Académique Documents
Professionnel Documents
Culture Documents
Gary R. Skuse
Maureen C. Ferran Editors
Cardio-
myocytes
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Cover Illustration: CytivaTM Plus Cardiomyocytes: The deconvolved Image was acquired on DeltaVision OMX by
Angela Williams (GE Healthcare). After 14 days of growth the cells were stained for cardiac Troponin I (Red) and
a-Actinin (Green)
Heart disease is responsible for untold global morbidity and mortality. Traditional medical
approaches to the treatment of heart disease often strive to ameliorate damage and to
prevent future damage, but they cannot reverse what has already happened. This is
especially apparent in the most extreme instances where heart transplantation is used to
replace the entire organ. Unfortunately, the supply of donor hearts cannot keep pace with
the demand; something must be done to enable us to repair damaged cardiac tissue and
generate whole organs when needed. Despite the fact that death rates from coronary heart
disease are falling, heart disease remains the leading cause of death worldwide.
This volume, Cardiomyocytes: Methods and Protocols, has been assembled for scientists
interested in basic and applied biomedical research directed toward understanding the
development, genetics, and function of cardiomyocytes. The methods and protocols
contained herein address cell culture techniques, cardiomyocyte differentiation and redif-
ferentiation, experimental induction of cardiomyopathies, introducing genes into cardio-
myocytes, genomic approaches to the understanding of cardiomyocytes, cryopreservation
of neonatal cardiomyocytes, and modeling of cardiomyocyte function. Among the chapters
of this work, readers will find complimentary areas of cardiomyocyte science that, taken
together, should inform individuals with a broad range of interests.
These collected contributions were written by current and nascent leaders in the field
of cardiomyocyte biology. Together the authors have provided a wealth of methods that
can be used to further explore the many aspects of cardiomyocyte biology that we need to
understand in order to better grasp the development and function of these cells and to
develop the next generation of effective therapies. The chapters are organized thematically
with regard to cardiovascular disease, modelling of cardiomyocytes function, isolation of
cells, induced differentiation of cells into cardiomyocytes, gene transfer into cardiac myo-
cytes, gene expression analysis, and the application of next-generation sequencing toward
furthering our understanding of cardiovascular disease.
Of course it is impossible to include contributions from every researcher who is
contributing to this important field. Instead we have compiled a collection of chapters
that together represent some of the leading and potentially most impactful work. We hope
you find them informative and useful in your own laboratories.
v
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
Index. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
Contributors
ix
x Contributors
Abstract
Viruses can induce direct damage to cardiac myocytes and cardiac fibroblasts resulting in myocarditis and
impaired cardiac function. Cardiac myocytes and cardiac fibroblasts display different capacities to support
viral infection and generate a protective antiviral response. This chapter provides detailed protocols for
generation and characterization of primary cultures of murine cardiac myocytes and cardiac fibroblasts,
offering a powerful tool to probe cell type-specific responses that determine protection against viral
myocarditis.
Key words Cardiac myocyte, Cardiomyocyte, Cardiac fibroblast, Myocarditis, Primary cell culture,
Reovirus
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_1, © Springer Science+Business Media New York 2015
1
2 Barbara Sherry
2 Materials
2.1 Mice (See Note 1) 1. Timed-pregnant mice can be purchased or generated in-house
from wild-type or transgenic colonies (see Note 2).
2. Use a sufficient number of timed-pregnant females to generate
30–150 fetal and neonatal (<24 h old) mice. The fraction of
each is random (see Note 3).
2.3 In Tissue Culture 1. Two plastic Petri dishes each containing ~20 ml sterile PBS
Hood (See Note 4) (see Subheading 2.5).
2. Disposable sterile plastic transfer pipettes.
3. 5, 10, and 25 ml sterile pipettes.
4. Forceps, sterilized by autoclaving in advance or by dipping in
ethanol and flaming immediately before starting.
5. Micropipettes (e.g., Eppendorf, Pipetman) and both large and
regular orifice sterile tips.
Generating Primary Cultures of Murine Cardiac Myocytes and Cardiac Fibroblasts. . . 3
3 Methods
3.2 Dissociating 1. Use a transfer pipette to remove most of the PBS from the Petri
the Hearts dish(es) with hearts.
2. Refill the dish with PBS and then remove most of this PBS to
facilitate access to hearts.
3. Use sterile forceps to transfer the hearts to a fresh Petri dish
containing PBS.
4. Use a transfer pipette to remove most of the PBS from this Petri
dish with hearts.
Generating Primary Cultures of Murine Cardiac Myocytes and Cardiac Fibroblasts. . . 5
Fig. 1 Removing fetal mouse hearts. (a) Abdomen of euthanized pregnant mouse is sprayed with ethanol, skin
and membrane are pulled back, and U-shaped uterus is exposed. (b and c) Decapitated fetal mouse is held
between fingers. Thoracic cavity is cut, taking care to keep scissor tips pointed outward away from mouse to
avoid the heart. (d) Middle finger is gently pressed against back of the fetus to splay open the thoracic cavity
and better expose the heart for removal. (e) Scissor tips are used to cut heart away from mouse and transfer to
Petri dish. (f) A maximum of 100 hearts are transferred to a Petri dish containing PBS. Some contaminating
blood is common
5. Refill the dish with PBS and then remove most of this PBS to
facilitate access to hearts.
6. Use the same sterile forceps to transfer a group of ~15 hearts to
sterile PBS-wetted Whatman paper in a glass Petri dish. Gently
roll the group a little bit being sure to remove blood clots, and
then transfer them to a fresh Petri dish containing PBS (see
Note 15).
7. Repeat for the remaining hearts, pooling all hearts in a single
Petri dish containing PBS.
8. Remove most of the PBS to facilitate access to hearts.
6 Barbara Sherry
the reservoir to the pellet in the first tube, take up the pellet
gently to keep it intact, transfer it to the second tube with a
pellet, and continue transfers if additional tubes exist. Use the
same cell-laden pipette to retrieve 2.5 ml cDMEM from the
reservoir, rinse the first “empty” tube, serially rinse any remain-
ing tubes and pool this rinse with the cell suspension (final total
volume ~5 ml). Holding the pipette so that the tip is flat against
the tube bottom, use maximum force to retrieve and eject the
suspension to disperse the pellet. Repeat this “up and down”
~7 times to disperse the pellet. Place tube on ice while waiting
to proceed to step 27.
27. Gently decant the supernatants from step 25 into a waste
beaker to discard.
28. Handle the pellets and washes exactly as for step 26, and pool
with the cell suspension in step 26. The final volume will be
~10 ml total.
29. Continue to pipette up and down (~5 ml volumes) ~7 times
until there is no further obvious disaggregation. Estimate the
volume.
30. Remove two independent 10 μl samples to Eppendorf tubes
with 90 μl PBS and use a hemocytometer to count cells that are
not Red Blood Cells [RBCs] (see Note 21).
31. Calculate the number of cells (see Note 22).
3.3 Separating 1. Calculate the number of 6-well clusters to plate at ~1.25 106
Cardiac Myocytes from cells/well as a “pre-plating” to separate the rapidly adhering
Cardiac Fibroblasts fibroblasts from the more slowly adhering myocytes.
2. Add cDMEM to the cell suspension so the final volume will
result in 2 ml suspension per well.
3. Dispense 2 ml per well in 6-well clusters. Rinse suspension tube
with very small volume cDMEM and add to several already-
plated wells.
4. Incubate for 3 h in a 37 C, CO2 incubator to allow fibroblasts
to adhere (see Note 23).
5. Use a P1000 micropipette set at 700 μl with a large orifice tip to
use media in the first well to vigorously rinse that well seven to
eight times, squirting directly onto the “monolayer.” Transfer
700 μl of cell suspension to a 50 ml tube, leaving ~1.3 ml in the
well (see Note 24).
6. Similarly remove 700 μl from each of the five remaining wells in
that cluster, pooling all in the same 50 ml tube (leaving ~1.3 ml
in each well) and rocking the plate after each removal to ensure
that cells do not dry out.
8 Barbara Sherry
7. Repeat steps 5 and 6 for that first cluster, pooling the suspen-
sion in the same 50 ml tube and leaving ~600 μl in each well.
8. Remove the remaining ~600 μl from all six wells and pool in the
same 50 ml tube.
9. Using a 10 ml pipette, retrieve ~6 from the cDMEM reservoir
and add ~1 ml to each well.
10. Repeat steps 5 and 6 for that first cluster, pooling the suspen-
sion in the same 50 ml tube and leaving ~300 μl in each well.
11. Remove the remaining ~300 μl from all six wells and pool with
the cell suspension.
12. Retrieve ~2 ml from the cDMEM reservoir and add ~1 ml to
first wells in top and bottom rows.
13. Use a P1000 micropipette with a large orifice tip to transfer
media across the rows of wells and pool with the cell
suspension.
14. Using a 10 ml pipette, retrieve ~6 from the cDMEM reservoir
and add ~1 ml to each well (see Note 25).
15. Repeat the entire procedure for the remaining clusters. Aim to
generate a single tube of cell suspension if possible, by slightly
adjusting volumes above as necessary. If a single tube would
require major volume adjustments, generate two tubes of cell
suspension.
16. Centrifuge in a tabletop centrifuge at ~300 g for 10 min at
4 C (~1,200 rpm in a Sorvall tabletop centrifuge).
17. Meanwhile, incubate clusters containing fibroblasts and 1 ml
overlying media in a 37 C, CO2 incubator until ready to
trypsinize.
18. Gently decant the supernatants into an equal number of sterile
50 ml disposable sterile plastic conical tubes (save the cell
pellets for step 20).
19. Centrifuge the supernatants retrieved in the previous step
in a tabletop centrifuge at ~300 g for 10 min at 4 C
(see Note 20 again).
20. Meanwhile, resuspend pellets from step 18 and wash tubes
exactly as for step 26 in previous section.
21. Gently decant the supernatants from step 19 into a waste
beaker to discard.
22. Handle the pellets and washes exactly as for step 20, and pool
with the cell suspension in step 20.
23. Pipette the cell suspension through a cell strainer into a fresh
50 ml tube (using small volumes to avoid losing cells along the
length of pipette), carefully measuring volumes of each
addition.
Generating Primary Cultures of Murine Cardiac Myocytes and Cardiac Fibroblasts. . . 9
Table 1
Plating cardiac myocyte cultures
Volume of cell
Vessel suspension to plate Cell number Example of purpose
96-well cluster 300 μl per well 1.5 10 myocytes
5
Viral replication by plaque assay
48-well cluster 1,000 μl per well 5 10 myocytes
5
RNA or protein harvest (small)
24-well cluster 2,000 μl per well 1 106 myocytes RNA or protein harvest (large)
8-well chamber slide 700 μl per well 3.5 10 myocytes
5
Microscopy
24. Rinse the source tube with 1 ml cDMEM and add to the
strainer.
25. Calculate the final volume.
26. Remove two independent 10 μl samples to Eppendorf tubes
with 90 μl PBS and use a hemocytometer to count cells that are
not RBCs.
27. Calculate the number of cells (see Note 26).
28. Add cDMEM to 5 105 cells/ml.
3.4 Plating Cardiac 1. Using large orifice micropipette tips, plate cardiac myocytes (see
Myocytes Table 1).
2. Incubate in a 37 C, CO2 incubator overnight.
3.5 Plating Cardiac 1. Use a transfer pipette to remove and discard media from all
Fibroblasts wells in one 6-well cluster.
2. Add 1 ml PBS to each well.
3. Repeat for up to two additional 6-well clusters.
4. Use a transfer pipette to remove PBS from all wells in first
6-well cluster.
5. Add 100 μl 0.05 % trypsin-PBS to each well.
6. Repeat for up to two additional 6-well clusters.
7. Incubate in a 37 C, CO2 incubator for ~7 min.
8. Remove cluster(s) and tap sides to release cells.
9. Check by microscope to ensure cells are rounded and floating.
If not, incubate several minutes longer.
10. Add 1,000 μl cDMEM to each well.
11. Use overlying media to rinse wells and pool in 50 ml tube.
12. Centrifuge in a tabletop centrifuge at ~300 g for 10 min
at 4 C (~1,200 rpm in a Sorvall tabletop centrifuge).
13. Decant supernatants into waste.
10 Barbara Sherry
Table 2
Infecting cardiac myocyte and cardiac fibroblast cultures
3.8 Assessing Virus 1. At the appropriate time post-infection (depending on the virus
Effects in Cardiac Cell and assay), cultures are suitable for quantitation of: frequency
Cultures of virus infection (e.g., immunocytochemistry), virus subcellu-
lar localization (e.g., confocal microscopy; see Note 35 again),
generation of infectious virus (e.g., plaque assay), generation of
12 Barbara Sherry
4 Notes
Acknowledgements
References
1. Cooper LT Jr (2009) Myocarditis. N Engl J 11. Zurney J, Howard KE, Sherry B (2007) Basal
Med 360:1526–1538 expression levels of IFNAR and Jak-STAT
2. Esfandiarei M, McManus BM (2008) Molecu- components are determinants of cell-type-
lar biology and pathogenesis of viral myocardi- specific differences in cardiac antiviral
tis. Annu Rev Pathol 3:127–155 responses. J Virol 81:13668–13680
3. Kindermann I, Barth C, Mahfoud F, Ukena C, 12. Nam YJ, Song K, Olson EN (2013) Heart
Lenski M, Yilmaz A, Klingel K, Kandolf R, repair by cardiac reprogramming. Nat Med
Sechtem U, Cooper LT, Bohm M (2012) 19:413–415
Update on myocarditis. J Am Coll Cardiol 13. Quijada P, Sussman MA (2014) Making it
59:779–792 stick: chasing the optimal stem cells for cardiac
4. Drory Y, Turetz Y, Hiss Y, Lev B, Fisman EZ, regeneration. Expert Rev Cardiovasc Ther
Pines A, Kramer MR (1991) Sudden unex- 12:1275–1288
pected death in persons less than 40 years of 14. Naqvi N, Li M, Calvert JW, Tejada T, Lambert
age. Am J Cardiol 68:1388–1392 JP, Wu J, Kesteven SH, Holman SR, Matsuda
5. Feldman AM, McNamara D (2000) Myocardi- T, Lovelock JD, Howard WW, Iismaa SE, Chan
tis. N Engl J Med 343:1388–1398 AY, Crawford BH, Wagner MB, Martin DI,
6. Mason JW, O’Connell JB, Herskowitz A, Rose Lefer DJ, Graham RM, Husain A (2014) A
NR, McManus BM, Billingham ME, Moon proliferative burst during preadolescence
TE, The Myocarditis Treatment Trial Investi- establishes the final cardiomyocyte number.
gators (1995) A clinical trial of immunosup- Cell 157:795–807
pressive therapy for myocarditis. N Engl J 15. Porrello ER, Mahmoud AI, Simpson E, Hill
Med 333:269–275 JA, Richardson JA, Olson EN, Sadek HA
7. Baty CJ, Sherry B (1993) Cytopathogenic (2011) Transient regenerative potential of the
effect in cardiac myocytes but not in cardiac neonatal mouse heart. Science 331:1078–1080
fibroblasts is correlated with reovirus-induced 16. Porrello ER, Olson EN (2014) A neonatal
acute myocarditis. J Virol 67:6295–6298 blueprint for cardiac regeneration. Stem Cell
8. Sherry B, Li X, Tyler KL, Cullen JM, Virgin Res 13:556–570
HW (1993) Lymphocytes protect against and 17. Senyo SE, Steinhauser ML, Pizzimenti CL, Yang
are not required for reovirus-induced myocar- VK, Cai L, Wang M, Wu TD, Guerquin-Kern
ditis. J Virol 67:6119–6124 JL, Lechene CP, Lee RT (2013) Mammalian
9. Irvin SC, Zurney J, Ooms LS, Chappell JD, heart renewal by pre-existing cardiomyocytes.
Dermody TS, Sherry B (2012) A single- Nature 493:433–436
amino-acid polymorphism in reovirus protein 18. Martin ML, Blaxall BC (2012) Cardiac inter-
mu2 determines repression of interferon sig- cellular communication: are myocytes and
naling and modulates myocarditis. J Virol fibroblasts fair-weather friends? J Cardiovasc
86:2302–2311 Transl Res 5:768–782
10. Li L, Sevinsky JR, Rowland MD, Bundy JL, 19. Porter KE, Turner NA (2009) Cardiac fibro-
Stephenson JL, Sherry B (2010) Proteomic blasts: at the heart of myocardial remodeling.
analysis reveals virus-specific Hsp25 modula- Pharmacol Ther 123:255–278
tion in cardiac myocytes. J Proteome Res
9:2460–2471
Chapter 2
Abstract
In vitro culture of neonatal murine cardiomyocytes is vital for understanding the functions of the heart.
Cardiomyocyte cultures are difficult to maintain because they do not proliferate after birth. The mainte-
nance of primary cultures of viable and functional cardiomyocytes is considerably affected by the yield from
initial steps of isolation procedures. This protocol describes an efficient and rapid method for isolation and
maintenance of long-term cultures of neonatal murine cardiomyocytes by effectively shortening the trypsin
enzyme digestion period and the cardiomyocyte enrichment step.
Key words Primary cell culture, Neonatal mice, Murine cardiomyocyte enrichment,
Immunocytochemistry
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_2, © Springer Science+Business Media New York 2015
17
18 Sreejit Parameswaran et al.
2 Materials
2.4 Animals 1. Mice—BALB/c or Swiss Albino neonatal mice 1–3 days old.
3 Methods
3.1 Excision of 1. Swab the neonatal mice completely with 70 % ethanol before
Ventricular Myocardial sacrificing by cervical dislocation (see Notes 1–7).
Tissue from Neonatal 2. Excise the whole heart and transfer it immediately to sterile
Mice ice-cold DPBSA.
3. Squeeze the blood out of the heart gently using sterile forceps.
4. Wash the excised hearts once more with sterile ice-cold
DPBSA.
5. Place the tissue in sterile ice-cold BSS for 10 min (see Note 8).
Remove the auricles carefully and discard. Place the excised
ventricles in a sterile 60-mm Petri dish.
6. Carefully mince the ventricles into small sections less than or
equal to 1 mm3 in 0.05 % Trypsin EDTA using a sterile scalpel.
Transfer the pieces into a sterile 15-mL falcon tube.
3.2 Isolation and 1. Disperse the cells by incubating the tissue with 0.5 % Trypsin
Culture of EDTA (1 mL of Trypsin EDTA per 100 mg of tissue) (see
Cardiomyocytes Note 9). Incubate it at 37 C in a water bath for 4 min with
intermittent pipetting.
2. Allow the cell suspension to stand for 1 min and then transfer
the supernatant into a fresh 15-mL centrifuge tube kept on ice
(see Note 10).
3. Add 2 mL of Maintenance Medium. Repeat steps 1–3 (diges-
tion process) three times.
4. Pool the supernatant obtained from each of the digestion steps.
Enrichment of Cardiomyocytes in Primary Cultures of Murine Neonatal Hearts 21
4 Notes
12. Cells must be counted within 3–5 min of mixing with trypan
blue, as prolonged incubation might cause cell death and
thereby can result in reduced viability counts.
13. Avoid excessive pipetting and only use intermittently so as to
avoid cell death and debris.
14. During the preparation of 4 % Paraformaldehyde, the solution
will never be free of precipitate unless the optimal pH is
attained and will carry a hazy appearance. Less than 1 mL of
2 N NaOH was sufficient to dissolve the precipitate under this
author’s laboratory conditions.
15. When preparing dilutions of antibodies for use on adherent cell
populations such as a cardiomyocyte primary culture, the dilu-
tion need be prepared according to the surface area of the TCP.
An adequate volume that just covers the surface of the plate is
sufficient. The dilutions given in Subheading 3 can vary accord-
ing to manufacturer and has to be determined by titrations.
16. GATA-4 and Nkx2.5 are transcriptional factors; therefore
staining for these proteins will require permeabilization with
triton-X. While H 33342 can pass through the membrane and
needs no permeabilization, the use of DAPI as a nuclear coun-
terstain can be facilitated using triton-X.
Acknowledgments
References
1. Yamashita N, Nishida M, Hoshida S, Kuzuya T, 4. Wang GW, Kang YJ (1999) Inhibition of doxo-
Hori M, Taniguchi N et al (1994) Induction of rubicin toxicity in cultured neonatal mouse car-
manganese superoxide dismutase in rat cardiac diomyocytes with elevated metallothionein
myocytes increases tolerance to hypoxia 24 h levels. J Pharmacol Exp Ther 288(3):938–944
after preconditioning. J Clin Invest 5. Kruppenbacher JP, May T, Eggers HJ, Piper
94:2193–2199 HM (1993) Cardiomyocytes of adult mice in
2. Bahi N, Zhang J, Llovera M, Ballester M, long-term culture. Naturwissenschaften
Comella JX, Sanchis D (2006) Switch from 80:132–134
caspase-dependent to caspase-independent 6. Chlopclkova Š, Psotova J, Miketova P (2001)
death during heart development: essential role Neonatal rat cardiomyocytes—a model for the
of endonuclease G in ischemia-induced DNA study of morphological, biochemical and
processing of differentiated cardiomyocytes. J electrophysiological characteristic of the heart.
Biol Chem 281(32):22943–22952 Biomed Pap Med Fac Univ Palacky Olomouc
3. Limaye DA, Shaikh ZA (1999) Cytotoxicity of Czech Repub 145:49–55
cadmium and characteristics of its transport in 7. Nuss HB, Marban E (1994) Electrophysiological
cardiomyocytes. Toxicol Appl Pharmacol 154 properties of neonatal mouse cardiac myocytes in
(1):59–66 primary culture. J Physiol 479(2): 265–279
Chapter 3
Abstract
MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth
and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition
element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their
translation via mechanisms that may include transcript degradation and/or prevention of ribosome
binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only
partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-
mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore
biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence
and quantity of each. To address these deficiencies we describe an empirical method, developed via studies
of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the
mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods
are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their
annotation in the genome of interest. We describe the laboratory bench steps required to perform these
experiments, experimental design strategies to achieve an appropriate number of sequencing reads per
biological replicate, and computer-based processing tools and procedures to convert large raw sequencing
data files into gene expression measures useful for differential expression analyses.
Key words microRNA, mRNA, Argonaute, Ago2, RNA-induced silencing complex (RISC),
Immunoprecipitation, Deep sequencing, Read alignment, Gene annotation, Differential expression
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_3, © Springer Science+Business Media New York 2015
27
28 Scot J. Matkovich and Gerald W. Dorn II
2 Materials
2.4 RNA- and 1. 5 fragmentation buffer, 50 mL: 1.21 g Tris–HCl base, 2.45 g
RISC-Seq Library potassium acetate, 1.61 g magnesium acetate tetrahydrate
Preparation (200 mM Tris–HCl acetate, 500 mM potassium acetate,
150 mM magnesium acetate, DEPC H2O). Adjust pH to 8.2
with 1 N acetic acid, and keep aliquots frozen at 20 C.
2. Zymo RNA Clean + Concentrator™-5 columns for RNA
purification, catalog #R1015.
3. Invitrogen SuperScript III first-strand synthesis system,
#18080-051 (50 reactions), which comprises SuperScript III
reverse transcriptase, random hexamer solution, and buffer
components including DTT and MgCl2.
4. 5 second-strand reaction buffer; 100 mM Tris–HCl pH 6.9,
450 mM KCl, 23 mM MgCl2, 0.75 mM β-NAD+, 50 mM
(NH4)2SO4. Keep frozen aliquots at 20 C.
5. E. coli DNA ligase (New England Biolabs, catalog #M0205S)
and DNA polymerase I (New England Biolabs, catalog
#M0209S).
6. Qiagen QIAquick PCR purification kit (catalog #28104),
MinElute kit (catalog #28004), gel purification kit (catalog
#28704).
7. Adapter oligonucleotides for multiplexed Illumina library
sequencing (Table 1).
Table 1
Adapter oligonucleotide and PCR primer sequences
3 Methods
3.1 Isolation of Total 1. Use Trizol following the manufacturer’s directions precisely.
RNA Take the usual precautions for RNase-free benchtop work.
2. Flash-frozen intact tissue should be homogenized (e.g., an Ika
Ultra Turrax probe homogenizer or similar): keep tissue frozen
(in liquid nitrogen), wash down homogenization probe with a
few hundred μL of Trizol first, add, e.g., 0.5 mL Trizol directly
to tube as soon as it is removed from liquid nitrogen, and
homogenize. For mouse heart apices, we use a total of 1 mL
Trizol; the second aliquot of 0.5 mL is used to help wash tissue
pieces out of the probe. This results in good extraction of the
total RNA fraction. To enhance recovery of the small RNA
32 Scot J. Matkovich and Gerald W. Dorn II
3.5 For RNA-Seq This step chemically shears full-length RNA transcripts into
and RISC-Seq: RNA 200–500 nt fragments, permitting uniform reverse transcription
Fragmentation during subsequent stages. An important initial paper on RNA-Seq
methodology by Mortazavi et al. [33] documents full-length
RNA + oligo(dT) reverse transcription vs. fragmented RNA + ran-
dom primer reverse transcription, and concludes that fragmenta-
tion followed by random primer-based reverse transcription
improves the coverage of exonic elements with reduction of 30
bias in final sequencing libraries.
1. Take 100–500 ng polyA+ RNA, or the Ago2-
immunoprecipitated RNA; typically we use one-half of the
RNA obtained, thus preserving an aliquot should there be a
processing error in subsequent steps, and prepare a solution of
Deep Sequencing of Cardiac MicroRNA-mRNA Interactomes in Clinical. . . 35
AAAA
AAAA
AAAA
mRNA AAAA
AAAA
Ago2 IP
Fragment mRNA
~200 nt
ds cDNA synthesis
No amplification
Illumina HiSeq
3.6 cDNA Synthesis Use the SuperScript III first-strand synthesis system. Each reaction
can accommodate 8 μL of fragmented polyA+ RNA. Follow the
3.6.1 First-Strand cDNA directions supplied, but do not treat with supplied RNase H at the
end of this procedure.
1. Combine 8 μL RNA, 1 μL 50 ng/μL random hexamers, 1 μL
10 mM dNTP mix.
2. Incubate at 65 C for 5 min, then place on ice for 1 min.
3. Add 10 μL “cDNA synthesis mix,” prepared as follows:
36 Scot J. Matkovich and Gerald W. Dorn II
3.7 For RNA-Seq The protocol given below for generating sequencing libraries for
and RISC-Seq: Adapter the Illumina platform is based on the “ChIP sequencing protocol”
Ligation to cDNA available at http://bioinfo.mbb.yale.edu/array/resources.html
Fragments (Yale Center for Excellence in Genomic Science). The detailed
steps we describe in Subheadings 3.6 and 3.7 are specific for the
Illumina platform and will be different for different sequencing
platforms, requiring consultation of the manufacturers’ documen-
tation or other validated protocols.
Double-stranded cDNA x μL
10 End-Repair Buffer 5 μL
2.5 mM dNTP Mix 5 μL
10 mM ATP 5 μL
Sterile water y μL
End-Repair Enzyme Mix 1 μL
Total reaction volume 50 μL
3.7.2 Addition of “A” Use Klenow (30 ! 50 exo), not the large Klenow fragment typi-
Base to 30 Ends cally used to fill in DNA ends.
1. Combine and mix the following components:
3.8 For RNA-Seq Considerations for sample indexing and the number of separate
and RISC-Seq: Size samples to be combined and sequenced on a single lane:
Selection, PCR For standard mRNA work, it is likely that sample “indexing”
Recovery, Sample (conceptually similar to DNA barcoding) will be desired so that
Indexing, 8–12 indexed samples can be combined into one sequencing lane of
and Preparation ~240 million raw 50 nucleotide single-end reads—this represents
for Cluster Formation the current capacity of the Illumina HiSeq 2000-family sequencers
available at our core facility. Indexes are read separately and do not
detract from the 50 nucleotides available for sequence alignment.
The nature of RISC-Seq analysis involves a large amount of rRNA is
present in the Ago2 immunoprecipitate, which dilutes the reads
useful for determining the abundance of bound mRNAs. For this
reason we submit approximately half of the number of RISC-Seq
samples on a single lane in comparison to what we submit for
RNA-Seq on a single lane; in the final analysis, the number of
sequencing reads that map to mRNA species is largely similar.
Some examples of indexing primers are given in Table 1.
Particular core sequencing facilities may recommend particular
7-nucleotide indexes over others. Provided that the nucleotides
are chosen are varied, without >3 of the same nucleotide occurring
in series, we have observed no particular bias or difficulty in
recovering sequence reads resulting from the use of one index
sequence compared to another.
A common question in work of this nature relates to the
number of reads that are appropriate in order to perform accurate
quantitation of the starting RNAs and consequently to perform
differential expression analyses of a suitable power. This is a com-
plex and user-dependent issue, and will partly depend on the rarity
of genes of interest, especially if analysis of splice variants is
required. Some recommendations for appropriate sequencing
depth can be found in the following references: [34, 35].
Deep Sequencing of Cardiac MicroRNA-mRNA Interactomes in Clinical. . . 39
3.8.1 Size Selection 1. Gel-purify the DNA (using a 2 % low-melting agarose gel) by
of Sequencing Libraries via cutting a gel slice that does NOT include any DNA from a
Agarose Gel Purification potential adapter-adapter (self-ligated) band migrating at
~120 bp. The ligation product may not be readily visible at
this stage if the cDNA input was small (0.5 μg or less), and will
appear as a smear of fragments of different sizes in any case.
Isolate cDNA in the 150–300 bp range. If purifying multiple
libraries on a single gel, be very careful to avoid cross-
contamination by leaving at least two empty lanes between
each sample (and preferably three to four).
2. Purify the DNA from the agarose slice using a Qiagen Gel
Extraction Kit (see Note 7). Elute in 30 μL EB.
3.8.3 Quality Check Purify the amplified product on a QIAquick PCR purification
of Final Library column, similarly to the preceding steps in library generation, and
Preparations, elute in 30 μL buffer EB. Run 3–5 μL on a 2 % agarose gel (no need
and Preparation for low-melting agarose) to verify that the amplified fragment sizes
for Sequencing are similar to what was excised from the purification gel in step A.
Alternatively, an Agilent BioAnalyzer trace could be gained on the
amplified material. It is advisable to electrophorese the gel suffi-
ciently to allow good visualization of any material in the
100–120 bp range. Typically, detection of sharp bands in this
range indicates the presence of PCR primer-dimers or PCR ampli-
fication of core adapters that were not sufficiently removed after the
ligation step.
If these low-molecular-weight products represent a significant
fraction of the total sequencing library, then it is usually desirable to
perform a second size-selection step to remove them. Our experi-
ence has been that these products tend to be more evident when
beginning with a lower overall RNA input, such as occurs with
RISC-Seq. If the low-molecular-weight products are not removed,
they will compete with the desired cDNA fragments for binding to
the Illumina sequencing flowcell and decrease the number of useful
sequencing reads obtained as a result. One option is to perform
another gel purification round, this time on the PCR-amplified
material. Our core sequencing facility offers AMPure XP bead
purification (Beckman Coulter), on the basis of differential binding
of differently sized fragments, to achieve the same effect.
Quantitate the final libraries using a fluorescent DNA-binding
dye protocol (such as the Qubit or PicoGreen assays); we have
repeatedly found that this gives more accurate loading than Nano-
Drop or other UV-based measurement for sequencing library
quantitation. Prepare an equimolar mixture of the desired, indexed
libraries and dilute as appropriate for the chosen sequencing instru-
ment. As an example, we submit library mixtures at 10 nM to our
sequencing facility, which are then further diluted to 5 pM for
cluster formation on Illumina flowcells.
3.11 microRNA-Seq In this section and the following ones, a general workflow will be
Data Alignment described, together with recommendations for specific software
and Quantitation packages that we currently use. However, many of the programs
used for read alignment and quantitation are under continuous
development, or are superseded by more powerful alternatives,
and due to their “open-source” nature may become unavailable
or relocated to different web addresses without notice. The major-
ity of these programs are designed to be run in a Linux environ-
ment, either on a native Linux computer, a Linux emulator for
Windows (such as Cygwin), or the “Terminal” of Mac OS X.
Biological scientists that have not had previous exposure to Unix-
style operating systems may experience some level of discomfort
with the use of these programs at first, and some initial assistance
from a computational biologist or bioinformatician that is fluent in
the environment may be helpful in overcoming the initial learning
curve. A detailed description of Unix file management and com-
mands, read alignment procedures, and use of the popular statistical
42 Scot J. Matkovich and Gerald W. Dorn II
FastQC
TopHat
(sequence alignment to genome/transcriptome)
HTSeq Cufflinks
(calculate reads per gene) (calculate FPKM)
Fig. 2 Workflow for processing sequence reads to gene abundance data and
differential expression
Our workflow is as follows, and is the same for both mRNA and
RISC RNA sequencing (Fig. 2):
1. Alignment of sequencing reads to the desired genome/tran-
scriptome. We use the program TopHat [30, 36], which
employs the Bowtie aligner [29] at its core with specific con-
sideration for the splicing out of introns. TopHat can use a
genome-wide, annotated transcriptome database for its align-
ment procedure. Annotated genome-wide transcriptomes from
Ensembl or UCSC sources often contain multiple noncoding
RNA species in addition to mRNAs. While this is useful in some
circumstances, we prefer the alternative allowed by TopHat of
defining a more limited transcriptome and annotating only to
this. An advantage of such an approach is that it is easy to limit
alignments to mRNAs only (without inclusion of noncoding
RNAs), which are the only data we require for parallel mRNA-
and RISC-Seq analyses, and thus discarding all reads which
map to, e.g., the rRNA that is inevitably contained in RISC-
Seq libraries.
2. Conversion of aligned sequencing reads to gene expression
measures. The calculation of gene expression values (with or
without provision for determining isoform fractions and/or
new alternatively spliced transcripts) and the use of normaliza-
tion procedures to compensate for differences in library
sequencing depth and/or gene length [37, 38] have been the
subject of much discussion. These issues cannot be divorced
from debate over the most appropriate method for determina-
tion of significant differences in gene expression between treat-
ments, with three principal scientific groups involved in the
44 Scot J. Matkovich and Gerald W. Dorn II
3.13 Statistical Tools In many of our earlier publications using deep sequencing meth-
to Determine odologies, we used a fairly straightforward method of importing
Differential Gene Cufflinks-derived FPKM values into statistical software such as
Expression Partek Genomics Suite (http://www.partek.com/), log-
transformed the data (achieving a better fit to the normal
Deep Sequencing of Cardiac MicroRNA-mRNA Interactomes in Clinical. . . 45
4 Notes
#############
sub load_bowtie_output_files # and process
{
& time; print "Running Bowtie alignment using
$processors processors start ¼ $theTime. . .\n";
# system("cat *_TBDL | awk ’{print \">\"\$1\"\\n
\"\$1}’ > bowtie_temp.fa ");
$outfile ¼"bowtie_temp.fa_OUT";
Acknowledgements
References
1. Lynn FC, Skewes-Cox P, Kosaka Y et al (2007) 10. Matkovich SJ, Zhang Y, Van Booven D et al
MicroRNA expression is required for pancre- (2010) Deep mRNA sequencing for in vivo
atic islet cell genesis in the mouse. Diabetes functional analysis of cardiac transcriptional
56:2938–2945 regulators. Application to Gαq. Circ Res
2. Kuehbacher A, Urbich C, Zeiher AM et al 106:1459–1467
(2007) Role of Dicer and Drosha for endothe- 11. Hu Y, Matkovich SJ, Hecker PA et al (2012)
lial microRNA expression and angiogenesis. Epitranscriptional orchestration of genetic
Circ Res 101:59–68 reprogramming is an emergent property of
3. Chen JF, Murchison EP, Tang R et al (2008) stress-regulated cardiac microRNAs. Proc
Targeted deletion of Dicer in the heart leads to Natl Acad Sci U S A 109:19864–19869
dilated cardiomyopathy and heart failure. Proc 12. Matkovich SJ, Van Booven DJ, Youker KA et al
Natl Acad Sci U S A 105:2111–2116 (2009) Reciprocal regulation of myocardial
4. Melkman-Zehavi T, Oren R, Kredo-Russo S microRNAs and messenger RNA in human
et al (2011) miRNAs control insulin content cardiomyopathy and reversal of the microRNA
in pancreatic β-cells via downregulation of signature by biomechanical support. Circula-
transcriptional repressors. EMBO J tion 119:1263–1271
30:835–845 13. Ikeda S, Kong SW, Lu J et al (2007) Altered
5. van Rooij E, Olson EN (2007) MicroRNAs: microRNA expression in human heart disease.
powerful new regulators of heart disease and Physiol Genomics 31:367–373
provocative therapeutic targets. J Clin Invest 14. van Rooij E, Sutherland LB, Liu N et al (2006)
117:2369–2376 A signature pattern of stress-responsive micro-
6. Liu N, Olson EN (2010) MicroRNA regu- RNAs that can evoke cardiac hypertrophy and
latory networks in cardiovascular development. heart failure. Proc Natl Acad Sci U S A
Dev Cell 18:510–525 103:18255–18260
7. Chen CY, Zheng D, Xia Z et al (2009) Ago- 15. Putt ME, Hannenhalli S, Lu Y et al (2009)
TNRC6 triggers microRNA-mediated decay Evidence for coregulation of myocardial gene
by promoting two deadenylation steps. Nat expression by MEF2 and NFAT in human
Struct Mol Biol 16:1160–1166 heart failure. Circ Cardiovasc Genet
8. Kozomara A, Griffiths-Jones S (2011) miR- 2:212–219
Base: integrating microRNA annotation and 16. Margulies KB, Matiwala S, Cornejo C et al
deep-sequencing data. Nucleic Acids Res 39: (2005) Mixed messages: transcription patterns
D152–D157 in failing and recovering human myocardium.
9. Matkovich SJ, Hu Y, Dorn GW II (2013) Reg- Circ Res 96:592–599
ulation of cardiac microRNAs by cardiac 17. van Rooij E, Sutherland LB, Thatcher JE et al
microRNAs. Circ Res 113:62–71 (2008) Dysregulation of microRNAs after
Deep Sequencing of Cardiac MicroRNA-mRNA Interactomes in Clinical. . . 49
myocardial infarction reveals a role of miR-29 31. Anders S, Huber W (2010) Differential expres-
in cardiac fibrosis. Proc Natl Acad Sci U S A sion analysis for sequence count data. Genome
105:13027–13032 Biol 11:R106
18. Ozsolak F, Milos PM (2011) RNA sequencing: 32. Matkovich SJ, Van Booven DJ, Eschenbacher
advances, challenges and opportunities. Nat WH et al (2011) RISC RNA sequencing for
Rev Genet 12:87–98 context-specific identification of in vivo micro-
19. Jensen KB, Darnell RB (2008) CLIP: cross- RNA targets. Circ Res 108:18–26
linking and immunoprecipitation of in vivo 33. Mortazavi A, Williams BA, McCue K et al
RNA targets of RNA-binding proteins. Meth- (2008) Mapping and quantifying mammalian
ods Mol Biol 488:85–98 transcriptomes by RNA-Seq. Nat Methods
20. Hafner M, Landthaler M, Burger L et al (2010) 5:621–628
PAR-CliP—a method to identify 34. Toung JM, Morley M, Li M et al (2011) RNA-
transcriptome-wide the binding sites of RNA sequence analysis of human B-cells. Genome
binding proteins. J Vis Exp 41:e2034 Res 21:991–998
21. Hafner M, Landthaler M, Burger L et al (2010) 35. Labaj PP, Leparc GG, Linggi BE et al (2011)
Transcriptome-wide identification of RNA- Characterization and improvement of RNA-
binding protein and microRNA target sites by Seq precision in quantitative transcript expres-
PAR-CLIP. Cell 141:129–141 sion profiling. Bioinformatics 27:i383–i391
22. Licatalosi DD, Mele A, Fak JJ et al (2008) 36. Trapnell C, Roberts A, Goff L et al (2012)
HITS-CLIP yields genome-wide insights into Differential gene and transcript expression
brain alternative RNA processing. Nature analysis of RNA-seq experiments with TopHat
456:464–469 and Cufflinks. Nat Protoc 7:562–578
23. Chi SW, Zang JB, Mele A et al (2009) Argo- 37. Bullard JH, Purdom E, Hansen KD et al
naute HITS-CLIP decodes microRNA-mRNA (2010) Evaluation of statistical methods for
interaction maps. Nature 460:479–486 normalization and differential expression in
24. Karginov FV, Conaco C, Xuan Z et al (2007) A mRNA-Seq experiments. BMC Bioinformatics
biochemical approach to identifying micro- 11:94
RNA targets. Proc Natl Acad Sci U S A 38. Oshlack A, Wakefield MJ (2009) Transcript
104:19291–19296 length bias in RNA-seq data confounds systems
25. Matkovich SJ, Hu Y, Eschenbacher WH et al biology. Biol Direct 4:14
(2012) Direct and indirect involvement of 39. Trapnell C, Williams BA, Pertea G et al (2010)
microRNA-499 in clinical and experimental Transcript assembly and abundance estimation
cardiomyopathy. Circ Res 111:521–531 from RNA-Seq reveals unannotated transcripts
26. Dorn GW II, Matkovich SJ, Eschenbacher WH and isoform switching during cell differentia-
et al (2012) A human 30 miR-499 mutation tion. Nat Biotechnol 28:511–515
alters cardiac mRNA targeting and function. 40. Robinson MD, McCarthy DJ, Smyth GK
Circ Res 110:958–967 (2010) edgeR: a bioconductor package for dif-
27. Buermans HP, Ariyurek Y, van Ommen G et al ferential expression analysis of digital gene
(2010) New methods for next generation expression data. Bioinformatics 26:139–140
sequencing based microRNA expression 41. Anders S, Reyes A, Huber W (2012) Detecting
profiling. BMC Genomics 11:716 differential usage of exons from RNA-seq data.
28. An J, Lai J, Lehman ML et al (2013) miR- Genome Res 22:2008–2017
Deep*: an integrated application tool for 42. Dillies MA, Rau A, Aubert J et al (2013) A
miRNA identification from RNA sequencing comprehensive evaluation of normalization
data. Nucleic Acids Res 41:727–737 methods for Illumina high-throughput RNA
29. Langmead B, Trapnell C, Pop M et al (2009) sequencing data analysis. Brief Bioinform
Ultrafast and memory-efficient alignment of 14:671–683
short DNA sequences to the human genome. 43. Kim YK, Yeo J, Kim B et al (2012) Short
Genome Biol 10:R25 structured RNAs with low GC content are
30. Trapnell C, Pachter L, Salzberg SL (2009) selectively lost during extraction from a small
TopHat: discovering splice junctions with number of cells. Mol Cell 46:893–895
RNA-Seq. Bioinformatics 25:1105–1111
Chapter 4
Abstract
In recent years, next-generation sequencing (NGS) technologies have revolutionized approaches to genetic
studies, making whole-genome sequencing a possible way for obtaining global genomic information. At
present, three most NGS platforms are used in genetics for clonally amplified templates. These technologies
share general processing steps but differing in specific technical details that determine their limits or
advantages. NGS has been recently shown to have great potential for identifying novel causative mutations
in different disorders. It is expected that the NGS will be increasingly important in the study of inherited
and complex traits such as cardiovascular diseases (CVDs). Indeed, the identification and characterization of
genes that enhance prediction of CVDs risk remain an important challenge for improving prevention and
treatment.
1 Introduction
Sanger sequencing was used for the Human Genome Project [1], but
despite significant technical improvements to this “first-generation”
technology, new second-generation screening or next-generation
sequencing (NGS) technologies are required for sequencing mul-
tiple human genomes at adequate depth. Over the last 5 years,
NGS technology has revolutionized the genomic (and transcrip-
tomic) approach to biology reducing the cost of sequencing on a
per-base pair (bp) basis and increasing the output of sequencing
from a few hundred bps by each Sanger analysis to about 600
billion bps per NGS machine run [2, 3]. Whole-genome
sequencing has become a possible and efficient way to obtain
global genomic information [4]. Thus also in the field of cardio-
vascular diseases (CVDs), hundreds of loci associated with these
pathologies have been identified [5].
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_4, © Springer Science+Business Media New York 2015
51
52 Cecilia Vecoli
1.1 NGS Platforms The three NGS technologies share general processing steps while
for Clonally Amplified differing in specific technical details (Fig. 1). The first common step
Template in NGS is the preparation of a “library” comprising genomic DNA
(or cDNA) fragments ligated to platform specific oligonucleotide
adapters.
The input nucleic acid can be genomic DNA, standard or long-
range PCR amplicons (or cDNA).
To achieve fragmentation, the input nucleic acid is fragmented
(by nebulization, sonication, or enzymatic digestion) to generate
random overlapping fragments typically in the size range of
150–600 bp depending on platform and application requirements
[7]. A common theme among NGS technologies is that the tem-
plate is immobilized or attached to a solid surface or support. The
immobilization of spatially separated template sites allows
thousands to billions of sequencing reactions to be performed
simultaneously. For the Roche and Life Technologies platforms,
clonal amplification uses emulsion PCR (emPCR) and requires
hybridizing the adapter modified fragment library to beads that
display oligonucleotides with sequences complementary to adapter
sequences [8–10]. Briefly, in emPCR, a reaction mixture consisting
of an oil–aqueous emulsion is created to encapsulate bead–DNA
complexes into single aqueous droplets. DNA fragments are ampli-
fied on the beads in emPCR, resulting in beads carrying tens of
millions of copies of the original DNA fragment. After PCR, the
emulsion is broken, and DNA-coated beads are purified, dena-
tured, and loaded into the wells of a “picotiter” plate. EmPCR
beads can be deposited into individual PicoTiterPlate (PTP) wells
(Roche) [11] in which the NGS chemistry can be performed or
chemically attached to a glass slide chemically cross-linked to an
amino-coated glass surface (Life Technologies) [12].
Fig. 1 Next-generation sequencing process steps for platforms requiring clonally amplified templates
(Illumina, Roche, and Life Technologies). Input DNA is random fragmented and ligated to platform-specific
oligonucleotide adapters. Individual library fragments are clonally amplified by emulsion PCR (Roche and Life
Technologies) or solid surface bridge amplification (Illumina). Flow cell sequencing of clonal templates
generates luminescent (Roche) or fluorescent (Illumina and Life Technologies) signals. From luminescent or
fluorescent signals images are generated that, then, will be algorithmically processed into sequence reads.
These data can be exported and next assembly and aligned thanks special bioinformatics tools
54 Cecilia Vecoli
The wells of the picotiter plate are large enough for only a
single bead to be loaded; each well carrying a bead will generate
an individual DNA sequence. Pyrosequencing is performed by
cyclical addition of individual nucleotides, sulfurylase, and lucifer-
ase. As each nucleotide is incorporated into the growing strand, an
inorganic pyrophosphate group is released and converted to ATP
by the sulfurylase. Luciferase uses the ATP to convert luciferin to
oxyluciferin, producing a light signal that is directly proportional to
the number of inorganic pyrophosphate molecules released and the
number of nucleotides incorporated [13].
In Life Technologies protocol, beads are deposited onto a slide
and primers hybridize to the adaptor sequence on the template
beads. Four fluorescently labeled probes compete for ligation to the
sequencing primer. Multiple cycles of ligation, detection, and cleav-
age are performed, with the number of cycles determining the even-
tual read length of up to 75 bp. More recently, Life Technologies
acquired Ion Torrent to release the PGM™ and Proton™ sequencers
that use a very similar approach to the original Roche/454 pyrose-
quencing. Indeed, the sequencing is performed on a semiconductor
chip that has wells into which individual emulsion PCR beads can be
loaded. Sequencing is carried out in a similar cyclical manner, but as
each nucleotide is incorporated hydrogen ions are released, changing
the pH of the well. This is detected by the ion sensors in the semi-
conductor chip, which then produces a “flowgram” format.
In contrast to emPCR, Illumina utilizes a unique “bridge
amplification” reaction that occurs on the surface of the flow cell
[14]. Certainly, the isothermal bridge amplification considerably
reduces the complexity of sample processing compared to emPCR
even if new front-end automation devices for the emulsion PCR
steps have been developed in recent years.
In Illumina chemistry, libraries are prepared from two oligonu-
cleotides that share complementarity at one end; when annealed
and ligated to DNA fragments they allow different sequences to be
added to the end of each fragment. The library of DNA fragments
is enriched by PCR ready for clustering and sequencing. Libraries
are denatured to pM concentration and are introduced to a specific
flow cell. The fragments hybridize to complementary oligonucleo-
tides on the surface of the flow cell and are copied by DNA
polymerase. These daughter molecules are then “bridge-amplified”
by repeated cycles of chemical denaturation and polymerase exten-
sion to produce discrete clusters each containing about 1,000
molecules. Sequencing-by-synthesis technology uses fluorescently
labeled and reversibly blocked terminator deoxynucleoside-
triphosphates in a cyclic sequencing reaction. Nucleotides are
incorporated by DNA polymerase into the growing DNA strand,
the flow cell is imaged to determine which nucleotide has been
incorporated into each individual cluster, and finally the terminator
is removed by chemical cleavage ready for the next round of incor-
poration, imaging, and cleavage [14, 15].
Next-Generation Sequencing Technology in the Genetics of Cardiovascular Disease 55
Protein Gene
Myosin, heavy chain 7 MYH7
Myosin binding protein C MYBPC3
Troponin T type 2 TNNT2
Troponin I type 3 TNNI3
Cysteine and glycine-rich protein 3 CSRP3
Tropomyosin α TPM1
Myosin light chain 2 MYL2
Actin ACTC
Myosin light chain 3 MYL3
Protein kinase AMP activated, γ2 PRKAG2
Phospholamban PLN
Troponin C type 1 TNNC1
Titin TTN
Myosin, heavy chain 6 MYH6
Titin-cap TCAP
Caveolin 3 CAV3
?
Design Studio
Library Preparation
Data Analysis
Fig. 3 Schematic flow chart of steps for target resequencing using MiSeq
Illumina platform
Next-Generation Sequencing Technology in the Genetics of Cardiovascular Disease 59
Note: The first thing is to identify the Sample Preparation Kit that
best fits our sequencing project. In the Illumina web site there is a
Sample Preparation Kit Selector Tool (http://support.illumina.
com/training/sample_prep_kit_selector.ilmn) that helps in the
search. To resequence several amplicons, the TruSeq Custom
Amplicon is recommended.
2 Materials
3 Methods
3.1 DNA Extraction GenElute™ Blood Genomic DNA Kit (Sigma Aldrich) is a simple
and convenient way to isolate pure genomic DNA from fresh or
aged (older than 24 h) whole blood. It is important to carefully
follow the protocol provided by the manufacture’s company
(http://www.sigmaaldrich.com/technical-documents/protocols/
biology/genelute-blood-genomic-dna-kit.html). Briefly, the start-
ing material is lysed in a chaotropic salt-containing solution to
insure the thorough denaturation of macromolecules. The addition
of ethanol causes the DNA to bind when the lysate is spun through
a silica membrane in a microcentrifuge tube. A Prewash Solution is
provided to help remove contaminants that are associated with
aged (older than 24 h) whole blood samples. After washing to
remove contaminants, the DNA is eluted in 200 μL of a Tris-
EDTA solution.
60 Cecilia Vecoli
3.3 TruSeq Custom Once the TruSeq Custom Amplicon kit has been designed the
Amplicon Kit Company will provide all the material (including probes) for
sequencing the selected amplicons.
3.3.1 Study Design
General consideration. During the study design, we must take
into account three general considerations (valid for any
applications):
1. Read Length: Decide which read length is suitable for each
experiment before preparing the library. The amplicon length is
user-selected.
2. Coverage: The coverage is referred to as the number of
times that a nucleotide base must be sequenced. Expressed in
percent, coverage is the total number of non-overlapping bases
covered by the attempted amplicons divided by the total
number of bases in the design.
3. Pooling indexed samples (Multiplexing): DNA samples col-
lected from the different subjects can be distinguished in
NGS reads by adding unique short oligos (6–10 bps) as bar-
codes when sequencing adapters are ligated. Barcoded samples
can be pooled and sequenced together, enabling a significant
reduction in the per sample cost of each NGS machine run.
This labeling allows sharing between several samples by tagging
each sample with a unique DNA “barcode.” In this way it is
possible to use a single NGS run to sequence either a handful of
genes from many patients or many genes from fewer patients.
TruSeq Custom Amplicon has integrated sample barcodes that
enable pooling of up to 96 samples per run. However, the real
number of samples that can be pooled together per sequencing
run depends on the number of amplicons and the desired depth
of sequencing coverage.
Design Studio for selected HCM genes. Go to the http://
designstudio.illumina.com/ web page. After registration, you can
start your project design. In the Design Studio for the genes listed
in Table 1, you can insert “Amplicon length” as 250 bp, and then
directly the name of the gene (i.e., MYH7) and choose the option
“exons only” to sequence all the exonic regions. You have to repeat
this operation for each gene associated with HCM. (Check the
“estimated amplicon” that cannot surpass 1536).
Next-Generation Sequencing Technology in the Genetics of Cardiovascular Disease 61
3.4 Kit Protocol Kit details seem to be perfect. (Note: library preparation and their
concentration measurement can both be automated with compatible
systems like Agilent Bravo, Hamilton Banadu, Tecan, and Apricot
Designs.) This assay takes less than 8 h total, with 2–3 h of hands‐on
time and allows processing up to ~650 kb of cumulative genomic
sequence (1,536 amplicons 425 bp each) starting from between
150 and 250 ng of DNA, depending on the quality of DNA and
62 Cecilia Vecoli
Acknowledgements
References
1. Venter JC, Adams MD, Myers EW et al (2001) S, Ho CH, Irzyk GP, Jando SC, Alenquer ML,
The sequence of the human genome. Science Jarvie TP, Jirage KB, Kim JB, Knight JR, Lanza
291:1304–1351 JR, Leamon JH, Lefkowitz SM, Lei M, Li J,
2. Clark MJ, Chen R, Lam HY, Karczewski KJ, Lohman KL, Lu H, Makhijani VB, McDade
Euskirchen G, Butte AJ, Snyder M (2011) Per- KE, McKenna MP, Myers EW, Nickerson E,
formance comparison of exome DNA sequenc- Nobile JR, Plant R, Puc BP, Ronan MT, Roth
ing technologies. Nat Biotechnol 29:908–914 GT, Sarkis GJ, Simons JF, Simpson JW, Srini-
3. Zhang J, Chiodini R, Badr A, Zhang G (2011) vasan M, Tartaro KR, Tomasz A, Vogt KA,
The impact of next-generation sequencing on Volkmer GA, Wang SH, Wang Y, Weiner MP,
genomics. J Genet Genomics 38:95–109 Yu P, Begley RF, Rothberg JM (2005) Genome
sequencing in microfabricated high-density
4. Su Z, Ning B, Fang H, Hong H, Perkins R, picolitre reactors. Nature 437:376–380
Tong W, Shi L (2011) Next-generation
sequencing and its applications in molecular 11. Leamon JH (2003) A massively parallel Pico-
diagnostics. Expert Rev Mol Diagn 11:333–343 TiterPlate based platform for discrete picoliter-
scale polymerase chain reactions. Electrophore-
5. Faita F, Vecoli C, Foffa I, Andreassi MG sis 24:3769–3777
(2012) Next generation sequencing in cardio-
vascular diseases. World J Cardiol 4:288–295 12. Kim JB, Porreca GJ, Song L, Greenway SC,
Gorham JM, Church GM, Seidman CE, Seid-
6. Davey JW, Hohenlohe PA, Etter PD, Boon JQ, man JC (2007) Polony multiplex analysis of
Catchen JM, Blaxter ML (2011) Genome-wide gene expression (PMAGE) in mouse hypertro-
genetic marker discovery and genotyping using phic cardiomyopathy. Science 316:1481–1484
next-generation sequencing. Nat Rev Genet
12:499–510 13. Quail MA, Kozarewa I, Smith F, Scally A, Ste-
phens PJ, Durbin R, Swerdlow H, Turner DJ
7. Borgstrom E, Lundin S, Lundeberg J (2011) (2008) A large genome center’s improvements
Large scale library generation for high to the Illumina sequencing system. Nat Meth-
throughput sequencing. PLoS One 6:e19119 ods 5:1005–1010
8. McKernan KJ, Peckham HE, Costa GL, 14. Bentley DR, Balasubramanian S, Swerdlow HP
McLaughlin SF, Fu Y, Tsung EF, Clouser CR, et al (2008) Accurate whole human genome
Duncan C, Ichikawa JK, Lee CC, Zhang Z, sequencing using reversible terminator chemis-
Ranade SS, Dimalanta ET, Hyland FC, try. Nature 456:53–59
Sokolsky TD, Zhang L, Sheridan A, Fu H,
Hendrickson CL, Li B, Kotler L, Stuart JR, 15. Ruparel H, Bi L, Li Z, Bai X, Kim DH, Turro
Malek JA, Manning JM, Antipova AA, Perez NJ, Ju J (2005) Design and synthesis of a 30-
DS, Moore MP, Hayashibara KC, Lyons MR, O-allyl photocleavable fluorescent nucleotide
Beaudoin RE, Coleman BE, Laptewicz MW, as a reversible terminator for DNA sequencing
Sannicandro AE, Rhodes MD, Gottimukkala by synthesis. Proc Natl Acad Sci U S A
RK, Yang S, Bafna V, Bashir A, MacBride A, 102:5932–5937
Alkan C, Kidd JM, Eichler EE, Reese MG, De 16. Ruffalo M, Laframboise T, Koyuturk M (2011)
La Vega FM, Blanchard AP (2009) Sequence Comparative analysis of algorithms for next-
and structural variation in a human genome generation sequencing read alignment. Bioin-
uncovered by short-read, massively parallel formatics (Oxford, England) 27:2790–2796
ligation sequencing using two-base encoding. 17. DePristo MA, Banks E, Poplin R, Garimella
Genome Res 19:1527–1541 KV, Maguire JR, Hartl C, Philippakis AA, del
9. Wheeler DA, Srinivasan M, Egholm M, Shen Y, Angel G, Rivas MA, Hanna M, McKenna A,
Chen L, McGuire A, He W, Chen YJ, Makhi- Fennell TJ, Kernytsky AM, Sivachenko AY,
jani V, Roth GT, Gomes X, Tartaro K, Niazi F, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ
Turcotte CL, Irzyk GP, Lupski JR, Chinault C, (2011) A framework for variation discovery
Song XZ, Liu Y, Yuan Y, Nazareth L, Qin X, and genotyping using next-generation DNA
Muzny DM, Margulies M, Weinstock GM, sequencing data. Nat Genet 43:491–498
Gibbs RA, Rothberg JM (2008) The complete 18. Bos JM, Towbin JA, Ackerman MJ (2009)
genome of an individual by massively parallel Diagnostic, prognostic, and therapeutic impli-
DNA sequencing. Nature 452:872–876 cations of genetic testing for hypertrophic car-
10. Margulies M, Egholm M, Altman WE, Attiya diomyopathy. J Am Coll Cardiol 54:201–211
S, Bader JS, Bemben LA, Berka J, Braverman 19. Soor GS, Luk A, Ahn E, Abraham JR, Woo A,
MS, Chen YJ, Chen Z, Dewell SB, Du L, Fierro Ralph-Edwards A, Butany J (2009) Hypertro-
JM, Gomes XV, Godwin BC, He W, Helgesen phic cardiomyopathy: current understanding
64 Cecilia Vecoli
and treatment objectives. J Clin Pathol 62: basic concepts and future molecular diagnos-
226–235 tics. Clin Biochem 42:755–765
20. Taylor MR, Carniel E, Mestroni L (2004) 22. Fokstuen S, Lyle R, Munoz A, Gehrig C, Lerch
Familial hypertrophic cardiomyopathy: clinical R, Perrot A, Osterziel KJ, Geier C, Beghetti M,
features, molecular genetics and molecular Mach F, Sztajzel J, Sigwart U, Antonarakis SE,
genetic testing. Expert Rev Mol Diagn 4: Blouin JL (2008) A DNA resequencing array
99–113 for pathogenic mutation detection in hypertro-
21. Rodriguez JE, McCudden CR, Willis MS phic cardiomyopathy. Hum Mutat 29:
(2009) Familial hypertrophic cardiomyopathy: 879–885
Chapter 5
Abstract
Mathematical models are now an important tool for studying cardiac electrophysiology and arrhythmias.
Utilizing these models to quantify behavior and make predictions requires solving the models computa-
tionally using numerical schemes. We discuss different solution methods and other computational con-
siderations for simulating cardiac action potentials in single cells and multicellular preparations.
Key words Cardiac action potential, Computational methods, Computer simulation, Mathematical
models, Numerical integration
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_5, © Springer Science+Business Media New York 2015
65
66 Michael M. Bell and Elizabeth M. Cherry
2 Materials
3 Methods
3.1 Numerical 1. Specify initial conditions for all state variables according to
Integration of Model the model.
Components 2. Select a temporal resolution Δt (and, for multicellular prepara-
tions, a spatial resolution Δx); efficiency and accuracy consid-
erations discussed below may affect these choices.
3. For Hodgkin-Huxley-style models, integrate the gating variables
using a forward Euler (see Note 1), backward Euler (see Note 2),
or analytic (see Note 3) approach. For example, for an arbitrary
y 1 y
gating variable y that follows the differential equation dy
dt = τ y ,
where y 1 and τy are functions of the transmembrane potential V,
a solution could be obtained using the three methods as
y þβy
y iþ1 =y i þβ y 1 y i , y iþ1 = i1þβ1 , and y iþ1 =y 1 y 1 y i eβ ,
respectively, where β=Δt=τ y . For Markov models, calculate tran-
sition rates and integrate the channel state variables using a
forward Euler approach or possibly eliminate one differential
equation by substituting in the algebraic equation for that chan-
nel (see Note 4).
4. Calculate the transmembrane currents using the updated values
of the gating variables and/or Markov state variables.
5. Update intracellular and extracellular concentrations using
forward Euler for all associated differential equations.
6. Calculate the time-dependent stimulus current, if needed
(see Note 5).
7. For multicellular preparations, apply boundary conditions
(see Note 6).
8. For multicellular preparations, calculate the diffusive current
(see Note 7).
9. Update the transmembrane potential using a forward Euler
approach.
3.2 Efficiency The following practices are recommended for promoting efficiency:
Considerations
1. Calculate and store separate variables for combinations of con-
stants that occur inside the time loop (see Note 8).
2. Preserve memory contiguity by traversing higher-dimensional
arrays in order, if applicable (see Note 9).
3. Identify computationally expensive functions of one variable
(such as exponentials and raising a variable to a non-integer
power) and replace them with lookup tables (see Note 10).
4. Be aware of trade-offs between extensibility and efficiency
(see Note 11).
5. Note that specialized architectures like supercomputers, clus-
ters, or graphics processing units are useful or even necessary
for addressing large-scale, long-time, or high-resolution pro-
blems, but such a discussion is beyond the scope of this article.
Computational Cardiac Electrophysiology. . . 69
3.3 Accuracy The accuracy achieved in a simulation depends on the temporal and
Considerations spatial resolutions used, the numerical method chosen, and the
model itself. The following practices are recommended for validat-
ing numerical solutions:
1. Use one-dimensional simulations to measure conduction
velocity achieved with different values of the spatial and tem-
poral resolution to verify that the velocity has converged
(see Note 12). Linear extrapolation to a time step of zero can
be used to determine the relative accuracy of velocity for a given
fixed spatial resolution [9].
2. For simulations in two or more spatial dimensions, especially
with simple finite-difference schemes for the spatial derivative,
check target or reentrant waves for indications of insufficient
resolution that appear as asymmetries in the wave shape [8].
For an isotropic simulation, consider using a spatial derivative
discretization whose error is rotationally symmetric to leading
order (see Note 13). Be aware of additional complications
that arise from anisotropy, fiber rotation, heterogeneity, curved
boundaries, and other geometric complexities; these may
benefit from the use of more sophisticated computational
methods [8].
3. Repeat results using finer temporal and spatial resolution to
verify that convergence has been reached. Unless a high degree
of accuracy is needed for a particular application, it usually is
more helpful to focus on qualitative similarity, as small quanti-
tative differences will be expected and, for studies in a chaotic
regime, will be unavoidable.
4. For further verification, benchmarks have been developed that
can be used to assess accuracy [16].
4 Notes
y ðtþΔt Þy ðt Þ
of the derivative: dy dt Δt . Evaluating this expression at
dy ðt i Þ
t=t i and noting that dt = f y i ; t i leads to the desired
approximation y iþ1 = y i þ f y i , t i Δt. Given an initial condi-
tion y 0 = f ðt 0 Þ, repeated iteration of the formula y iþ1 =
y i þ f y i , t i Δt produces the subsequent approximate
function values y1, y2, y3, . . .. This is known as the forward
Euler approximation and is an explicit method because the
value of y iþ1 can be determined using only the known values
of yi and f (yi, ti). Although the forward Euler method is
straightforward to implement and is sufficient for many equa-
tions in cardiac electrophysiology, certain equations require
such a small time step to produce accurate solutions using this
method that other numerical methods are preferred.
2. A slight modification to forward Euler leads to what is known
as the backward Euler method: y iþ1 = y i þ f y iþ1 , t iþ1 Δt.
Note that this method is an implicit method, as the value of
y iþ1 depends on the unknown value of f y iþ1 , t iþ1 . In gen-
eral, the backward Euler method is more computationally
intensive than the forward method, because an algebraic equa-
tion (typically nonlinear) must be solved at each step. However,
the backward version can produce accurate approximations to a
wider class of differential equations. For integrating gating
variables using this method, generally only the gating variable
itself is treated implicitly, with all other variables (such as the
transmembrane potential V) evaluated using the known values
at the current time step.
3. Note that a standard gating variable equation could be solved
analytically if there were no voltage dependence. Following this
approach, making the assumption that V does not change
significantly during one time interval (over Δt) gives the itera-
Δt=τ
tive solution y iþ1 = y 1 þ y i y 1 e y
, where y 1 and τy are
evaluated using the current voltage, V i =V ðt i Þ [17].
4. The systems of equations for Markov states are overdeter-
mined: in addition to having a differential equation for each
state variable, there is an algebraic constraint that the sum of
the states must be identically one. Thus, the final state may be
solved using the algebraic constraint (one minus the sum of the
values of all the other newly updated state variables) or using its
differential equation.
5. The stimulus current usually is a square pulse set to be twice the
diastolic threshold current needed to elicit an action potential.
This procedure avoids distorted action potentials that can occur
when the stimulus is just slightly above threshold. The stimulus
duration usually is fairly brief, often on the order of 1–2 ms.
In multicellular preparations, the stimulus typically is applied to
a small region in space. For models that track intracellular
Computational Cardiac Electrophysiology. . . 71
Acknowledgment
References
1. Hodgkin AL, Huxley AF (1952) A quantitative (2011) Cardiac cell modelling: observations
description of membrane currents and its appli- from the heart of the cardiac physiome project.
cation to conduction and excitation in nerve. Prog Biophys Mol Biol 104:2–21
J Physiol 117:500–544 8. Clayton RH, Bernus O, Cherry EM, Dierckx
2. Noble D (1962) A modification of the H, Fenton FH, Mirabella L, Panfilov AV,
Hodgkin–Huxley equations applicable to Sachse FB, Seemann G, Zhang H (2011)
Purkinje fibre action and pace-maker potentials. Models of cardiac tissue electrophysiology:
J Physiol 160:317–352 progress, challenges and open questions. Prog
3. Beeler GW, Reuter H (1977) Reconstruction Biophys Mol Biol 104:22–48
of the action potential of ventricular myocar- 9. Cherry EM, Greenside HS, Henriquez CS
dial fibres. J Physiol 268:177–210 (2003) Efficient simulation of three-dimensional
4. DiFrancesco D, Noble D (1985) A model of anisotropic cardiac tissue using an adaptive mesh
cardiac electrical activity incorporating ionic refinement method. Chaos 13:853–865
pumps and concentration changes. Philos 10. Bueno-Orovio A, Cherry EM, Fenton FH
Trans R Soc Lond B Biol Sci 307:353–398 (2008) Minimal model for human ventricular
5. Clancy CE, Rudy Y (2002) Na(+) channel action potentials in tissue. J Theor Biol
mutation that causes both Brugada and 253:544–560
long-QT syndrome phenotypes: a simulation 11. Fenton FH, Cherry EM, Hastings HM, Evans
study of mechanism. Circulation SJ (2002) Multiple mechanisms of spiral wave
105:1208–1213 breakup in a model of cardiac electrical activity.
6. Fenton FH, Cherry EM (2008) Models of car- Chaos 12:852–892
diac cell. Scholarpedia 3:1868 12. Roth BJ, Wikswo JP (1986) A bidomain model
7. Fink M, Niederer SA, Cherry EM, Fenton FH, for the extracellular potential and magnetic
Koivum€aki JT, Seemann G, Thul R, Zhang H, field of cardiac tissue. IEEE Trans Biomed
Sachse FB, Beard D, Crampin EJ, Smith NP Eng 33:467–469
74 Michael M. Bell and Elizabeth M. Cherry
13. Roth BJ (2008) Bidomain model. Scholarpedia Philos Transact A Math Phys Eng Sci
3:6221 369:4331–4351
14. The CellML Project. www.cellml.org 17. Rush S, Larsen H (1978) A practical algorithm
15. Bartocci E, Cherry EM, Glimm J, Grosu R, for solving dynamic membrane equations.
Smolka SA, Fenton FH (2011) Toward IEEE Trans Biomed Eng 25:389–392
real-time simulation of cardiac dynamics. 18. Hund TJ, Kucera JP, Otani NF, Rudy Y (2001)
In: CMSB 2011: Proceedings of the 9th inter- Ionic charge conservation and long-term
national conference on computational methods steady state in the Luo-Rudy dynamic cell
in systems biology. ACM, Paris, France, model. Biophys J 81:3324–3331
pp. 103–110 19. Cherry EM, Hastings HM, Evans SJ (2008)
16. Niederer SA, Kerfoot E, Benson AP, Bernabeu Dynamics of human atrial cell models: restitu-
MO, Bernus O, Bradley C, Cherry EM, tion, memory, and intracellular calcium
Clayton R, Fenton FH, Garny A, Heidenreich dynamics in single cells. Prog Biophys Mol
E, Land S, Maleckar M, Pathmanathan P, Biol 98:24–37
Plank G, Rodrı́guez JF, Roy I, Sachse FB, 20. Henriquez CS, Papazoglou AA (1996) Using
Seemann G, Skavhaug O, Smith NP (2011) computer models to understand the roles of
Verification of cardiac tissue electrophysiology tissue structure and membrane dynamics in
simulators using an N-version benchmark. arrhythmogenesis. Proc IEEE 84:334–354
Chapter 6
Abstract
Organization in the heart is important on multiple length scales. Myofibrillogenesis processes control the
assembly of this multi-scale architecture. Understanding myofibrillogenesis might allow us to better control
self-assembly of cardiac tissues. One approach consists of creating phenomenological models and compar-
ing these models to in vitro data from primary myocytes. In this chapter, we present a method for building
these models to recapitulate different aspects of myofibrillogenesis. We present a specific example for a
cardiomyocyte model, but the same procedure can be used to model fibrillogenesis with other mechanisms
such as motility. In sum, the models allow for a better understanding of mechanisms behind self-assembly.
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_6, © Springer Science+Business Media New York 2015
75
76 Nancy K. Drew and Anna Grosberg
2 Materials
2.2 Experimental The in vitro experiments are essential to validate the models dis-
cussed in this chapter. The experiments can utilize a very wide range
of techniques and still be used for validation purposes. It is possible
to validate models based on published data alone. However, this
approach places a limit on some of the hypotheses that can be tested
with the models. We therefore provide a list of supplies needed to run
78 Nancy K. Drew and Anna Grosberg
2.2.2 Micropatterning 1. Stamp template: mask example source (Front Range Photo-
Components Mask Co, Palmer Lake, CO, USA); silicon wafers (wafer source
example: Wafer World) spin-coated with SU-8 2002
Materials
photoresist (MicroChem Corp.) can be made using the
custom photomasks and a mask aligner (ABM Inc.) or can be
ordered from INRF UCI, Irvine, CA, USA; and polydimethyl-
siloxane (PDMS) (Sylgard 184, Dow Corning).
2. ECM: Millipore water, fibronectin (BD Biosciences).
3. Wash: phosphate-buffered saline (PBS) (Life Technologies
Corporation, Grand Island, NY, USA).
4. Blocking: Pluronic F-127 (Sigma-Aldrich, Inc., St. Louis, MO,
USA).
5. Coverslips (VWR, Radnor, PA, USA).
Methods of Myofibrillogenesis Modeling 79
3 Methods
3.1 Formulation To model the interaction between myofibrils and focal adhesions,
of Model we start with a base model of focal adhesion distribution dynamics
[14]. The model is two dimensional, which is a reasonable approxi-
3.1.1 Base Model
mation for a cell that has spread to a relatively large extracellular
matrix (ECM) island. Unbound integrins are free to diffuse
throughout the model cell. Bound integrins are fixed to the ECM
as part of the focal adhesion complex. We will designate ρ∗ ðrÞ and
ρ(r) as the density at point r of unbound and bound integrins,
respectively. Their dynamics is then described by Novak et al. [14] as
∂ρ
¼ k0 þ k1 Fðr; t Þ ρ∗ k1 ρ; ð1Þ
∂t
∂ρ∗
¼ k0 þ k1 Fðr; t Þ ρ∗ þ k1 ρ þ D ρ ∇2 ρ∗ : ð2Þ
∂t
The first term describes the change in force due to the assembly of
myofibrils that connect to point r, while the second term describes
the change in force due to the disassembly of the fibril. In Eq. 3a f1
is the product of the rate of bundle formation and the force pro-
duced by filaments of actomyosin. The density of bound integrins
at point r and r0 at time point t is ρ(r, t) and ρ(r0, t), respectively.
The fraction in this equation is the unit vector between r and r0.
The integration is done over the area of the cell, Ω. The rate
constant f 1 describes bundle disassembly. Based on biological
Methods of Myofibrillogenesis Modeling 81
∂ρn
¼ k2 Fðr; t Þρ p k2 ρn
∂t
¼ fchange of bound integrin connected to nascent myofibril density with timeg:
ð5Þ
∂ρ∗ h i
¼ k0 þ k1 Fðr; t Þ ρ∗ þ k1 ρ p þ D ρ ∇ eU μ=D ρ ∇ ρ∗ eU μ=Dρ :
∂t
ð6Þ
Now the last term in Eq. 6 includes a biasing potential field (U),
which over time, in the course of normal integrin recycling, forces
82 Nancy K. Drew and Anna Grosberg
þ ρn ðt ¼ 0Þd2 r: ð8Þ
By combing Eqs. 9 and 11, we can explicitly solve for the constant:
ð
ρ ρ p ρn d2 r
C¼ Ωð : ð12Þ
eμU =Dρ d2 r
Ω
where the ratio between bias diffusion and free diffusion coeffi-
cients is τ=μ=D ρ . Thus, Eqs. 4, 5, and 13 define the dynamics of
integrins and myofibrils, which are influenced by force and the
biasing potential.
Methods of Myofibrillogenesis Modeling 83
3.1.3 Focal Adhesions An infinite number of fibrils cannot attach to a focal adhesion due
and Fibril Connections to space limitations, but Novak et al. [14] do not account for the
physical space limitation within the focal adhesion. We believe a
focal adhesion complex can be better modeled as a surface reaction,
meaning after saturation, the presence of additional integrins does
not affect the production of force. Both types of bound integrins
are located in the same focal adhesion complex, and thus the pre-
myofibrils and myofibrils are competing for the same space. This
can be described in Langmuir isotherm form for all bound
integrins:
ρ p ðr; t Þ þ ρn ðr; t Þ
RðrÞ ¼ :
ρ0 þ ρ p ðr; t Þ þ ρn ðr; t Þ
ρ p ðr; t Þ
R p ðrÞ ¼
ρ0 þ ρ p ðr; t Þ þ ρn ðr; t Þ
ρn ðr; t Þ
Rn ðrÞ ¼
ρ0 þ ρ p ðr; t Þ þ ρn ðr; t Þ
Now, Eq. 16a describes the force at each focal adhesion at point r
and the equation is dimensionalized. The force contribution from
pre-myofibrils and nascent myofibrils is in the first and second
integral of Eq. 16a, respectively. The ratio between the strength
of pre-myofibril and nascent myofibril is defined as f0. Unlike
Eq. 3b, here we define a constant, L, which controls the contribu-
tion of fibril length to the amount of produced force. Specifically, if
L = 0, the fraction is a unit vector like in Eq. 3b and there is no
length-force dependence. Conversely, if L = 1, there is a linear
dependence of force on fiber length. The force in Eq. 16a can be
used to estimate the traction stress on the substrate [20]:
T ¼ dF=dA ð16bÞ
3.1.5 Fibril Distribution Like Novak et al. [14], we have approximated the fibers starting
with the assumption that each bound integrin is connected to all
other integrins with the same virtual label. We then approximate
the actual fibrils by calculating the average direction. In the pre-
myofibril, nascent, and total myofibril networks at each small area,
δA in a specific direction, n^ Δθ, we calculate the total length of
the fiber passing through, where n^ is a unit vector. For the pre-
myofibril network, we obtain
ðð
p
^Þ
S NN ðr; n ðα1 þ α2 Þ R p ðr þ α1 n^ ÞR p ðr α2 n^ Þ dα1 dα2 ;
ð19Þ
S total ðrÞ
S ðrÞ ¼ ¼ fFiber density in δA g: ð24Þ
S cell
Similarly, in a small area, δA, around point r and in direction n^ , the
fiber density distribution is the fiber length in the direction of n^
derived from Eq. 22 to be
S NN ðr; n ^Þ
^Þ ¼
S ðr; n ¼ fAngular fiber distributiong : ð25Þ
S total ðrÞ
86 Nancy K. Drew and Anna Grosberg
We will assume that for any point r we can approximate the fibers as
straight rods within the area δA. The orientational order parameter
(OOP) classifies the orientational order of rod distribution and is
one for perfectly aligned rods and zero for isotropic systems [21].
The main orientation of rod distribution is defined as the director.
At each point r in the cell, we determine the director of fiber
distribution and OOP. The coefficients of the Fourier series of the
^ Þ were used to calculate the OOP
distribution of fiber density S ðr; n
and director
ð ð
2 π 2 π
a ðrÞ ¼ ^ Þ cos 2θ dθ,
S ðr; n b ðrÞ ¼ ^ Þ sin 2θ dθ; ð26Þ
S ðr; n
π 0 π 0
π pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
ffi
OOP ðrÞ ¼ a2 þ b 2
2
¼ fLocal orientational order parameterg, and ð27Þ
"sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi #
1 a b 1 a
n^ 0 ðrÞ ¼ þ pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi, pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
2 2 a2 þ b 2 b 2 2 a2 þ b 2
3.1.6 Parameter Fitting In the work described by Grosberg et al. [18], the experiments were
and Validation done specifically for the modeling effort. It is possible to fit para-
meters using published data. We will give a very brief overview of
the experiments performed to fit and validate this model to point
the reader in the right direction. However, since this chapter is
focused on the modeling aspect, the experiments will not be dis-
cussed in depth.
To create a template for parameter fitting, a cardiomyocyte was
cultured on a stair-shaped ECM island and stained for actin fibrils.
The stain shows shadows where the sarcomeres have coupled the
aligned actin fibrils, giving a visual measure of the location of
greater parallel coupling [18]. The model parameters were fitted
Methods of Myofibrillogenesis Modeling 87
3.1.7 Testing Hypotheses These types of models can be used to test biological hypotheses.
For example, Grosberg et al. hypothesized that longer fibers pro-
duce more force than shorter fibers. It is possible to test for this
because Eq. 16a includes a fiber length-developed tension coeffi-
cient L. In Eq. 16a force can be made independent of fiber length
by setting L=0 and force dependent on fiber length by setting L = 1.
Running the simulation with the two parameter options will result
in two different images of fibril distributions within the cell. These
can then be compared to in vitro images to test the hypothesis.
Grosberg et al. also hypothesized that there is active parallel
coupling between neighboring myofibrils. Testing for active align-
ment is possible by changing τ, the ratio between bias diffusion and
free diffusion, which is included in Eq. 17. By setting the parameter
τ=0 in Eq. 13, active alignment can be turned off and it can be
turned on by setting τ=150. Again, the simulation results would
be compared to the in vitro images to determine the validity of the
hypothesis. Some hypotheses are easier to test by comparing T
(Eq. 16b) to results of traction force experiments.
3.1.8 Motility There are no current models that combine all the functionalities of
myofibrillogenesis that we describe in previous sections and cell
motility. It should be possible to incorporate motility into this
model by using concepts from Dayel et al. [13]. The model
would need to be updated to include the change of cell shape
during cell migration. Thus, Ω, the cell geometry would change
at every time step. Since the cell is no longer stationary, the grid
inside the cell is constantly changing. At each time step, the model
needs to be updated with the points (r) that are actually in the cell.
This would present several challenges, such as a changing grid and
competing mechanisms on similar time scales. However, incorpor-
ating these changes would allow the model to predict the internal
structure for a migrating cell.
3.2 In Vitro This chapter is focused on modeling, and the in vitro experiments
Experiments are used for model validation. The work done by Grosberg et al.
included in vitro experiments on neonatal rat ventricular myocytes
[18]. The same model was also later validated for mouse
88 Nancy K. Drew and Anna Grosberg
3.2.1 Cardiac Myocyte Cardiomyocytes were isolated from neonatal Sprague Dawley rats.
Culture Heart tissue obtained from the rats was placed in a trypsin solution
overnight and collagenase was used to dissociate the cells from the
tissue [18]. A pre-plating separation technique was used to obtain
purified cardiomyocytes [18].
3.2.2 Micropatterning PDMS was spin-coated onto glass coverslips and incubated for
Substrates 8–12 h. Square, triangular, stair-shaped, and circular islands of
fibronectin were micropatterned on substrates using PDMS stamps
[24, 18]. These substrates were later used for immunostaining. For
traction force microscopy, substrates were coated with soft gels,
which were also micropatterned with ECM islands [18].
3.2.3 Traction Force Images of beating cardiomyocytes above a gel of fluorescent beads
Microscopy Data were collected as described previously [18]. Consecutive images
Measurement and Analysis were taken and used to calculate the displacement of the beads
positions [25]. A method described previously was used to calculate
traction force [18].
3.2.4 Immunofluorescent Stains for actin, vinculin, or alpha-actinin were done on cardiomyo-
Staining and Imaging cytes using a procedure similar to the one described in Grosberg
et al. [18]. Primary stains Alexa Fluor 488 Phalloidin (actin stain),
Clone hVIN-1 (vinculin stain), Clone EA-53 (alpha-actinin stain),
and DAPI (nuclei stain) were used on the myocytes. The secondary
stains used on the myocytes were Goat anti-mouse IgG Alexa Fluor
633 (alpha-actinin stain) and Goat anti-mouse IgG Alexa Fluor 594
(vinculin stain). After staining the myocytes, a microscope was used
to complete imaging.
4 Notes
h i
ρn ðt þ Δt Þ ¼ k2 Fðr; t Þρ p k2 ρn Δt þ ρn ðt Þ: ð31Þ
( )
r r0 r00 r0 2 00
00
1 0 00 0 2 0
r r0 ¼ 00 r r r r r r
r r 0 2
!
h 00 0
0
i 2
r r rr :
ð36Þ
^ Þ Δα1 Δα2 ∑ ∑ ðα1 þ α2 Þ R p ðr þ α1 n^ ÞR p ðr α2 n^ Þ ;
S NN ðr; n
8α1 8α2
ð37Þ
^ Þ;
S total ðrÞ ¼ Δθ∑ S NN ðr; n ð38Þ
8n^
S total ðrÞ
S ðrÞ ¼ ; ð40Þ
S cell
^Þ
S dθ ðr; n
S ðr, n^ ðθÞÞ ¼ ; ð41Þ
S total ðrÞ
2Δθ 2Δθ
aðrÞ ¼ ^ Þ cos 2θ,
∑ S ðr; n b ðrÞ ¼ ^ Þ sin 2θ; ð42Þ
∑ S ðr; n
π 8n^ π 8n^
π pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
ffi
OOP ðrÞ ¼ a2 þ b 2 ; ð43Þ
2
"sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi #
1 a b 1 a
n^ 0 ðrÞ ¼ þ pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi, pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi : ð44Þ
2 2 a2 þ b b 2 2 a2 þ b 2 2
References
1. Alberts B, Johnson A, Lewis J, Raff M, Roberts 3. Chen JJ, Liu W, Zhang HY, Lacy L, Yang XX,
K, Walter P (2002) Molecular biology of the Song SK, Wickline SA, Yu X (2005) Regional
cell, 4th edn. Garland, New York ventricular wall thickening reflects changes in
2. Feinberg AW, Alford PW, Jin H, Ripplinger cardiac fiber and sheet structure during con-
CM, Werdich AA, Sheehy SP, Grosberg A, traction: quantification with diffusion tensor
Parker KK (2012) Controlling the contractile MRI. Am J Physiol Heart Circ Physiol 289
strength of engineered cardiac muscle by hier- (5):H1898–H1907
archal tissue architecture. Biomaterials 4. Sheehy SP, Grosberg A, Parker KK (2012) The
33:5732–5741. doi:10.1016/j.biomaterials. contribution of cellular mechanotransduction
2012.04.043 to cardiomyocyte form and function. Biomech
Methods of Myofibrillogenesis Modeling 91
Abstract
The mechanical bidomain model provides a macroscopic description of cardiac tissue biomechanics and also
predicts the microscopic coupling between the extracellular matrix and the intracellular cytoskeleton of
cardiomyocytes. The goal of this chapter is to introduce the mechanical bidomain model, to describe the
mathematical methods required to solve the model equations, and to predict where the membrane forces
acting on integrin proteins coupling the intracellular and extracellular spaces are large.
Key words Displacement, Extracellular matrix, Integrin, Intracellular cytoskeleton, Length constant,
Mathematical modeling, Mechanical bidomain model, Membrane, Pressure, Shear modulus, Strain,
Stress
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_7, © Springer Science+Business Media New York 2015
93
94 Bradley J. Roth
2 Methods
2.1 Deriving the 1. Four factors contribute to the intracellular stress τi: (a) an
Equations of the intracellular hydrostatic pressure p; (b) an isotropic shear stress,
Mechanical Bidomain proportional to the intracellular shear strain εi with shear mod-
Model ulus ν; (c) an anisotropic Young’s modulus along the myocardial
fibers γ; and (d) an active tension acting along the fibers,
T (see Note 3). In two dimensions (see Note 4), the intracellular
stress tensor consists of three terms: τixx, τiyy, and τixy,
∂wx ∂w y 1 ∂w x ∂w y
εexx ¼ , εey y ¼ , εex y ¼ þ : ð4Þ
∂x ∂y 2 ∂y ∂x
∂ϕ ∂ϕ ∂η ∂η
ux ¼ , uy ¼ , wx ¼ , wy ¼ : ð5Þ
∂y ∂x ∂y ∂x
∂τixx ∂τix y
þ ¼ K ðux wx Þ,
∂x ∂y
ð6Þ
∂τix y ∂τiy y
þ ¼ K uy wy ;
∂x ∂y
∂τexx ∂τex y
þ ¼ K ðux w x Þ,
∂x ∂y
ð7Þ
∂τex y ∂τey y
þ ¼ K u y w y :
∂x ∂y
3
∂p ∂ ϕ ∂3 ϕ ∂3 ϕ ∂T
þν þ þ γ þ
∂x ∂x ∂y ∂y
2 3 ∂x ∂y ∂x
2
∂ϕ ∂η
¼K ; ð8Þ
∂y ∂y
96 Bradley J. Roth
3
∂p ∂ ϕ ∂3 ϕ ∂ϕ ∂η
ν þ ¼ K ; ð9Þ
∂y ∂x 3 ∂x∂y 2 ∂x ∂x
3
∂q ∂ η ∂3 η ∂ϕ ∂η
þμ þ ¼ K ; ð10Þ
∂x ∂x 2 ∂y ∂y 3 ∂y ∂y
3
∂q ∂ η ∂3 η ∂ϕ ∂η
μ þ ¼K : ð11Þ
∂y ∂x 3 ∂x∂y 2 ∂x ∂x
2.2 Solving the 1. The mechanical bidomain equations can be solved using either
Equations of the analytical techniques or numerical methods (see Note 11).
Mechanical Bidomain Here, an analytical solution is derived for a simple example
Model that shows many of the key features of the model (see
Note 12). Consider a long strip of cardiac tissue of width 2L.
Let the x direction be along this strip and assume the fibers lie
along the x direction, and let y be the direction perpendicular to
the fibers (Fig. 2). Assume the active tension T is zero. The
tissue is passively sheared along its surfaces: to the right over
the surface y ¼ L and to the left over the surface y ¼ L. In
particular, assume that the shear force F is applied to the
extracellular space at the tissue boundary and is only
Fig. 2 A long, two-dimensional strip of cardiac tissue. The fibers (thin horizontal
lines) lie along the x-axis. A shear force is applied to the extracellular space at
the tissue boundary y =L; the intracellular space is free at the boundary. (a)
The intracellular and extracellular displacements, u and w, as functions of y. The
value of the length constant σ is small enough that the difference between u and
w is negligible on this scale. (b) The differences between the extracellular
displacement and the intracellular displacement, u w. The length of the
arrows is magnified compared to panel (a). The difference u w is
significant only within a few length constants of the tissue surface
Mechanical Bidomain Model for Analyzing Cardiomyocytes 97
y y y
B B D
ν sinh ¼ K 2Ay þ sinh 2C y sinh ; ð14Þ
σ3 σ σ σ σ σ
y y y
D B D
μ 3 sinh ¼ K 2Ay þ sinh 2C y sinh : ð15Þ
σ σ σ σ σ σ
F σ2
A¼ , B¼ F: ð17Þ
2ðν þ μÞ ðν þ μÞ cosh Lσ
F 1 2 ν 2 coshð y=σ Þ
ηðx; y Þ ¼ y þ σ : ð19Þ
ðν þ μÞ 2 μ coshðL=σ Þ
98 Bradley J. Roth
F sinhð y=σ Þ
ux w x ¼ σ : ð22Þ
μ coshðL=σ Þ
Except near the tissue surface, the shear strain in each space is
approximately F/2(ν + μ). At the tissue surface, the intracellu-
lar shear strain is zero and the extracellular shear strain is F/2μ.
3 Notes
1. The electrical bidomain model [5] has been used for decades to
simulate pacing and defibrillation of the heart. The mechanical
bidomain model has many similarities to the electrical bidomain
model.
2. Figure 1 indicates that the extracellular matrix is coupled to the
cytoskeleton across the cell membrane by membrane proteins,
such as integrins. Differences between the intracellular and
extracellular displacements, u and w, result in a shear force
acting between the intracellular and extracellular sides of the
protein. Integrins may play a key role in mechanotransduction
[6], remodeling, and mechanoelectric feedback [7].
3. This separation of the stress into several components follows
the model of cardiac tissue biomechanics derived by Ohayon
and Chadwick [8]. They assumed a hydrostatic pressure
because the tissue is primarily water, an active tension caused
by the myocardial fibers and an isotropic shear associated with
the collagen matrix. The main difference between their model
and the mechanical bidomain model is that their model was a
“monodomain,” in which all three contributions to the stress
were used to describe the overall tissue behavior. In a “bido-
main,” the active tension is assigned to the intracellular space
and the collagen shear to the extracellular space.
4. In this analysis, the model is restricted to two dimensions (x, y).
It can be generalized to three dimensions without too much
difficulty. In this derivation of the model, the fibers are assumed
to lie in the x direction.
100 Bradley J. Roth
∂y∂x
= 0. The scalar function ϕ specifies both components of
the vector function u and guarantees that the tissue is
incompressible.
8. In a monodomain model, the equations of mechanical
∂τ ∂τ ∂τ
equilibrium are [9] ∂τ∂xxx þ ∂yx y = 0 and ∂xx y þ ∂yy y = 0. The phys-
ical meaning of these equations is that the sum of the forces in
both the x and y directions is zero everywhere in the tissue.
9. The coupling K(u w) is the key new term that distinguishes a
bidomain model from a monodomain model. This term is the
force acting across the cell membrane, like in Fig. 1. In this
version of the mechanical bidomain model, the coupling is a
simple Hookean spring; the force equals the negative of the
spring constant times the displacement of the spring from
equilibrium.
10. The first two equations (Eqs. 8 and 9) govern the intracellular
space and the second two (Eqs. 10 and 11) the extracellular
space. Equations 8 and 10 describe forces in the x direction and
Eqs. 9 and 11 in the y direction.
11. A numerical algorithm for solving the mechanical bidomain
equations would permit the solution of many more problems
than do analytical methods, which are generally restricted to
idealized geometries. However, numerical methods to solve
Eqs. 8–11 are not yet developed. One advantage of analytical
solutions is that they often illustrate the physical behavior
better than numerical solutions [2, 4].
12. Another analytical solution can be found in [4]. However, that
solution uses polar coordinates (r, θ) rather than Cartesian
coordinates (x, y), complicating the mathematics.
13. Determining the correct boundary conditions at the surface of
a bidomain remains an open question. Punal and Roth [2]
Mechanical Bidomain Model for Analyzing Cardiomyocytes 101
19. In Eqs. 20 and 21 the monodomain terms are large but are
exactly the same in the intracellular and extracellular spaces, so
they do not contribute to the difference ux wx. The mem-
brane force is therefore entirely due to the bidomain term
(Fig. 2b). The main point of the mechanical bidomain model
is to predict these small differences between the two
displacements.
References
1. Puwal S, Roth BJ (2010) Mechanical bidomain 6. Chiquet M, Gelman L, Lutz R, Maier S (2009)
model of cardiac tissue. Phys Rev E 82:041904 From mechanotransduction to extracellular
2. Punal VM, Roth BJ (2012) A perturbation solu- matrix gene expression in fibroblasts. Biochim
tion of the mechanical bidomain model. Bio- Biophys Acta 1793:911–920
mech Model Mechanobiol 11:995–1000 7. Dabiri BE, Lee H, Parker KK (2012) A
3. Roth BJ (2013) The mechanical bidomain potential role for integrin signaling in mechan-
model: a review. ISRN Tiss Eng 2013:863689 oelectrical feedback. Prog Biophys Mol Biol
4. Roth BJ (2013) Boundary layers and the distri- 110:196–203
bution of membrane forces predicted by the 8. Ohayon J, Chadwick RS (1988) Effects of colla-
mechanical bidomain model. Mech Res Com- gen microstructure on the mechanics of the left
mun 50:12–16 ventricle. Biophys J 54:1077–1088
5. Henriquez CS (1993) Simulating the electrical 9. Love AEH (1944) A treatise on the mathemati-
behavior of cardiac tissue using the bidomain cal theory of elasticity. Dover, New York
model. Crit Rev Biomed Eng 21:1–77
Chapter 8
Abstract
The incidence of cardiovascular disease represents a significant and growing health-care challenge to the
developed and developing world. The ability of native heart muscle to regenerate in response to myocardial
infarct is minimal. Tissue engineering and regenerative medicine approaches represent one promising
response to this difficulty. Here, we present methods for the construction of a cell-seeded cardiac patch
with the potential to promote regenerative outcomes in heart muscle with damage secondary to myocardial
infarct. This method leverages iPS cells and a fibrin-based scaffold to create a simple and commercially viable
tissue-engineered cardiac patch. Human-induced pluripotent stem cells (hiPSCs) can, in principle, be
differentiated into cells of any lineage. However, most of the protocols used to generate hiPSC-derived
endothelial cells (ECs) and cardiomyocytes (CMs) are unsatisfactory because the yield and phenotypic
stability of the hiPSC-ECs are low, and the hiPSC-CMs are often purified via selection for expression of a
promoter-reporter construct. In this chapter, we describe an hiPSC-EC differentiation protocol that
generates large numbers of stable ECs and an hiPSC-CM differentiation protocol that does not require
genetic manipulation, single-cell selection, or sorting with fluorescent dyes or other reagents. We also
provide a simple but effective method that can be used to combine hiPSC-ECs and hiPSC-CMs with
hiPSC-derived smooth muscle cells to engineer a contracting patch of cardiac cells.
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_8, © Springer Science+Business Media New York 2015
103
104 Lei Ye et al.
2 Materials
3 Methods
3.1 hiPSC Culture Irradiated MEFs were cultured in 6-well plate with MEF growth
medium (90 % DMEM supplemented with 10 % FBS, 1 penicillin-
streptomycin, 1 NEAA, 1 mM glutamine, and 1) for 24 h.
On the day of passaging hiPSCs, MEFs are washed with DPBS
followed twice with hiPSC growth medium (85 % DMEM/F12
supplemented with 15 % knockout serum, 8 ng/mL bFGF, 0.5
penicillin-streptomycin, 1 NEAA, 1 mM glutamine, and 55 μM
mercaptoethanol) before used for hiPSC cell culture.
hiPSC would be added with 100 U/mL collagenase type IV in
DMEM/F12 for 5–7 min. Then, the collagenase medium would
be removed. hiPSC would be washed with DPBS (once) and hiPSC
medium (twice). Then, hiPSC colonies would be scratched into
small clusters and split into 6-well plates pre-cultured with irra-
diated MEF at 1:3 ratio.
3.2 Differentiation This hiPSC-EC differentiation protocol is performed with cells that
of hiPSCs into ECs have been suspended in a three-dimensional fibrin scaffold. The
hiPSC-containing scaffold is created 2 days before (i.e., on Day 2)
differentiation is induced on Day 0; then, the differentiation media
is modified over the ensuing 5 days, and the hiPSC-ECs are purified
on Day 14 (Fig. 1).
3.2.1 Day 2 1. Wash the hiPSCs with DPBS (calcium and magnesium free),
and then incubate them with 2 mL Versene for 5 min at 37 C.
2. Aspirate the Versene solution, wash the hiPSCs once with
DPBS and once with hiPSC culture medium, and then dissoci-
ate the hiPSC population into single cells by gently pipetting
them with hiPSC culture medium.
3. Add the dissociated cells to a 15 mL centrifuge tube containing
fresh hiPSC culture medium.
4. Centrifuge the cells for 5 min at 200 g (Model 5430, Eppen-
dorf, USA). Then, resuspend the cells in hiPSC culture
medium and centrifuge them for another 5 min at 200 g.
5. Resuspend the hiPSCs in mTeSR1 medium supplemented with
10 μM ROCK inhibitor, and then measure the cell density with
a hemacytometer (see Note 2).
3.2.2 Day 1 1. Replace the medium with 2 mL of fresh mTeSR1 medium only.
3.2.3 Day 0 1. Remove the mTeSR1 medium; wash the scaffold twice with
DPBS, and then culture the scaffold in EGM2-MV medium
containing 1 B27 minus insulin 50 ng/mL Activin-A and
25 ng/mL BMP4 for 24 h (see Note 4).
3.2.4 Day 1 Through 1. On Day 1, replace the supernatant with EGM2-MV medium
Day 3 containing B27 minus insulin, 50 ng/mL VEGF, 10 ng/mL
TGF-β1, and 100 ng/mL erythropoietin; culture the scaffold
for 2 days.
2. On Day 3, replace the supernatant with fresh EGM2-MV
medium containing the same concentrations of B27 minus
insulin, VEGF, TGF-β1, and erythropoietin; culture the scaf-
fold for 2 days.
3.2.6 Day 14 1. Wash the cells with DPBS and detach them from the plate by
(Purification) adding 0.25 % trypsin for 5 min; then, neutralize the trypsin
Fabrication of a Myocardial Patch with Cells Differentiated from Human-Induced. . . 111
3.3.1 Day 4 1. Prepare the hiPSCs as described under Day 2, steps 1–6 of
the hiPSC-EC differentiation protocol.
2. Coat the wells of a 6-well plate with growth factor-reduced
Matrigel; then, add 1 106 of the prepared hiPSCs and
2.5 mL of mTeSR1 medium supplemented with 10 μM
ROCK inhibitor to each well (see Notes 1, 2 and 5).
3. Change the mTeSR1/ROCK inhibitor medium daily until the
cells reach 100 % confluence.
3.3.2 Day 0 1. Remove the mTeSR1 medium, wash the cells twice with
RPMI1640 medium, and then culture the cells in RPMI1640
medium supplemented with B27 minus insulin, 50 ng/mL
Activin-A, and 25 ng/mL BMP4 (see Note 4).
3.3.4 Day 4 Through 1. Wash the cells with RPMI1640 medium, and then culture
~Day 15 them with RPMI1640 medium supplemented with B27
complete.
2. Replace the medium with fresh RPMI1640/B27 complete
medium every 3 days; contracting cells typically begin to appear
on Day 10 after differentiation is initiated.
3. Continue culturing the cells for 10–11 more days.
3.4 Manufacture of a The benefit of engineered cardiac patches for the treatment of
Contracting, Fibrin- injured myocardium has been convincingly demonstrated in
Based, Cardiac-Cell small-animal studies. Here, we present a simple and effective
Patch method for combining hiPSC-ECs and hiPSC-CMs with hiPSC-
SMCs to create a patch of contracting cardiac cells that may be used
for subsequent large-animal and clinical investigations of cell ther-
apy. We suggest that the hiPSC-ECs and hiPSC-CMs be generated
via the protocols described above [15].
1. Add two million hiPSC-CMs, one million hiPSC-ECs, and
one million hiPSC-SMCs to a solution containing 0.12 mL of
25 mg/mL fibrinogen and 0.56 mL of 20 mM HEPES
[16, 17].
2. Mix the cell-containing fibrinogen solution with a solution
containing 0.017 mL thrombin (20 U/mL), 0.0013 mL
CaCl2 (2 M), and 0.3 mL RPMI1640 medium in the wells of
a 6-well plate to a final volume of 1 mL/well; the mixture will
solidify within a few minutes.
3. Add culture medium consisting of RPMI1640 medium, 10 %
FBS, 1 penicillin-streptomycin, and 2 mg/mL ε-aminocaproic
acid to the wells.
Fabrication of a Myocardial Patch with Cells Differentiated from Human-Induced. . . 113
4 Notes
Acknowledgments
References
1. Gamba L, Harrison M, Lien CL (2014) Car- regeneration in the final 1-year results of the
diac regeneration in model organisms. Curr CADUCEUS trial (CArdiosphere-Derived
Treat Opt Cardiovasc Med 16:288 aUtologous stem CElls to reverse ventricUlar
2. Basu J, Ludlow JW (2010) Platform technolo- dySfunction). J Am Coll Cardiol 63:110–122
gies for tubular organ regeneration. Trends 6. Caplan AI, Correa D (2011) The MSC: an
Biotechnol 28:526–533 injury drugstore. Cell Stem Cell 9:11–15
3. Lakshmanan R, Krishnan UM, Sethuraman S 7. Guthrie K, Bruce A, Sangha N et al (2013)
(2012) Living cardiac patch, the elixir for car- Potency evaluation of tissue engineered and
diac regeneration. Exp Opin Biol Ther regenerative medicine products. Trends Bio-
12:1623–1640 technol 31:505–514
4. Freytes DO, Santambrogio L, Vunjak- 8. Choi KD, Yu J, Smuga-Otto K, Salvagiotto G,
Novakovic G (2012) Optimizing dynamic Rehrauer W, Vodyanik M, Thomson J, Slukvin
interactions between cardiac patch and inflam- I (2009) Hematopoietic and endothelial differ-
matory host cells. Cells Tissues Organs entiation of human induced pluripotent stem
195:171–182 cells. Stem Cells 27:559–567
5. Malliaras K, Makkar RR, Smith RR et al (2014) 9. Li Z, Hu S, Ghosh Z, Han Z, Wu JC (2011)
Intracoronary cardiosphere-derived cells after Functional characterization and expression
myocardial infarction: evidence of therapeutic profiling of human induced pluripotent stem
114 Lei Ye et al.
cell- and embryonic stem cell-derived endothe- JH, Conklin BR, Chen HS, Mercola M (2009)
lial cells. Stem Cells Dev 20:1701–1710 Lentiviral vectors and protocols for creation of
10. Rufaihah AJ, Huang NF, Jame S, Lee JC, stable hesc lines for fluorescent tracking and
Nguyen HN, Byers B, De A, Okogbaa J, Roll- drug resistance selection of cardiomyocytes.
ins M, Reijo-Pera R, Gambhir SS, Cooke JP PLoS One 4:e5046
(2011) Endothelial cells derived from human 14. Ye L, Haider H, Esa WB, Law PK, Zhang W, Su
ipscs increase capillary density and improve per- L, Zhang Y, Sim EK (2007) Nonviral vector-
fusion in a mouse model of peripheral arterial based gene transfection of primary human skel-
disease. Arterioscler Thromb Vasc Biol 31: etal myoblasts. Exp Biol Med (Maywood)
e72–e79 232:1477–1487
11. Anderson D, Self T, Mellor IR, Goh G, Hill SJ, 15. Hill KL, Obrtlikova P, Alvarez DF, King JA,
Denning C (2007) Transgenic enrichment of Keirstead SA, Allred JR, Kaufman DS (2010)
cardiomyocytes from human embryonic stem Human embryonic stem cell-derived vascular
cells. Mol Ther 15:2027–2036 progenitor cells capable of endothelial and
12. Huber I, Itzhaki I, Caspi O, Arbel G, Tzuker- smooth muscle cell function. Exp Hematol
man M, Gepstein A, Habib M, Yankelson L, 38:246–257
Kehat I, Gepstein L (2007) Identification and 16. Zhang G, Nakamura Y, Wang X, Hu Q, Suggs
selection of cardiomyocytes during human LJ, Zhang J (2007) Controlled release of stro-
embryonic stem cell differentiation. FASEB J mal cell-derived factor-1 alpha in situ increases
21:2551–2563 c-kit + cell homing to the infarcted heart. Tis-
13. Kita-Matsuo H, Barcova M, Prigozhina N, Sal- sue Eng 13:2063–2071
omonis N, Wei K, Jacot JG, Nelson B, Spiering 17. Zhang G, Wang X, Wang Z, Zhang J, Suggs L
S, Haverslag R, Kim C, Talantova M, Bajpai R, (2006) A pegylated fibrin patch for mesenchy-
Calzolari D, Terskikh A, McCulloch AD, Price mal stem cell delivery. Tissue Eng 12:9–19
Chapter 9
Abstract
Human pluripotent stem cells have tremendous replicative capacity and demonstrated potential to generate
functional cardiomyocytes. These cardiomyocytes represent a promising source for cell replacement therapy
to treat heart disease and may serve as a useful tool for drug discovery and disease modeling. Efficient
cardiomyocyte differentiation, a prerequisite for the application of stem cell-derived cardiomyocytes, can be
achieved with a growth factor-guided method. Undifferentiated cells are sequentially treated with activin
A and BMP4 in a serum-free and insulin-free medium and then maintained in a serum-free medium with
insulin. This method yields as much as >75 % cardiomyocytes in the differentiation culture within 2 weeks,
and the beating cardiomyocytes have expected molecular, cellular, and electrophysiological characteristics.
In this chapter, we describe in detail the differentiation protocol and follow-up characterization focusing on
immunocytochemistry, quantitative RT-PCR, and flow cytometry analysis.
Key words Cardiomyocytes, Differentiation, Flow cytometry analysis, Growth factors, Immunocyto-
chemical analysis, Pluripotent stem cells, qRT-PCR, Serum-free medium
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_9, © Springer Science+Business Media New York 2015
115
116 Rajneesh Jha et al.
2 Materials
3 Methods
3.1 Growth Factor- Stock cultures of undifferentiated hPSCs are maintained in feeder-
Guided Cardiomyocyte free culture conditions and passaged every 5–7 days using collage-
Differentiation nase IV or Versene. Examples are given using cells maintained on
Matrigel in MEF-CM [24]. Similar method can be used for cells
3.1.1 Culture of maintained in serum-free medium supplemented with growth fac-
Undifferentiated hPSCs tors [14]. Detailed methods for culture and characterization of
undifferentiated hPSCs are described elsewhere [25]. Note that
successful cardiomyocyte differentiation is highly dependent upon
the quality of undifferentiated cells (see Note 3).
Cardiomyocyte differentiation can be achieved through
sequential treatment of activin A and BMP4 in RPMI/B27
medium [8]. As illustrated in Fig. 1a, to induce cardiomyocyte
differentiation, undifferentiated cells are first cultured on Matrigel
in MEF-CM for a few days and then treated with activin A for 1 day
followed by BMP4 for 4 days in RPMI/B27 insulin-free medium.
Insulin-free B27 is expected to improve differentiation efficiency
because insulin negatively affects cardiomyocyte differentiation
[26, 27]. Subsequently, the growth factors are removed, and the
Efficient Differentiation of Cardiomyocytes from Human Pluripotent Stem Cells. . . 121
Fig. 1 Cardiomyocyte differentiation and characterization. Differentiation procedure is shown in (a). When
undifferentiated cells become fully confluent after cultured on Matrigel in MEF-CM as shown in (b), cells were
induced to differentiate by treatment with activin A (AA) for 1 day followed by BMP4 for 4 days in RPMI/B27
insulin-free medium. Cells were maintained in RPMI/B27 for 10–15 days after the treatment of growth factors
and were harvested for in vitro characterization, such as immunocytochemical analysis, qRT-PCR, and flow
cytometry, as shown in (c), (d), and (e), respectively. The day of adding activin A is designated as day 0
cells are maintained in RPMI/27 for 10–20 days. Cells are har-
vested for in vitro characterization at the end of differentiation or
earlier during differentiation when characterizing progenitors.
3.1.2 Setup 1. After stock culture of undifferentiated cells has been main-
Differentiation Cultures tained for 4–6 days or until colonies occupy approximately
80 % of the well surface area, cells are ready to be passaged
and set up for cardiac differentiation. Example here is stock
culture maintained in 6-well plates.
2. Warm up required amount of MEF-CM for setting up differ-
entiation cultures and supplement the MEF-CM with 8 ng/ml
bFGF (see Note 4).
122 Rajneesh Jha et al.
3. Remove medium from each well of the stock culture and rinse
cells with 2 ml D-PBS/well.
4. Aspirate D-PBS and add 2 ml Versene to each well and incubate
at 37 C for 5 min (see Note 5).
5. Remove Versene and add 1 ml MEF-CM into each well.
6. Dislodge cells by gently adding 1 ml MEF-CM to the wells and
then triturating (approximately ten times) with 1-ml pipet tip
to make it single-cell suspension (see Note 6). Transfer and pool
the cells into a 50-ml conical tube.
7. Further, take 1 ml MEF-CM to wash each well by transferring
MEF-CM from one well to another and finally pool into the
conical tube.
8. Count cells using trypan blue with a hemacytometer and make
dilution of required cells in a 50-ml tube (which works better
than a 15-ml tube for properly mixing and evenly distributing
cells into wells).
9. Seed 2 105 to 4 105 cells in 1 ml of MEF-CM for each well
of a 24-well Matrigel-coated plate. For other culture formats,
seed cells at 1 105 to 2 105 cells/cm2. Feed cells daily by
replacing MEF-CM supplemented with bFGF (8 ng/ml) until
cells compactly cover the wells (~100 % confluence) (see Note 7).
10. Passage the rest of the culture as stock culture using
200 units/ml collagenase IV or Versene. Detach the cells from
the surface using a cell scraper and triturate the cells less than ten
times using a 5-ml pipet and culture the cells on Matrigel-coated
6-well plates in MEF-CM supplemented with 8 ng/ml bFGF.
3.1.3 Growth Factor- When undifferentiated cells reach full confluence, typically 2–4 days
Induced Differentiation after the seeding, the cultures are sequentially treated with activin A
for 1 day followed by BMP4 for 4 days (see Note 8). The day when
activin A treatment starts is designated as differentiation day 0.
1. Aspirate medium and add 1 ml/well of RPMI/B27 insulin-free
medium supplemented with 100 ng/ml activin A onto a 24-
well plate. Adjust medium volume based on culture vessel
surface areas, if other culture formats are used (we have
obtained successful differentiation in 96-well plates and T75
or T225 flasks).
2. 24 h later (on differentiation day 1), aspirate the medium to
remove activin A.
3. Add RPMI/B27 insulin-free supplemented with BMP4 at
10 ng/ml (1 ml/well for a 24-well plate).
Efficient Differentiation of Cardiomyocytes from Human Pluripotent Stem Cells. . . 123
11. Perform cell counting using trypan blue and aliquot cells for
flow cytometry assays.
12. For immunocytochemistry or other assays, centrifuge, resus-
pend the cells in RPMI/B27 medium, and seed the cells onto
Matrigel or gelatin-coated 96-well plates or chamber slides.
3.2.3 Flow Cytometry Flow cytometry analysis permits quantitative analysis of purity of
Analysis cardiomyocytes in differentiation cultures. Here we provide a
procedure for intercellular staining of cardiomyocyte-associated
protein α-actinin. Other intercellular proteins can be detected
126 Rajneesh Jha et al.
Table 1
Primers and probes for real-time RT-PCR assays
Genes Sequences
TaqMan assays
NKX2-5 Primers and probe Purchased from Applied Biosystems
(assay number Hs00231763_m1)
TNNT2 Primers and Purchased from Applied Biosystems
probe (assay number Hs00165960_m1)
18S Primers and Purchased from Applied Biosystems
probe (assay number Hs03003631_g1)
SYBR Green
reactions
NKX2-5 Forward CTGTCTTCTCCAGCTCCACC
Reverse TTCGACCTGCAGGAGAAGTT
(http://primerdepot.nci.nih.gov/)
TNNT2 Forward CTGTCTTCTCCAGCTCCACC
Reverse TTCTATCCACGTGCCTACAGC
(http://primerdepot.nci.nih.gov/)
GAPDH Forward GCGGGTCTTGGAGACTTTCT
Reverse TTCGACCTGCAGGAGAAGTT
(http://pga.mgh.harvard.edu/primerbank/)
4 Notes
Acknowledgments
References
1. Kehat I, Kenyagin-Karsenti D, Snir M, Segev H, pluripotent stem cells to cardiomyocytes: a
Amit M, Gepstein A, Livne E, Binah O, methods overview. Circ Res 111:344–358
Itskovitz-Eldor J, Gepstein L (2001) Human 8. Laflamme MA, Chen KY, Naumova AV, Musk-
embryonic stem cells can differentiate into myo- heli V, Fugate JA, Dupras SK, Reinecke H, Xu C,
cytes with structural and functional properties of Hassanipour M, Police S, O’Sullivan C, Collins
cardiomyocytes. J Clin Invest 108:407–414 L, Chen Y, Minami E, Gill EA, Ueno S, Yuan C,
2. Xu C, Police S, Rao N, Carpenter MK (2002) Gold J, Murry CE (2007) Cardiomyocytes
Characterization and enrichment of cardio- derived from human embryonic stem cells in
myocytes derived from human embryonic pro-survival factors enhance function of infarcted
stem cells. Circ Res 91:501–508 rat hearts. Nat Biotechnol 25:1015–1024
3. He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ 9. Burridge PW, Anderson D, Priddle H, Barba-
(2003) Human embryonic stem cells develop dillo Munoz MD, Chamberlain S, Allegrucci
into multiple types of cardiac myocytes: action C, Young LE, Denning C (2007) Improved
potential characterization. Circ Res 93:32–39 human embryonic stem cell embryoid body
4. Mummery C, Ward-van Oostwaard D, Doe- homogeneity and cardiomyocyte differentia-
vendans P, Spijker R, van den Brink S, Hassink tion from a novel V-96 plate aggregation sys-
R, van der Heyden M, Opthof T, Pera M, de la tem highlights interline variability. Stem Cells
Riviere AB, Passier R, Tertoolen L (2003) 25:929–938
Differentiation of human embryonic stem 10. Yao S, Chen S, Clark J, Hao E, Beattie GM,
cells to cardiomyocytes: role of coculture Hayek A, Ding S (2006) Long-term self-
with visceral endoderm-like cells. Circulation renewal and directed differentiation of human
107:2733–2740 embryonic stem cells in chemically defined
5. Burridge PW, Keller G, Gold JD, Wu JC conditions. Proc Natl Acad Sci U S A
(2012) Production of de novo cardiomyocytes: 103:6907–6912
human pluripotent stem cell differentiation 11. Yang L, Soonpaa MH, Adler ED, Roepke TK,
and direct reprogramming. Cell Stem Cell Kattman SJ, Kennedy M, Henckaerts E, Bon-
10:16–28 ham K, Abbott GW, Linden RM, Field LJ,
6. Xu C (2012) Differentiation and enrichment of Keller GM (2008) Human cardiovascular pro-
cardiomyocytes from human pluripotent stem genitor cells develop from a KDR+ embryonic-
cells. J Mol Cell Cardiol 52:1203–1212 stem-cell-derived population. Nature
7. Mummery CL, Zhang J, Ng ES, Elliott DA, 453:524–528
Elefanty AG, Kamp TJ (2012) Differentiation 12. Tomescot A, Leschik J, Bellamy V, Dubois G,
of human embryonic stem cells and induced Messas E, Bruneval P, Desnos M, Hagege AA,
Efficient Differentiation of Cardiomyocytes from Human Pluripotent Stem Cells. . . 131
Abstract
Cardiac safety pharmacology requires in vitro testing of all drug candidates before clinical trials in order to
ensure they are screened for cardiotoxic effects which may result in severe arrhythmias and, ultimately,
cardiomyopathy (Chi, Nat Rev Drug Discov 12:565–567, 2013). Given the physiological similarities
between nonhuman primates and humans, isolated primate cardiac muscle cells are an ideal animal model
for such in vitro testing. The aims of this chapter are to describe two methods for isolating and culturing
primate cardiac muscle cells. One method uses mechanical dissociation of the tissue followed by placing the
small pieces onto a Petri dish and culturing these tissue explants. The other method also uses mechanical
dissociation but is then followed by enzymatic digestion and culturing of the cell suspension. Methods are
also described for phenotypically characterizing cardiac muscle cells by flow cytometry. Based on the
location within the heart tissue chosen for cell isolation, a dividing population of cardiac muscle cells
expressing cardiomyocyte cell markers was obtained.
Key words Nonhuman primate, Heart, Cardiac muscle, Cardiomyocyte, Explant culture, Enzymatic
digestion, Flow cytometry
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_10, © Springer Science+Business Media New York 2015
133
134 Steven M. Hoynowski and John W. Ludlow
2 Materials
2.6 Culture Media Storage conditions, shelf life, and expiration dates for all media,
Components and components, and supplements are provided by the manufacturer.
Supplements 1. Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12
(DMEM/F-12) (Invitrogen, LifeTechnologies Corp., Grand
Island, NY, USA).
2. Dulbecco’s phosphate-buffered saline (DPBS) (Invitrogen).
3. 0.25 % Trypsin EDTA, 1 (Invitrogen).
4. Fetal bovine serum (FBS) (Invitrogen).
5. Antibiotic/antimycotic, 100 (Invitrogen).
6. Gentamicin, 50 mg/mL concentration (Invitrogen).
7. Collagenase Type IV (Worthington).
8. Sterile 500 mM CaCl2 solution.
9. Dimethyl sulfoxide (DMSO), tissue culture grade (Sigma-
Aldrich, St Louis, MO, USA, Cat # D2650).
10. 0.4 % trypan blue.
2.7 Formulations All manipulations take place in a biosafety cabinet to reduce the risk
of microbial contamination.
1. Digestion solution—0.25 % trypsin EDTA (1) containing
0.1 % (w/v) collagenase type IV, 5 mM CaCl2. Sterilize
136 Steven M. Hoynowski and John W. Ludlow
3 Methods
3.1 Tissue Explant 1. Remove the heart from its shipping container and place in a
Cultures sterile 100 mm tissue culture dish.
3.1.1 Heart Tissue 2. Dissect away any extraneous tissue and remove the pericardium
Handling and Preparation membrane (see Fig. 1).
3. Flush the outside of the organ with 10 mL of Wash medium
(see Note 2).
Fig. 2 Bisected heart showing locations of tissue excision for cell isolation
3.1.2 Tissue Explant 1. Excise tissue from the inside of the ventricles.
Method 2. Pre-fill the wells of a sterile 6-well plate with 10 mL of pre-
warmed Wash medium in each well (see Note 4).
3. Using sterile forceps, gently place the biopsy tissue into the first
well of the 6-well washing plate.
4. Gently agitate the tissue in the well using the sterile forceps for
5–10 s.
5. Carefully lift the tissue from the first well and place in the
second well and repeat the agitation procedure in step 4 of
Subheading 3.1.2 above.
6. Continue the successive washing of the tissue through each
until all six wells have been used.
7. After washing, carefully move the tissue into a sterile 100 mm
tissue culture dish for dissection.
8. Using sterile forceps and either small sterile scissors or a sterile
scalpel, cut cardiac muscle tissue into small pieces approxi-
mately 1 mm in diameter.
138 Steven M. Hoynowski and John W. Ludlow
Fig. 3 A 100 mm tissue culture dish showing tissue explants adhered to the
surface
Fig. 4 (a) Phase contrast image of cardiac muscle cells migrating away from tissue explant (Day 6). (b) Phase
contrast image of cardiac muscle cells surrounding a tissue explant (Day 9). (c) Proliferation of cardiac muscle
cells subsequent to migration from tissue explant resulting in confluency (Day 12) (d) Space left on the dish
after explant spontaneously lifted off
5. Carefully lift the tissue from the first well and place in the
second well and repeat the agitation procedure in step 4 of
Subheading 3.1.3 above.
6. Continue the successive washing of the tissue through each
until all six wells have been used.
7. After washing, carefully move the tissue into a sterile 100 mm
tissue culture dish for dissection.
8. Using sterile forceps and either small sterile scissors or a sterile
scalpel, mince tissue and transfer approximately 1 g to a 50 mL
tube.
9. Repeat step 8 of Subheading 3.1.3 for the remainder of the
tissue.
10. Add 40 mL of digestion solution, cap tightly, and rock vigor-
ously at 37 C for 20 min (see Note 6).
11. Add 10 mL of neutralization medium to deactivate the
Enzyme.
12. Connect the digestion tube to a 100 mm Steriflip™ assembly
and apply a gentle vacuum to filter out any remaining undi-
gested material.
140 Steven M. Hoynowski and John W. Ludlow
Fig. 5 Cardiac muscle cell cultures at Day 2 (a), Day 7 (b), and Day 18 (c) following enzymatic digestion of
tissue, cell isolation, and plating
3.1.4 Cardiac Muscle 1. For explant culture method, carefully aspirate any remaining
Cell Passaging tissue and conditioned medium from the plate without disturb-
ing the surrounding cell colonies.
2. For cultures from enzymatic digestion method, aspirate
conditioned medium from the flask.
3. Wash cell surface with 10 mL of DPBS.
4. Aspirate the DPBS, and then add 5 mL of 0.25 % trypsin
EDTA.
5. Monitor the cell detachment visually using the inverted
microscope.
6. When most of the cells have detached, add 5 mL of culture
medium to neutralize the trypsin and detach any lightly
attached cells.
7. Transfer the trypsin/medium mixture to a 15 mL sterile cen-
trifuge tube and centrifuge at 300 g for 5 min to pellet the
cells.
8. After centrifugation, carefully aspirate the supernatant making
sure not to disturb the cell pellet.
Isolation, Culturing, and Characterization of Cardiac Muscle Cells from Nonhuman. . . 141
3.1.5 Phenotypic Marker 1. Pellet at least 50,000 cells in a 1.5 mL microcentrifuge tube.
Analysis 2. Fix in 100 μL Cytofix/Cytoperm fixation and permeabilization
solution for 20 min at 4 C.
3. Spin in microcentrifuge at 500 g for 3 min to pellet fixed
cells.
4. Wash fixed cells once with 500 μL of perm/wash buffer.
5. Resuspend pellet in 20 μL of perm/wash buffer.
6. Add 1 μg primary antibody.
7. Incubate for 1 h at 4 C.
8. Wash once with 500 μL of perm/wash buffer.
9. Resuspend pellet in 20 μL of perm/wash buffer.
10. Add 1 μg secondary antibody.
11. Incubate for 30 min at 4 C.
12. Wash once with 500 μL of perm/wash buffer.
13. Resuspend pellet in 150 μL DPBS.
14. Analyze by flow cytometry (see Fig. 6).
3.1.6 Cardiac Muscle 1. Count cells and pellet at 300 g for 5 min in a 50 mL sterile
Cell Cryopreservation centrifuge tube.
2. Resuspend cells in cryopreservation medium at desired concen-
tration (see Note 8).
3. Aliquot 1 mL into cryopreservation vials.
4. Place vials into Mr. Frosty™.
5. Place Mr. Frosty™ into 80 C freezer for 24–72 h.
6. Transfer vials to liquid nitrogen dewar for long-term storage.
4 Notes
Fig. 6 Flow cytometric analysis of nonhuman primate cardiac muscle cell cultures. (a) Cells stained with goat
anti-mouse IgG Alexa Fluor 488, revealing nonspecific binding of this secondary antibody (control), and
cardiac myosin heavy chain staining with goat anti-mouse IgG secondary, showing a shift in the population,
indicating a positive staining for this marker (MH). (b) Cardiac troponin T staining with goat anti-mouse IgG
secondary, showing a very slight shift in the population, indicating weakly positive staining for this marker
(troponin). (c) Cells stained with allophycocyanin goat anti-mouse IgG, revealing nonspecific binding of this
secondary antibody (control), and cells stained with sarcomeric alpha actinin antibody followed by allophy-
cocyanin secondary, showing a further shift in the population, indicating a positive staining for this marker
(actinin)
References
1. Chi KR (2013) Revolution dawning in cardio- 3. Hirt MN, Hansen A, Eschenhagen T (2014)
toxicity testing. Nat Rev Drug Discov 12 Cardiac tissue engineering: state of the art. Circ
(8):565–567 Res 114(2):354–367
2. Gu Y, Yi F, Liu G-H, Izpisua Belmonte JC
(2013) Beating in a dish: new hopes for cardio-
myocyte regeneration. Cell Res (3):314–316
Chapter 11
Abstract
Embryonic stem (ES) cells are pluripotent stem cells capable of self-renewal and have broad differentiation
potential yielding cell types from all three germ layers. In the absence of differentiation inhibitory factors,
when cultured in suspension, ES cells spontaneously differentiate and form three-dimensional cell aggre-
gates termed embryoid bodies (EBs). Although various methods exist for the generation of EBs, the
hanging drop method offers reproducibility and homogeneity from a predetermined number of ES cells.
Herein, we describe the in vitro differentiation of mouse embryonic stem cells into cardiac myocytes using
the hanging drop method and immunocytochemistry to identify cardiomyogenic differentiation. In brief,
ES cells, placed in droplets on the lid of culture dishes following a 2-day incubation, yield embryoid bodies,
which are resuspended and plated. 1–2 weeks following plating of the EBs, spontaneous beating areas can
be observed and staining for specific cardiac markers can be achieved.
Key words Cardiac myocytes, Embryonic stem cells, Embryoid bodies, Hanging drop, Cell culture,
Culture medium, Differentiation medium, Cell differentiation
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_11, © Springer Science+Business Media New York 2015
145
146 Carley Glass et al.
2 Materials
2.2 Cell Culture 1. Cell culture media: Dulbecco’s modified Eagle medium
Media (DMEM) was accompanied with 2 mM L-glutamine, 0.1 mM
β-mercaptoethanol, 1 nonessential amino acids (see Note 2),
1 mM sodium pyruvate, 10–15 % fetal calf or bovine serum
(FBS), leukemia inhibitory factor (LIF, 1,000-2,000 U/ml),
50 U/ml penicillin/streptomycin.
2. Differentiation media: DMEM along with 2 mM glutamine,
0.1 mM β-mercaptoethanol, 1 nonessential amino acids
(see Note 2), 1 mM sodium pyruvate, 15 % FBS, 50 U/ml
penicillin/streptomycin.
Mouse Embryonic Stem Cell-Derived Cardiac Myocytes in a Cell Culture Dish 147
3 Methods
3.2 Hanging Drop 1. Culture ES cells in cell culture medium for 2–3 passages on
Method for the 0.1 % gelatin-coated 100 mm plates after thawing.
Formation of Embryoid 2. Aspirate culture medium and wash ES cells once with 5 ml PBS.
Bodies (Day 1) 3. Remove PBS and place 3 ml of trypsin/EDTA into the plate for
3–5 min.
4. Pipette the solution so that the cells are disassociated (see Note 6).
After isolation of the cells, no clusters should be visible in the
solution.
5. Place solution into a 15 ml tube containing 3 ml of differentia-
tion medium.
6. Spin down for 5 min at 1,000 rpm.
7. Remove supernatant and resuspend cells in 5–10 ml of differ-
entiation medium.
8. Calculate cells/ml using a hemacytometer.
9. Dilute the cells using differentiation medium so that the final
concentration is 2.5 104 cells/ml (see Note 7).
10. Resuspend cell suspension thoroughly and transfer into a sterile
reagent reservoir.
11. Remove the lid from a new, sterile 100 mm plate, placing it
upside down with the inside facing upright.
12. Fill the bottom of the 100 mm dish with 15 ml of 1 PBS to
prevent evaporation.
13. Using a multichannel pipette, place 30 μl drops onto the lid of
the petri dish.
14. Repeat this step 5–6 times until the lid is full (50–60 drops per
lid) (see Note 8).
15. Place the lid containing the drops back onto the 100 mm plate
(see Note 9).
16. Incubate the plate at 37 C for 2 days (see Note 10).
3.3 Resuspension 1. Keeping in mind the number of 100 mm dishes made in the
of Embryoid Bodies hanging drop step, place 5 ml of differentiation medium into
(Day 3) the same number of bacterial plates.
2. Remove the lid from the 100 mm plate containing the hanging
drops. EBs can be visualized at this time as a white point at the
end of each drop.
Mouse Embryonic Stem Cell-Derived Cardiac Myocytes in a Cell Culture Dish 149
3.4 Plating Embryoid 1. Prepare the same number of 0.1 % gelatinized 100 mm plates as
Bodies (Day 6) the number of plates incubated in step 5 of Subheading 3.3.
Resuspension of embryoid bodies.
2. Place 10 ml of differentiation medium into each new plate.
3. Very gently, pick up all EBs with a 1 ml pipette and place into a
new gelatin-coated 100 mm plate.
4. Incubate at 37 C.
3.5 Media Change 1. Change the media in the plates every other day using differen-
(Day 7 and Every Other tiation medium.
Day Thereafter) 2. Aspirate and discard the culture medium in the 100 mm dishes.
3. Place 10 ml of fresh differentiation medium into each plate.
4. Incubate at 37 C.
3.6 EB Observation 1. At day 7 to day 21, microscopically evaluate EBs for beating
areas (see Notes 12 and 13).
2. When >50 % of the EB is beating, cardiomyogenic markers can
be evaluated.
3.7 Immunocyto- 1. Aspirate culture medium and gently pick up EBs using a
chemistry to Detect scraper.
Cardiomyogenic 2. Place 1 EB per well into a prepared 0.1 % gelatin-coated 8-well
Markers on EBs chamber slide.
(See Note 14) 3. Place 500 μl of differentiation medium into each well.
4. Incubate at 37 C for 48–72 h.
5. Remove differentiation medium and wash 1 with 1 PBS.
6. Fix EBs with 4–5 % paraformaldehyde for 15–20 min at room
temperature (see Note 15).
7. Wash 3 with 1 PBS for 5 min each.
8. Add 0.3 % Triton X-100 for 15 min at room temperature
(see Note 16).
9. Wash 3 in 1 PBS for 5 min each.
10. Incubate chamber slide in working solution of M.O.M. Mouse
Ig Blocking Reagent for 1 h at room temperature (see Note 17).
11. Wash 2 in 1 PBS for 2 min each.
150 Carley Glass et al.
4 Notes
9. When flipping the lid onto the petri dish, do so carefully, with
grace and swiftness, to ensure that placement of the drops is not
disturbed.
10. For proper EB formation, the dishes with the drops must not
be disturbed for the 2-day duration.
11. This must be done with gentle flushes avoiding bubbles in
order not to disturb the delicate architecture of the EBs. Also,
be careful to avoid solution coming into contact with the
border of the lid to avoid contamination.
12. Although this protocol details up to day 21, EBs can be
cultured for months with medium changes occurring every
other day as previously specified.
13. A straightforward way to evaluate cardiomyogenic differentia-
tion is to count the number of beating EBs, count the beats/
min of each beating EB, and calculate the beating area/total
EB area.
14. Although here we detail immunocytochemisty for the detec-
tion of cardiomyogenic differentiation, other techniques
including western blot and RT-PCR can be used.
15. All procedures from this step forward do not have to be per-
formed under a biosafety cabinet.
16. This step is light sensitive, so make sure to protect the slides
from light.
17. The working solution for this blocking reagent can be made by
adding 1 drop of the stock solution to 1.25 ml of 1 PBS.
18. The working solution for the M.O.M. Diluent can be made by
adding 200 μl of protein concentrate to 2.5 ml 1 PBS.
19. As per our experience we suggest that the accurate times
explained in steps 12–15 will give you better staining results.
Additional longer incubation of slides may result in an increase
in background staining. If longer incubation times are
required, then additional appropriate negative controls are
recommended to ensure the efficacy of the M.O.M.™ kit.
20. To prepare the working solution of M.O.M.™ Biotinylated
Anti-Mouse IgG Reagent, add 4 μl of stock solution to 1 ml
of M.O.M. Diluent previously prepared.
21. To prepare fluorescein avidin DCS, add 16 μl of reagent to 1 ml
1 PBS.
152 Carley Glass et al.
References
1. Doetschman T, Shull M, Kier A et al (1993) embryonic stem cells in vitro. Cell Transplant
Embryonic stem cell model systems for vascu- 11:429–434
lar morphogenesis and cardiac disorders. 8. Kobayashi T, Tanaka H, Kuwana H et al
Hypertension 22:618–629 (2005) Wnt4-transformed mouse embryonic
2. Kehat I, Gepstein L (2003) Human embryonic stem cells differentiate into renal tubular cells.
stem cells for myocardial regeneration. Heart Biochem Biophys Res Commun 336:585–595
Fail Rev 8:229–236 9. Talavera-Adame D, Wu G, He Y et al (2011)
3. Kumar D, Kamp TJ, LeWinter MM (2005) Endothelial cells in co-culture enhance embry-
Embryonic stem cells: differentiation into car- onic stem cell differentiation to pancreatic pro-
diomyocytes and potential for heart repair and genitors and insulin-producing cells through
regeneration. Coron Artery Dis 16:111–116 BMP signaling. Stem Cell Rev 7:532–543
4. Singla DK (2010) Stem cells in the infarcted 10. Kurosawa H (2007) Methods for inducing
heart. J Cardiovasc Transl Res 3:73–78 embryoid body formation: in vitro differentia-
5. Williams RL, Hilton DJ, Pease S et al (1988) tion system of embryonic stem cells. J Biosci
Myeloid leukaemia inhibitory factor maintains Bioeng 103:389–398
the developmental potential of embryonic stem 11. Boheler KR, Czyz J, Tweedie D et al (2002)
cells. Nature 336:684–687 Differentiation of pluripotent embryonic stem
6. Kehat I, Kenyagin-Karsenti D, Snir M et al cells into cardiomyocytes. Circ Res
(2001) Human embryonic stem cells can dif- 91:189–201
ferentiate into myocytes with structural and 12. Kawai T, Takahashi T, Esaki M et al (2004)
functional properties of cardiomyocytes. J Efficient cardiomyogenic differentiation of
Clin Invest 108:407–414 embryonic stem cell by fibroblast growth factor
7. Miyashita H, Suzuki A, Fukao K et al (2002) 2 and bone morphogenetic protein 2. Circ J
Evidence for hepatocyte differentiation from 68:691–702
Chapter 12
Abstract
Cardiomyocytes are frequently used for in vitro models for cardiac research. The isolation of cells is time-
consuming and, due to the cells limited proliferative abilities, must be performed frequently. To reduce the
time requirements and the impact on research animals, we describe a method for cryopreserving neonatal
rat cardiomyocytes (NRCMs), and subsequently thawing them for use in assays.
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_12, © Springer Science+Business Media New York 2015
153
154 Adam C. Vandergriff et al.
time required for the isolation procedure, but this does not address
the issue of timing the birth of the rats.
Many labs opt for cells that can be cryopreserved such as
cardiomyocytes derived from embryonic stem cells (ESCs) or
induced pluripotent stem cells (iPSCs), but the differentiation
process can be difficult and these cells have been shown to exhibit
differences from primary cardiomyocytes [5–7]. Dissociated
NRCMs are capable of being stored for several days using refriger-
ation [8], yet this does not allow for long term storage. For long
term storage in liquid nitrogen a cryoprotectant such as dimethyl
sulfoxide (DMSO) is necessary. Previous research has shown that
the ideal concentration between 5 and 10 % DMSO in the freezing
media allows for cryopreservation of NRCMs, yet even then their
viability remains low [9]. Although DMSO helps protect the cells
during freezing, it can be toxic to cells at concentrations above
1.5 % [10]. Previous studies have shown that slowly removing
DMSO from the cells may improve cell viability [11].
In order to improve upon cardiac in vitro models, we have
created a protocol for the isolation and cryopreservation of
NRCMs. By cryopreserving the cells lab efficiency can be increased
and the impact on research animals reduced. Using this method, we
show that it is possible to cryopreserve NRCMs and thaw them for
use at a later time.
2 Materials
2.2 Tools 1. Surgical tools: Large scissors, small scissors, large forceps, and
small sharp forceps. Autoclave prior to use.
2. 40 μm cell strainer.
3. Plastics: 15 mL conical tubes, 50 mL conical tubes, 150 mm
culture dishes, cryogenic vials.
4. Trypan blue.
5. Cryo-freezing container (such as Mr. Frosty™, Nalgene) or
controlled rate freezer to keep rate of cooling to 1 C/min.
6. Small sterile gauze pads.
7. Bench pads.
3 Methods
3.1 Cell Isolation Perform the following work in a culture hood to prevent contami-
Day 1 nation of the samples. This portion is best started late in the
afternoon since it ends with an overnight incubation.
1. Prepare workspace inside a sterile culture hood. Place bench
pad in culture hood. Fill two 250 mL beakers with 70 % ethanol
and place surgical tools in them. Place small bucket of ice in
hood. The bucket must be large enough to hold several tubes
and a 150 mm dish. UV-sterilize the hood for 10 min.
2. Retrieve neonatal rat pups. Place them on a bench pad in an
insulated container to keep them warm during transport and
during the operation.
3. Fill a 150 mm culture dish with 25 mL HBSS and place on ice.
4. Unwrap 2–3 gauze pads and place in work area.
5. Holding pup by the skin on the back of the neck, spray it with
70 % ethanol and place in hood (see Note 2).
6. Euthanize the pup by holding the pup by the skin on the back
of the neck. Then, using the large scissors, in one quick, strong
cut remove the head. Blot the blood with gauze.
7. Continue cutting down anterior side of chest through the
ribcage. Squeeze the skin on the neck to help open the ribcage
until the heart is visible. Using the small scissors, remove the
heart and place in the HBSS containing culture dish on ice.
8. Repeat for the other pups.
9. Remove any non-heart tissue from the samples and swirl the
HBSS gently to wash the hearts.
156 Adam C. Vandergriff et al.
3.2 Cell Isolation 1. While aspirating in the following steps, use a pipette rather than
Day 2 a vacuum line. The tissue moves easily, and a vacuum line will
clog or remove tissue still containing cells. Therefore, it is best
to use a pipette for aspiration instead. If tissue enters the
pipette, pipette it back out to avoid losing it.
2. Make three aliquots of 10 % NRCM Media: one with 25 mL
and two with 15 mL. Place one 25 mL tube of media in 37 C
water bath.
3. Add 4 mL HBSS to five different 15 mL conical tubes and place
all on ice. Label the tubes 1 through 5.
4. Add 40 mL HBSS to a 50 mL conical tube. Add 10 mL of
HBSS to 50 mg lyophilized collagenase and pipette up and
down repeatedly to suspend. Add this solution to 40 mL
HBSS to create a 1 mg mL1 collagenase solution. Sterilize
by passing the solution through a 0.22 μm vacuum filter and
store at room temperature.
5. Retrieve heart tissue from each trypsin tube. The trypsin solu-
tion should be clear, and the tissue should look fluffy. Allow the
tissue to settle to a corner of tube and remove as much liquid as
possible by aspiration.
6. Add 25 mL warm 10 % serum culture media to the tube and
swirl. Replace the cap and rotate in 37 C water bath for 2 min.
7. Aspirate liquid again. The tissue may float at this step; if so,
aspirate from the bottom of the tube.
8. Add 10 mL of collagenase. Rotate in water bath for 2 min or
until the solution is cloudy.
9. Quickly aspirate the liquid from the tube.
10. Add 10 mL fresh collagenase and rotate in water bath for
2 min. Pipette to mix, transfer solution to the tube labeled
#1, and place on ice. Note that it may not be possible to remove
all of the liquid.
11. Repeat prior step for the other three 15 mL conical tubes.
12. Any remaining liquid and tissue can be transferred to the tube
labeled #5.
13. Centrifuge the 15 mL tubes at 410 rcf for 8 min. While
centrifuging, place a 15 mL tube containing 10 % media in
water bath at 37 C.
14. Place 40 μm cell strainer on top of a 50 mL conical tube and
wet with 2 mL cold HBSS.
Cryopreservation of Neonatal Cardiomyocytes 157
3.4 Thawing Cells 1. Coat a culture dish with fibronectin by dissolving 250 μL of
fibronectin into 9.75 mL water. Add enough solution to cover
culture plate and incubate at 37 C for at least 30 min.
2. In four 15 mL conical tubes, make the DMSO/media mixtures
as follows by adding DMSO to 20 % Media:
(a) 5 %—9.5 mL media with 500 μL DMSO.
(b) 2.5 %—9.75 mL media with 250 μL DMSO.
(c) 0 %—10 mL media (make two of these).
3. Warm media in 37 C water bath.
4. Remove cells from liquid nitrogen and place on dry ice.
5. When the media mixtures are warm, thaw cells in 37 C water bath.
6. Transfer contents of cryogenic vial to 5 % DMSO/media tube.
Centrifuge at 410 rcf for 8 min. Aspirate supernatant and leave
the cell pellet.
158 Adam C. Vandergriff et al.
3.5 Cell Culture 1. Cells are plated at about 100 k cells per cm2. The plating
density can be adjusted based on the intended use of the
culture. The following is a timeline of a typical culture.
2. Day 1—rinse dead cells away with warm IMDM add 10 %
NRCM (optionally containing 100 μM BrdU).
3. Day 2—rinse dead cells away with warm IMDM add 10 %
NRCM.
4. Day 3—add 2 % NRCM.
5. Day 4—add 2 % NRCM.
6. Day 5—cells should be confluent and beating (see Note 5)
(Fig. 1).
4 Notes
Fig. 2 Fluorescence staining of α-sarcomeric actinin (green) and nuclei (blue) shows numerous NRCMs
present with minimal fibroblasts
160 Adam C. Vandergriff et al.
Acknowledgement
References
1. Louch WE, Sheehan KA, Wolska BM (2011) artid¼3667201&tool¼pmcentrez&rendertype¼
Methods in cardiomyocyte isolation, culture, and abstract. Accessed 8 Aug 2014
gene transfer. J Mol Cell Cardiol 51:288–298, 8. Uchida T et al (2011) Optimal temperature
Available at: http://www.pubmedcentral.nih. range for low-temperature preservation of dis-
gov/articlerender.fcgi?artid¼3164875&tool¼ sociated neonatal rat cardiomyocytes. Cryobiol-
pmcentrez&rendertype¼abstract. Accessed 21 ogy 63:279–84, Available at: http://www.ncbi.
Oct 2013 nlm.nih.gov/pubmed/22005593. Accessed 12
2. Miragoli M, Salvarani N, Rohr S (2007) Myo- Feb 2014
fibroblasts induce ectopic activity in cardiac 9. Miyamura K et al (2010) Evaluation of viability
tissue. Circ Res 101:755–758 of cryopreserved rat cardiac myocyte. Cryobi-
3. Simpson P, McGrath A, Savion S (1982) Myo- ology 56:111–117
cyte hypertrophy in neonatal rat heart cultures 10. Rana P, Anson B, Engle S, Will Y (2012) Char-
and its regulation by serum and by catechola- acterization of human-induced pluripotent stem
mines. Circ Res 51:787–801, Available at: cell-derived cardiomyocytes: bioenergetics and
http://circres.ahajournals.org/cgi/doi/10. utilization in safety screening. Toxicol Sci
1161/01.RES.51.6.787. Accessed 6 Mar 130:117–31, Available at: http://www.ncbi.
2014 nlm.nih.gov/pubmed/22843568. Accessed 15
4. Rohr S, Fl€ uckiger-Labrada R, Kucera JP July 2014
(2003) Photolithographically defined deposi- 11. Yokomuro H, Mickle DA, Weisel RD, Li RK
tion of attachment factors as a versatile method (2003) Optimal conditions for heart cell cryo-
for patterning the growth of different cell types preservation for transplantation. Mol Cell Bio-
in culture. Pfl€ ugers Arch 446:125–32, chem 242:109–14, Available at: http://www.
Available at: http://www.ncbi.nlm.nih.gov/ ncbi.nlm.nih.gov/pubmed/12619872
pubmed/12690471. Accessed 26 Aug 2014 12. Simpson P, Savion S (1982) Differentiation of
5. Fu J-D et al (2006) Crucial role of the sarco- rat myocytes in single cell cultures with and
plasmic reticulum in the developmental regula- without proliferating nonmyocardial cells.
tion of Ca2+ transients and contraction in Cross-striations, ultrastructure, and chronotro-
cardiomyocytes derived from embryonic stem pic response to isoproterenol. Circ Res
cells. FASEB J 20:181–3, Available at: http:// 50:101–116, Available at: http://circres.
www.ncbi.nlm.nih.gov/pubmed/16249315 ahajournals.org/cgi/doi/10.1161/01.RES.
6. Liu J, Fu JD, Siu CW, Li RA (2007) Functional 50.1.101. Accessed 20 Mar 2014
sarcoplasmic reticulum for calcium handling of 13. Evans HJ, Goodwin RL (2007) Western array
human embryonic stem cell-derived cardio- analysis of cell cycle protein changes during the
myocytes: insights for driven maturation. hyperplastic to hypertrophic transition in heart
Stem Cells 25:3038–44, Available at: http:// development. Mol Cell Biochem 303:189–99,
www.ncbi.nlm.nih.gov/pubmed/17872499. Available at: http://www.ncbi.nlm.nih.gov/
Accessed 31 July 2014 pubmed/17457520. Accessed 18 Aug 2014
7. Knollmann BC (2013) Induced pluripotent 14. Golden HB et al. (2012) Isolation of Cardiac
stem cell-derived cardiomyocytes: boutique Myocytes and Fibroblasts from Neonatal Rat
science or valuable arrhythmia model? Circ Pups. In: Peng X, Antonyak M (eds) Cardiovas-
Res 112:969–976, Available at: http://www. cular Development. Methods in Molecular Biol-
pubmedcentral.nih.gov/articlerender.fcgi? ogy, vol 843. Springer, New York, pp 205–214
Chapter 13
Abstract
High-resolution optical imaging provides valuable window in examining transitional and systemic changes in
cellular processes. The relative spatial relationship of structural, transport, and signaling proteins, surface
antigens, and transcription factors may reveal developmental state of the cellular system. Here, we describe the
use of confocal microscopy to evaluate the organization of sarcomeric structural proteins, sarcoplasmic channel
proteins, and cardiac transcription factors in human pluripotent stem cell (PSC)-derived cardiomyocytes.
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_13, © Springer Science+Business Media New York 2015
161
162 Chrishan J.A. Ramachandra and Winston Shim
2 Materials
3 Methods
3.1 Specimen 1. Coat the chamber slide overnight with 0.1 % gelatin and
Preparation remove the following day (see Note 4).
2. Dissociate approximately 5–7 contracting cardiomyocyte
clusters (per chamber) and seed cells in the chambers
(see Note 5).
3. When cells have attached, remove the culture media and rinse
the chambers twice with 0.3 ml wash solution to remove non-
viable cells and debris (see Note 6).
4. Add 0.2 ml fixative solution to each chamber and incubate the
slide at 4 C for 20 min.
5. Remove fixative solution and rinse the chambers twice with
0.3 ml wash solution.
6. Add 0.2 ml permeabilizing solution to each chamber and incu-
bate the slide at 4 C for 10 min (see Note 7).
7. Remove permeabilizing solution and rinse the chambers twice
with 0.3 ml wash solution.
8. Add 0.2 ml blocking solution to each chamber and incubate the
slide at 4 C for 1 h.
9. Dilute primary antibodies in antibody diluent. All primary
antibodies can be used at a 1:200 dilution (see Note 8).
10. Remove blocking solution and add 0.2 ml antibody diluent
containing the respective primary antibodies to the chambers.
Incubate the slide at 4 C overnight.
11. Remove antibody diluent and rinse the chambers twice with
0.3 ml antibody wash solution (see Note 9).
12. Dilute secondary antibodies in antibody diluent. All secondary
antibodies can be used at a 1:400 dilution (see Note 8).
13. Add 0.2 ml antibody diluent containing the respective second-
ary antibodies to the chambers. Incubate the slide at 4 C in the
dark for 1 h.
14. Remove antibody diluent and rinse the chambers thrice with
0.3 ml antibody wash solution (see Note 9).
164 Chrishan J.A. Ramachandra and Winston Shim
3.2 Specimen 1. Break off the chambers and add mounting solution on to the
Mounting and Imaging slide in a dropwise manner (see Note 10).
2. Carefully lay down a coverslip (see Note 11).
3. Once the coverslip is set firmly on the slide (approximately 1 h at
room temperature), seal the edges of the coverslip with nail varnish.
4. Mount slide on the confocal microscope stage and capture
images using a 10, 20, 40, or 63 objective lens (see
Note 12).
5. Blue, green, and red fluorescence can be detected at wave-
lengths of 350, 488, and 543, respectively.
6. For high-resolution images, immersion oil should be applied
when using 40 and 63 objective lenses (Fig. 1).
7. Store the slide at 4 C in the dark.
4 Notes
Acknowledgements
References
1. Hoekstra M, Mummery CL, Wilde AA et al derived from virus-free induced pluripotent
(2012) Induced pluripotent stem cell derived stem cells. Cardiovasc Res 91:577–586
cardiomyocytes as models for cardiac arrhyth- 3. Mehta A, Chung Y, Sequiera GL et al (2013)
mias. Front Physiol 3:346 Pharmacoelectrophysiology of viral-free induced
2. Mehta A, Chung YY, Ng A et al (2011) Pharma- pluripotent stem cell-derived human cardiomyo-
cological response of human cardiomyocytes cytes. Toxicol Sci 131:458–469
Chapter 14
Abstract
Cardiomyocytes isolated from chick and rodent are widely used in studying cardiac physiology. However,
contaminating non-cardiomyocytes are an inherent problem that hinders downstream analysis. Here, we
report a novel electrical stimulation coupled with metabolic selection method using cytosine arabinoside
(AraC) to efficiently eliminate contaminating cells in isolating chick embryonic cardiomyocytes. Compared
with conventional methods of pre-plating or AraC alone, electrical stimulation coupled with AraC increased
the percentage purity of cardiomyocytes by 2–6-fold with added effect of improved contractile function and
maturation. This simple method could be useful in isolating and maintaining purified cardiomyocytes for
long-term studies of cardiac physiology.
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_14, © Springer Science+Business Media New York 2015
167
168 Winston Shim et al.
2 Materials
2.1 Chick Embryos 1. Fertilized chicken eggs were obtained from the Chew’s Farm
Singapore.
3 Methods
3.1 Chick Embryo 1. Carefully isolate and finely mince embryonic chick hearts from
Cardiomyocytes 17-day-old fertilized eggs.
Isolation and Culture 2. Minced heart tissues are digested in 0.1 % trypsin in PBS in
37 C water bath for 10 min (see Note 3) as depicted in a
flowchart in Fig. 1a.
3. Remove supernatant and repeat step 2 twice to remove cardiac
fibroblasts and other interstitial cells.
4. The protease-treated heart tissue is further incubated in 0.05 %
trypsin in 37 C water bath for 8 min to isolate cardiomyocytes.
5. Transfer the supernatant containing cells into ice cold DMEM
high glucose medium containing 20 % fetal bovine serum
(FBS). This step is repeated 5–6 times until the tissue has
been fully digested and obtained a homogenous cell suspension
before passing through a 40 μm nylon mesh cell strainer (BD
Falcon) into a new 50 mL tube.
170 Winston Shim et al.
Fig. 1 Schematic chart of experimental (a) and bright-field images of cell morphology on day 7 after
purification treatment initiation. Scale bar in (b) showed 100 μm
13. At day 2, when late attaching cells are adhered to the culture
surface, fresh medium is exchanged for cardiomyocytes purifi-
cation step (see Notes 5 and 6).
3.3 Propidium Iodide 1. At day 7, fresh medium supplemented with 0.5 μM of propi-
(PI) Staining dium iodine dye is added to the electrically paced culture for
live/dead cell assay (see Note 9).
2. After a 30-min incubation at 37 C, cells are washed by PBS for
three times, followed by fixation with 4 % paraformaldehyde
and 0.05 % Triton X-100 in PBS for 10 min.
3. Visualize and quantify the numbers of cells that have taken up
the propidium iodide dye, indicating their compromised cellu-
lar membrane.
4. Capture images using Zeiss Axiovert 200 M fluorescent
microscope.
3.5 Image 1. Captured images are analyzed by ImageJ 1.46r (see Note 11).
Processing and 2. Approximately 100 cells from each group are analyzed and
Statistical Study triplicate experiments are performed.
172 Winston Shim et al.
4 Notes
Fig. 2 Cell viability analysis. (a) Cell viability by propidium iodide (PI) staining on day 7 after purification
treatment initiation. Pink color showed positive staining of dead cells. Scale bar showed 50 μm. (b) Graphic
representation of statistical result of cell viability. *p < 0.01 compared with other groups
Fig. 3 Cardiomyocytes characterization. (a) Showed immunostaining images of sarcomeric α-actinin. Scale
bar showed 50 μm while 20 μm in inserts. Green is α-actinin and blue is DAPI staining. (b) Quantification of
cardiomyocyte yield following treatment regimes by counting α-actinin stained cardiomyocytes/mm2 field of
view. (c) Showed the statistical result of the percentage of cardiomyocytes in culture on day 7 after purification
treatment. *p < 0.01 compared with other groups
Acknowledgements
References
1. Gregorio CC, Fowler VM (1995) Mechanisms T, Onitsuka T, Shimoji K, Ohno Y, Egashira T,
of thin filament assembly in embryonic chick Kaneda R, Murata M, Hidaka K, Morisaki T,
cardiac myocytes: tropomodulin requires Sasaki E, Suzuki T, Sano M, Makino S, Oikawa
tropomyosin for assembly. J Cell Biol S, Fukuda K (2010) Nongenetic method for
129:683–695 purifying stem cell-derived cardiomyocytes.
2. Muller-Ehmsen J, Whittaker P, Kloner RA, Nat Methods 7:61–66
Dow JS, Sakoda T, Long TI, Laird PW, Kedes 11. Sreenivasan Y, Sarkar A, Manna SK (2003)
L (2002) Survival and development of neonatal Mechanism of cytosine arabinoside-mediated
rat cardiomyocytes transplanted into adult apoptosis: role of Rel A (p65) dephosphoryla-
myocardium. J Mol Cell Cardiol 34:107–116 tion. Oncogene 22:4356–4369
3. Zhang J, Wilson GF, Soerens AG, Koonce CH, 12. Fisher DJ, Heymann MA, Rudolph AM (1981)
Yu J, Palecek SP, Thomson JA, Kamp TJ Myocardial consumption of oxygen and carbo-
(2009) Functional cardiomyocytes derived hydrates in newborn sheep. Pediatr Res
from human induced pluripotent stem cells. 15:843–846
Circ Res 104:e30–e41 13. Tohyama S, Hattori F, Sano M, Hishiki T,
4. Laflamme MA, Murry CE (2011) Heart regen- Nagahata Y, Matsuura T, Hashimoto H,
eration. Nature 473:326–335 Suzuki T, Yamashita H, Satoh Y, Egashira T,
5. Sanger JW, Kang S, Siebrands CC, Freeman N, Seki T, Muraoka N, Yamakawa H, Ohgino Y,
Du A, Wang J, Stout AL, Sanger JM (2005) Tanaka T, Yoichi M, Yuasa S, Murata M, Sue-
How to build a myofibril. J Muscle Res Cell matsu M, Fukuda K (2012) Distinct metabolic
Motil 26:343–354 flow enables large-scale purification of mouse
6. Zhang Y, Li TS, Lee ST, Wawrowsky KA, and human pluripotent stem cell-derived cardi-
Cheng K, Galang G, Malliaras K, Abraham omyocytes. Cell Stem Cell 12:127–137
MR, Wang C, Marban E (2010) Dedifferentia- 14. Meyer T, Boven KH, Gunther E, Fejtl M
tion and proliferation of mammalian cardio- (2004) Micro-electrode arrays in cardiac safety
myocytes. PLoS One 5:e12559 pharmacology: a novel tool to study QT inter-
7. Haddad J, Decker ML, Hsieh LC, Lesch M, val prolongation. Drug Saf 27:763–772
Samarel AM, Decker RS (1988) Attachment 15. Radisic M, Park H, Shing H, Consi T, Schoen
and maintenance of adult rabbit cardiac myo- FJ, Langer R, Freed LE, Vunjak-Novakovic G
cytes in primary cell culture. Am J Physiol 255: (2004) Functional assembly of engineered
C19–C27 myocardium by electrical stimulation of cardiac
8. Fijnvandraat AC, van Ginneken AC, Schuma- myocytes cultured on scaffolds. Proc Natl Acad
cher CA, Boheler KR, Lekanne Deprez RH, Sci U S A 101:18129–18134
Christoffels VM, Moorman AF (2003) Cardi- 16. Tandon N, Cannizzaro C, Chao PH, Maidhof
omyocytes purified from differentiated embry- R, Marsano A, Au HT, Radisic M, Vunjak-
onic stem cells exhibit characteristics of early Novakovic G (2009) Electrical stimulation sys-
chamber myocardium. J Mol Cell Cardiol tems for cardiac tissue engineering. Nat Protoc
35:1461–1472 4:155–173
9. Dubois NC, Craft AM, Sharma P, Elliott DA, 17. Jones SP, Kennedy SW (2009) Chicken
Stanley EG, Elefanty AG, Gramolini A, Keller embryo cardiomyocyte cultures–a new
G (2011) SIRPA is a specific cell-surface approach for studying effects of halogenated
marker for isolating cardiomyocytes derived aromatic hydrocarbons in the avian heart. Tox-
from human pluripotent stem cells. Nat Bio- icol Sci 109:66–74
technol 29:1011–1018 18. Abramoff MD, Magalhaes PJ, Ram SJ (2004)
10. Hattori F, Chen H, Yamashita H, Tohyama S, Image processing with ImageJ. Biophoton Int
Satoh YS, Yuasa S, Li W, Yamakawa H, Tanaka 11:36–42
Chapter 15
Abstract
Traditional methods for DNA transfection are often inefficient and toxic for terminally differentiated cells,
such as cardiac myocytes. Vector-based gene transfer is an efficient approach for introducing exogenous
cDNA into these types of primary cell cultures. In this chapter, separate protocols for adult rat cardiac
myocyte isolation and gene transfer with recombinant adenovirus are provided and are routinely utilized for
studying the effects of sarcomeric proteins on myofilament function.
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_15, © Springer Science+Business Media New York 2015
177
178 Sarah E. Lang and Margaret V. Westfall
2 Materials
2.1 Reagents and 1. Perfusion setup: A Baker apparatus (Harvard “Baker” perfu-
Supplies for Isolation sion set #50-8382) is used for this protocol and has a double-
of Adult Rat Cardiac barrel warming coil with an upper, changeover stopcock to
Myocyte regulate flow from syringes containing perfusion buffers
(syringe #1: KHB + Ca2+, Subheading 2.1, item 17; syringe
#2: KHB-Ca2+, Subheading 2.1, item 16) (see Note 1). Two
50 mL glass syringes are attached to the warming coil by tubing
and are positioned to achieve a 70 mmHg gravimetric pressure
difference between the syringe and the heart. Unless otherwise
noted, all tubing used for the Baker apparatus is Tygon® tub-
ing. Two pieces of tubing also are connected to the top of the
warming coil with the opened ends positioned at the same
height as the syringes to serve as bubble traps. Two additional
pieces of tubing are attached to the sides of the warming coil to
adjust and drain buffers. Stopcocks are attached to the end of
each set of drain tubing and these stopcocks are closed in
between cell isolations. A final piece of tubing is inserted into
the bottom of the warming chamber and connected to a sec-
ond, smaller stopcock (i.e., the lower stopcock) to hold the
heart mounted to a tubing adapter. The Baker warming cham-
ber temperature is kept at 37 C by constant water flow from a
circulating water bath through a water inlet and outlet within
the warming chamber. A small piece of PE-20 tubing
180 Sarah E. Lang and Margaret V. Westfall
2.2 Reagents for 1. Laminin (mouse): Store laminin at 80 C and thaw on ice just
Gene Transfer and Cell prior to dilution in sterile phosphate buffered saline (1 PBS).
Culture Laminin is diluted to a concentration of 40 μg/mL, aliquoted
into one-use prechilled microfuge tubes, and stored at 20 C
for up to 6 months.
2. Cell equilibration media (KHB + Ca2+ and 2 % Bovine Serum
Albumin [BSA]): Dissolve 2 g of BSA (Fraction V, heat-shocked,
fatty acid free) in 100 mL KHB + Ca2+ (Subheading 2.1, item
17). Filter-sterilize media and store at 4 C for up to 2 weeks.
3. DMEM + P/S: Add 5 mL P/S (Subheading 2.1, item 10) to
500 mL Dulbecco’s modified Eagle’s medium (DMEM; high
glucose with L-glutamine), filter-sterilize, and store at 4 C for
up to 2 weeks.
4. DMEM + 10%FBS + P/S: Add 10 mL fetal bovine serum
(FBS; premium) to 90 mL DMEM + P/S (Subheading 2.2,
item 3). Filter-sterilize media and store at 4 C for up to
2 weeks.
182 Sarah E. Lang and Margaret V. Westfall
3 Methods
3.1 Isolation of Adult 1. KHB-Ca2+ (Subheading 2.1, item 16) and KHB + Ca2+
Cardiac Myocytes from (Subheading 2.1, item 17) should be pre-warmed at 37 C
Rat Hearts prior to use.
3.1.1 Preparing for 2. All “open” tubes should be covered tightly with Parafilm
Myocyte Isolation between cell isolations. Just prior to each cell isolation, remove
Parafilm from all openings, place Pyrex gas dispersion tube
(e.g., oxygenator) in syringe #1 (KHB + Ca2+ syringe) and
adjust delivery of gas (95 % O2, 5 % CO2) to achieve a gentle
release of O2.
3. Turn on the water bath to begin heating the Baker perfusion
manifold to 37 C. Wash the perfusion apparatus, syringes #1
and #2 and all tubing with 70 % ethyl alcohol (Subheading 2.1,
item 9), then sterile dH2O (x2) (Subheading 2.1, item 5), and
finally sterile dH2O with P/S (Subheading 2.1, item 10).
Ensure both the primary tubing and the bubble traps and
drains are treated with ethyl alcohol and then thoroughly
rinsed with dH2O to remove all traces of ethyl alcohol prior
to the next step.
4. Turn the changeover stopcock to closed position while keeping
the lower stopcock in an open position. Fill syringe #1 and the
attached tubing with pre-warmed KHB + Ca2+ (Subhead-
ing 2.1, item 17). Fill syringe #2 with pre-warmed
KHB-Ca2+ (Subheading 2.1 item 16) (see Note 1). Remove
all air bubbles in the tubing while flushing the setup with KHB
from each syringe (see Note 3). Once air bubbles are removed,
perform a final flush with KHB + Ca2+. Then, keep the upper
stopcock in the syringe #1 open position. Close the lower
stopcock until the heart is ready to mount. Do not allow the
syringes and tubing to empty once the flushing process is
complete. Oxygenate the KHB + Ca2+ buffer for 10–15 min
prior to heart perfusion.
5. Fill a large bucket with ice loaded to be even with the rim of the
bucket. Place both the top and bottom portions of a cell
culture dish on the ice. Fill each portion with 50 mL KHB +
Ca2+ (Subheading 2.1 item 17) and keep one on ice. Fill a
Gene Transfer into Cardiac Myocytes 183
3.1.3 Retrograde 1. Perfuse the heart for 5 min with KHB + Ca2+ (Subheading 2.1,
Perfusion of the Heart item 17; syringe #1). The perfusion rate during this time
should be 6–10 mL/min (see Note 8).
2. After 3 min, transfer the oxygenator to syringe #2 containing
KHB-Ca2+ (Subheading 2.1, item 16), then wait an additional
2 min to turn the changeover stopcock to the open position for
syringe #2 (KHB-Ca2+). Perfuse the heart with KHB-Ca2+ for
5 min (see Note 9). After 3 min of perfusion with KHB-Ca2+,
adjust the syringe volume to 35 mL with KHB-Ca2+ and add all
of the digestion solution (Subheading 2.1, item 20) using the
drain tubing (final volume 60 mL). Place the heart in a 25 mL
beaker and allow the perfusate to rise to level where the heart is
partially or fully submerged in buffer. Then, position the tip of
the reperfusion tubing (a small piece of PE-20 tubing) near the
top of the perfusate against the glass interface and away from
the heart. Perfuse the heart in digestion solution for 15–18 min
at a rate of up to 10 mL/min (see Note 9).
3. Add 3 150 μL aliquots of 100 mM CaCl2 (Subheading 2.1,
item 15) to syringe containing the KHB-Ca2+ (Subhead-
ing 2.1, item 16) with digestion solution (syringe #2) every
30 s for 1.5 min. Add 50 μL of 100 mM CaCl2 directly to the
solution surrounding the heart at the end of 1.5 min. Continue
perfusion for an additional 15–18 min (see Note 9).
4. At the end of this interval, turn the changeover stopcock to
stop perfusion, remove the cannula containing the heart from
the apparatus and place the heart in a sterile cell culture dish.
Remove the aorta, any remaining fascia, and the atria from the
heart. Drain all of the digestion solution (Subheading 2.1, item
20) from syringe #2 and the associated tubing into a sterile
100 mL beaker. Then, mince the ventricles into 5–6 pieces with
fine dissection scissors, and place into a sterile 50 mL beaker
containing 15–20 mL of warm digestion solution. Cover the
remaining digestion solution with Parafilm and store in a
37 C, 5 % CO2 incubator. Cover the beaker containing the
minced heart pieces with Parafilm to minimize contamination.
3.1.4 Myocyte Isolation 1. A small piece of PE-20 tubing connected via larger Tygon®
tubing is used to oxygenate the minced ventricle with O2 gas
(95 % O2–5 % CO2). Treat the PE-20 tubing tip with 70 % ethyl
alcohol (Subheading 2.1, item 9), allow tip to air-dry, and then
place tip just inside the beaker adjacent to the Parafilm. Gently
swirl the minced ventricular tissue in a 37 C water bath.
2. After 5 min, collect the supernatant into a sterile Blue Max tube
(15 mL; DB Falcon™) using a silanized triturator to transfer
the solution. Centrifuge in a tabletop clinical centrifuge for 10 s
at 45 g. This supernatant is generally discarded because there
are few rod-shaped cells, but this first digestion is highly vari-
able and should be determined by each lab.
Gene Transfer into Cardiac Myocytes 185
3.2 Gene Transfer Work with recombinant adenovirus requires prior BL2 approval.
into Rat Cardiac Viral vectors should be handled in a biosafety cabinet and the
Myocytes surface should be treated with 60 % Lysol followed by 70 % ethyl
alcohol with each entry and exit from the cabinet. Personnel
handling vectors should wear safety glasses, gloves, and a lab coat.
The biosafety cabinet should be equipped with a vacuum system
containing tandem Erlenmeyer flasks attached to a 0.1 μm
approved vacuum filter. The Erlenmeyer used for direct collection
of media and a 2 L beaker should have adequate amounts of 10 %
bleach to treat all virus for at least 20 min prior to discarding excess
media. All plasticware and glassware should be treated with 10 %
bleach for 20 min and then disposed of in a biocontainment bag.
1. Aspirate excess laminin from each coverslip (Subheading 3.1.4
#9) and pipette 200 μL of resuspended cells onto the laminin-
coated surface (2 104 cells/ coverslip) (see Note 13).
2. Carefully place the plates into the incubator (37 C; 5 % CO2)
and incubate the cells for 2 h.
3. During the incubation period, dilute the adenoviral stocks in
sterile microfuge tubes to the desired multiplicity of infection
(MOI) with DMEM + P/S (Subheading 2.2 item 3)
Gene Transfer into Cardiac Myocytes 187
3.3 Culturing Rat 1. One hour after the addition of virus, add 2 mL M199 + P/S
Cardiac Myocytes (Subheading 2.2 item 5) to each well and return the plates to
the incubator (see Note 16).
2. Replace the media in each well with 2 mL pre-warmed
M199 + P/S (Subheading 2.2 item 5) 24 h after gene transfer.
3. Change the media every other day after this initial media change.
4 Notes
Acknowledgements
References
1. Davis J et al (2008) Designing heart perfor- Handbook of Molecular and Cellular Methods
mance by gene transfer. Physiol Rev 88 in Biology and Medicine. CRC Press, Boca
(4):1567–1651 Raton, Florida, pp 557–578
2. Westfall MV et al (1997) Adenovirus-mediated 12. Jaenisch R (1976) Germ line integration and
myofilament gene transfer into adult cardiac Mendelian transmission of the exogenous
myocytes. Methods Cell Biol 52:307–322 Moloney leukemia virus. Proc Natl Acad Sci
3. Panchal RG et al (2001) Gene transfer: manip- U S A 73(4):1260–1264
ulating and monitoring function in cells and 13. Pfeifer A (2004) Lentiviral transgenesis. Trans-
tissues. Clin Exp Pharmacol Physiol 28 genic Res 13(6):513–522
(8):687–691 14. Fassler R (2004) Lentiviral transgene vectors.
4. McWhinney CD, Hansen C, Robishaw JD EMBO Rep 5(1):28–29
(2000) Alpha-1 adrenergic signaling in a car- 15. Wells K, Moore K, Wall R (1999) Transgene
diac murine atrial myocyte (HL-1) cell line. vectors go retro. Nat Biotechnol 17(1):25–26
Mol Cell Biochem 214(1–2):111–119 16. Kass-Eisler A et al (1993) Quantitative determi-
5. Beaumont J et al (2008) Overexpression of nation of adenovirus-mediated gene delivery to
human truncated peroxisome proliferator- rat cardiac myocytes in vitro and in vivo. Proc
activated receptor alpha induces apoptosis in Natl Acad Sci U S A 90(24):11498–11502
HL-1 cardiomyocytes. Cardiovasc Res 79 17. Hofmann A et al (2003) Efficient transgenesis
(3):458–463 in farm animals by lentiviral vectors. EMBO
6. Ting YK et al (2011) Transcriptional activation Rep 4(11):1054–1060
of the anchoring protein SAP97 by heat shock 18. Izsvak Z et al (2009) Efficient stable gene
factor (HSF)-1 stabilizes K(v) 1.5 channels in transfer into human cells by the Sleeping
HL-1 cells. Br J Pharmacol 162(8):1832–1842 Beauty transposon vectors. Methods 49
7. Louch WE, Sheehan KA, Wolska BM (2011) (3):287–297
Methods in cardiomyocyte isolation, culture, 19. Merkulov S et al (2012) In vivo cardiac myosin
and gene transfer. J Mol Cell Cardiol 51 binding protein C gene transfer rescues myofil-
(3):288–298 ament contractile dysfunction in cardiac myo-
8. Monge C et al (2009) Comparative analysis of sin binding protein C null mice. Circ Heart Fail
the bioenergetics of adult cardiomyocytes and 5(5):635–644
nonbeating HL-1 cells: respiratory chain activ- 20. Lee CJ et al (2011) Promoter-specific lentivec-
ities, glycolytic enzyme profiles, and metabolic tors for long-term, cardiac-directed therapy of
fluxes. Can J Physiol Pharmacol 87 Fabry disease. J Cardiol 57(1):115–122
(4):318–326
21. Fassler M et al (2013) Preferential lentiviral
9. Rust EM, Westfall MV, Metzger JM (1998) targeting of astrocytes in the central nervous
Stability of the contractile assembly and system. PLoS One 8(10):e76092
Ca2 + -activated tension in adenovirus
infected adult cardiac myocytes. Mol Cell Bio- 22. Wang L et al (2009) Long-term effect of neu-
chem 181(1–2):143–155 ronal nitric oxide synthase over-expression on
cardiac neurotransmission mediated by a lenti-
10. Kirshenbaum LA et al (1993) Highly efficient viral vector. J Physiol 587(Pt 14):3629–3637
gene transfer into adult ventricular myocytes by
recombinant adenovirus. J Clin Invest 92 23. Pacak CA, Byrne BJ (2011) AAV vectors for
(1):381–387 cardiac gene transfer: experimental tools and clin-
ical opportunities. Mol Ther 19(9):1582–1590
11. Kampert SE, Devaney E, Westfall MV (2011)
Gene transfer and expression in animal cells. In: 24. Deyle DR, Russell DW (2009) Adeno-
Cseke AKLJ, Kaufman PB, Westfall MV (eds) associated virus vector integration. Curr Opin
Mol Ther 11(4):442–447
190 Sarah E. Lang and Margaret V. Westfall
Abstract
4D myocardial wall motion analysis (3D structure over time) during early embryonic stages of chick heart
development provides a comprehensive view to characterize the biomechanical environment of cardiac
growth. Myocardial wall strains, velocity, and area shortening over the cardiac cycle are common wall
motion assessments and can be accurately measured from 4D datasets. Here, we describe how to employ a
variety of image modalities (optical, ultrasound, and optical coherence tomography imaging) and analysis
techniques to extract quantitative measures of myocardial wall motion.
Key words Myocardial wall motion, Chick heart development, Optical imaging, Ultrasound imaging,
Optical coherence tomography (OCT) imaging, 4D synchronization, 4D reconstruction, Cardiac
segmentation
1 Introduction
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8_16, © Springer Science+Business Media New York 2015
191
192 Madeline Midgett and Sandra Rugonyi
2 Materials
2.2 Optical Imaging 1. Stereomicroscope, with at least 10 magnification for proper
image resolution at early cardiac development stages (3–4 days
of incubation).
2. CCD camera, with a frame rate of at least 100 frames per second
(fps) to achieve adequate time resolution within the cardiac cycle
(>40 frames per cycle with typical cardiac periods ~400 ms).
3. Egg positioning platform, with a cup to hold egg in place
during imaging.
2.5 Imaging Analysis 1. Computer, with enough memory and processing capacity to
analyze acquired datasets.
2. Image analysis software, e.g., imaging system platform, Matlab,
Amira, etc.
3 Methods
3.1 Embryo 1. Incubate fertilized white Leghorn chick eggs blunt end up at
Preparation 37.5 C and 80 % humidity until they reach the desired imaging
embryonic developmental stage. Following Hamburger-
Hamilton (HH) staging, eggs reach stage HH18 and HH24
after approximately 3 and 4 days of incubation, respectively [5]
(see Note 4).
194 Madeline Midgett and Sandra Rugonyi
3.2 Imaging the Image embryos in vivo at development stages up to HH26 nonin-
Embryo Using Optical vasively with optical imaging (see Note 6), to acquire top view
Imaging (and a CCD images of the beating heart. Perform the following steps for optical
Camera) image acquisition:
1. Attach a CCD camera to a lens adapter and mount on a
stereomicroscope.
2. Position the embryo in the holding cup to obtain a clear view of
the heart, as shown in Fig. 1.
3. Record at least 3–4 cardiac cycles of video.
4. Record a scribed standard in the view field to convert pixel
dimensions to length measurements during image analysis.
3.3 Analysis of Optical images can be used to measure ventricular area and volume
Optical Images over the cardiac cycle to allow characterization of embryonic car-
diac mechanics, including stroke volume and cardiac output, and
3.3.1 Optical Image thus of myocardial function. Keller et al. among others have used
Geometrical Analysis planimetry software to measure ventricular epicardial perimeter and
ventricular area from optical images [8–11], and have also charac-
terized the relationship between ventricular area and pressure over
the cardiac cycle [12] (shown in Fig. 2). Further, ventricular vol-
ume has been estimated from optical images using both prolate
spheroid and spherical geometry [13]. These analyses of optical
images are outlined in this section.
1. Verify the heart region of interest was imaged, and that the
image contrast provides distinguishable heart structures from
surrounding tissue and fluid. Also verify that an adequate heart
rate was obtained throughout the entire acquired dataset.
2. Use the imaged scribed standard to calibrate image pixel count
to an appropriate length measurement (e.g., mm).
3. Select acquired image frames (from at least three cardiac cycles)
where maximum or end-diastole (ED) and minimum or end-
systole (ES) ventricular area occurs, and use planimetry soft-
ware to calculate ventricle perimeter and area in the imaging
plane from an outline of the ventricle.
4. Calculate shortening fractions (SF) for each variable measured,
using
x ED x ES
SF ¼ ð1Þ
x ED
Fig. 2 Pressure-area loops for HH stage 16–24, with the progression of the
cardiac cycle moving in a counterclockwise direction around each loop.
Ventricular diastole (relaxation and filling) occurs at the bottom edge of the
loop until the ventricle reaches maximum expansion. Ventricular systole (active
contraction) then causes the pressure to rapidly increase to the top edge of
the loop, where the outflow tract cushions open and blood flows from the
ventricle into the aorta. This is followed by ventricle relaxation to form the
pressure-area loop. Figure reproduced with permission from [12]
196 Madeline Midgett and Sandra Rugonyi
where xED and xES are the average measure values (ventricle
diameter, perimeter, or area) at ED and ES, respectively.
5. Calculate ventricle volume assuming either prolate spheroid or
spherical geometry [13]. With prolate spheroid geometry,
measure the long axis (2a) and short axis (2b) of the ventricle,
and calculate ventricle volumes (V) at each phase of the cardiac
cycle using
V ¼ ð4=3Þ π ab 2 : ð2Þ
3.3.2 Optical Image Embryonic cardiac wall motion can also be quantified from optical
Centerline Point-Intensity images using centerline point-intensity analysis. This analysis uses
Analysis image intensities to estimate heart size over the cardiac cycle, and is
most effective to compare myocardial wall motion and determine the
phase of contraction events along the embryonic tubular heart (ven-
tricle and OFT) (see Note 7). Centerline point-intensity analysis of
optical images is summarized in Fig. 3 and outlined in this section.
1. Use image software to invert the intensity of monochrome
videos to create a direct correlation of pixel intensity with
lumen diameter, so that cardiac expansion and contraction
correspond to an increase and decrease of inverse image inten-
sity, respectively.
Fig. 3 Centerline point-intensity analysis overview. (a) Inverted intensity frame from a recorded video of the
embryonic chick heart, with the heart ventricle and outflow tract identified. (b) Frame from (a) showing
possible M-mode extraction locations, and M-mode image from location V2 over approximately eight cardiac
cycles. (c) Extracted pixel intensity versus time data from dashed centerline of the M-mode from (b)
Analysis of 4D Myocardial Wall Motion During Early Stages of Chick Heart Development 197
3.4 Imaging the Use embryos at stages HH24 and older for ultrasound imaging (see
Embryo Using Note 8). B-mode images, M-mode images, and Doppler velocity
Ultrasound can be separately acquired with ultrasound. Doppler velocity within
Biomicroscopy the myocardium walls can be acquired with ultrasound, but it is
difficult to confirm that the measurement location (sampling area)
stays within the wall boundaries, so blood flow velocities through
the heart are more commonly measured. While the different imag-
ing modalities can be acquired independently, B-mode images are
first acquired to locate the heart and cardiac structures of interest.
3.4.1 Acquisition 1. During embryo preparation, window the egg as much as possi-
of B-Mode Ultrasound ble so that the probe can make direct contact with the fluid
Images surface. Wait to remove the ISM until the egg is immersed in
HBSS (see Note 9).
2. Place the egg in a beaker filled with warmed HBSS (37.5 C) so
that the level of HBSS just covers the embryo, and stabilize the
egg to ensure it stays upright.
3. Center the egg on an XYZ platform to allow maximal range of
motion during positioning, and lower the probe until it
touches the HBSS surface. Ensure good contact between the
ultrasound probe and the HBSS solution (which acts as ultra-
sound gel for embryonic cardiac image acquisition), as air gaps
at the probe surface degrade ultrasound signals.
4. Begin acquiring ultrasound images in B-mode. Gently move
the probe while observing acquired images to locate the
embryonic heart, which is easily distinguishable due to its
beating motion. A B-mode ultrasound biomicroscopy frame
of a HH24 chick embryo is shown in Fig. 4a.
5. Position the probe so that the desired cardiac imaging plane is
achieved and the image focal zone is in line with the heart
structure. To collect cross-sectional images of the OFT, for
example, maneuver the probe until the OFT is circular with
the lumen completely filling the OFT at maximum expansion
and having a slit-like shape at maximum contraction.
6. Decrease the image width as much as possible around the heart,
and set the line density to achieve optimal resolution and frame
capture rate (see Note 10). Adjust the persistence setting to
198 Madeline Midgett and Sandra Rugonyi
Fig. 4 Typical ultrasound longitudinal OFT image. (a) B-mode image of HH24 chick embryo. (b) Pulse wave
velocity of blood flowing through the OFT during approximately four cardiac cycles. L lumen, M myocardium,
C cardiac jelly, A atrium, V ventricle
3.4.2 Acquisition of 1. Start imaging in B-mode and position the probe to show a
Doppler Ultrasound Images longitudinal section of the heart.
2. Change the system setting to Doppler mode.
3. Select a sampling area in the center of the lumen, and make it as
small and close to the center of the lumen as possible to keep
the sampling area within the lumen over the cardiac cycle.
4. Use the ultrasound system’s software to estimate the angle
between the probe beam and the direction of flow (this is
typically done using the system software to manually draw a
line along the presumed direction of blood flow in the sampling
area). The ultrasound system will use the measured flow angle
(θ) to convert the measured velocity projection (Vz) to the
magnitude of flow velocity (V) (see Note 11) using
Vz
V ¼ : ð4Þ
cos θ
5. Acquire Doppler velocity data for at least 3–4 cardiac cycles. A
Doppler velocity trace of blood flow over time through the
HH24 heart OFT is shown in Fig. 4b.
Analysis of 4D Myocardial Wall Motion During Early Stages of Chick Heart Development 199
3.4.3 Acquisition 1. Start imaging in B-mode and position the probe to show the
of M-Mode Ultrasound heart region of interest.
Images 2. Change the system setting to M-mode.
3. Choose a line spanning a region of interest in the heart from a
B-mode image frame.
4. Acquire M-mode data for at least 3–4 cardiac cycles.
3.5 Analysis Ultrasound images can be used to measure heart dimension, strain,
of Ultrasound and blood flow velocity over the cardiac cycle to allow characteri-
Biomicroscopy Images zation of embryonic cardiac mechanics. Because ultrasound pro-
duces tomographic images, ultrasound cardiac views are not
restricted to top view images (as is the case for the optical images).
Thus ultrasound biomicroscopy enables characterization of ventric-
ular mechanics (in ways similar as those described in Subheading 3.3
but using 2D section views of the ventricle) and also atrio-
ventricular and OFT motion and function. Quantification of ultra-
sound biomicroscopy images is facilitated by the system’s software
(frequently manually done image by image), although image
sequences can also be exported and analyzed with external image
post-processing tools. The advantage of obtaining ultrasound
images is that different section views can be obtained, greatly
enhancing the analysis of embryonic myocardial motion. Ultra-
sound biomicroscopy analysis options are outlined in this section.
1. Verify the heart region of interest was imaged, and that an
adequate heart rate was obtained throughout the entire
acquired dataset.
2. Use the ultrasound system’s structural tracking features to
measure distances in selected cross-sectional B-mode frames
at several points in the cardiac cycle. Use the relative positions
to calculate strains (wall thickening and thinning) relative to
the maximum expansion position of the myocardium. Calcu-
late radial strain (εr) using
3.6 Imaging the Image embryonic hearts at stage HH18 or younger using OCT (see
Embryo Using Optical Note 13). Typically, only B-mode images are collected during
Coherence OCT image acquisition, and M-mode images are later extracted
Tomography (OCT) from the B-mode image set. Further, raw OCT data allows simul-
taneous extraction of structural and Doppler data with the same
resolution.
4D images can be acquired with nongated image acquisition,
where collection of B-mode images starts at random points in the
cardiac cycle and requires post-acquisition synchronization; or with
gated image acquisition where collection is triggered by a cardiac
signal. Jenkins et al. performed prospective-gated OCT imaging by
triggering image acquisition with signals obtained by a laser Dopp-
ler velocimeter from a vitelline vessel [14]. Gated imaging can also
be triggered with ECG signals. The gating signals need to be strong
and clear enough to adequately trigger acquisition, because error
can be introduced in 4D reconstruction if the cardiac signals are
weak or triggering algorithms are not robust. Unlike gated acquisi-
tion, which relies heavily on the gated signal for image synchroni-
zation and reconstruction, nongated acquisition requires image
post-processing. At early stages of chick cardiac development suc-
cessful synchronization and reconstruction of 4D OCT images is
possible using nongated acquisition because the embryo is not yet
moving within the egg, and also due to the periodic motion of the
cardiac cycle. Acquisition of 2D and 4D OCT image sets, focusing
on OCT imaging of the HH18 heart OFT, is outlined in this
section.
1. Set up system acquisition parameters. To adequately analyze
heart wall motion data over the cardiac cycle, the OCT system
should achieve an axial resolution of at least 10 μm in tissue, a
Analysis of 4D Myocardial Wall Motion During Early Stages of Chick Heart Development 201
Fig. 5 Representative OCT images of the embryonic chick OFT. (a) Cross-sectional 2D image at maximal
expansion. (b) Cross-sectional 2D image at maximal contraction. (c) Longitudinal 2D image at maximal
expansion. (d) Longitudinal 2D image at maximal contraction. (e) 2D scan strategy schematic. M myocardium,
C cardiac jelly, L lumen
202 Madeline Midgett and Sandra Rugonyi
Fig. 6 Flow chart of OCT image analysis. (a) Select a centerline in the middle OFT of the B-mode structural
image at maximal expansion. (b) Extract an M-mode image from the B-scan structural dataset along the
centerline, select points along the top and bottom borders of the upper myocardium wall, and interpolate
between the points and give the wall trace (red borders). (c) Extract the position data and convert to relative
wall depth, where z0 and zi are the outer and inner myocardial wall positions, respectively. (d) Select the B-
mode phase image at time tn, and select the centerline. (e) Extract an M-phase image from the B-scan phase
dataset along the centerline. (f) Extract the velocity profile along the center (dashed) line, import the
myocardium wall z-positions at time tn on the velocity profile, and perform a linear fit to the Doppler data
over the myocardial wall thickness to obtain the velocity gradient, i.e., strain rate. M myocardium
where zo and zi are the radial positions of the outer and inner
borders of the upper myocardial wall (obtained from the
M-mode tracing algorithm), respectively [15].
8. To calculate myocardial wall radial velocity using Doppler OCT
data, first obtain an M-phase image that corresponds to the
extracted M-mode image. Phase images contain data on phase
shifts (caused by the movement of tissue and blood cells
between two adjacent A-lines in a B-scan image), and are
obtained together with structural images (and with the same
resolution) after processing raw OCT signals. M-phase images
are then obtained the same way M-mode images are obtained,
but data is extracted along a line from phase images (rather than
structural images). Then convert the phase shift (Δϕ) at each
pixel in the M-phase image to the vertical component of veloc-
ity (Vz) using
λ0 Δϕ
Vz ¼ ; ð8Þ
4π n τ
where λ0 is the central wavelength, n is the refractive index of
the tissue (~1.35), and τ is the time difference between two
adjacent A-scans. Vz of the myocardial wall corresponds to the
wall radial velocity. To identify the regions corresponding to
the myocardial wall in M-phase images, use the myocardial wall
traces extracted from M-mode images.
9. Measure myocardial wall strain rates (in the radial direction)
with Doppler OCT, using the velocity gradient in the myocar-
dium wall [16]. Use the delineated myocardial wall borders to
determine the portion of the extracted velocity profile that
corresponds to the myocardial wall. Since the velocity distribu-
tion is linear along the myocardial wall, find the radial strain rate
by calculating the slope of a linear fit to the velocity gradient.
10. The radial strain can be calculated (see also the alternative calcu-
lation presented in Subheading 3.7, step 5) by integrating the
strain rate velocity gradient over the time period of interest [16].
Analysis of 4D Myocardial Wall Motion During Early Stages of Chick Heart Development 205
Y X OFT
t/T=0 t/T=1
Z X Z
Position 1
1st Scan
Position
1st Scan 2nd Scan 200th Scan 1st image 2nd image 196th image
Position 110
Fig. 7 Schematic of OFT synchronization and reconstruction. 200 cross-sectional images were acquired at
120 different positions along the OFT, images from each sequence are then pooled and synchronized to one
cardiac cycle, and then 2D images are pooled at each time point to reconstruct 196 3D images over one
cardiac cycle. Figure adapted from [20]
206 Madeline Midgett and Sandra Rugonyi
These lines should contain the OFT upper and lower walls, and
be centered with respect to the OFT cross section to achieve
optimal synchronization.
2. Extract M-mode images from each cross-sectional B-mode
sequence along the selected lines. The resulting M-mode
image can be represented by its intensity I (zm, tn), which varies
with position along the vertical axis (zm) and time point (tn).
3. Compute the cardiac period of each M-mode image (and thus
each B-mode sequence) using the string-length method (SLM)
or a similar algorithm [19] (see Note 19).
4. Re-arrange M-mode lines by pooling them into one cardiac
cycle and arranging them by phase (see Note 20). If tn is the
time corresponding to a structural line in the M-mode image,
the phase (pn: time position during the first cardiac cycle) for
that line is
ht i
n
pn ¼ t n T; ½: represents integer part: ð9Þ
T
5. Resample the phase-organized M-mode images into a normal-
ized cardiac cycle using cubic spline interpolation among line
gray-scale intensities (see Note 21), so that each M-mode image
has the same number of vertical lines (K), equally spaced in
time spanning exactly one cardiac cycle.
6. Compute the correlation (a measure of similarity) of M-mode
images (Ii and Ii+1) corresponding to image sequences acquired
at adjacent positions i and i + 1 along the OFT. Correlation is
computed using a correlation coefficient (Ci,i+1) defined as
M K
C i, iþ1 ðs Þ ¼ ∑ ∑ I i z m ; pn I iþ1 z m , pn s ð10Þ
m¼1n¼1
Δ p Δ p* 0
plag ¼ ; S i ¼ S i þ ði 1Þ plag : ð13Þ
L1
12. Using the absolute phase shifts calculated in Subheading 3.8,
step 11, synchronize all acquired image sequences (cross-
sectional B-mode images) along the OFT. Shift time points
for each image sequence by Si0 and pool the images to a normal-
ized cardiac cycle across all sequences to fully synchronize the
dataset. Use image interpolation to resample images at equally
spaced phases over the cardiac cycle, so that 2D images can
form 3D structural images spanning the cardiac cycle, and
reconstruct the 4D motion of the heart.
3.9 Analysis of 4D To fully analyze the reconstructed 4D motion of the heart, struc-
OCT Images tural cardiac features might be segmented from the rest of the
image. Segmented geometries are used to better visualize and
quantify cardiac wall motion over the cardiac cycle. Motions from
different control and treated embryos can be compared to assess
the effects of interventions on myocardial motion dynamics and
function. Further, segmented geometries can be used in computa-
tional models of the beating heart. Groups have used manual or
semi-manual segmentation to analyze heart wall motion by picking
specific time points within the cardiac cycle to analyze the 3D
structural data. Garita et al. chose 15 points in the cardiac cycle to
segment the myocardium, lumen, and cardiac jelly at six locations
spanning the OFT to produce 90 volumes of structural data [21].
208 Madeline Midgett and Sandra Rugonyi
Fig. 8 Sketch showing the OFT shape extraction procedure from OCT images. (a) Cross-sectional plane
depicting the myocardium and endocardium layers, the myocardium mid-layer contour, a layer DLM placed on
the myocardium, and an edge DLM placed on the endocardium. (b) Initial cross-sectional plane, with ps as the
centroid position vector in each plane, and ns as the normal vector in the direction of flow. (c) Extraction of the
cardiac shape is performed by sweeping cross-sectional planes along the OFT. Image reproduced from [20]
Analysis of 4D Myocardial Wall Motion During Early Stages of Chick Heart Development 209
4 Notes
placed near the embryo, or ECG heart rate tracking that work
with the employed imaging system.
3. Use a 40 MHz probe to fully penetrate the fluid and heart tissue
at stage HH24–HH26. Higher frequency probes can achieve
deeper penetration depths for subsequent embryo stages.
4. At these early stages of development, the chick heart is tubular
with no valves. The OFT connects the ventricle with the arterial
system and acts as a primitive valve by closing to limit blood flow
[7]. The ventricle and OFT are readily visible on the top of the
embryo.
5. Embryos at stage HH18 of development have a curved upper
body and straight tail, only slight limb buds, and un-pigmented
eyes, while embryos at developmental stage HH24 have a
curved upper body and tail, protruding limb buds, dark-
pigmented eyes, and more surrounding vasculature than at
stage HH18.
6. After HH26, the embryo sinks in the egg and the heart becomes
difficult to visualize using noninvasive optical methods.
7. Point-intensity analysis is based on the same principles as video
densitometry used by clinicians to track changes in x-ray and
ultrasound images. In the vasculature, image intensity is mainly
determined by the amount of blood present at different points in
the cardiac cycle. Red blood cells absorb a fraction of the light,
reflecting a less intense (darker) region in a digital image. There-
fore, decreasing image intensities are representative of increasing
blood vessel diameter in which more blood is present.
8. Ultrasound spatial resolution of heart structures in embryos
younger than HH24 is poor.
9. The ISM is easier to cleanly remove (less blood vessels tear),
when immersed in HBSS.
10. The motion of the beating heart is better resolved with higher
acquisition frame rates. Smaller image widths and lower line
densities produce higher system acquisition frame rates, but
decrease image resolution. Proper image acquisition should
balance a high frame rate with adequate image resolution.
11. The angle between the probe beam and flow for Doppler
velocity correction calculations introduces more error with
larger angles, as indicated by Eq. 4.
12. Velocity measurement variations will occur from ultrasound
probe placement angle measurement and biologic variations
between embryos.
13. From the onset of cardiac beating to about stage HH16, the
whole embryonic heart can be imaged with OCT. Between
HH17 and HH18, only the heart OFT can be completely
visualized on OCT images due to penetration limits. At stages
Analysis of 4D Myocardial Wall Motion During Early Stages of Chick Heart Development 211
older than HH18, the heart becomes bigger (so that the lower
myocardium structures can no longer be distinguished) and
then it sinks down into the egg until it exceeds the maximum
depth penetration of the system.
14. Increasing the number of A-lines in each B-scan increases axial
resolution but decreases B-scan frame rate.
15. It is important to keep the distance between adjacent imaging
planes small so that structural features overlap in 4D
reconstruction.
16. Previous 4D acquisition of the OFT motion has used 200 time
frames at 140 fps, and 196 positions along the OFT spaced
7.5 μm apart, which takes about 20 min to image at HH18 [22].
17. M-mode images can also be extracted from B-mode ultrasound
images, except that the image resolution does not usually allow
for crisp M-mode images, and thus direct M-mode acquisition
is usually preferred to increase M-mode image resolution.
18. The line must be in similar orientation to the lumen slit/jelly
across datasets so as not to introduce any differences in radial
strains due to cardiac jelly influence on wall deformation.
19. Differences in periods across the dataset occur mainly because
of temperature fluctuations during imaging. Thus, temperature
needs to be controlled and only allowed to fluctuate minimally.
20. The M-mode A-lines are pooled to one cardiac cycle step to
improve the accuracy of the algorithm.
21. Cubic spline interpolation offers a good balance between algo-
rithm cost and performance. Other interpolation algorithms,
however, can also be used.
22. Constant contraction velocity is assumed. This is only true on
relatively small portions of the heart and is the case for the
length of the OFT. Phase lags should be evaluated in separate
regions of the heart to achieve accurate reconstruction.
23. 2D cross-sectional planes are used since the tubular tissue layer
forms a closed contour for segmentation. Image processing is
also much simpler on 2D frames than with 3D or 4D datasets.
24. Layer detection can sometimes fail and will have to be manually
corrected, especially in cases of close proximity between target
and adjacent tissues, incorrect initial DLM orientation, and
overlap of adjacent DLMs.
Acknowledgement
This work was supported by NIH grant R01 HL094570 and NSF
grant DBI 1052688.
212 Madeline Midgett and Sandra Rugonyi
References
1. Clark EB, Hu N, Frommelt P et al (1989) 13. Faber JJ, Green TJ, Thornburg KL (1974)
Effect of increased pressure on ventricular Embryonic stroke volume and cardiac output
growth in stage 21 chick embryos. Am J in the chick. Dev Biol 41:14–21
Physiol 257:H55–H61 14. Jenkins MW, Chughtai OQ, Basavanhally AN
2. Fishman MC, Stainier DY (1994) Cardiovas- et al (2007) In vivo gated 4-D imaging of the
cular development. Prospects for a genetic embryonic heart using optical coherence
approach. Circ Res 74:757–763 tomography. J Biomed Opt 12(3):030505
3. Groenendijk BC, Hierck BP, Vrolijk J et al (2005) 15. Li P, Yin X, Shi L et al (2011) Measurement of
Changes in shear stress-related gene expression strain and strain rate in embryonic chick heart
after experimentally altered venous return in the in vivo using spectral domain optical coherence
chicken embryo. Circ Res 96:1291–1298 tomography. IEEE Trans Biomed Eng
4. Hove JR, Koster RW, Forouhar AS et al (2003) 58:2333–2338
Intracardiac fluid forces are an essential epige- 16. Li P, Liu A, Shi L et al (2011) Assessment
netic factor for embryonic cardiogenesis. of strain and strain rate in embryonic chick
Nature 421:172–177 heart in vivo using tissue Doppler optical
5. Hamburger V, Hamilton HL (1951) A series of coherence tomography. Phys Med Biol
normal stages in the development of the chick 56:7081–7092
embryo. J Morphol 88:49–92 17. Liebling M, Forouhar AS, Gharib M et al
6. Hogers B, DeRuiter MC, Gittenberger-de (2005) Four-dimensional cardiac imaging in
Groot AC et al (1997) Unilateral vitelline vein living embryos via post-acquisition synchroni-
ligation alters intracardiac blood flow patterns zation of nongated slice sequences. J Biomed
and morphogenesis in the chick embryo. Circ Opt 10(5):054001
Res 80:473–481 18. Liebling M, Forouhar AS, Gharib M et al
7. Gittenberger-de Groot AC, Bartelings MM, (2005) Wavelet-based synchronization of non-
Deruiter MC et al (2005) Basics of cardiac devel- gated confocal microscopy data for 4-D imag-
opment for the understanding of congenital ing of the embryonic heart. Proc SPIE
heart malformations. Pediatr Res 57:169–176 5914:591409
8. Keller BB, Hu N, Clark EB (1990) Correlation 19. Liu A, Wang R, Thornburg KL et al (2009)
of ventricular area, perimeter, and conotruncal Efficient postacquisition synchronization of 4-
diameter with ventricular mass and function in D nongated cardiac images obtained from opti-
the chick embryo from stages 12 to 24. Circ cal coherence tomography: application to 4-D
Res 66:109–114 reconstruction of the chick embryonic heart.
9. Lin IE, Taber LA (1994) Mechanical effects of J Biomed Opt 14:044020
looping in the embryonic chick heart. J Bio- 20. Yin X, Liu A, Thornburg K et al (2012)
mech 27:311–312 Extracting cardiac shapes and motion of the
10. Keller BB, Yoshigi M, Tinney JP (1997) chick embryo heart outflow tract from four-
Ventricular-vascular uncoupling by acute con- dimensional optical coherence tomography
otruncal occlusion in the stage 21 chick images. J Biomed Opt 17(9):096005
embryo. Am J Physiol Heart Circ Physiol 21. Garita B, Jenkins MW, Han M et al (2011)
273:H2861–H2866 Blood flow dynamics of one cardiac cycle and
11. Stekelenburg-De Vos S, Steendijik P, Ursem relationship to mechanotransduction and tra-
NTC et al (2005) Systolic and diastolic ventric- beculation during heart looping. Am J Physiol
ular function assessed by pressure-volume Heart Circ Physiol 300:H879–H891
loops in the stage 21 venous clipped chick 22. Liu A, Yin X, Shi L et al (2012) Biomechanics
embryo. Pediatr Res 57:16–21 of the chick embryonic heart outflow tract at
12. Keller BB, Hu N, Serrino PJ et al (1991) Ventric- HH18 using 4D optical coherence tomogra-
ular pressure-area loop characteristics in the stage phy imaging and computational modeling.
16 to 24 chick embryo. Circ Res 68:226–231 PLoS One 7(7):e40869
INDEX
Gary R. Skuse and Maureen C. Ferran (eds.), Cardiomyocytes: Methods and Protocols, Methods in Molecular Biology,
vol. 1299, DOI 10.1007/978-1-4939-2572-8, © Springer Science+Business Media New York 2015
213
214 C ARDIOMYOCYTES: METHODS
Index
AND PROTOCOLS
T V
Taqman ........................................................ 119, 125, 126 Vascular endothelial growth factor (VEGF) ...............106,
Thrombin ........................................................... 106, 108, 108, 110, 112
110, 112 Ventricular area.............................................................. 195
Tissue displacement Ventricular pressure....................................................... 195
bidomain.................................................................... 98 Ventricular volume........................................................ 195
extracellular ......................................... 96, 98, 99, 101 Versene............................................... 106, 107, 109, 118,
intracellular ...........................................94–96, 99, 101 120, 122, 129
monodomain .............................................. 67, 98–102 Viral myocarditis
Tissue engineering ..............................103, 104, 115, 134 adenovirus .................................1, 178, 179, 186–188
TopHat ............................................................... 31, 43, 44 coxsackievirus B3 ........................................................ 1
Traction force microscopy ........................................79, 88 enterovirus ................................................................... 1
Transcription factors Viral vectors
GATA-4 ................................................. 19, 21, 23, 25 adeno-associated virus (AAV)................................. 178
Nkx2.5 ............................................. 25, 162, 164–166 adenovirus ................................ 1, 178, 179, 186, 188
Transforming growth factor (TGF) ............................106, lentivirus .................................................................. 178
110, 116
Triton X-100 ........................................10, 149, 162, 165, W
169, 171
Trizol .....................................................29, 31, 34, 45, 46 Whole genome sequencing ......................................51, 55