Vous êtes sur la page 1sur 36

Accepted Manuscript

Effects of stocking density on survival, growth, and food intake of


Haliotis discus hannai Ino in recirculating aquaculture systems

Gao Xiaolong, Zhang Mo, Li Xian, Wu Fucun, Song Changbin,


Liu Ying

PII: S0044-8486(17)30386-1
DOI: doi: 10.1016/j.aquaculture.2017.07.005
Reference: AQUA 632726
To appear in: aquaculture
Received date: 1 March 2017
Revised date: 4 July 2017
Accepted date: 5 July 2017

Please cite this article as: Gao Xiaolong, Zhang Mo, Li Xian, Wu Fucun, Song Changbin,
Liu Ying , Effects of stocking density on survival, growth, and food intake of Haliotis
discus hannai Ino in recirculating aquaculture systems, aquaculture (2017), doi: 10.1016/
j.aquaculture.2017.07.005

This is a PDF file of an unedited manuscript that has been accepted for publication. As
a service to our customers we are providing this early version of the manuscript. The
manuscript will undergo copyediting, typesetting, and review of the resulting proof before
it is published in its final form. Please note that during the production process errors may
be discovered which could affect the content, and all legal disclaimers that apply to the
journal pertain.
ACCEPTED MANUSCRIPT

Effects of stocking density on survival, growth, and food intake of

Haliotis discus hannai Ino in recirculating aquaculture systems

Gao Xiaolonga,b, Zhang Moa, Li Xiana, Wu Fucuna, Song Changbinc, Liu Yingb*
a
Institute of Oceanology, Chinese Academy of Sciences, Qingdao, 266071, China
b
Dalian Ocean University, Dalian, 116023, China

PT
c
Institute of Semiconductors, Chinese Academy of Sciences, Beijing, 100083, China

RI
Running title: Effects of density on growth and food intake of H. d. hannai Ino in

SC
RAS.
NU
*Corresponding author:
Liu Ying
MA

College of Marine Technology and Environment, Dalian Ocean University, 116023,


Dalian, Liaoning Province, China.
Tel.: +86 532 82898646; fax: +86 532 82898646
D

Email: yingliuaquaculture@gmail.com
E
PT
CE
AC
ACCEPTED MANUSCRIPT

Abstract: To examine the effects of stocking density on growth, food intake, and
expression levels of related genes of Haliotis discus hannai Ino in recirculating
aquaculture systems, abalones (shell length: 38.42 ± 2.31 mm, weight: 7.04 ± 0.89 g)
were cultured at three different stocking densities (high [1,500/m2], medium
[1,000/m2], and low [600/m2], 4 replicates each) for 90 d. At the end of the
experiment, the survival rate and specific growth rate of weight of abalones in the
high-density group were 86.5% and 0.14 mg d–1, respectively, which were

PT
significantly lower than those in the low- and medium-density groups (P < 0.05). The

RI
food intake of abalones in the low-density group was significantly higher than that in
the medium- and high-density groups (P < 0.05). At days 60 and 90, the food

SC
conversion efficiency of abalones in the medium-density group had declined, but it
still was significantly higher than that in the high-density group (P < 0.05). At the end
NU
of the experiment, the moisture and lactic acid contents of abalones in the
high-density group were significantly higher than those in the low-density group. The
MA

protein content in the medium-density group decreased over time and became
significantly lower than that in the low-density group at day 90 (P < 0.05). The
D

activities of pepsin and cellulase were significantly higher in the low- and
E

medium-density groups than in the high-density group (P < 0.05). At days 60 and 90,
PT

the activity of α-amylase in the low-density group was significantly higher than that in
the medium-density group (P < 0.05). At the end of the experiment, the expression
CE

levels of the polysaccharide cleavage enzyme genes Hdaly and Hdamyl in the
low-density group had increased and were significantly higher than those in the
AC

medium- and high-density groups (P < 0.05). The expression level of Hdlam in the
high-density group was significantly lower than that in the medium-density group (P
< 0.05), whereas the expression level of Hdcel in the medium-density group was
significantly lower than that in the low-density group (P < 0.05). At the end of the
experiment, the expression levels of catalase and glutathione S-transferase in the
high-density group were significantly higher than levels in the medium- and
low-density groups (P < 0.05). Overall, although food was readily available in this
study, abalones had to first search for food and then spend time feeding and ingesting
ACCEPTED MANUSCRIPT

it. For some individuals, such as those in the corners of the tank or under a stack of
other abalones, access to food was restricted. Moreover, extra energy expenditure was
required to resist oxidative damage. These were the main reasons for the observed
slow down of abalone growth and the increased mortality rate observed in this study..

Keywords: Haliotis discus hannai Ino; Density; Body Composition; Activity of

PT
Digestive Enzymes; Gene Expression

RI
1. Introduction
Haliotis discus hannai Ino is an economically important marine shellfish species

SC
in China. China’s aquaculture production of abalones reached 128,000 tons in 2015,
which accounted for more than 90% of the total world output in that year (China
NU
Fishery Statistics Yearbook, 2016). The rapid development of the aquaculture industry
was accompanied by numerous problems, including worsening water pollution,
MA

frequent occurrence of natural disasters, and spatial limitations to maritime


aquaculture (Wu and Zhang, 2016). Addressing such problems to allow future
D

development of this industry requires changing aquaculture production methods and


E

exploring new approaches to intensive aquaculture practices. Closed recirculating


PT

culture of abalone offers one of the major means for production of large-scale,
high-density production of healthy seedlings.
CE

In China, the use of closed recirculating aquaculture systems (RASs) to culture


abalones is in the early stage, and there is still a long way to go compared to the
AC

situation in developed countries. RASs have the following advantages over


conventional running water aquaculture systems: (1) reduced utilization of water
resources and reduced water pollution; (2) reduced risk of exotic disease infection; (3)
improved safety of seeds and quality of the product; (4) precise, automated
management and control, which improve production efficiency and reduce work
intensity (Dalsgaard et al., 2013; McKenzie et al., 2012; Suhr and Pedersen, 2010).
Based on the physiological and ecological characteristics of abalone, an RAS can be
set up to precisely control the environmental factors suitable for growth, survival, and
ACCEPTED MANUSCRIPT

reproduction.
In industrialized aquaculture production, the output per volume of culture water is
often improved by increasing the stocking density, which in turn leads to a higher
commercial value. However, higher stocking density may stress the cultured
organisms, which can cause physiological dysfunction and increase the possibility of
disease occurrence, resulting in decreased growth and survival rates, greater

PT
individual differences, and the occurrence of growth stage differences (Liu et al., 2015;
Sammouth et al., 2009; Sun et al., 2016). Many factors influence the growth and

RI
survival rates of abalones, such as water quality (James and Barr, 2012; Naylor et al.,
2013), size of seeds (Aviles and Shepherd, 1996; Nie et al., 1996; Wu et al., 2009),

SC
quality and quantity of food (Viera et al., 2005; Viera et al., 2016), and stocking
density (Ahmed et al., 2013; Capinpin et al., 1999). Growth of some Haliotis species,
NU
including Haliotis tuberculata (Mgaya and Mercer, 1995), Haliotis rubra (Huchette et
al., 2003a), Haliotis rufescens (Vivanco-Aranda et al., 2011), H. d. hannai (Park et al.,
MA

2008a; Park et al., 2008b), and Haliotis asinina (Jarayabhand et al., 2010), is
significantly affected by density. However, McShane and Naylor (1995) suggested
D

that the growth of Haliotis iris is not subject to density due to its special living habits
E

(e.g., gregariousness and mutual attachment). Thus, there is some controversy over
PT

the exact effect of stocking density on the growth of abalones.


Managing the reproduction and development of Haliotis species in the aquaculture
CE

environment is more difficult than for other aquatic animals due to water quality
requirements and the need for manual feeding. For these reasons, studies of the effects
AC

of stocking density on growth and survival of abalones are often carried out in the
laboratory or in on-land indoor cement ponds. Few studies have been conducted in
industrialized recirculating systems. When evaluating results of different studies, the
ecological conditions present in different aquaculture systems and the different
aquaculture methods must be considered, because such differences may affect the
results.
In this study, the effects of different aquaculture densities on growth and food
intake of H. d. hannai in a proprietary multi-layer and cubic RAS were evaluated. In
ACCEPTED MANUSCRIPT

addition, the physiological adaptation mechanism of H. d. hannai in the high-density


group was analyzed using molecular biological methods. Among the stocking
densities tested, the optimum density was identified to provide a reference for the
development of industrialized RAS technology for culturing abalones.
2. Materials and Methods
2.1 Experimental facility and acclimation of abalones

PT
This experiment was carried out at the Institute of Oceanology, Chinese Academy
of Sciences, Qingdao, Shandong, China. Four sets of multi-layer cubic RAS were

RI
used as the experimental facility. Each set consisted of an aquaculture system and a
water treatment system. Each aquaculture system contained an culture tank,

SC
perforated partitions, inlet pipe, drain pipe, and wave maker; each water treatment
system consisted of a filter tank, tilted partition, sewage tank, temperature-regulated
NU
chamber, heat exchanger, cooler, water pump, UV disinfection device, foam separator,
jet pump, disk aerator, biotank, air pump, oxygen cone, and oxygen cylinder (Fig. 1).
MA

In these devices, the water flow first ran into the wave maker (height: 25 cm, volume:
6 L) through the inlet pipe. When the water level in the wave maker reached a certain
D

depth, the water automatically poured into the aquaculture tank. The culture tank (1.8
E

m L×0.6 m W×0.35 m H) was partitioned into three horizontal spaces, with the
PT

perforated partitions affixed inside the tank. The filter tank (volume: 0.13 m³) was
composed of two parts. In the upper part, tilted filter plates (60°relative to horizontal)
CE

were affixed inside the filter tank through a slot. The plates contained biochemical
cotton of different pore sizes, and they were positioned in descending order of pore
AC

sizes to allow for layered filtering. The lower part of the filter tank contained the drain
outlet, which was connected directly to the sewage tank. The food residue and feces
were deposited on the bottom of the sewage tank, and they were collected by opening
the bottom drain valve. The water discharged from the aquaculture tank ran through
the filter tank into the temperature-regulated chamber (volume: 0.216 m³), which was
treated by the cooler and heat exchanger to keep the temperature at 17°C. The water
pump drew the water from the top into the foam separator, during which time the
water was sterilized by the UV light (30 W). After this treatment, the water ran into
ACCEPTED MANUSCRIPT

the biotank, the bottom of which contained a disk aerator connected to an air pump
(rated power: 138 W) for continuous aeration. In addition, circular carrier filters
(diameter: 3.5 cm, thickness: 0.3 cm) were placed in the biotank. The water then ran
into the oxygen cone, which was connected to the oxygen cylinder to provide liquid
oxygen (1–1.5 L/min) to ensure that the dissolved oxygen concentration was higher
than 6 mg/L. Finally, the water travelled out of the oxygen cone to return to the inlet

PT
pipe, thus completing the recirculating cycle.
In this experiment, H. d. hannai seeds (that were artificially hatched from the

RI
same batch of seeds) were purchased, brought to the laboratory, transferred at the
given density to different aquaculture tanks, and acclimated for 15 d. Water

SC
temperature was kept at 17°C, salinity at 30 ± 1, pH at 7.9, dissolved oxygen
concentration at > 6 mg/L, and the light cycle was set as the natural light cycle.
NU
Aquaculture water was obtained from the natural sea area and used after
sedimentation and sand filtration. During the acclimation period, Laminaria japonica
MA

Aresch was placed in the tanks once every day at 17:00 to feed the abalone; the
feeding quantity was equivalent to 7% of the wet body weight of the abalone to
D

ensure satiety.
E
PT

2.2 Experimental design


Three density groups were set in the experiment, the stocking density for each
CE

layer in each set of the aquaculture system was 650, 1,080 and 1,620, which equate to
low (600), medium (1,000), and high (1,500)/m2 if calculated by unit area. Four
AC

replicates were used for each density. The experiment ran for 90 d beginning on 1
March and ending on 1 June of 2016. The experimental abalones had shell lengths of
38.42 ± 2.31 mm and weighed 7.04 ± 0.89 g. Abalones were fed fresh L. japonica
once per day at 17:00 at 7% of their wet weight. At 10:00 the next morning, food
residues were collected and weighed. A microcomputer control system was used to
provide UV light from 10:00 until the 3:00 the next morning (i.e., for 5 h every day).
After feeding, the water recirculation was stopped so that the wave maker stopped
flipping, then 1 h after the end of feeding the system began recirculating again. Each
ACCEPTED MANUSCRIPT

day the water in each system was recirculated 18 times, and the flow rate of water was
not < 0.4 cm/s. Three pieces of “W-shaped” substrates (height: 15 cm) were evenly
placed in each aquaculture tank to enlarge the attachment area and avoid the adverse
effect of wastes deposited at the bottom. The filter cotton and the bottom part of the
sewage tank were cleaned every 10 d, and 3% seawater was added to make up for
evaporation.

PT
A YSI-556MPS portable multi-parameter water quality measuring instrument
(YSI Inc., Yellow Springs, OH, USA) was used to measure the water temperature,

RI
salinity, pH, and dissolved oxygen concentration in the four RASs each day. Every 10
d, three water samples were collected from the filter tank of each system prior to

SC
cleaning the sewage tank, and the concentrations of total nitrogen (TAN), nitrite
nitrogen (NO2-N), nitrate nitrogen (NO3-N), and chemical oxygen demand (COD)
NU
were measured using Nessler’s reagent colorimetry, naphthyl diamine hydrochloride
spectrophotometry, ultraviolet spectrophotometry, and the alkaline potassium
MA

permanganate method, respectively (Li et al., 2015).


D

2.3 Data collection


E
PT

2.3.1 Analysis of digestive enzyme activity


The water on the body surface of each abalone was removed using absorbent
CE

paper, and then the abalone was rapidly dissected in an ice tray. After removing the
shell, the hepatopancreas was removed, placed in a 1.5-mL centrifuge tube, quickly
AC

placed in liquid nitrogen, and later moved to a −80°C freezer to await analysis. The
activities of PES, LPS, CL, and AMS were determined using kits supplied by Nanjing
Jiancheng Bioengineering Institute (Jiangsu Sheng, China). To measure PES, CL, and
AMS activities (Gao et al., 2016a), 0.2–0.4 g of tissue were mixed with 1.8 mL 0.86%
normal saline and fully ground in an ice water bath. The tissues then were centrifuged
at 2500 × g /min for PES, 8000 × g /min for CL, and 2500 × g /min for AMS at 4 °C
for 15 min until a 10% tissue homogenate was produced. PES activity was defined as
the amount of tissue protein per mg decomposed into 1 μg of amino acid at 37°C in 1
ACCEPTED MANUSCRIPT

min (i.e., 1 enzyme activity unit). CL activity was defined as the amount of tissue per
g catalyzed to 1 μg of glucose in 1 min (i.e., 1 enzyme activity unit). AMS activity
was defined as the amount of protein per mg in the tissue that reacted with the
substrate (3, 5-dinitrosalicylic acid, 0.2 mol/L phosphate buffer, 6 mol/L NaOH, 0.3%
NaCl) at 37°C for 30 min to hydrolyze 10 mg of amylon (i.e., 1 AMS activity unit).
LPS activity was measured as follows: 0.2–0.4 g of tissue were mixed with 1.8 mL

PT
0.86% normal saline and fully ground in an ice water bath. The tissues were
mechanically homogenized at 2,500 × g /min then centrifuged for 10 min. The

RI
supernatant was used for the measurement. LPS activity was defined as the amount of
tissue protein per g that reacted with the substrate (4-nitrophenyl palmitate) at 37°C

SC
for 1 min to consume 1 μmol 4-nitrophenyl palmitate (i.e., 1 enzyme activity unit)
(Gao et al., 2016a). The protein content in the homogenate was determined using
NU
Coomassie blue staining as described by Bradford (1976), and bovine serum albumin
was used as the protein standard.
MA

2.3.2 Analysis of gene expression


The rest of each sample preserved in liquid nitrogen was used to analyze gene
D

expression. Liquid nitrogen was added to a mortar prior to grinding the


E

hepatopancreas tissues, and 0.05 mg of the obtained sample powders were rapidly
PT

mixed with 1 mL TRIzol (Invitrogen, Carlsbad, CA, USA) to extract total RNA from
the hepatopancreas. Total RNA was extracted by removing the residual DNA from the
CE

sample using RQI RNase-Free DNase (TaKaRa, Kusatsu, Shiga, Japan), and then
RNA was reverse transcribed to cDNA using M-MLV reverse transcriptase (Promega,
AC

Madison, WI, USA). Real-time quantitative PCR was performed using the SYBR®
Premix Ex TaqTM II kit (Tli RNaseH Plus) (TaKaRa) and the TaKaRa Thermal Cycler
DiceTM Real Time System TP800 instrument. The specific primers were designed
based on the cDNA complete sequence available in GenBank. Genetic information
and primer sequences for Hdaly, Hdamyl, Hdlam, Hdcel, CAT, GSTs, and the
reference gene β-actin are shown in Table 1. Each sample was evenly mixed in a PCR
tube and then placed into a PCR plate (Roche Diagnostics, Indianapolis, IN, USA).
PCR amplification was performed after transient centrifugation, and the reaction
ACCEPTED MANUSCRIPT

conditions were as follows: initial denaturation at 94°C for 30 s; the cycling


conditions were 94°C for 5 s, 60°C for 30 s, 40 cycles in total. Analysis of the
solubility curve was conducted at the end of the experiment. Each RNA sample and
gene were analyzed three times for all PCR analyses. mRNA levels of each target
gene were calibrated using the real-time PCR Ct (2–ΔΔCt) relative quantitative method,
with the β-actin gene as the quantitative standard.

PT
2.3.3 Biochemical analysis of body composition

RI
Abalones were dried at 105°C to a constant weight to determine the percent
moisture content of the muscle as (wet weight – dry weight) × 100. The Soxhlet

SC
method was used to determine the content of fat (Liu and Dai, 1978). Abalones were
placed in a muffle furnace at 550°C for 12 h to determine the ash content (Dong et al.,
NU
2006). The content of lactic acid was determined using kits supplied by Nanjing
Jiancheng Bioengineering Institute. In this system, NAD was used as the hydrogen
MA

acceptor, and lactate dehydrogenase catalyzed the dehydration of lactic acid to


produce pyruvic acid and convert NAD+ into NADH. Phenazine methylsulfate
D

transferred hydrogen to reduce nitrotetrazolium blue chloride to a purple chromogenic


E

substrate. When the absorbency of the chromogenic substrate equals 530 nm, it is in
PT

linear relationship with the content of lactic acid, thus the content of lactic acid can be
calculated (Gao et al., 2016a).
CE
AC

2.4 Data calculation


All abalones were starved for 24 h before the start of the experiment, and prior to
the experiment, 20 abalones were randomly selected and used as the initial samples
for later analysis of enzyme activity and biochemical composition. At 30, 60, and 90 d,
100 abalones were randomly selected from each density group to measure shell length
and weight, and the survival rate of abalones in each density group was also recorded.
Twenty abalones were randomly collected from each density group at 30, 60, and 90 d,
and the activities of pepsin (PES), lipase (LPS), cellulase (CL), and α-amylase (AMS)
ACCEPTED MANUSCRIPT

in the liver and pancreas tissues were measured. In addition, the content of moisture,
ash, fat, crude protein, and lactic acid and the expression levels of four polysaccharide
cleavage enzyme genes (Hdaly, Hdamyl, Hdlam, Hdcel), catalase (CAT), and
glutathione S-transferase (GST) in the samples were determined. Twenty individuals
were assayed from each of the four replicates for each stocking density, and
measurements for a given sample were made in triplicate and averaged.

PT
During the experiment, the survival rate (S, %), shell length/body weight specific
growth rate (SGR, % d–1), food intake (FI, % body weight d–1), and food conversion

RI
efficiency (FCE, %) of the abalones were calculated at 30, 60, and 90 d using the
following equations:

SC
S (%) = [(N1 − N2)/N1] × 100
SGR (% d–1) = (lnW2 − lnW1)/T × 100 and SGR (% d–1) = (lnL2 − lnL1)/T × 100
NU
FI (% body weight d–1) = F/[T × (W2 + W1)/2] × 100
FCE (%) = (W2 − W1)/F × 100
MA

where N1 and N2 are the number of abalones at the beginning and end of the
experiment, respectively; W1 and W2 are the wet weight (g) of abalones at the
D

beginning and end, respectively; L1 and L2 are the shell length at the beginning and
E

end, respectively, T is the number of days; and F is the weight of food ingested during
PT

the experiment (dry weight, g).


CE

2.5 Statistical analysis


SPSS18.0 was used for statistical analysis (Armonk, NY, USA). One-way analysis
AC

of variance (ANOVA) and Tukey’s test were performed to examine the differences in
growth, food intake, activity of digestive enzymes, body composition, and related
gene expression of H. d. hannai among the different density groups. The differences
in growth and food intake at different sampling times within the same density group
were also tested using one-way ANOVA. P < 0.05 was considered to be significantly
different. All experimental data were expressed as mean ± standard error (mean ± SE),
and the data obtained were graphed using Sigmaplot (Systat Software Inc., San
Jose, CA, USA).
ACCEPTED MANUSCRIPT

3. Results
3.1 Water quality indexes
During the course of the experiment, there were no significant differences in water
temperature, salinity, pH, dissolved oxygen, or dissolved oxygen saturation recorded
among the different stocking density groups (Tab. 2). The concentrations of TAN and
NO2-N varied slightly during the experiment, ranging from 0.113 to 0.177 mg/L and

PT
0.003 to 0.007 mg/L, respectively (Fig. 2). The curve for the concentration of NO3-N

RI
exhibited an inverted “W” shape, and the maximum value (2.47 mg/L) and the
minimum value (1.86 mg/L) appeared at days 70 and 40, respectively. The

SC
concentration of COD ranged from 1.17 to 1.46 mg/L.
NU
3.2 Survival rate
As the experiment progressed, the survival rate of H. d. hannai Ino decreased
MA

gradually. At day 60, the survival rate of abalones in the low-density group was
significantly higher than that in high-density group (P = 0.004) but not the
D

medium-density group (Fig. 3). At day 90, the survival rate of abalones in the
E

high-density group was 86.5%, which was significantly lower than that in the low-
PT

and medium-density groups (F = 17.58, df1 = 2, df2 = 6, P = 0.001).


CE

3.3 Growth and food intake


At day 30, the SGR of shell length of abalones in the high-density group was
AC

significantly lower than that in the low- and medium-density groups, but no
significant difference was detected between the low- and medium-density groups (P =
0.183, Fig. 4a). At days 60 and 90, the SGR of shell length of abalones in the
medium-density group had decreased, and the values were significantly lower than
those in the low-density group (P60d < 0.001, P90d < 0.001). At the end of the
experiment, the SGR of weight of abalones in the high-density group was 0.14 mg d–1,
which was significantly lower than that in the low- and medium-density groups (F =
38.54, df1 = 2, df2 = 6, P < 0.001, Fig. 4b).
ACCEPTED MANUSCRIPT

Stocking density also had a significant effect on food intake of abalones.


Throughout the experiment, food intake in the low-density group was significantly
higher than that in the medium- and high-density groups (F = 108.25, df1 = 2, df2 = 6,
P < 0.001, Fig. 5). At day 30, no significant difference in food intake was found
between the medium- and high-density groups (P = 0.133), but at days 60 and 90
food intake in the high-density group became significantly lower than that in the

PT
medium-density group (P60d = 0.002, P90d < 0.001).
At day 30, no significant difference in FCE was detected between the low- and

RI
medium-density groups (P = 0.207), but both values were significantly higher than
that in the high-density group (F = 90.16, df1 = 2, df2 = 6, P < 0.001, Fig. 6). At days

SC
60 and 90, the FCE of abalones in the medium-density group had decreased but it still
was significantly higher than that in the high-density group (P60d = 0.003, P90d <
NU
0.001).
MA

3.4 Activities of digestive enzymes


No significant difference in the activity of PES was found between the low- and
D

medium-density groups, but both values were significantly higher than that in the
E

high-density group (F = 167.39, df1 = 2, df2 = 6, P < 0.001, Tab. 3). The activity of
PT

LPS was not affected by stocking density, as no significant difference in LPS activity
was detected among the density groups. At day 30, no significant difference in CL
CE

activity was detected among the density groups, but at days 60 and 90 the CL activity
in the low- and medium-density groups was significantly higher than that in the
AC

high-density group (F60d = 4.06, df1 = 2, df2 = 6, P60d = 0.015, F90d = 8.19, df1 = 2, df2
= 6, P90d = 0.006). At day 30, the activity of AMS in the low and medium-density
groups did not differ significantly (P = 0.193), but the values were significantly
higher than that in the high-density group. At days 60 and 90, the activity of AMS in
the low-density group had increased, and the values were significantly higher than
those in the medium-density group (P60d =0.001, P90d < 0.001, Tab. 3).

3.5 Body composition


ACCEPTED MANUSCRIPT

At day 30, the moisture content of abalones did not differ significantly among the
density groups. However, at day 90 the moisture content in the high-density group had
increased and was significantly higher than that in the low-density group (P = 0.006)
but not the medium-density group (Tab. 4). At days 30 and 60, the protein content of
abalones in the low-density group was significantly higher than that in the
high-density group, but no significant difference between the low- and

PT
medium-density groups was detected (P30d = 0.166, P60d = 0.137). At the end of the
experiment, the protein content of abalones in the medium-density group had

RI
decreased, and the content was significantly lower than that in the low-density group
(P < 0.001). At day 30, no significant difference in ash content of abalones was found

SC
among the density groups, but at the end of the experiment the ash content of the
medium- and low-density groups was significantly higher than that in the high-density
NU
group (F = 63.28, df1 = 2, df2 = 6, P = 0.002). At days 60 and 90, no significant
difference in fat content of abalones was detected between the low- and
MA

medium-density groups, but the fat content was significantly higher in the low-density
group than in the high-density group (P60d < 0.001, P90d = 0.001). The lactic acid
D

content also was affected by stocking density. Throughout the experiment, the lactic
E

acid content of abalones did not differ significantly between the low- and
PT

medium-density groups (P30d = 0.216, P60d = 0.193, P90d = 0.238), but the values were
significantly lower than those in the high-density group (F = 133.07, df1 = 2, df2 = 6, P
CE

< 0.001, Tab. 4).


AC

3.6 Gene expression


At days 30 and 60, the expression level of Hdaly did not differ significantly
between the low- and medium-density groups, but both levels were significantly
higher than that in the high-density group (F30d = 22.14, df1 = 2, df2 = 6, P30d < 0.001,
F60d = 25.04 df1 = 2, df2 = 6, P60d < 0.001, Fig. 7a). At day 90, the expression level of
Hdaly in the low-density group had increased and became significantly higher than
that in the medium and high-density groups (F = 34.62, df1 = 2, df2 = 6, P < 0.001).
Throughout the experiment, the expression level of Hdamyl in the low-density group
ACCEPTED MANUSCRIPT

was significantly higher than that in the medium and high-density groups (F30d =
31.59, df1 = 2, df2 = 6, P30d < 0.001, F60d = 38.20, df1 = 2, df2 = 6, P60d < 0.001, F90d =
44.97, df1 = 2, df2 = 6, P90d < 0.001, Fig. 7b). At days 30 and 90, the expression levels
of Hdamyl in the medium-density group were significantly higher than those in the
high-density group. At days 60 and 90, the expression levels of Hdlam in the
high-density group were significantly lower than those in the medium-density group

PT
(P60d < 0.001, P90d < 0.001), but at day 30 no significant difference was detected (P =
0.128). Levels for both groups were significantly lower than that in the low-density

RI
group (F = 72.19, df1 = 2, df2 = 6, P < 0.001, Fig. 7c). At days 60 and 90, the
expression levels of Hdcel in the medium-density group were significantly lower than

SC
those in the low-density group, but at day 30 no significant difference was detected (P
= 0.245, Fig. 7d).
NU
The expression level of CAT increased with increasing stocking density. At days
60 and 90, the expression levels of CAT in the high-density group were significantly
MA

higher than those in the medium and low-density groups (F60d = 16.52, df1 = 2, df2 = 6,
P60d = 0.002, F90d = 23.87, df1 = 2, df2 = 6, P90d < 0.001, Fig. 7e). At the end of the
D

experiment, the expression level of GST in the high-density group was significantly
E

higher than that in the medium- and low-density groups (F = 27.81, df1 = 2, df2 = 6, P
PT

< 0.001), which did not differ significantly from each other (P = 0.155, Fig. 7f).
CE

4. Discussion
In addition to genetics, food, and environmental conditions, stocking density is an
AC

important factor that influences the growth and sexual maturity of farmed aquatic
organisms. Organisms living in a high-density environment often experience the
interaction of a series of environmental factors, which in turn individually or
collectively influence the organisms’ growth (DiMaggio et al., 2014; Smith et al.,
1978; Stillman et al., 2000). Stocking density has a threshold, which may differ
among species and growth characteristics. For example, the mortality rate will not be
subject to the influence of stocking density within a range of densities, but if density
increases beyond the threshold, mortality will increase (Iguchi et al., 2003; Jia et al.,
ACCEPTED MANUSCRIPT

2016). In the current study, the survival rate of abalones in the high-density group
gradually decreased over time and was 86.5% at the end of experiment. This rate was
significantly lower than that in the low- and medium-density groups. A higher
stocking density may intensify the competition among abalones for living space and
food, which in turn can result in large size differences among individuals, exacerbated
growth dispersion, restricted food intake for small individuals, metabolic dysfunction,

PT
and increased mortality rate. Although the mortality rate was higher for the higher
stocking density, the RAS ensured good water quality. The temperature, salinity, and

RI
pH values were kept at a relatively constant level, and the dissolved oxygen
concentration was > 6 mg/L. Although the concentration of TAN, NO2-N, NO3-N, and

SC
COD in the water slightly changed over the course of the experiment, all were within
the normal tolerance range of abalones (Huchette et al., 2003b; Park et al., 2008b;
NU
Reddy-Lopata et al., 2006). These good water quality conditions weakened the effects
of intra-specific competition and excretion factors on the growth and survival of
MA

abalones in the high-density group. Thus, the water quality in the RAS was not the
main cause for the observed differences in survival rate among the density groups.
D

In the current study, the SGR of weight of abalones was lower with increased
E

stocking density. At the end of the experiment, the SGR of weight of abalones in the
PT

high-density group was significantly lower than that in the medium- and low-density
groups. At days 60 and 90, the food intake and the FCE of abalones in the medium-
CE

and high-density groups were significantly lower than those in the low-density group.
Despite the controversy over the density effect (Björnsson, 1994; McShane and
AC

Naylor, 1995), the growth of Haliotis species is generally considered to be dependent


on stocking density. Individuals usually grow slowly in the high-density environment,
which is supported by the results presented herein. Competition for living space and
food (Foster and Stiven, 1996; Lloyd and Bates, 2008) and water quality differences
(Harris et al., 1998) arising from animal metabolism (e.g., excretion of ammonia
nitrogen and changes in dissolved oxygen concentration) (Wu et al., 2009) at different
stocking densities might be the cause of the density effect. The competition for living
spaces might explain the effects of stocking density on the growth of abalones
ACCEPTED MANUSCRIPT

identified in the experiment, due to sensitivity of light and manual operation


(Morikawa and Norman, 2003). Abalones tend to gather in high density at the corners
of aquaculture tanks and under attachment substrates, which may lead to competition
for locally limited shaded spaces. During the current study, the abalones were fed with
an excessive amount of food, but this does not necessarily mean that there was no
competition for food among the individuals. In general, abalones are more active 2–3

PT
h after sunset and 2–3 h before sunrise (Ahmed et al., 2013). Abalones feed by using
the radula to scrape bits of algae from the larger plant, which is a slow process. In this

RI
study, food was available for 17 h per day, but abalones had to first search for food
and then feed on the algae. Individuals in the corners of the tank, in the middle of a

SC
group, or underneath a stack of abalones (Fermin and Buen, 2001; Huchette et al.,
2003a) would have difficulty with this process. This scenario resulted in competition
NU
for food and thus reduced food intake. Therefore, despite the provision of excessive
amounts of food, food availability was a restrictive factor for the growth of abalones
MA

in this study. Furthermore, movement to and from and over each other can increase
the likelihood of shell damage and physiological stress, which can negatively impact
D

food intake and growth.


E

Organisms cultured in a high-density environment often are exposed to a series of


PT

complex environmental factors, which interactively and collectively impact their


growth and survival (Olson and Paiya, 2013; Taylor et al., 1997). Miller and Weil
CE

(1963) reported that a change of one component in body composition may lead to a
change of another component. At the end of the current study, the moisture content of
AC

abalones in the high-density group was significantly higher than that in the
low-density group, but its fat content was significantly lower than that in the
low-density group. Previous studies have shown that a decrease of moisture content
may lead to an increase of fat content in fish, and the fat content can be predicted by
their weight and moisture content (Konstantinov and Zdanovich, 1986; Spigarelli et
al., 1982). Shearer (1994) reported that the protein and ash contents of fish are
primarily affected by endogenous factors, such as development stage and size. The
protein and ash contents of abalones in the high-density group were lower than those
ACCEPTED MANUSCRIPT

in the other groups, which indicates that, at this density, the energy consumed for
physiological function and behavioral regulation increased and that more organic
matter was consumed and less was accumulated. Gao et al. (2016a) found that when
Haliotis discus discus was subjected to light stress, it used a set of physiological and
behavioral adaptation mechanisms to cope. However, the long-term stress response of
abalones may result in a metabolic balance disorder that involves allocating the

PT
energy usually used for growth to adaptation to the external environment. The chronic
stress will further accelerate energy consumption, resulting in a change in the

RI
biochemical composition of abalones. Anaerobic glycolysis is an anaerobic metabolic
pathway, and lactic acid is the end product of this pathway; thus, lactic acid is

SC
regarded as an indicator of stress. When an organism is under environmental stress, its
energy demand will increase (Paterson, 1993). In the medium- and low-density
NU
groups in the current study, the lactic acid content of abalones was lower than that in
the high-density group, which indicates that organisms at lower densities were in a
MA

state of physiological balance. In contrast, the higher lactic acid content in the
high-density group indicates that the level of anaerobic metabolism was higher and
D

that more energy was required to withstand the stress of adverse environmental
E

factors.
PT

Like many herbivores, abalones rely on enzymes to decompose the structural


polysaccharides in algae and hydrolyze the undigested proteins. The activity levels of
CE

digestive enzymes directly reflect an organism’s ability to digest food and absorb
nutrients as well as its immune state. In most cases, there is certain relationship
AC

between food intake and activity of digestive enzymes, as undigested food stimulates
the digestive system to secrete digestive enzymes, which in turn promotes food intake
behavior (Bolasina et al., 2006). The activity of PES in the digestive tract is the factor
responsible for effective absorption and utilization of undigested proteins
(Picos-Garcı́a et al., 2000). At the end of the experiment, the activities of PES, CL,
and AMS of abalones in the medium- and low-density groups were significantly
higher than those in the high-density group, which indicates that abalones in the
high-density condition had poor food digestion and absorption capabilities. Because
ACCEPTED MANUSCRIPT

abalones are herbivores, they require little fat in their food. This characteristic may
explain why the LPS activity did not differ significantly among the density groups.
Energy metabolism of many gastropods is based on the utilization of
carbohydrates. A number of studies have demonstrated that abalones also follow this
trend, as the fat content in their natural foods generally is low but the carbohydrate
content is higher (Knauer et al., 1996). At the end of the experiment, the expression

PT
levels of Hdaly, Hdamyl, Hdlam, and Hdcel in the low-density group were
significantly higher than those in the medium- and high-density groups. These higher

RI
levels promoted higher activity of related digestive enzymes in the low-density group,
resulting in greater food intake and FCE and acceleration of growth. The ability of an

SC
organism to digest food depends on both the composition of food and the internal
ability to use endogenous and exogenous enzymes to digest the food (Jones et al.,
NU
1997). Garcia-Esquivel and Felbeck (2006) verified that abalone are herbivores, as the
activities of CL and AMS were obviously higher than those of fat and protein
MA

breakdown enzymes such as LPS, chymotrypsin, and aminopeptidase. In the current


study, the different expression levels of Hdaly, Hdamyl, Hdlam, and Hdcel among the
D

density groups likely resulted in decreased activity of digestive enzymes with


E

increased stocking density. The abalones in the high-density group were in a state of
PT

stress, which may have inhibited the synthesis and secretion of enzymes. When food
intake decreases, abalones may need to expend extra energy to resist environmental
CE

stressors, resulting in slow growth and increased mortality.


The dynamic balance between the antioxidant system and reactive oxygen species
AC

is an important factor that ensures the health status of an organism (Seifried, 2007).
For aquatic animals, the complexity of the living environment means that this internal
balance is more likely to be broken by oxidative stress factors compared to land-based
organisms (Almroth et al., 2015; Hu et al., 2015; Li et al., 2016). At the end of the
experiment, the expression levels of CAT and GST in the low- and medium-density
groups were significantly lower than those in the high-density group, which indicates
that high-density aquaculture caused the abalones to experience oxidative stress.
Canesi et al. (2007) found that low-dosage bisphenol A can significantly reduce the
ACCEPTED MANUSCRIPT

transcription and translation expression levels of CAT in the hepatopancreas of


Mytilus galloprovincialis and enhance the activity of GST and glutathione disulfide
reductase. Gao et al. (2016b) reported that when the light intensity reached 60
μmol/m2/s, it could cause H. d. hannai to experience oxidative stress. The significant
increase of expression levels of GSTS and CAT is a tissue-specific mechanism and
long-term cell protective mechanism that is of great significance for improving the

PT
capacity of an organism to resist oxidative stress.
In this study, increased stocking density resulted in decreased survival rate and

RI
SGR of H. d. hannai. In the high-density group, reduced expression levels of Hdaly,
Hdamyl, Hdlam, and Hdcel resulted in significant decreases in the corresponding

SC
digestive enzymes. Despite the sufficient food supply, food was more difficult to
obtain for abalones in the high-density environment. When feeding activity was
NU
restricted, extra energy expenditure was needed to resist oxidative damage, resulting
in slow growth and increased mortality. Overall, the low-density culture of H. d.
MA

hannai (600/m2) in the RAS produced the best results. These findings may prove
useful for increasing aquaculture efficiency and maintaining the normal physiological
D

metabolism of H. d. hannai cultured in RASs.


E
PT

Acknowledgements
We would like to thank Xu Jianping and Li Wenya for help with analyzing antioxidant
CE

capacity and enzyme activity of body tissues. We thank Shi Ce for discussions and
suggestions about this article. This research was supported by the National Key R&D
AC

Program of China [2017YFB0404000], the National 863 Project [2013AA103001],


the earmarked fund for the Modern Agro-industry Technology Research System
[CARS-48], and the National Natural Science Fund of China [31672673, 31402283,
41306152].

References
Ahmed, F., Koike, Y., Strüssmann, C.A., Watanabe, S., 2013. Effect of density on growth and feed
consumption of the abalones Haliotis discus discus, H. gigantea, H. madaka and their
ACCEPTED MANUSCRIPT

hybrids. Aquacult. Int. 21, 969-986.


Almroth, B.C., Asker, N., Wassmur, B., Rosengren, M., Jutfelt, F., Gräns, A., Sundell, K.,
Axelsson, M., Sturve, J., 2015. Warmer water temperature results in oxidative damage in an
Antarctic fish, the bald notothen. J. Exp. Mar. Biol. Ecol. 468, 130-137.
Aviles, J.G.G., Shepherd, S.A., 1996. Growth and survival of the blue abalone Haliotis fulgens in
barrels at Cedros Island, Baja California, with a review of abalone barrel culture. Aquaculture.
140, 169-176.
Björnsson, B., 1994. Effects of stocking density on growth rate of halibut (Hippoglossus
hippoglossus L.) reared in large circular tanks for three years. Aquaculture. 123, 259-270.
Bolasina, S., Tagawa, M., Yamashita, Y., Tanaka, M., 2006. Effect of stocking density on growth,

PT
digestive enzyme activity and cortisol level in larvae and juveniles of Japanese flounder,
Paralichthys olivaceus. Aquaculture. 259, 432-443.

RI
Bradford, M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254.

SC
Canesi, L., Borghi, C., Ciacci, C., Fabbri, R., Vergani, L., Gallo, G., 2007. Bisphenol-A alters gene
expression and functional parameters in molluscan hepatopancreas. Mol. Cell. Endocrinol.
276, 36-44.
NU
Capinpin, E.C., Toledo, J.D., Encena, V.C., Doi, M., 1999. Density dependent growth of the tropic
abalone Haliotis asinina in cage culture. Aquaculture. 171, 227-235.
China Bureau of Fisheries, 2016. China Fisheries Yearbook in 2015. Agricultural Press of China,
MA

Beijing, pp. 29 (in Chinese).


Dalsgaard, J., Lund, I., Thorarinsdottir, R., Drengstig, A., Arvonen, K., Pedersen, P.B., 2013.
Farming different species in RAS in Nordic countries: current status and future perspectives.
Aquacult. Eng. 53, 2-13.
D

DiMaggio, M.A., Ohs, C.L., Broach, J.S., Sink, T.D., 2014. Effects of stocking density on growth,
survival, and stress physiology of pigfish. N. Am. J. Aquacult. 76, 201-210.
E

Dong, Y.W., Dong, S.L., Tian, X.L., Wang, F., Zhang, M.Z., 2006. Effects of diel temperature
PT

fluctuations on growth, oxygen consumption and proximate body composition in the sea
cucumber Apostichopus japonicus Selenka. Aquaculture. 255, 514-521.
Ekanayake, P.M., De Zoysa, M., Kang, H.S., Qiang, W., Jee, Y., Lee, Y.H., Kim, S.J., Lee, J., 2008.
CE

Cloning, characterization and tissue expression of disk abalone (Haliotis discus discus)
Catalase. Fish. Shellfish. Immun. 24, 267-278.
Fermin, A.C., Buen, S.M., 2001. Feeding, growth and survival of abalone (Haliotis asinina
AC

Linnaeus 1758) reared at different stocking densities in suspended mesh cages in


flow-through tanks. Phili. Sci. 39, 31-41.
Foster, B.A., Stiven, A.E., 1996. Experimental effects of density and food on growth and mortality
of the Southern Appalachian land gastropod, Mesodon normalis (Pilsbry). Am. Midl. Nat.
136, 300-314.
Gao, X.L., Zhang, M., Li, X., Shi, C., Song, C.B., Liu, Y., 2016a. Effects of LED light quality on
the growth, metabolism, and energy budgets of Haliotis discus discus. Aquaculture. 453,
31-39.
Gao, X.L., Li, X., Li, M.J., Song, C.B., Liu, Y., 2016b. Effects of light intensity on metabolism
and antioxidant defense in Haliotis discus hannai Ino. Aquaculture. 465, 78-87.
Garcia-Esquivel, Z., Felbeck, H., 2006. Activity of digestive enzymes along the gut of juvenile red
ACCEPTED MANUSCRIPT

abalone, Haliotis rufescens, fed natural and balanced diets. Aquaculture. 261, 615-625.
Harris, J.O., Maguire, G.B., Edwards, S., Hindrum, S.M., 1998. Effect of ammonia on growth rate
and oxygen consumption rate of juvenile greenlip abalone, Haliotis laevigata Donovan.
Aquaculture. 160, 259-272.
Hu, M.H., Wu, F.L., Yuan, M.Z., Li, Q.Z., Gu, Y.D., Wang, Y.J., Liu, Q.G., 2015. Antioxidant
responses of triangle sail mussel Hyriopsis cumingii exposed to harmful algae Microcystis
aeruginosa and hypoxia. Chemosphere. 139, 541-549.
Huchette, S., Koh, C.S., Day, R., 2003a. The effects of density on the behaviour and growth of
juvenile blacklip abalone (Haliotis rubra). Aquacult. Int. 11, 411-428.
Huchette, S.M.H., Koh, C.S., Day, R.W., 2003b. Growth of juvenile blacklip abalone (Haliotis

PT
rubra) in aquaculture tanks: effects of density and ammonia. Aquaculture. 219, 457-470.
Iguchi, K., Ogawa, K., Nagae, M., Ito, F., 2003. The influence of rearing density on stress

RI
response and disease susceptibility of ayu (Plecoglossus altivelis). Aquaculture. 220,
515-523.

SC
James, P.J., Barr, N.G., 2012. The effects of elevated concentrations of dissolved inorganic
phosphate in seawater on the growth and survival of juvenile abalone, Haliotis iris. Aquac.
Res. 43, 438-446.
NU
Jarayabhand, P., Kruiroongroj, W., Chaisanit, C., 2010. Effects of stocking density on growth
performance of Thai abalone, Haliotis asinina, Linnaeus 1758, reared under a semiclosed
recirculating land-based system. J. Shellfish. Res. 29, 593-597.
MA

Jia, R., Liu, B.L., Feng, W.R., Han, C., Huang, B., Lei, J.L., 2016. Stress and immune responses in
skin of turbot (Scophthalmus maximus) under different stocking densities. Fish. Shellfish.
Immun. 55, 131-139.
Jones, D.A., Kumlu, M., Le Vay, L., Fletcher, D.J., 1997. The digestive physiology of herbivorous,
D

omnivorous and carnivorous crustacean larvae: a review. Aquaculture. 155, 285-295.


Knauer, J., Britz, P.J., Hecht, T., 1996. Comparative growth performance and digestive enzyme
E

activity of juvenile South African abalone, Haliotis midae, fed on diatoms and a practical diet.
PT

Aquaculture. 140, 75-85.


Konstantinov, A.S., Zdanovich, V.V., 1986. Some features of fish growth at fluctuating
temperature. Vopr. Ikhtiol. 26, 971-977.
CE

Li, M., Song, X.F, Sun, G.X., Ma, X.N., Liu, Y., 2015. Optimal ratios of oyster to Gracilaria
improving removal efficiency of nitrogen nutrients in aquaculture wastewater. Transactions
of the CSAE. 31, 243-248.
AC

Li, Y.H., Wei, L., Cao, J.R., Qiu, L.G., Jiang, X., Li, P., Song, Q.Q., Zhou, H.L., Han, Q., Diao,
X.P., 2016. Oxidative stress, DNA damage and antioxidant enzyme activities in the pacific
white shrimp (Litopenaeus vannamei) when exposed to hypoxia and reoxygenation.
Chemosphere. 144, 234-240.
Liu, B.L., Liu, Y., Wang, X.P., 2015. The effect of stocking density on growth and seven
physiological parameters with assessment of their potential as stress response indicators for
the Atlantic salmon (Salmo salar). Mar. Freshw. Behav. Phy. 48, 177-192.
Liu, F.L., Dai, X.J., 1978. The Physical and Chemical Method for Food. Light Industry Press,
Beijing, pp. 53-57 (in Chinese).
Lloyd, M., Bates, A.E., 2008. Influence of density-dependent food consumption, foraging and
stacking behaviour on the growth rate of the Northern abalone, Haliotis kamtschatkana.
ACCEPTED MANUSCRIPT

Aquaculture. 277, 24-29.


McKenzie, D.J., Höglund, E., Dupont-Prinet, A., Larsen, B.K., Skov, P.V., Pedersen, P.B.,
Jokumsen, A., 2012. Effects of stocking density and sustained aerobic exercise on growth,
energetics and welfare of rainbow trout. Aquaculture. 338-341, 216-222.
McShane, P.E., Naylor, J.R., 1995. Density independentgrowth of Haliotis iris Martyn (Mollusca:
Gastropoda). J. Exp. Mar. Biol. Ecol. 190, 51-60.
McShane, P.E., Naylor, J.R., 1995. Small-scale spatial variation in growth, size at maturity, and
yield- and egg-per-recruit relations in the New Zealand abalone Haliotis iris. New. Zeal. J.
Mar. Fresh. 29, 603-612.
Mgaya, Y.D., Mercer, J.P., 1995. The effects of size grading and stocking density on growth

PT
performance of juvenile abalone, Haliotis tuberculata Linnaeus. Aquaculture. 136, 297-312.
Miller, I., Weil, W.B., 1963. Some problems in expressing and comparing body composition

RI
determined by direct analysis. Ann. NY. Acad. Sci. 153-160.
Morikawa, Y., Norman, C.P., 2003. Perception of light intensity by Haliotis discus discus based on

SC
locomotor activity patterns. Fisheries. Sci. 69, 478-486.
Naylor, M.A., Kaiser, H., Jones, C.L.W., 2013. The effect of dosing with sodium hydroxide
(NaOH-) on water pH and growth of Haliotis midae in an abalone serial-use raceway.
NU
Aquacult. Int. 21, 467-479.
Nie, Z.Q., Ji, M.F., Yan, J.P., 1996. Preliminary studies on increased survival and accelerated
growth of overwintering juvenile abalone, Haliotis discus hannai Ino. Aquaculture. 140,
MA

177-186.
Olson, D.E., Paiya, M., 2013. An evaluation of rearing densities to improve growth and survival of
hatchery spring chinook salmon. J. Fish. Wildl. Manag. 4, 114-123.
Park, J., Kim, P.K., Jo, J.Y., 2008a. Growth performance of disk abalone Haliotis discus hannai in
D

pilot- and commercial-scale recirculating aquaculture systems. Aquacult. Int. 16, 191-202.
Park, J., Kim, H.B., Kim, P.K., Jo, J.Y., 2008b. The growth of disk abalone, Haliotis discus hannai
E

at different culture densities in a pilot-scale recirculating aquaculture system with a baffled


PT

culture tank. Aquacult. Eng. 38, 161-170.


Paterson, B.D., 1993. The rise in inosine monophosphate and l-lactate concentrations in muscle of
live penaeid prawns (Penaeus japonicus, Penaeus monodon) stressed by storage out of water.
CE

Comp. Biochem. Phys. B. 106, 395-400.


Picos-Garcı́a, C., Garcı́a-Carreño, F.L., Serviere-Zaragoza, E., 2000. Digestive proteases in
juvenile Mexican green abalone, Haliotis fulgens. Aquaculture. 181, 157-170.
AC

Reddy-Lopata, K., Auerswald, Lutz., Cook, P., 2006. Ammonia toxicity and its effect on the
growth of the South African abalone Haliotis midae Linnaeus. Aquaculture. 261, 678-687.
Sammouth, S., d’Orbcastel, E.R., Gasset, E., Lemarié, G., Breuil, G., Marino, G., Coeurdacier, J.L.,
Fivelstad, S., Blancheton, J.P., 2009. The effect of density on sea bass (Dicentrarchus labrax)
performance in a tank-based recirculating system. Aquacult. Eng. 40, 72-78.
Seifried, H.E., 2007. Oxidative stress and antioxidants: a link to disease and prevention? J. Nutr.
Biochem. 18, 168-171.
Shearer, K.D., 1994. Factors affecting the proximate composition of cultured fishes with emphasis
on salmonids. Aquaculture. 119, 63-88.
Smith, H.T., Schreck, C.B., Maughan, O.E., 1978. Effect of population density and feeding rate on
the fathead minnow (Pimephales promelas). J. Fish. Biol. 12, 449-455.
ACCEPTED MANUSCRIPT

Spigarelli, S.A., Thomas, M.M., Prepejchal, W., 1982. Feeding, growth, and fat deposition by
brown trout in constant and fluctuating temperatures. T. Am. Fish. Soc. 111, 199-209.
Stillman, R.A., McGrorty, S., Goss-Custard, J.D., West, A.D., 2000. Predicting mussel population
density and age structure: the relationship between model complexity and predictive power.
Mar. Ecol. Prog. Ser. 208, 131-145.
Suhr, K.I., Pedersen, P.B., 2010. Nitrification in moving bed and fixed bed biofilters treating
effluent water from a large commercial outdoor rainbow trout RAS. Aquacult. Eng. 42,
31-37.
Sun, G.X., Liu, Y., Qiu, D.G., Yi, M.M., Li, X., Li, Y., 2016. Effects of feeding rate and frequency
on growth performance, digestion and nutrients balances of Atlantic salmon (Salmo salar) in

PT
recirculating aquaculture systems (RAS). Aquac. Res. 47, 176-188.
Taylor, J.J., Rose, R.A., Southgate, P.C., 1997. Effects of stocking density on the growth and

RI
survival of juvenile silver-lip pearl oysters (Pinctada maxima, Jameson) in suspended and
bottom culture. J. Shellfish. Res. 16, 569-572.

SC
Viera, M.P., Courtois de Viçose, G., Fernández-Palacios, H., Izquierdo, M., 2016. Grow-out
culture of abalone Haliotis tuberculata coccinea Reeve, fed land-based IMTA produced
macroalgae, in a combined fish/abalone offshore mariculture system: effect of stocking
NU
density. Aquac. Res. 47, 71-81.
Viera, M.P., Pinchetti, J.L.G., de Vicose, G.C., Bilbao, A., Suárez, S., Haroun, R.J., Izquierdo, M.S.,
2005. Suitability of three red macroalgae as a feed for the abalone Haliotis tuberculata
MA

coccinea Reeve. Aquaculture. 248, 75-82.


Vivanco-Aranda, M., Gallardo-Escárate, C. J., del Río-Portilla, M.Á., 2011. Low-density culture
of red abalone juveniles, Haliotis rufescens Swainson 1822, recirculating aquaculture system
and flow-through system. Aquac. Res. 42, 161-168.
D

Wu, F.C., Liu, X., Zhang, G.F., Wang, C.D., 2009. Effects of the initial size, stocking density and
sorting on the growth of juvenile Pacific abalone, Haliotis discus hannai Ino. Aquac. Res. 40,
E

1103-1110.
PT

Wu, F.C., Zhang, G.F., 2016. Pacific abalone farming in China: recent innovations and challenges.
J. Shellfish. Res. 35, 703-710.
CE
AC
ACCEPTED MANUSCRIPT

PT
RI
SC
NU
MA
E D
PT
CE
AC

Fig. 1. Experimental system configuration. (A) Schematic diagram of the abalone recirculating
aquaculture system: (1) culture tank; (3) drain outlet; (4) filter tank; (8) drain pipe; (9)
temperature-regulated chamber; (10) heat exchanger; (11) cooler; (12) water pump; (13) UV
disinfection device; (14) foam separator; (15) jet pump; (16) biotank; (17) disk aerator; (18) air
pump; (19) oxygen cylinder; (20) oxygen cone; (21) inlet pipe; (22) wave maker; (23) intake; (24)
shelf. (B) The geometry of culture tank: (2) perforated partitions. (C) The geometry of the filter
tank: (5) tilted partition; (6) sewage tank; (7) drain valve.
ACCEPTED MANUSCRIPT

PT
RI
Fig. 2. Changes in total nitrogen (TAN), nitrite nitrogen (NO2-N), nitrate nitrogen (NO3-N), and

SC
chemical oxygen demand (COD) in the sewage tank of the abalone recirculating aquaculture
system during the experiment. NU
MA
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

PT
RI
SC
NU
Fig. 3. Effects of stocking density on the survival rate of juvenile abalone (H. discus hannai).
Values are expressed as mean ± SE (n = 4). Statistical analysis was performed by one-way
analysis of variance (ANOVA) followed by Turkey’s test, using SPSS version 18.0. Means with
MA

the different lower case letters are significantly different at P < 0.05 level.
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

PT
RI
SC
NU
a. Shell-length specific growth rate of juvenile abalone (H. discus hannai)
MA
E D
PT
CE
AC

b. Body-weight specific growth rate of juvenile abalone (H. discus hannai)

Fig. 4. Effects of stocking density on the shell-length (A) and body-weight (B) specific growth
rate of juvenile abalone (H. discus hannai). Values are expressed as mean ± SE (n = 4). Statistical
analysis was performed by one-way analysis of variance (ANOVA) followed by Turkey’s test,
using SPSS version 18.0. Means with the different lower case letters are significantly different at
P < 0.05 level.
ACCEPTED MANUSCRIPT

PT
RI
SC
NU
Fig. 5. Effects of stocking density on the food intake of juvenile abalone (H. discus hannai).
Values are expressed as mean ± SE (n = 4). Statistical analysis was performed by one-way
analysis of variance (ANOVA) followed by Turkey’s test, using SPSS version 18.0. Means with
MA

the different lower case letters are significantly different at P < 0.05 level.
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

PT
RI
SC
NU
Fig. 6. Effects of stocking density on the food conversion efficiency of juvenile abalone (H. discus
hannai). Values are expressed as mean ± SE (n = 4). Statistical analysis was performed by
one-way analysis of variance (ANOVA) followed by Turkey’s test, using SPSS version 18.0.
MA

Means with the different lower case letters are significantly different at P < 0.05 level.
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

PT
RI
SC
NU
Fig. 7. Relative mRNA expression levels of polysaccharide cleavage enzyme genes (a. Hdaly, b.
Hdamyl, c. Hdlam, d. Hdcel) and antioxidant enzyme genes (e. catalase, f. glutathione
S-transferase) in the hepatopancreas of abalone Haliotis discus hannai. Values are expressed as
MA

mean ± SE (n = 3). Statistical analysis was performed by one-way analysis of variance (ANOVA)
followed by Turkey’s test, using SPSS version 18.0. Means with different lower case letters are
significantly different at P < 0.05 level.
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

Table 1. Real-time quantitative PCR primers for polysaccharide cleavage enzyme genes and

antioxidant enzyme genes of Haliotis discus hannai.

Gene Sequence (5'-3') Size (bp) Reference

F: TGCCCCATCTCCGATCGAAT
Hdaly 132 Designed by author
R: GCAATACCGCCCTCTAGGC
F: GTTAACGACCTAAACTTGCCTAAC
Hdamyl 188 Designed by author
R: CAAGTCCCTGGGTCAACTTGCC

PT
F: TACCTGATTCCCGAATCCTTG
Hdlam 176 Designed by author
R: GCCCTTACCTTGTAAACTCCATTC
F: CAGCCGTTGATAAACTGGC

RI
Hdcel 159 Designed by author
R: GCACCGCAACAGCTTGGATCC
F: GCTGCGTTGGTTATCG

SC
β-Actin 151 Designed by author
R: GGTACTTGAGGGTGAGGA
F: ACTACCTGCAACTTCCCGTCAACT
CAT 124 Ekanayake et al. (2008)
R: AGGTTGTTGATCAGATGGTCCCGT
NU
F: GCGGAGATTGTGACGGAAA
Sigma-GST 163 Designed by author
R: GAGCAGCAAACAGGTCATCAAA
MA

Hdaly: alginate lyase, Hdamyl: alpha-amylase, Hdlam: β-1,3-glucanase, Hdcel: cellulase, Sigma-GST:

Sigma-glutathione-s-transferase, CAT: catalase.

F: Forward primer; R: Reverse primer.


E D
PT
CE
AC
ACCEPTED MANUSCRIPT

Table 2. Water quality parameters in different stocking density treatments.


Density (individual/m2)
Water quality indexes
600 1000 1500

Temperature (°C) 17.26 ± 0.02a 17.20 ± 0.02a 17.38 ± 0.01a

Salinity 29.12 ± 0.36a 29.29 ± 0.31a 29.34 ± 0.25a

pH 7.82 ± 0.02a 7.81 ± 0.01a 7.95 ± 0.03a

Dissolved oxygen (mg/L) 6.11 ± 0.05a 6.02 ± 0.02a 6.08 ± 0.03a

PT
Dissolved oxygen saturation (%) 89.37 ± 0.97a 85.16 ± 0.88a 87.50 ± 0.92a

Values are expressed as mean ± SE (n = 4). The different letters on the parameters in one row mean significant

RI
differences (P < 0.05); the same ones mean no significant differences (P > 0.05).

SC
NU
MA
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

Table 3. Effects of stocking density on the activity of digestive enzyme of juvenile abalone, H.

discus hannai

Variable
Density Time Pepsase (U/mg Lipase (U/g Cellulase (U/g Amylase (U/mg
prot) prot) prot) prot)
1/4/2016 3.92 ± 0.28a 0.15 ± 0.02a 5.95 ± 0.28a 7.28 ± 0.46a
600
1/5/2016 4.25 ± 0.36a 0.17 ± 0.01a 6.37 ± 0.42a 9.09 ± 0.63a
individuals/m2

PT
1/6/2016 4.08 ± 0.21a 0.15 ± 0.01a 6.16 ± 0.23a 12.55 ± 0.41a

1/4/2016 3.68 ± 0.29a 0.11 ± 0.01a 6.02 ± 0.57a 6.02 ± 0.38a


1000

RI
1/5/2016 3.22 ± 0.17a 0.13 ± 0.02a 5.73 ± 0.34a 5.41 ± 0.57b
individuals/m2
1/6/2016 3.10 ± 0.33a 0.14 ± 0.02a 5.88 ± 0.39a 5.88 ± 0.29b

SC
1/4/2016 1.23 ± 0.19b 0.15 ± 0.02a 5.59 ± 0.46a 2.35 ± 0.26b
1500
1/5/2016 1.05 ± 0.11b 0.13 ± 0.01a 4.21 ± 0.25b 2.18 ± 0.33c
individuals/m2
1.01 ± 0.16b 0.17 ± 0.03a 3.39 ± 0.31b 1.86 ± 0.21c
NU
1/6/2016

Values are expressed as mean ± s.e. (n = 4). Different small letters indicate significant differences

in activity of digestive enzyme for the same time points in different stocking density treatments, P
MA

< 0.05.
E D
PT
CE
AC
ACCEPTED MANUSCRIPT

Table 4. Mean biochemical content of juvenile abalone (H. discus hannai), reared under

three different stocking densities

Variable

Density Time Lactic acid


Tissue Protein (%
Ash Lipid content
moisture (%) DTW)
(mmol/g prot)

PT
a a a a
1/4/2016 80.25 ± 1.33 28.09 ± 2.07 27.36 ± 0.95 2.95 ± 0.17 0.19 ± 0.03b
600
1/5/2016 83.07 ± 2.11b 30.15 ± 1.68a 28.91 ± 1.34a 2.77 ± 0.25a 0.22 ± 0.05b
individuals/m2
81.98 ± 1.59b 32.22 ± 1.24a 27.02 ± 1.83a

RI
1/6/2016 2.63 ± 0.14a 0.24 ± 0.02b

1/4/2016 82.74 ± 2.26a 29.09 ± 2.54a 27.51 ± 2.24a 2.43 ± 0.32a 0.22 ± 0.02b
1000

SC
1/5/2016 81.32 ± 1.77b 25.33 ± 1.38ab 25.09 ± 1.91ab 2.29 ± 0.24ab 0.28 ± 0.06b
individuals/m2
1/6/2016 84.69 ± 2.38ab 24.02 ± 2.41b 25.76 ± 2.02a 2.21 ± 0.19ab 0.27 ± 0.02b

1/4/2016 83.29 ± 1.98a 21.77 ± 1.46b 25.96 ± 1.67a 1.56 ± 0.20b 0.41 ± 0.06a
NU
1500
1/5/2016 86.35 ± 1.46a 20.89 ± 3.13b 23.29 ± 0.93b 1.72 ± 0.28b 0.38 ± 0.03a
individuals/m2
1/6/2016 88.43 ± 2.19a 17.06 ± 1.20c 21.49 ± 2.15b 1.70 ± 0.30b 0.48 ± 0.04a
MA

Values are expressed as mean ± s.e. (n = 4). Different small letters indicate significant differences

in mean biochemical content for the same time points in different stocking density treatments, P <

0.05.
E D
PT
CE
AC

34
ACCEPTED MANUSCRIPT

Highlight

1. The differences in growth and food intake of H. d. hannai Ino cultured at different
stocking densities were initially analyzed using molecular biological methods;

2. This experiment was carried out in a proprietary multi-layer and cubic RAS, where

PT
the environmental factors were stable and controllable;

RI
3. Although food was readily available in this study, abalones had to first search for
food and then spend time feeding and ingesting it. For some individuals, such as those

SC
in the corners of the tank or under a stack of other abalones, access to food was
restricted. Moreover, extra energy expenditure was required to resist oxidative
NU
damage. These were the main reasons for the observed slow down of abalone growth
and the increased mortality rate observed in this study.
MA
E D
PT
CE
AC

35