Vous êtes sur la page 1sur 17

EXAMEN

1. Complete el siguiente cuadro de las enzimas involucradas en la replicación del ADN


ENZIMA ACCIÓN
ADN polimerasa III Añade nucleótidos a la molécula de DNA en formación, revisa
y corrige la secuencia
DNA girasa (Topoismerasa II) Promueve el superenrollamiento
Primasa Coloca cebadores/primers
ADN polimerasa I Añade nucleótidos a la molécula de DNA en formación,
remueve cebadores de RNA
Helicasa Rompe los puentes de hidrógeno
Helicasa Promueve la separación de las hebras de DNA
ADN polimerasa III Acción exonculceasa 3´ 5´
Ligasa Une los fragmentos de ADN resultantes en la replicación
Topoismerasa I Mantiene el nivel adecuado de enrollamiento

2. Escriba las características de los componentes de la telomerasa


● Componente ribonucleotídico: se trata de la porción de ARN de la telomerasa que
se encuentra totalmente integrado en la enzima
● Componente proteico: invierte el curso normal de la información (ADN hacia ARN),
trascribiendo el ARN a ADN. Dicha transcripción inversa en los telómeros es la
actividad telomerasa.

Escriba Verdadero o Falso según corresponda justifique su respuesta

a. El envejecimiento es una consecuencia de la pérdida de telómeros con la edad (V)

Cuando una línea celular no tiene una telomerasa activa, los telómeros de los cromosomas se
van acortando de unos 50 a 200 pares de bases en cada división. Si el acortamiento
alcanza un nivel crítico se induce la senescencia de las células de esa línea celular. En
definitiva los telómeros se pueden considerar como estructuras dinámicas que actúan
a modo de reloj celular. Su longitud está en relación con el tiempo de vida

b. En los procariotas prácticamente todo el DNA existe en forma de copia única, la cual
tienen secuencias intergénicas e intragenicas (F)

La mayor parte del genoma de las procariotas está compuesto por secuencias codificantes
(copia única), debido a que contienen

c. Las mutaciones somáticas pueden determinar las características normales o


patológicas del individuo pero los cambios en algunas ocasiones son heredables (F)
Las mutaciones que ocurren en células somáticas no son heredables, si existe una
mutación solo afecta a la célula

Si existe mutaciones germinales estas pasarían de generación en generación

d. La ADN polimerasa hace lectura de la hebra molde en dirección 3´ - 5` (V)


La ADN polimerasa realiza a lectura en dirección 3`---5` para poder realizar la
elongación además de colocar los nucleótidos en sentudo 5`---3`

Complete
● Región del DNA necesaria para que pueda sintetizarse una macromolécula funcional
GEN
● Secuencias altamente repetitivas en tándem entre miles y un millón de veces
agrupadas en región heterocromáticas como los centrómeros y telómeros ADN
SATÉLITE
● Agente del medio externo que modifique la estructura o contenido de ADN AGENTE
MUTÁGENO
● Los RAYOS GAMMA provocan aperturas de los anillos y fragmentación de las bases,
asi como rotura del esqueleto covalente del DNA
● Una glicosilasa reconoce un solo tipo de base emparejada de manera incorrecta e
hidroliza su enlace N-glicosílico, dando lugar a un sitio apurínico, esta enzima actúa en
el mecanismo de reparación ESICIÓN DE BASES
● La maquinaria de reparación determina cuál de las dos bases de un par incorrecto es la
errónea basándose en la METILACIÓN del ADN
● Proteínas que adosan a las hebras molde del ADN para evitar que se vuelvan a enrollar
SSB
CONTESTE LAS SIGUIENTES PREGUNTAS

Los nitritos y nitratos pueden metabolizarse a ácido nitroso el cual acelera la desanimación
oxidativa de la C

a. Qué efectos tiene este tipo de mutágenos sobre el ADN


Se produce un cambio de grupo cuando ocurre una desaminacion oxidativa amino por un
grupo carboxilo alterando así la unión de las bases por alteración de los puentes de hidrogeno,
el caso más común de desaminacion oxidativa es de la citosina cuando produce el cambio por
un uracilo

b. Que mecanismo de reparación utiliza la célula para evitar mutaciones


Reparación por escisión de base

● Una glucosilasa elimina la base, deja la cadena intacta


● La AP endonucleasa corta la cadena, la AP liasa elimina el azúcar
● La DNA polimerasa rellena el hueco
● La DNA ligasa sella la mella

c. Que efectos o qué tipo de mutación se daría en el ADN de no ser reparado el daño

Escoja la respuesta correcta

Cuál de las siguientes afirmaciones en cuanto al cáncer es falsa

a. La diferenciación de las células es una de sus características


b. El equilibrio entre la diferenciación y la proliferación es importante
c. En células de tumor, la división y diferenciación no se acoplan
d. EL CICLO CELULAR ESTÁ fe2DESCONTROLADO Y LAS CÉLULAS SON INMORTALES, LA
TASA DE DIVISIÓN ES BAJA
Los factores de crecimiento estimulan a

a. Síntesis de Cdk para sintetizar las enzimas que dirigen las ciclinas
b. SÍNTESIS DE CICLINAS
c. La célula para saltar a S y G1, de la interfase y mitosis directamente
d. La célula para ignorar los puntos de control del cilclo celular
Es necesaria la existencia de un ARN cebador que

a. La ADN polimerasa solo sintetiza en sentido 5´3´


b. La duplicación del DNA es semiconservativa
c. La ADN polimerasa sólo puede añadir desoxiribonucleótido y no unir dos
desoxiribonucleótidos
d. LA PRIMASA ACTIVA A LA DNA POLIMERASA
La enzima que se encarga de aliviar la tensión que existe en las horquillas de replicación es

a. TOPOSIOMERASA
b. Ligasa
c. SSB
d. Exonucleasa
La función de las caspasas es

a. Volver a formar puentes de hidrógeno en el ADN


b. SER LAS ULTIMAS RESPONSABLES DE LA APOPTOSIS
c. Corregir las mutaciones que se producen en el ADN
d. Intervenir en el plegamiento correcto de las proteínas
Un cáncer puede desarollarse debido a

a. Una mutación en protooncogones


b. Una mutación en los genes supresores de tumores
c. Un error en la duplicación del DNA
d. TODAS LAS ANTERIORES
Sus células epiteliales y musculares son diferentes porque cada célula

a. Contiene diferente clases de genes


b. EXPRESA DIFERENTES GENES
c. Contiene diferente número de genes
d. Ha sufrido diferentes mutaciones
Cuál de los siguientes mecanismos de regulación génica es común en procariotas y
eucariotas

a. El grado de condensación del ADN


b. LA ACCIÓN DE PORTEINAS ACTIVADORAS Y REPRESOARAS DE GENES
c. La adición de de la cap y la cola poli A en el ARNm
d. El sistema operón lac y triptófano

El sitio de unión de la ARN pol al molde de ADN se denomina

a. Regulador
b. Codificador
c. Operador
d. PROMOTOR
Cuál de los siguientes elementos participa tanto en la transcripción procariota como
eucariota
a. Factores de transcripción basales
b. ADN MOLDE
c. ARN pol II
d. Factores de transcripción específicos
Cuál de las siguientes enzimas participan en la activación de aminoácidos

a. Peptidasa señal
b. Petidil transferasa
c. AMINOCIL ARNT SINTETASA
d. ARN polimerasas
Cuál de las siguientes interacciones determina donde finaliza la traducción de un mensaje

a. ARNt y aminoácido
b. Codón stop y anticodón
c. CODÓN STOP Y FACTOR PROTEÍCO
d. Subunidad menor y ARNm
La energía necesaria para que se produzca la unión peptídica proviene de

a. Una molécula de GTP


b. La unión del aminoácido con el ARNr
c. LA UNIÓN DEL AMINOÁCIDO CON EL ARNT
d. La unión de ARNt con el ARNr
El código genético es

a. Degenerado, ambiguo y solapado


b. No degenerado, no ambiguo, no solapado
c. DEGENERADO, NO AMBIGUO, NO SOLAPADO
d. Degenerado, ambiguo y no solapado
Cuál de las siguientes secuencias establece un orden decreciente de estructuras

a. Gen-cromosoma-nucleótido-codón
b. CROMOSOMA-GEN-CODÓN-NUCLEÓTIDO
c. Nucleótido-cromosoma-gen-codón
d. Gen-cromosoma-codón-nucleótido
Secuencia de ADN dispersa de aproximadamente 300 pb encontada en el genoma de
primates que es cortada por la enzima Alu I, pertenece a los:

a. LINE
b. SINE
c. Mircosatélites
d. Transposones

Segmento de ADN entre regiones codificantes de un gen, que no están representados en el


polipéptido codificado por el gen

a. Exón
b. INTRÓN
c. Secuencia intergénica
d. Promotor
Complete

En un cromosoma bacteriano, grupo de genes contiguos que se transcriben en una sola


molécula de ARNm OPERON

Sitio del ribosoma al que ingresan el complejo amnoacil ARNt cuyo aminoácido está a punto
de ser agragado a la cadena polipéptidica en crecimiento SITIO AMINOACIDICO
Corta región del ADN de un cromosoma bacteriano que controla la transcripción de genes
adyacentes OPERADOR

Enzima formada por un un complejo proteína-ácido ribonucleico con actividad adn polimerasa
dependiente de ARN que está presente en células de línea germinal, en tejidos fetales y en
ciertas células madre poco diferenciadas y que permite el alargamiento de los telómeros
TELOMERASA

Por qué la Tm está relacionada con la composición de bases

La temperatura de fusión es la temperatura a la que se ha desnaturalizado la mitad del ADN,


al aumentar la densidad del ADN aumenta el contenido de G+C

Una de las lesiones espontáneas más comunes del ADN en condiciones fisiológicas en la
hidrolisis del grupo amino de las citosinas, convirtiéndolas en uracilos ¿Cuál será el efecto
sobre la estrucutra del ADN si un grupo uracilo reemplaza una citocina?

Es un tipo de mutacion sustitución por desaminación oxidativa que consiste en la pérdida de


un grupo aminoexociclico con aparición de un grupo carbonilo, dando lugar a que se altere los
puentes de hidrogeno en las bases.

La reparación puede darse por escisión de bases

● Una glucosilasa elimina la base, deja la cadena intacta


● La AP endonucleasa corta la cadena, la AP liasa elimina el azúcar
● La DNA polimerasa rellena el hueco
● La DNA ligasa sella la mella
Muchos de los productos génicos que participan en la síntesis de ADN se caracterizaron
inicalmente investigando con cepas de mutantes de E.coli que no podían sintetizar ADN, el
gen dnaE codifica la subunidad o de la ADN polimerasa III que efectos espera si hay mutación
en ese gen.

La ADNa-poli alfa posee dos actividades enzimáticas independientes la polimerasa y primasa,


gracias a su actividad se encarga de formar un ARN cebador necesario para empezar iniciar la
replicación y por su actividad polimerasa de la elongación inicial de este cebador.

La ADNpol III es encargada de la elongación de la ADN 5´--3´durante la cual también se realiza


la correccio ) actividad exonucleasa 3´--5´)

En 1994 se descubrió la actividad de la telomerasa en la línea de células cancerígenas


humanas, si bien la telomerasa no se encuentra activa en los tejidos somáticos humanos,
este descubrimiento indicó que los humanos tenemos los genes para la proteína y el ARN de
la telomerasa. Dado que la activación inadecuado de la telomerasa puede provocar cáncer.
Porque cree que se han mantenido en el genoma humano los genes que codifican esta
enzima a lo largo de la evolución.

En ausencia de telomerasa, las células se van cortando – enevenciendo sufre un proceso


constante de acortamiento de los telómeros, se ha considerado este acortamiento como parte
de un reloj biológico o celular que mide el proceso de envejecimiento.

La telomerasa presente en casi todas las células que proliferan en especial las células
tumorales.

El aumento de la actividad telomerasa en fases tadrias del proceso tumoral puede ser
necesario para el crecimiento del tumor, al impedir la muerte celular.
Se ha propuesto la inhibición de la actividad telomerasa, como un principio de terapia anti
tumoral

Exámen Génetica Primer Parcial Cris

1. Si la guanina sufre desaminación, se convierte en:


a) Adenina
b) Hipoxantina
c) Xantina
d) Uracilo
e) Citosina

2. La actividad 5´-3´ exonucleasa de la DNA en polimerasa l de E. coli está implicada en:


a) Corrección de pruebas
b) Retirada de cebadores de RNA
c) Sellado de mellas
d) Formación de los Fragmentos de Okasaki
3. De las siguientes afirmaciones, cuál es la correcta: El genoma:
a) Presenta grandes cantidades de secuencias no codificantes
b) El tamaño está en relación con su complejidad
c) Las secuencias codificantes representan la mayor parte del genoma
d) Las secuencias SINE son secuencias codificantes
4. La región especializada del cromosoma cuyo papel es asegurar la correcta distribución
de los cromosomas es:
a) Telómero
b) Centrómero
c) Huso
d) Cromatina
5. La telomerasa es una:
a) Enzima que acorta las secuencia teloméricas
b) Transcriptasa inversa que codifica ARN
c) Enzima que posee su propio ARN
d) Polimerasa dependiente de ADN
6. Si el gen que codifica para la ADN polimerasa l en procariotas es mutada, se esperaría
que:
a) La cadena de ADN no se desarrolle.
b) Los cebadores de ARN no se sinteticen.
c) La cadena retardada no pueda eliminar cebadores.
d) Los puentes de hidrógeno se rompan.

7. Las roturas de doble hebra son reparadas mediante la reparación:


a) SOS
b) Recombinatoria
c) Escisión de bases
d) Escisión de nucleótidos
COMPLETE

8. En una célula EUCARIOTA el ADN está altamente COMPACTADO en torno a las


proteínas HISTÓNICAS.
9. Un GEN es un segmento de ADN que se expresa para dar un producto funcional que
puede ser un polipéptido de o un ARN.
10. Las DNA POLIMERAZAS sintetizan ADN exclusivamente en sentido 5´3´ mediante la
adicción de Dntp a la hebra cebadora de ADN
11. Los GENES ACALLADOS han sido INACTIVADOS por mutaciones y ya no representan
genes funcionales
12. En E. coli la enzima central de la recombinación homóloga es RecA RECOMBINASA,
que cataliza el intercambio de hebras entre los ADN homólogos.
13. La RECOMBINACIÓN HOMÓLOGA da lugar a la reorganización de genes entre pares de
cromosomas sin alterar la disposición de los genes en el genoma.
14. La estructura que constituye la unidad fundamental y esencial de la cromatina forma
por un núcleo proteico constituido por un octámero de histonas es: NUCLEOSOMA
15. Las TOPOISOMERAZAS catalizan la rotura reversible y la unión de hebras de ADN en el
inicio la replicación.
16. El PARADIGMA DEL VALOR C indica el hecho que de que el tamaño del genoma es
prácticamente constante dentro de una especie
17. La DESPURINACION se produce por la rotura del enlace entre las bases de purina y la
desoxirribosa
18. La siguiente imagen corresponde a una: DESAMINACIÓN

19. Los DÍMEROS DE PIRIMIDINA se provocan por la exposición a las luz ultravioleta en
donde los residuos de guanina alquilada que se han modificado por la adición de
grupos metilos y etilos en la posición 06 del anillo de purina
20. La metilación de la guanina y a unión errónea con la timina puede ser reparada por la
REPARACIÓN DIRECTA (No intervienen nucleasas ni ADN-polimerasas)
21. La proteína XPC está involucrada en la reparación mediante escisión de NUCLEÓTIDOS
en los EUCARIOTAS y se encarga del RECONOCIMIENTO.
22. En E.coli la proteína MUTS reconoce la no complementariedad y forma un complejo
con MutL Y MutH
23. BRCA2 codifica una proteína que participa en la reparación de CADENAS HOMÓLOGAS
mediante la recombinación homóloga
24. Trastorno asociado al sistema de reparación por escisión de nucleótidos XERODERMIA
PIGMENTOSA

ESCRIBA V O F SEGÚN CORRESPONDA, JUSTIFIQUE SU RESPUESTA EN EL ESPACIO ASIGNADO


(NO UTILICE MÁS).

25. En el reconocimiento entre la cadena nueva y la madre, la cadena hija permanece sin
metilar en las secuencias GATC varios minutos después de su síntesis. (VERDADERO)

La cadena hija no metila estas secuencias GATC para que se dé un reconocimiento adecuado,
en este caso la cadena madre sería la que se metila.

26. El mal funcionamiento del sistema de reparación de desapareamientos post-


replicativo MMR) predispone al CÁNCER DE COLÓN. (VERDADERO)

Este mal funcionamiento se da por defectos en los genes h-MSH2 o h-MSLH, que son los
responsables de la reparación de emparejamientos incorrectos.
27. Cuando el ADN pol de replicación encuentra una lesión de, dímero de timina o un
sitio AP, que no ha sido reparada, actúa un mecanismo de seguridad que permite
que la maquinaria de replicación se salte “by-pass” estos sitios de lesión, haciendo
que la replicación sea muy confiable no permita errores. (VERDADERO)

Se da la síntesis de translesión, sistema que es muy propenso a cometer errores, pero evita
que un cromosoma se replique de manera incompleta

El cáncer puede definirse como una proliferación anormal de células que desafía los
controles reguladores normales existentes en las células no afectada, recientemente se han
intentado usar terapias de desacetilación histónica en el tratamiento de ciertos cánceres
Específicamente FDA ha probado inhibidores de desacetiliacion hitsonica (HDAC) para el
tratamiento de linfoma de células T cutáneo

a. Explique porque la acetilación histónica podría estar asociada con el cáncer


Existen enzimas en las células que unen grupos acetilo a ciertos reciduos de lisina de las
histonas, varias de estas histonas acetil transferasa son factores de transcripción asi mismo
existen histonas desacetilasas que catalizan la reacción opuesta de eliminación del grupo
acetilo.

Las histonas pierden cargas positivas como consecuencia la cromatina se descondensa


fácilmente.

El alto grado de acetilación la cromatina es menos condensada y es transcripcionalmente


activa, por ende, los genes activos se van a expresar.

b. Cuál es la razón para el uso de inhibidores HDAC en el tratamiento de ciertas formas


de cáncer
Porque HDAC (carente de grupos acetilo), la estructura de la cromatina es mucho más
compacta lo que impide que entre en la maquinaria transcripcional y por lo tanto anula la
expresión de dichos genes.

La mamografía es una técnica muy precisa para la detección del cáncer de mama en los seres
humanos. Puesto que esta técnica utiliza rayos X con fines diagnósticos, ha causado una gran
controversia explique porque?

Los rayos X es un agente mutágeno físico el cual provoca la rotura de las cadenas de ADN,
puede causar sustituciones o microdelesionces.

Pueden provocar apertura de los anillos fragmentación de las bases así como la rotura del
esqueleto covalente.

EXAMENES DE GÉNETICA

Complete los siguientes enunciados.

a. Los VIROIDES son virus extremadamente simples constituidos por ARN circular de muy
bajo peso molecular, sin cápside protectora y producen enfermedades hasta el
momento exclusivamente en plantas.

b. En los organismos procariotes, algunos PLASMIDOS poseen uno o más Tn que portan
determinantes de RESISTENCIA a antibióticos.

c. Los genes que codifican para los RNA ribosómicos son un ejemplo de: FAMILIAS
GÉNICAS CLÁSICAS (DNA REPETITIVO CODIFICANTE AGRUPADO)

d. Los GENES TRUNCADOS son copias incompletas de un gen, por pérdida de una región
situada en uno de los extremos (5´-3´).
e. El ADN SATÉLITE se encuentra en regiones HETEROCROMÁTICAS, principalmente en
torno al centrómero y los TELÓMEROS, se ha sugerido que cumplen un rol en el
control del ENVEJECIMIENTO celular.

f. La TRANSPOSICIÓN es el proceso mediante el cual las secuencias se copian y se


insertan en un nuevo muy sitio del genoma.

g. Los elementos móviles que transponen a través de un intermediario de DNA se


denominan TRANSPOSONES DE DNA.

h. Los elementos Alu contienen un sitio de reconocimiento para la enzima de restricción


ALU l y son secuencias ricas en GUANINA Y CITOSINA.

i. Una FOSFORILACIÓN de la proteína Rb, provoca la activación de E2F un FACTOR DE


TRANSCRIPCION, provocando el paso de la célula de G1 a S.

j. La proteína p53 funcional presenta tres dominios, la mayor cantidad de mutaciones se


han presentado en el dominio: DOMINIO CENTRAL, estas mutaciones pueden
ocasionar una inactivación del gen provocando TUMORES.

k. La desaminación de la citocina produce un URACILO, este error en cadena de ADN


debe ser reparado mediante el mecanismo ESCISIÓN DE BASES, en donde interviene la
GLUCOSILASA que conduce a la formación de un sitio AP, si no se corrige el daño
conlleva a una mutación permanente la TRANSCRIPCION.

l. La radiación UV produce dímeros de timina, une de forma COVALENTE dos residuos de


timina ADYACENTES en una hebra de DNA formando un CICLOBUTANO, este daño es
reparado en procariotes por una enzima llamada ESCINUCLEASA y en eucariotes por
ENDONUCLEASA.

m. Los rayos gama provocan ROTURAS de doble hebra del ADN, este daño puede ser
reparado por UNION DE EXTREMOS HOMOLOGOS lo que podría provocar APERTURA
DE ANILLOS o por FRACMENTACION DE LAS BASES en donde no existen errores.

A. ESCOJA LA RESPUESTA CORRECTA.


1. Los codones de terminación (UAG, UGA y UAA):
a) Poseen uracilo, y por ello se atasca el ribosoma.
b) SI Son reconocidos por factores de terminación de la traducción.
c) Se unen a ARNt sin sentido.
d) Se unen a ARNt que no van cargados con ningún aminoácido.
2. Qué es un marco de lectura abierto (ORF)?
a. Todos los nucleótidos de un gen que son transcritos a mRNA
b. Los nucleótidos de un gen que forman codones que especifican aminoácidos.
c. Los nucleótidos de una molécula de mRNA antes de la eliminación de intrones
d. La secuencias de aminoácidos de un polipéptido.

3. Un nucleosoma:
a. ES UNA ESTRUCTURA REGULARMENTE REPETIDA DE DNA E HISTONAS
b. Tiene un núcleo de DNA con poteínas que lo envuelven
c. Utiliza un solo tipo de histona por nucleosoma
d. Está separado de un segundo nucleosoma por proteínas no histónicas

4. Un enfoque en el tratamiento del cáncer consiste en el uso de compuestos que


inhiben a las topoisomerasas. Las topoisomerasas:
a. SIEMPRE ROMPEN ÚNICAMENTE UNA HEBRA DE ADN.
b. Pueden crear pero no elimina el superenrollamiento.
c. Necesitan ATP
d. La subclase de las girasas introduce superhélices negativas en el DNA eucariótico.

5. La actividad tumoral se presenta cuando:


a. Aumenta la expresión de P53.
b. Disminuye la expresión de oncogenes.
c. Existe mayor actividad telomerasa.
d. DISMINUYE LA EXPRESIÓN DE CICLINAS.

6. Regiones del genoma originadas a partir de un gen funcional, con el que presentan
un alto grado de homología, pero funcionalmente inertes y aparentemente fijas en la
población.
a. Intrones
b. EXONES
c. Pseudogen
d. Transposones

7. Las radiaciones ultravioleta producen mutaciones porque


a) rompen una de las hebras de la molécula del DNA
b) MODIFICAN QUÍMICAMENTE LAS BASES Y PRODUCEN DÍMEROS DE TIMINA
c) eliminan bases de la estructura del DNA
d) producen entrecruzamientos entre las hebras del DNA

8. Durante la reparación del DNA, los mecanismos de alquilación


a) reparan directamente las lesiones
b) ESTÁN ASOCIADOS AL ENZIMA METILTRANSFERASA
c) requieren la ruptura de un fragmento del DNA
d) utilizan la energía de la luz visible

9. Las fotoliasas
a) son exclusivas de plantas
b) suelen tener más de dos cromóforos
c) UTILIZAN LA LUZ ULTRAVIOLETA PARA REPARAR EL DNA

10. Se llama lugar AP


a) a una zona característica del ribosoma
b) a un lugar en la proteína donde falta un aminoácido
c) al lugar donde la RNA-polimerasa se une a su promotor
d) A UN LUGAR EN EL DNA DONDE FALTA UNA BASE NITROGENADA

11. Durante la respuesta S. O. S. de reparación del DNA


a) la proteína RecA es proteolizada por la proteína LexA
b) se corrigen de forma inmediata la gran mayoría de las lesiones del DNA
c) SE ACTIVAN SISTEMAS DE REPLICACIÓN QUE COMETEN NUMEROSOS ERRORES
d) aumenta la concentración de la proteína RecA

12. El sistema que localiza apareamientos defectuosas puede identificar cuál de las dos
hebras es la progenitora, en función de
a) el contenido en G+C de cada hebra
b) EL GRADO DE METILACIÓN DE CADA HEBRA
c) la longitud de cada hebra
d) la temperatura de fusión de cada hebra

13. Indica cuál será la secuencia del RNA que resulte de la transcripción de una región de
DNA cuya secuencia (en la hebra molde) es:
5’GGCATTTCGAACACGTACAC3´

a) 5´GGCAUUUCGAACACGUACAC3´
b) 3´CACAUGCACAAGCUUUACGG5´
c) 5´CCGUAAAGCUUGUGCAUGUG3´
d) 5’GUGUACGUGUUCGAAAUGCC3´
e) 3´GTGTACGTGTTCGAAATGCC5´
14. Los factores de transcripción del tipo TFIID...
a) Determinan el punto de inicio de la replicación.
b) Son proteínas que reconocen específicamente la secuencia TATA.
c) Están constituidos por un octámero de histonas.
d) Se conocen también como secuencias promotoras de la clase II.

15. La guanosilación ocurre en dos reacciones; es necesaria para las metilaciones que
conducen a la:
a) Poliadenilación
b) FORMACIÓN DE LA CAPERUZA O CASQUETE 5'
c) Formación del spliceosoma
d) Transesterificación

16. Un aminoácido degenerado es:


a. Metionina
b. Está codificado por un codón
c. ES CODIFICADO POR SEIS CODONES

17. De acuerdo con el concepto de degeneración del código, se llaman codones


sinónimos...
a) Aquéllos que codifican un único aminoácido.
b) AQUELLOS CODONES DIFERENTES QUE CODIFICAN EL MISMO AMINOÁCIDO.
c) Aquellos codones que codifican varios aminoácidos distintos.
d) Aquéllos que no codifican aminoácido alguno.

18. La activación de los aminoácidos ocurre en la fase previa al inicio de la síntesis


proteica...
a) Al unirse el aminoácido al AMP, en la reacción catalizada por la aminoacil-tRNA-
sintetasa.
b) AL UNIRSE EL AMINOÁCIDO AL TRNA, EN LA REACCIÓN CATALIZADA POR LA
AMINOACIL-TRNA-SINTETASA.
c) Al incorporarse el aminoacil-tRNA a su codón correspondiente en el mRNA.
d) Al unirse cada aminoácido entre sí mediante enlace peptídico.

B. ESCRIBA VERDADERO (v) O FALSO (f), JUSTIFIQUE SU RESPUESTA.

19. Una diferencia entre la DNA y RNA polimerasa es que la DNA polimerasa utiliza un
cebador, mientras que la RNA-polimerasa no lo requiere, la reacción de
polimerización es idéntica: nucleósidos-5'-trifosfato, con sus bases apareadas a las
de la hebra molde de DNA, ataque nucleofílico del OH 3' del extremo 3' de la cadena
en crecimiento sobre el fosfato alfa del NTP entrante. (V)

La ADN polimerasa es la principal enzima de la replicación. Partiendo de una cadena inicial o


“primer” la ADN polimerasa añade nucleótidos complementarios a la cadena molde
extendiendo la nueva cadena de ADN en dirección 5’- 3’.
La ARN polimerasa es la enzima encargada de la transcripción. Realiza una copia de ADN a
ARN, de ahí que sea dependiente de ADN. Esta copia se hace nucleótido a nucleótido por
complementariedad.
20. La hebra molde de un DNA sufre el proceso de la transcripción para dar un transcrito
de RNA. Por ello, dicha hebra recibe también el nombre de cadena no-codificante,
no-informativa, antisentido o cadena (V).
Hebra o cadena de DNA complementaria al RNA mensajero, que resultará de la transcripción.
También se denomina cadena no codificante o cadena molde.

21. Todos los promotores utilizados por las RNApol-I, RNApol-II y RNApol-III en la
transcripción de eucariotas, son idénticos y están situados en la misma posición de la
hebra molde de DNA. ( F)
Cada una de los RNA cumple una función específica

ARN polimerasa I: síntesis, reparación y revisión. Sintetiza precursores de ARN ribosómico.

ARN polimerasa II: reparación, Sintetiza precursores de ARN mensajero, microARNs y otros
tipos de ácido ribonucleico.

ARN polimerasa III: sintetiza ARN de transferencia, ARN ribosómico de 5S y otros pequeños
ARN (ARNpequeños) encontrados en el núcleo celular (ARNp nucleares) y en el citoplasma
(ARNp citoplasmáticos).

22. La regulación epigenética está relacionada con cambios en la secuencia del DNA,
concretamente, lo más común es la regulación mediante metilación de algunas bases
del DNA( V )
El mecanismo epigenético es un sistema complejo para utilizar
selectivamente la información genética, activando y desactivando diversos
genes funcionales. Las modificaciones epigenéticas pueden implicar la
metilación de residuos de citosina en el ADN y/o cambios en la estructura
de la cromatina que regulan la expresión génica.

La secuencia de Kozak (en el mRNA de eucariotas) actúa como señal iniciadora de


traducción. Se aparea por tres de sus nucleótidos con el anticodón del primer aminoacil-
tRNA (Met-tRNA), en presencia de eIF-2 y GTP. (F)

La secuencia de Kozak es una secuencia de ARNm que facilita el reconocimiento de la


secuencia de iniciación (AUG) durante el proceso de traducción los eucariontes.

¿Qué secuencias tiene el RNA que indican donde comienza la traducción?

La Shine-Dalgarno (en procariotas)

Kozak (en eucariotas

23. La paradoja del valor C en Eucariotes se refiere A la falta de correspondencia entre


los valores C y la cantidad presumible de información genética contenida dentro de
los genomas (V )
La paradoja del valor C surge cuando se compara la cantidad de ADN o tamaño del genoma
con las funciones para las que lleva la información.

24. El ADN mitocondrial posee el 1% de regiones intergénicas e intrónicas ( V)


El ADN mitocondrial sólo posee un 3% de secuencias no codificantes

25. Los pseudogenes se encuentran activos en el genoma actual y cumplen una función
específica ( F)
Estos pseudogenes son copias inactivas que no van a expresarse y si lo hacen no son
funcionales.

26. Los elementos LINE no contienen marcos de lectura abiertos largos (ORF) ( F)
Los elementos LINE poseen dos tipos de marcos de lectura ORF, ORF1 que sirve de unión
de la proteína con RNA , ORF2 Regiones con transcriptasa inversa.
27. Los genes inductores de la apoptosis celular son transcripcionalmente regulados por
p53 (V)
Debido a que p53 es un factor de transcripción conocido como el guardián del genoma ya
que regula el ciclo celular y induce apoptosis.

B. COMPLETE
28. Los telómeros son secuencias ESPECIALIZADAS ricos en guanina en los extremos de los
cromosomas lineales, se acortan progresivamente con cada ciclo de división celular
hasta alcanzar una longitud crítica que desencadena la INESTABILIDAD E INTEGRIDAD
DEL CROMOSOMA

29. Los potenciadores, activadores, o intensificadores (enhancers), son elementos


PROMOTORES, regulan la expresión del gen dependiendo del tipo celular, señales de
otras células o del entorno, etc.

30. La región estructural de un gen eucariótico contiene 3 tipos de secuencias: (a)


secuencias internas no codificantes (llamadas). INTRONES (b) secuencias internas
codificantes (llamadas ) EXONES .

31. La activación de un aminoácido consiste en la unión del aminoácido con su tRNA


específico, para dar el aminoacil-tRNA. Esta unión tiene lugar entre el grupo COOH del
aminoácido y el grupo N-metionina terminal del tRNA. La reacción está catalizada por
aminoacil-tRNA-sintetasa específicas

32. El mRNA _EN LA SÍNTESIS DE PROTEÍNAS se traduce generando varios polipéptidos, es


característico de los procariotas. El mRNA _en la TRANSCRIPCIÓN sólo da lugar a un
polipéptido.

C. CONTESTE LAS SIGUIENTES PREGUNTAS.

33. Indica, concretamente, la composición en subunidades de las RNA polimerasas de


procariotas y eucariotas.
Las subunidades αα se une a con proteínas y secuencias reguladoras
Las subunidades β y β’ son las responsables de la formación del enlace fosfodiéster
y unión al ADN.
Las subnidadades ααββ’forman el núcleo que se caracteriza por ser la unión al ADN
inespecífica y de alta afinidad es la que lleva a cabo el proceso de polimerización en
sí.
La subunidad σ, que es la responsable del reconocimiento de las regiones
promotoras, y debe disociarse del núcleo del enzima para que este lleve a cabo el
proceso de polimerización.

34. Dentro de la secuencia de transmisión de la información génica (DNA -> RNA ->
proteína), ¿en qué punto tiene lugar con mayor frecuencia la regulación de la
expresión génica en eucariotes?
El control del acceso que tienen las ARN polimerasas al ADN para que las enzimas
encargadas de la transcripción puedan realizar su función sobre unos genes, es necesario
que la cromatina esté descondensada y los promotores de estos genes no se encuentren
embebidos en una superestructura cromatínica.
35. Explica la diferencia entre genes constitutivos y genes de expresión diferencial o
regulada.
Genes constitutivos siempre permanecen activos, independientemente de las condiciones del
medio

Genes regulados cuya actividad está controlada en respuesta a las necesidad de una célula u
organismo

En una especie se ha encontrado una deleción de la Adenina en el centro de ramificación de un


intrón de un gen

36. En una especie se ha encontrado una deleción de la Adenina en el centro de


ramificación de un intrón de un gen, qué efecto tiene esta mutación.

En los intrones hay unas secuencias consenso responsables de la correcta maduración


del ARN mensajero. Si el cambio de nucleótido afecta a estas secuencias se podía dar un
proceso de corte y empalme (splicing) de los exones incorrecto y por lo tanto el ARN
mensajero maduro no ser funcional.

El xenoderma pigmentosa es una enfermedad causada por el sistema de reparación por


escisión de nucleótidos se encuentra afectado, provocando en los individuos fotosencibilidad
dérmica y ocular.

a. Que múgatenos pueden estar causando daños al ADN


Los mutágenos físicos: rayos UV por exposición prolongada al sol

b. Que daños se producen

Formación de los dímeros de timina; dos timinas adyacentes (en una misma cadena de
ADN) se sueldan covalentemente, determinando problemas muy serios en el
proceso de replicación del ADN

c. Como se afecta la célula al tener afectado este mecanismo

En la célula se ve afectado varios complejos enzimáticos (fotoliasas y su cofactor FADH2) se


hallan implicados en la reparación. El complejo enzimático absorbe la luz y utiliza
esta energía para romper en enlace que une el dímero, separando las dos timinas.
La enfermedad es consecuencia de la mutación de cualquiera de los siete genes
implicados en la reparación.

37. La bleomicina es utilizada en quimioterapia provocando roturas de doble hebra en el


ADN, que pretende la farmacocinética con este medicamento, que le ocurre a la
célula.
La bleomicina se absorbe pobremente a través del tracto gastrointestinal y debe administrarse
por vía parenteral. Después de la administración intravenosa, el fármaco se distribuye a los
espacios intracelulares y extracelulares en 10-20 minutos. Después de la administración
intramuscular, las concentraciones máximas son sólo una décima parte de los que se producen
después de la administración IV.

Las células son más susceptibles a la bleomicina en la fase G2 o fase M del ciclo celular.
Aunque la toxicidad es mayor en la fase G2, no está claro si la bleomicina tiene actividad
preferencial para las células en división rápida (es decir, de forma logarítmica) o para de
células que no se dividen.

RELEXIONE LAS SIGUIENTES PREGUNTAS


En la leucemia crónica mieloide, una translocación cromosomal en particular (llamado el
cromosoma Philadelfia) ha sido identificada que crea una quinasa nueva que se encuentra
“encendida” todo el tiempo. Los procesos que esta quinasa controla permanecen,
efectivamente siempre activos. Esto resulta en la proliferación de células cancerosas.

Explique cuál es la función de la quinasa y como afecta esta mutación en el ciclo celular.
Su principal función es como transductor de señales y esto lo hace modificando otras
proteínas (sustratos) que generalmente son quinasas, mediante la fosforilación.

La ciclina B/CDK1 controla el paso de la fase G2 a la fase M 20. Cuando la célula entra en fase
G2, se sintetiza ciclina B y se une a CDK1, formándose el complejo ciclina B/CDKI, cuya
actividad es indispensable para que las células pasen a la fase M. Este complejo se activa por
fosforilización y la cinasa activa fosforila a varias proteínas involucradas en: mitosis, replicación
del DNA, despolimerización de la lámina nuclear, formación del huso mitótico

EXAMEN PRIMER PARCIAL

A: COMPLETE

38. En las células eucariontes, una región dada de ADN con sus proteínas asociadas recibe
el nombre de CROMOSOMA
39. Las células procariotas con frecuencia portan un DNA circular independiente pequeño
llamado PLÁSMIDO
40. Una secuencia nucleótida similar a un gen normal pero que no da como resultado un
producto funcional, es decir, que no se expresa se conoce como PSEUDOGEN
41. El mecanismo por el cual una molécula es marcada para ser degradada se conoce
como APOPTOSIS, como por ejemplo lo que sucede con la proteína p53.
B: ESCRIBA VERDADERO (V) O FALSO (F).

42. En las células procariotas tienen una sola copia completa de su cromosoma
condensada en una estructura denominada nucleotide (V)
43. Las secuencias reguladoras son regiones de ADN necesarias para dirigir y regular la
trascripción y estas contribuyen al aumento de secuencias intergénicas (V)
la presencia de las regiones intergénicas intergénicas constituyen, en realidad, genes que se
transcriben para la expresión de genes, lo cual indica que éstas contienen las señales
necesarias para la transcripción

C: ESCOJA LA RESPUESTA CORRECTA

44. Movimiento en donde una secuencia (elemento) se cambia a una posición nueva en
el genoma con frecuencia dejando tras la copia original.
a. Recombinación
b. TRASNPOSICION
c. Transcripción
d. Transcripción
45. El fármaco antiviral Aciclovir (su estructura se muestra a continuación) se utiliza para
tratar infecciones causadas por virus de ADN bicatenario. El Aciclovir actua a nivel de
la síntesis del ADN porque:

a. Genera roturas de doble hebra


b. Es análogo de bases y se inserta
en lugar de la guanina
c. Es análogo de bases y se inserta
en lugar de la citosina
d. Genera roturas de una hebra

46. Se ha encontrado mutaciones asociadas a una enfermedad congénita en el ADN que


codifica para el componente de ARN de la telomerasa.
Los defectos del componente de ARN de la telomerasa provoca:
a. Envejecimiento prematuro
b. PROLIFERACIÓN CELULAR
c. Acallamiento de genes
d. Activación de pseudogenes

47. la DNA polimerasa inserta por error una C frene a una T durante la duplicación. Ante
la suposición d la lectura de prueba y síntesis de reparación de los apareamientos
incorrectos como corrigen el mal apareamiento, la mutación resultante es:
a. Transición
b. TRANSVERSIÓN
c. Delecion
d. Inserción
D: COMPLETE LOS SIGUIENTES CUADROS

48. Indique en el siguiente cuadro las características de las ADN polimerasas procariotas

Actividad/función ADN Pol I ADN Pol II ADN Pol III

Polimerasa 5' → 3' / Elongación Si Si si

Exonucleasa 3' → 5' / Corrección Si si Si

Exonucleasa 5' → 3' / Reparación Si no no

49. Enumere los pasos generales de los mecanismos de reparación del ADN
● Reconocimiento de la secuencia del ADN dañado (dado por el ADN glicolasa)
● Corte del ADN dañado (por ADN endonucleasa )
● Eliminación del fragmento dañado (lo realiza el ADN liasa)
● Replicación (lo realiza el ADN polimerasa)
● Ligación de la mella se cierra (este proceso lo realiza la ADN ligasa)

50. Dado un mutante con perdida funcional para dam (el gen que codifica la Dam
metiltransferasa) en E.coli, pronostique el fenotipo que se observaría con respecto a
la mutagenesis espontanea, con respecto a la identificación de la cadena antigua.

Al tener el gen DAM con pérdida de función lo que va a provocar es que no puedan reconocer
la cadena antigua metilada y por ende las endonucleasas como la metilasa no
reconozcan y no corten la secuencia específica provocando que la E.coli no obtenga
un sistema inmunológico para protegerse de infecciones por bacteriófagos.

51. Pronostique las consecuencias inmediatas para una célula en la que el sistema de
reparación por escisión de nucleótido acoplada a la transcripción dejo de funcionar
en forma adecuada.
● Dímeros de pirimidina
● Modificaciones químicas con carcinógenos: benzopireno, aflatoxina y con agentes
quimioterápicos como cisplatino
● Bases desapareadas y pequeños lazos del DNA

52. Mencione la característica principal en el ciclo de recombinación que distingue los


transposones de ADN de los retrotransposones.
● Transposones Procariotas: formación de elementos de resistencia múltiple a
antibióticos.
● Retrotransposones Eucariotas: usos de las transcriptasa inversa
https://wikisanidad.wikispaces.com/oncologia+2016

http://genomasur.com/lecturas/Guia11.htm

http://www.altillo.com/examenes/uba/cbc/biologia/biolog2005p2preg.asp

http://www.iespando.com/web/departamentos/biogeo/web/departamento/2BCH/B4_INFOR
MACION/T404_TRAS_TRADU/EJERCICiOS_sol.htm