Plant Physiology and Biochemistry 120 (2017) 156e168

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Research article

Understanding the role of DNA polymerase l gene in different growth

and developmental stages of Oryza sativa L. indica rice cultivars
Sayantani Sihi a, Soumitra Maiti a, Sankar Bakshi b, Arup Nayak a, Shubho Chaudhuri c,
Dibyendu Narayan Sengupta a, *
a
Division of Plant Biology, Bose Institute, 93/1 A.P.C. Road, Kolkata 700009, India
b
Vidyasagar College for Women, 39 Sankar Ghosh Lane Kolkata 700006, India
c
Division of Plant Biology, Bose Institute, P-1/12, C.I.T. Scheme VIIM, Kankurgachi, Kolkata 700054, West Bengal, India

a r t i c l e i n f o a b s t r a c t

Article history: DNA polymerase l (Pol l) is the only member of DNA polymerase family X present in plants. The enzyme
Received 4 June 2017 is ddNTP sensitive as it contains the conserved C-terminal Pol b domain. The 1.1 kb partial coding
Received in revised form sequence isolated spanned the whole 30 regions of the gene containing functionally important domains
29 September 2017
of the Pol l gene. Comparative in silico studies from both indica and japonica cultivars involving ho-
Accepted 29 September 2017
Available online 4 October 2017
mology modelling showed that the model for the partial Pol l gene was stable and acceptable. The
alignment of both the protein models showed a RMS value of 0.783.
Apart from this, expression of Pol l and its relative activity is studied during different development
Keywords:
Indica rice cultivars
stages of three different indica rice cultivars (IR29, Nonabokra and N22). Enhanced accumulation and
Developmental stages higher activity of Pol l during the early seedling stage was detected. Higher expression and activity were
DNA polymerase l observed in the anthers, which was probably necessary for DNA repair during microspore formation.
Gene expression However, during the maturation stage of seed development and plant growth, expression and the ac-
ddNTP sensitivity tivity of Pol l decreased due to slow metabolic activity and a reduced rate of cell division respectively.
In vitro DNA polymerase assay Furthermore, the expression and activity of Pol l were found to be higher in IR29 in comparison to
Nonabokra and N22. IR29 is a rice cultivar susceptible to environmental stresses and hence it encounters
higher DNA damages. The enhanced presence and activity of the Pol l enzyme in IR29 with respect to the
other two cultivars, which are more tolerant to the environmental stresses during various developmental
stages, is therefore explainable.
© 2017 Elsevier Masson SAS. All rights reserved.

1. Introduction hamper the genome integrity of the plant.

Rice (Oryza sativa L.) is a major agronomic crop, and approxi-
mately one-fifth of the world's population depends on rice culti-
vation for their livelihoods (https://www.irri.org). India is one of
the world's biggest producers of rice, accounting for 20% of total
global rice production. Moreover, India has the largest area under
rice cultivation. It is cultivated throughout the year and thus, as a
crop, rice is exposed to a diverse set of environmental stresses, both
biotic and abiotic, which affect the crop yield. Most of the abiotic
environmental stresses are known to cause DNA damage and
Abbreviations: cds, Coding sequence; ddNTP, Dideoxynucleotidetriphosphate;
PMSF, Phenylmethanesulfonyl fluoride; PVDF, Polyvinylidenedifluoride.
* Corresponding author.
E-mail address: dnsenguptabi@gmail.com (D.N. Sengupta).
In living organisms, DNA polymerases are required for three
critical cellular processes: DNA replication, repair and recombina-
tion (Furukawa et al., 2015). Based on their structures and func-
tions, the DNA polymerases have been grouped into seven families
e A, B, C, D, X, Y and reverse transcriptase. Six members of DNA
polymerase family X e Pol b, Pol l, Pol m, Terminal deoxy-
nucleotidyltransferase (Tdt), Pol s1 and Pol s2 have been identified
from the eukaryotic system (Ramadan et al., 2004). Members of
DNA polymerase family X are conserved in most organisms from
bacteria to humans (Uchiyama et al., 2009; Oliveros et al., 1997). But
despite their conserved nature, Pol l is the only member of DNA
polymerase family X present in the plant systems. Arabidopsis and
Oryza sativa have been used as model plants to study the function
of plant Pol l (García-Díaz et al., 2000; Uchiyama et al., 2004;
Amoroso et al., 2011; Roy et al., 2011). At the amino acid level, Pol
l shows a 30% homology with Pol b. The C-terminal domain of Pol l

https://doi.org/10.1016/j.plaphy.2017.09.027
0981-9428/© 2017 Elsevier Masson SAS. All rights reserved.
 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168
is similar to Pol b, whereas the N-terminal part of Pol l has BRCT
(breast cancer type 1 susceptibility protein C terminus) domain,
known for interactions with other BRCT-domain-containing pro-
teins (Roy et al., 2009). Pol l is a single polypeptide, ddNTP sensi-
tive, aphidicolin insensitive DNA repair protein. It is involved in
base excision repair (García-Díaz et al., 2001), non-homologous end
joining (Lee et al., 2004) and translesion synthesis (TLS) for
repairing oxidative DNA damage (Maga et al., 2007). Although the
biochemical properties of Pol l are widely studied in plants, its
in vivo functions are hardly studied and understood. Earlier studies
demonstrated the role of OsPoll in BER (Sarkar et al., 2004) and
increased transcript abundance in culture cells when exposed to
UV-B irradiation and MMS treatment, suggesting the role of Pol l in
repairing methylated bases (Uchiyama et al., 2004).
Germination of seeds involves a series of events that start with
the uptake of water by quiescent dry seeds and terminates with the
elongation of the embryonic axis (Bewley and Black, 1994). The
metabolic machinery is present in dormant dry seeds in an inactive
form. Upon imbibition, the dry seeds rapidly resume their meta-
bolic activity resulting in a division of embryonic cells and seed
germination (Bewley, 1997). Fragmentation of nuclear DNA occurs
during the maturation, drying and long dehydration period in dry
seeds (Cheah and Osborne, 1978). In plants, for survival, proper cell
division is required which can occur only after the repair of
damaged DNA.
The present work deals with the study of gene expression and
enzyme activity of the Pol l during different growth and develop-
mental stages in three different indica rice cultivars. Comparative
study of Pol l in these three indica rice cultivars - IR29, Nonabokra
and N22 e will be helpful in giving us an insight into the role and
function of Pol l during different vegetative and reproductive
developmental stages. This study will further elucidate the critical
role and involvement of DNA polymerase l in controlling various
cellular and molecular activities as well as the physiological effect.
2. Materials and methods
2.1. Plant materials and growth conditions
Seeds of Oryza sativa cv. IR29 were collected from CRRI, West
Bengal; cv. Nonabokra from CSSRI, West Bengaland N22 from
NIPGR, New Delhi. Seeds were multiplied at the Madhyamgram
Experimental Farm (MEF) of the Bose Institute, West Bengal, India.
Seeds were surface sterilized with 0.1% HgCl2, and after thorough
washing, the seeds were imbibed overnight in sterile water and
then spread over moist gauge cloth in plastic trays. Seeds were
allowed to germinate in autoclaved deionized water at 37  C in
darkness for 3 days. Plants were grown for 8 weeks in greenhouse
conditions (photoperiod: 16/8 h, temperature: 28 ± 3  C) and were
transferred to an experimental field (MEF) to procure large
amounts of the crop. Plant tissues were collected at different stages
of development and from various organs. All samples were
collected from three consecutive years and experiments were
performed with three biological and technical replicas.
2.2. Amplification and cloning of partial coding sequence of Pol l
gene
Total RNA was isolated from 8-day-old seedlings of IR29, Non-
abokra and N22 cultivars by the PhenoleSDS method (Longhurst
et al., 1994). After DNase I (Roche) treatment, cDNA was prepared
using Sensiscript RT Kit (Qiagen, USA) and was used as a template
for PCR amplification using Taq polymerase (Genet Bio). Actin was
used as constitutive gene and was amplified using forward primer
ActinF-50 CCTCATGAAGATCCTGACGG30 and reverse primer ActinR-
157
50 GGAATGTGCTGAGAGATGCC30 . For full length Pol l cDNA ampli-
fication, different oligonucleotides were designed according to the
Oryza sativa japonica sequence (Uchiyama et al., 2004) but without
much success except for one set of partial primer, i.e. forward
primer PolEx3F-50 GCCAAAGTGCCTCTGGAGAT30 and reverse primer
PolEx14R-50 CAGTCTCGAGCTAGAGATTACGTTCGTGAGGTTC30 . PCR
was performed for 25 cycles of 45 s at 94  C, 30 s at 60  C (annealing
temperature) and 90 s at 72  C with final extension step for
20 min at 72  C. The PCR product was purified using QIAgen gel
extraction kit (QIAGEN, USA). The purified PCR product was ligated
with TA vector (Thermo Scientific) and transformed into competent
E. coli (strain DH5a; Clontech, USA) cells. Transformed cells were
screened by colony PCR. The plasmids from the selected positive
colonies were isolated. The recombinant clones were confirmed by
restriction digestion, and sequencing was carried out using M13
forward and M13 reverse primers according to the standard
manufacturer protocol of Applied Biosystem, USA. The obtained
nucleotide sequence and its transformed amino acid sequence were
analysed using different in silico tools to confirm it as part of DNA
polymerase l.
2.3. Multiple sequence alignment and amino acid sequence analysis
of Pol l gene
The sequences of the amplicons were used as query sequences
for BLAST searches in NCBI. The sequences of Pol l reported from
Oryza sativa japonicar and the amplified partial coding sequence
from the indica rice were subjected to multiple sequence align-
ments using Clustal Omega to ascertain the presence of Single
Nucleotide Polymorphisms (SNPs) in the indica Pol l gene. The
partial coding sequence was then converted to an amino acid
sequence using Expasy translate tools (http://www.expasy.org/). It
was used as a query for conserved domain search (Marchler-Bauer
et al., 2015; Marchler-Bauer et al., 2011; Marchler-Bauer et al.,
2009; Marchler-Bauer and Bryant, 2004).
2.4. Homology modelling and structural analysis of Pol l gene
The protein model of the partial indica Pol l was generated
using the SWISS-MODEL (Guex and Peitsch, 1997) package pro-
vided by the Swiss-PDB viewer program based on the crystal
structure of DNA polymerase l (PDB ID:3c5g.2.A) as the template.
The model quality was assessed using PROCHECK (Liang et al.,
1998). The stereochemical stability of the model was checked and
a Ramachandran plot for the model was obtained.
2.5. Genomic DNA isolation and southern blot analysis
Genomic DNA was isolated from the plumules of IR29, Non-
abokra and N22 germinated seedlings by the cetyltrimethyl
ammonium bromide (CTAB) method (Murray and Thompson,
1980). DNA (10 mg) was digested with EcoRI at 37  C and electro-
phoresed on 0.8% agarose gel (Sambrook and Russell, 2001). The gel
was initially treated with HCl). After repeated washing with
deionized water, the gel was soaked in denaturation solution (1.5 M
NaCl, 0.5 M NaOH) followed depurination solution (0.2 N by brief
rinsing with deionized water. The gel was subsequently immersed
in a neutralization buffer (1 M Tris-Cl pH7.4, 1.5 M NaCl) until the
pH of the buffer came below 7.5. The DNA was transferred to a
Nytran membrane (GE, Amersham) by capillary transfer in 10X
SSPE (Sigma Aldrich) solutions for overnight. The membrane was
cross-linked by UV radiation in UV cross linker (Hoefer, UVC 500)
for 2 min under 12,000mJ/sq. cm (Church and Gilbert, 1984). It was
incubated in a prehybridization solution for 6 h at 42  C and then
hybridized with the radiolabelled probe (specific activity
158 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168

1  108cpm/mg of DNA) at 42  C for 24 h. An 850 bp fragment was
amplified from genomic DNA of indica rice. It was labelled with a32-
P-dCTP using Mega Prime labelling kit (GE Amersham, USA) and
was used as the probe. After hybridization, the membrane was
rinsed in 2X SSPE, and 0.5% SDS for 5 min at room temperature and
then washed twice with 1X SSPE with 0.5% SDS for 15 min at room
temperature with constant shaking. Finally, the membrane was
washed with 0.1X SSPE with 0.5% SDS for 10 min at 68  C. The semi-
dried membrane was then covered with a saran wrap and exposed
to KODAK X-Omat X-ray film kept at 80  C for 7days and the
autoradiogram was developed.
2.6. Semi-quantitative reverse transcription-PCR for transcript
expression analysis
Total RNA was isolated from different organs and stages of
development of rice plants by the Phenol-SDS method (Longhurst
et al., 1994) and cDNA was prepared using Sensiscript RT Kit (Qia-
gen, USA). RT PCR was done to amplify the partial cDNA (1096 bp)
of Pol l using the primer pair PolEx3F (50 -GCCAAAGTGCCTCTG-
GAGAT-30 ) and PolEx14R (50 -CAGTCTCGAGCTAGAGATT ACGTTCGT-
GAGGTTC-30 ). PCR was performed for 25 cycles of 45 s at 94  C,
30 s at 60  C (annealing temperature), and 90 s at 72  C with a final
extension step for 10 min at 72  C. RT-PCR with actin (ActinF-
50 CCTCATGAAGATCCTGACGG30 and ActinR-
50 GGAATGTGCTGAGAGATGCC30 ) was also performed as a consti-
tutive gene. Experiments were done in triplicate and for three
consecutive years to prepare the histogram and standard errors
were estimated.
band on the membrane was obtained following the enzymatic
assay of AP for colour development (Sihi et al., 2015). Experiments
were performed in triplicate to prepare the histogram and standard
errors were estimated.
2.9. In vitro DNA polymerase assay
In vitro DNA polymerase assay was done to measure the activity
of the enzyme (Sarkar et al., 2004; Sihi et al., 2015). DNA poly-
merase activity was measured by the incorporation of a-32P-dCMP
(deoxycytidine monophosphate) using activated calf thymus DNA
as both the template and the primer, followed by precipitation in
10% TCA (Tri Chloro Acetic acid) and counting the radioactivity on
glass fibre filter. The incorporation was measured by Liquid scin-
tillation counter (Perkin-Elmer Tri-carb-2800 TR) after drying un-
der a heat lamp. Incorporation of a-32P-dCTP (>800 Ci/mol) in 10%
TCA insoluble fraction per mg of protein samples was calculated
from triplicates in each case to prepare the histogram, and standard
errors were estimated.
2.10. In-gel activity assay of rice polymerase l
Determination of the activity of DNA polymerase protein was
carried out using in-gel activity analysis. Partially purified enzyme
(2 mg) was used (Sarkar et al., 2004; Blank et al., 1983; Karawya
et al., 1983) in the absence or presence of inhibitor (200-folds
molar excess of ddCTP over dCTP) and rat Pol b antibody. The ac-
tivity and specificity of the Klenow enzyme was also examined in
the presence of this antibody.

2.7. Isolation of soluble protein and partial purification of 3. Results and discussions
polymerase l
3.1. Identification and cloning of partial cds of Oryza sativa indica
Partial purification of Pol l was done at 4  C (SanathKumar et al., Pol l
1996; Sarkar et al., 2004; Sihi et al., 2015). Briefly, tissue was
homogenised using liquid nitrogen in a chilled mortar and pestle In the present study, a target amplicon of partial coding
with 3 vol of ice cold protein buffer A (50 mM TriseHCl, pH 7.5, sequence (cds) of Pol l gene from the indica rice cultivars was
10 mM MgCl2, 250 mM sucrose, 1 mM 2-mercaptoethanol, 0.1 mM obtained. The size of the amplicon was ~1.1 kb (Fig. 1). The obtained
EDTA, and 1 mM PMSF). Homogenate was centrifuged at 10,000 g sequence was analysed using BLASTN for homology searching and
for 10 min at 4  C and supernatant was precipitated with ammo- verification for Pol l. The results of homology searching of the
nium sulphate to attain 70% saturation. Pellet was resuspended
with 1 ml of protein isolation buffer A and dialyzed against 100
volume of dialysis buffer B (50 mM TriseHCl, pH 7.5, 1 mM 2-
mercaptoethanol, 0.1 mM EDTA, 20% glycerol and 1 mM PMSF).
For partial purification through DEAE-Sephacel column chroma-
tography, 7.5 mg of protein was allowed to bind with 4 ml of
equilibrated DEAE-Sephacel and poured into the column
(2.1  5 cm). Unbound protein was washed with buffer B and the
bound proteins were step eluted with 0.3 M KCl. Buffer soluble
proteins were isolated from three separate sets of biological sam-
ples using the standard protocols.

2.8. Western blot analysis

10 mg of partially purified plant proteins were resolved on 10%

SDS-PAGE. Separated proteins were transferred onto a 0.2-m pol-
yvinylidenedifluoride (PVDF) membrane for Western blot analysis.
The blots were charged by affinity purified polyclonal anti-sera
(purified IgG fraction) developed against rat DNA Pol b as Pol
lwhich shows 30% homology with Pol b at amino acid level and the
C-terminal domain of Pol l is similar to Pol b (Sihi et al., 2015). The
blots were also charged with the polyclonal antihistone H3 anti-
body (1:5000 dilution in TBST- 50 mM Tris-Cl pH 7.5, 200 mM NaCl, Fig. 1. Amplification of partial Pol l cDNA. The partial cDNA of 1097 bp was amplified
0.05% Tween 20), followed by alkaline phosphatase (AP) conjugated from three different indica rice cultivars- IR29, Nonabokra and N22 and run on 1%
goat anti-IgG secondary antibody. The primary antibody recognized agarose gel.
 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168 159

Table 1
Homology search using indica rice partial DNA Polymerase l (detected by BLASTN).

Sl. no. Description Accession no. E value Identity

1 Oryza sativa Japonica Group OsPolL mRNA for DNA polymerase lambda, complete cds AB099525.1 0.0 99%
2 PREDICTED: Oryza sativa Japonica Group DNA polymerase beta (LOC4340604), transcript variant X2, mRNA XM_015788333.1 0.0 99%
3 PREDICTED: Oryza sativa Japonica Group DNA polymerase beta (LOC4340604), transcript variant X1, mRNA XM_015788332.1 0.0 98%
4 PREDICTED: Oryza brachyantha DNA polymerase beta (LOC102704895), transcript variant X1, mRNA XM_015838397.1 0.0 94%
5 PREDICTED: Oryza brachyantha DNA polymerase beta (LOC102704895), transcript variant X2, mRNA XM_015838398.1 0.0 95%
6 PREDICTED: Brachypodium distachyon DNA polymerase beta (LOC100827137), mRNA XM_003563980.3 0.0 86%
7 PREDICTED: Setaria italic DNA polymerase beta (LOC101782419), transcript variant X2, mRNA XM_004965035.3 0.0 84%
8 PREDICTED: Setaria italic DNA polymerase beta (LOC101782419), transcript variant X1, mRNA XM_012845065.2 3e-143 86%
9 PREDICTED: Setaria italic DNA polymerase beta (LOC101782419), transcript variant X3, misc RNA XR_001163772.1 2e-129 85%
10 PREDICTED: Prunus mume DNA polymerase beta (LOC103343270), transcript variant X2, mRNA XM_008246939.2 3e-108 77%
11 PREDICTED: Prunus mume DNA polymerase beta (LOC103343270), transcript variant X1, mRNA XM_008246937.2 3e-108 77%
12 PREDICTED: Malus x domestica DNA polymerase beta-like (LOC103425492), transcript variant X2, mRNA XM_008363575.2 2e-100 76%
13 PREDICTED: Malus x domestica DNA polymerase beta-like (LOC103425492), transcript variant X1, mRNA XM_008363574.2 2e-100 76%
14 Oryza sativa Japonica Group DNA, chromosome 6, cultivar, Nipponbare, complete sequence AP014962.1 3e-88 99%
15 Oryza sativa Japonica Group genomic DNA, chromosome 6, BAC clone:OSJNBa0068B06 AP004995.3 3e-88 99%
16 Oryza sativa Indica Group cultivar RP Bio-226, chromosome 6 sequence CP012614.1 2e-86 99%

received sequence showed significant homology with the reported
sequence of Pol l gene (Genebank accession-AB099525.1) of Oryza
sativa japonica cultivar (Table 1). The sequences were also used for
conserved domain search (Marchler-Bauer A et al., 2015; Marchler-
Bauer A et al., 2011; Marchler-Bauer A et al., 2009; Marchler-Bauer
A, Bryant SH, 2004). The results showed that the partial cds con-
tained all the essential domains of Pol l including the active site and
the region similar to the complete Pol b protein.
In the present study we have successfully isolated, cloned and
analysed the partial ~1.1 kb coding sequence of the Pol l gene from

Fig. 2. Result of multiple sequence alignment of amino acid sequence of indica rice partial Pol l with Pol l from japonica cultivar.
160 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168
the indica rice cultivars. Polymerase l, being the only X-family DNA
polymerase present in plants, is one of the essential genes which
play a significant role in maintaining the genome stability, fidelity
and integrity by repairing damage to the genome caused by various
chemicals or environmental stresses as well as during the cell di-
vision process. There are reports of enhanced Pol l activity during
early seedling stage in Oryza sativa (Sihi et al., 2015) and in Arabi-
dopsis thaliana (Amoroso et al., 2011). Enhanced Pol l activity was
observed after imbibition and during seed germination in maize
(Bakshi et al., 2015). Enhanced activity was also seen in the spike-
lets of maize and rice (Bakshi et al., 2016).
3.2. Multiple sequence alignment and amino acid sequence analysis
of Pol l gene
The amino acid sequence of the obtained partial Pol l gene
showed that most of the amino acid residues are conserved in the
Fig. 3. (a) Homology model of indica rice partial Pol l protein.
(b) Ramachandran plot analysis of the homology model of indica rice partial Pol l protein.
protein sequence except for some critical amino acid changes. In
the Nucleotidyltransferase (NT) domain of DNA Polymerases of
family X, an arginine 463 as in japonica, is substituted by alanine in
indica as well as five other substitutions: Isoleucine 441 is
substituted by Threonine, Leucine 462 is substituted by Cysteine,
Isoleucine 466 is substituted by Valine and Aspartic acid 467 is
substituted by Serine (Fig. 2). The overall amino acid sequence as
well as the active sites and domains are found to be conserved in
the partial indica Pol l protein.
The multiple sequence alignment of the isolated coding
sequence with that of the reported full-length Pol l gene from
japonica rice showed the presence of several SNPs in the region
spanning the isolated cds in indica rice. The sequences on further
analysis at the amino acid level showed that very few of the SNP
lead to amino acid changes of which some of the amino acid sub-
stitutions were significant. One such amino acid substitution at the
Nucleotidyltransferase (NT) domain in indica rice where an
 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168
arginine 463 is substituted by alanine.
3.3. Homology modelling and structural analysis of Pol l gene
Homology modelling of partial indica Pol l protein was carried
out using the crystal structure of DNA polymerase l (PDB ID:
3c5g.2.A) as the template (Fig. 3a). The Ramachandran plot analysis
of the generated protein model showed that 96.9% of the amino
acid residues lay in the most favourable region, while 2.3% of res-
idues lay in the allowed region and the remaining 0.8% residues fall
in the outlier region. The result of PROCHECK analysis showed that
no residue has phi/psi angles in the disallowed region, suggesting
the acceptability of the Ramachandran plot for partial indica Pol l
protein (Fig. 3b). The homology model of partial indica Pol l and the
same region of japonica partial Pol l was aligned and it showed the
Root Mean Square (RMS) value of 0.783 (Fig. 4).
The substitution of a positively charged amino acid residue
arginine 463 with a hydrophobic amino acid residue alanine at one
of the important catalytic domains could have significant impact on
the overall 3D structure of the protein, as well as significantly
compromise the catalytic activity of the protein. While in the case
of all the other of the five substitutions observed in the protein
sequence, this will have minimum or negligible impact on the 3-D
structure of the protein as all the substituted amino acids belong to
the same group, i.e. a hydrophobic amino acid is substituted to
another hydrophobic amino acid or a polar amino acid is
substituted to another polar amino acid. In order to support these
hypotheses further bioinformatics analysis like homology model-
ling and aligning of the 3D structure of both the proteins was done.
These alignments of a 3D model of the indica rice DNA Pol l protein
with that of the japonica Pol l showed RMS value of 0.783, which
indicates that the amino acid residue substitutions in the Pol l
protein from indica rice cultivar, affects the 3D structure of the
protein and causes the observed difference with that of the
japonica Pol l protein. This finding also suggests that significant
dissimilarity in structure and function may exist between the Pol l
Fig. 4. Alignment of indica rice partial Pol l protein (blue) with japonica rice pol l
protein (red). (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.)
161
protein from indica and japonica rice cultivars. This comparative
study between Pol l gene from indica and japonica rice cultivars is,
to the best of our knowledge, a first report of its kind.
3.4. Southern blot hybridization analysis of Pol l
The copy number of Pol l gene in the three indica rice cultivars
(IR29, Nonabokra and N22) was investigated by southern blotting
(Fig. S1). The results (Fig. 5) showed the presence of single band on
the blot, which confirmed that Pol l is present in single copy in the
genome of the three cultivars.
3.5. Expression analysis of Pol l in the life cycles of three different
rice cultivars
The expression of Pol l gene was found to be identical in the
three indica rice cultivars throughout the life cycle. The normalised
gene expression of Pol l (using actin) was minimal in the dry seed
(DS) stage, whereas the fold change in the transcript level increased
6e8-fold during the imbibition (Imb) and subsequent stages until
there is a 48hr-old seedling (Fig. 6a). During the later develop-
mental stages, the gene expression of Pol l decreases until the onset
of microspore development. In the early vegetative stage, like in 12-
day old seedlings, the transcript level drops by 1.5-folds as
compared to the 48-hr-old seedlings (Fig. 6b), while during the
later developmental stages, for example after 30-days, 60-days and
90-days, the transcript level decreased 3e4-fold as compared to the
initial imbibition stage (Fig. 6c). A steep increase of about 3-fold in
the Pol l transcript was observed during microspore development
in the anther tissues as compared to overnight imbibed seeds. A
Fig. 5. Southern blot hybridization of rice genomic DNA. Probed with 30 end 850 bp
genomic DNA (by using Pol Ex 11F & Pol Ex 14R) O. sativa DNA polymerase l probe.
162 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168

Fig. 6. The mRNA expression analysis of Pol l during (a) Early seed germination (b) Early vegetative stages (c) Late vegetative stages (d) microspore formation and seed devel-
opment. The expression of Pol l was compared after normalizing them with Actin. Samples were collected from three consecutive years. Experiments were performed in triplicates
and standard errors were estimated.

decrease in the gene expression level was seen during subsequent
stages of seed development, i.e. the milky stage and the formation
of young seed and mature seed (Fig. 6d). Although the pattern of Pol
l expression is similar in the three cultivars, the level of the tran-
script varied between the cultivars during similar developmental
stages. The level of gene expression was always high, about 1e2-
folds in IR29 cultivar as compared to other two cultivars Non-
abokra and N22.
found during microspore development and diminished during the
later seed developmental stages (Fig. 7b). The young seeds showed
moderate enzyme activity whereas no Pol l activity was detected
during the formation of mature seeds (Fig. 7c). IR29 showed
maximum activity whereas minimum Pol l activity was found in
N22 in all developmental stages. In the three successive years, IR29
showed better incorporation/Pol l activity in comparison to Non-
abokra and N22 rice seeds.

3.6. Activity assay of ddNTP sensitive Poll during different
developmental stages in rice cultivars
The results of in vitro Pol l activity assay showed similar trends
in the three indica rice cultivars. The activity was the lowest in the
dry seeds, whereas an increase of 6-fold was observed in the
imbibed seeds. The Pol l activity was found to be highest in protein
isolated from 48 h germinated seedlings in all the three cultivars. A
gradual decline in the enzyme activity was observed after 4days of
germination, and it became almost negligible at maturity in the 90-
day-old plants (Fig. 7a). Elevated ddNTP sensitive Pol l activity was
3.7. In-gel activity assay to examine the presence of Pol l
To study the active polypeptide ddNTP-sensitive DNA poly-
merase l, in-gel activity assay was done with the partially purified
proteins. An equal amount (2 mg) of partially purified protein was
loaded in each lane. 1U of Klenow enzyme was loaded as a positive
control. Autoradiogram shows an undetectable level of active DNA
polymerase l in the dry seeds. After imbibition, enhancement (4-
fold) of the enzyme was found with an intense band. However,
higher incorporation of a-32P dCTP was observed after 48 h imbi-
bitions (Fig. 8). Two important observations were made from the
 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168
Fig. 6. (continued).
analysis of the activity gel. Initially, it confirms the size of the active
polypeptide as 67 kDa since the enzyme migrated slower than the
Klenow enzyme, whose molecular weight is 66 kDa. Secondly, it
contains rice Pol l as a single subunit, ddNTP-sensitive enzyme. The
other half of the same gel when subjected to the antibody against
rat DNA Pol b was able to inhibit the DNA polymerase activity of the
partially purified rice enzyme isolated from different stages, but
was specific as the activity of the ddNTP sensitive Klenow enzyme
was unaffected by the antibody (Data not shown). Therefore, the in-
gel activity assay for Pol l showed similar results as with in vitro
activity assay results.
3.8. Immuno-detection of rice ddNTP-sensitive Pol l during
different stages of rice plant development
The western blot analysis was conducted to ascertain the pres-
ence of Pol l and to substantiate the activity assay results. Fig. 9a-e
163
shows the immuno-blot and the normalized value against histone
by densitometric scanning of the bands. An equal amount of pro-
teins from different samples were loaded as shown in Coomassie
brilliant blue R250 stained 10% SDS PAGE (Fig. S2). Western blot
analysis revealed that though the band is barely visible in the dry
seeds, an enhanced presence of the enzyme was found after
imbibition. The presence of Pol l protein was determined after
overnight imbibition and it was at the maximum level at 48 h after
imbibition when the shoots were just sprouting. Enhancement of
the Pol l protein at 48 h after imbibition was found to be 12-folds as
compared to dry seeds. A lesser amount of the protein was detected
in the later vegetative stages that gradually diminished with the
maturity of the plant. It also showed that in indica rice the Pol l
protein is nearly 67 kDa.
Pol l gene expression and activity were studied throughout the
life cycle of the three indica rice cultivars (IR29, Nonabokra and
N22). Low or negligible gene expression vis-a-vis activity in the dry
164 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168

Fig. 6. (continued).

seed in all the three cultivars, with high expression after imbibition,
can be attributed to the fact that dry seeds resume metabolic ac-
tivity after overnight imbibition. Enzymes already present in dry
seeds metabolize during imbibition and lead to the growth of the
embryo structures (Bewley and Black, 1994). Pol l transcript was
found in abundance until 48 h of germination in all three cultivars,
implying the probable role of Pol l in protecting against DNA
damage during early stages of germination. In the imbibed seeds,
repairing of the embryo genome damage takes place before the cell
enters the S-phase and activates the cell cycle, leading to the
massive amount of de novo DNA synthesis (Elder and Osborne,
1993). In contrast, basal activity and expression of Pol l were
observed during the vegetative stages of development, which can
be explained by the fact that during the vegetative stages there is
very little active DNA replication that would require higher Pol l
activity. Hence, the observed basal expression of the gene is in
compliance with the finding of Amoroso et al. (2011) where a
higher expression of Pol l was found in young seedlings than in
leaves of older plants in the case of Arabidopsis thaliana. Expression
analysis of OsPoll transcript suggests its role in DNA replication
and/or repair in both meristematic and meiotic tissues (Uchiyama
et al., 2004). During flowering, several stages, like the initiation of
inflorescence, flower structure development, panicle extrusion, and
anthesis, take place (Yoshida and Nagato, 2011). The development
of microspore is a crucial stage in the life cycle of plants. DNA po-
lymerase l expression was found to be very high in meiotic tissues
 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168
Fig. 6. (continued).
of anther in the three rice cultivars. High expression of Pol l in the
anthers is probably required for microspore formation and main-
tenance of genomic stability, as the role played by DNA polymerase
b in mammals (Kidane et al., 2010). During seed maturation, the
gene expression level and activity of Pol l decreases gradually and
is negligible in mature seeds. It has been reported by van Zanten
et al. (2011) that during seed maturation a decrease in nuclear
size and chromatin condensation occurs, which helps in main-
taining genome stability, thus justifying the low level of DNA
repairing enzyme, Pol l, in this stage. In mature seeds, metabolism
is reduced to low levels, and the embryo becomes quiescent but
remains responsive to environmental signals resulting in later
modifications at transcriptional and post-transcriptional stages
(Finch-Savage et al., 2007; Holdsworth et al., 2008). As the chances
of damage decrease during this stage, the capacity for repair also
reduces and thus the level of Pol l. Use of ddNTP during DNA po-
lymerase enzyme assay, western blot analysis using polyclonal
antibody (even at 1:20000 dilution) and in-gel activity assay in the
165
absence or presence of the inhibitor ddNTP establish the fact that it
was Pol l. Moreover, the siRNA or miRNA sequence was searched
and no homologous candidate to Pol l from O. sativa was detected.
Thus, expression studied at post translational level with proper
control can be considered as perfect estimation. The cDNA from
japonica rice has been cloned and published (Uchiyama et al., 2004)
but several attempts to amplify full-length cDNA from indica rice
have failed, probably due to post-transcriptional transcript pro-
cessing or maturation.
4. Conclusion
In the cell, DNA damage can occur due to several reasons, like
ROS, metabolic by-products and during DNA replication. The
damage to the DNA, if unrepaired, could lead to DNA lesions, mu-
tations, stalling of DNA replication and transcriptional complexes,
etc., thereby inhibiting the growth and development of plants. To
maintain the integrity of the genome and to prevent the issues as
166 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168

Fig. 7. Activity of ddNTP sensitive DNA Polymerase in IR29, Nonabokra and N22 during (a) Seed germination (b) Microspore formation (c) Seed development. Incorporation of
a-32P-dCTP in 10% TCA insoluble fraction per mg of protein samples were calculated from triplicates to prepare the histogram. Standard errors were estimated and shown above each
histogram.

mentioned above, the DNA repair enzymes play a critical role in
repairing the damaged DNA and preventing the occurrence and
passage of mutations to the next generation (Waterworth et al.,
2015). The study shown here is one of the first reports where the
total expression level and activity of Polymerase l is measured
throughout the life cycle in rice. It will further help us to under-
stand the nature and mechanism by which the X-family Polymer-
ase l works during different developmental stages in rice, one of
the most important cereal crops. This study will also provide a
prospect of utilizing the gained information for the betterment of
yield and quality of the indica rice cultivars in the long run. The
present study also clearly demonstrates the difference in the
protein structure of Pol l from indica rice as compared to Pol l from
japonica rice, which may affect the function and activity of Pol l
protein in indica rice. The expression analysis of the Pol l gene, as
well as the activity assay results during different developmental
growth stages in indica rice, establishes the fact that the Pol l gene
and protein are exclusively up-regulated during the stages, having a
higher amount of DNA replication and damage thereby establishing
its role in DNA repair mechanisms in rice. IR29, an abiotic stress
susceptible cultivar, encounters higher DNA damages that require
enhanced presence and activity of the enzyme in comparison to the
other two abiotic stress tolerant cultivars.
Fig. 8. In-gel activity of ddNTP sensitive DNA Polymerase from different stages of rice plant development of IR29, Nonabokra and N22 during (a) Early seed germination (b) Early
vegetative stages (c) Late vegetative stages (d) Microspore formation (e) Seed development and the densitometric scans of the bands in the activity.

Fig. 9. Immuno-detection of ddNTP sensitive DNA Polymerase during rice plant development of Oryza sativa L. (a) Early seed germination (b) Early vegetative stages (c) Late
vegetative stages (d) Microspore formation (e) Seed development using Anti rabbit rat DNA Pol b primary antibody (purified IgG) and densitometric scans showing the normalized
value against histone. Experiments were performed in triplicates to estimate the standard errors.
168 S. Sihi et al. / Plant Physiology and Biochemistry 120 (2017) 156e168
Acknowledgements
We gratefully acknowledge financial support received from DST-
SERB project (SR/SO/PS e 66/2013) and the Director, Bose Institute
(Financed by DST, Government of India, New Delhi). The polyclonal
antibody was a generous gift from Dr. S.H. Wilson and Dr. R. Prasad,
NIEHS, USA. Thanks to Mrs. Kaberi Ghosh, Mr.Jadab Ghosh (Divi-
sional instrument facility, Main Campus) and Mr. Mrinal Das
(Central Instrument Facility, Centenary Building) for technical help.
SS and SB acknowledge DST-INSPIRE and UGC Teacher fellowship.
SM acknowledges DST SERB for fellowship from project SR/SO/PS e
66/2013.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.plaphy.2017.09.027.
Authors’ contribution
SS, DNS and SC designed the experiments. SS conducted the
experiments with the help from SM, SB, AN. SS, SM, SB and DNS
wrote the manuscript. All authors read and approved the final
manuscript.
References
Amoroso, A., Concia, L., Maggio, C., Raynaud, C., Bergounioux, C., Crespan, E., 2011.
Oxidative DNA damage bypass in Arabidopsis thaliana requires DNA polymerase
k and proliferating cell nuclear antigen 2. Plant Cell 23 (2), 806e822.
Bakshi, S., Sihi, S., Sengupta, D.N., 2015. Activity of DNA polymerase l in dry and
germinating seeds of Zea mays L. Indian J. Plant Physiol. 20 (4), 396e399.
Bakshi, S., Sihi, S., Sengupta, D.N., 2016. Activity of DNA polymerase l in spikelets of
rice and maize. Biol. Plant. 60 (4), 788e792.
Bewley, J.D., Black, M., 1994. Seeds: Physiology of Development and Germination,
second ed. Plenum Press, New York. 448pp.
Bewley, J.D., 1997. Seed germination and dormancy. Plant Cell 9 (7), 1055e1066.
Blank, A., Siber, J.R., Thelen, M.P., Dekker, C.A., 1983. Detection of enzymatic activ-
ities in sodium dodecyl sulfate-polyacrylamide gels: DNA polymerases as model
enzymes. Anal. Biochem. 135 (2), 423e430.
Cheah, K.E., Osborne, D.J., 1978. DNA lesions occur with loss of viability in embryos
of ageing rye seed. Nature 272, 593e599.
Church, G.M., Gilbert, W., 1984. Genomic sequencing. Proc. Natl. Acad. Sci. U. S. A. 81,
1991e1995.
Elder, R., Osborne, D., 1993. Function of DNA synthesis and DNA repair in the sur-
vival of embryos during early germination and in dormancy. Seed Sci. Res. 3,
43e53.
Finch-Savage, W.E., Cadman, C.S., Toorop, P.E., Lynn, J.R., Hilhorst, H.W., 2007. Seed
dormancy release in Arabidopsis Cvi by dry after-ripening, low temperature,
nitrate and light shows common quantitative patterns of gene expression
directed by environmentally specific sensing. Plant J. 51, 60e78.
Furukawa, T., Angelis, K.J., Britt, A.B., 2015. Arabidopsis DNA polymerase lambda
mutant is mildly sensitive to DNA double strand breaks but defective in inte-
gration of a transgene. Front. Plant Sci. 6, 357.
García-Díaz, M., Bebenek, K., Kunkel, T.A., Blanco, L., 2001. Identification of an
intrinsic 5'-deoxyribose-5-phosphate lyase activity in human DNA polymerase
lambda: a possible role in base excision repair. J. Biol. Chem. 276, 34659e34663.
García-Díaz, M., Domínguez, O., Lo pez-Fernandez, L., Teresa de Lera, L., Saníger, M.L.,
Ruiz, J.F., Parraga, M., García-Ortiz, M.L., Kirchhoff, T.J., Mazo, J., Bernad, A.,
Blanco, L., 2000. DNA polymerase lambda (Pol l), a novel eukaryotic DNA po-
lymerase with a potential role in meiosis. J. Mol. Biol. 301 (4), 851e867.
Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss- PdbViewer: an envi-
ronment for comparative protein modelling. Electrophoresis 18, 2714e2723.
Holdsworth, M.J., Finch-Savage, W.E., Grappin, P., Job, D., 2008. Post genomics
dissection of seed dormancy and germination. Trends Plant Sci. 13, 7e13.
Karawya, E., Swack, J.A., Willson, S.H., 1983. Improved conditions for activity gel
analysis of DNA polymerase catalytic polypeptides. Anal. Biochem. 135,
318e325.
Kidane, D., Jonason, A.S., Gorton, T.S., Mihaylov, I., Pan, J., Keeney, S., de Rooij, D.G.,
Ashley, T., Keh, A., Liu, Y., Banerjee, U., Zelterman, D., Sweasy, J.B., 2010. DNA
polymerase ß is critical for mouse meiotic synapsis. EMBO J. 29, 410e423.
Liang, J., Edelsbrunner, H., Woodward, C., 1998. Anatomy of protein pockets and
cavities: measurement of binding site geometry and implications for ligand
design. Protein Sci. 7, 1884e1897.
Lee, J.W., Blanco, L., Zhou, T., Garcia-Diaz, M., Bebenek, K., Kunkel, T.A., Wang, Z.,
Povirk, L.F., 2004. Implication of DNA polymerase lambda in alignment-based
gap filling for nonhomologous DNA end joining in human nuclear extracts.
J. Biol. Chem. 279, 805e811.
Longhurst, T., Lee, L., Hinde, R., Brady, C., Speirs, J., 1994. Structure of the tomato
Adh2 gene and Adh 2 pseudogenes, and a study of Adh 2 gene expression in
fruit. Plant Mol. Biol. 26, 1073e1084.
Maga, G., Villani, G., Crespan, E., Wimmer, U., Ferrari, E., Bertocci, B., Hübscher, U.,
2007. 8-oxo-guanine bypass by human DNA polymerases in the presence of
auxiliary proteins. Nature 447, 606e6088.
Marchler-Bauer, A., Bryant, S.H., 2004. CD-Search: protein domain annotations on
the fly. Nucleic Acids Res. 32, 327e331.
Marchler-Bauer, A., et al., 2009. CDD: specific functional annotation with the
Conserved Domain Database. Nucleic Acids Res. 37, 205e210.
Marchler-Bauer, A., et al., 2011. CDD: a Conserved Domain Database for the func-
tional annotation of proteins. Nucleic Acids Res. 39, 225e229.
Marchler-Bauer, A., et al., 2015. CDD: NCBI's conserved domain database. Nucleic
Acids Res. 43, 222e226.
Murray, M.G., Thompson, W.F., 1980. Rapid isolation of higher molecular weight
plant DNA. Nucleic Acids Res. 8, 4321e4325.
Oliveros, M., Yanez, R.J., Salas, M.L., Salas, J., Vinuela, E., Blanco, L., 1997. Charac-
terization of an African swine fever virus 20kDa DNA polymerase involved in
DNA repair. J. Biol. Chem. 272, 30899e30910.
Ramadan, K., Shevelev, I., Hübscher, U., 2004. The DNA-polymerase-X family:
controllers of DNA quality? Nature 5, 1038e1043.
Roy, S., Choudhury, S.R., Singh, S.K., Das, K.P., 2011. AtPoll, a homolog of mammalian
DNA polymerase-l in Arabidopsis thaliana, is involved in the repair of UV-B
induced DNA damage through the dark repair pathway. Plant Cell Physiol. 52
(2), 448e467.
Roy, S., Singh, S.R., Choudhury, S.R., Sengupta, D.N., 2009. An insight into the bio-
logical functions of family X- DNA polymerase in DNA replication and repair of
plant genome. Plant Signal Behav. 4 (7), 678e681.
Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual, fourth
ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Sanathkumar, M., Ghosh, B., Sengupta, D.N., 1996. Isolation of mammalian pol b
type DNA polymerase in shoot tips of germinated seedlings of IR-8 rice (Oryza
sativa L.). Biochem. Mol. Biol. Int. 39, 117e136.
Sarkar, S.N., Bakshi, S., Mokkapati, S.K., Roy, S., Sengupta, D.N., 2004. Dideox-
ynucleoside triphosphate-sensitive DNA polymerase from rice is involved in
base excision repair and immunologically similar to mammalian DNA pol b.
Biochem. Biophys. Res. Commun. 320 (1), 145e155.
Sihi, S., Bakshi, S., Sengupta, D.N., 2015. Detection of DNA polymerase l activity
during seed germination and enhancement after salinity stress and dehydration
in the plumules of indica rice (Oryza sativa L.). Indian J Biochem. Bio 52 (1),
86e94.
Uchiyama, Y., Takeuchi, R., Kodera, H., Sakaguchi, K., 2009. Distribution and roles of
X-family DNA polymerases in eukaryotes. Biochimie 91, 165e170.
Uchiyama, Y., Kimura, S., Yamamoto, T., Ishibashi, T., Sakaguchi, K., 2004. Plant DNA
polymerase l, a DNA repair enzyme that functions in plant meristematic and
meiotic tissues. Eur. J. Biochem. 271, 2799e2807.
van Zanten, M., Koini, M.A., Geyer, R., Liu, Y., Brambilla, V., Bartels, D., Koornneef, M.,
Fransz, P., Soppe, W.J., 2011. Seed maturation in Arabidopsis thaliana is charac-
terized by nuclear size reduction and increased chromatin condensation. Proc.
Natl. Acad. Sci. U. S. A. 108, 20219e20224.
Waterworth, W.M., Bray, C.M., West, C.E., 2015. The importance of safeguarding
genome integrity in germination and seed longevity. J. Exp. Bot. 66 (12),
3549e3558.
Yoshida, H., Nagato, Y., 2011. Flower development in rice. J. Exp. Bot. 62, 4719e4730.