms entries was measured as an index of locomotor activity to rule out the
possible interference of changes in motility with the parameters of learning and memory. Animals that completed only
8 arm entries or less within 8 min were excluded from further analysis (Holcomb et al., 1998).

Novel object recognition test (NOR)

The NOR task was used to measure non-spatial memory. The task procedure consisted of three sessions: habituation,
familiarization and test sessions. During the habituation each animal was individually habituated to the open field box
(40×40×40 cm), with 10 min of exploration in the absence of objects for 2 consecutive days (days 19 and 20). In the
familiarization session, two identical objects (A1 and A2) were positioned in two adjacent corners, 10 cm from the
walls and each animal was allowed to explore the identical objects for 3min (day 21). Exploratory behavior was
considered as sniffing or touching the objects with the nose but not sitting or standing on the objects. During the short-
term memory (STM) session, 90 min after the familiarization, animals were placed into the same box for 3min, in
which one of the familiar objects (A1 or A2) used during familiarization session was replaced by a novel object (B)
(day 21). In the long-term memory (LTM) session, 24 h after the STM, the same animals were subsequently placed
into the box for 3min, in which object B used during the STM, was replaced by a novel object (C) (day 22). The time
spent exploring each object was recorded in each session. Objects (plastic lego) and the apparatus were thoroughly
wiped down with 75% ethanol solution between sessions. The objects used were on the basis of preliminary
experiments with naïve rats demonstrated that the objects engendered similar preference. All sessions were
videotaped, and an experimenter blind to treatment condition analyzed the NOR behavior. Preference index, a ratio of
the amount of time spent exploring a novel object in the STM (B) or LTM (C) session over the total time spent
exploring both objects (A+B or A+C), was used to measure recognition memory function.

Passive avoidance test (PA)

PA experiment was carried out in a step-through inhibitory avoidance apparatus. This apparatus consisted of
illuminated and dark compartments of the same size (30×20×20 cm) separated by a sliding door (10×20 cm). On the
training day (days 23), each animal was gently placed into the illuminated compartment, after 10 s the sliding door
was raised and animal was allowed to enter the dark compartment (Animals that waited more than 120 s to enter the

This article is protected by copyright. All rights reserved

  

dark compartment were excluded from the experiment). Once the animal entered with all four-paws to the dark
compartment, the sliding door was closed and after 30 s animal was withdrawn from this compartment. This trial was
repeated after 30 min. In the acquisition trial, after 10 s the sliding door was raised, and as soon as animal entered the
dark (shock) compartment the door was closed and a foot shock (50 Hz, 1 mA and 2 s) was immediately delivered.
After 20 s the door was raised and animal was allowed to enter the illuminated compartment. After entering illuminated
compartment, if animal did not enter to the dark compartment during 120 s, a successful acquisition of inhibitory
avoidance response was recorded. Otherwise, when the animal entered the dark compartment (before 120 s) a second
time, the door was closed and animal received the shock again. Retention test was performed 24 h later (days 24)
using a same procedure, except that no foot shock was administered. Each animal was placed into the light
compartment, and the step through latency was recorded for 300 s. The step through latency was used as the index of
retention for the training experience (Yamada et al., 1996).

RNA extraction, cDNA synthesis and quantitative polymerase chain reaction (qPCR)

24 h after the last behavioral test, total RNA was extracted from hippocampus using YTzol reagent according to the
manufacturer’s protocol (Yektatajhiz azma, Tehran, Iran). The RNA quality was evaluated by determining 18S and
28S ribosomal RNA bands using electrophoresis. Then 250 nano grams of total RNA was reverse transcribed to cDNA
using TransScript First-Strand cDNA Synthesis Kit (Pars toos, Tehran, Iran) according to manufacturer’s instructions.
Briefly, RNA template, primer and nuclease free H2O were mixed and incubated at 65°C for 5 min and chilled on ice.
Then the mixture was mixed with RT-Premix2X and incubated 10 min at 65°C, 60 min at 50°C, 10 min at 70°C and
held at -20°C until further use. The resulting cDNA was then used to quantitatively measure the expression of genes
using Red PCR Master Mix (Ampliqon) reagents by the following cycling conditions; activation 5 min at 95°C,
denaturation 30 s at 95°C, annealing 30 s, extension 30 s at 72°C. Real-time PCR was performed with SYBR Green
Real-Time PCR Master Mix (Ampliqon) reagents using ABI System. The threshold cycles (Ct) were used to quantify
the mRNA levels of the target genes. Relative gene expressions were calculated by 2-ΔΔCt method (Xu et al., 2014),
normalized to β-actin housekeeping gene and relative to control group. Primer sequences are shown in Table 1.

Western Blotting

A set of animals (n=4) was killed 24 h after the last behavioral test, the brains were rapidly removed and hippocampus
was dissected on ice and stored at -80°C until western blot analysis. Total tissue was homogenized in lysis buffer [50
mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Triton X-100, 0.25% sodium deoxycholate, 0.1% sodium dodecyl sulfate
(SDS), 1 mM EDTA, 1 mM Sodium orthovanadate, 15 mM Sodium pyrophosphate, 50 mM Sodium fluride and 1mM
PMSF]. Protein concentration was determined using the BCA method (BCA Protein Assay Kit, Thermo scientific,
USA) and 60µg of protein was loaded on the electrophoresis gel. Samples were separated by electrophoresis on 12%
SDS-PAGE, transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Billercia, MA) and blocked
with 2% non-fat dry milk (Amersham, Ecl Advance TM) for 1 h at room temperature (RT). Afterwards, the blots were

This article is protected by copyright. All rights reserved

  

probed with anti-PI3 Kinase antibody (1:1000; Cell Signaling, Cat# 3811), anti-Phospho-PI3 Kinase p85 (Tyr458)/p55
(Tyr199) antibody (1:1000; Cell Signaling, Cat# 4228), anti-Akt1/2/3 (H-136) antibody (1:1000; Santa Cruz, Cat# sc-
8312), anti-p-Akt1/2/3 (Ser473) antibody (1:1000; Santa Cruz, Cat# sc-101629), anti-GSK3β (27C10) antibody
(1:1000; Cell Signaling, Cat# 9315), anti-Phospho-GSK3β (Ser9) (5B3) antibody (1:1000; Cell Signaling, Cat# 9323)
overnight at 4°C. Next day, the blots were washed and incubated with HRP-conjugated secondary Goat Anti-Rabbit
IgG H&L (HRP) antibody (1:12000, Abcam, Cat# ab97051) for 1 h at RT. Subsequent visualization was performed
using an enhanced chemiluminescence system (ECL, BIO RAD, USA). β-Actin expression was analyzed using anti
β-Actin (13E5) rabbit monoclonal antibody (1:750; Cell signaling, Cat# 4970) as an internal control for normalization
of protein amounts. Finally, results were quantified by scan of X-ray films and analysis by Image J software.

Statistical analysis

Behavioral data were analyzed using paired t-test and one-way analysis of variance (ANOVA) and comparison
between groups in the molecular studies was made by one-way ANOVA followed by post hoc Tukey’s test. Statistical
analyses were performed using 16th version of SPSS and P<0.05 was accepted as statistically significance. All data
are presented as the mean ± standard error of the mean (SEM).

Results

Intranasal insulin treatment attenuated working memory impairment induced by repeated MA administration.

We proceeded to evaluate the consequences of repeated MA administration on alternation behavior using the Y maze,
a task dependent on hippocampus integrity. As represented in Fig. 2A, one-way ANOVA analysis revealed that MA-
treated animals showed a significant decrease in the spontaneous alternation behavior compared with control group [F
(3, 36) = 16.045, p<0.001], indicating working memory impairment. Interestingly, it was observed that IN insulin
treatment significantly increased spontaneous alternation behavior compared with MA-treated animals (p<0.05). No
significant difference was detected in this parameter following only insulin treatment compared with control group.
Moreover, drugs-induced locomotion alterations, which may affect alternation rates, were evaluated by counting the
total number of entries in the Y maze arms during the 8 min trial. However, all the animals showed equal locomotor
activity [F (3, 36) = 1.318, p>0.05] (Fig. 2B). It is necessary to mention that 30-40 min after IN insulin delivery (because
it takes about 10–20 min for insulin to reach into the rat brain via intranasal delivery (Dahl and Mygind, 1998)), blood
glucose was measured by tail sampling. Measurement of blood glucose was performed with Accu-Chek Go (Roche)
glucometer and the results showed that IN insulin treatment did not change the peripheral glucose levels (Data not
shown).

This article is protected by copyright. All rights reserved

  

Intranasal insulin treatment decreased recognition memory impairment induced by repeated MA

administration.

The novel object recognition task is based on the spontaneous behavior of rodents to explore a novel object. Studies
showed that this task is dependent on the health of prefrontal cortex and hippocampus (Broadbent et al., 2004). As
represented in Fig. 3A, during the familiarization session, animals spent similar time in the exploration of each
identical object (A1 and A2) and showed a similar preference to them, indicating that there was no biased exploratory
preference in each group. In the short-term memory (STM) test, given 90 min after the familiarization, one-way
ANOVA analysis revealed that the level of exploratory preference for a novel object (B) in the MA-treated animals
was significantly smaller than control group [F (3, 36) = 5.237, p<0.01] (Fig. 3B), indicating short-term recognition
memory impairment. MA-treated animals also showed a decreased level of exploratory preference for the novel object
in the long-term memory (LTM) test, given 24 h after STM, [F (3, 36) = 18.231, p<0.001] (Fig. 3C), indicating long-
term memory destruction. But IN insulin treatment decreased cognitive impairments compared with MA-treated
animals, with a significant increase at the time spent in the exploration of novel object in STM (object B) (p<0.05)
and LTM (object C) (p<0.001) sessions. It should be noted that insulin itself did not affect the level of exploratory
preference for the objects in each session compared with control group.

Intranasal insulin treatment reduced learning and memory impairment induced by repeated MA
administration.

The passive avoidance test was used to examine another hippocampus-dependent memory (Cimadevilla et al., 2007),
in which the animals learn to avoid from a aversive stimulus (mild electric foot shock). As shown in Fig. 4, one-way
ANOVA analysis revealed that MA-treated animals showed lower latency entrance into the dark compartment
compared with control group [F (3, 36) = 6.806, p<0.01], indicating repeated MA administration suppressed the
acquisition ability of animal regarding previous shocks. In contrast, IN insulin treatment increased latency entrance
into the dark compartment compared with MA-treated animals (p<0.05), indeed IN insulin treatment could be
reminiscent of the shock in the dark compartment in MA-treated animals. Insulin itself did not affect this parameter
compared with control group.

Intranasal insulin treatment restored insulin signaling impairment induced by repeated MA administration.

To examine the molecular events of MA-induced cognitive impairments, we evaluated the effects of repeated MA
administration on insulin signaling pathway (IR/IRS2/PI3K/Akt/GSK3β) using RT-PCR and western blot analyses.
This pathway is activated when insulin binds to its receptor on the cell membrane, which in turn initiates activation of
the insulin signal transduction pathway, including insulin receptor (IR), insulin receptor substrate (IRS),
phosphatidylinositide 3-kinase (PI3K) and protein kinase B (AKT) that inhibits GSK3β. The activation of each
component of this pathway is mediated through phosphorylation by its upstream component. Thus, in western blot

This article is protected by copyright. All rights reserved

  

analysis we determined the ratio of phosphorylation/ non-phosphorylation of each component of insulin signaling
pathway in the animal’s hippocampus in each group. One-way ANOVA analysis revealed a significant decrease in the
mRNA levels of IR [F (3, 8) = 3.980, p<0.05] and IRS2 [F (3, 8) = 7.590, p<0.01] in the MA-treated animals compared
with control group (Fig. 5A, B). Also we found a significant decrease in the protein levels of p-PI3K (Tyr199) [F (3,
12) = 6.867, p<0.01], p-AKT (Ser473) [F (3, 12) = 8.895, p<0.01] and p-GSK3β (Ser9) [F (3, 12) = 71.570, p<0.001] in the
MA-treated animals (Fig. 5C-E). Interestingly, IN insulin treatment for seven days after MA discontinuation, showed
a clear overall restoration of insulin signaling, as evidenced by the recovery of components involved in this pathway.
No significant differences were detected in the expression of insulin signaling pathway components following only
insulin treatment compared with control group.

Intranasal insulin treatment partially reversed mitochondrial biogenesis dysfunction induced by repeated MA
administration.

It has been demonstrated that mitochondrial dysfunction is associated with neurological disorders (Federico et al.,
2012). To investigate whether MA by affecting mitochondrial functions induces cognitive deficits, we analyzed key
transcriptional regulators of mitochondrial biogenesis in the rat hippocampus, region implicated in learning and
memory. One-way ANOVA analysis revealed the decreased expression of PGC-1α [F (3, 8) = 3.989, P<0.05] (Fig. 6A),
NRF1 [F (3, 8) = 2.933, P<0.05] (Fig. 6B) and TFAM [F (3, 8) = 15.057, P<0.05] (Fig. 6C) in MA-treated animals. IN
insulin treatment increased the expression of genes involved in mitochondrial biogenesis compared with MA-treated
animals. But increased expression of NRF1 and TFAM were not statistically significant (P>0.05). In the other words,
IN insulin treatment partially reversed mitochondrial biogenesis dysfunction induced by repeated MA administration.
No significant differences were detected in the expression of these genes following only insulin treatment compared
with control group.

Discussion

It has been shown that long term use of MA is associated with impairments in attention, memory and learning (Scott
et al., 2007). In this study, we observed that spontaneous alternation behavior in the Y-maze task, which is regarded
as hippocampal-dependent spatial working memory (Kim et al., 2006), was impaired in MA-treated animals. In
agreement with our result, it has been reported that repeated MA administration impairs spatial working memory in
rats (Nagai et al., 2007). IN insulin treatment for 7 days after MA discontinuation could attenuate MA-induced
working memory impairment. It has been indicated that insulin exerts beneficial effects on the function of CNS and
facilitates processes of working and recognition memory (Banks et al., 2012). The impairment of working memory
observed in MA-treated animals was not due to changes in motor or motivational functions induced by MA, because
total number of arm entries during the test were not different between the groups. We also examined the effect of
repeated MA exposure on recognition memory in the NOR task. This task provides a powerful tool to assess long-

This article is protected by copyright. All rights reserved

  

lasting memory impairments in animals exposed to psychostimulant drugs (Schroder et al., 2003). In our study MA
impaired both short and long-term memory. These results are consistent with the study that has demonstrated chronic
MA administration impairs non-spatial recognition memory in rodents in the NOR test (Reichel et al., 2012) and that
the impairments persist even after MA withdrawal (Scott et al., 2007). Treatment with IN insulin significantly reduced
recognition memory impairments induced by MA. MA-treated animals also showed impaired memory in the passive
avoidance test that is an indication of long-term memory and a useful tool for the estimation of standard learning and
memory (LeDoux, 1993). Consistent with our finding, Sean et al., (2012) have indicated that exposure to MA impairs
passive avoidance performance and result in significant depletions of serotonin, dopamine and their metabolites in
various brain regions. In this test insulin also could attenuate learning and memory impairments induced by repeated
MA exposure. These results were seemingly compatible with studies that applied intracerebroventricular (Park et al.,
2000) or intrahippocampal (Babri et al., 2007) administration of insulin and reported that insulin could improve
performance on a passive avoidance task, upon which they demonstrated the hippocampus was the area through which
insulin would facilitate memory processes. Altogether, our behavioral experiments demonstrated a remarkably robust
and long-lasting effect of repeated MA exposure on cognitive deficits in some types of memory—working memory,
object recognition and passive avoidance memory—in rats. However, the precise mechanisms through which MA
causes cognitive deficits are still not fully understood. So, we examined the effects of MA on the insulin signaling
pathway and mitochondrial biogenesis that are involved in cognitive processes.

IR and IRS are the first two key molecules transmitting insulin signaling. PI3K/Akt signaling, one of the major
pathways activated by IR receptors, has recently gained attention in psychiatric (Beaulieu, 2007; Vasudevan and
Garraway, 2010) and neurocognitive deficits (Zhao et al., 2004). Reduced brain expression of genes encoding insulin
and IR has been observed in aging-associated brain degenerative disorders such as AD (Steen et al., 2005). Also, it
has been shown that neuronal insulin resistance accompanied with PI3K/Akt signaling pathway dysfunction
(Neumann et al., 2008) is related to increased dementia risk (Benedict et al., 2012). Akt inhibits GSK3β activity
through phosphorylating it at the serine 9 residues (Perluigi et al., 2014). Chen et al., (2014) have reported that
decreased brain insulin signaling can lead to a downregulation of Akt and thus overactivation of GSK3β, which in
turn results in cognitive disorders. Investigating the effects of MA on the insulin signaling pathway, our molecular
results showed that repeated MA exposure decreased the expression of IR and IRS2 genes and also significantly
reduced protein levels of p-PI3K, p-Akt and p-GSK3β in the rat hippocampus. IN insulin treatment significantly
restored the expression of IR and IRS2 and increased PI3K, Akt and GSK3β phosphorylation in MA-treated animals.
Several line of evidence show that MA induces oxidative stress, mitochondrial dysfunction and neuroinflammation
(Shin et al., 2017) which all can impair insulin signaling (Cetinkalp et al., 2014). In a recent study it is shown that
activation of dopamine D4 receptors, in rat renal proximal tubule cells, reduces the gene expression of IR (Zhang et
al., 2016). Considering the effects of MA on brain dopamine levels and activation of dopamine receptors (Scott et al.,
2007), implication of such mechanism in brain needs to be investigated.

In this study MA-treated animals also showed significant decrease in the expression of PGC-1α, NRF1 and TFAM
that are involved in mitochondrial biogenesis. PGC-1α lies up-stream of NRF and TFAM and serves as a nutrient-

This article is protected by copyright. All rights reserved

  

sensing system that increases mitochondrial biogenesis (Nervina et al., 2006). Some studies have indicated that MA-
induced neurodegeneration can be dependent on mitochondrial mechanisms in vivo and in vitro (Gubert, 2016; Deng
et al., 2002). St-Pierre et al., (2003) have revealed decreased expression of PGC-1α and NRF1 in insulin-resistance
and diabetic subjects. Kleinridders et al., (2015) also have demonstrated that insulin receptor deficiency in the brain
results in brain mitochondrial dysfunction and proposed that there may be a potential link between brain insulin
resistance and behavioral symptoms. These studies provide evidence that insulin can affect mitochondrial biogenesis
gene expression and function and that decreased mitochondrial capacity might arise, in part, as a consequence of
impaired insulin action. In verification of these evidence, we observed that insulin partially increased the expression
of PGC1α, NRF1 and TFAM in the MA-treated animals. Accordingly, in a recent study it has been shown that while
insulin does not affect normal brain mitochondrial function, prevents from mitochondrial dysfunction and preserves
neurons in the context of amyloid beta-peptide-induced toxicity (Moreira et al., 2005). Also, Piantadosi et al. (2008)
have reported that PI3K/Akt activation is related to PGC-1α activation and mitochondrial biogenesis. So, it seems that
PI3K/Akt pathway induced by IN insulin in our study may be a possible upstream signaling pathway for compensation
of mitochondrial biogenesis, though it was not fully significant.

Collectively, our findings showed that repeated MA exposure induced hippocampus-dependent memory impairments
concomitant with impairments in insulin signaling and mitochondrial biogenesis. Then it was observed that IN
delivery of insulin interestingly decreased memory impairments induced by MA and partially restored mitochondrial
biogenesis possibly through activating PI3K/Akt signaling. So, insulin can emerge as a promising field of investigation
to increase the quality of life in abuse people.

Acknowledgement

This study was carried out as part of a Ph.D thesis funded by the Neuroscience Research Center of Shahid Beheshti
University of Medical Sciences (Grant No. A-A-919-1393).

This article is protected by copyright. All rights reserved

  

Fig. 1. Schematic drawing of experimental schedule.

Fig. 2. The effect of intranasal (IN) insulin treatment on working memory impairment induced by repeated MA
administration. IN insulin treatment (0.5 IU/day, for 7 days after MA discontinuation) attenuated working memory
impairment induced by repeated MA administration (1-10 mg/kg, twice a day for 10 days) during 8 min of exploration
in the Y-maze task. Data represent Mean ± SEM. The differences between groups were determined by ANOVA
followed by Tukey test. ***P<0.001 vs. control group, #P<0.05 vs. MA-treated group, (n=10 in each group), (A)
Alternation behavior % and (B) Total number of arm entries.

Fig. 3. The effect of intranasal (IN) insulin treatment on recognition memory impairment induced by repeated MA
administration. IN insulin treatment (0.5 IU/day, for 7 days after MA discontinuation) attenuated short and long-term
memory impairments induced by repeated MA administration (1-10 mg/kg, twice a day for 10 days) in the NOR task.
Data represent Mean ± SEM. The differences between groups were determined by ANOVA followed by Tukey test.
*
P<0.05 and ***P<0.001 vs. control group, #P<0.05 and ###P<0.001 vs. MA-treated group, (n=10 in each group), (A)
Preference index % in familiarization session, (B) Novel object preference index % in STM session, and (C) Novel
object preference index % in LTM session.

Fig. 4. The effect of intranasal (IN) insulin treatment on impairment of learning and memory induced by repeated MA
administration. IN insulin treatment (0.5 IU/day, for 7 days after MA discontinuation) reduced memory impairment
induced by repeated MA administration (1-10 mg/kg, twice a day for 10 days) in the PA task. Data represent Mean ±
SEM. The differences between groups were determined by ANOVA followed by Tukey test. **P<0.01 vs. control
group, #P<0.05 vs. MA-treated group, (n=10 in each group).

Fig. 5. The effect of intranasal (IN) insulin treatment on the insulin signaling impairment induced by repeated MA
administration. IN insulin treatment (0.5 IU/day, for 7 days after MA discontinuation) restored insulin signaling
disorders induced by repeated MA administration (1-10 mg/kg, twice a day for 10 days) in the hippocampus of rats.
RT-PCR data analysis showed that MA decreased IR (A) and IRS2 (B) mRNA levels. Western blot analysis also
indicated that MA atteniuted protein levels of p-PI3K (C), p-Akt (D) and p-GSK3β (E). But IN insulin treatment
significantly increased the mRNA levels of IR (p<0.05) and IRS2 (p<0.01) and also increased protein levels of p-
PI3K (p<0.05), p-Akt (p<0.05) and p-GSK3β (p<0.001) in the MA-treated animals. Each blot contained all
experimental groups. Data represent Mean ± SEM. The differences between groups were determined by ANOVA
followed by Tukey test. *p<0.05, **p<0.01 and ***p<0.001 vs. control group, #p<0.05, ##p<0.01 and ###p<0.001 vs. MA-
treated group, (n=3-4 in each group). (Ctrl= Control, MA= Methamphetamine, MI= Methamphetamine+Insulin, Ins=
Insulin)

Fig. 6. The effect of intranasal (IN) insulin treatment on the mitochondrial dysfunction induced by repeated MA
administration. IN insulin treatment (0.5 IU/day, for 7 days after MA discontinuation) partially reversed mitochondrial
biogenesis dysfunction induced by repeated MA administration (1-10 mg/kg, twice a day for 10 days) in the
hippocampus of rats. RT-PCR data analysis showed that MA decreased PGC-1α (A), NRF1 (B) and TFAM (C) mRNA
levels. But IN insulin treatment partially could reverse mitochondrial dysfunctions induced by MA. Data represent
Mean ± SEM. The differences between groups were determined by ANOVA followed by Tukey test. *p<0.05 and
**
p<0.01 vs. control group; #p<0.05 vs. MA-treated group, (n=3-4 in each group).

Table 1. Primer sequences (5′–3′) used in quantitative polymerase chain reaction (qPCR)

This article is protected by copyright. All rights reserved

  

References

Adzovic L, Domenici L. 2014. Insulin induces phosphorylation of the AMPA receptor subunit GluR1, reversed by
ZIP, and overexpression of protein kinase M zeta, reversed by amyloid beta. J Neurochem 31:582–7.
Babri S, Gholamipour Badie H, Khamene S, Ordikhani-Seyedlar M. 2007. Intrahippocampal insulin improves
memory in a passive-avoidance task in male wistar rats. Brain Cogn 64:86-91.
Banks WA, Owen JB, Erickson MA. 2012. Insulin in the brain: there and back again. Pharmacol Ther 136: 82–93.
Beaulieu JM. 2007. Not only lithium: regulation of glycogen synthase kinase-3 by antipsychotics and serotonergic
drugs. Int J Neuropsychopharmacol 10:6-3.
Benedict C, Brooks SJ, Kullberg J et al. 2012. Impaired insulin sensitivity as indexed by the HOMA score is associated
with deficits in verbal fluency and temporal lobe gray matter volume in the elderly. Diabetes Care 35:488–
94.
Broadbent NJ, Squire LR, Clark RE. 2004. Spatial memory, recognition memory, and the hippocampus. Proc Natl
Acad Sci USA 101:14515–20.
Cetinkalp S, Simsir IY, Ertek S. 2014. Insulin resistance in brain and possible therapeutic approaches. Curr Vasc
Pharmacol 12:553-64.
Chen Y, Deng Y, Zhang B, Gong CX. 2014. Deregulation of brain insulin signaling in Alzheimer’s disease. Neurosci
Bull 30:282–294.
Cimadevilla JM, Mendez M, Mendez-Lopez M, Arias JL. 2007. Unilateral hippocampal blockade reveals that one
hippocampus is sufficient for learning a passive avoidance task. J Neurosci Res 85:1138–1142.
Cretzmeyer M, Sarrazin MV, Huber DL, Block RI, Hall JA. 2003. Treatment of methamphetamine abuse: Research
findings and clinical directions. J Subst Abuse Treat 24:267–277.
Cui L, Jeong H, Borovecki F, Parkhurst CN, Tanese N, Krainc D. 2006. Transcriptional repression of PGC-1[α] by
mutant huntingtin leads to mitochondrial dysfunction and neurodegeneration. Cell 127:59–69.
Dahl R, Mygind N. 1998. Anatomy, physiology and function of the nasal cavities in health and disease. Adv Drug
Deliv Rev 29: 3–12.
De la Monte SM. 2012. Brain Insulin Resistance and Deficiency as Therapeutic Targets in Alzheimer's disease. Curr
Alzheimer Res 9:35–66.
De la Monte SM, Wands JR. 2005. Review of insulin and insulin-like growth factor expression, signaling, and
malfunction in the central nervous system: relevance to Alzheimer's disease. J Alzheimers Dis 7:45-61.
Deng X, Cai NS, McCoy MT et al. 2002. Methamphetamine induces apoptosis in an immortalized rat striatal cell line
by activating the mitochondrial cell death pathway. Neuropharmacology 42:837-845.
Federico A, Cardaioli E, DaPozzo P, Formichi P, Gallus GN, Radi E. 2012. Mitochondria, oxidative stress and
neurodegeneration. J Neurol Sci 322:254–262.
Gubert C, Fries GR, Pfaffenseller B. 2016. Role of P2X7 receptor in an animal model of mania induced by D-
amphetamine. Mol Neurobiol 53:611-620.
Halestrap AP, Doran E, Gillespie JP, O'Toole A. 2000. Mitochondria and cell death. Biochem. Soc. Trans. 28, 170-
177.
Holcomb L, Gordon MN, McGowan E et al. 1998. Accelerated Alzheimer-type phenotype in transgenic mice carrying
both mutant amyloid precursor protein and presenilin 1 transgenes. Nat Med 4:97–100.
Kim DH, Hung TM, Bae KH, Jung JW, Lee S, Yoon BH, Cheong JH, Ko KH, Ryu JH. 2006. Gomisin A improves
scopolamine-induced memory impairment in mice. Eur J Pharmacol 542:129–135.
Kleinridders A, Cai W, Cappellucci L, Ghazarian A. 2015. Insulin resistance in brain alters dopamine turnover and
causes behavioral disorders. 112:3463–3468.
LeDoux JE. 1993. Emotional memory systems in the brain. Behav Brain Res 58:69–79.
Lee HC, Wei YH. 2005. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under
oxidative stress. Int J Biochem Cell Biol 37:822–834.
Lochhead JJ, Thorne RG. 2012. Intranasal delivery of biologics to the central nervous system. Adv Drug Deliv Rev
64:614–628.
Marks DR, Tucker K, Cavallin MA, Mast TG, Fadool DA. 2009. Awake intranasal insulin Modifies protein
complexes and alters memory, anxiety, and olfactory behaviors. J Neurosci 29:6734–675.
McNay EC, Williamson A, McCrimmon RJ, Sherwin RS. 2006. Cognitive and neural hippocampal effects of long-
term moderate recurrent hypoglycemia. Diabetes 55:1088–1095.
Moreira PI, Santos MS, Sena C, Seica R, Oliveria CR. 2005. Insulin protects against amyloid beta-peptide toxicity in
brain mitochondrial of diabetic rats. Neurobiol Dis 18:628-37.

This article is protected by copyright. All rights reserved

  

Nagai T, Takuma K, Dohniwa M, Ibi D, Mizoguchi H, Kamei H, Nabeshima T, Yamada K. 2007. Repeated
methamphetamine treatment impairs spatial working memory in rats: reversal by closapine but not
haloperidol. Psychopharmacology 194:21-32.
Nervina JM, Magyar CE, Pirih FQ, Tetradis S. 2006. PGC-1α is induced by parathyroid hormone and coactivates
Nurr1-mediated promoter activity in osteoblasts. Bone 39:1018–10125.
Neumann KF, Rojo L, Navarrete LP, Farías G, Reyes P, Maccioni RB. 2008. Insulin Resistance and Alzheimer´s
Disease: Molecular Links & Clinical Implications. Curr Alzheimer Res 5:438-47.
Park CR, Seeley RJ, Craft S, Woods SC. 2000. Intracerebroventricular insulin enhances memory in a passive-
avoidance task. Physiology and Behavior 68:509–514.
Perluigi M, Pupo G, Tramutola A et al. 2014. Neuropathological role of PI3K/Akt/mTOR axis in Down syndrome
brain. Biochim Biophys Acta 1842:1144-1153.
Piantadosi CA, Carraway MS, Babiker A, Suliman HB. 2008. Heme oxygenase-1 regulates cardiac mitochondrial
biogenesis via Nrf2-mediated transcriptional control of nuclear respiratory factor-1. Circ Res 103:1232–
1240.
Reichel CM, Ramsey LA, Schwendt M, McGinty JF, See RE. 2012. Methamphetamine-induced changes in the object
recognition memory circuit. Neuropharmacology 62:1119–1126.
Renner DB, Svitak AL, Gallus N et al. 2012. Intranasal delivery of insulin via the olfactory nerve pathway. Journal of
Pharmacy and Pharmacology 64:1709-1714.
Rodgers EE, Theibert AB. 2002. Functions of PI 3-kinase in development of the nervous system. Int J Dev Neurosci
20:187–197.
Samsonovich AV, Ascoli GA. 2005. Simple neural network model of the hippocampus suggesting its path finding
role in episodic memory retrieval. Learning and Memory 12:193–208.
Schroder N, O’Dell SJ, Marshall JF. 2003. Neurotoxic methamphetamine regimen severely impairs recognition
memory in rats. Synapse 49:89–96.
Scott JC, Woods SP, Matt GE, Meyer RA, Heaton RK, Atkinson JH, Grant I. 2007. Neurocognitive effects of
methamphetamine: a critical review and meta-analysis. Neuropsychol Rev 17:275–297.
Sean MK, Alan PS, James FB et al. 2012. Effects of exposure to amphetamine derivatives on passive avoidance
performance and the central levels of monoamines and their metabolites in mice: correlations between
behavior and neurochemistry. Psychopharmacology 220: 495–508.
Shin EJ, Tran HQ, Nguyen PT, Jeong JH, Nah SY, Jang CG, Nabeshima T, Kim HC. 2017. Role of Mitochondria in
Methamphetamine-Induced Dopaminergic Neurotoxicity: Involvement in Oxidative Stress,
Neuroinflammation, and Pro-apoptosis-A Review. Neurochem Res DOI 10.1007/s11064-017-2318-5.
Steen E, Terry BM, Rivera EJ, Cannon JL, Neely TR, Tavares R, Xu XJ, Wands JR, de la Monte SM. 2005. Impaired
insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer’s disease – is this
type 3 diabetes? Journal of Alzheimer’s disease 7:63–80.
St-Pierre J, Lin J, Krauss S, Tarr PT, Yang R, Newgard CB, Spiegelman BM. 2003. Bioenergetic analysis of
peroxisome proliferator-activated receptor gamma coactivators 1alpha and 1beta (PGC-1alpha and PGC-
1beta) in muscle cells. J Biol Chem 278:26597–26603.
Vasudevan KM, Garraway LA. 2010. AKT signaling in physiology and disease. Curr Top Microbiol Immunol
347:105–133.
Vorel SR, Liu X, Hayes RJ, Spector JA, Gardner EL. 2001. Relapse to cocaine-seeking after hippocampal theta burst
stimulation. Science 292:1175–1178.
Wang X, Zheng W, Xie JW, Wang T, Wang SL, Teng WP, Wang ZY. 2010. Insulin deficiency exacerbates cerebral
amyloidosis and behavioral deficits in an Alzheimer transgenic mouse model. Mol Neurodegener 5:46.
Xu R, Hu Q, Ma Q, Liu C, Wang G. 2014. The protease Omi regulates mitochondrial biogenesis through the
GSK3β/PGC-1a pathway. Cell Death Dis 5:e1373.
Yamada K, Noda Y, Hasegawa T, Komori Y, Nikai T, Sugihara H, Nabeshima T. 1996. The role of nitric oxide in
dizocilpine-induced impairment of spontaneous alternation behavior in mice. J Phar macol Exp Ther
276:460–466.
Zhang Y, Ren H, Lu X, He D, Han Y, Wang H, Zeng C, Shi W. 2016. Inhibition of D4 Dopamine Receptors on Insulin
Receptor Expression and Effect in Renal Proximal Tubule Cells. J Am Heart Assoc 5:e002448.
Zhao WQ, Chen H, Quon MJ, Alkon DL. 2004. Insulin and the insulin receptor in experimental models of learning
and memory. Eur J Pharmacol 490:71-81.

This article is protected by copyright. All rights reserved

  

Table 1. Primer sequences (5′–3′) used in quantitative polymerase chain reaction (qPCR)

Gene Forward Primer (5'-3') Reverse Primer (5'-3')

IR GAGCGGAGGAGTCTTCATT GGTGTAGTGGCTGTCACATT
IRS2 GACTTCTTGTCCCATCACTTGAAA GCTAAGCATCTCCTCAGAATGGA
PGC-1α GTGCAGCCAAGACTCTGTATGG GTCCAGGTCATTCACATCAAGTTC
NRF1 AAATTGGGCCACATTACAGGG GTTGCATCTCCTGAGAAGCG
TFAM AGAGTTGTCATTGGGATTGG CATTCAGTGGGCAGAAGTC
β-actin TCTATCCTGGCCTCACTGTC AACGCAGCTCAGTAACACTCC

This article is protected by copyright. All rights reserved

  

Figure 1

This article is protected by copyright. All rights reserved

  

Figure 2

This article is protected by copyright. All rights reserved

  

Figure 3

This article is protected by copyright. All rights reserved

  

Figure 4

This article is protected by copyright. All rights reserved

  

Figure 5

This article is protected by copyright. All rights reserved

  

Figure 6

This article is protected by copyright. All rights reserved