Vous êtes sur la page 1sur 25

TRABAJO COLABORATIVO PASO 2

GENÉTICA CUANTITATIVA Y DE POBLACIONES APLICADA


AL MEJORAMIENTO ANIMAL

MARIA DEL CARMEN QUIMBAYO ACOSTA


CODIGO_1065655016
FERNANDO JAVIER GARCIA
CODIGO_
LUCENI MARIN ELIZALDE
CODIGO_
LAURA ANDREA REYES
CODIGO_
ANDRES FELIPE VILLEGAS
CODIGO_

DAVID ROMERO
TUTOR

UNIVERSIDAD NACIONAL ABIERTA A DISTANCIA-UNAD


ESCUELA: ECPMA
PROGRAMA: ZOOTECNIA
CURSO: MEJORAMIENTO ANIMAL
MARZO 2018
A continuación, encontrará la secuencia de parte del gen de la
miostatina y su respectiva traducción en la proteína
correspondiente.
En relación a las secuencias (del gen y de la proteína) indique:
A. Importancia del gen:
El gen pertenece a la superfamilia de factores
transformantes de crecimiento beta (TGF-B) que actúa
como factor de crecimiento y diferenciación en los tejidos
musculares.

B. Función del gen de la miostatina


Su función es el control y mantenimiento de la masa del
musculo esquelético y actúa como un regulador negativo del
crecimiento muscular. Entre las funciones moleculares
están: actividad citoquinetica, actividad de
homodimierización de proteínas, unión de receptores y
unión de proteínas idénticas. Entre los procesos biológicos
en los que actúa están: desarrollo celular, homeostasis de
células musculares, desarrollo de órganos, proceso de
ovulación, respuesta del estrógeno y muchos otros
procesos.

C. Enfermedades genéticas asociadas a las mutaciones


del gen y en que especies.
Hipertrofia muscular, una afección caracterizada por
aumento de la masa muscular y la fuerza.
Las especies donde se ha reportado son: Humanos, ratones,
bovinos, perros, caballos.
D. Cómo se realiza el diagnóstico molecular de la
enfermedad debida a la mutación más frecuente en
ganado azul belga.
La enfermedad se denomina “doble musculación”
(hipertrofia muscular) y el diagnóstico molecular se realiza
a través de marcadores de microsatelites para mapear el
locus “mh” del cromosoma 2 bovino. En la investigación
realizada por Charlier et al (1995) se demostró el que locus
de la hipertrofia muscular (mh) se localiza en el extremo del
centrómero del cromosoma 2.

Los microsatelites se constituyen cortas regiones de ADN,


de 1 a 6 pb repetidas en tandas dentro de los genomas
eucariotas, cuya repetición puede llegar hasta 60 o más
veces. Se heredan de forma mendeliana y la posibilidad de
tener varios alelos de un locus particular en las poblaciones,
los hacen útiles en el análisis de identificación, estudios
poblacionales, análisis de enfermedades genéticas
particulares asociadas a expansión de repeticiones.
Técnicamente los microsatélites son fáciles de identificar
utilizando la metodología de Reacción en Cadena de la
Polimerasa (PCR), la cual permite Flanquear con iniciadores
específicos los extremos de los mismos y luego pueden ser
detectados con tinción en plata o con Fluorocromos en
secuenciadores automáticos. (Ortega et al, 2011)

E. Cómo afecta la producción las mutaciones en el gen


de la miostatina
Las mutaciones del gen ocasionan inactivación de la
miostatina, lo que genera crecimiento muscular exagerado.
De igual forma la sobreexpresión de este está asociado con
una atrofia muscular y pérdida de masa corporal
Estudiando las mutaciones

En relación a la secuencia del gen, indique el nombre de la


mutación y el tipo de la misma si:
A. Mutación de A(T) por C, en el nucleótido No. 229
(indíquelo dentro de la secuencia), ¿qué pasa con la
proteína?
El nucleótido 229 corresponde a Timina, si este muta por
Citosina, No cambia el aminoácido que codifica ese codón,
el cual es Asparagina, y es codificada por AAT o AAC, de
tal forma que la proteína no sufre ninguna alteración.
ES una mutación molecular o puntual, silenciosa
B. Inserción de CC en la posición 25 del gen
Mutación puntual por inserción de nucleótidos. Sin
embargo como se insertan en una región no codificante del
gen, no altera la proteina
C. Deleción de GG en la posición 264
Mutación puntual por deleción, lo que altera el marco de
lectura y por ende la formación de la proteína
D. Inserción de CCC en la posición 25 del gen
Mutación puntual por inserción de nucleótidos. Sin
embargo como se insertan en una región no codificante del
gen, no altera la proteína
E. Cómo se denomina el cambió de una purina, por una
pirimidina, ¿cómo el cambio de una purina por una
purina?
Transiciones: cambio de una purina por purina o pirimidina
por pirimidina.
Transversiones: Cambio de Purina por pirimidina o
pirimidina por purina.
F. Dentro de la secuencia del gen dado, construya los
siguientes tipos de mutación: Una mutación silente,
una mutación de perdida de sentido y una mutación
sin sentido

Mutación silente: Cambio de A por C en el nucleótido No.


211. La mutación no afecta la transcripción de la proteína.
CCA codifica para prolina y CCC también codifica para ese
aminoacido.

Mutación de perdida de sentido: Cambio de T por C en el


nucleótido No. 513. Cambia la transcripción del aminoácido,
pasa de Metionina a Treonina (aminoácido incorrecto) lo que
puede alterar más o menos la función de la proteína
dependiendo de su localización e importancia.

Mutación sin sentido: Cambio de T por A en el nucleótido


No. 468, el cambio de este nucleótido, determina un
triplete que determina una señal de STOP, dando fin a la
cadena de aminoácidos y truncando la proteína y
afectando su función

BT12005-RA
5´ATGCAAAAACTGCAAATCTCTGTTTATATTTACCTATTTATG
CTGATTGTTGCTGGCCCCGTGGATCTGAATGAGAACAGCGAG
CAGAAGGAAAATGTGGAAAAAGAGGGGCTGTGTAATGCATGT
TTGTGGAGGGAAAACACTACATCCTCAAGACTAGAAGCCATAA
AAATCCAAATCCTCAGTAAACTTCGCCTGGAAACAGCTCCTAA
CATCAGCAAAGATGCTATCAGACAACTTTTGCCCAAGGCTCCT
CCACTCCTGGAACTGATTGATCAGTTCGATGTCCAGAGAGATG
CCAGCAGTGACGGCTCCTAGGAAGACGATGACTACCACGCCA
GGACGGAAACGGTCATTACCACGCCCACGGAGTCTGATCTTC
TAACGCAAGTGGAAGGAAAACCCAAATGTTGTTTCTTTAAATTT
AGCTCTAAGATACAATACAATAAACTAGTAAAGGCCCAACTGT
GGATATATCTGAGGCCTGTCAAGACTCCTGCGACAGTGTTTGT
GCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGG
TATACTGGAATCCGATCTCTGAAACTTGACATGAACCCAGGCA
CTGGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAGAA
CTGGCTCAAACAACCTGAATCCAACTTAGGCATTGAAATCAAA
GCTTTAGATGAGAATG
GCCATGATCTTGCTGTAACCTTCCCAGAACCAGGAGAAGATGG
ACTGACTCCTTTTTTAGAAGTCAAGGTAACAGACACACCAAAA
AGATCTAGGAGAGATTTTGGGCTTGATTGTGATGAACACTCCA
CAGAATCTCGATGCTGTCGTTACCCTCTAACTGTGGATTTTGA
AGCTTTTGGATGGGATTGGATTATTGCACCTAAAAGATATAAG
GCCAATTACTGCTCTGGAGAATGTGAATTTGTATTTTTGCAAAA
GTATCCTCATACCCATCTTGTGCACCAAGCAAACCCCAGAGGT
TCAGCCGGCCCCTGCTGTACTCCTACAAAGATGTCTCCAATTA
ATATGCTATATTTTAATGGCGAAGGACAAATAATATACGGGAA
GATTCCAGCCATGGTAGTAGATCGCTGTGGGTGTTCA 3´

G. ¿Qué es un polimorfismo genético?


Un polimorfismo es una variación en la secuencia de un
lugar determinado del ADN en los cromosomas (locus)
entre los individuos de una población.
H. Llene la siguiente tabla en donde indique cinco tipos de
mutaciones genética en diferentes animales: porcinos,
bovinos, caprinos, ovinos.
Especie Nombre de Tipo de Tipo de Cómo afecta
la mutación Herencia la producción
enfermedad
síndrome de mutación de Hereditaria perdidas
estrés sentido autosómica económicas
porcino erróneo recesiva.
Porcinos

MULEFOOT causada por hereditaria puede afectar


(Pie de mula dos a la producción
o Sindactilia) mutaciones en ya que estos
Bovinos el gen animales no
autosómico resisten a las
LRP4, que condiciones
provocan climáticas y
fusión solo causan
interdigital gastos para la
total o parcial, producción
principalmente
en las
extremidades
anteriores
Enanismo o Es importante Puede Esta
Dwarfism1 resaltar que recibe enfermedad
Los genes genes además causar
específicos mutados de pérdidas
implicados son uno o económicas en
diferentes en ambos la producción
cada raza de padres. más que todo
ganado. Por afecta al hato
ejemplo, ya que hay
enanismo en que hacer un
ganado Angus minucioso
es causada por estudio para
una mutación así poder
en el, quinasa erradicar la
dependiente de mutación.
GMP tipo II
proteína
(Prkg2) gen.
albinismo mutación en el los padres generan
gen de la son pérdidas
tirosina portadores económicas ya
de esta que los
mutación, terneros nacen
recesiva muertos
simple
Hipertrofia mutación en el hereditaria por ser
Muscular gen de la animales tan
miostatina grandes al
nacer
provocan
partos
distócicos,
aumentando
los costos de
producción ya
que hay que
realizarles
cesarías a las
vacas
Caprinos braquignatia una mutación recesivo perdidas
en los primeros simple económicas y
22 animal ya que
cromosomas suelen nacer
no sexuales. muertos.
Ovinos hipospadia en desde el punto recesiva afecta a la
ovinos de vista autónoma producción de
genético se tal manera que
clasifica como los machos no
intersexo pueden ser
fenotípico reproductores,
y son de
descarte
provocando
pérdidas
económicas.
I. Consulte e indique un ejemplo de los siguientes tipos de
herencia:
a. Herencia mendeliana (dominante, recesiva, ligada al sexo)
Herencia dominante: Si cruzamos un gato homocigótico para
el color negro del pelo (NN ) con otro también homocigótico para
el color blanco (nn), todos los gatos que se obtengan de este
cruzamiento serán de color negro (Nn), ya que este domina
sobre el blanco.
Herencia recesiva: Cuando un espermatozoide (que puede por
lo dicho poseer N, o bien n) fecunde a un óvulo (que también
puede poseer N, o bien n) las posibles combinaciones para
formar la pareja de alelos (genotipo) en los individuos de la F2
serán NN, Nn, Nn y nn, según se expresa en el esquema. Así
pues, en la segunda generación filial (F2) se presentará una
proporción genotípica de 1 : 2 : 1, es decir, que de 100
individuos, el 25 por 100 serán de genotipo NN; el 50 por 100,
de genotipo Nn, y el 25 por 100, de genotipo nn. Pero como se
trata de un caso de herencia dominante, el fenotipo de los
individuos NN y Nn será igual, de ahí que la proporción fenotípica
será 3: 1, es decir, el 75 por 100 de los gatos serán negros y el
25 por 100 de blancos. Que es el gen recesivo.
Herencia ligada al sexo: La especie humana tiene 46
cromosomas, es decir, 22 parejas de autosomas más una pareja
de cromosomas sexuales, XX en la mujer y XY en el hombre.
Como en otras muchas especies, el cromosoma X es mayor que
el del Y, pero en ambos existe un largo segmento homólogo, que
les permite aparearse y entrecruzarse durante la meiosis, y un
corto segmento diferencial, no apareable, con genes específicos
para cada uno de los dos cromosomas.
La Hemofilia es una enfermedad hereditaria ligada al cromosoma
X, es decir, está ligada al sexo, lo que significa que en el caso
concreto de la Hemofilia la transmiten las mujeres (portadoras)
y la padecen los hombres, debido a la dotación de dos
cromosomas X (XX) de la mujer y una dotación (XY) en el
hombre. Es causada por una alteración en los genes F8 o F9 que
producen el factor VIII (FVIII) y el factor IX (FIX) de la
coagulación, se trata de una enfermedad producida por la
deficiencia de uno de estos factores en el sistema de
coagulación.
b.Herencia multifactorial
Los rasgos suelen cuantificarse midiéndolos, no contándolos. Los
rasgos pueden estar controlados por dos o más genes, cada uno
de los cuales aporta un elemento aditivo, habiendo algunos que
no aportan nada. Expresión variable de los fenotipos por
interacción con factores ambientales
Pueden presentarse Malformaciones congénitas como el Labio
leporino/hendidura palatina y en los adultos diabetes Mellitus o
epilepsia.
c.Herencia mitocondrial
Las alteraciones del material genético de las mitocondrias son la
causa de algunas enfermedades que se transmiten con un
patrón característico debido a que las mitocondrias solo se
heredan de la madre. Todos los hijos e hijas de una mujer
afectada heredarán las mitocondrias con la mutación y serán
afectados por la enfermedad.
Enfermedad de Leigh: encefalomielopatía necrosante subaguda
d.Impronta genética
Puede definirse como la expresión selectiva de un gen según el
origen parental del alelo (paterno o materno)
Algunas enfermedades genéticas humanas están relacionadas
con la impronta, entre ellas el síndrome de Angelman y el
síndrome de Prader-Willi, ambos ligados a la misma región del
cromosoma 15 (se hereda recíprocamente).
2- Anormalidades cromosómicas
A. Por medio de un dibujo, explique cada uno de los términos
relacionados en la siguiente figura:

Conceptos básicos de genética cuantitativa y de


poblaciones

1-Consulte las referencias correspondientes a esta unidad


y realice un esquema en donde demuestre las principales
diferencias y similitudes entre la genética mendeliana y la
genética cuantitativa; tener en cuenta los siguientes
parámetros:
a) Método de estudio utilizado
b) Unidad experimental
c) Tipo de caracteres
d) Cómo se expresan las características (en
proporciones, en mediciones, etc.)
e) Significado de la variación continua de un carácter
f) Indique la importancia de la genética de poblaciones
para el mejoramiento animal.
Genética Cuantitativa Genética
Mendeliana

Utiliza métodos estadísticos Utiliza cálculos de


para su estudio como la proporciones y
media y la varianza relaciones como
método de
estudios.

Herencia compleja, Herencia simple


poligénica y mediado por el
ambiente.

Diferencias Caracteres cuantitativos Caracteres


como la cantidad de leche cualitativos (alto-
producida por una Bajo, verde-
lactación, sin embargo, no amarillo, ect).
todos los caracteres
muestran un rango
continuo por lo que se
distinguen 3 tipos de
caracteres:
continuos: pueden tomar
un valor cualquiera dentro
de dos límites.
Merísticos: los fenotipos se
expresan en número
Genética Cuantitativa Genética
Mendeliana

enteros (numero de huevos


puestos en el día, número
de hijos por parto).
Umbral: Están presentes o
no lo están.

Caracteres continuos,
significa que no existe una
única clasificación
fenotípica, sino que esta se
realiza agrupando los
distintos valores en clases
establecidas, normalmente
son caracteres que se
miden o se cuentan. En los
caracteres merísticos como
umbral la distribución del
carácter no es continua,
pero su expresión sigue
siendo el resultado de la
acción conjunta de varios
genes modulados por el
medio en que se expresan.

Su unidad experimental
son los genes y como el
conjunto de la expresión de
varios genes condicionados
Similitudes por el medio se manifiestan
en diferente grado.
Genética Cuantitativa Genética
Mendeliana

De gran importancia en el
mejoramiento animal ya
que la mayor parte de los
caracteres de interés en
veterinaria pertenecen a
esta categoría de
caracteres cuantitativos

La genética de poblaciones tiene gran importancia en el


mejoramiento animal ya que esta suministra los principios
teóricos de la evolución y la herencia de los caracteres de
importancia económica en las distintas especies domésticas. El
conocimiento de la estructura genética de una población permite
modificarla a través de la selección o de los sistemas de
apareamientos, con el fin de producir su mejoramiento genético,
de esta forma se encuentran estrategias óptimas para
aprovechar la variación genética que existe en una especie de
animales en particular para maximizar el mérito de dicho animal.
Lo cual involucraría tanto las variaciones genéticas entre los
individuos de una misma raza, así como la variación entre
diferentes razas y cruzas de estas razas. (Montaldo y Barría,
1998)
2- Identifique la expresión matemática que determina
la relación entre el genotipo, el fenotipo y el ambiente,
explíquela.
F=G+A
Los sistemas funcionales del SN resultan de la interacción entre
factores genéticos y ambientales
 Fenotipo
 Rasgos anatómicos, fisiológicos, conductuales, cognitivos
 Producto de la expresión genética
 Genotipo
 Información heredada
 Expresión genética
 Síntesis de proteínas
 Ambiente
 Condiciones externas
 Alimentación, clima, época del año, momento del día,
presencia de congéneres, predadores, variables
socioculturales.
El genotipo y el ambiente interactúan para encontrar el fenotipo
de un organismo.
Ejemplo:
Gen para pelo negro
Pero la actividad de enzima depende de la temperatura, la
proteína es inactivada a temperatura corporal E.G 35°c en las
regiones más frías del cuerpo la enzima es activada.
Tres interacciones de F=G+A
3- Las siguientes características, corresponden a
características de producción importantes en hatos de
diversos animales:
a) Peso de la camada al destete (en cerdos)
Factores ambientales:
 la granja: condiciones de infraestructura adecuadas,
el manejo reproductivo y nutricional que recibe la
cerda, el manejo entre cerdas jóvenes y de 3-5
partos, si es estable se obtienen mayor cantidad de
lechones. De igual forma también influye la habilidad
y capacitación del personal. (Ek-Mex y segura –
correra, 2014)
 Efecto de año de parto: el efecto del año de parto
puede ser atribuido a los cambios en las condiciones
de manejo con el trascurso del tiempo, resultado de
una mayor experiencia del personal en el cuidado de
las cerdas, diferencias en las condiciones climáticas y
en los aspectos de manejo de los animales. (Segura
y Segura, 1991)
 Época de parto: Las variaciones en el número y peso
de lechones nacidos vicos y lechones destetados
generalmente depende de la época del año, varios
estudios han demostrado que las altas temperaturas
ambientales, aunado a la alta humedad y a los
cambios en el fotoperiodo afectan adversamente la
reproducción de las cerdas, decrecen el tamaño y
peso de camada
 Número de partos: El tamaño y peso de camada
usualmente se incrementa del primer parto hasta el
cuarto o quinto parto, comenzando a disminuir a
partir del sexto o séptimo parto, y con las mismas
tendencias el número de lechones desdetados.
(Segura y segura, 1991)

Factores genéticos: Raza de las cerdas: existen


nuevas líneas y cruces maternas sobresalientes por
su prolificidad, algunos genotipos destacados son:
Large white, Chester white, C15 (PIC), Hampshire.
Sin embargo en el estudios realizado por Gómez ,
2009, no encontraron diferencias significativas en
ninguno de los caracteres de camada (tamaño al
nacimiento y al destete y del peso de la camada al
nacimiento y al destete). Los autores concluyeron
que fueron más importante los factores ambientales,
lo cual no indica que no existan diferencias en la
eficiencia reproductiva de la cerda, sino que bajo las
condiciones de las prácticas de manejo, alimentación
y clima no fueron capaces de manifestarse.

b) Peso al nacimiento en ganado de carne


Factores ambientales:
 Sexo: Los machos son más pesados que las
hembras
 Tipo de parto: estudios han descrito que partos
triples o dobles obtienen el 69.07% frente al
peso de partos únicos.
 Época de nacimiento: el efecto estacional
sobre el peso al nacimiento es probable se
deba a la calidad del forraje disponible y a la
suplementación proporcionada durante la
gestación
 Tamaño de la camada: las crías de vacas
jóvenes (de primer y segundo parto) y de
vacas viejas (de más de siete partos) tuvieron
pesos al nacimiento más bajos que las de
número de partos intermedios.
 Peso de la madre al parto. En el estudio
realizado por Aguilera et al, 1987, se encontró
que existe una relación lineal entre el peso al
nacimiento y el peso de la madre
 Factores ambientales año: el pastoreo
estacional y las estrategias frente a las épocas
secas, es causa principal del bajo peso de las
crías.
Factores genéticos: la raza tiene una influencia en
el peso al nacer, en el estudio realizado por Magaña,
2002; determino que existen razas de vacas como la
Gyr que el peso de sus crías es menor frente al de
otras razas como Nelore, indubrasil o cebú.
c) Porcentaje de grasa en leche
Factores ambientales:
 Número de partos y etapa de lactación. EL
porcentaje de grasa alcanza mayores tasas
durante el primer parto, y los valores
disminuyen desde el primero hasta el cuarto
mes de lactación, para luego incrementarse
hasta alcanzar el máximo valor durante el
último mes. (Patiño, 2004). También se ha
informado de la disminución en el porcentaje
de materia grasa de 0.2% al pasar de 5
lactancias. (morales, 1999)
 Condiciones ambientales: en épocas de sequía
se presenta una baja de calidad en la leche.
 Año de parto: influye de forma importante en el
porcentaje de grasa, esto por el efecto
gestacional y la cantidad y calidad del forraje
disponible para la alimentación del ganado.
 Edad al parto: en el estudio de Patiño, 2004 se
encontró un incremento gradual en la
producción láctea, hasta alcanzar una meseta
entre los 69 y 99 meses de edad, a partir del
cual empieza a declinar.
Factores genéticos:
La grasa es el componente lácteo mas variable
dentro de razas, sin embargo se ha descrito que la
raza que produce leche con el mayor tenor de grasa
es la Jersey. (Morales, 1999)

d) Peso al destete en ganado de carne


Factores ambientales:
 Sexo: es altamente significativo, los machos
son más pesados que las hembras al nacer y
se mantienen así al momento del destete.
 Año de Nacimiento: aquí la influencia se
atribuye a las variaciones climáticas entre
años.
 Época de nacimiento: los becerros nacidos en
la época húmeda fueron superiores a los
nacidos durante la época seca, lo cual se
puede deber a las condiciones adversas y a la
baja disponibilidad tanto en calidad como
cantidad forrajera.
 Edad de la madre al parto. En el estudio
realizado por Martínez, 1998. Este fue el factor
que más afecto los pesos al destete, el estudio
indico que las vacas jóvenes (4 años) y las
viejas (10 o más años), destetaron becerros
muy livianos con respecto a la media ajustada.
También existe un incremento continuo hasta
los nueve años de edad en el cual alcanzan los
mayores pesos al destete.
Factores genéticos: En los estudios se reporta que
el grupo racial no resulta significativo en el peso al
destete.

e) Marmóreo, en ganado bovino


Factores ambientales:
 Sexo: es altamente significativo, los machos
son más pesados que las hembras al nacer y
se mantienen así al momento del destete.
 Año de Nacimiento: aquí la influencia se
atribuye a las variaciones climáticas entre
años.
 Época de nacimiento: los becerros nacidos en
la época húmeda fueron superiores a los
nacidos durante la época seca, lo cual se
puede deber a las condiciones adversas y a la
baja disponibilidad tanto en calidad como
cantidad forrajera.
 Edad de la madre al parto. En el estudio
realizado por Martínez, 1998. Este fue el factor
que más afecto los pesos al destete, el estudio
indico que las vacas jóvenes (4 años) y las
viejas (10 o más años), destetaron becerros
muy livianos con respecto a la media ajustada.
También existe un incremento continuo hasta
los nueve años de edad en el cual alcanzan los
mayores pesos al destete.
Factores genéticos: la raza es un factor que afecta
esta característica en la carne, se afirma que los
animales de la raza Brahmán y sus cruzas, presentan
carne menos suave que los animales de las razas
Británicas y continentales (Bautista, 2009)

En relación a las características anteriores indique:


a) Determine que conceptos estadísticos y
matemáticos necesita para el estudio de dichas
características en un hato determinado.
Conceptos estadísticos y matemáticos necesarios:
 media poblacional: es una variable aleatoria X,
que formaliza la idea de valor medio de un
fenómeno aleatorio.
 Promedio: es el resultado que se obtiene al
generar una división con la sumatoria de
diversas cantidades por el digito que las
represente en total.
 Varianza: la esperanza del cuadrado de la
desviación de dicha variable respecto a su
media, es decir, es la media de los residuos al
cuadrado.
 Interacción: cuando el efecto de un factor
depende del nivel del otro factor, se puede
utilizar una gráfica de interacción para
visualizar las posibles interacciones.
 coeficiente de regresión: se denomina a si a
la pendiente de la recta de regresión, indica la
tendencia (directa o inversa )
 error aleatorio: es aquel error inevitable que se
produce por eventos únicos imposibles de
controlar durante el proceso de medición.
Viene determinado por el hecho de tomar solo
una muestra de una población para realizar
inferencias.
 correlaciones genética: Porción de una
correlación fenotipo entre dos características
en una población que se puede atribuir a
efectos genéticos aditivos.
 Análisis de mínimos cuadrados: es una técnica
de análisis numérico enmarcada dentro de la
optimización matemática, en la que, dados un
conjunto de pares ordenados) variables
independientes, variables dependientes) y una
familia de funciones, se intenta encontrar la
función continua, dentro de dicha familia, que
mejor se aproxime a los datos, de acuerdo con
el criterio de mínimo error cuadrático.
 Covariables: es una variable que posiblemente
predice el resultado bajo estudio.
 Variable: es un símbolo que puede ser
reemplazado o que toma un valor numérico en
una ecuación o expresión matemática general.

b) Determine que conceptos genéticos necesita


para el estudio de dichas características.
Conceptos genéticos necesarios para el estudio
de dichas características:
 Fenotipo: conjunto de caracteres visibles que
un individuo presenta como resultado de la
interacción entre su genotipo y el medio.
 Genotipo: conjunto de genes que existen en el
núcleo celular de cada individuo.
 genética cuantitativa: estudio de los
caracteres cuantitativos, se entiende por
caracteres cuantitativo a que es consecuencia
de una base genética compleja, en la que lo
habitual es la acción conjunta de genes,
modulada por el medio en que dichos genes se
expresan.
 genética mendeliana: se basa en los estudios
de las proporciones en las que se heredan las
características de los individuos.
 Carácter hereditario: característica
morfológica, estructural o fisiológica presente
en un ser vivo y transmisible a la
descendencia.
 Locus: lugar ocupado por un gen en un
cromosoma.
 Heredabilidad: es el parámetro genético de
mayor importancia ya que determina la
estrategia a ser usada en el mejoramiento del
carácter. Expresa la confianza que se puede
tener en el fenotipo del animal como una guía
para predecir el valor de cría.
 Germoplasma: conjunto de genes que se
transmite por la reproducción a la
descendencia por medio de gametos o células
reproductoras, se utiliza para designar la
diversidad genética de las especies.
BIBLIOGRAFIA
 Aguilera, L. C., Madrazo, A. V., & Gutiérrez, T. O. (1987).
Algunos factores ambientales que afectan el peso al nacer
y al destete de corderos Pelibuey. Revista Mexicana de
Ciencias Pecuarias, 25(3), 289-295.
 Charlier, C., Coppieters, W., Farnir, F., Grobet, L., Leroy,
P. L., Michaux, C., Mni, M., Schwers, A., Vanmanshoven,
P., Hanset, R., Georges, M. The mh gene causing double-
muscling in cattle maps to bovine chromosome 2.
Mammalian Genome 6: 788-792, 1995. [PubMed:
8597635, related citations]
 Cañon, J. INTRODUCCIÓN A LA GENETICA CUANTITATIVA.
Universidad Complutense Madrid. Consultado en:
http://webs.ucm.es/info/genetvet/Tema_1.pdf
 Cañón, J. (2006). Utilización de información molecular en
programas de mejoramiento animal. Corpoica. Ciencia y
Tecnología Agropecuaria, 7(1).
 Bautista, J. H., & Rincón, F. G. R. (2009). Efecto de los
grupos raciales bovinos en las características de la calidad
de la carne. Nacameh, 3(1), 1-20.
 Díaz, D. R. R., & Aguirre, B. C. (2011). Encefalopatías
espongiformes transmisibles. infectio, 8(4).
 Ek-Mex, J. E., Segura-Correa, J. C., Batista-Garcia, L., &
Alzina-López, A. (2014). FACTORES AMBIENTALES QUE
AFECTAN LOS COMPONENTES DE PRODUCCION Y
PRODUCTIVIDAD DURANTE LA VIDA DE LAS CERDAS.
Tropical and Subtropical Agroecosystems, 17(3).
 Gómez, B., Ortega, R., & Becerril, J. (2009). FACTORES
QUE CONTRIBUYEN EN LA VARIACIÓN DEL PESO DE LA DE
CAMADA AL NACIMIENTO Y EL NUMERO DE LECHONES
DESTETADOS DE LÍNEAS Y CRUCES MATERNOS
PORCINOS. Revista Computadorizada de Producción
Porcina Volumen, 16(4).
 Magaña, J. G., Delgado, R., & Segura, J. C. (2002).
Factores ambientales y genéticos que influyen en el
intervalo entre partos y el peso al nacer del ganado Cebú
en el sureste de México. Revista Cubana de Ciencia
Agrícola, 36(4).
 Martínez, G., Petrocinio, J., & Herrera, P. (1998). Factores
que afectan el peso al destete en un rebaño de bovinos de
carne. Revista de la Facultad de Agronomía, 15(3).
 Montaldo, H., & Barría, N. (1998). Mejoramiento genético
de animales. Ciencia al día, 1(2).
 Morales, M. S. (1999). Factores que afectan la composición
de la leche. TecnoVet, 5(1).
 Ortega T, J., & García P, L. (2011). El Genoma Bovino,
métodos y resultados de su análisis. Revista MVZ Córdoba,
16 (1), 2410-2424.
 BONELLI, A. M., & SCHIFFERLI R, C.. (2001). Síndrome
Estrés Porcino. Archivos de medicina veterinaria, 33(2),
125-135. https://dx.doi.org/10.4067/S0301-
732X2001000200001
 Patiño, E. M. (2004). Factores que afectan las propiedades
físicas y la composición química de la leche de búfalas
(Bubalus bubalis) en Corrientes, Argentina. Revista
Veterinaria, 15(1), 21-25.
 Quintela, F. D., Baroni, L., Techera, M., & Iturburo, M. C.
Q. (2012). Osteopetrosis letal hereditaria (enfermedad de
los huesos de mármol) en terneros Aberdeen Angus en
Uruguay. Veterinaria, 48(185), 21-27.
 Segura, C. J.C. y Segura, C.V. 1991. Influencia de algunos
factores genéticos y ambientales sobre la eficiencia
reproductiva de cerdos en una granja de la Chontalpa,
Tabasco. Veterinaria México. 12: 73-76.
 Vélez, E. C., Pablos, L. T., Milazzo, J., Pizarro, G. P., &
Herrero, V. S. (2011). Intersexualidad en la especie
caprina. REDUCA, 3(3).