Académique Documents
Professionnel Documents
Culture Documents
75:330–337, 2004
Report
Rheumatoid arthritis (RA) is the most common systemic autoimmune disease, affecting ∼1% of the adult population
worldwide, with an estimated heritability of 60%. To identify genes involved in RA susceptibility, we investigated
the association between putative functional single-nucleotide polymorphisms (SNPs) and RA among white indi-
viduals by use of a case-control study design; a second sample was tested for replication. Here we report the
association of RA susceptibility with the minor allele of a missense SNP in PTPN22 (discovery-study allelic P p
6.6 # 1054; replication-study allelic P p 5.6 # 1058 ), which encodes a hematopoietic-specific protein tyrosine phos-
phatase also known as “Lyp.” We show that the risk allele, which is present in ∼17% of white individuals from
the general population and in ∼28% of white individuals with RA, disrupts the P1 proline-rich motif that is important
for interaction with Csk, potentially altering these proteins’ normal function as negative regulators of T-cell acti-
vation. The minor allele of this SNP recently was implicated in type 1 diabetes, suggesting that the variant phos-
phatase may increase overall reactivity of the immune system and may heighten an individual carrier’s risk for
autoimmune disease.
Rheumatoid arthritis (RA [MIM 180300]) is character- 2002; Fisher et al. 2003). Although interesting associ-
ized by immune cell–mediated destruction of the joint ations have been reported (Suzuki et al. 2003; Tokuhiro
architecture and is two to three times more common in et al. 2003), only alleles at the HLA-DRB1 locus have
women than in men (Firestein 2003). A strong genetic consistently demonstrated both linkage and association
component is indicated (Seldin et al. 1999; MacGregor (Seldin et al 1999).
et al. 2000), and genome scans have identified multiple To identify genes involved in genetic predisposition to
regions linked to disease (Cornelis et al. 1998; Shiozawa RA, we performed a case-control association study
et al. 1998; Jawaheer et al. 2001, 2003; MacKay et al. (called “discovery study”) with assays for 87 putative
functional SNPs (Botstein and Risch 2003) in RA can-
Received April 30, 2004; accepted for publication May 25, 2004;
didate genes and/or linkage regions. The discovery study,
electronically published June 18, 2004. consisting of 475 individuals with RA and 475 individ-
Address for correspondence and reprints: Dr. Ann B. Begovich, Cel- ually matched controls, was obtained by Genomics Col-
era Diagnostics, 1401 Harbor Bay Parkway, Alameda, CA 94502. E- laborative, Inc. (GCI). Case samples were collected from
mail: Ann.Begovich@celeradiagnostics.com
throughout the United States, and they met the 1987
* These authors contributed equally to this work.
䉷 2004 by The American Society of Human Genetics. All rights reserved. American College of Rheumatology (ACR) diagnostic
0002-9297/2004/7502-0019$15.00 criteria for RA. All case samples were from white in-
330
Reports 331
tional and/or local institutional review boards, and all NOTE.—Genotypes were generated by use of kinetic, allele-specific PCR
subjects were enrolled with informed written consent. (Germer et al. 2000): 0.3 ng of DNA in a 15-ml reaction containing the allele-
specific primers 5-CCTCCACTTCCTGTAT/C and a common primer, 5-CCCA-
We found association with the minor allele (T) of a TCCCACACTTTATTTTATAC. Genotyping accuracy was 100%, as deter-
missense SNP (R620W [rs2476601, 1858CrT]) in the mined by internal comparisons by use of a different assay (Iannone et al. 2000)
protein tyrosine phosphatase non-receptor type 22 gene for the same marker on ∼6% of the samples. All case and control populations
were in Hardy-Weinberg equilibrium.
(PTPN22) (allele frequency 13.8% in cases, 8.8% in a
Independent cases comprising one randomly selected sib per NARAC family.
controls) (P p 6.6 # 10⫺4, allelic odds ratio [OR] 1.65, b
All affected individuals in NARAC.
95% CI 1.23–2.20).
Replication in a second study (called the “replication the local institutional review board’s approval was se-
study”) confirmed association. Cases in the replication cured at each recruitment site. The enrollment criteria
study were obtained by the North American Rheuma- for family participation are described in detail elsewhere
toid Arthritis Consortium (NARAC) and consisted of (Jawaheer et al. 2001). In brief, at least two siblings must
members of white multiplex families. For this study, satisfy the 1987 ACR criteria for RA, at least one sibling
DNA was available for 840 individuals with RA from must have documented erosions on hand radiographs,
463 families. These families were recruited from and at least one sibling must have disease onset between
throughout the United States through the 12 partici- the ages of 18 and 60 years. The presence of psoriasis,
pating recruitment centers of NARAC (NARAC Web inflammatory bowel disease, or SLE was an exclusionary
site). Informed written consent was obtained from every criterion for the sib pair. Controls were selected from
subject, including all participating family members, and 20,000 individuals who are part of the New York Cancer
Table 2
Association of PTPN22 with RA
RESULTS FOR
DATA SET
Crude Analysisa CLRb CLR, Adjusted for HLAc
AND NO. OF NO. OF
d d
GENOTYPE CASES CONTROLS OR 95% CI P OR 95% CI P ORd 95% CI P
Discovery:
TT 6 3 2.25 .56–9.07 .32e 2.26 .56–9.14 .25 2.39 .35–16.43 .38
TC 119 78 1.72 1.25–2.36 .001 1.69 1.23–2.32 .001 1.53 1.05–2.23 .03
TT⫹TCf 125 81 1.74 1.27–2.38 .0005 1.71 1.25–2.34 .0008 1.55 1.07–2.25 .02
CC 350 394 … … … … … … … … …
Replication:
TT 10 9 2.63 1.06–6.53 .03 2.55 1.03–6.31 .04 3.26 1.03–10.28 .04
TC 126 143 2.09 1.59–2.74 !.0001 2.08 1.58–2.74 !.0001 1.7 1.19–2.42 .004
TT⫹TCf 136 152 2.12 1.62–2.76 !.0001 2.11 1.62–2.76 !.0001 1.78 1.26–2.51 .001
CC 327 774 … … … … … … … … …
a
Values were calculated by use of standard contingency tables (or two-tailed Fisher’s Exact Test).
b
CLR was performed as described elsewhere (Breslow and Day 1980) to account for individual matching of controls to cases.
c
To assess whether the observed associations were independent of the HLA-DRB1 genotype, we further adjusted for this known
risk factor. HLA-DRB1 genotyping was performed as described elsewhere (Jawaheer et al. 2002), and, for this analysis, samples
were binned according to their HLA-DRB1 genotype: high risk, two shared epitopes (HR-2SE); high risk, one shared epitope (HR-
1SE; 4K,X; or 4R,X); low risk, one shared epitope (LR-1SE; 1R,X; or 10,X); and low risk, zero shared epitopes (LR-0SE; X,X)
(Fries et al. 2002).
d
ORs were calculated relative to the major allele homozygote (CC).
e
P value calculated by use of Fisher’s Exact Test.
f
Because of the infrequency of the TT genotype, we combined it with the TC genotype and repeated the analysis.
332 Am. J. Hum. Genet. 75:330–337, 2004
Figure 1 PTPN22 knockdown by RNAi increases antigen-receptor signaling in Jurkat T-cell line. Knockdown and NF-kB transcriptional
response after T-cell receptor stimulation for cells transfected with two control siRNAs (Scramble) and two PTPN22 siRNAs. First, 4.5 mg
siRNA (Dharmacon) and 1 mg pNF-kB-luc plasmid (Stratagene) were electroporated into 2 # 106 Jurkat cells (ATCC, clone E6-1, homozygous
for 620R) in Cell Line Nucleofector Solution V, according to manufacturer’s protocol #S18 (amaxa). After 24 h, 5.5 # 104 cells were stimulated
with anti-CD3 (2 mg/ml [BD Pharmingen, clone UCHT1]), anti-CD28 (2 mg/ml [BD Pharmingen, clone CD28.2]), and anti-mouse IgG1 (2 mg/
ml [BD Pharmingen, clone A85-1]). Cells were lysed and assayed for luminescence 6 h after stimulation by use of Bright-Glo (Promega) and a
96-well MicroBeta plate reader (Wallac). PTPN22 siRNAs that were effective for knockdown were found by screening seven candidate siRNA
sequences that were designed by use of Web-based tools from Ambion and Dharmacon. siRNA sequences used in this study were PTPN22.1
(5-AAGGCAGACAAAACCTATCCT), PTPN22.2 (5-GAGGATTCCAGCTACATCAAT), Scramble.1 (5-AAGAACGGCATCAAGGTGAAC),
and Scramble.2 (5-AATTCTCCGAACGTGTCACGT). RNA was harvested according to the manufacturer’s protocol (RNeasy 96 [Qiagen]),
and TaqMan real-time quantitative RT-PCR (SDS-7900 [Applied Biosystems]) was used to measure PTPN22 expression levels. PTPN22 mRNA
levels in each sample were normalized to total RNA amounts (RiboGreen [Molecular Probes]) and then expressed relative to PTPN22 levels
in cells that were untransfected with siRNA. The PTPN22 TaqMan sequences were 5-GGCCCAAAGCAAGAAAATTACTAAA (forward), 5-
TGTCTGCCTTGTACTTGGTAGATTG (reverse), and 5-TTCAGCTTCAGAAATT (MGB probe).
Project (NYCP), a population-based prospective study increase of the risk allele frequency was apparent when
of the genetic and environmental factors that cause dis- all affected siblings (n p 840) were analyzed (allele fre-
ease (New York Cancer Project Web site). Two control quency 16.8%). Genotypic analyses produced similar
individuals were matched to a single randomly chosen results, showing increased frequencies of both TT and
affected sib on the basis of sex, age (birth decade), and TC genotypes in the cases, compared with the controls
ethnicity (grandparental country/region of origin). These (table 1).
463 independent cases (referred to as “single sibs”) and We used contingency tables and conditional-logistic
their 926 matched controls were used for all analyses regression (CLR) (Breslow and Day 1980) to assess the
reported in this study, except where noted. association of the PTPN22 R620W genotype with RA
The association for single sibs was as follows: allele (table 2). In the discovery study, both the TC (ORCLR
frequency 15.8% in cases and 8.7% in controls (P p 1.69, P p .0012) and TT (ORCLR 2.26, P value not sig-
5.6 # 10⫺8, allelic OR 1.97, 95% CI 1.55–2.50). An nificant) genotypes conferred an increased risk for dis-
Reports 333
Table 3
Association of PTPN22 with RF+ and RF5 Disease
RESULTS FOR
DATA SET a
Crude Analysis CLRb CLR, Adjusted for HLAc
AND RF NO. OF NO. OF
d d
GENOTYPE STATUS CASES CONTROLS OR 95% CI P OR 95% CI P ORd 95% CI P
e
Discovery:
TT⫹TCf RF⫹ 125 81 1.74 1.27–2.38 .0005 1.71 1.25–2.34 .0008 1.55 1.07–2.25 .02
CC RF⫹ 350 394 … … … … … … … … …
Replication:
TT⫹TCf RF⫹ 119 122 2.38 1.78–3.18 !.0001 2.36 1.76–3.16 !.0001 2 1.35–2.97 .0005
CC RF⫹ 266 648 … … … … … … … … …
TT⫹TCf RF⫺ 17 30 1.17 .60–2.29 .64 1.17 .60–2.31 .64 1.09 .51–2.36 .82
CC RF⫺ 61 126 … … … … … … … … …
a
Values were calculated by use of standard contingency tables.
b
CLR was performed as described elsewhere (Breslow and Day 1980) to account for individual matching of controls to cases.
c
To assess whether the observed associations were independent of the HLA-DRB1 genotype, we further adjusted for this known risk factor.
For this analysis, samples were binned according to their HLA-DRB1 genotype: high risk, two shared epitopes (HR-2SE); high risk, one shared
epitope (HR-1SE; 4K,X; or 4R,X); low risk, one shared epitope (LR-1SE; 1R,X; or 10,X); and low risk, zero shared epitopes (LR-0SE; X,X)
(Fries et al. 2002).
d
ORs were calculated relative to the major allele homozygote (CC).
e
All patients in the discovery cohort are RF⫹.
f
Because of the infrequency of the TT genotype, we combined it with the TC genotype for these analyses.
Figure 3 RNA expression profile of PTPN22. Expression of the PTPN22 major splice variant (GenBank accession number NM_015967)
was determined by kinetic RT-PCR analysis by use of total RNA from sorted hematopoeitic cells (AllCells) and selected tissues (Clontech), as
described elsewhere (Rogge et al. 2000). Data for additional tissues are provided online (table A1 [online only]). To eliminate genomic DNA
amplification, amplification primers (5-GGTTGAGGAAGCTGGAGAAT and 5-GGGAGAAGAACGATCTTGATGTA) were selected from dif-
ferent exons. Each RNA sample was also amplified with seven housekeeping genes, as described elsewhere (Rogge et al. 2000). The level of
expression of these housekeeping genes was used to normalize the amount of message in all samples. The normalized expression levels of
PTPN22 in all normal tissues (excluding tumor cell lines and purified hematopoietic cells) were averaged, and the results from each individual
sample were expressed as a fold change relative to this average. A positive number indicates more PTPN22 message in the indicated sample
relative to the average of all samples, whereas a negative number means there is less PTPN22 message relative to the overall average.
is consistent with recent results in PEP-deficient mice ings by examining numerous tissues and specific PBMC
(Hasegawa et al. 2004). These animals have rather subtle subsets by use of semiquantitative kinetic RT-PCR (fig.
phenotypic alterations in T-cell function, with enhanced 3 and table A1 [online only]). Expression appeared to
activation of Lck and expansion of memory T cells, but be largely confined to hematopoietic tissues and was
apparently normal naive T-cell function. present in all subtypes of normal human PBMCs tested,
The first proline-rich domain (P1) of PEP binds the including resting CD3⫹ T cells, CD4⫹ T cells, CD8⫹
SH3 domain of the negative regulatory kinase Csk T cells, B cells, monocytes, neutrophils, dendritic cells,
(Cloutier and Veillette 1996; Gregorieff et al. 1998). Bot- and natural killer (NK) cells (fig. 3). However, there ap-
tini and colleagues (2004) have recently shown that the pears to be a hierarchy, with NK cells and neutrophils
R620W SNP (which is located in P1) affects the binding expressing the most PTPN22 message and B cells and
of PTPN22 to Csk. We confirmed this finding by co- CD4⫹ T cells expressing the least. These data raise the
transfection of full-length cDNA clones for PTPN22 possibility that the association of PTPN22 with RA
(R620 or W620) and Csk into 293T cells, followed could also be a result of functional changes in these other
by immunoprecipitation of PTPN22. Although both cell types. In particular, monocytosis and monocyte ac-
PTPN22 constructs were expressed at similar levels, 2.5– tivation are characteristic features of RA, and NK and
3-fold less Csk was coimmunoprecipitated by the W620 NK-T cells may also be involved in the pathogenesis of
protein, relative to the R620 protein (fig. 2). These data RA (Kojo et al. 2001; Dalbeth and Callan 2002). As a
suggest that the association of this missense SNP with consequence, a complete analysis of PTPN22 function
RA may be due to the inability of the variant phospha- in these cell populations will be required to fully eluci-
tase to bind Csk and down-regulate T-cell activation. date the role of this protein in autoimmunity.
Prior studies have suggested that PTPN22 is expressed Familial clustering of multiple autoimmune disorders
primarily in hematopoietic tissues (Cohen et al. 1999: in the same family is well documented, and first-degree
Hill et al. 2002; Chien et al. 2003), such as thymus, relatives of RA probands have a significantly higher
spleen, bone marrow, and peripheral blood mononuclear prevalence of type 1 diabetes (T1D [MIM 222100]) than
cells (PBMCs). We confirmed and extended these find- the general population (Lin et al. 1998). In addition,
336 Am. J. Hum. Genet. 75:330–337, 2004
Griffiths MM, Encinas JA, Remmers EF, Kuchroo VK, Wilder MacGregor AJ, Snieder H, Rigby AS, Koskenvuo M, Kaprio
RL (1999) Mapping autoimmunity genes. Curr Opin Im- J, Aho K, Silman AJ (2000) Characterizing the quantitative
munol 11:689–700 genetic contribution to rheumatoid arthritis using data from
Gudbjartsson DF, Jonasson K, Frigge ML, Kong A (2000) Al- twins. Arthritis Rheum 43:30–37
legro, a new computer program for multipoint linkage anal- MacKay K, Eyre S, Myerscough A, Milicic A, Barton A, Laval
ysis. Nat Genet 25:12–13 S, Barrett J, Lee D, White S, John S, Brown MA, Bell J,
Hasegawa K, Martin F, Huang G, Tumas D, Diehl L, Chan Silman A, Ollier W, Wordsworth P, Worthington J (2002)
AC (2004) PEST domain-enriched tyrosine phosphatase Whole-genome linkage analysis of rheumatoid arthritis sus-
(PEP) regulation of effector/memory T cells. Science 303: ceptibility loci in 252 affected sibling pairs in the United
685–689 Kingdom. Arthritis Rheum 46:632–639
Hill RJ, Zozulya S, Lu YL, Ward K, Gishizky M, Jallal B (2002) Marrack P, Kappler J, Kotzin BL (2001) Autoimmune disease:
The lymphoid protein tyrosine phosphatase Lyp interacts why and where it occurs. Nat Med 7:899–905
with the adaptor molecule Grb2 and functions as a negative Rogge L, Bianchi E, Biffi M, Bono E, Chang SY, Alexander
regulator of T-cell activation. Exp Hematol 30:237–244 H, Santini C, Ferrari G, Sinigaglia L, Seiler M, Neeb M,
Iannone MA, Taylor JD, Chen J, Li MS, Rivers P, Slentz-Kesler Mous J, Sinigaglia F, Certa U (2000) Transcript imaging of
KA, Weiner MP (2000) Multiplexed single nucleotide poly- the development of human T helper cells using oligonucle-
morphism genotyping by oligonucleotide ligation and flow otide arrays. Nat Genet 25:96–101
cytometry. Cytometry 39:131–140 Schlesselman JJ (1982) Case-control studies: design, conduct,
Jawaheer D, Li W, Graham RR, Chen W, Damle A, Xiao X, analysis. Oxford University Press, New York
Monteiro J, Khalili H, Lee A, Lundsten R, Begovich A, Bu- Seldin MF, Amos CI, Ward R, Gregersen PK (1999) The ge-
gawan T, Erlich H, Elder JT, Criswell LA, Seldin MF, Amos netics revolution and the assault on rheumatoid arthritis.
CI, Behrens TW, Gregersen PK (2002) Dissecting the genetic Arthritis Rheum 42:1071–1079
complexity of the association between human leukocyte an- Shiozawa S, Hayashi S, Tsukamoto Y, Goko H, Kawasaki H,
tigens and rheumatoid arthritis. Am J Hum Genet 71:585– Wada T, Shimizu K, Yasuda N, Kamatani N, Takasugi K,
594 Tanaka Y, Shiozawa K, Imura S (1998) Identification of the
Jawaheer D, Seldin MF, Amos CI, Chen WV, Shigeta R, Etzel gene loci that predispose to rheumatoid arthritis. Int Im-
C, Damle A, et al (2003) Screening the genome for rheu- munol 10:1891–1895
matoid arthritis susceptibility genes: a replication study and Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki
combined analysis of 512 multicase families. Arthritis M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono
Rheum 48:906–916 M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma
Jawaheer D, Seldin MF, Amos CI, Chen WV, Shigeta R, Mon- S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine
teiro J, Kern M, Criswell LA, Albani S, Nelson JL, Clegg A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto
DO, Pope R, Schroeder HW Jr, Bridges SL Jr, Pisetsky DS, K (2003) Functional haplotypes of PADI4 encoding citrul-
Ward R, Kastner DL, Wilder RL, Pincus T, Callahan LF, linating enzyme peptidylarginine deaminase 4, are associ-
Flemming D, Wener MH, Gregersen PK (2001) A genome- ated with rheumatoid arthritis. Nat Genet 34:395–402
wide screen in multiplex rheumatoid arthritis families sug- Tokuhiro S, Yamada R, Chang X, Suzuki A, Kochi Y, Sawada
gests genetic overlap with other autoimmune diseases. Am T, Suzuki M, Nagasaki M, Ohtsuki M, Ono M, Furukawa
J Hum Genet 68:927–936 H, Nagashima M, Yoshino S, Mabuchi A, Sekine A, Saito
Kojo S, Adachi Y, Keino H, Taniguchi M, Sumida T (2001) S, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K
Dysfunction of T cell receptor AV24AJ18⫹, BV11⫹ double- (2003) An intronic SNP in a RUNX1 binding site of
negative regulatory natural killer T cells in autoimmune dis- SLC22A4 encoding an organic cation transporter is asso-
eases. Arthritis Rheum 44:1127–1138 ciated with rheumatoid arthritis. Nat Genet 35:341–348
Li C, Scott LJ, Boehnke M (2004) Assessing whether an allele Wandstrat A, Wakeland E (2001) The genetics of complex
can account in part for a linkage signal: the Genotype-IBD autoimmune diseases: non-MHC susceptibility genes. Nat
Sharing Test (GIST). Am J Hum Genet 74:418–431 Immunol 2:802–809
Lin JP, Cash JM, Doyle SZ, Peden S, Kanik K, Amos CI, Bale Yang Q, Khoury MJ, Friedman JM, Flanders WD (2003) On
SJ, Wilder RL (1998) Familial clustering of rheumatoid ar- the use of population attributable fraction to determine sam-
thritis with other autoimmune diseases. Hum Genet 103: ple size for case-control studies of gene-environment inter-
475–482 action. Epidemiology 14:161–167