Appl Microbiol Biotechnol (2011) 91:113–122
DOI 10.1007/s00253-011-3211-9
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Unexpected property of ectoine synthase
and its application for synthesis of the engineered
compatible solute ADPC
Elisabeth M. H. J. Witt & Noel W. Davies &
Erwin A. Galinski
Received: 20 January 2011 / Accepted: 21 January 2011 / Published online: 6 April 2011
# Springer-Verlag 2011
Abstract A new cyclic amino acid was detected in a deletion
mutant of the moderately halophilic bacterium Halomonas
elongata deficient in ectoine synthesis. Using mass spec-
troscopy (MS) and nuclear magnetic resonance (NMR)
techniques, the substance was identified as 5-amino-3,4-
dihydro-2H-pyrrole-2-carboxylate (ADPC). We were able to
demonstrate that ADPC is the product of a side reaction of
lone ectoine synthase (EC 4.2.1.108), which forms ADPC
by cyclic condensation of glutamine. This reaction was
shown to be reversible. Subsequently, a number of ectoine
derivatives, in particular 4,5-dihydro-2-methylimidazole-4-
carboxylate (DHMICA) and homoectoine, were also shown
to be cleaved by ectoine synthase, which is classified as a
hydro-lyase. This study thus reports for the first time that
ectoine synthase accepts more than one substrate and is a
reversible enzyme able to catalyze both the intramolecular
condensation into and the hydrolytic cleavage of cyclic amino
acid derivatives. As ADPC supports growth of bacteria under
salt stress conditions and stabilizes enzymes against freeze-
thaw denaturation, it displays typical properties of compatible
solutes. As ADPC has not yet been described as a natural
compound, it is presented here as the first man-made
compatible solute created through genetic engineering.
Keywords Halomonas elongata . Ectoine synthase .
ADPC . Genetic engineering . Cyclic amino acid
derivatives . Compatible solute
E. M. H. J. Witt : E. A. Galinski (*)
Institut für Mikrobiologie & Biotechnologie,
Rheinische Friedrich-Wilhelms-Universität,
53115 Bonn, Germany
e-mail: galinski@uni-bonn.de
N. W. Davies
Central Science Laboratory, University of Tasmania,
Hobart 7001, Australia
Introduction
Life at high or fluctuating osmolarity is mastered by a
broad range of microorganisms using the so-called “com-
patible solute strategy”, which relies on accumulation of
small organic osmolytes in order to balance the osmotic
pressure. As implied by the term “compatible”, these
osmolytes do not interfere with the cells' metabolism even
when accumulated at molar concentrations. On the contrary,
there is evidence that these substances have stabilizing
properties on macromolecules and whole cells (Lippert and
Galinski 1992; Louis et al. 1994; Göller and Galinski 1999;
Manzanera et al. 2002; Graf et al. 2008).
Based on these observations, many possible applica-
tions have been developed from medical treatment of
disease (Furusho et al. 2005; Kanapathipillai et al. 2008;
Kanapathipillai et al. 2005; Wei et al. 2009) to engineering
of transgenic plants (Nakayama et al. 2000; Moghaieb
et al. 2006; Rai et al. 2006).
One of the most thoroughly investigated osmolytes is
ectoine (1,4,5,6-tetrahydro-2-methyl-4-pyrimidine carbox-
ylic acid). First discovered in 1985 in Ectothiorhodospira
halochloris (Galinski et al. 1985), it is now produced on a
large scale with the halophilic bacterium Halomonas
elongata using the bacterial milking technique (Sauer and
Galinski 1998) and marketed as a constituent of a wide
array of skin-care products. The biosynthetic pathway of
ectoine has been completely elucidated (Fig. 1) (Louis 1997;
Peters et al. 1990). Starting from aspartic semialdehyde, it
proceeds via L-2,4-diaminobutyric acid (DABA) and N4-
acetyl-L-2,4-diaminobutyric acid (Nγ-acetyl-diaminobutyric
acid, ADABA) and comprises the action of three gene
products (EctA, EctB, and EctC), of which the last, ectoine
synthase (EctC), catalyzes an intramolecular condensation
reaction (Fig. 5, top). A subsequent step, catalyzed by
114
ectoine hydroxylase EctD (Reuter et al. 2010; Bursy et al.
2007), converts ectoine into its S,S-β-hydroxy derivative
(Fig. 1). The relative proportion of hydroxyectoine is
typically increased in H. elongata under salt and temperature
stress and, therefore, believed to exert superior stabilization
properties.
In this study, we report the surprising discovery and
isolation of the new compatible solute 5-amino-3,4-dihydro-
2H-pyrrole-2-carboxylate (ADPC) from H. elongata. This
solute does not accumulate in growing cells due to
reversibility of ectoine synthase. It does, however, support
growth of cells devoid of ectoine synthase such as
Escherichia coli or an ectC deletion mutant of H. elongata
and shows all the properties of a typical compatible solute.
Materials and methods
Chemicals
Ectoine was isolated from H. elongata and hydroxyectoine
from Marinococcus halophilus M52. The preparation meth-
ods were developed in our laboratory (Galinski et al. 1985).
ADPC was isolated from H. elongata KB1 as described
below. Glutamine was purchased from Sigma (Deisenhofen,
Germany), betaine and ethyl-5-oxo-2-pyrrolidine-carboxylic
acid from FLUKA (Buchs, Switzerland). Synthetic deriva-
tives of L-ectoine (homoectoine and DHMICA) were
synthesized from ortho-acetic acid trimethylester and D,L-
2,3-diaminopropionic acid or L-ornithine, respectively,
according to the method of Koichi et al. (1991), as modified
by Voß (2002). Lactate dehydrogenase (LDH) from rabbit
muscle was purchased from FLUKA.
Microorganisms and plasmids
Different mutant strains of H. elongata DSM2581T (Vreeland
et al. 1980) impaired in ectoine biosynthesis were used in
Fig. 1 Biosynthetic pathway of
L-ectoine and S,S-β-hydroxyec-
toine in H. elongata. EctA L-2,4-
diaminobutyric acid acetyltrans-
ferase, EctB L-2,4-diaminobuty-
ric acid transaminase, EctC
ectoine synthase, EctD ectoine
hydroxylase
Appl Microbiol Biotechnol (2011) 91:113–122
this study: H. elongata KB1 (ΔectA) (Grammann et al.
2002), H. elongata WUB01 (ΔectC), and H. elongata
WUB02 (ΔectA, ΔectC). E. coli BL21 (DE3) (Studier and
Moffatt 1986), purchased from Novagen (Madison, USA),
was used for the synthesis of recombinant ectoine synthase.
Plasmid pET-22b_ectC_Hel_His, derived from the pET-22b
(+) vector (Novagen) was used for C-terminal fusion of
ectoine synthase to a His-tag, allowing purification of the
heterologously expressed protein.
Culture conditions and harvest
For physiological characterization, H. elongata strains were
grown aerobically at 30°C in MM63 medium (Larsen et al.
1987) with glucose as single carbon source and variable
NaCl concentration. Fermentation of H. elongata KB1 for
ADPC production was performed in a 15-L NLF22
fermentation unit (Bioengineering; Wald, Switzerland) at
30°C using GC medium (glucose 75.68 mM, tri-Na-citrate
34 mM, MgSO4 8.9 mM, NH4Cl 84 mM, K2HPO4
6.4 mM, FeSO4 0.036 mM) with 5% NaCl (w/v). High cell
density was achieved by a stepwise fed-batch method with
1 L of tenfold concentrated GC medium. Cells were
harvested and freeze-dried prior to extraction.
Determination of compatible solutes
Freeze-dried cells were extracted with chloroform/metha-
nol/water (10:5:4, by vol.) using a modified Bligh & Dyer
technique (Bligh and Dyer 1959). The water-soluble
fraction was subsequently analyzed on a Nucleosil®
aminopropyl-phase column (Macherey & Nagel, Düren,
Germany) using acetonitrile/water (80:20, (v/v)) as a
solvent (Galinski and Herzog 1990). Compounds were
monitored using a HPLC unit with refractive index monitor
and UV detector. Glutamine was analyzed by gradient
HPLC with pre-column FMOC-ADAM-derivatization as
described previously (Kunte et al. 1993).
Appl Microbiol Biotechnol (2011) 91:113–122
Mass spectrometry
Samples were analyzed by combined LC-UV-MS using a
Waters Alliance 2690 HPLC with Waters 996 Photodiode
array (PDA) detector, coupled in series with a Finnigan LCQ
ion trap mass spectrometer with an electrospray ion source
fitted. The HPLC column was a 125×4 mm Grom-Sil 100
amino-1 PR (3μ), and the injection volume was 20 μL. The
mobile phase was acetonitrile/water (75:25, (v/v)) at a flow
rate of 0.5 mL/min. The PDA was monitored over the range
of 190 to 300 nm at one cycle per second.
The electrospray needle voltage was 4 kV, sheath gas
(nitrogen) was 90 psi, and the heated capillary inlet was at
200°C. The mass spectrometer was operated in a complex
manner with a combination of full scan, data-dependent
MS/MS scans from the most intense ion, and a series of
targeted selected ion monitoring (SIM) and selected
reaction monitoring (SRM) experiments in different time
windows for some commonly occurring compatible solutes.
To set up this experiment, a reference sample of each
compatible solute was first run by direct infusion into the
mass spectrometer to determine suitable target SIM and/or
SRM ions and conditions, and then subsequently injected
onto the column to determine retention times for the
establishment of specific time windows covering one or
more compatible solutes.
The positive ions from m/z 50 to 300 were scanned
within each time window, and data-dependent MS/MS data
was generated from the most intense ion in each scan with
an isolation width (IsoW) of 3m/z units and collision
energy (CE) of 15%. Column background ions at m/z 120,
138, 139, 179, 216, 228, 242, 258, 272, and 298 coming
from the column were excluded. The typical full cycle time
was 5 s, which was adequate for the HPLC peak shape.
Following preliminary data from full scan spectra, targeted
experiments on the major unknown peak in H. elongata KB1
were run by acquiring full scan MS/MS data from m/z 129 in
positive ion mode (CE 15%, IsoW 3), as column background
ions precluded it being the most intense ion at the point of
elution. Negative ion full scans from m/z 50 to 300 were also
acquired for H. elongata KB1 in a separate experiment.
NMR spectroscopy
Cell dry weight (1 g) was extracted with chloroform/
methanol/water (10:5:4, by vol.) and the water-soluble
fraction was dried by evaporation overnight. The residual
material was solved in 1 mL D2O as a lock signal.
Methanol (10 μL) and acetonitrile (10 μL) were added as
internal standards. 13C-NMR spectroscopy was performed
relative to trimethylsilylpropiosulfonic acid sodium salt
(TMSP). 1H, 13C, and COSY NMR spectra were recorded
on a Bruker Avance 300 DPX spectrometer.
115
Extraction and purification of ADPC
Freeze-dried cell material from the fermentation was
repeatedly extracted in a Soxhlet apparatus using methanol
as a solvent. The resulting methanol extract was evaporated
under vacuum at 50°C. Remaining proteins were removed
by treatment with chloroform/water (50:50, (v/v)). The
water-soluble fraction was used for further purification
steps. Glutamate was removed by anion exchange chroma-
tography (Dowex 1X2, counter ion: Cl−) using water as
eluent. Inorganic salts were discarded by ion retardation
chromatography (AG11-A8, Bio-Rad laboratories, Munich,
Germany), again with water as solvent.
Chemical synthesis of ADPC
The chemical synthesis of 5-amino-3,4-dihydro-2H-pyrrole-
2-carboxylate (ADPC) started with ethyl-5-oxo-2-pyrrolidine-
carboxylic acid as reactant and was performed as described in
the literature (Lee and Lown 1987).
Generation of deletion mutants
The gene ectC coding for ectoine synthase was deleted in-
frame by use of the splicing-by-overlap-extension (SOE)
PCR technique. DNA sequences upstream and downstream
from ectC were amplified using the primers ectCup_F1
(CTCACGTCCTGCAGCGCCCCGAGCTCGA), ect
Cup_R1 (AGAATACTGCGCCGGGGTCGATTCTCCA),
ectCdown_F1 (CACTGGAGAATCGACCCCGGCGCAG
TAT), and ectCdown_R1 (ACGGCCCTGCAGAGCG
GAGCGGTCGTGA) and joined together (Horton et al.
1989). The resulting PCR fragment was ligated into the
shuttle vector pK18 mobsacB (Schaefer et al. 1994) and
transferred into H. elongata by E. coli S17-1-mediated
conjugation (Simon et al. 1983; Kunte and Galinski 1995).
Deletion mutants arising after double crossover were then
selected on LB medium supplemented with 0.2% glucose
and 22% sucrose at 37°C and subsequently verified via
PCR using the primers ectCup_F1 and ectCdown_R1.
Expression and purification of ectoine synthase
Ectoine synthase of H. elongata was heterologously
expressed in E. coli BL21 (DE3) using the vector pET-
22b_ectC_Hel_His. The protein was a C-terminal fusion
with a 6× His-tag for purification via Ni-NTA-affinity
chromatography. The expression strain was grown in LB
medium supplemented with 0.2 % glucose, 0.5% NaCl, and
ampicillin (100 μg/mL). Induction with IPTG (final
concentration 0.5 mM) took place at an optical density of
about 0.5. Cells were harvested 4 h after induction and the
fusion protein was purified and eluted using sodium
116
phosphate buffers with 0.5 M NaCl and stepwise increasing
imidazole concentration (10 mM, 20 mM, 250 mM;
pH 8.5) (Fig. 6). The eluted protein was dialyzed against
Tris–HCl buffer (0.5 M NaCl, pH 8.5). As a control for the
in vitro assays, the same procedure was applied to E. coli
BL21 (DE3) pET-22b(+) carrying the vector without insert.
In vitro assays with ectoine synthase
In vitro assays were performed with heterologously expressed
His-fusion EctC from H. elongata at room temperature (21°C).
The reaction mixture contained 50 mM Tris–HCl buffer
(pH 8.5), 0.5 M NaCl, and substrate (glutamine, ADPC,
homoectoine, and DHMICA, respectively) in a final concen-
tration of 92 mM. Reaction was started by adding the enzyme
and stopped by dilution with the same volume of acetonitrile
and subsequent freezing. Samples taken from the reaction
mixture were analyzed by HPLC. To ensure that reactions
were not caused by E. coli protein contaminants, we used Ni-
NTA purified E. coli BL21 pET-22b(+) protein as a control.
Supplementation experiments
Supplementation experiments for determination of growth
rates were performed in 200 μL cultures in a microtiter
plate. H. elongata WUB02 was cultured in MM63 medium
(Larsen et al. 1987) with glucose as single carbon source
and 3% (w/v) NaCl, supplemented with different solutes at
a final concentration of 1 mM.
LDH assays
Lactate dehydrogenase (LDH) activity was measured at 21°C.
The 1.0 mL reaction mixture contained 10 mM potassium
phosphate buffer (pH 7.8), 2.0 mM pyruvate, and 0.3 mM
NADH. The reaction was initiated by the addition of 10 μL of
the LDH preparation in buffer (0.05 mg/mL) and compatible
solutes in a concentration of 400 mM. The decrease in
absorbance at 340 nm was taken as a measure for enzyme
activity.
For stress experiments, the LDH preparation was subjected
to a number of freeze-thaw cycles as described previously
(Lippert and Galinski 1992). Freezing took place in liquid
nitrogen (−196°C) for approximately 30 s, thawing by
leaving the samples at room temperature (21°C) for 5 min.
Results
Mass spectrometry
Analysis of the compatible solute content of the ectoine
deletion mutant H. elongata KB1 (ΔectA) by HPLC
Appl Microbiol Biotechnol (2011) 91:113–122
revealed a previously unknown compound with strong
UV absorbance. Using LC-UV-MS on this novel peak, we
observed a putative protonated molecule at m/z 129 in
positive ion mode and a weak anion at m/z 127 in negative
ion mode. The compound was further characterized in
positive ion MS/MS by a loss of 46 Da to give a product
ion at m/z 83. This loss (formic acid) is characteristic of
carboxylic acids. The MS data therefore indicated a
molecular mass of 128 g/mol, the presence of a carboxyl
group, and an even number of nitrogen (if any).
Detection, isolation, and identification of ADPC
NMR analysis of the cell extract showed signals of
glutamate, glutamine, and L-2,4-diaminobutyric acid, as
expected for an ectA deletion mutant. Furthermore, NMR
revealed some resonances which were not consistent with
the previously known solute spectrum of H. elongata
(Fig. 2). Using Soxhlet extraction, anion exchange chro-
matography and ion retardation chromatography we were
able to isolate the novel substance for subsequent structural
determination.
13
C-natural abundance NMR of the purified substance
(Fig. 2) displayed characteristic signals at 28.5, 32.4, 65.8,
174.4, and 180.9 ppm relative to TMSP. Using COSY-
NMR, the substance was subsequently identified as 5-
amino-3,4-dihydro-2H-pyrrole-2-carboxylate (ADPC)
(Fig. 3) with the molecular formula C5H8N2O2. This result
corroborated the mass spectrometric data (see above). The
structure was further confirmed by comparison with a
chemically synthesized reference compound (Lee and
Lown 1987). ADPC displays structural similarities to Δ1
pyrroline-5-carboxylate but also features the amidinium
group characteristic for ectoine-type compatible solutes. It
has so far not been described as a natural compound.
Investigation of ADPC biosynthesis
The occurrence of ADPC in the producer strain H. elongata
KB1 was investigated in more detail. The size of the cell-
associated ADPC pool was shown to increase with external
salt concentration in the range of 3% to 5% NaCl. At
0.51 M (3% (w/v)) NaCl, the cell-associated ADPC
concentration was approx. 100 μmol/g DW (Fig. 4;
Table 1); at 0.68 M (4%) NaCl, this value increased to
220 μmol/g DW. The highest level (approximately
400 μmol/g DW) was reached at a salinity of 0.86 M (5%
(w/v)), which represents the maximum tolerated NaCl
concentration for growth of the mutant in minimal medium.
Compared to biomass-related ectoine levels of H. elongata
wild-type (approximately 400 and 800 μmol/g DW at 3%
and 5% NaCl, respectively) (Dötsch et al. 2008), these
values are markedly lower but nonetheless considerable.
Appl Microbiol Biotechnol (2011) 91:113–122
Fig. 2 13C-natural abundance NMR of cell extract from H. elongata
KB1 (top) and the purified substance ADPC (bottom); shown signals:
glutamate (open circle), glutamine (full circle), DABA (square),
unknown substance later identified as ADPC (diamond)
The above-mentioned ADPC levels were quantified
during the early stationary phase of growth, as ADPC
levels in H. elongata KB1 revealed a strong dependence on
the growth phase. Low levels of ADPC increased at least
20-fold when entering the stationary phase (Fig. 4). This
increase always coincided with a decrease of the amino acid
glutamine. The fact that glutamine and ADPC levels
Fig. 3 Tautomeric forms
of ADPC and its likely
zwitterionic structure in
aqueous solution
117
appeared to be linked led us to investigate whether
glutamine was a potential precursor of ADPC. As shown
in Fig. 5, ADPC synthesis from glutamine was proposed to
proceed in analogy to the ring-forming reaction in ectoine
biosynthesis. The cyclic amino acid derivative ectoine is
formed from Nγ-acetyl-diaminobutyric acid (ADABA) by
an intramolecular condensation reaction through nucleo-
philic attack of the alpha amino nitrogen at the terminal
carbonyl group (Fig. 5, top), catalyzed by ectoine synthase.
As the normal substrate ADABA is absent in the mutant
KB1 (due to the deletion of ectA), a side reaction with
glutamine as an alternative substrate would be a possible
explanation for the occurrence of ADPC (Fig. 5, bottom).
To prove this hypothesis, additional deletion mutants
were constructed by deleting the gene ectC in H. elongata
wild-type and the mutant KB1. The arising mutant strain H.
elongata WUB01 (ΔectC) was unable to produce ectoine
to balance osmotic stress, as expected, and accumulated
ADABA instead (Table 1), enabling a salt tolerance of up to
1.7 M NaCl. The fact that the ectC deletion mutant WUB01
displayed, besides ADABA, low levels of ectoine, suggests
alternative ways of ectoine synthesis from ADABA,
possibly via doeA (Schwibbert et al. 2010) or by slow
spontaneous cyclization of ADABA. The double mutant H.
elongata WUB02 (ΔectA, ΔectC) could not tolerate more
than 0.7 M NaCl, similar to the deletion strain KB1. H.
elongata WUB02 was not only unable to produce ectoine,
it was also unable to produce ADPC (Table 1), confirming
our hypothesis that ectoine synthase is essential for the
biosynthesis of ADPC.
In order to investigate the involvement of ectoine synthase
in ADPC biosynthesis in vitro, the heterologous expression
system E. coli BL21 (DE3) pET-22b_ectC_Hel_His was
employed. HPLC analysis revealed ADPC production of this
E. coli strain when osmotically stressed with 3% (w/v) NaCl
in minimal medium. In fact, we were able to detect cell-
associated ADPC levels similar to those of strain KB1
(Table 1). As E. coli without the ectC gene proved unable to
synthesize ADPC, this finding further confirms the involve-
ment of ectoine synthase in ADPC biosynthesis.
118 Appl Microbiol Biotechnol (2011) 91:113–122

slower than the ectoine-forming reaction under similar

Fig. 4 Growth of H. elongata KB1 at 3% NaCl displayed as Ln OD
(diamond) and development of cell-associated ADPC (triangle) and
glutamine (square) levels
In vitro assay with ectoine synthase (EctC)
conditions (Ono et al. 1999) and emphasizes the fact that
glutamine is an unfavorable substrate.
Against expectations, this reaction proved far from
complete. Only approx. 20% of the glutamine was
converted into ADPC (Fig. 7). This is at first surprising,
as the conversion of ADABA into ectoine was shown to
proceed almost completely (>95%) under identical con-
ditions (data not shown). Subsequently, the reverse reaction
(i.e., hydrolysis of ADPC into glutamine) was investigated
(Fig. 7). In this case, approx. 80% of the ADPC was
hydrolyzed into glutamine at a faster initial reaction rate
(approximately 0.3 Umg−1).
These results not only provide evidence that ectoine
synthase is responsible for the formation of ADPC from
glutamine but also prove the existence of an equilibrium
between the two compounds which is largely on side of
glutamine.

The role of ectoine synthase in ADPC biosynthesis was
further corroborated using the purified enzyme in vitro.
The His-tag fusion protein (EctC_Hel_His) was success-
fully overexpressed in E. coli BL21 (DE3) pET-
22b_ectC_Hel_His and purified by Ni-NTA affinity
chromatography. The enzyme appeared in SDS-PAGE
with the expected size of 16.52 kDa (Fig. 6). Although the
eluted fraction was not free from minor impurities, a
control preparation (from cells devoid of ectC) proved that
ectoine synthase was solely responsible for the observed
enzymatic activity. In order to approximate the cellular
substrate concentration in H. elongata KB1 for in vitro
measurements, we used the quantification of glutamine
from Fig. 4 (approx. 100 μmol/ g DW) in combination
with the cell volume of 1.12 mL/g DW according to
Dötsch et al. (2008) to calculate a cytoplasmic concentra-
tion of approx. 90 mM of glutamine for cells grown at 3%
(w/v) NaCl.
At that concentration, glutamine as a substrate was
slowly converted into ADPC in vitro (approx. 0.1 Umg−1,
at 21°C). This rate is more than two orders of magnitude
Substrate spectrum of ectoine synthase
The reversibility of ADPC formation and hydrolysis
provided argument for further investigations into the
substrate spectrum of ectoine synthase (EctC) with special
emphasis on potential hydrolytic reactions. Subsequent in
vitro assays with a number of cyclic amino acid derivatives
revealed two further substrates of ectoine synthase, namely
L-homoectoine and DL-DHMICA (Fig. 8). The former was
converted completely into Nδ-acetyl-L-ornithine, whereas
the latter (a racemate) only by 50% to its open form Nβ-
acetyl-diaminopropionic acid. The hydrolytic reactions rate
with ADPC and DHMICA (approximately 0.3 and 0.16 U
mg−1, respectively) proved much slower than with homo-
ectoine as a substrate.
Kinetic values generated for the hydrolytic reaction of
homoectoine revealed a Vmax of 4.6 Umg−1 and a Km of
28.7 mM. Compared with the kinetic values for the forward
reaction with the natural substrate ADABA (Vmax 56 U
mg−1, Km 8.4 at 0.77 M NaCl; Ono et al. 1999), the
hydrolysis of homoectoine is itself one order of magnitude

Table 1 Compatible solute content (at 3% NaCl) of H. elongata wild-type and various mutants deficient in ectoine biosynthesis, as well as ADPC
content of E. coli strain expressing ectoine synthase from H. elongata

Ectoine [μmol/g DW] ADABA [μmol/g DW] ADPC [μmol/g DW]

H. elongata WT 400a <50b –

KB1 (ΔectA) – – 100
WUB01 (ΔectC) 7 460 –
WUB02 (ΔectA, ΔectC) – – –
E. coli BL21 (DE3) pET-22b_ectC_Hel_His – – 110
a
Dötsch et al. 2008
b
Göller et al. 1998
Appl Microbiol Biotechnol (2011) 91:113–122
Fig. 5 Proposed reaction
mechanism leading to ectoine
and ADPC, respectively,
catalyzed by ectoine synthase
slower. These data clarify that the investigated alternative
substrates of ectoine synthase are processed as a result of
slow side reactions.
Thus, there is now strong evidence that ectoine
synthase is a reversible enzyme which can hydrolyze a
number of cyclic amino acid derivatives, among those
ADPC, which under physiological and in vitro conditions
forms an equilibrium, which is largely on the side of
glutamine. Ectoine synthesis appears to be unusual in as
much as the equilibrium between ADABA and ectoine is
almost completely on the side of the cyclic condensation
product ectoine.
Fig. 6 SDS-PAGE of Ni-NTA purified protein of control strain E. coli
BL21 (DE3) pET-22b(+) (1) and His-fusion ectoine synthase derived
from E. coli BL21 (DE3) pET-22b_ectC_Hel_His (2). M protein marker
119
Characterization of ADPC
ADPC not only shares structural similarities with known
compatible solutes but also is the product of an enzyme
related to osmoadaptation and increasingly accumulated
when the external salt concentration is raised. All these
findings indicate a possible participation in osmoadaptation.
However, as relevant concentrations of ADPC only occur in
the stationary phase, a function as compatible solute for
improvement of growth at high salinities seems unlikely in
the producing strain H. elongata KB1. Nevertheless, we
wanted to clarify whether ADPC supplied in the medium
can function as a growth-improving compatible solute for
cells lacking ectoine synthase.
Such a supplementation experiment was performed with
the double deletion mutant H. elongata WUB02 (ΔectA,
ΔectC), which is unable to produce ectoine and also lacks
the ability to convert ADPC into glutamine. When grown
under salt stress (4% (w/v)) supplemented with 1 mM
ADPC, the organism's ability to cope with salt was greatly
improved (Fig. 9). In comparison to other compatibles
solutes, the salt-protective effect of ADPC was similar to
Fig. 7 In vitro reaction of ectoine synthase leading to equilibrium of
glutamine and ADPC. With glutamine as the substrate (white bars)
approx. 20% were converted into ADPC. When ADPC was used as
the substrate, approx. 80% were hydrolyzed to yield glutamine (gray
bars). Substrates 92 mM, protein 0.9 mg/mL, temperature 21°C
120
Fig. 8 Hydrolytic action of ectoine synthase on D,L-DHMICA (top)
and L-homoectoine (bottom). HPLC-UV-chromatogram: before reac-
tion (gray) and after reaction (black). It is shown that the
stereoisomeric L-homoectoine is hydrolyzed completely, whereas only
50% of the DHMICA racemate is hydrolyzed
that of hydroxyectoine. Uptake and accumulation in the
cells was confirmed by HPLC (data not shown).
In view of the salt-protective effect of ADPC on living
cells, we investigated the possibility of a stress-protective
effect on proteins. Lactate dehydrogenase (LDH) has been
used before as model enzyme for the assessment of the
ability of compatible solutes to prevent freeze-thaw related
inactivation of enzymes (Lippert and Galinski 1992). As
Fig. 9 Growth-promoting effects of ADPC and other solutes on
ectoine deletion mutant WUB02 (ΔectA, ΔectC) grown in MM63
medium with 4% NaCl
Appl Microbiol Biotechnol (2011) 91:113–122
shown in Fig. 10, we were able to demonstrate extraordi-
nary protective properties of ADPC. In the presence of
ADPC (0.4 M), the post-stress activity of LDH does not
drop below 60% over a period of at least six freeze-thaw
cycles, whereas the control was completely inactivated after
three cycles. This stabilizing effect is far superior to that of
hydroxyectoine (approximately 15% residual activity), one
of the most potent freeze-thaw stabilizers so far (Lippert
and Galinski 1992).
Discussion
Ectoine synthase has so far always been associated with
the intramolecular condensation reaction forming ectoine
from N4-acetyl-L-2,4-diaminobutyric acid (Nγ-acetyl-
diaminobutyric acid, ADABA). Although classified as
hydro-lyase, reversibility of this enzyme has until now
never convincingly been demonstrated. The observed
conversion of ectoine into ADABA in crude cell extract
(Peters et al. 1990) could have been caused by the action
of an independent ectoine degradation pathway, the
presence of which has recently been revealed in H.
elongata (Schwibbert et al. 2010). Similarly, in vitro assays
with partially purified ectoine synthase from Streptomyces
also indicated the possibility of ectoine hydrolysis, but could
not exclude a likely contamination with degradative enzymes
(Grammel 1999). Working with purified ectoine synthase,
Ono et al. (1999) were unable to demonstrate reversibility of
the enzyme with ectoine as a substrate. However, this
negative result might have been caused by detection limits
for the expected product ADABA.
Using ectoine derivatives (DHMICA, homoectoine) and
ADPC as alternative substrates for the hydrolytic reaction
of ectoine synthase, we have now for the first time
unambiguously demonstrated the enzyme's reversibility.
Fig. 10 Protective effect of ADPC on model enzyme LDH in a
freeze-thawing experiment. Control (black), 0.4 M hydroxyectoine
(dark gray), 0.4 M ADPC (light gray). Average activity of control
before first freeze-thaw cycle was set to 100%
Appl Microbiol Biotechnol (2011) 91:113–122
At the same time, it was shown that the equilibrium for the
reaction ADABA→ectoine is almost completely on the side
of the cyclic condensation product ectoine. This explains
why irreversibility of ectoine synthase had erroneously
been assumed.
Previous studies on purified ectoine synthase unsuccess-
fully tested a number of acetylated amino acids as potential
alternative substrates (Ono et al. 1999). In this work, we have
demonstrated for the first time one further substrate for the
forward reaction, namely the amino acid glutamine, which is
(slowly) converted through a condensating cyclization
reaction into ADPC. In this case, the equilibrium seems to
be largely on the side of the educt glutamine. This explains
the low levels of ADPC during growth of mutant KB1. For
the same reason, ADPC cannot accumulate in the growing
producer strain and is not part of the usual compatible solute
cocktail of this organism. It remains an open question,
however, why in vivo the equilibrium (usually on the side of
the hydrolytic product) is shifted towards cyclic condensa-
tion when the organism enters stationary phase.
This is the first description of the novel compatible
solute ADPC from a deletion mutant of the moderately
halophilic H. elongata. We have here the very unusual
situation that the producer strain of ADPC does not profit
from its own product. There seems to be no increased
osmoprotection for the producer strain, as KB1 displays the
same osmotolerance as the strain WUB02 (ΔectA, ΔectC),
which is unable to synthesize ADPC. This is not surprising
because in the presence of a functional ectoine synthase,
ADPC levels are very low during exponential growth
(approx. 5 mM, at 3% NaCl), whereas the reported high
concentrations are only observed when cells enter the
stationary phase. However, when ADPC is supplied to
growing cultures of cells lacking ectoine synthase (e.g., E.
coli, H. elongata ΔectA, ΔectC), it is accumulated (up to
550 μmol/g DW in H. elongata ΔectA, ΔectC at 4% NaCl)
and displays the essential properties of a good compatible
solute, i.e., improvement of the accumulating organism's
salt tolerance. In addition, extraordinary stress protection of
proteins has been demonstrated with LDH as a model
enzyme. As supply of ADPC is only achieved by genetic
engineering, it is the first engineered compatible solute.
To our knowledge, ADPC has not yet been described as
a natural compound in its own right. It has, however, been
published as a substructure of different peptide antimicro-
bials such as kikumycin A, kikumycin B, anthelvencin A,
noformycin, or dihydrokikumycin B, where it forms the N-
terminal cyclic amino acid (Lee et al. 1988; Lee and Lown
1987; Takizawa et al. 1987). Hence, ADPC has been
suspected of being an intermediate in biosynthesis or
degradation of such antibiotics (Takizawa et al. 1987) and
used as a building block in their chemical synthesis (Lee
and Lown 1987; Lee et al. 1988). Its N-methylated
121
derivative, 2-imino-1-methylpyrrolidine-5-carboxylic acid
has previously been extracted from a marine sponge, where
it is presumed to display allelopathic activity against corals
(Castellanos et al. 2006). In addition, ADPC in ester-
linkage with threonine (2-imino-5-L(carboxy-L-threoninyl)-
pyrrolidine) has been reported by Mitchell and Teh (2005)
from Burkholderia plantarii.
Although glutamine appears to be a poor substrate for
ectoine synthase and the formation of ADPC no more than
a side reaction, the enzyme's unexpected property to form
and—even more interesting—to hydrolyze cyclic amino
acids and derivatives raises the question whether related
enzymes may be involved in secondary metabolite path-
ways, in particular the synthesis and degradation of
antimicrobials.
Acknowledgement We would like to express our gratitude to Katrin
Grammann for the construction of mutant KB1 during her diploma
thesis at the Institute of Microbiology & Biotechnology, which turned
our attention to and eventually led to the disclosure of the other facets
of ectoine synthase.
References
Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction
and purification. Can J Biochem Physiol 37:911–917
Bursy J, Pierik AJ, Pica N, Bremer E (2007) Osmotically induced
synthesis of the compatible solute hydroxyectoine is mediated by
an evolutionarily conserved ectoine hydroxylase. J Biol Chem
282:31147–31155. doi:10.1074/jbc.M704023200
Castellanos L, Duque C, Zea S, Espada A, Rodriguez J, Jimenez C
(2006) Isolation and synthesis of (−)-(5S)-2-imino-1-methylpyr-
rolidine-5-carboxylic acid from Cliona tenuis. Structure revision
of pyrostatins. Org Lett 8:4967–4970
Dötsch A, Severin J, Alt W, Galinski EA, Kreft J (2008) A
mathematical model for growth and osmoregulation in halophilic
bacteria. Microbiology 154:2956–2969
Furusho K, Yoshizawa T, Shoji S (2005) Ectoine alters subcellular
localization of inclusions and reduces apoptotic cell death
induced by the truncated Machado-Joseph disease gene product
with an expanded polyglutamine stretch. Neurobiol Dis 20:170–
178. doi:10.1016/j.nbd.2005.02.011
Galinski EA, Pfeiffer HP, Trüper HG (1985) 1,4,5,6-Tetrahydro-2-
methyl-4-pyrimidinecarboxylic acid. A novel cyclic amino acid
from halophilic phototrophic bacteria of the genus Ectothiorho-
dospira. Eur J Biochem 149:135–139
Galinski EA, Herzog RM (1990) The role of trehalose as a substitute
for nitrogen-containing compatible solutes (Ectothiorhodospira
halochloris). Arch Microbiol 153:607–613
Göller K, Galinski EA (1999) Protection of a model enzyme (lactate
dehydrogenase) against heat, urea and freeze-thaw treatment by
compatible solute additives. J Mol Catal B Enzym 7:37–45
Göller K, Ofer A, Galinski EA (1998) Construction and characteriza-
tion of an NaCl-sensitive mutant of Halomonas elongata
impaired in ectoine biosynthesis. FEMS Microbiol Lett
161:293–300
Graf R, Anzali S, Buenger J, Pfluecker F, Driller H (2008) The
multifunctional role of ectoine as a natural cell protectant. Clin
Dermatol 26:326–333. doi:10.1016/j.clindermatol.2008.01.002
122
Grammann K, Volke A, Kunte HJ (2002) New type of osmoregulated
solute transporter identified in halophilic members of the bacteria
domain: TRAP transporter TeaABC mediates uptake of ectoine
and hydroxyectoine in Halomonas elongata DSM 2581(T). J
Bacteriol 184:3078–3085
Grammel N (1999) Molekulargenetische und biochemische Analyse
der Biosynthese von 2-Methyl-4-carboxy-3,4,5,6-tetrahydropyr-
imidin und seinem 5-Hydroxyderivat, zwei salzstreßinduzierba-
ren Osmolyten, in Streptomyces chrysomallus. Dissertation,
Technische Universität Berlin
Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR (1989)
Engineering hybrid genes without the use of restriction enzymes:
gene splicing by overlap extension. Gene 77:61–68
Kanapathipillai M, Lentzen G, Sierks M, Park CB (2005) Ectoine and
hydroxyectoine inhibit aggregation and neurotoxicity of Alz-
heimer's β-amyloid. FEBS Lett 579:4775–4780
Kanapathipillai M, Ku SH, Girigoswami K, Park CB (2008) Small
stress molecules inhibit aggregation and neurotoxicity of prion
peptide 106–126. Biochem Biophys Res Commun 365:808–813.
doi:10.1016/j.bbrc.2007.11.074
Koichi M, Mitsuhiko M, Tatsuo N, Yoshio S; Takeda Chem Ind Ltd
(Take), assignee (1991) Production of tetrahydropyrimidine
derivatives. Jp. Patent JP3031265
Kunte HJ, Galinski EA (1995) Transposon mutagenesis in halophilic
eubacteria: conjugal transfer and insertion of transposon Tn5 and
Tn1732 in Halomonas elongata. FEMS Microbiol Lett 128:293–299
Kunte HJ, Galinski EA, Trueper HG (1993) A modified FMOC-
method for the detection of amino acid-type osmolytes and
tetrahydropyrimidines (ectoines). J Microbiol Meth 17:129–136
Larsen PI, Sydnes LK, Landfald B, Strøm AR (1987) Osmoregulation
in Escherichia coli by accumulation of organic osmolytes:
betaines, glutamic acid, and trehalose. Arch Microbiol 147:1–7
Lee M, Coulter DM, Lown JW (1988) Total synthesis and absolute
configuration of the antibiotic oligopeptide (4S)-(+)-anthelvencin
A and its 4R-(−) enantiomer. J Org Chem 53:1855–1859
Lee M, Lown JW (1987) Synthesis of (4S)- and (4R)-methyl 2-amino-
1-pyrroline-5-carboxylate and their application to the preparation
of (4S)-(+)- and (4R)-(−)-dihydrokikumycin B. J Org Chem
52:5717–5721
Lippert K, Galinski EA (1992) Enzyme stabilization be ectoine-type
compatible solutes: protection against heating, freezing and
drying. Appl Microbiol Biotechnol 37:61–65
Louis P (1997) Characterization of genes for the biosynthesis of the
compatible solute ectoine from Marinococcus halophilus and
osmoregulated expression in Escherichia coli. Microbiology
143:1141–1149
Louis P, Trueper HG, Galinski EA (1994) Survival of Escherichia coli
during drying and storage in the presence of compatible solutes.
Appl Microbiol Biotechnol 41:684–688
Manzanera M, de García Castro A, Tøndervik A, Rayner-Brandes M,
Strøm AR, Tunnacliffe A (2002) Hydroxyectoine is superior to
trehalose for anhydrobiotic engineering of Pseudomonas putida
KT2440. Appl Environ Microbiol 68:4328–4333
Mitchell RE, Teh KL (2005) Antibacterial iminopyrrolidines from
Burkholderia plantarii, a bacterial pathogen of rice. Org Biomol
Chem 3:3540–3543. doi:10.1039/b509319h
Moghaieb REA, Tanaka N, Saneoka H, Murooka Y, Ono H,
Morikawa H, Nakamura A, Nguyen NT, Suwa R, Fujita K
Appl Microbiol Biotechnol (2011) 91:113–122
(2006) Characterization of salt tolerance in ectoine-transformed
tobacco plants (Nicotiana tabaccum): photosynthesis, osmotic
adjustment, and nitrogen partitioning. Plant Cell Environ 29:173–
182
Nakayama H, Yoshida K, Ono H, Murooka Y, Shinmyo A (2000)
Ectoine, the compatible solute of Halomonas elongata, confers
hyperosmotic tolerance in cultured tobacco cells. Plant Physiol
122:1239–1268
Ono H, Sawada K, Khunajakr N, Tao T, Yamamoto M, Hiramoto M,
Shinmyo A, Takano M, Murooka Y (1999) Characterization of
biosynthetic enzymes for ectoine as a compatible solute in a
moderately halophilic eubacterium, Halomonas elongata. J
Bacteriol 181:91–99
Peters P, Galinski EA, Trüper HG (1990) The biosynthesis of ectoine.
FEMS Microbiol Lett 71:157–162
Rai M, Pal M, Sumesh KV, Jain V, Sankaranarayanan A (2006)
Engineering for biosynthesis of ectoine (2-methyl 4-carboxy
tetrahydro pyrimidine) in tobacco chloroplasts leads to accumu-
lation of ectoine and enhanced salinity tolerance. Plant Sci
170:291–306
Reuter K, Pittelkow M, Bursy J, Heine A, Craan T, Bremer E (2010)
Synthesis of 5-hydroxyectoine from ectoine: crystal structure of
the non-heme iron(II) and 2-oxoglutarate-dependent dioxygenase
EctD. PLoS ONE 5:e10647. doi:10.1371/journal.pone.0010647
Sauer T, Galinski EA (1998) Bacterial milking: a novel bioprocess
for production of compatible solutes. Biotechnol Bioeng
57:306–313
Schaefer A, Tauch A, Jaeger W, Kalinowski J (1994) Small
mobilizable multi-purpose cloning vectors derived from the
Escherichia coli plasmids pK18 and pK19 selection of defined
deletions in the chromosome of Corynebacterium glutamicum.
Gene 145:69–73
Schwibbert K, Marin-Sanguino A, Bagyan I, Heidrich G, Lentzen G,
Seitz H, Rampp M, Schuster SC, Klenk H, Pfeiffer F, Oesterhelt D,
Kunte HJ (2010) A blueprint of ectoine metabolism from the
genome of the industrial producer Halomonas elongata DSM 2581
(T). Environ Microbiol. doi:10.1111/j.1462-2920.2010.02336.x
Simon R, Priefer U, Puhler A (1983) A broad host range mobilization
system for in vivo genetic engineering: transposon mutagenesis
in gram negative bacteria. Nat Biotech 1:784–791
Studier FW, Moffatt BA (1986) Use of bacteriophage T7 RNA
polymerase to direct selective high-level expression of cloned
genes. J Mol Biol 189:113–130
Takizawa M, Tsubotani S, Tanida S, Harada S, Hasegawa T (1987) A
new pyrrole-amidine antibiotic TAN-868 A. J Antibiot 40:1220–
1230
Voß P (2002) Synthese von kompatiblen Soluten mit ectoinanaloger
Struktur und Charakterisierung des protektiven Effektes auf
biochemische Modellsysteme und Escherichia coli. Dissertation,
Westfälische Wilhelms-Universität Münster
Vreeland RH, Litchfield CD, Martin EL, Elliot E (1980) Halomonas
elongata, a new genus and species of extremely salt-tolerant
bacteria. Int J Syst Bacteriol 30:485–495
Wei L, Wedeking A, Buttner R, Kalff JC, Tolba RH, van Echten-
Deckert G (2009) A natural tetrahydropyrimidine protects small
bowel from cold ischemia and subsequent warm in vitro
reperfusion injury. Pathobiology 76:212–220. doi:10.1159/
000218338