2018 Book PlantCellCultureProtocols

Methods in
Molecular Biology 1815
Victor M. Loyola-Vargas
Neftalí Ochoa-Alejo Editors
Plant Cell
Culture
Protocols
Fourth Edition
Methods in M o l e c u l a r B i o lo g y
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Plant Cell Culture Protocols
Fourth Edition
Edited by
Víctor M. Loyola-Vargas
Unidad de Bioquímica y Biología Molecular de Plantas, Centro de Investigación Científica de Yucatán,
Mérida, Yucatán, Mexico
Neftalí Ochoa-Alejo
Departamento de Ingeniería Genética, Unidad Irapuato, Centro de Investigación y de Estudios Avanzados
del Instituto Politécnico Nacional, Irapuato, Guanajuato, Mexico
Editors
Víctor M. Loyola-Vargas Neftalí Ochoa-Alejo
Unidad de Bioquímica y Biología Departamento de Ingeniería Genética
Molecular de Plantas Unidad Irapuato
Centro de Investigación Científica de Yucatán Centro de Investigación y de Estudios Avanzados
Mérida, Yucatán, Mexico del Instituto Politécnico Nacional
Irapuato, Guanajuato, Mexico
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-8593-7 ISBN 978-1-4939-8594-4 (eBook)
https://doi.org/10.1007/978-1-4939-8594-4
Library of Congress Control Number: 2018945533
© Springer Science+Business Media, LLC, part of Springer Nature 2018

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed
to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Printed on acid-free paper
This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
Plant cell, tissue, and organ culture techniques have been utilized for a long time and surely
will continue to be important biological systems for a series of basic studies and also as
biotechnological tools for clonal propagation of plants, for crop improvement programs,
and for genetic manipulation of important crop species through genetic engineering or by
genomic editing approaches.
New avenues and possibilities for plant cell, tissue, and organ culture have been
incorporated to enrich this fourth edition of Plant Cell Culture Protocols composed of 34
chapters dealing with a series of basic auxiliary protocols for tissue culture (confocal
microscopy for immunolocalization of auxins, histological techniques and photographic
analysis to follow morphogenetic events, and cytometry applied to the analysis of
regenerated plants). A micropropagation chapter in the twenty-first century describing its
importance, limitations, challenges, and possible solutions provides the reader with new
horizons and perspectives, and also a collection of protocols for the micropropagation and
embryo rescue of Agave spp., the conditions for the clonal propagation of Yucca spp., and
the somatic embryogenesis- mediated plant regeneration systems for Cocos nucifera,
Phaseolus vulgaris, Musa spp., Theobroma cacao, Quercus, and Jatropha curcas form part of
the content of this volume.
One of the most frequently faced problems in tissue culture is microbial contamination,
and for many years it was thought that only those microorganisms present in the surface of
the explants were important; however, endophytic bacteria very often can affect the
establishment and the responses of cell, tissue, or organ cultures; because of the importance
of endophytes, a description and identification of some commonly found endophytic
bacteria as well as some of the effects caused by them and how to control this problem is
provided in the current edition.
Somaclonal variation is still an interesting issue and a protocol for the selection of
molecular markers to estimate somaclonal variation in cell and tissue cultures is now
presented here.
Elimination of plant viruses through meristem isolation and subsequent culture or the
use of thermotherapy combined with meristem culture are the regular methods to get
virus-free plant materials of high phytosanitary quality; however, a protocol using
cryotherapy represents a new alternative for this purpose and is integrated here.
The production of haploid and doubled haploid plant production of carrot using
induced parthenogenesis and ovule excision can be used for both basic and applied crop
improvement programs.
Conservation of germplasm of important crops has been always an issue of primary
interest due to the potential utilization of genetic variation for crop improvement p
rograms;
therefore, protocols for the cryopreservation of pollen grains from pineapple and other
bromeliads were considered as a part of the strategies for the preservation of germplasm of
these plant species.
v
vi Preface
Plant cell, tissue, and organ culture are used as systems to study the potential of d
ifferent
plant species to produce secondary metabolites; this is the case of the chili pepper (Capsicum
chinense) protocol for the establishment of cell suspensions and immobilized placenta
tissues, which are used as models to investigate the production of capsaicinoids, compounds
responsible for the hot taste. Moreover, genetic transformation is certainly another tool of
great value for the genetic manipulation of agricultural crops, but also when the aim is to
carry out metabolic engineering of secondary metabolite pathways, such as the protocol for
the Agrobacterium tumefaciens-genetic transformation of the Mayan medicinal species
Pentalinon andrieuxii, which produces pentacyclic triterpenes with potential application in
the pharmaceutical industry.
In this fourth edition, a special focus was paid to the inclusion of protocols regarding
the omics (transcriptomics, proteomics, and metabolomics) applied to different aspects of
plant cell, tissue, and organ cultures. For example, protocols for the analysis of secondary
metabolites (terpenes, carotenoids, phytosterols) through NMR-based metabolomics of
Catharanthus roseus or hairy root cultures from several medicinal plants.
Of relevance in this volume are the protocols for the application of proteomics and
transcriptomics to study somatic embryogenesis and morphogenesis processes. Moreover,
the participation of microRNAs and transcription factors as important actors in somatic
embryogenesis is also described. Epigenetic changes involving histone modifications and
changes in chromatin organization during biological processes can be analyzed using the
chromatin immunoprecipitation assay (Chip) protocol presented in the current edition.
Perhaps the most spectacular current tool for genomic editing is undoubtedly the CRISPR/
Cas9 technology, and a review on its use in plant tissue culture is reported.
Among the miscellaneous applications of cell culture, the readers can consult and f ollow
a protocol for the use of cell suspensions to test heavy metal toxicity and accumulation for
a possible phytoremediation alternative.
As in the previous editions of Plant Cell Culture Protocols, an Appendix of the
composition of the most commonly used plant cell, tissue, and organ culture media is
included.
We would like to thank all the authors for their enthusiasm and the time devoted to
prepare their chapters in which they are sharing the most invaluable richness: their
expertise.
Finally, we should make a special mention of gratitude to David Casey and John Walker,
who always supported and guided us during this editorial journey.
Mérida, Yucatán, Mexico Víctor M. Loyola-Vargas

Irapuato, Guanajuato, Mexico Neftalí Ochoa-Alejo
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
Part I Introduction
1 An Introduction to Plant Tissue Culture: Advances and Perspectives �� 3

Victor M. Loyola-Vargas and Neftalí Ochoa-Alejo
Part II Cell Culture the Fundaments
2 Micropropagation in the Twenty-First Century�� 17

Jean Carlos Cardoso, Lee Tseng Sheng Gerald, and Jaime A. Teixeira da Silva
3 Cellular and Morpho-histological Foundations of In Vitro
Plant Regeneration �� 47
Diego Ismael Rocha, Lorena Melo Vieira, Andréa Dias Koehler,
and Wagner Campos Otoni
4 Bacterial Endophytes in Plant Tissue Culture: Mode of Action, Detection,
and Control�� 69
Mona Quambusch and Traud Winkelmann
5 Digital Photography as a Tool of Research and Documentation in Plant
Tissue Culture�� 89
Victor Gaba, Yehudit Tam, Danny Shavit, and Benjamin Steinitz
6 Selection of Molecular Markers for the Estimation of Somaclonal Variation �� 103
Octavio Martínez
7 Plant Tissue Culture: A Battle Horse in the Genome Editing Using
CRISPR/Cas9�� 131
Víctor M. Loyola-Vargas and Randy N. Avilez-Montalvo
Part III Protocols
8 Micropropagation of Agave Species�� 151

Benjamín Rodríguez-Garay and José Manuel Rodríguez-Domínguez
9 Protocol for the Micropropagation of Coconut from Plumule Explants�� 161
Luis Sáenz, José Luis Chan, María Narvaez, and Carlos Oropeza
10 Micropropagation of Yucca Species �� 171
Yessica López-Ramírez, Alejandra Palomeque-Carlín,
Lucía Isabel Chávez Ortiz, Ma. de Lourdes de la Rosa-Carrillo,
and Eugenio Pérez-Molphe-Balch
vii
viii Contents
11 Auxin Immunolocalization in Coffea canephora Tissues �� 179

Ruth E. Márquez-López, Ángela Ku-González, Hugo A. Méndez-Hernández,
Rosa M. Galaz-Ávalos, and Víctor M. Loyola-Vargas
12 Somatic Embryogenesis in Common Bean Phaseolus vulgaris L.�� 189
José Luis Cabrera-Ponce, Itzel Anayetzi González-Gómez,
Claudia G. León-Ramírez, José A. Sánchez-Arreguín,
and Alba E. Jofre y Garfias
13 Induction of Somatic Embryogenesis in Jatropha curcas�� 207
Rosa M. Galaz-Ávalos, Heydi G. Martínez-Sánchez,
and Víctor M. Loyola-Vargas
14 In Vitro Proliferation of Female Buds for Induction of Somatic
Embryogenesis from False Horn Plantain (AAB, cv. Curraré)�� 215
Rosa Maria Escobedo-Gracia-Medrano, Carlos Iván Cruz-Cárdenas,
Lucila Aurelia Sánchez-Cach, José Roberto Ku-Cauich,
and Wilma Aracely González-Kantún
15 Somatic Embryogenesis in Theobroma cacao L.�� 227
Claudia Garcia, Jean-Philippe Marelli, Juan Carlos Motamayor,
and Cristiano Villela
16 Somatic Embryogenesis of Quercus suber L. From Immature
Zygotic Embryos�� 247
Pilar S. Testillano, Aránzazu Gómez-Garay, Beatriz Pintos,
and María C. Risueño
17 Cryotherapy: A Novel Method for Virus Eradication in Economically
Important Plant Species�� 257
Min-Rui Wang, Long Chen, Zhibo Zhang, Dag-Ragnar Blystad,
and Qiao-Chun Wang
18 Cryopreservation of Pineapple Shoot Tips by the Droplet
Vitrification Technique �� 269
Fernanda Vidigal Duarte Souza, Everton Hilo de Souza, Ergun Kaya,
Lívia de Jesus Vieira, and Ronilze Leite da Silva
19 Cryopreservation of Pollen Grains of Pineapple and Other Bromeliads�� 279
Fernanda Vidigal Duarte Souza, Everton Hilo de Souza,
and Ronilze Leite da Silva
20 Application of in Casa Pollination and Embryo Rescue Techniques
for Breeding of Agave Species �� 289
Benjamín Rodríguez-Garay, Sigifredo López-Díaz,
José Manuel Rodríguez-Domínguez, Antonia Gutiérrez-Mora,
and Ernesto Tapia-Campos
21 Haploid and Doubled Haploid Plant Production in Carrot Using
Induced Parthenogenesis and Ovule Excision In Vitro�� 301
Agnieszka Kiełkowska, Adela Adamus, and Rafal Baranski
22 Using Flow Cytometry Analysis in Plant Tissue Culture Derived Plants�� 317
Rosa María Escobedo-Gracia-Medrano, Martha Josefa Burgos-Tan,
José Roberto Ku-Cauich, and Adriana Quiroz-Moreno
Contents ix
23 Procedure for Estimating the Tolerance and Accumulation

of Heavy Metals Using Plant Cell Cultures �� 333
Antonio Bernabé-Antonio, Amalia Maldonado-Magaña,
María Elena Estrada-Zúñiga, Leticia Buendía-González,
and Francisco Cruz-Sosa
24 Proteomics as a Tool to Study Molecular Changes During
Plant Morphogenesis In Vitro�� 339
André Luis Wendt dos Santos, Ricardo Souza Reis, Angelo Schuabb Heringer,
Eny Iochevet Segal Floh, Claudete Santa-Catarina, and Vanildo Silveira
25 Proteomic Analysis of Non-model Plant Tissues Using Phenol Extraction,
Two-Dimensional Electrophoresis, and MALDI Mass Spectrometry �� 351
Petra Peharec Štefanić, Mario Cindrić, and Biljana Balen
26 Chromatin Immunoprecipitation (ChiP) Protocol for the Analysis of Gene
Regulation by Histone Modifications in Agave angustifolia Haw�� 371
Rosa Us-Camas and Clelia De-la-Peña
27 Transcription Factors: Their Role in the Regulation of Somatic
Embryogenesis in Theobroma cacao L. and Other Species�� 385
Claudia Garcia, Dahyana Britto, and Jean-Philippe Marelli
28 MicroRNA Expression and Regulation During Maize Somatic
Embryogenesis �� 397
Brenda Anabel López-Ruiz, Vasti Thamara Juárez-González,
Elva Carolina Chávez-Hernández, and Tzvetanka D. Dinkova
29 Elaboration of Transcriptome During the Induction of Somatic
Embryogenesis �� 411
Elsa Góngora-Castillo, Geovanny I. Nic-Can, Rosa M. Galaz-Ávalos,
30 Induction of Specialized Metabolism in In Vitro Cultures
of Capsicum chinense Jacq �� 429
Felipe A. Vázquez-Flota and María de Lourdes Miranda-Ham
31 Analysis of Terpenoid Indole Alkaloids, Carotenoids, Phytosterols,
and NMR-Based Metabolomics for Catharanthus roseus
Cell Suspension Cultures�� 437
Mohd Zuwairi Saiman, Natali Rianika Mustafa, and Robert Verpoorte
32 Transformed Root Culture: From Genetic Transformation
to NMR-Based Metabolomics�� 457
Andrey S. Marchev, Zhenya P. Yordanova, and Milen I. Georgiev
33 Genetic Transformation of Pentalinon andrieuxii Tissue Cultures�� 475
Yeseña Burgos-May, Elidé Avilés-Berzunza, Luis Manuel Peña-Rodríguez,
and Gregorio Godoy-Hernández
Appendix A: The Components of the Culture Media �� 493
Index �� 503

Contributors
Adela Adamus • Faculty of Biotechnology and Horticulture, Institute of Plant Biology and

Biotechnology, University of Agriculture, Krakow, Poland
Elidé Avilés-Berzunza • Unidad de Bioquímica y Biología Molecular de Plantas, Centro
de Investigación Científica de Yucatán, Mérida, Yucatán, Mexico
Randy N. Avilez-Montalvo • Unidad de Bioquímica y Biología Molecular de Plantas,
Centro de Investigación Científica de Yucatán, Mérida, Yucatán, Mexico
Biljana Balen • Faculty of Science, Division of Molecular Biology, Department of Biology,
University of Zagreb, Zagreb, Croatia
Rafal Baranski • Faculty of Biotechnology and Horticulture, Institute of Plant Biology
and Biotechnology, University of Agriculture, Krakow, Poland
Antonio Bernabé-Antonio • Departamento de Madera, Celulosa y Papel, Centro
Universitario de Ciencias Exactas e Ingenierías, Universidad de Guadalajara,
Guadalajara, Jalisco, Mexico
Dag-Ragnar Blystad • Division of Biotechnology and Plant Health, Norwegian Institute
of Bioeconomy Research, Ås, Norway
Dahyana Britto • Mars Center for Cocoa Science, Itajuípe, BA, Brazil
Leticia Buendía-González • Facultad de Ciencias, Universidad Autónoma del Estado
de México, Toluca, Estado de Mexico, Mexico
Yeseña Burgos-May • Unidad de Bioquímica y Biología Molecular de Plantas, Centro de
Investigación Científica de Yucatán, Mérida, Yucatán, Mexico
Martha Josefa Burgos-Tan • Unidad de Bioquímica y Biología Molecular de Plantas,
Centro de Investigación Científica de Yucatán A.C., Mérida, Yucatán, Mexico
José Luis Cabrera-Ponce • Departamento de Ingeniería Genética, Unidad Irapuato,
Centro de Investigación y de Estudios Avanzados del IPN, CP, Guanajuato, Mexico
Jean Carlos Cardoso • Laboratory of Plant Physiology and Tissue Culture, Department
of Biotechnology, Plant and Animal Production, Centro de Ciências Agrárias,
Universidade Federal de São Carlos, Araras, SP, Brazil
José Luis Chan • Unidad de Biotecnología, Centro de Investigación Científica de
Yucatán, Mérida, Yucatán, Mexico
Lucía Isabel Chávez Ortiz • Unidad de Biotecnología Vegetal, Centro de Ciencias
Básicas, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico
Elva Carolina Chávez-Hernández • Instituto de Ecología, Universidad Nacional
Autónoma de México, Ciudad de México, México
Long Chen • State Key Laboratory of Crop Stress Biology for Arid Areas, College of
Horticulture, Northwest A&F University, Yangling, Shaanxi, China
Mario Cindrić • Division of Molecular Medicine, Ruđer Bošković Institute, Zagreb,
Croatia
Carlos Iván Cruz-Cárdenas • Unidad de Bioquímica y Biología Molecular de Plantas,
Centro de Investigación Científica de Yucatán A.C., Mérida, Yucatán, Mexico; Centro
Nacional de Recursos Genéticos, Instituto Nacional de Investigaciones Forestales,
Agrícolas y Pecuarias (INIFAP), Tepatitlán de Morelos, Jalisco, Mexico
xi
xii Contributors
Francisco Cruz-Sosa • Departamento de Biotecnología, Universidad Autónoma

Metropolitana-Iztapalapa, Ciudad de Mexico, Mexico
Ma. de Lourdes de la Rosa-Carrillo • Unidad de Biotecnología Vegetal, Centro de
Ciencias Básicas, Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico
Clelia De-la-Peña • Unidad de Biotecnología, Centro de Investigación Científica de
Tzvetanka D. Dinkova • Facultad de Química, Departamento Bioquímica,
Universidad Nacional Autónoma de México, Ciudad de México, México
Rosa Maria Escobedo-Gracia-Medrano • Unidad de Bioquímica y Biología Molecular
de Plantas, Centro de Investigación Científica de Yucatán A.C., Mérida, Yucatán,
Mexico
María Elena Estrada-Zúñiga • Centro de Investigación en Recursos Bióticos-Facultad
de Ciencias, Universidad Autónoma del Estado de México, Toluca, Estado de Mexico,
Mexico
Victor Gaba • Department of Plant Pathology and Weed Science, Agricultural Research
Organization—The Volcani Center, Rishon LeZion, Israel
Rosa M. Galaz-Ávalos • Unidad de Bioquímica y Biología Molecular de Plantas, Centro
Claudia Garcia • Mars Center for Cocoa Science, Fazenda Almirante, Itajuípe, BA,
Brazil
Milen I. Georgiev • Group of Plant Cell Biotechnology and Metabolomics, The Stephan
Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, Plovdiv, Bulgaria
Gregorio Godoy-Hernández • Unidad de Bioquímica y Biología Molecular de Plantas,
Centro de Investigación Científica de Yucatán, Mérida, Yucatán, México
Aránzazu Gómez-Garay • Faculty of Biology, Department of Plant Biology I,
UCM, Madrid, Spain
Elsa Góngora-Castillo • CONACYT Research Fellow-Unidad de Biotecnología, Centro
Itzel Anayetzi González-Gómez • Departamento de Ingeniería Genética, Unidad
Irapuato, Centro de Investigación y de Estudios Avanzados del IPN, CP, Guanajuato,
Mexico
Wilma Aracely González-Kantún • Unidad de Bioquímica y Biología Molecular de
Plantas, Centro de Investigación Científica de Yucatán A.C., Mérida, Yucatán, Mexico
Antonia Gutiérrez-Mora • Unidad de Biotecnología Vegetal, Centro de Investigación y
Asistencia en Tecnología y Diseño del Estado de Jalisco, Zapopan, Jalisco, Mexico
Alba E. Jofre y Garfias • Departamento de Ingeniería Genética, Unidad Irapuato,
Vasti Thamara Juárez-González • Facultad de Química, Departamento Bioquímica,
Ergun Kaya • Department of Molecular Biology and Genetics, Faculty of Science Mugla
Sitki Kocman University Koteki, Koteki, Mugla, Turkey
Agnieszka Kiełkowska • Faculty of Biotechnology and Horticulture, Institute of Plant
Biology and Biotechnology, University of Agriculture, Krakow, Poland
Andréa Dias Koehler • Laboratório de Cultura de Tecidos—LCT, Instituto de
Biotecnologia Aplicada à Agropecuária-BIOAGRO/Departamento de Biologia Vegetal,
Campus Universitário, Universidade Federal de Viçosa, Viçosa, MG, Brazil
José Roberto Ku-Cauich • Unidad de Bioquímica y Biología Molecular de Plantas,
Centro de Investigación Científica de Yucatán A.C., Mérida, Yucatán, Mexico
Contributors xiii
Ángela Ku-González • Unidad de Bioquímica y Biología Molecular de Plantas, Centro

Claudia G. León-Ramírez • Departamento de Ingeniería Genética, Unidad Irapuato,
Sigifredo López-Díaz • Departamento de Investigacion, Centro Interdisciplinario de
Investigación para el Desarrollo Integral Regional Unidad, Michoacán-Instituto
Politécnico Nacional, Jiquilpan, Michoacán, Mexico
Yessica López-Ramírez • Unidad de Biotecnología Vegetal, Centro de Ciencias Básicas,
Universidad Autónoma de Aguascalientes, Aguascalientes, Mexico
Brenda Anabel López-Ruiz • Facultad de Química, Departamento Bioquímica,
Victor M. Loyola-Vargas • Unidad de Bioquímica y Biología Molecular de Plantas,
Amalia Maldonado-Magaña • Centro de Investigaciones Químicas, Universidad
Autónoma del Estado de Morelos, Cuernavaca, Estado de Morelos, Mexico
Andrey S. Marchev • Group of Plant Cell Biotechnology and Metabolomics, The Stephan
Angeloff Institute of Microbiology, Bulgarian Academy of Sciences, Plovdiv, Bulgaria
Jean-Philippe Marelli • Mars Center for Cocoa Science, Fazenda Almirante, Itajuípe,
BA, Brazil
Ruth E. Márquez-López • Unidad de Bioquímica y Biología Molecular de Plantas,
Octavio Martínez • Unidad de Genómica Avanzada (Langebio), Centro de
Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav),
Guanajuato, México
Heydi G. Martínez-Sánchez • Unidad de Bioquímica y Biología Molecular de Plantas,
Hugo A. Méndez-Hernández • Unidad de Bioquímica y Biología Molecular de Plantas,
María de Lourdes Miranda-Ham • Unidad de Bioquímica y Biología Molecular de
Plantas, Centro de Investigación Científica de Yucatán, Mérida, Yucatán, Mexico
Juan Carlos Motamayor • Mars Center for Cocoa Science, Fazenda Almirante, Itajuípe,
BA, Brazil
Natali Rianika Mustafa • Natural Products Laboratory, Institute of Biology, Leiden
University, Leiden, The Netherlands
María Narvaez • Unidad de Biotecnología, Centro de Investigación Científica de
Geovanny I. Nic-Can • CONACYT Research Fellow-Campus de Ciencias Exactas e
Ingeniería, Universidad Autónoma de Yucatán, Mérida, Yucatán, Mexico
Neftalí Ochoa-Alejo • Departamento de Ingeniería Genética, Unidad Irapuato,
Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional,
Irapuato, Guanajuato, Mexico
Carlos Oropeza • Unidad de Biotecnología, Centro de Investigación Científica de
Wagner Campos Otoni • Laboratório de Cultura de Tecidos—LCT, Instituto de
Alejandra Palomeque-Carlín • Unidad de Biotecnología Vegetal, Centro de Ciencias
xiv Contributors
Petra Peharec Štefanić • Faculty of Science, Division of Molecular Biology, Department

of Biology, University of Zagreb, Zagreb, Croatia
Luis Manuel Peña-Rodríguez • Unidad de Biotecnología, Centro de Investigación
Científica de Yucatán, Mérida, Yucatán, Mexico
Eugenio Pérez-Molphe-Balch • Unidad de Biotecnología Vegetal, Centro de Ciencias
Beatriz Pintos • Pollen Biotechnology of Crop Plants, Biological Research Centre, Madrid,
Spain
Mona Quambusch • Abteilung Waldgenressourcen, Nordwestdeutsche Forstliche
Versuchsanstalt, Hann. Münden, Germany
Adriana Quiroz-Moreno • Unidad de Biotecnología, Centro de Investigación Científica
de Yucatán A.C., Mérida, Yucatán, Mexico
María C. Risueño • Pollen Biotechnology of Crop Plants, Biological Research Centre,
Madrid, Spain
Diego Ismael Rocha • Instituto de Biociências, Universidade Federal de Goiás, Jataí,
GO, Brazil
José Manuel Rodríguez-Domínguez • Unidad de Biotecnología Vegetal, Centro de
Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco, Zapopan, Jalisco,
Mexico
Benjamín Rodríguez-Garay • Unidad de Biotecnología Vegetal, Centro de Investigación
y Asistencia en Tecnología y Diseño del Estado de Jalisco, Zapopan, Jalisco, Mexico
Luis Sáenz • Unidad de Biotecnología, Centro de Investigación Científica de Yucatán,
Mérida, Yucatán, Mexico
Mohd Zuwairi Saiman • Faculty of Science, Institute of Biological Sciences, University of
Malaya, Kuala Lumpur, Malaysia; Centre for Research in Biotechnology for Agriculture
(CEBAR), University of Malaya, Kuala Lumpur, Malaysia; Natural Products
Laboratory, Institute of Biology, Leiden University, Leiden, The Netherlands
José A. Sánchez-Arreguín • Departamento de Ingeniería Genética, Unidad Irapuato,
Lucila Aurelia Sánchez-Cach • Unidad de Bioquímica y Biología Molecular de
Plantas, Centro de Investigación Científica de Yucatán A.C., Mérida, Yucatán, Mexico
Claudete Santa-Catarina • Laboratório de Biologia Celular e Tecidual, CBB, UENF,
Campos dos Goytacazes, RJ, Brazil
Angelo Schuabb Heringer • Laboratório de Biotecnologia, Centro de Biociências e
Biotecnologia (CBB), Universidade Estadual do Norte Fluminense Darcy Ribeiro
(UENF), Campos dos Goytacazes, RJ, Brazil; Unidade de Biologia Integrativa, Setor de
Genômica e Proteômica, UENF, Campos dos Goytacazes, RJ, Brazil
Eny Iochevet Segal Floh • Laboratory of Plant Cell Biology, Department of Botany,
Institute of Biosciences, University of São Paulo, São Paulo, Brazil
Danny Shavit • Shavit Professional Scientific Photography, Kfar Saba, Israel
Lee Tseng Sheng Gerald • Laboratory of Plant Physiology and Tissue Culture,
Department of Biotechnology, Plant and Animal Production, Centro de Ciências
Agrárias, Universidade Federal de São Carlos, Araras, SP, Brazil
Ronilze Leite da Silva • State University of Feira de Santana (UEFS), Feira de
Santana, Bahia, Brazil
Vanildo Silveira • Laboratório de Biotecnologia, Centro de Biociências e Biotecnologia
(CBB), Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos
dos Goytacazes, RJ, Brazil; Unidade de Biologia Integrativa, Setor de Genômica e
Proteômica, UENF, Campos dos Goytacazes, RJ, Brazil
Contributors xv
Ricardo Souza Reis • Laboratório de Biotecnologia, Centro de Biociências e Biotecnologia

(CBB), Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos
dos Goytacazes, RJ, Brazil; Unidade de Biologia Integrativa, Setor de Genômica e
Proteômica, UENF, Campos dos Goytacazes, RJ, Brazil
Everton Hilo de Souza • Federal University of Recôncavo da Bahia (UFRB), Cruz das
Almas, Bahia, Brazil; Scholarship of Coordination for the Improvement of Higher
Education Personnel (CAPES) at CAPES-EMBRAPA Program in Embrapa Cassava
and Fruits (CNPMF), Cruz das Almas, Bahia, Brazil
Fernanda Vidigal Duarte Souza • Embrapa Cassava and Fruits, Cruz das Almas,
Bahia, Brazil; Federal University of Recôncavo da Bahia (UFRB), Cruz das Almas,
Bahia, Brazil
Benjamin Steinitz • Institute of Plant Sciences, Agricultural Research Organization—
The Volcani Center, Rishon LeZion, Israel
Yehudit Tam • Department of Plant Pathology and Weed Science, Agricultural Research
Organization—The Volcani Center, Rishon LeZion, Israel
Ernesto Tapia-Campos • Unidad de Biotecnología Vegetal, Centro de Investigación y
Asistencia en Tecnología y Diseño del Estado de Jalisco, Zapopan, Jalisco, Mexico
Jaime A. Teixeira da Silva • Kagawa, Japan
Pilar S. Testillano • Pollen Biotechnology of Crop Plants, Biological Research Centre,
Madrid, Spain
Rosa Us-Camas • Unidad de Biotecnología, Centro de Investigación Científica de
Felipe A. Vázquez-Flota • Unidad de Bioquímica y Biología Molecular de Plantas,
Robert Verpoorte • Natural Products Laboratory, Institute of Biology, Leiden
University, Leiden, The Netherlands
Lívia de Jesus Vieira • Scholarship of Coordination for the Improvement of Higher
Education Personnel (CAPES) at CAPES-EMBRAPA Program in Embrapa Cassava
and Fruits (CNPMF), Cruz das Almas, Bahia, Brazil
Lorena Melo Vieira • Laboratório de Cultura de Tecidos—LCT, Instituto de
Cristiano Villela • Mars Center for Cocoa Science, Fazenda Almirante, Itajuípe, BA,
Brazil
Min-Rui Wang • State Key Laboratory of Crop Stress Biology for Arid Areas, College of
Horticulture, Northwest A&F University, Yangling, Shaanxi, China; Division of
Biotechnology and Plant Health, Norwegian Institute of Bioeconomy Research, Ås,
Norway
Qiao-Chun Wang • State Key Laboratory of Crop Stress Biology for Arid Areas, College of
Horticulture, Northwest A&F University, Yangling, Shaanxi, China
André Luis Wendt dos Santos • Laboratory of Plant Cell Biology, Department of
Botany, Institute of Biosciences, University of São Paulo, São Paulo, Brazil
Traud Winkelmann • Institut für Gartenbauliche Produktionssysteme,
Leibniz Universität Hannover, Hannover, Germany
Zhenya P. Yordanova • Faculty of Biology, Department of Plant Physiology,
Sofia University “St. Kliment Ohridski”, Sofia, Bulgaria
Zhibo Zhang • Division of Biotechnology and Plant Health, Norwegian Institute of
Bioeconomy Research, Ås, Norway
Part I
Introduction
Chapter 1
An Introduction to Plant Tissue Culture: Advances

and Perspectives
Victor M. Loyola-Vargas and Neftalí Ochoa-Alejo
Abstract
Plant tissue culture techniques are the most frequently used biotechnological tools for basic and applied
purposes ranging from investigation on plant developmental processes, functional gene studies, commer-
cial plant micropropagation, generation of transgenic plants with specific industrial and agronomical traits,
plant breeding and crop improvement, virus elimination from infected materials to render high-quality
healthy plant material, preservation and conservation of germplasm of vegetative propagated plant crops,
and rescue of threatened or endangered plant species. Additionally, plant cell and organ cultures are of
interest for the production of secondary metabolites of industrial and pharmaceutical interest. New tech-
nologies, such as the genome editing ones combined with tissue culture and Agrobacterium tumefaciens
infection, are currently promising alternatives for the highly specific genetic manipulation of interesting
agronomical or industrial traits in crop plants. Application of omics (genomics, transcriptomics, and pro-
teomics) to plant tissue culture will certainly help to unravel complex developmental processes such as
organogenesis and somatic embryogenesis, which will probably enable to improve the efficiency of regen-
eration protocols for recalcitrant species. Additionally, metabolomics applied to tissue culture will facilitate
the extraction and characterization of complex mixtures of natural plant products of industrial interest.
General and specific aspects and applications of plant tissue culture and the advances and perspectives are
described in this edition.
Key words Aseptic culture, Genetic modified organisms, Large-scale propagation, Metabolic engi-
neering, Plant cell culture, Proteomics, Transcriptomics
1 Introduction
Plant tissue culture is a broad term that refers to the culture of any
part of a plant (cells, tissues, or organs) in artificial media, in aseptic
conditions, and under controlled environments. This set of tech-
niques emerged as an experimental approach to demonstrate the
cell theory, which establishes that all living organisms are consti-
tuted of cells, the basic units of structure and reproduction, and also
the totipotency concept, which is defined as the genetic potential of
a cell to generate an entire multicellular organism [1]. Different
attempts were conducted by several researchers to investigate the
Víctor M. Loyola-Vargas and Neftalí Ochoa-Alejo (eds.), Plant Cell Culture Protocols, Methods in Molecular Biology, vol. 1815,
https://doi.org/10.1007/978-1-4939-8594-4_1, © Springer Science+Business Media, LLC, part of Springer Nature 2018
3
4 Victor M. Loyola-Vargas and Neftalí Ochoa-Alejo
conditions to initially achieve the growth of organs [2] or tissues

[3] in an artificial nutrient culture medium [4] rather than isolated
cells because of the complex nutritional and hormonal require-
ments they need. Nutrient solutions alone or supplemented with
natural extracts were used as starting culture media, and some
important results were reported [5]; however, the discovery of
plant growth regulators was determinant for the successful estab-
lishment of in vitro plant tissue cultures [6, 7]. A key advance in
plant tissue culture was the control of morphogenesis by using dif-
ferent levels and combinations of growth regulators [8], because
this allowed the regeneration of entire plants, opening the possibil-
ity of using in vitro systems to study fundamental aspects of cell
differentiation and development, and also for the application of tis-
sue culture for different purposes. Some other relevant advances in
plant tissue culture were the culture of meristems as a tool for get-
ting virus-free plants [9]; the demonstration of totipotency in hap-
loid or gametophyte cells, which made possible the faster generation
of isogenic lines important for plant breeding programs [10, 11];
the rescue of hybrid embryos to overcome sexual incompatibility
between plant species [12]; the enzymatic degradation of cell walls
of plant cells to produce protoplasts and the fusion of these naked
cells to eliminate sexual barriers between different plant species to
render intraspecific or interspecific somatic hybrids [13, 14]; and
the production of secondary compounds using cell or organ cul-
tures [15], and perhaps the most relevant advance in plant tissue
culture was the development and establishment of genetic transfor-
mation systems by Agrobacterium tumefaciens infection and
through particle bombardment to allow the genetic manipulation
of plant species [16] (Fig. 1).
2 Basic Principles of Cell, Tissue, and Organ Culture
Anyone who wishes to start plant tissue cultures should have in

mind the following basic principles: (1) select an appropriate
explant from a healthy and vigorous plant, (2) eliminate microbial
contamination from the surface of the explant, (3) inoculate the
explant in an adequate culture medium, and (4) provide the explant
in culture with the proper controlled environmental conditions. In
the case of in vitro regenerated plants, they are subjected to an
adaptation process (acclimatization) in the greenhouse before the
transference to ex vitro conditions.
Depending on the part of the plant that is cultured, we can
refer them as cell culture (gametic cells, cell suspension, and proto-
plast culture), tissue culture (callus and differentiated tissues), and
organ culture (any organ such as zygotic embryos, roots, shoots,
and anthers, among others). Each type of culture is used for differ-
ent basic and biotechnological applications.
Plant Tissue Culture Introduction 5
Fig. 1 (a) Mixotrophic callus from Catharanthus roseus. (b) Heterotrophic callus from Catharanthus roseus. (c)
Suspension culture from Catharanthus roseus. (d) Regeneration of Catharanthus roseus plants from callus. (e)
Root culture from Catharanthus roseus. (f) Somatic embryogenesis in Coffea canephora. (g) Protoplast from
Coffea canephora. (h) Micropropagation of Agave fourcroydes. Pictures a, b, c, d, e, f, and g are from the
authors’ laboratories. Picture h is a gift from the laboratory of Dr. Clelia De la Peña, from Centro de Investigación
Científica de Yucatán
3 Micropropagation
Undoubtedly, micropropagation or in vitro clonal propagation is

one of the most current extended commercial applications of tissue
culture (see Chapters 2, 8, and 10). Plant tissue culture is an excel-
lent tool for the asexual multiplication of those species that are
naturally reproduced asexually, but it is also used to overcome
some problems of germination of seeds in different plant species;
for example, recalcitrant species are particularly characterized for
their short-seed viability (recalcitrant seeds), and therefore, asexual
multiplication is a good alternative. Although tissue culture can be
applied for the micropropagation of almost any plant species, it is

recommended only for those that are economically profitable.
Among the plant species that are currently micropropagated at the
commercial level, the ornamentals occupy the first place.
Micropropagation of plants may be carried out through three dif-
ferent ways: (1) by promoting the proliferation of apical or axillary
buds and then rooting them, (2) by inducing adventitious bud
formation and its further rooting (see Chapters 2 and 3), and (3)
by somatic embryo formation, maturation, and germination (see
Chapters 9, 12, 13, 14, 15, and 16). Each alternative can be applied
to several plant species at different efficiencies depending on the
genetic background or regeneration capacity, the culture media,
and the incubation conditions.
4 Plant Breeding and Genetic Improvement
Plant tissue techniques can be certainly powerful auxiliary tools for

plant breeding and genetic improvement programs. Genetic vari-
ability detected in callus tissue and cell cultures can be due to
genetic or epigenetic changes and represents an important possi-
bility for recovering somaclonal variants or mutants with specific
agronomic or industrial characteristics that can be exhibited at the
cell or plant level [17]. Thousands or millions of cells constitute a
piece of callus or a cell suspension, and they can be subjected to a
selective pressure of different kinds of stresses to isolate resistant
cells under controlled conditions. The recovered resistant cells may
regenerate the entire resistant plants when cultured in adequate
media. In this way, it is possible to generate plants resistant to
drought, salinity, and cold or to biotic stress that affects crop yield
[18]. A novel protocol for the estimation of somaclonal variation
using molecular markers is described in Chapter 6.
Isogenic or homozygous plants are important materials for
breeding programs since they are used as parental lines to generate
hybrid seeds, which when they raise plants, they have high yields.
However, the generation of isogenic or homozygous lines can take
five to ten cycles of self-fertilization by the traditional breeding
techniques. By using microspore or anther culture, the time to
produce isogenic lines may be reduced dramatically, because hap-
loid plants can be regenerated in just one cycle of culture and then
they can be diploidized by a colchicine treatment to get double-
haploid plants with fixed homozygous sets of chromosomes [19,
20] (see Chapter 21). Anther or microspore culture can be also
used to fix the characteristics of hybrid plants generated by parental
crosses and conventional techniques.
Embryo rescue and culture allow the recovery of hybrid plants
from partially sexual compatible species. After cross-pollination between
two different species, the development of the hybrid embryo occurs,
but the endosperm not necessarily accompanies the whole process of

seed development, and at certain step, the hybrid embryo aborts; it is in
that moment that the embryo can be rescued and cultured for further
development [21, 22] (see Chapter 20).
Intra- or interspecific hybrid plants can be also generated in
sexual incompatible plant species through somatic hybridization
using protoplasts from two different sources, which are fused by
physicochemical methods. The hybrid cells are cultured to regen-
erate hybrid plants. Different somatic hybrid plants have been gen-
erated and described in the literature [23–27].
5 Genetic Engineering
Plant genetic engineering is possible thanks to the use of plant tissue

culture systems combined with recombinant molecular biology tech-
niques. The goal of plant genetic engineering is to manipulate genetic
material from different organisms in such a way to have specific
sequences coding for specific genes that confer particular characteris-
tics when they are introduced and integrated into a plant genome.
Once a gene of interest is isolated, a construct is prepared in an
appropriate vector to carry out the genetic transformation using
either biological (Agrobacterium tumefaciens-mediated infection)
(see Chapter 33) or physical methods (usually microparticle bom-
bardment). Genetic transformation has been achieved with impor-
tant crops such as corn, wheat, cotton, rice and soybean, among
others, and millions of hectares are currently planted with transgenic
crops resistant to pests [28] or herbicides [29]. A reduction in the
applications of toxic insecticides (organophosphorus insecticides) to
control several pests is expected with the use of transgenic plants
resistant to insects. Besides biotic factors, crop production and yield
are much more frequently affected by abiotic factors (water stress,
salinity, and cold, among others). Plants have evolved adaptation
mechanisms to abiotic factors, but, in general, they are quite complex
because they involve physiological, biochemical, and molecular pro-
cesses. However, transgenic resistant plant crops to drought or salin-
ity have been already generated [30–34], opening new opportunities
of manipulation of complex abiotic resistant traits to cope with differ-
ent environmental stresses. Genetic transformation has been also a
powerful approach in basic science to carry out functional studies of
plant genes (see Chapter 33).
6 Genome Editing
In the last decade, different genome editing techniques based on

the use of sequence-specific nucleases have allowed precise manip-
ulation of target genomic sequences opening the possibility of
creating specific desirable mutations [35, 36]. Genome editing

technology combined with plant tissue culture and genetic trans-
formation has started to revolutionize the breeding and improve-
ment programs of several crops. One of these technologies involves
the CRISPR/Cas9 genome editing system [37–39]. Comparatively
with genetic transformation, genomic editing technologies do not
imply the use of foreign DNA to make a genetic change in the
receptor plant, but the genetic change is carried out in the own
genome of the plant species to be genetically modified [40]. A
review of this novelty technology is described in Chapter 7.
Examples of successful genetically edited modified plants using
CRISPR/Cas9 include important crops such as rice [41, 42],
wheat [43], corn [44], tomato [45], and potato [46], among oth-
ers. Genome editing systems are also currently of high value for
functional gene studies [47, 48].
7 Omics and Plant Tissue Culture
Genomics (the study of gene structure, function and regulation,

and related techniques), transcriptomics (the study of the tran-
scriptome or the set of genes that are transcribed in an organism),
proteomics (the study of the set of proteins translated in an organ-
ism), and metabolomics (the study of all metabolites present in an
organism) have become essential for the study of biological pro-
cesses in plants. The knowledge on plant genomes, transcriptomes,
proteomes, and metabolomes has impacted favorably in the com-
prehension of complex developmental processes, such as in vitro
organogenesis, embryogenesis, or dedifferentiation, and the
genetic changes induced during in vitro conditions [49–51] (see
Chapters 24, 25, and 29). Additionally, metabolomics can be very
useful to investigate secondary metabolism not only during mor-
phogenetic processes but mainly in cell, tissue, and organ cultures
of plant species producing secondary metabolites of industrial and
pharmaceutical interest [52, 53] (see Chapter 32).
8 Epigenetics in Plant Tissue Culture
Epigenetic changes (heritable changes in gene function that do not

involve changes in the DNA sequence) affecting in vitro plant
regeneration and also explaining the variation frequently observed
in either cells or regenerated plants have been reported [54–61].
Due to the impact of these epigenetic changes on tissue cultures, it
was considered convenient to include in this edition protocols
regarding the analysis of histone modifications and gene regulation
(see Chapter 26).
9 Preservation and Conservation of Plant Germplasm
Plant germplasms are the genetic resources that are collected and
conserved for plant breeding and crop improvement programs,
and they represent really true preserved treasures of genetic vari-
ability from which plant breeders start looking for specific desirable
characteristics to be selected to increase the yield of crops. Plant
germplasm of important crops such as corn and wheat are main-
tained as seed collections under low temperatures at the Centro
Internacional de Mejoramiento de Maíz y Trigo (International
Maize and Wheat Improvement Center; CIMMYT) in México,
whereas rice germplasm is concentrated at the International Rice
Research Institute (IRRI) in the Philippines. Plant germplasms of
vegetatively propagated crops such as potato (Solanum tuberosum
L.) and sweet potato (Ipomoea batatas L.) are preserved in the
form of tubercles or under tissue culture conditions at the Centro
Internacional de la Papa (International Potato Center; IPC) in
Peru. Plant tissue culture offers excellent alternatives for the con-
servation of germplasm of those crops that are vegetatively propa-
gated since thousands of plantlets may be conserved in small spaces
under controlled conditions that can reduce the growth of cultures
(minimum growth) or can even stop completely their growth
(cryopreservation). Cryopreservation protocols for shoot tips of
pineapple and pollen of bromeliads are described in Chapters 18
and 19.
10 Future Perspectives
Plant cell, tissue, and organ cultures have been applied to a range of
different purposes including micropropagation, which is the most
extended and successful application at commercial level and surely
will continue in the future, and genetic engineering of important
crops to confer tolerance mainly to pests and herbicides enabling the
increase in production and yield with less applications of toxic insec-
ticides and herbicides in millions of hectares worldwide. A significant
impact is predicted in the production of different transgenic crops
resistant or tolerant to drought, salinity, or cold under these stress
conditions in the near future. Additionally, genetic transformation
will be certainly a strategic tool for facing the global warming and its
consequences by generating transgenic plants resistant to abiotic fac-
tors. Genetic engineering is still expected to contribute to the devel-
opment of transgenic crops with increased nutritional or nutraceutical
value or resistant to diseases caused by fungi, bacteria, or viruses.
Plant metabolic engineering contribution to the development of
more metabolically efficient crops [62, 63] or with modified bio-
chemical pathway leading to the production of commercial secondary
metabolites has been slow and modest, but it should have great
promise to regulate the biosynthesis of target diverse secondary
metabolites of industrial and pharmaceutical interest [64, 65]. Much
more difficult is to evaluate quantitatively the impact that tissue cul-
ture has had or will have on plant breeding and crop improvement
using embryo rescue, double-haploid generation, or somatic hybrid-
ization, but of course they will be contributing to get improved
hybrid crops to increase productivity. Somaclonal variation in tissue
cultures has been employed to rescue or recover interesting materials
that have led to the generation of new varieties [66] and undoubtedly
will continue to be applied in the future for the isolation of soma-
clones bearing polygenic novel traits in which the mechanisms under-
lying complex agronomical characteristics are unknown.
Genome editing techniques have opened a new and wide ave-
nue for the second green revolution and certainly will allow the
creation of new and novel plant varieties with useful agronomic
traits through the fine manipulation of specific genetic changes in
important crop species [67]. The development of high-throughput
genome and transcriptome sequencing techniques, the application
of protein separation and sequencing, and the improvement of
extraction, separation, and identification of metabolites, as well as
the availability of data in public databases, have helped to decipher
genome organization, gene function and regulation, and predic-
tion of protein function and to know the set of metabolites pro-
duced in different plant species. Omics have therefore become
fundamental tools for the study of basic biological processes in
plants. Integration of omics is desirable for a better understanding
of whole biological phenomena. It is evident that omics will be of
great benefit to investigate in vitro morphogenetic processes and
should facilitate the establishment of more efficient in vitro plant
regeneration protocols if master control genes of differentiation
and development are identified and characterized. On the other
hand, the combination of different omics should enable the
metabolic engineering of interesting biochemical pathways in

order to manipulate specific characteristics for the optimization
and production of secondary metabolites of industrial and pharma-
ceutical importance.
References
1. Haberlandt G (1902) Kulturversuche mit iso- 4. White PR (1939) Potentially unlimited growth
lierten pflanzenzellen. Sber Akad Wiss Wein of excised plant callus in an artificial nutrient.
111:69–92 Am J Bot 26:59–64
2. White PR (1934) Potentially unlimited growth 5. Knudson L (1922) Nonsymbiotic germination
of excised tomato root tips in a liquid medium. of orchid seeds. Bot Gaz 73:1–25. https://
Plant Physiol 9:585–600. https://doi. doi.org/10.1086/332956
org/10.1104/pp.9.3.585 6. Thimann KV, Schneider CL (1939) The rela-
3. White PR (1939) Controlled differentiation tive activities of different auxins. Am J Bot
in a plant tissue culture. Bull Torrey Bot Club 26:328–333
66:507–513
7. Miller CO, Skoog F, Von Saltza MH et al (1955) 21. Stewart JM (1981) In vitro fertilization and
Kinetin, a cell division factor from deoxyri- embryo rescue. Environ Exp Bot 21:301–315.
bonucleic acid. J Am Chem Soc 77:1392. https://doi.org/10.1016/0098-8472(81)
https://doi.org/10.1021/ja01610a105 90040-X
8. Skoog F, Miller CO (1957) Chemical regula- 22. Ji W, Li GR, Luo YX et al (2015) In vitro
tion of growth and organ formation in plant embryo rescue culture of F1 progenies from
tissues cultured in vitro. Symp Soc Exp Biol crosses between different ploidy grapes. Genet
11:118–131 Mol Res 14:18616–18622
9. Morel G, Martin G (1952) Guérison de dahlías 23. Borgato L, Conicella C, Pisani F et al (2007)
atteints d’une maladie a virus. CR Acad Sci III- Production and characterization of arbore-
Vie 235:1324–1325 ous and fertile Solanum melongena + Solanum
10. Guha S, Maheshwari SC (1966) Cell division marginatum somatic hybrid plants. Planta
and differentiation of embryos in the pollen 226:961–969. https://doi.org/10.1007/
grain of Datura in vitro. Nature 212:97–98. s00425-007-0542-y
https://doi.org/10.1038/212097a0 24. Gx W, Tang Y, Yan H et al (2011) Production
11. Guha S, Maheshwari SC (1964) In vitro and characterization of interspecific somatic
production of embryos from anthers of hybrids between Brassica oleracea var. botrytis
Datura. Nature 204:497. https://doi.org/ and B. nigra and their progenies for the selec-
10.1038/204497a0 tion of advanced pre-breeding materials.
12. Raghavan V (2003) One hundred years of Plant Cell Rep 30:1811–1821. https://doi.
zygotic embryo culture investigations. In Vitro org/10.1007/s00299-011-1088-9
Cell Dev Biol Plant 39:437–442. https://doi. 25. Prange ANS, Bartsch M, Meiners J et al
org/10.1079/IVP2003436 (2012) Interspecific somatic hybrids between
13. Power JB, Cummind SE, Cocking EC Cyclamen persicum and C. coum, two sexu-
(1970) Fusion of isolated protoplasts. ally incompatible species. Plant Cell Rep
Nature 225:1016–1018. https://doi.org/ 31:723–735. https://doi.org/10.1007/
10.1038/2251016a0 s00299-011-1190-z
14. Melchers G, Sacristán MD, Holder AA (1978) 26. Yu Y, Ye W, He L et al (2013) Introgression
Somatic hybrid plants of potato and tomato of bacterial wilt resistance from eggplant to
regenerated from fused protoplasts. Carlsb potato via protoplast fusion and genome
Res Commun 43:203–218. https://doi. components of the hybrids. Plant Cell Rep
org/10.1007/BF02906548 32:1687–1701. https://doi.org/10.1007/
s00299-013-1480-8
15. Zenk MH (1991) Chasing the enzymes of sec-
ondary metabolism: plant cell cultures as a pot of 27. Liu S, Xia G (2014) The place of asymmet-
gold. Phytochemistry 30:3861–3863. https:// ric somatic hybridization in wheat breeding.
doi.org/10.1016/0031-9422(91)83424-J Plant Cell Rep 33:595–603. https://doi.
org/10.1007/s00299-013-1552-9
16. Fraley RT, Rogers SG, Horsch RB et al (1983)
Expression of bacterial genes in plant cells. 28. Gatehouse JA (2008) Biotechnological pros-
Proc Natl Acad Sci U S A 80:4803–4807 pects for engineering insect-resistant plants.
Plant Physiol 146:881–887. https://doi.
17. Larkin PJ, Scowcroft WR (1981) Somaclonal org/10.1104/pp.107.111096
variation -a novel source of variability from
cell cultures for plant improvement. Theor 29. Green JM, Owen MDK (2011) Herbicide-
Appl Genet 60:197–214. https://doi. resistant crops: utilities and limitations for
org/10.1007/BF02342540 herbicide-resistant weed management. J Agric
Food Chem 59:5819–5829. https://doi.
18. Lestari EG (2006) In vitro selection and soma- org/10.1021/jf101286h
clonal variation for biotic and abiotic stress tol-
erance. Biodiversitas 7:297–301 30. Zhang HX, Blumwald E (2001) Transgenic
salt-tolerant tomato plants accumulate salt in
19. Lotfi M, Alan AR, Henning MJ et al (2003) foliage but not in fruit. Nat Biotechnol 19:765.
Production of haploid and doubled hap- https://doi.org/10.1038/90824
loid plants of melon (Cucumis melo L.) for
use in breeding for multiple virus resistance. 31. Hu H, Dai M, Yao J et al (2006) Overexpressing
Plant Cell Rep 21:1121–1128. https://doi. a NAM, ATAF, and CUC (NAC) transcrip-
org/10.1007/s00299-003-0636-3 tion factor enhances drought resistance
and salt tolerance in rice. Proc Natl Acad
20. Germanà MA (2011) Anther culture for hap- Sci U S A 103:12987–12992. https://doi.
loid and doubled haploid production. Plant org/10.1073/pnas.0604882103
Cell Tissue Org 104:283–300. https://doi.
org/10.1007/s11240-010-9852-z 32. Rivero RM, Kojima M, Gepstein A et al (2007)
Delayed leaf senescence induces extreme
drought tolerance in a flowering plant. Proc Nat Biotechnol 32:947–951. https://doi.

Natl Acad Sci U S A 104:19631–19636. org/10.1038/nbt.2969
https://doi.org/10.1073/pnas.0709453104 44. Feng C, Yuan J, Wang R et al (2016) Efficient
33. Todaka D, Shinozaki K, Yamaguchi-Shinozaki targeted genome modification in maize using
K (2015) Recent advances in the dissection of CRISPR/Cas9 system. J Genet Genomics
drought-stress regulatory networks and strat- 43:37–43. https://doi.org/10.1016/j.
egies for development of drought-tolerant jgg.2015.10.002
transgenic rice plants. Front Plant Sci 6:84. 45. Soyk S, Muller NA, Park SJ et al (2017)
https://doi.org/10.3389/fpls.2015.00084 Variation in the flowering gene SELF
34. Sanghera GS, Wani SH, Hussain W et al (2011) PRUNING 5G promotes day-neutrality and
Engineering cold stress tolerance in crop early yield in tomato. Nat Genet 49:162–168.
plants. Curr Genomics 12:30–43. https://doi. https://doi.org/10.1038/ng.3733
org/10.2174/138920211794520178 46. Wang S, Zhang S, Wang W et al (2015)
35. Cardi T, Neal Stewart C (2016) Progress of Efficient targeted mutagenesis in potato by
targeted genome modification approaches in the CRISPR/Cas9 system. Plant Cell Rep
higher plants. Plant Cell Rep 35:1401–1416. 34:1473–1476. https://doi.org/10.1007/
https://doi.org/10.1007/s00299-016- s00299-015-1816-7
1975-1 47. Zhou JP, Deng K, Cheng Y et al (2017)
36. Subburaj S, Tu L, Jin YT et al (2016) Targeted CRISPR-Cas9 based genome editing reveals
genome editing, an alternative tool for trait new insights into microRNA function and
improvement in horticultural crops. Hortic regulation in rice. Front Plant Sci 8:1598.
Environ Biotechnol 57:531–543. https://doi. https://doi.org/10.3389/fpls.2017.01598
org/10.1007/s13580-016-0281-8 48. Lowder LG, Malzahn A, Qi Y (2018) Plant gene
37. Belhaj K, Chaparro-Garcia A, Kamoun S et al regulation using multiplex CRISPR-dCas9
(2015) Editing plant genomes with CRISPR/ artificial transcription factors. In: Lagrimini
Cas9. Curr Opin Biotechnol 32:76–84. LM (ed) Maize: methods and protocols.
https://doi.org/10.1016/j.copbio.2014. Springer, New York, pp 197–214. https://doi.
11.007 org/10.1007/978-1-4939-7315-6_12
38. Luo M, Gilbert B, Ayliffe M (2016) 49. Neelakandan AK, Wang K (2012) Recent
Applications of CRISPR/Cas9 technol- progress in the understanding of tissue
ogy for targeted mutagenesis, gene replace- culture- induced genome level changes in
ment and stacking of genes in higher plants. plants and potential applications. Plant Cell
Plant Cell Rep 35:1439–1450. https://doi. Rep 31:597–620. https://doi.org/10.1007/
org/10.1007/s00299-016-1989-8 s00299-011-1202-z
39. Mahfouz MM, Cardi T, Neal Stewart C (2016) 50. Wickramasuriya AM, Dunwell JM (2015)
Next-generation precision genome engineer- Global scale transcriptome analysis of
ing and plant biotechnology. Plant Cell Rep Arabidopsis embryogenesis in vitro. BMC
35:1397–1399. https://doi.org/10.1007/ Genomics 16:301. https://doi.org/10.1186/
s00299-016-2009-8 s12864-015-1504-6
40. Kanchiswamy CN (2016) DNA-free genome 51. Imin N, Nizamidin M, Daniher D et al (2005)
editing methods for targeted crop improve- Proteomic analysis of somatic embryogen-
ment. Plant Cell Rep 35:1469–1474. https:// esis in Medicago truncatula. Explant cul-
doi.org/10.1007/s00299-016-1982-2 tures grown under 6-benzylaminopurine
41. Li M, Li X, Zhou Z et al (2016) Reassessment and 1- naphthaleneacetic acid treatments.
of the four yield-related genes Gn1a, DEP1, Plant Physiol 137:1250–1260. https://doi.
GS3, and IPA1 in rice using a CRISPR/Cas9 org/10.1104/pp.104.055277
system. Front Plant Sci 7:377. https://doi. 52. Turi CE, Axwik KE, Murch SJ (2014) In vitro
org/10.3389/fpls.2016.00377 conservation, phytochemistry, and medici-
42. Srivastava V, Underwood JL, Zhao S (2017) nal activity of Artemisia tridentata Nutt.:
Dual-targeting by CRISPR/Cas9 for precise metabolomics as a hypothesis-generating tool
excision of transgenes from rice genome. Plant for plant tissue culture. Plant Growth Regul
Cell Tissue Org 129:153–160. https://doi. 74:239–250. https://doi.org/10.1007/
org/10.1007/s11240-016-1166-3 s10725-014-9915-y
43. Wang Y, Cheng X, Shan Q et al (2014)
53. Vasilev N, Boccard J, Lang G et al (2016)
Simultaneous editing of three homoeo- Structured plant metabolomics for the simulta-
alleles in hexaploid bread wheat confers neous exploration of multiple factors. Sci Rep
heritable resistance to powdery mildew. 6:37390. https://doi.org/10.1038/srep37390
54. Kaeppler SM, Kaeppler HF, Rhee Y (2000) the long-term in vitro proliferation of oil palm
Epigenetic aspects of somaclonal variation in embryogenic suspension cultures. Plant Cell
plants. Plant Mol Biol 43:179–188. https:// Rep 32:359–368. https://doi.org/10.1007/
doi.org/10.1023/A:1006423110134 s00299-012-1369-y
55. Nic-Can GI, De-la-Peña C (2014) Epigenetic 61. Us-Camas R, Rivera-Solís G, Duarte-Aké F
advances on somatic embryogenesis of agro- et al (2014) In vitro culture: an epigenetic
nomical and important crops. In: Álvarez- challenge for plants. Plant Cell Tissue Org
Venegas R, De-la-Peña C, Casas-Mollano 118:187–201. https://doi.org/10.1007/
JA (eds) Epigenetics in plants of agronomic s11240-014-0482-8
importance: fundamentals and applications. 62. Lau W, Fischbach MA, Osbourn A et al (2014)
Springer, Cham, pp 91–109. https://doi. Key applications of plant metabolic engineer-
org/10.1007/978-3-319-07971-4_6 ing. PLoS Biol 12:e1001879. https://doi.
56. De-la-Peña C, Nic-Can GI, Galaz-Ávalos RM org/10.1371/journal.pbio.1001879
et al (2015) The role of chromatin modifica- 63. Vanhercke T, El Tahchy A, Liu Q et al (2014)
tions in somatic embryogenesis in plants. Front Metabolic engineering of biomass for high
Plant Sci 6:635. https://doi.org/10.3389/ energy density: oilseed-like triacylglycerol
fpls.2015.00635 yields from plant leaves. Plant Biotechnol
57. Duarte-Aké F, Castillo-Castro E, Pool FB et al J 12:231–239. https://doi.org/10.1111/
(2016) Physiological differences and changes in pbi.12131
global DNA methylation levels in Agave angus- 64. Lu X, Tang K, Li P (2016) Plant metabolic
tifolia haw. Albino variant somaclones during engineering strategies for the production
the micropropagation process. Plant Cell Rep of pharmaceutical terpenoids. Front Plant
25:2489–2502. https://doi.org/10.1007/ Sci 7:1647. https://doi.org/10.3389/
s00299-016-2049-0 fpls.2016.01647
58. Duarte-Aké F, De-la-Peña C (2016) 65. Tatsis EC, O’Connor SE (2016) New develop-
Epigenetic advances in somatic embryogenesis ments in engineering plant metabolic pathways.
in sequenced genome crops. In: Loyola-Vargas Curr Opin Biotechnol 42:126–132. https://
VM, Ochoa-Alejo N (eds) Somatic embryo- doi.org/10.1016/j.copbio.2016.04.012
genesis: fundamental aspects and applications. 66. Krishna H, Alizadeh M, Singh D et al (2016)
Springer, Cham, pp 81–102. https://doi. Somaclonal variations and their applica-
org/10.1007/978-3-319-33705-0_6 tions in horticultural crops improvement. 3
59. Smulders M, de Klerk G (2011) Epigenetics Biotech 6:54. https://doi.org/10.1007/
in plant tissue culture. Plant Growth Regul s13205-016-0389-7
63:137–146. https://doi.org/10.1007/ 67. Kim H, Kim S-T, Kim S-G et al (2015)
s10725-010-9531-4 Targeted genome editing for crop improve-
60. Rival A, Ilbert P, Labeyrie A et al (2013) ment. Plant Breed Biotechnol 3:283–290.
Variations in genomic DNA methylation during https://doi.org/10.9787/PBB.2015.3.4.283
Part II
Cell Culture the Fundaments

Chapter 2
Micropropagation in the Twenty-First Century

Jean Carlos Cardoso, Lee Tseng Sheng Gerald,
and Jaime A. Teixeira da Silva
Abstract
Despite more than a century of research on effective biotechnological methods, micropropagation contin-
ues to be an important tool for the large-scale production of clonal plantlets of several important plant
species that retain genetic fidelity and are pest-free. In some cases, micropropagation is the only technique
that supports the maintenance and promotes the economic value of specific agricultural species. The
micropropagation of plants solved many phytosanitary problems and allowed both the expansion and
access to high-quality plants for growers from different countries and economic backgrounds, thereby
effectively contributing to an agricultural expansion in this and the last century. The challenges for micro-
propagation in the twenty-first century include cost reduction, enhanced efficiency, developing new tech-
nologies, and combining micropropagation with other systems/propagation techniques such as
microcuttings, hydroponics, and aeroponics. In this chapter, we discuss the actual uses of micropropaga-
tion in this century, its importance and limitations, and some possible techniques that can effectively
increase its wider application by replacing certain conventional techniques and technologies.
Key words Actual applications, Breeding, Combined techniques, Cost reduction, Micropropagation,
Plant tissue culture, Large-scale production, Secondary metabolic production, Somatic
embryogenesis
1 Introduction
One of the first reports on plant tissue culture was by Gottlieb

Haberlandt [1], who used individual cell culture and totipotency;
this was followed by other attempted cultivation of isolated root
tips under aseptic conditions. Philip White (1934) reported unlim-
ited growth in excised root tips in liquid culture media containing
inorganic salts, sucrose, and yeast extract [2]. Further, in 1939, he
reported unlimited growth of proliferated masses in the same cul-
ture media from tumor-like excised tissues of leaves and stems from
a Nicotiana hybrid [3]. In the same year, Philip White also reported
spontaneous shoot growth from tumor tissues of Nicotiana in a
liquid medium [4]. Subsequently, on the basis of these studies of
White, Folke Skoog and collaborators [5, 6] established the
17
18 Jean Carlos Cardoso et al.
importance of relationship among auxins and cytokinins during

in vitro stimulation/inhibition of roots and shoots from tobacco
callus culture, and these observations formed the foundation of
modern plant biotechnology and are still in use [7]. It is also
important to include studies by Knudson [8], who experimented
with nonsymbiotic germination of orchids and reported the need
for a type of sugar, either as glucose or fructose, for the germina-
tion and width enhancement of zygotic embryos.
Toshio Murashige and Folke Skoog, in a paper published in
Physiologia Plantarum [9], described a culture medium that is cur-
rently most widely used in plant tissue culture and pointed to a
culture medium that could provide all essential nutrients for the
rapid growth and large yields for in vitro pith tissues of tobacco.
They showed that the inclusion of a tobacco leaf extract in the
mineral culture media modified from White [10] resulted in a sig-
nificant increase in the fresh and dry weight of tobacco tissues.
This medium, called the “revised culture medium” published by
Murashige and Skoog (MS), was developed based on changes in
the fresh and dry weight of tobacco callus (variety Wisconsin 38)
after the addition of single or multiple nutrients to the culture
medium. After more than half a century, MS medium and its modi-
fications continue to be one of the main culture media used for
micropropagation of a wide variety of plant species, with satisfac-
tory results.
The formulation of MS culture medium, considered a struc-
tural pillar of actual micropropagation systems being currently
used, is an example of the importance of basic studies that facilitate
new advances and support modern, agriculturally important, bio-
technology techniques. Such techniques help to overcome genetic
barriers of interspecific hybridization [11] and facilitate the pro-
duction of transgenic plants by plant tissue culture techniques [12]
or the development of double-haploid technology for obtaining
hybrids of important crops [13], apart from accelerating the large-
scale production of pest-free plantlets with genetic uniformity sim-
ilar to other clonal propagation techniques.
Although many new techniques are being developed, modern
biotechnology also continues to be extremely dependent on the
development of more efficient protocols for plant tissue culture
and micropropagation [12] as these techniques offer many advan-
tages. These include controlled environmental conditions for cul-
tivation that allows high repeatability of results irrespective of local
climatic conditions; high rates of regeneration; the production of
shoots from small tissues or organs (normally less than 1.0 cm in
length); rapid, efficient, and large-scale disease-free production of
plantlets; an aseptic environment with a better control of cultivated
organism as plants or plant microorganisms that have no or low
rates of contaminants; automation of different processes; better
control of tissue or organ development using plant growth regula-
tors; single-cell or few-cell origin organogenesis that eases the pro-
Plant Micropropagation 19
duction of solid mutants or transgenic plants rather than chimeras;

easy maintenance of replicates of important cultures under in vitro
conditions that help avoid the loss of important genotypes; cryo-
preservation of tissues or organs for long-term conservation; and
obtaining plants that cannot survive in uncontrolled environmen-
tal conditions such as haploid plantlets.
Most of these techniques owe their origin to theories proposed
by Haberlandt, while the evolution of micropropagation tech-
niques that have made modern biotechnology possible can be
attributed to various investigators.
Nonetheless, certain aspects of micropropagation were consid-
ered to be challenging during the twenty-first century. These
include increasing the efficiency of the most micropropagation
techniques, limited innovation in new techniques developed, the
maintenance of recalcitrant species for micropropagation, and the
high cost of micropropagation that could lead to substitution by
cheaper techniques. In this chapter, we address some aspects of real
micropropagation systems with the aim of reducing the costs of
micropropagated plantlets, the use of dedicated techniques, and
some new techniques that could either replace existing ones or
potentially alter the final products from large-scale micropropaga-
tion in the twenty-first century. Finally, we also offer some perspec-
tives and difficulties that are likely to be encountered during
micropropagation in this century.
2 Cost Reduction of Micropropagated Plantlets
The high costs of micropropagated plants are related to the use

of aseptic culture conditions in a highly controlled environment
that aims to produce high-quality plantlets in large quantities and
ensures their genetic fidelity and pest-free status. The essential
control of environmental conditions constitutes the major nonre-
curring costs of a laboratory [14, 15] and includes infrastructure
construction and maintenance; equipment required for prepar-
ing, sterilizing, and stocking culture media and associated prod-
ucts; equipment used for maintaining an aseptic environment in
growth and transfer rooms; and materials and equipment required
to control environmental factors, mainly in the growth room,
such as lamps for artificial light and air conditioning to maintain
temperature in a narrow range for the ideal development of plants
cultivated in vitro. Other costs include electrical energy required
to maintain environmental control, labor to maintain the produc-
tion of micropropagated plants, high-quality plant material as
starter cultures, a greenhouse for acclimatization, royalties paid
to the breeder if commercial laboratories use new or protected
cultivars, and, finally, costs associated with marketing, sales, and
the logistics of delivery of plantlets from a laboratory to the final
client [14–16].
Given these factors, large variations in the cost of micropropa-

gated plantlets are to be expected, and these will be based on the
location of the laboratory and the type and quantity of technology
and automation used [17]. Micropropagated plantlets are nor-
mally more costly than those obtained using other sexual and asex-
ual techniques of propagation [18]. Greater costs related to the
actual technologies used for plant micropropagation in agriculture,
horticulture, floriculture, and forestry continue to be the main
problem that prevents the expansion of this technique in the devel-
oping and undeveloped countries [15, 16, 18–20]. Kozai [21]
proposed that a 90% reduction in the cost of production would be
required for worldwide commercialization of micropropagated
plantlets and concluded that only robotization/automation could
lead to such a drastic reduction in costs.
In a commercial laboratory, with few automated processes,
intensive labor use accounts for the main proportion (60–70%) of
the cost of micropropagated plantlets, followed by electrical energy
costs (10–25%), which are used for culture medium preparation
and to maintain environmental control and aseptic conditions in
the growth room. Variations in the costs depend on the region, the
type of plant produced, the technology used, and its efficiency [15,
22]. Due to high labor costs, many large-scale commercial micro-
propagation companies transfer plantlet production to developing
countries to lower costs and increase competitiveness in the world
of micropropagated plantlets.
High labor costs are the principle reason for switching to auto-
mation of certain processes in some plant tissue culture laborato-
ries. The use of bioreactor systems would result in a significant cost
reduction of micropropagated plants due to a reduction in the
number of workers required to perform labor-intensive processes
such as preparation of culture media and transplantation of plant
shoots.
Few studies have evaluated the yield as plantlets per worker,
and such data can result in a significant cost reduction. For exam-
ple, a cost analysis of Phalaenopsis micropropagation showed that
the greatest cost was skilled labor required for transferring plantlets
(61.7%), followed by electrical energy used for air conditioners
(16.9%) to maintain a stable temperature [15].
According to Charanasri (1989), in Thailand, the mean yield
of a single worker is 100,000 plantlets per year. Similarly, based on
personal experience (JCC) in a commercial laboratory in Brazil,
ten workers (5 days a week, working 8 h/day) have the capacity to
produce around 1.0–1.2 million plants per year (100,000–120,000
plantlets/worker/year) during micropropagation of Anthurium,
gerbera, and orchid plantlets on agar culture media.
Other factors that affect efficiency and increase costs include a
low rate of multiplication, the quality of shoot clusters produced
for transplantation, problems with microbial contamination, and
the loss of plants during different phases of micropropagation,

such as plant death during acclimatization. According to Chen
[15], an increase in multiplication rate from 1.5 to 2.5 could lead
to a 50% cost reduction in micropropagated Phalaenopsis; this
increase in efficiency is one of the most important factors that
affect costs.
Based on this information and the fact that the cost of one
micropropagated plantlet is significantly higher per unit than plants
propagated sexually or asexually by other methods [16, 18, 23],
micropropagation as a technique was found to be of limited use
and could only be applied to some important horticultural and for-
est species and conditions, as described below:
(a) Species with important limitations related to sexual propaga-
tion, where seeds are unavailable (e.g., most cultivars of banana
and pineapple); plants with dormancy limitations (strawber-
ries), those with limitations in genetic material and quantity
from the mother plant (e.g., Anthurium); and plants with
long juvenile phases due to sexual propagation (most fruit
trees), those associated with or not with high heterozygosity
where maintenance of the main characteristics of interest in
some commercial cultivars by propagation of seeds alone is dif-
ficult (Anthurium, eucalyptus, orchids, pineapple).
(b) Species with few or limited techniques of alternate methods of
vegetative or asexual propagation, for example, banana or
pineapple. In these plants, mother plant developmental period
is long, a limited number of new shoots are produced upon
standard vegetative propagation, and the rooting of new
shoots occurs directly from adult plants. In contrast, micro-
propagation produces more efficient and rapid mass propaga-
tion of new shoots.
(c) When limited numbers of mother plants are available to start
propagation: during eucalyptus clonal propagation, mini-
cuttings are the main propagation technique used by the
industry. However, as soon as new clones are developed
from seeds (when only one or few mother plants are avail-
able), micropropagation is predominantly used by the indus-
try to rapidly mass propagate and increase the number of
mother plants. Similar procedures were applied to a high
number of commercial species, as a part of the propagation
process, but it is not the main technique for large or mass
propagation of the culture. Some examples include potatoes,
Anthurium and other ornamental plants, eucalyptus, tree
fruits, and sugarcane.
(d) The removal of important diseases in old mother plants propa-
gated asexually generally causes huge damage to the culture, as
in potato tubers. Mass propagation of potato tubers is nearly
impossible due to the presence of a high number of viruses and
other bacterial and fungal diseases after several generations of

propagation. It is important to note that many micropropa-
gated plants have this benefit because most plants with bacte-
rial and fungal infections do not survive in vitro or are discarded
at some time point after inoculation. The removal of viruses
and some bacteria may require additional treatment with anti-
biotics, antiviral agents, or heat treatment, along with shoot
meristem culture.
(e) To support available biotechnological tools that aim to breed
and develop new cultivars and hybrids, e.g., for somatic hybrid-
ization of different species by protoplast fusion (Citrus spp.),
obtaining transgenic plants using direct or indirect transfor-
mation (soybean, maize), and double-haploid production
(maize).
(f) In some dioecious plants, micropropagation could be used to
propagate only plants of a specific sex, such as in papaya
(Carica papaya), where only hermaphrodite and female plants
are required for fruit production.
(g) This technique can be used to conserve noncommercial spe-
cies and reforestation of areas with native vegetation, especially
in plants where propagation of species is very limited or
unknown. This scenario is mostly futuristic and will be possible
because of new advances in mycorrhization and somatic
embryogenesis.
The high cost of plantlets produced by micropropagation is the
major limitation for their use and expansion in extensive plant
propagation [23]. Thus, cost reduction represents the most
important advance for this technique in this century. Furthermore,
micropropagated plantlets display many advantages compared to
other systems of vegetative propagation and produce high-quality
(physiological and genetic) plants that are free of pests and dis-
eases and better vegetative development and yield [23, 24]. For
example, in potatoes, an important food source, combining
micro-tubers produced in vitro with soil cultivation under plastic
polytunnels produces conventional sized tubers. This represents a
significant increase in the final productivity of edible tubers
because this type of propagule is practically free of diseases and
pests, which considerably increases yields [25]. Another alterna-
tive is the combined use of micropropagation to produce disease-
free mother plants followed by propagation using low-cost
microcuttings under greenhouse conditions to achieve the large-
scale production of disease-free tubers [26]. Essentially, new tech-
niques such as aeroponics (soil and substrate-less growth) increases
potato yield from multiplication systems; however, this requires
further verification [27].
Thus, cost reduction of micropropagated plants could be a

definitive solution to increase the production of commercial spe-
cies in vitro and is a separate issue from the usefulness of this tech-
nique when used as part of a larger propagation system, e.g.,
potato, sugarcane, strawberry, and some important ornamentals.
The cost of micropropagated plantlets can be reduced by using
two alternatives. The first method (option A) aims to reduce costs
associated with the micropropagation technique, i.e., using auto-
mation to reduce manual labor costs, while the second option
(option B) is to increase the efficiency of micropropagation sys-
tems, i.e., increasing the multiplication factor of each explant inoc-
ulated in vitro.
Opinions differ on option A or B as being a better method to
reduce costs. However, in the twenty-first century, only a combi-
nation of A and B would significantly and efficiently reduce the
price of micropropagated plantlets. The use of low-cost techniques,
but with low efficiency, (e.g., low multiplication rate) or vice versa,
is not compensatory.
In Phalaenopsis micropropagation, only efficiency (option B)
was considered to be effective. Therefore, increasing shoot multi-
plication was identified as the main approach to reduce plantlet
costs [15] because higher multiplication rates drastically reduce the
time required to obtain a specified number of plantlets in the labo-
ratory, which reduces both labor costs and electrical energy
consumption.
In Coffea arabica, the high cost (US$ 0.60) of in vitro plant-
lets, compared to the costs for propagating plants by seedlings
(US$ 0.20), is the major limiting factor preventing the use of
somatic embryogenesis for large-scale production [18].
Many techniques for reducing costs are available, but most of
them are not applicable to commercial laboratories for various rea-
sons. For example, the use of a specific culture medium for only
one cultivar of a micropropagated species is hard to achieve in
commercial laboratory conditions, unless this cultivar represents
one of the main cultivars in the laboratory or has high potential
and is irreplaceable.
Based on personal experience (JCC) in commercial laborato-
ries with gerbera (cut gerbera daisies), a species for which many
new cultivars are marketed every year and introduced in the labora-
tory for micropropagation, important problems include bacterial
contamination or low rates of multiplication. In this case, together
with field tests for the development and evaluation of ornamental
characteristics, a cultivar is also grown under in vitro conditions for
evaluating general growth. Additionally, propagation rate, the
presence of endogenous bacteria in culture, rooting capacity, and
signs of hyperhydricity are also monitored [28]. These tests are
typically performed for certain types of culture media that are used
for groups of gerbera cultivars. If a new cultivar shows low rates of

propagation or some specific developmental failure, such as
extremely hard root induction or high hyperhydricity in shoots
(after some tentative in vitro reintroduction) in all the culture
media tested, according to the experience of JCC, this cultivar will
most likely be eliminated from the laboratory and field production
rather than investing in the development of a specific culture
medium or procedures for this particular cultivar. This process is
simple to understand from a business point of view as using a new
and specific culture medium for only one or few cultivars not only
increases the direct cost of the micropropagated plantlet but also
involves additional labor that also increases overall cost. In addi-
tion, the use of many different culture media is expected to result
in greater risk of human error in media preparation as each medium
would require a unique formula for preparation.
Thus, the development and preparation of specific media for
one or few cultivars are only possible in cases where the cultivar is
irreplaceable and has very low growth rates, or if is one of the most
important commercial cultivars of that laboratory.
One example of a plant that requires specific procedures for
cultivating a specific cultivar is Anthurium andraeanum cv. White
Beauty, which is considered recalcitrant to in vitro organogenesis
regeneration, as it requires the use of leaf segments from juvenile
explants instead of adult tissues [29]. This cultivar is the only one
with completely white spathes instead of regular green-white
spathes, which result in vigorous growth and excellent horticul-
tural and ornamental characteristics under greenhouse conditions.
Interestingly, in gerbera cultivars that normally show physi-
ological problems in vitro, propagated plantlets continue to
manifest these problems under field conditions, probably due to
epigenetic variations. It has been noted that under commercial
conditions, some gerbera cultivars with problems in the labora-
tory, such as high hyperhydricity, are harder to acclimatize and
show early plant death. However, interestingly, the reintroduc-
tion of the same cultivar under in vitro conditions, using healthy
mother plants from the field, can result in normal responses of
tissues and good in vitro development in the same culture
medium that previously caused problems in growth (unpub-
lished observations, JCC).
Essentially, new culture media are introduced in a commercial
laboratory only when it represents an alternative that results in a
significant increase in regeneration, shoot, or root production for
a specific minimum number of cultivars.
Most laboratories use one or a few types of culture media for
each micropropagated species. MS medium continues to be the
predominantly used salt mixture because of its high applicability
and suitability for various species and for multiple varieties of the
same species. However, other salt formulations that could be used
for some species include the wood plant medium [30] for some
woody species such as eucalyptus [31]. In order to reduce the cost
of culture media preparation, some laboratories have adopted the
use of pre-prepared culture media that are formulated by compa-
nies that sell biochemical products, instead of preparing stock solu-
tions for each salt and subsequent preparation of the culture media.
Many different formulations of culture media are available on the
market, and this availability represents an important source of
reduction in labor required for culture media preparation and in
error risk during stock solution and culture media preparation.
Differences in culture media in a laboratory entail the addition of
different plant growth regulators and certain complex mixtures
and additives that are required for each culture and stage of micro-
propagation. Commercially available culture media are attractive
alternatives to tissue culture laboratories as these can be custom-
formulated based on the nutritional requirements of the species
and their genotypes.
Other alternatives to reduce micropropagation costs are dis-
cussed below.
2.1 LEDs, CCFLs, Light-emitting diodes (LEDs) and cold cathode fluorescent lamps
and Laser Light (CCFLs) have gained greater application in plant tissue culture due
for Tissue Culture to the ability to control their spectral composition and the ability
to reduce radiant heat while offering high light intensity, allowing
such light systems to be placed close to plants on a growth shelf
[32–35]. Heat-emitting incandescent and fluorescent lamps not
only increase cooling costs, important for commercial plant tissue
culture laboratories and enterprises, but also limit the density of
cultures that can be commercially cultivated per unit area. These
aspects, together with their short life-spans, relative to LEDs and
CCFLs, reduce their competitive nature in intensive commercial
crop production that uses tissue culture operations, although they
still have lower unit costs, making them the continued standard in
tissue culture laboratories [32, 35]. However, lower manufactur-
ing costs, for example, in China, now allow individual LED lamps
and LED boards to be produced at competitive prices [34]. For
laboratories with limited space (e.g., plant production on the space
station [36]) or that need highly specialized experiments, such as
the simultaneous use of specific light intensity of spectral quality,
together with photoautotrophic micropropagation (i.e., CO2
enrichment), small CCFL units [35] or LED boards are the ideal
treatment unit for small-scale lab-based experiments, even if their
unit costs may be higher than the use of conventional fluorescent
lamps. The history of the use of LEDs in horticulture, and plant
tissue culture, is not that long, since practical blue LEDs were only
first invented in the early 1990s [37]. The ability to change the red
to blue LED ratio, and to alter the light intensity of each bulb, and
thus of a LED board, allows for an excellent experimental system
to study in vitro organogenesis of horticultural and ornamental

crops, including strawberry [38], chrysanthemum [39],
Zantedeschia [40], grapevine [41], orchids like Cymbidium [42],
and papaya [43], or even of photosynthetic parameters of tomato
in a greenhouse setting [44]. Despite these advantages and increas-
ing use of LEDs, Ooi et al. [45] claim that “the electrical-to-optical
power conversion of LEDs remains inefficient beyond a certain
electrical current,” suggesting instead that laser light could be used
to deliver individualized light spectral quality beyond what LEDs
(or CCFLs) can offer, showing the growth of model plant
Arabidopsis thaliana with lasers being equivalent to growth under
LEDs and with comparable costs. As horticultural production
becomes more competitive, researchers and industry need to begin
to assess the cost-benefit ratio, depending on available size, bud-
get, labor, and expected profits, as in rapeseed plant factories
employing LEDs [46]. Researchers and commercial producers are
cautioned, however, at the possible risk of LEDs increasing endo-
reduplication in tissue cultures, leading to somaclonal variants, as
occurs with Phalaenopsis [47].
2.2 Photoautotrophic The control of environmental conditions, especially temperature

Micropropagation and light, is essential for micropropagation in growth rooms prob-
Systems, the Use ably because these two factors have the greatest influence on plant
of Natural Light, development. The use of artificial light continues to be the main
and Greenhouse method to control the intensity, periodicity, and quality of light in
Micropropagation growth rooms. For temperature control, most laboratories use air
conditioners for cooling growth rooms. In general, approximately
15–25% of the cost of a micropropagated plantlet accounts for
environmental control to sustain development in micropropagated
plants, e.g., the production of normal chlorophyll plants with
leaves, stem, and roots. Interestingly, it is known that in vitro
grown plants are not photosynthetically active, because of two
main factors. The first is the low intensity of light from the lamps
used in laboratories (LED or fluorescent lamps). The second is a
low concentration of CO2 inside the flask and in the growth room
caused by a combination of rapid consumption of CO2 by plantlets
and the poor air exchange between in vitro conditions and the
external environment [48, 49]. In addition, maintaining a narrow
temperature (22–27 °C) in the growth room increases microprop-
agated plantlet costs and reduces the efficiency of acclimatization
under greenhouse conditions, as the latter shows wider fluctua-
tions in temperature and other climatic conditions such as low air
humidity which can to plant death on these conditions by excessive
loss of water for the environment.
In order to compensate the absence of photosynthesis
under in vitro conditions, conventional micropropagation uses
heterotrophic or photomixotrophic systems that externally add
a source of sugar (carbon), normally sucrose, to maintain
regeneration, multiplication, rooting, or other in vitro devel-

opment responses. This addition of sucrose also leads to many
problems that eventually increase the costs of micropropagated
plantlets. In addition, plants cultivated in vitro have high pho-
tosynthetic ability due to the presence of chlorophyll and
develop photoautotrophy [48, 49].
To address the problems of low CO2 concentration and the
internal accumulation of ethylene in culture flasks, some compa-
nies have developed perforated polypropylene caps with filters.
Other types of caps as plastic film, cotton balls, and filter caps
have also been used to increase internal-external air exchange.
However, the use of such caps alone does not result in suffi-
ciently increase CO2 for photoautotrophy [49]. Additionally,
any increase in air exchange could also result in microbial con-
tamination, which reduces the efficiency of micropropagation.
Nonetheless, modifications in the type of flasks being used can
increase air exchange and CO2 supply. For example, Tanaka et al.
[50] developed the “Culture Pack” to replace commonly used
flasks for film cultures. Film vessels composed of a fluorocarbon
polymer film, the “Vitron,” were successfully used in the photo-
autotrophic micropropagation of Eucalyptus urograndis [51]
and Spathiphyllum [52].
Kozai [48] proposed that photoautotrophic micropropagation
systems can be established only when certain conditions are ful-
filled. First, plant growth should occur in sucrose-free culture
medium, the culture should be cultivated under in vitro conditions
with high PPFD (photosynthetic photon flux density), and cul-
tures should be cultivated under in vitro conditions in a CO2-
enriched environment. Xiao et al. [53] described that this system
could be enhanced by decreasing relative humidity in flasks by sub-
stituting agar-based gelling agents with a fibrous or porous sup-
port material with high air porosity. Under these conditions,
photoautotrophic micropropagation could be successfully estab-
lished for different species. The use of this technique proposed by
Kozai has several advantages including reduced contamination
(probably because of the sucrose-free culture medium), a decrease
in plant loss and physiological disorders, and consequently, costs.
Further cost reduction can be achieved by increasing automation/
robotization and the use of larger vessels, as these measures drasti-
cally decrease the number of transplants and labor required [17,
54]. However, the main disadvantages of using automation are
high initial costs compared to conventional micropropagation sys-
tems and difficulties associated with the creation of a modified and
controlled atmosphere necessary for a growth room, i.e., con-
trolled CO2 enrichment, or the use of light bulbs that increase the
PPFD to permit photoautotrophy. Well-developed systems for
CO2 enrichment are available and are used in horticulture.
However, the use of higher light intensity and PPFD increases
costs attributable to electrical energy, and because more light

implies more heat, longer hours of air conditioning are needed to
maintain temperature. Nevertheless, as discussed in Subheading
2.1, the use of LED, laser, or CCFL light bulbs with high PPFD
and with a wavelength designed to stimulate photosynthesis could
be a solution. In addition, the higher costs for establishing photo-
autotrophic micropropagation can be compensatory, if microprop-
agation efficiency is increased and labor for plantlet production is
reduced [17]. Photoautotrophic micropropagation (high CO2 and
PPFD and an increase in the number of air exchanges) enhanced
the growth and survival of acclimatized Doritaenopsis plants as a
result of biochemical and physiological changes [55]. Similar envi-
ronmental conditions also stimulated autotrophy and an increase
in the rate of biomass production in “golden” papaya [56].
Another alternative for photoautotrophic micropropagation is
the use of a greenhouse environment with natural light and atmo-
spheric CO2 concentration. This could be considered as the most
low-cost disposable source of light in terms of intensity and quality
(i.e., replacing artificial light), far exceeding that required for pho-
tosynthesis and photomorphogenesis for in vitro cultivation. The
feasibility of using a natural environment under greenhouse condi-
tions, where in vitro cultures would be performed using various
strategies to control the environment, has been scientifically tested
on a reasonable number of micropropagated species.
In many developing countries, the micropropagation of com-
mercial orchids such as Vanda, Phalaenopsis, Dendrobium, Cattleya,
and Oncidium has been achieved under greenhouse conditions
several years ago. Normally, growers seed orchids in glass bottles
containing a culture medium based on a mixture of fruit pulp and
charcoal and maintain these bottles in horizontal positions covered
with plastic film (to avoid excessive air humidity) with a net shade
cutting more than 80% of incident sunlight but with approximately
10–20% of natural light inside in the greenhouse. This minimal
entrance of light avoids excessive temperature elevation as light
transforms to heat under greenhouse conditions. Under these high
net shading greenhouse conditions, plants receive between 8000
and 15,000 lux of natural light, which is approximately 5–15 times
more intense than the light in a growth room with LED or cold flu-
orescent lamps in commercial micropropagation laboratories. Such
greenhouse micropropagation has been used in the final phase of
orchid shoot rooting, before acclimatization.
Cardoso et al. [57] used this greenhouse micropropagation
technique for gerbera cultivation with a PPFD of 100 μmol m−2/s.
They compared this to an identical phase in the growth room during
rooting and observed significant increases in leaf number and diam-
eter, rooting percentage, and number, as well as fresh and dry weight
in plantlets cultivated under greenhouse conditions. The plants cul-
tivated in sucrose-free medium achieved the same efficiency only
during acclimatization when cultured under greenhouse conditions

in the previous stage (pre-acclimatization). The use of pre-acclimati-
zation in micropropagated plantlets (rooting phase in greenhouse
conditions) drastically reduces the time required in the growth room
and facilitates an increase in the efficiency of micropropagation in
commercial laboratories.
The efficiency of yield of in vitro Solanum tuberosum mini-
tubers was not different in a controlled growth room and in a non-
controlled room, similar to a greenhouse that used natural light, in
long-term experiments (2009–2014) covering different seasons of
growth [58].
These results show the potential of this technique not only for
rooting orchids but also for the micropropagation of other orna-
mentals [57], tubers [58], and fruit species, as banana [59–61] and
pineapple [62] apart from improving the use of laboratory space,
especially for a growth room as it will only be used during specific
phases of micropropagation such as establishment and
multiplication.
The rooting phase normally requires more space than other
phases of micropropagation as only a few plants can be accom-
modated in each flask, and each plant requires space to increase
weight, leaf number, and roots in preparation for acclimatization.
For example, the rooting phase of gerbera requires two to three
times more space than its multiplication phase to achieve ade-
quate rooting of shoots obtained in the previous phase. A work-
ing estimate is that each flask in the multiplication phase requires
two flasks for rooting and elongation, while the last phase uses
approximately 60–70% of the useful space in the growth room.
By transferring these flasks in the rooting phase to greenhouse
conditions, it is possible to double or triple the usable space in
the growth room for multiplication, thereby significantly expand-
ing the capacity of the laboratory to produce more shoots. The
following is a simple calculation for a laboratory with a full capac-
ity of 10,000 flasks where each flask can support five initial shoots
in the multiplication phase and ten shoots in the rooting stage.
Using a multiplication factor of 4:1 for simultaneous rooting and
multiplication, the use of a greenhouse rooting system with pre-
acclimatization will enhance the laboratory capacity to 180,000–
200,000 shoots/month (9–10,000 flasks × 5 initial shoots × a
multiplication factor of 4:1, 90–100% of the laboratory for mul-
tiplication). Comparatively, a conventional system that uses the
growth room for multiplication and rooting will only accommo-
date 60–70,000 shoots (3330 flasks × 5 initial shoots × a multi-
plication factor of 4:1) as most of the space will be used for shoot
elongation and rooting.
Other advantages of pre-acclimatization under greenhouse
conditions, apart from cost reduction of micropropagated plant-
lets, are the presence of natural light and cheaper methods of
temperature control, as fogs or pad fan systems which reduce

temperature by increasing cold air humidity, instead of artificial
light and temperature control by air conditioners. Additionally,
plants rooted under greenhouse conditions begin photosynthesis
before those rooted in growth rooms [55], probably owing to
the cultivation in sucrose-free medium and better anatomical
adaptation for acclimatization [57]. Furthermore, pre-acclimati-
zation under greenhouse conditions increases survival rates of
acclimatized plantlets [59, 62, 63].
The main difficulty associated with this technique involves
good planning and project implementation to maintain a green-
house in close proximity to the growth room to ease the transport
of flasks from the laboratory to the greenhouse. This technique
also requires a greenhouse for in vitro culture with specific envi-
ronmental conditions. Verticalization, which is normally used in
laboratories with artificial lights, is harder to achieve in a green-
house and results in great variations in the intensity and quality of
natural light received by the plants in vitro. This less controlled
environment could also increase microorganism contamination in
flasks, and it is harder to control photoperiod in the greenhouse
without supplementary artificial light.
A successful alternative for micropropagation is the use of
tubular skylights that redirect natural light to a growth room with-
out heat, instead of using a greenhouse environment [60].
2.3 Chemical The chemical sterilization of the culture media is an alternative to

Sterilization of Culture the commonly used physical autoclaving system where high tem-
Media peratures (121 °C) and pressure (1 kgf cm−2) are applied for
20–30 min. This process consumes electrical energy, labor, and
time (normally 1–2 h for one round of autoclaving) to sterilize the
culture medium and other products required for establishing an
aseptic culture.
The alternative is chemical sterilization, which uses a chemical
substance with bacteriostatic/fungistatic or antibiotic/fungicide
action to eliminate and avoid future contamination of the culture
medium in flasks, thereby replacing the process of autoclaving.
This technique differs from the use of antibiotics in the culture
medium that is used to prevent microbial contamination from
endogenous bacteria in certain types of explants, post-autoclaving
contamination, or to prevent the growth of Agrobacterium tume-
faciens after indirect genetic transformation of plant tissues. In all
these cases, antibiotics are complementary to autoclaving and are
added by filter sterilization after the culture medium has been
autoclaved.
Most products investigated and used for chemical steriliza-
tion are chlorine-based derivatives. Teixeira et al. [64] tested the
use of NaOCl (using common bleach as the source) and observed
that a concentration ranging between 0.0003 and 0.0005% of

active chlorine results in 100% uncontaminated cultures with the
highest average number of shoots and fresh weight. This study
was conducted on pineapple (Ananas comosus) in vitro shoots
using MS liquid culture medium, and interestingly, the average
number of shoots obtained was the double (13.4 shoots/cul-
ture) that obtained with autoclaved culture media (6.6 shoots/
culture). Brondani et al. [65] also used NaOCl to establish nodal
segments from different clones of Eucalyptus benthamii and
found that concentrations between 0.001 and 0.003% resulted
in a good percentage of establishment, viable shoots, and fungal
decontamination that were similar to those observed with auto-
claved culture medium. Similar results were obtained with ger-
bera cv. Essandre [66].
NaOCl is normally used to achieve aseptic explants from non-
sterile conditions during the micropropagation establishment stage
and has the advantages of being both cheap and easy to acquire.
The disadvantage of this technique is that a more complex method
to prepare flasks and culture media is required, which includes
washing flasks with a solution containing NaOCl and the prepara-
tion of culture medium containing NaOCl. Most commercial lab-
oratories wash culture flasks using an automatic washing machine
to reduce labor and increase the yield of washes; however, it should
be noted here that NaOCl is corrosive to metals.
Other chemicals tested and used during the micropropagation
of Anthurium andraeanum [67] and gerbera [68] include chlo-
rine dioxide (ClO2), which is widely used and is recommended for
food sanitation. Various commercial formulations containing stabi-
lized ClO2 in a liquid phase facilitate its use in solution and its
application in culture media preparation. ClO2 is added to the cul-
ture medium at 0.0025% before pH adjustment and results in
microorganism-free in vitro growth during all stages of
micropropagation of gerbera and better plant development com-
pared to autoclaved culture media. This technique is simple to use
and does not require any additional procedures for sterilization as
flasks need to be washed with water and detergent before use.
Finally, a gelling agent is added to the culture medium, dissolved
at high temperature, poured into flasks, and flasks are capped. The
culture medium is now ready for transplantation. Cultures were
maintained sterile for up to 90 days after preparation of culture
medium and in vitro cultivation of Anthurium [67], satisfying the
time required to transplant more than 90% of in vitro cultured
commercial species.
One disadvantage of this technique is that stabilized ClO2
increases the pH of the culture medium and requires the careful
addition of HCl during pH adjustment to maintain a range between
5.8 and 6.2.
Other products that are free of chlorine can also be used for
chemical sterilization of culture media, such as diethyl pyrocarbon-
ate (DEPC) at 1 g/L [69] and hydrogen peroxide [70].
A distinct advantage of the chemical sterilization technique is
the utilization of different types of flasks/vessels for micropropaga-
tion, such as polyethylene or other non-autoclavable plastic vessels
that are cheaper than glass or autoclavable plastic flasks. In addi-
tion, this technique can be applied to bioreactor systems that use
polyethylene bottles, instead of autoclavable plastic or glass bottles
that are more expensive and difficult to autoclave.
Cold sterilization with nontoxic chemical products also pres-
ents advantages compared to autoclaved products such as avoiding
the degradation of nutrients, plant growth regulators, and other
products added to the culture medium and prevents the formation
of toxic substances caused by a high-temperature exposure of dif-
ferent components in the culture medium [71], resulting in better
performance of in vitro plantlets.
2.4 Bioreactor The major obstacle to the micropropagation of conventional plants

Systems to Reduce in a plant biofactory is the excessive use of labor, which increases
the Cost costs of seedling/plantlet production in vitro. The term plant bio-
of Micropropagated factory refers to a micropropagation laboratory that produces
Plantlets plants in vitro in large quantities and whose production process is
well-defined [72]. The most important advantage of using Rita®
and BIT® bioreactors is the reduction in the demand for labor,
which will, in turn, reduce plant costs by 20–40% or more.
The process of plant micropropagation involves three main
steps, namely, initiation, multiplication, and elongation rooting.
Typically, in a biofactory using bioreactors, the initiation phase is
similar to that of conventional methods, but bioreactors are used
in the multiplication and elongation-rooting phases when the
demand for flask and labor greatly increases [73].
Several types of bioreactors have been developed and used. The
most common types of bioreactors are the aeration agitation biore-
actor, roller drum bioreactor, spin filter bioreactor, air driven biore-
actor, airlift bioreactor, gaseous phase bioreactor, oxygen permeable
membrane aerator bioreactor, overlay aeration bioreactor, and the
immersion by bubbles bioreactor. In all these models, the culture
material remains continuously immersed in the culture medium.
This continuous immersion causes problems that arise from hyper-
hydration of the shoots/plantlets. Depending on the species and the
type of medium used, hyperhydration can cause serious physiologi-
cal disturbances that affect the growth and development of the
growing material, a phenomenon known as hyperhydricity [74].
In order to minimize this problem, Alvard et al. [75] devel-
oped a bioreactor model, called the temporary immersion bioreac-
tor – BIT®. In this bioreactor, the culture medium remains in
contact with the explant for a predetermined period after which

the medium is drained, and the explant ceases to be in the direct
contact with the culture medium [73, 74].
The model developed by Alvard et al. [75] was modified by
Teisson et al. [76] and gave rise to the bioreactor system RITA®.
The RITA® system has been used for a number of plant species
with different types of explants and has shown very good results
[73, 74].
The advantages of using temporary immersion bioreactors in a
plant biofactory are enormous. In addition to reducing costs, the
quality of the plants produced is much higher. This is not surpris-
ing because, physiologically, the bioreactor process facilitates plant
growth without stress. The plants thus produced are usually larger,
well rooted, easily acclimatized, and do not suffer many losses. The
advantages are summarized below [73, 74]:
1. Decreased demand for labor
2. Decreased use of appliances (laminar flow, tools for operation)
and jars
3. Reduction in the space required for the micropropagation of
plants
4. Reduction in electricity costs for plant cultivation
5. Total or partial elimination of the use of gelling agents that are
one of the most expensive components in a plant micropropa-
gation unit
6. A significant increase in the multiplication rate of the culti-
vated materials
7. Significant increase in the quality of the plants produced
8. Ease of acclimatization of cultivated materials
9. Decrease in contamination risk in carefully installed operations
The disadvantages of using a bioreactor in a biofactory are
rather few. Plant losses can be quite large if there is contamination,
and the initial cost of an installation may appear too high when
compared to that of traditional biofactories. Initial quality inspec-
tion of plant material should be strict, and, possibly, latent bacterial
indexing may become necessary before the use of this material in a
bioreactor. The problem of hyperhydricity, which normally occurs
in liquid culture, is easily addressed by adjusting the immersion
time of the materials. Problems arising from sterilization in a bio-
reactor system can currently be solved by a set of chemical steriliza-
tions and preparation of liquid culture media in industrial autoclaves
[73, 77].
In conclusion, conventional plant micropropagation is a labor-
intensive operation that results in a very high cost of plants pro-
duced by this technology.
The use of temporary immersion bioreactors is a semiauto-

matic operation that not only solves this problem but also pro-
duces plantlets with a quality that is far superior to those produced
by conventional micropropagation methods.
3 Increasing the Efficiency of Micropropagation for Other Applications
Micropropagation has great importance in improving techniques

to obtain high-efficiency regeneration of cells, tissues, and organs;
it is also useful in developing breeding techniques using biotech-
nological tools and for the production of secondary metabolites
with medicinal properties.
The main advantages of the use of micropropagation as a bio-
technological breeding tool, instead of conventional breeding
techniques, are attributable to the need of very small explants from
the different parts of the plants to start in vitro culture. Other
advantages are the cultivation and regeneration of plants from iso-
lated cells, tissues, or organs, regeneration of complete plants from
unicelular or few agglomerates of cells to avoid chimeras, excellent
control over chemical and physical conditions, an aseptic environ-
ment, regenerated plants that are free of pests and diseases, reduc-
tion of genetic barriers commonly observed in some in vivo crosses,
easy selection of regenerated plants using selective culture media,
controlled systems for test isolated factors in plant development,
and efficient protocols for large and rapid propagation of new gen-
otypes obtained by breeding.
Somatic embryogenesis (SE) is another technique that can be
used to reduce costs and increase the efficiency of micropropagation
techniques. Essentially, this technique is more actually limited to
research on understanding genes and factors that control SE in
plants [78] and is used in protocols applied to produce transgenic
plants [79, 80]. Although SE and the production of synthetic
seeds represent a large potential for application in several species
and were considered a preferred method for propagation of woody
plants [81], some problems that still challenge research in this
century are the warranty of commercial production and the quan-
tity and quality of synthetic seeds produced. The most important
limitations of SE are the limited number of responsive species and
genotypes [81] and the high epigenetic and somaclonal variations
during the development in somatic embryogenesis (especially,
during embryo-to-plantlet conversion). This limits its application
in the commercial production of synthetic seeds in some impor-
tant areas of agriculture, horticulture, and forestry. For example,
Beyene et al. [82] detected the loss of CMD2, a monogenic resis-
tance gene found in cassava (Manihot esculenta) cultivars resistant
to cassava mosaic disease, when immature leaves and axillary buds
were used for tissue regeneration by SE. Although somaclonal
variation in SE-derived plants is detrimental for propagation, the

technique could be used for breeding to obtain superior soma-
clones [83].
The combination of different techniques, SE, and the use of
microcuttings (4–6 cm) rooting, from juvenile acclimatized
SE-derived plantlets, have resulted in significant increases in the
efficiency of Coffea arabica and have reduced the production costs
of in vitro SE derived-plants, from US$ 0.60 to US$ 0.27, pro-
moting mass propagation of coffee plantlets derived from SE tech-
nology [18].
The encapsulation of somatic-derived embryos with a calcium
alginate gel is an alternative to storage and conservation that also
increases germination of the somatic embryos. Further, somatic
embryogenic cultures could be used for cryopreservation [84].
3.1 Plant Breeding The development and evolution of micropropagation techniques

Using Biotechnological also promotes their actual use as biotechnological tools for breed-
Tools ing. The main techniques used are somatic hybridization by proto-
plast isolation and fusion, in vitro pollination and fertilization,
embryo rescue, haploid and double-haploid production, poly-
ploidization, mutation induction, and transgenic plant
production.
Most of these techniques were not possible under in vivo envi-
ronmental conditions because of reproductive barriers and the lim-
ited capacity of isolated cells, tissues, and organs to survive outside
the mother plant.
Among these techniques based on plant tissue culture proto-
cols, the most useful are transgenic plants and haploid and
double-
haploid production because of their potential or realist
technologic applications.
Transgenic plants offer the foremost applications of biotech-
nology in agriculture. Biotech crops (genetically modified or GM
crops) represented 180 million ha in 2015, and 2 billion ha was
cultivated in 20 years of cultivation, from 1996 (start of GM crop
commercialization) to 2015 [85]. The production of transgenic
plants has the main objective of generating more efficient plants,
plants with environmental resistance to salinity, water deficit, and
high temperature, those with resistance to pests and diseases, those
with resistance to herbicides, those that produce essential amino
acids and vitamins to solve malnutrition in undeveloped countries,
those producing vaccines against animal and human diseases, those
producing more resistant fibers for industry, those with new colors
of flowers for the floriculture market, and those with rapid growth
and high resistant wood for the timber industry and the better
knowledge of genes and their function. GM crops could help sus-
tainable agriculture under climate change in this century. However,
onerous regulatory processes continue to be the main constraint in
the adoption of new technologies from transgenic plants.
Golden rice, which is enriched by micronutrients, Clustered

regularly Interspaced short palindromic repeats (CRISPR)-related
technologies, and the expansion of GMO growing areas in Africa
and China in this century, are to be one of the greatest advances in
the future of transgenic plants [85, 86].
Haploid and double-haploid technologies are now used by
many companies to obtain homozygous lineages with hybrid pro-
duction, such as in maize (Zea mays).
The production of haploids can be induced either in vivo or
in vitro. In maize, the main method of haploid induction uses
pollen grains from male lines, called inductors or inducers, which
are crossed with female lineages that produce seedlings at 0.7–
16.8% of haploid-inducing frequency. For screening haploids in
seeds, a marker gene R1-nj is used in the inductor male parent
that has a purple scutellum and a “purple crown” of the aleurone
in diploid zygotic embryos, instead of the white/green in hap-
loids [87]. This technique is called parthenogenesis, but most of
the haploids obtained would be through gynogenesis or pseu-
dogamy. In the first scenario, the concept is related to the devel-
opment of an embryo without fertilization or any stimulus, while
in the second scenario of pseudogamy or gynogenesis, the devel-
opment of embryos requires some stimulus (e.g.,, pollination)
but without inheriting genes from the male parent [88, 89].
Parthenogenesis, using unpollinated ovules and ovaries, can also
be attained in plants [90].
Gynogenesis or pseudogamy can be induced in vivo or in vitro
using different techniques as follows: (1) using an inductor as
described above for maize; (2) using crossings with pollen grains
from distant species; (3) using crossings with irradiated pollen
grains [91]; (4) using triploid pollen grains [92]; and (5) combin-
ing some of these techniques, e.g., irradiating pollen grains of dis-
tant species for use in crossings.
Pollination can be achieved in vitro or in vivo followed by
embryo rescue and in vitro cultivation of seeds or embryos.
Importantly, seed/embryo rescue can also be carried out in vitro.
Froelicher et al. [93] obtained haploid plants from rescued
embryos of small seeds of Citrus clementina, tangor “Ellendale,”
and “Fortune” mandarin, after irradiation with 150 and 300 Gy
of gamma irradiation and crossing with pollen grains from
“Meyer” lemon.
Microspore culture is another technique used to obtain hap-
loids and double haploids and entails cultivation of anthers or iso-
lated microspores in a culture medium in order to switch from
pollen grain formation to gametic embryogenesis induction via
microspores; this is also a more common method of regeneration.
The choice of the best technique for haploid production
depends on the species and cultivars. For example, in Citrus
clementina, microspore culture is very difficult [94] compared
to anther culture; it is possible to produce large quantities of

tri-haploids embryos from small quantities of anthers cultivated
in vitro. Contrarily, in apple (Malus domestica), microspore cul-
ture was found to be ideal for embryo induction rather than
anther culture [95]. In onion (Allium cepa), the best way to
regenerate haploids is by parthenogenesis where flowers are cul-
tivated, but many attempts with anther culture did not result in
haploids in this species [96].
Developing haploid callus, embryos, or plantlets is generally
associated with certain genotypes or species, and this represents
one of the most important factors responsible for successful hap-
loid embryogenesis. The second factor is the stage of the develop-
ment of the microspore, and in most cases, the mid- to
late-uninucleate stage is the most responsive.
The in vitro technique of anther culture is limited by its high
dependence on genotype responses that lead to haploid produc-
tion and a low regeneration percentage in haploid plants [97]. This
absent or very low rate of regeneration of haploids and double
haploids (DH) limits the commercial application of the technique
to only responsive species. Despite research on the efforts to under-
stand the causes of recalcitrance in haploid and double-haploid
induction and regeneration [98], many of the challenges have not
yet been addressed to date. Developing effective protocols cer-
tainly increases the relative importance of haploid and double-
haploid production, especially for economically important crops
such as vegetables, fruits, ornamentals, forest plants, and other
cultures that use hybrid seeds in large numbers for agriculture in
the twenty-first century. The use of this technique also allows the
development of completely homozygous lines in one growth cycle
that can be used for hybrid production rather than conventional
allogamous breeding for hybrid production using successive late
and numerous self-fertilizations [99]. Actually, a centromere-
specific histone 3 variant and correlated transgenes (CENH3-
tailswap and other cenh3 null mutants) can help new discoveries to
improve haploid production, by eliminating mutant chromosomes
from the genome [99, 100], and will be applied mainly for haploid
recalcitrant species [101].
Transgeny using combined double-haploid lineages accelerates
programs of breeding in crops in which the main genotypes used
for cultivation are hybrids [102, 103].
Haploids and double haploids are also used for molecular plant
breeding, genetic studies, and other molecular techniques such as
marker-assisted selection, QTL mapping, genome sequence pro-
grams, and studies on male sterility, among others [13].
Polyploidization is another technique used for the develop-
ment of new cultivars; however, tetraploid cultivars have much
larger organs than diploids. For example, in floriculture, the pro-
duction of larger flowers could cater to a specific market.
Similarly, tetraploids could be used in crossings with diploids

to produce triploids (3×). Triploid cultivars are predominantly
used for seedless fruit production, such as in watermelon (Citrullus
lanatus) and grape (Vitis sp.).
Despite the presence of multiple strategies, micropropagation
continues to be an important method to produce polyploidy plants,
mainly due to certain important advantages. These include the
possibility of using minimal quantities of very expensive antimi-
totic agents, such as colchicine or oryzalin, in the culture medium
to induce polyploidy in cells but with decreased undesirable genetic
variations, establishing solid polyploidy using organogenetic or
embryogenetic processes from one or very small quantities of cell
agglomerates that result in complete polyploid plantlets rather
than common chimeras obtained using other types of in vivo treat-
ment that require larger amounts of tissues/organs (e.g., seeds),
possible rapid multiplication of numerous individual genotypes
from only one or few initial mother plants, asexual propagation of
fruits and flowers, and easy application and clonal propagation of
new triploid genotypes.
The techniques used to produce polyploids include protoplast
isolation and fusion, which are mainly used for obtaining somatic
hybrids (allopolyploids) from different species with the total num-
ber of chromosomes being the sum of each species. Autopolyploids
can also be produced using leaf, internode, or hypocotyl segments
exposed to antimitotic agents for varying periods and concentrations
followed by the regeneration of plantlets from these tissues. Other
applications are rescue and in vitro cultivation of immature embryos
from crossings between 2× and 4× plants to obtain triploid geno-
types and endosperm culture to obtain triploid plantlets.
A combination of techniques used for in vitro immature ovule
culture (50–60 days after pollination) using rescue and in vitro cul-
tivation of ovules in culture media obtained from various crosses
between 2× and 4× grape cultivars is reported to be a good strategy
for obtaining triploids in grape [104, 105].
Triploids could also be obtained from diploid plants by using
cultivation and regeneration of plants from endosperm tissues.
This method has been successfully applied to several species and
represents an important tool for the generation of new triploid
genotypes [106].
3.2 The Use The in vitro milieu provided by a plant micropropagation vessel
of Micropropagation offers the perfect platform for the mass production of secondary
for Secondary metabolites, primarily from medicinal and aromatic plants, many of
Metabolite Production which are used in food, flavorant, perfumery, and medicinal and
pharmaceutical industries. This is because in vitro conditions are
sterile, avoiding competition by microbiological agents while also
providing the most suitable optimized conditions for cellular or
tissue/organ growth. Researchers have always sought ways to
assess optimal conditions, including lighting, temperature, and the

inclusion of plant growth regulators, media, and vessels, to assess
the optimal production of secondary metabolites from MAPs
[107]. One of the most common means to mass produce second-
ary metabolites is through the use of callus or cell suspension cul-
tures (CSCs) in bioreactors, eliciting the production of the desired
compound(s) in continuous liquid culture, while the second popu-
lar method is the mass production of organs, such as leaves, on
in vitro plants, that are then harvested en masse. Biofarming or
biotransformation involves feeding precursors to cell or tissue cul-
tures, allowing them to undergo a series of biochemical reactions
to produce secondary metabolites of interest. Selected noticeable
examples of key MAPs are discussed next.
Callus induced from the roots, stems, leaves, and cotyledons of
Rhodiola sachalinensis could produce salidroside (555 mg/L),
about five- to tenfold higher than wild plants [108]. Cannabinoid
content, especially of ∆9-tetrahydrocannabinol, was stable in
plantlets derived from leaf-induced callus cultures of Cannabis
sativa induced in the presence of 0.5 μM 1-naphthaleneacetic acid
(NAA) and 1.0 μM thidiazuron (TDZ) [109]. The addition of
200 μM methyl jasmonate (MeJA) to Taxus canadensis and Taxus
cuspidata CSCs induced the production of paclitaxel (taxol) and
other taxoids, but paclitaxel never exceeded 20% of the total taxoid
production [110]. MeJA, when combined with TDZ, increased
the production of centelloside from Centella asiatica about 2.4-
fold more than when just MeJA was used [111]. Another popular
chemical elicitor, salicylic acid, allowed for the production of
hypericin and pseudohypericin to be doubled in a Hypericum per-
foratum CSC [112]. The optimization of withanolide production
(withanolide A, withanolide B, withaferin A, and withanone) from
a Withania somnifera CSC was possible by adjusting the levels of
sucrose in a basal CSC that included 40% (w/v) Gracilaria edulis
extract, 200 mg/L L-glutamine, 1 mg/L picloram, and 0.5 mg/L
kinetin [113].
In some circumstances, physical treatments can improve sec-
ondary metabolite production, for example, exposure of
Rosmarinus officinalis stem-induced callus to heat (45 min of
50 °C) increased rosmarinic acid production 1.7-fold relative to
non-heat treatment [114]. Stress induced by ultraviolet light can
also serve as a useful physical treatment to elicit secondary metabo-
lite production. Exposure of Camptotheca acuminata callus cul-
tures to 3 days of UV-B increased camptothecin levels 11-fold
more than no UV induction [115].
Genetic transformation is also a valuable method to produce
secondary metabolites in plant tissue cultures. For example, the
use of Agrobacterium rhizogenes to produce hairy roots in American
ginseng, Panax quinquefolium, allowed for the production of gin-
senosides [116]. Similarly, the ability to genetically engineer
jasmonate-responsive transcription factors would allow for the

controlled production of specific metabolites through chemically
induced control of specific metabolic genes [117].
4 Conclusions and New Perspectives for Micropropagation
The priorities for increasing the importance of micropropagation

techniques in this century require addressing some complex chal-
lenges. A reduction in costs is a clear requirement for the wider use
of micropropagation in various important commercial species that
are used in agriculture, horticulture, and forestry. Other priorities
include increasing the efficiency of micropropagation techniques
to reduce the main costs incurred during micropropagation of
plantlets. Somatic embryogenesis and bioreactor systems could be
techniques that replace conventional micropropagation using agar
sucrose-based media. Advances in photoautotrophic systems are
largely dependent on new sources of light, such as LEDs, laser, or
use of the natural light and represent a solution for sucrose-free
culture that has several benefits with respect to reducing problems
of contamination and increasing the efficiency of micropropaga-
tion. Greenhouse micropropagation is a realistic alternative to
micropropagation in developing countries. Nonetheless, advances
are required in this area, not only for cultivating new species under
these conditions but also for changing the environmental condi-
tions using CO2 injection systems and low-cost efficient alterna-
tives to reduce the temperature as mist fogger systems [118] and
heat tube exchangers for heat on cold nights [119] and comple-
mentary light sources for maintaining photoperiod, e.g., LED
light technologies increase the rate and quality of survival of accli-
matized plantlets [120]. In addition, combining efficient micro-
propagation with other propagation techniques and production
systems, such as microcutting propagation from disease-free
in vitro plantlets under greenhouse conditions, can be an effective
solution for efficient propagation with reduced costs and easy
access to high-quality plantlets with wide application in plant pro-
duction [18, 121].
Many species remain very recalcitrant to in vitro cultivation
and require targeted research to better understand such phenom-
ena and to solve technological problems that can ultimately be
transformed into new technologies. Furthermore, micropropaga-
tion also continues to be an important technique for breeding pur-
poses because it offers a diverse range of advantages compared to
limitations of common and natural reproductive barriers in con-
ventional breeding techniques.
Increases in the importance of the use of cells, tissues, callus, and
plants as a bioreactor for the production of secondary metabolites will
be a solution for the production of biochemicals for pharmaceutical
and medicinal purposes. A combination of transgenic technologies

and the overexpression of target genes are already in use to promote
secondary metabolite production [122]. Plant tissue culture will
increase its use for this purpose, and MAP CSC is a reality for the
production of secondary metabolites [123].
New software and traceability also emerged in many commer-
cial laboratories, which increases management of plantlets pro-
duced in large-scale micropropagated plant production. Also, 3D
printing can improve products and systems for plant tissue culture,
e.g., the development of functional culture vessels [124].
Acknowledgments
JCC thanks CNPQ for the research fellowship No.

304174/2015-7.
Contribution Statements
LTSG contributed writing item 2.4 Bioreactors Systems to Reduce

the Cost of Micropropagated Plantlets. JATS contributed writing
items 2.1 LEDs, CCFLs, and Laser Light for Tissue Culture and
3.2 The Use of Micropropagation for Secondary Metabolite
Production and with final revision of all the text. JCC contributed
writing all other items in the chapter and final revision of the text.
References
1. Haberlandt G (1902) Culturversuche mit iso- 7. Sussex IM (2008) The scientific roots of
lierten Pflanzenzellen. Sitz-Ber. Mat Nat Kl modern plant biotechnology. Plant Cell
Kais Akad Wiss Wien 111:69–92 20:1189–1198
2. White PR (1934) Potentially unlimited 8. Knudson L (1922) Nonsymbiotic germina-
growth of excised tomato root tips in a liquid tion of orchid seeds. Bot Gaz 73:1–25
medium. Plant Physiol 9:585–600 9. Murashige T, Skoog F (1962) A revised medium
3. White PR (1939) Potentially unlimited for rapid growth and bio assays with tobacco tis-
growth of excised plant callus in an artificial sue cultures. Physiol Plant 15:473–497
nutrient. Am J Bot 26:59–64 10. White PR (1943) A handbook of plant tissue
4. White PR (1939) Controlled differentiation culture. Ronald Press Co, New York
in a plant tissue culture. Bull Torrey Bot Club 11. Vij S, Pathak D, Kaur N et al (2016)
66:507–513 Development and molecular confirmation of
5. Skoog F, Miller CO (1957) Chemical regula- interspecific hybrids between Gossypium hirsu-
tion of growth and organ formation in plant tum and Gossypium arboreum. Agric Res
tissues cultured in vitro. Symp Soc Exp Biol J 53:169–172
11:118–131 12. Cruz-Mendívil A, Rivera-López J, Germán-
6. Skoog F, Tsui C (1948) Chemical control of Baez LJ et al (2011) A simple and efficient
growth and bud formation in tobacco stem protocol for plant regeneration and genetic
segments and callus cultured in vitro. Am transformation of tomato cv. Micro-tom from
J Bot 35:782–787 leaf explants. Hortscience 46:1655–1660
13. Germanà MA (2011) Gametic embryogenesis 25. Ahloowalia BS (1994) Production and per-
and haploid technology as valuable support to formance of potato mini-tubers. Euphytica
plant breeding. Plant Cell Rep 30:839–857 75:163–172
14. Kaur A, Sandhu JS (2015) High throughput 26. Haapala T, Cortbaoui R, Chujoy E (2008)
in vitro micropropagation of sugarcane Production of disease-free seed tubers.
(Sacharum officinarum L.) from spindle leaf International year of the potato (FAO).
roll segments: cost analysis for Agri-business http://www.fao.org/potato-2008/pdf/
industry. Plant Cell Tiss Org Cult IYP-9en.pdf. Accessed 20 Apr 2018
120:339–350 27. Tierno R, Carrasco A, Ritter E et al (2014)
15. Chen C (2016) Cost analysis of micropropa- Differential growth response and minituber
gation of Phalaenopsis. Plant Cell Tissue production of three potato cultivars under
Organ Cult 126:167–175 aeroponics and greenhouse bed culture. Am
16. IAEA-TECDOC (2004) Low cost options J Potato Res 91:346–353
for tissue culture technology in developing 28. Cardoso JC, Teixeira da Silva JA (2013)
countries. IAEA-TECDOC-1384, IAEA, Gerbera micropropagation. Biotechnol Adv
Vienna. http://www.pub.iaea.org/MTCD/ 31:1344–1357
publications/PDF/te_1384_web.pdf. 29. Cardoso JC, Habermann G (2014)
Accessed 20 Apr 2018 Adventitious shoot induction from leaf seg-
17. Xiao Y, Kozai T (2004) Commercial applica- ments in Anthurium andreanum is affected
tion of a photoautotrophic micropropagation by age of explant, leaf orientation and plant
systems using large vessels with forced ventila- growth regulator. Hortic Environ Biotechnol
tion: plantlet growth and production cost. 55:56–62
Hortscience 39:1387–1391 30. Lloyd G, McCown B (1981) Commercially
18. Georget F, Courtel P, Garcia EM et al (2017) feasible micropropagation of mountain
Somatic embryogenesis-derived coffee plant- Laurel, Kalmia latifolia, by use of shoot tip
lets can be efficiently propagated by horticul- culture. Combined Proc Int Plant Prop Soc
tural rooted mini-cuttings: a boost for somatic 30:421–427
embryogenesis. Sci Hortic 216:177–185 31. Oliveira LS, Brondani GE, Batagin-Piotto
19. Erig AC, Schuch MW (2005) KD et al (2015) Micropropagation of
Photoautotrophic micropropagation and use Eucalyptus cloeziana mature trees. J Aus For
of the natural light. Ciência Rural 78(4):219–231
35(4):961–965 32. Bourget MC (2008) An introduction to light-
20. Purohit SD, Teixeira da Silva JA, Habibi N emitting diodes. Hortscience 43:1944–1946
(2011) Current approaches for cheaper and 33. Morrow RC (2008) LED lighting in horti-
better micropropagation technologies. Int culture. Hortscience 43:1947–1950
J Plant Dev Biol 5:1–36 34. Wang Z, Li G-Y, He S-L, Teixeira da Silva JA,
21. Kozai T (1991) Photoautotrophic micro- Tanaka M (2011) Effects of cold cathode
propagation. In Vitro Cell Dev Biol Plant fluorescent lamps (CCFLs) on growth of
27:47–51 Gerbera jamesonii plantlets in vitro. Sci Hortic
22. Chun YW (1992) Clonal propagation in non- 130:482–484
aspen poplar hybrids. In: Ahuja MR (ed) 35. Norikane A, Teixeira da Silva JA, Tanaka M
Micropropagation of woody plants. Springer, (2013) Growth of in vitro Oncidesa plantlets
Netherlands cultured under cold cathode fluorescent
23. Singh HP, Uma S, Selvarajan R, Karihaloo JL lamps (CCFLs) with super-elevated CO2
(2011) Micropropagation for production of enrichment. AoB Plants 5:plt044. https://
quality banana planting material in AsiaPacific. doi.org/10.1093/aobpla/plt044
Asia-Pacific Consortium on Agricultural 36. Massa GD, Kim HH, Wheeler RM, Mitchell
Biotechnology (APCoAB), New Delhi, India. CA (2008) Plant productivity in response to
h t t p : / / w w w. a p c o a b . o r g / u p l o a d s / LED lighting. Hortscience 43:1951–1956
files/1298295339pub_banana.pdf. Accessed 37. Nakamura et al (1996) Light emitting gal-
20 Apr 2018 lium nitride-based compound semiconductor
24. Souza ALK, Schuch MW, Antunes LEC et al device. U.S. Patent 5,578,839, filed Nov. 17,
(2011) Desempenho de mudas de mirtilo 1993 and issued Nov. 26
obtidas por micropropagação ou estaquia. 38. Nhut DT, Takamura T, Watanabe H,
Pesq Agrop Brasileira 46(8):868–874 Okamoto K, Tanaka M (2003) Responses of
strawberry plantlets cultured in vitro under 49. Kozai T, lwabuchi K, Watanabe K et al (1991)
super-bright red and blue light-emitting Photoautotrophic and photomixotrophic
diodes (LED). Plant Cell Tissue Org Cult growth of strawberry plantlets in vitro and
73:43–52 changes in nutrient composition of the
39. Kim SJ, Hahn EJ, Heo JW, KY PK (2004) medium. Plant Cell Tissue Org Cult
Effects of LEDs on net photosynthetic rate, 25:107–115
growth and leaf stomata of Chrysanthemum 50. Tanaka M, Hirano T, Goi M et al (1992)
plantlets in vitro. Sci Hortic 101:143–151 Practical application of a novel disposable film
40. Jao RC, Lai CC, Fang W, Chang SF (2005) culture vessel in micropropagation. Acta
Effect of red light on the growth of Hortic 300:77–84
Zantedeschia plantlets in vitro and tuber for- 51. Tanaka M, Giang DTT, Murakami A (2005)
mation using light emitting diodes. Application of a novel disposable film culture
Hortscience 40:436–438 system to photoautotrophic micropropaga-
41. Poudel RP, Kataoka I, Mochioka R (2008) tion of Eucalyptus uro-grandis (Urophylia x
Effect of red-and blue-light-emitting diodes grandis). In vitro Cell Dev Biol Plant
on growth and morphogenesis of grapes. 41:173–180
Plant Cell Tissue Org Cult 92:147–153 52. Teixeira da Silva JA (2006) Photoautotrophic
42. Teixeira da Silva JA (2014a) The response of micropropagation of Spathiphyllum.
protocorm-like bodies of nine hybrid Photosynthetica 44:53–61
Cymbidium cultivars to light-emitting diodes. 53. Xiao Y, Niu G, Kozai T (2011) Development
Environ Exp Biol 12:155–159 and application of photoautotrophic micro-
43. Teixeira da Silva JA (2014b) Photoauto-, propagation plant system. Plant Cell Tissue
photohetero- and photomixotrophic in vitro Org Cult 105:149–158
propagation of papaya (Carica papaya L.) 54. Aitken-Christie J, Kozai T, Smith ML (1995)
and response of seed and seedlings to light- Automation and environmental control in
emitting diodes. Thammasat Int J Sci Tech plant tissue culture. Kluwer Academic
19:57–71 Publishers, Springer Netherlands
44. Song Y, Jiang C, Gao L (2016) Polychromatic 55. Shin K-S, Park SY, Paek K-Y (2014)
supplemental lighting from underneath can- Physiological and biochemical changes during
opy is more effective to enhance tomato acclimatization in a Doritaenopsis hybrid culti-
plant development by improving leaf photo- vated in different microenvironments in vitro.
synthesis and stomatal regulation. Front Environ Exp Bot 100:26–33
Plant Sci 7:1832. https://doi.org/10.3389/ 56. Schimildt O, Torres Netto A, Schimildt ER
fpls.2016.01832 et al (2015) Photosynthetic capacity,
45. Ooi A, Wong A, Ng TK, Marondedze C, growth and water relations in ‘golden’
Gehring C, Ooi BS (2016) Growth and papaya cultivated in vitro under modifica-
development of Arabidopsis thaliana under tions in light quality, sucrose concentration
single-wavelength red and blue laser light. Sci and ventilation. Theor Exp Plant Physiol
Rep 6:33885. https://doi.org/10.1038/ 27:7–18
srep33885 57. Cardoso JC, Rossi ML, Rosalem IB, Teixeira
46. Chang SX, Li CX, Yao XY et al (2016) da Silva JA (2013) Pre-acclimatization in the
Morphological, photosynthetic, and physio- greenhouse: an alternative to optimizing the
logical responses of rapeseed leaf to different micropropagation of gerbera. Sci Hortic
combinations of red and blue lights at the 164:616–624
rosette stage. Front Plant Sci 7:1144. https:// 58. Zapata Arias FJ, Akter S, Asadul Haque SM
doi.org/10.3389/fpls.2016.01144 et al (2014) The significance of non-
47. Park SY, Edward YC, Paek KY (2010) controlled natural light, temperature and
Endoreduplication in Phalaenopsis is affected humidity in the commercial micropropaga-
by light quality from light-emitting diodes tion of Solanum tuberosum L. cultivar
during somatic embryogenesis. Plant Diamant. Plant Tissue Cult Biotechnol
Biotechnol Rep 4:303–309 24:131–139
48. Kozai T (1991) Micropropagation under 59. Kodym A, Zapata-Arias FJ (1998) Natural
photoautotrophic conditions. In: Debergh light as an alternative light source for the
PC, Zimmerman RH (eds) Micropropagation. in vitro culture of banana (Musa acuminata
Kluwer Academic Publishers, Springer cv). ‘Grand Naine’. Plant Cell Tissue Org
Netherlands Cult 55:141–145
60. Kodym A, Hollenthoner S, Zapata Arias FJ sugar mill: achievements and problems. STAB
(2001) Cost reduction in micropropagation 13:33–34
of banana by using tubular skylights as source 73. Lee TSG (ed) (2011) Biofábrica de plantas:
of natural lighting. In Vitro Cell Dev Biol produção industrial de plantas in vitro.
Plant 37:237–242 Antiqua, Brazil
61. Costa FHS, Pasqual M, Pereira JES (2009) 74. Teixeira JB (2011) Biorreator de immersão
Anatomical and physiological modifications temporária - o futuro da produção industrial
of micropropagated ‘Caipira’ banana plants de plantas in vitro. In: Lee TSG (ed) Biofábrica
under natural light. Sci Agric 66:323–330 de plantas: produção industrial de plantas
62. da Silva AB, Pasqual M, de Castro EM et al in vitro. Antiqua, Brazil
(2008) Luz natural na micropropagação do 75. Alvard D, Cote F, Teisson C (1993)
abacaxizeiro (Ananas comosus L. Merr). Comparison of methods of liquid medium
Interciência 33:839–843 culture for banana micropropagation. Plant
63. Mazri MA (2012) Effect of liquid media and Cell Tissue Org Cult 32:55–60
in vitro pre-acclimatization stage on shoot 76. Teisson C, Alvard D (1995) A new concept of
elongation and acclimatization of date palm plant in vitro cultivation liquid medium: tem-
(Phoenyx dactylifera L.) cv. Najda. J Ornam porary immersion. In: Terzi M et al (eds)
Plants 2:225–231 Current issues in plant molecular and cellular
64. Teixeira SL, Ribeiro JM, Teixeira MT (2006) biology. Kluwer Academic Publishers,
Influence of NaOCl on nutrient medium ster- Netherlands
ilization and on pineapple (Ananas comosus 77. Cabral JB (2011) Sistema de imersão tem-
cv. Smooth cayenne) behavior. Plant Cell porária (sit) na produção em larga escala de
Tissue Org Cult 86:375–378 vitroplantas. In: Lee TSG (ed) Biofábrica de
65. Silva ALL, Brondani GE, Oliveira LS, plantas: produção industrial de plantas
Gonçalves NA (2013) Chemical sterilization in vitro. Antiqua, Brazil
of culture medium: a low cost alternative to 78. Mozgová I, Muñoz-Viana R, Hennig L
in vitro establishment of plants. Sci For (2017) PRC2 represses hormone-induced
41:257–264 somatic embryogenesis in vegetative tissue of
66. Pais AK, da Silva AP, Souza JC et al (2016) Arabidopsis thaliana. PLoS Genet
Sodium hypochlorite sterilization of culture 13:e1006562. https://doi.org/10.1371/
medium in micropropagation of Gerbera hyb- journal.pgen.1006562
rida cv. Essandre. Afr J Biotechnol 79. Xing W, Bao Y, Luo P et al (2014) An effi-
15:1995–1998 cient system to produce transgenic plants via
67. Cardoso JC (2009) Esterilização química de cyclic leave-originated secondary somatic
meio de cultura no cultivo in vitro de antúrio. embryogenesis in Rosa rugosa. Acta Physiol
Pesq Agrop Brasileira 44:785–788 Plant 36:2013–2023
68. Cardoso JC, Teixeira da Silva JA (2012) 80. Wu J, Liu C, Seng S et al (2015) Somatic
Micropropagation of gerbera using chlorine embryogenesis and Agrobacterium-mediated
dioxide (ClO2) to sterilize the culture transformation of Gladiolus hybridus cv.
medium. In Vitro Cell Dev Biol Plant ‘Advanced red’. Plant Cell Tissue Org Cult
48:362–368 120:717–728
69. Macek T, Král J, Vaněk T et al (1994) 81. Guan Y, Li S-G, Fan X-F, Su Z-H (2016)
Chemical sterilization of nutrient media for Application of somatic embryogenesis in
plant cell cultures using diethylpyrocarbon- woody plants. Front Plant Sci 7:938. https://
ate. Biotechnol Tech 8:885–888 doi.org/10.3389/fpls.2016.00938
70. Yanagawa T, Nagai M, Ogino T, Maeguchi R 82. Beyene G, Chauhan RD, Wagaba H et al
(1995) Application of disinfectants to orchid (2016) Loss of CMD-2 resistance to cassava
seeds, plantlets and media as a means to pre- mosaic disease in plants regenerated through
vent in vitro contamination. Lindleyana somatic embryogenesis. Mol Plant Pathol
10:33–36 17:1095–1110
71. Pan MJ, van Staden J (1999) Effect of acti- 83. Dey T, Saha S, Ghosh PD (2015) Somaclonal
vated charcoal, autoclaving and culture media variation among somatic embryo derived
on sucrose hydrolysis. Plant Growth Regul plants – evaluation of agronomically impor-
29:135–141 tant somaclones and detection of genetic
72. Uchôa PEA, Nogueira P Jr, Neto JAP, Lee changes by RAPD in Cymbopogon winteria-
TSG (1995) Biofactory of sugarcane at Ester nus. S Afr J Bot 96:112–121
84. Adu-Gyamfi R, Wetten A, Marcelino 96. Jakse M, Bohanec B (2003) Haploid induc-
Rodríguez López C (2016) Effect of cryo- tion in onion via gynogenesis. In: Maluszynski
preservation and post-cryopreservation M, Kasha KJ, Forster BP, Szarejko I (eds)
somatic embryogenesis on the epigenetic Double haploid production in crop plants.
fidelity of cocoa (Theobroma cacao L.). PLoS Springer, Netherlands
One 11:e0158857. https://doi. 97. Cardoso JC, Martinelli AP, Germanà MA,
org/10.1371/journal.pone.0158857 Latado RR (2014) In vitro anther culture of
85. ISAAA (2015) ISAAA Brief 51–2015: sweet orange (Citrus sinensis L. Osbeck) gen-
Executive summary. Global Status of otypes and of a C. clementina x C. sinensis
Commercialized Biotech: GM Crops 2015. ‘Hamlin’ hybrid. Plant Cell Tissue Org
ISAAA. http://isaaa.org/resources/publica- 117:455–464
tions/briefs/51/executivesummary/default. 98. Żur I, Dubas E, Krzewska M et al (2015)
asp, Accessed 20 Apr 2018 Hormonal requirements for effective induc-
86. Khatodia S, Bhatotia K, Passricha N, Khurana tion of microspore embryogenesis in triticale
SMP, Tuteja N (2016) The CRISPR/Cas (x Triticosecale Wittm.) anther cultures. Plant
genome-editing tool: application in improve- Cell Rep 34:47–62
ment of crops. Front Plant Sci 7:506. https:// 99. Britt AB, Kuppu S (2016) Cenh3: an emerg-
doi.org/10.3389/fpls.2016.00506 ing player in haploid induction technology.
87. Rotarenco V, Dicu G, State D, Fuia S (2010) Front Plant Sci 7:357. https://doi.
New inducers of maternal haploids in maize. org/10.3389/fpls.2016.00357
Maize Gen Cooperation Newsletter 84. 100. Ravi M, Chan SW (2010) Haploid plants pro-
http://www.agron.missouri.edu/mnl/84/ duced by centromere-mediated genome elim-
PDF/15rotarenco.pdf. Accessed 20 Apr ination. Nature 464:615–618
2018
101. Kelliher T, Starr D, Wang W et al (2016)
88. Nogler GA (1984) Gametophytic apomixis. Maternal haploids are preferentially induced by
In: Johri BM (ed) Embryology of angio- CENH3-tailswap transgenic complementation
sperms. Springer, Germany in maize. Front Plant Sci 7:414. https://doi.
89. Schlupp I (2005) The evolutionary ecology org/10.3389/fpls.2016.00414
of gynogenesis. Annu Rev Ecol Evol Syst 102. Brew-Appiah RAT, Ankrah N, Liu W (2013)
36:1–689 Generation of doubled haploid transgenic
90. Yan H, Yang H-Y, Jensen WA (1989) An elec- wheat lines by microspore transformation.
tron microscope study on in vitro partheno- PLoS One 8:e80155. https://doi.
genesis in sunflower. Sex Plant Reprod org/10.1371/journal.pone.0080155
2:154–156 103. Datta K, Sahoo G, Krishnan S et al (2014)
91. Blasco M, Badenes ML, del Mar Naval M Genetic stability developed for β-carotene
(2016) Induced parthenogenesis by gamma- synthesis in BR29 rice line using dihaploid
irradiated pollen in loquat for haploid pro- homozygosity. PLoS One 9:e100212.
duction. Breed Sci 66:606–612 https://doi.org/10.1371/journal.
92. Germanà MA, Chiancone B (2001) pone.0100212
Gynogenetic haploids of Citrus after in vitro 104. Yamashita H, Shigehara I, Haniuda T (1998)
pollination with triploid pollen grains. Plant Production of triploid grapes by in ovulo
Cell Tissue Org Cult 66:59–66 embryo culture. Vitis 37:113–117
93. Froelicher Y, Bassene JB, Jedidi-Neji E et al 105. Ji W, Li GR, Luo YX et al (2015) In vitro
(2007) Induced parthenogenesis in mandarin embryo rescue culture of F1 progenies from
for haploid production: induction procedures crosses between different ploidy grapes.
and genetic analysis of plantlets. Plant Cell Genet Mol Res 14:18616–18622
Rep 26:937–944 106. Hoshino Y, Miyashita H, Thomas TD (2011)
94. Chiancone B, Gniech Karasawa MM, In vitro culture of endosperm and its applica-
Gianguzzi V et al (2015) Early embryo tion in plant breeding: approaches to poly-
achievement through isolated microspore cul- ploidy breeding. Sci Hortic 130:1–8
ture in Citrus clementina Hort. Ex tan., cvs. 107. Máthé Á, Hassan F, Abdul Kader A (2015) In
‘Monreal Rosso’ and ‘Nules’. Front Plant Sci vitro micropropagation of medicinal and aro-
6:413. https://doi.org/10.3389/ matic plants. In: Máthé Á (ed) Medicinal and
fpls.2015.00413 aromatic plants of the world (Vol. 1 of the
95. Höfer M (2004) In vitro androgenesis in series medicinal and aromatic plants of the
apple – improvement of the induction phase. world). Springer Science+Business Media,
Plant Cell Rep 22:365–370 Netherlands
108. Wu S, Zu Y, Wu M (2003) High yield pro- quefolium L. and their antimicrobial activity.
duction of salidroside in the suspension cul- In Vitro Cell Dev Biol Plant 49:24–29
ture of Rhodiola sachalinensis. J Biotechnol 117. Shoji T, Hashimoto T (2013) Jasmonate-

106:33–43 responsive transcription factors: new tools
109. Lata H, Chandra S, Khan IA, ElSohly MA for metabolic engineering and gene discovery.
(2010) High frequency plant regeneration In: Chandra S, Lata H, Varma A (eds)
from leaf derived callus of high Biotechnology for medicinal plants. Springer-
Δ9-tetrahydrocannabinol yielding Cannabis Verlag, Berlin
sativa L. Planta Med 76:1629–1633 118. Watjanatepin N, Wong-Satiean W (2014) The
110. Ketchum REB, Gibson DM, Croteau RB,
design and construction of the PV-wind
Schuler ML (1999) The kinetics of taxoid autonomous system for greenhouse planta-
accumulation in cell suspension cultures of tions in Central Thailand. Int J Environ
Taxus following elicitation with methyl jas- Chem Ecol Geol Geophys Eng 8:884–888
monate. Biotechnol Bioeng 62:97–105 119. Jethva KR, Sharan G (2016) Assessment of
111. Yoo NH, Kim OT, Kim JB et al (2011)
environment control in arid area greenhouse
Enhancement of centelloside production coupled with earth tube heat exchanger. Curr
from cultured plants of Centella asiatica by World Environ 11:243–250
combination of thidiazuron and methyl jas- 120. Ferreira LT, de Araújo Silva MM, Ulisses C
monate. Plant Biotechnol Rep 5:283–287 et al (2017) Using led lighting in somatic
112.
Gadzovska S, Maury S, Delaunay A, embryogenesis and micropropagation of an
Spasenoski M, Hagège D, Courtois D, Joseph elite sugarcane variety and its effects on redox
C (2013) The influence of salicylic acid elici- metabolism during acclimatization. Plant Cell
tation of shoots, callus, and cell suspension Tissue Org Cult 128:211–221
cultures on production of naphtodianthrones 121. Kaur A, Sandhu JS (2015) High throughput
and phenylpropanoids in Hypericum perfora- in vitro micropropagation of sugarcane
tum L. Plant Cell Tissue Org Cult 113: (Saccharum officinarum L.) from spindle leaf
25–39 roll segments: cost analysis for Agri-business
113. Sivanandhan G, Kapil Dev G, Jeyaraj M et al industry. Plant Cell Tissue Org Cult
(2013) A promising approach on biomass 120:339–350
accumulation and withanolides production in 122. Liu Y, Sun G, Zhong Z et al (2016)

cell suspension culture of Withania somnifera Overexpression of AtEDT1 promotes root
(L.) Dunal. Protoplasma 250:885–898 elongation and affects medicinal secondary
114. Yesil-Celiktas O, Nartop P, Gurel A, Bedir E, metabolite biosynthesis in roots of transgenic
Vardar-Sukan F (2007) Determination of Salvia miltiorrhiza. Protoplasma 254:1617–
phenolic content and antioxidant activity of 1625. https://doi.org/10.1007/s00709-
extracts obtained from Rosmarinus officinalis’ 016-1045-0
calli. J Plant Physiol 164:1536–1542 123. Yue W, Ming Q-L, Lin B et al (2016)

115. Pi Y, Jiang KJ, Hou R et al (2010)
Medicinal plant cell suspension cultures:
Examination of camptothecin and pharmaceutical applications and high-yielding
10-hydroxycamptothecin in Camptotheca strategies for the desired secondary metabo-
acuminata plant and cell culture, and the lites. J Crit Rev Biotechnol 36:215–232
affected yields under several cell culture treat- 124. Shukla MR, Singh AS, Piunno K et al (2017)
ments. Biocell 34:139–143 Application of 3D printing to prototype and
116. Kochan E, Wasiela M, Sienkiewicz M (2013) develop novel plant tissue culture systems.
The production of ginsenosides in hairy root Plant Methods 13:6. https://doi.org/
cultures of American ginseng, Panax quin- 10.1186/s13007-017-0156-8
Chapter 3
Cellular and Morpho-histological Foundations of In Vitro

Plant Regeneration
Diego Ismael Rocha, Lorena Melo Vieira, Andréa Dias Koehler,
and Wagner Campos Otoni
Abstract
In vitro plant regeneration systems have turned into invaluable tools to plant biotechnology. Despite being
poorly understood, the molecular mechanisms underlying the control of both morphogenetic pathways,
de novo organogenesis and somatic embryogenesis, have been supported by recent findings involving
proteome-, metabolome-, and transcriptome-based profiles. Notwithstanding, the integration of molecu-
lar data with structural aspects has been an important strategy of study attempting to elucidate the basis of
the cell competence acquisition to further follow commitment and determination to specific a particular
in vitro regeneration pathway. In that sense, morpho-histological tools have allowed to recognize cellular
markers and patterns of gene expression at cellular level and this way have collaborated in the identification
of the cell types with high regenerative capacity. This chapter ties together up those fundamental and
important microscopy techniques that help to elucidate that regeneration occurs, most of the time, from
epidermis or subepidermal cells and from the procambial cells (pericycle and vascular parenchyma).
Important findings are discussed toward ultrastructural differences observed in the nuclear organization
among pluripotent and totipotent cells, implying that regeneration occurs from two cellular mechanisms
based on cellular reprogramming or reactivation.
Key words Histology, Morphology
1 Introduction
The capacity of a plant cell to acquire competence and assume a

new developmental fate after modulation of the growth conditions
is the basis for the establishment of plant regeneration systems.
Regeneration is a physiological process and refers here to the abil-
ity of a given cell be able to regenerate new tissues, organs, or the
whole individual. This process is widely conserved and appears to
be a fundamental adaptive strategy for plants [1]. It can be induced
in nature or in vitro which has long been utilized for clonal
propagation.
47
48 Diego Ismael Rocha et al.
Under in vitro conditions, there are two main morphogenetic

pathways extensively used for plant regeneration of higher plants:
de novo organogenesis and somatic embryogenesis. These path-
ways have been exploited for the vegetative propagation and con-
tributed to contemporary plant biotechnology allowing the
sophistication of genetic transformation and cloning practices.
Researchers have attempted to extend these practices to agricultur-
ally important crops as a prerequisite for in vitro genetic manipula-
tions. Several plant regeneration systems have been established
with applications in tissue culture-based techniques and genetic
transformation for many plant species, and an intensive work has
been conducted to overcome some of the drawbacks of these sys-
tems [2].
Over the recent decades, a range of descriptive studies using
light and electron microscopy has provided detailed characteriza-
tion of morpho-histological events underlying the progression
from somatic cells to the formation of apical meristems (de novo
organogenesis) or somatic embryos (somatic embryogenesis).
These microscopy studies have contributed to the better under-
standing the basic cellular mechanisms related to the induction of
the different plant morphogenetic pathways. Here, we summarize
our current understanding of the histological and ultrastructural
changes involved to both de novo organogenesis and somatic
embryogenesis induction. We also describe some microscopy tech-
niques that may be helpful for further works.
2 Concepts and General Aspects of In Vitro Plant Regeneration
2.1 Developmental The establishment of efficient in vitro regeneration systems requires

Pathways a high degree of developmental plasticity. For that, explants are
cultured in vitro in nutrient media supplemented with plant growth
regulators in order to enhance the regenerative capacity and induce
a given morphogenetic pathway. De novo organogenesis refers to
the formation of ectopic apical meristems and subsequently devel-
opment of shoots and roots, in a monopolar pattern, temporally
and spatially apart. The meristems are formed by a group of plant
stem cells that can both renew themselves and differentiated gen-
erating tissues and organs through cell division and differentiation.
Somatic embryogenesis, by its turn, is the process in which a bipo-
lar structure similar to zygotic embryos (containing both shoot
and root apical meristems differentiated simultaneously at opposite
poles) is formed and subsequently generates whole plant bodies.
Both de novo organogenesis and somatic embryogenesis pathways
occur either directly from parental tissues or indirectly via the for-
mation of a callus, being mainly influenced by the type of explant
and the plant growth regulator signaling.
Histology in In Vitro Cultures 49
The use of plant growth regulators is a landmark breakthrough

in the history of plant tissue culture. Since the classical finding of
Skoog and Miller [3], the balance between auxins and cytokinins
exogenously applied in the culture media is still the guiding prin-
ciple to determine the fate of regenerating tissue. In general, high
ratios of cytokinin to auxin induces de novo shoot organogenesis,
whereas opposite low ratios result in root development. An appro-
priate concentration and type of exogenous auxin are also crucial
to induce somatic embryogenesis in many plant species. During
early events of somatic embryogenesis induction, high levels of
auxin are required in the culture medium to promote cell prolifera-
tion and embryonic callus formation [4]. After that, the explants
are transferred to auxin-free medium for reestablishing the auxin
gradients in the embryonic callus. This initiates a developmental
program similar to zygotic embryogenesis and is also guided by
polarized auxin distribution [5]. Among the synthetic auxins,
2,4-dichlorophenoxyacetic acid (2,4-D) is the most effective
inducer of somatic embryos, possibly because it triggers both auxin
and stress responses simultaneously [6].
2.2 Morphological Based on the requirements and effects of exogenous plant growth
Phases regulators, both de novo organogenesis and somatic embryogen-
esis pathways can be generally divided into three morphological
phases: (1) morphogenetic acquisition of competence, somatic
cells acquire competence to assume a new developmental fate; (2)
cell determination, competent cell or tissue becomes committed in
response to exogenous plant growth regulator supplementation;
and (3) morphological differentiation, morphogenesis proceeding
independently of exogenous plant growth regulator supplementa-
tion [7–9]. Although these established morphological phases are
not easily recognized in the morphogenetic pathways of some spe-
cies, the first phase, competence acquisition, is certainly conserved
and denoted as a key step in plant regeneration process [10–12].
The acquisition of competence is acquired by somatic cells that
are able to respond a specific hormonal signal breaking their deter-
mined cell fate. These competent cells originate the meristematic-
like centers and assume a new developmental route [13]. According
to the degree of dedifferentiation, these competent cells can be
characterized as multipotent, totipotent, or pluripotent. The cel-
lular totipotency corresponds to the ability of a single cell to pro-
duce different kinds of cell within a particular cell lineage [14].
The pluripotency is the cellular ability to give rise to complete
organ formation but not the entirety of plant body (e.g., shoot or
root formation), whereas totipotent cells can give rise to all the cell
types constituting the plant body [15]. Both pluri- and totipotency
terms have been used to describe the competent cells in organo-
genic and embryogenic developmental pathways, respectively [16].
3 Structural and Ultrastructural Aspects of In Vitro Plant Regeneration
3.1 Morpho- Plant regeneration may be induced from different parts of plant
histological Origins body (Fig. 1). Shoot tips or nodal segments carrying a single bud
of In Vitro Plant have been used for clonal propagation to produce multiple shoots
Regeneration (Fig. 1). These explants are referred as meristematic explants, and
the regeneration occurs from the activation of the preexisting bud
that begins to develop. The regeneration of shoot, root, or even
the whole plant can also be induced from non-meristematic
explants (Fig. 1). In this case, the formation of new organs is
induced de novo from mature somatic tissues and occurs, primar-
ily, at the cut surfaces of the explants [17]. Protoplast or haploid
cells such as pollen and ovules have also been used to regenerate
plants via somatic embryogenesis (Fig. 1) [8, 18–21]. It has long
been known that mature somatic tissues may have low regenerative
capacity. Thus, young juvenile tissues have been used as explants
for in vitro regeneration of many plant species, as they are com-
posed of cells in the beginning of their developmental path and are
potentially totipotent [22]. The regeneration in grasses and mono-
cotyledonous species, for example, has long been thought to be
very difficult, and it has been obtained only from zygotic embryos,
inflorescences, or tissue derived from juvenile shoots [23, 24].
According to Ikeuchi et al. [25], plants possess at least two dis-
tinct cellular strategies to begin the process of regeneration. One is
through the reactivation of relatively undifferentiated cells and the
other through the reprogramming of differentiated somatic cells.
In both cases, regeneration relies on the phenomenon of cellular
plasticity, which can be broadly defined as the ability to re-specify
cell fate. Interestingly, most histological tracking studies of plant
regeneration process have demonstrated that the morphogenesis
responses typically originate from reactivation of pericycle and/or
vascular parenchyma (Fig. 2b, c) [26–29] or from reprogramming
of epidermal and/or subepidermal cells (Fig. 2a) [16, 30–33].
Pericycle has been proposed to be an extended meristem in the
plant body ended [34, 35]. It is constituted by pluripotent cells
and is able to acquire different cell fates depending on the condi-
tions to which they are subjected (Fig. 2b, c). Several studies have
reported the involvement of pericycle cells in the regeneration of
embryos and/or buds mainly from root explants [29, 33, 36–39].
This is consistent with recent studies on the molecular mechanisms
involved in in vitro morphogenesis. Many lines of evidence support
the understanding that pericycle and vascular parenchyma cells are
intrinsically prone to undertake different morphogenetic pathways
[34, 40–42].
While it is clear the formation of the pluripotent pericycle-like
cells, the mechanisms related to the reprogramming of epidermal
cells and their capacity to produce pluri-/totipotent cell lineages
Fig. 1 Pathways of in vitro plant regeneration. (a) Common types of explants used to induce regeneration in vitro.
(b) Somatic embryogenesis obtained from leaf explants of Coffea sp. (c, d) Regeneration of a somatic embryo
(d) from Passiflora gibertii protoplasts (c). (e) Regeneration of multiple shoots from nodal segment of Herreria
salsaparrilha. (f) De novo shoot organogenesis obtained from hypocotyls of Bixa orellana. (g) Somatic embryo-
genesis induced from Eustoma grandiflorum root explants. Based on Ikeuchi et al. [25]
still remain elusive. The involvement of epidermal and subepider-

mal cells in plant regeneration has been reported in a number of
morpho-histological studies, mostly derived from leaf and cotyle-
don explants (Fig. 2a). It is believed that contact between the
explant and the nutrient medium makes the epidermal and
subepidermal cell layers more prone to perceive hormonal signal-
ing that triggers the regeneration process. In fact, an accumulation
of auxin was identified in protodermal cells of Arabidopsis zygotic
embryo explants incubated on auxin-rich medium [43]. However,
the molecular regulation related to the reprogramming of epider-
mal cells is still poorly understood.
Fig. 2 Histological origins of in vitro plant regeneration. (a) Somatic embryogenesis from cotyledons of Bixa
orellana. Transverse sections showing that epidermal cells (arrowhead) give rise to somatic embryos (aster-
isk). (b, c) De novo shoot organogenesis induction from hypocotyl (b) and root (c) segments of Passiflora edulis.
Longitudinal and transverse sections of hypocotyl and root segments, respectively, are showing the regenera-
tion from reactivation of procambial cells (pericycle and vascular parenchyma; arrowheads) giving rise to
regenerated shoots (asterisk). Bars = 100 μm. Based on Ikeuchi et al. [25]
3.2 Direct In vitro plant regeneration may proceed directly from parental tis-
and Indirect In Vitro sues without an intervening callus phase or indirectly after a callus
Plant Regeneration: phase, referred to as direct or indirect regeneration mode, respec-
Callus Histological tively. Previous studies have hypothesized that both processes are
Features extremes of one continuous developmental pathway wherein callus
represents a reprogramming step of unorganized mass of dividing
dedifferentiated cells, which are capable of switching cell fate in
response to hormonal signals [8, 44]. However, recent investiga-
tions suggest that there are various types of calli exhibiting differ-
ent identities [45]. For instance, calli formed on Arabidopsis roots
from pericycle or pericycle-like cells have a characteristic gene
expression pattern reminiscent of partly organized root tip meri-

stems [41]. Its development follows the initial steps of lateral root
formation [40] and not a process of cellular reprogramming to an
undifferentiated state, as previously thought [41]. Therefore, this
callus tissue cannot be considered as a dedifferentiated but rather a
misdifferentiated root meristem. The mechanisms behind the
induction of each developmental pattern (direct and indirect)
remain poorly understood.
During the indirect system, both regenerative and non-
regenerative clusters might be present in the callus (Fig. 3a, d). It
is usually easy to distinguish these clusters based on the morpho-
logical and cellular features [46]. In general, regenerative clusters
present yellow or dark-yellow color, nodular features, and smooth
surface (Fig. 3a, d). Unlike, non-regenerative zones are generally
described as rough, friable, and translucent with disorganized cel-
lular system (Fig. 3a, d). At cellular level, regenerative clusters are
generally constituted by small and isodiametric meristematic-like
cells with dense cytoplasm, numerous mitochondria, evident
stained nuclei and nucleoli, small vacuoles, and a higher metabolic
activity (Fig. 3b, e). Conversely, non-regenerative zones are consti-
tuted by different cell shapes and highly vacuolated cells with few
organelles that can be interpreted as signals of low metabolic activ-
ity (Fig. 3b) [8, 46, 47].
3.3 Ultrastructural The ability of a given cell to regenerate a new tissue, either by cel-
Aspects of In Vitro lular reactivation or cellular reprogramming, is accompanied by
Plant Regeneration nuclear changes and chromatin reorganization. Many studies have
described the ultrastructural changes related to the transition of
differentiated somatic cells into a pluri- or totipotent state, and
some ultrastructural features were found to be a marker of cells
undergoing changes in cell fate [11, 15, 30, 48, 49].
Analyses performed by Rocha et al. [49] on Passiflora edulis
cotyledons during somatic embryogenesis process showed that at
initial stages, the protodermal cells had large and spherical nuclei
with conspicuous nucleoli and the presence of heterochromatin.
Throughout the process, these cells acquired embryonic state and
presented a large nucleus with only one evident nucleolus and less
heterochromatin. The same pattern was also described in
Brachypodium distachyon [11] which might be a conserved feature
between eudicots and monocots. According to Verdeil et al. [15],
the shape and structure of nucleus can be used to distinguish
between pluripotent meristematic cells and totipotent embryonic
cells. In pluripotent meristematic cells (the authors described shoot
meristem cells), the nucleus was spherical containing several nucle-
oli and heterochromatin uniformly distributed within the nucleus
(Fig. 3c). In the case of a totipotent embryonic cell, the nucleus
was conspicuous and contained only one large nucleolus and less
heterochromatin (Fig. 3e, f). The morphogenetic competence of a
Fig. 3 Ultrastructure features of pluripotent meristematic cells and totipotent embryonic cells. (a–c) De novo
organogenesis induced from root explants. (a) Organogenic callus. Note the presence of regenerated shoots
(sh). (b) Histological section showing the meristemoid (me) formed at the surface of organogenic callus (ca).
(c) Pluripotent meristematic cell of the meristemoid showing a dense cytoplasm with small vacuoles (v), many
plasmodesmata (black arrows), and a large nucleus with some heterochromatin distributed in the periphery
(white arrowheads). (d–f) Somatic embryogenesis of Brachypodium distachyon. (d) Embryogenic callus. Note
the presence of somatic embryos (se). (e, f) Totipotent embryogenic cells showing a high nuclear cytoplasmic
ratio, small vacuoles (v), amyloplasts containing starch, and conspicuous nuclei (n) containing only one large
nucleolus (nu) and less heterochromatin. Abbreviations: d dyctiosome; r reticulum. Bars = b 100 μm, (c) and
(f) 1 μm, (e) 5 μm
target cell increases as the nucleus euchromatin portion increases

and therefore the property to give rise an entire individual. Larger
quantities of euchromatin in relation to heterochromatin charac-
terize the totipotency, whereas the increase in genetic silenced
material (heterochromatin) characterizes the pluripotency [50].
Other ultrastructural features have also been used to character-
ize both pluri- and totipotent cells. The pluripotent meristematic
cells have high nuclear cytoplasmic ratio, dense cytoplasm with
many fragments of small vacuoles, without the presence of an
amyloplasts (Fig. 3c). It presents many plasmodesmata, due to the
strong dependence and interaction with neighboring cells, creating
a niche that maintains its cellular identity (Fig. 3c). Totipotent
embryonic cells also have high nuclear cytoplasmic ratio and dense
cytoplasm with small vacuoles fragmented (Fig. 3e, f). However, in
some reports, it was also observed the presence of a high amount
of amyloplasts and the absence of plasmodesmata that are rarely
observed in the cell wall (Fig. 3e, f), modified by deposition of cal-
lose, giving in this way the isolation of its immediate neighboring
cells [15, 48].
4 Localization of Cellular and Molecular Targets
4.1 Histochemical The culture of plant explants in presence of a specific balance of

Approach to Study plant growth regulators can trigger the regeneration process. Not
In Vitro Plant all tissues can respond to the hormonal signaling, but some cells
Regeneration will acquire competence changing their developmental fates. This
process increases the heterogeneity of cell population within the
explant, at a structural, molecular, and biochemical levels. Thus,
histochemical methods have been used to obtain a detailed descrip-
tion of the cytological and biochemical state of individual cells or
tissues involved or not in the regeneration process, elucidating
structural and biochemical variations between them [11, 33,
51–55].
Histochemical analyses are based mainly in two approaches:
histological techniques as well as physical and chemical methods
which provide valuable information to identify and localize specific
compounds of a particular chemical group within the plant cells
and tissues [56]. The ultimate goal of these techniques is to cor-
relate the anatomical or developmental stage of the tissues or cells
to their biochemical state [57]. In the plant regeneration process,
histochemical monitoring has also been used to determine the
essential factors involved in the morphogenetic differentiation
allowing the recognition of regions and/or tissues with high meta-
bolic activity [11, 26, 33]. Furthermore, it allows following the
dynamics of mobilization, synthesis and metabolism of storage
compounds during the regeneration process. Storage reserves may
have an important role during in vitro morphogenesis, mainly, if
zygotic embryos, cotyledons, or endosperm are used as explants.
In this section, we included few basic and common histochemical
protocols for localization of cell components that have been shown
to be important for plant regeneration.
4.1.1 Starch Starch is considered a primary source of energy for cell growth and
proliferation [58]. A high amount of starch has been observed dur-
ing in vitro regeneration process of many different species [31, 32,
59–61]. However, histochemical analyses have shown differences
in the starch distribution among the population of cell types within
the explant. In many species, cells or tissues mitotically active and
involved in the regeneration process presented a lower abundance
of starch in comparison with the adjacent vacuolated callus cells
(Fig. 4a–d), which may be related to the differences in energy
requirements and consumption between these cell populations
[30, 61].
Different protocols can be used for localization of starches.
Below we described two simplified staining procedures:
Procedure I: Lugol’s 1. Use fresh materials or fixed tissues embedded in paraffin or

Reagent methacrylate.
2. Place a drop of Lugol’s reagent onto the tissue and allow react-
ing for 5 min.
3. Gently wash 1–2 min in running water.
4. Mount the slides as usual. The positive reaction of the test results
in starch grains stained in brown, purple, or black (Fig. 4a, b).
Procedure II: Periodic This staining protocol is not starch-specific. It is used for identify-
Acid-Schiff’s (PAS) ing all carbohydrates in a given prepared tissue section. Tissues
Reaction fixed in aldehydes will react generally with Schiff’s bases to yield a
false-positive background.
1. Use fresh materials or fixed tissues embedded in paraffin or
methacrylate. For paraffin-embedded tissues, remove paraffin,
and hydrate as usual.
2. Place slides in 0.5% periodic acid solution (prepare the solution
just prior its use) for 10–15 min in order to oxidize it.
3. Wash three times for 3 min each in distilled water.
4. Stain in Schiff’s reagent for 30 min in the dark.
5. Rinse sections in distilled water for 5–10 min.
6. Place the slides in 2% sodium bisulfite for 3 min.
7. Wash in distilled water for 1 min.
8. Mount the slides as usual. The positive reaction to the Schiff
reagent occurs by the purplish red stain of polysaccharides
(e.g., cellulose, starch) (Fig. 4c, d). Due to the occurrence of
false positive, the test is usually applied without the oxidation
step in periodic acid as a control.
4.1.2 Proteins Proteins are involved in the regulation of cell expansion and the
creation of biophysical characteristics necessary for morphogenetic
processes [62]. Among the several chemical test used, Xylidine
Ponceau is one of the most popular reagents for protein detection
[63]. It has also been used to detect potential responsive morpho-
genic sectors in the explant (Fig. 4e, f). Cells with intense staining
by Xylidine Ponceau may suggest a high incidence of protein syn-
thesis and high metabolic activity [7, 11].
Procedure: Xylidine 1. Use fresh materials or fixed tissues embedded in paraffin or

Ponceau methacrylate. For paraffin-embedded tissues, remove paraffin,
and hydrate as usual.
2. Place slides in Xylidine Ponceau solution for 15–30 min.
3. Wash in 3% acetic acid for 5 min.
4. Wash 2 min in distilled water.
5. Mount the slides as usual. The positive reaction occurs by the
light purplish-red stain (Fig. 4e, f).
Fig. 4 Histochemical analysis. (a–d) Brachypodium distachyon somatic embryogenesis. Embryonic callus (ec)
stained with Lugol (a, b) and PAS (c, d). Note that starches are abundant only in the inner cell layers of the
explant that are not involved in regeneration process. A higher magnification of the square area marked in (a)
and (c) is shown in (b) and (d), respectively, evidencing starch grains stained in black (c) and purplish red (d).
(e–f) Histological sections of Bixa orellana organogenesis (e) and somatic embryogenesis (f) pathways stained
with xylidine ponceau (XP) [75]. A strong positive XP staining is observed in cell population with high mitotic rate,
such as pluripotent meristematic cells (black asterisk) in (e) and protodermis-dividing cells (pt) in (f). (g–i)
Eustoma grandiflorum embryonic callus stained with acetocarmine/Evans Blue histochemical test. Somatic
embryos (white asterisks) showed an intense red stained with acetocarmine (h). Non-embryogenic cells stained
blue (i). Bars = (a, c–i)100 μm, (b, d) 50 μm
4.1.3 Cellular A histochemical analysis to quickly diagnose the cellular morpho-

Morphogenetic Potential genetic potential of the explants is the double staining of acetocar-
mine and Evans Blue test [64]. This test has been successfully used
to detect the presence of pluripotent meristematic or totipotent
embryonic cells in callus or cell suspension culture (Fig. 4g) [7,
64–68]. In general, cells with embryogenic/meristematic features
such as small, isodiametric, and dense cytoplasm and high nucleus/
cytoplasm ratio stain an intense red with acetocarmine (Fig. 4g, h).
Non-embryogenic cells stain blue (Fig. 4g, i).
Procedure: Acetocarmine/ 1. Rub and spread the cellular agglomerates (callus or cell suspen-
Evans Blue Staining sion culture)Acetocarmine/Evans blue staining onto the slides.
2. Place a drop of Evans Blue staining 0.5% for 3 min onto the
tissue.
3. Place a drop of Carmine acetic staining (0.1%) for 3 min onto
the tissue.
4. Mount the slides in water or glycerin.
4.2 Integration The integration of molecular data with the structural aspects has
of Cellular been a strategy to elucidate the origin of the cell competence in the
and Molecular Data process of in vitro regeneration (Fig. 5). In this sense, it has been
of In Vitro Plant growing the number of publications involving studies on tissue
Regeneration by In culture protocols combined with gene cloning techniques, DNA
Situ Hybridization and RNA sequencing and gene expression data. As part of the
tools used for gene functional characterization of genes are the
spatial-temporal localization of the genic products, the promoter
activities studies, and target transcript location in induced tissues.
This has been possible, thanks to the development of techniques as
the transient expression of reporter genes under the control of spe-
cific promoters and by in situ hybridization.
Particularly the improvement of the in situ hybridization tech-
niques using nonradioactive RNA probe labeling with reporter
molecule has facilitated studies of this nature, especially in non-
model plants, which protocols of genetic transformation are still
not available. The use of this tool has allowed to identify conserved
patterns of gene expression at cell level as well as its variations
between the different taxon and has collaborated for the identifica-
tion of cell types with high regenerative capacity.
Interestingly the use of this strategy has revealed the function
of important genes during in vitro development. For instance, the
SERK (Somatic Embryogenesis Receptor-Like Kinase) gene, isolated
from an embryogenic culture of Daucus carota, was initially
described as a marker gene of somatic embryogenesis [27], because
of the differential expression between embryogenic and non-
embryogenic. Indeed in the last 20 years, the role of this gene in
the somatic embryogenesis has been proved in different embryo-
genic systems, because it marks competent cell groups for somatic
Fig. 5 Structural characterization and analysis of SERK-like expression by in situ hybridization during somatic
embryogenesis of Passiflora cincinnata. (a–c) Early developmental stage of somatic embryo formation. Strong
signal of PcSERK in a meristematic multicellular clump at callus surface (c). (d–g) Somatic embryos developed
(asterisks). (d) Morphological view. (e) Somatic embryos showing the typical meristematic features of totipo-
tent embryonic cells such as small cells with dense cytoplasm and high nucleus/cytoplasm ratio. (f) Strong
signal of PcSERK in somatic embryos. (g) Section hybridized with the sense probe. No signal above back-
ground was detected. Negative control. Bars = 200 μm
embryogenesis (Fig. 5) [11, 49, 69]. Recently, works involving the

in situ hybridization technique have been added other attributed
functions to these genes. In Cyclamen persicum, the localization of
CpSERK1 and CpSERK2 transcripts in groups of meristematic
cells present in both embryogenic and organogenic cell lines indi-
cate that these genes are also markers of pluripotency [70]. A simi-
lar pattern was observed by Rocha et al. [49] in Passiflora edulis,
detecting the presence of transcripts of the PeSERK1 gene in
mitotically active cells from meristemoids in shoot-like structures
and provascular elements.
The in situ hybridization technique is based on the specific
pairing of the two complementary molecules. The success of the
technique aiming at gene expression studies requires a previous
understanding of molecular biology and of the capacity of inter-
pretation of the morphological and anatomical data of the material
analyzed [71]. The knowledge of the structural and functional
characteristics of the gene in study is fundamental for the construc-
tion of a specific probe. In this section, we attempt to show a basic
protocol applied to the localization of transcripts from tissue
culture-derived material.
4.2.1 Procedure The protocol of in situ hybridization protocol shown in this chap-
ter is based on protocols described by Dusi [72] and Brown [71].
Basically, this technique can be summarized in five fundamental
steps: (1) construction and probe synthesis, (2) collection and
preparation of samples for microscopy, (3) hybridization reaction,
(4) post-hybridization, and (5) immunological detection.
Construction and Probe 1. For construction of specific probes, fragments of the cDNA

Synthesis corresponding to mRNA of interest are inserted into a cloning
vector containing the T7 and SP6 promoters, i.e., pGEM®-T
Easy (Promega) or pSPT18/19. The orientation of the insert,
in relation to transcription sites, should be considered and veri-
fied by sequencing.
2. The linearized vectors with restriction enzyme or purified PCR
fragments flanked by T7 and SP6 promoters are used as tem-
plate for probe synthesis.
3. Sense and antisense single-stranded RNA probes are synthe-
tized by in vitro transcription using the DIG RNA Labeling
Kit (SP6/T7), following all recommendations of the
manufacturer.
4. Check probe integrity and concentration on 1.5% agarose gel,
using the labeled RNA control (vial 5 of the kit).
5. Confirm the probe labeling in nylon membrane by dot blot
assay.
Sample Preparation 1. Collect samples in small pieces, and fix immediately in 4% para-
formaldehyde, pH 6.8–7.1. Apply vacuum for 1 h. Change the
fixative solution, and keep for 4–18 h at 4 °C, according to the
characteristic of each material to be analyzed (see Notes 1 and
2).
2. Dehydrate the samples in 1-h series of ethanol gradient (10,
30, 50, 70, 90, and 100%) incubations. If necessary the sam-
ples can be stored at −20 °C in 70% ethanol until the next step
or in 100% ethanol for months.
Embedding the sample in Paraffin Histosec® (Merck Millipore):
1. Transfer the sample to ethanol: xylol solution at proportions
3:1, 1:1, and 1:3 and pure xylol for 1 h each in glass bottles.
Gradually add pastilles of paraffin until it reaches a third of the
volume, at 60 °C. Keep for 1 day.
2. Add new paraffin until the proportion 1:1 and keep for 1 day.
Discard half of the solution xylol + paraffin, and complete the
volume with melted paraffin. Then keep for 1 day. Repeat this
procedure for two or three times until the xylol is completely
eliminated.
3. Carefully, insert the material in the desired orientation in small

molds of paper, and slowly pour the melted paraffin. Let the par-
affin solidify for 1 day. Store the blocks at −20 °C (see Note 3).
4. Serial sections (4–8 μm) are obtained in microtome, and they
are fixed under adhesive slides or microscope slides previously
treated with organosilane. Keep the slides at 42 °C overnight
in the hot plate surface, and store at 4 °C until the next step.
Hybridization Reaction Remove the paraffin as follows (steps 1-4):

1. Pure xylol (two times): 5–15 min.
2. Xylol/ethanol (1:1): 5–15 min.
3. Pure ethanol: 10 min.
4. DEPC-treated water: 10 min (two times).
5. For each material analyzed, hybridize two slides: for one of
them, use the antisense probe and for the other one the sense
probe (negative control).
6. For each slide, denature 60 ng of probe and 60 ng of tRNA at
80 °C for 5 min. Put immediately on ice for 2 min, and then
add 100 μL of hybridization buffer (Table 1).
7. Put the mix on top of the sections, and cover with Parafilm®
sealing film, and place the slides in a humid chamber, and incu-
bate at 42 °C (see Note 4).
Post-hybridization 1. Carefully remove the Parafilm®, and wash the slides with SSC
buffer (Table 2) at the following concentrations: 4×, 2×, 1×,
and 0.5× for 30 min at 42 °C, for until 16 h.
2. Remove excess liquid from the slides, and add 200 μL of block-
ing solution (detection buffer 2—Table 3). Again, cover the
Table 1
Hybridization buffer
Final
Components Amount concentration
1 M Tris–HCl pH 7.5 100 μL 10 mM
3 M NaCl 1 mL 300 mM
Deionized formamide 5 mL 50%
50 mM EDTA pH 8.0 200 μL 1 mM
Denhardt solution 50× 200 μL 1×
50% dextran sulfate 2 mL 10%
DEPC H2O 500 μL
Aliquote in smaller portions. Store at −20 °C
Table 2
SSC 20× solution
Components Amount Final concentration

NaCl 175.4 g 3 M
Sodium citrate dihydrate (Na3C6H5O7·2H2O) 88.2 g 300 mM
Deionized H2O Enough for 1000 mL
Adjust pH to 7.0 with 2.5 N HCl. Sterilize by autoclaving and store at room temperature
Table 3
Detection buffer 2

Bovine serum albumin (BSA) 2 g 2%
Detection buffer 1 Enough for 100 mL
Dissolve in a water bath at 70 °C. Aliquote in smaller portions. Store at −20 °C
slides with Parafilm® or coverslip, and incubate for 30 min.

Next, immerse the slides in detection buffer 1 (Table 4).
Immunological Detection 1. Dry the slides, and add 100–150 μL of Anti-digoxigenin-AP

and Visualization on Light antibody diluted 1:100 in detection buffer 1. Cover the slides,
Microscope and incubate in the dark for 1 h, at room temperature.
2. Immerse the slides in detection buffer 1 for 15 min (twice) and
then in detection buffer 3 (Table 5) for 5 min.
3. Dry the slides, and add 100–150 μL of color solution (4.5 μL
NBT + 4.5 μL BCIP in 1.0 mL of detection buffer 3). Incubate
in the dark, and observe every 15 min in microscope until the
signal (purple color) appears. The negative control (sense
probe) remains without characteristic signal.
4. Stop the reaction in detection buffer 4 (Table 6) for 10 min.
5. Wash in deionized water two times for 5 min.
6. Assembly the slides with coverslip in water or glycerol 50%,
and observe under light microscope.
7. Positively hybridized cells and tissues show a purple color as
characteristic signal, when treated with antisense probe
(Fig. 5c, f). Conversely, in sections treated with sense probe,
no signal is observed (Fig. 5g).
4.3 Concluding Since the visionary and seminal ideas from Gottlieb Haberlandt
Remarks [73], succeeded by Ótto Orsós and Harry Waris [74], among oth-
ers, a lot of progress has been made to these days in the field of
Table 4
Detection buffer 1

1 M Tris–HCl pH 7.5 100 mL 0.1 M
NaCl 8.77 g 0.15 M
Sterilize by autoclaving at 121 °C for 20 min. Store at room temperature
Table 5
Detection buffer 3

NaCl 5.84 g 0.1 M
MgCl2·6H2O 10.17 g 0.05 M
Adjust the pH to 9.5. Sterilize by autoclaving at 121 °C for 20 min. Store at room
temperature
Table 6
Detection buffer 4

500 mM EDTA pH 8.0 2 mL 1 mM
Sterilize by autoclaving at 121 °C for 20 min. Store at room temperature
plant cell, tissue, and organ culture. Over the years, scientists have
been throwing new ideas and filling scientific gaps, which today
underlie a wide range of application possibilities of in vitro culture
techniques in plant biotechnology. Recently, there has been
renewed interest in understanding the basis of in vitro regeneration
processes at both cellular and molecular levels. To cope with that,
histochemical and histological techniques are instrumental and
have historically contributed significantly to better characterize
morphogenetic events that lead to efficient in vitro regeneration
systems either based on de novo organogenesis or somatic embryo-
genesis. Indeed, there is a growing body of literature that
recognizes the importance of morpho-histological tools as auxil-

iary techniques to better explain and understand regenerative pro-
cesses in plants, and a wide road of possibilities is still ahead.
5 Notes
1. The fixative solution can be changed by combination of 4%

paraformaldehyde with 0.25% glutaraldehyde in 10 mM phos-
phate buffer. The FAA 70% (formalin, acetic acid, and ethyl
alcohol) solution may be a good choice for hard-to-fix
materials.
2. All glassware and solutions used should be RNAse-free.
3. Optionally the samples can be embedded in BMM (butyl-

methyl methacrylate).
4. Optionally the sections may be subjected to a pre-hybridization
step with proteinase K. In that case, the concentration and the
incubation time should be adjusted for each material.
Acknowledgments
This work was supported by Conselho Nacional de Desenvolvimento

Científico e Tecnológico (CNPq, Brasília, DF, Brazil), Coordenação
de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Brasília,
DF, Brazil), and Fundação de Amparo à Pesquisa do Estado de
Minas Gerais (FAPEMIG, Belo Horizonte, MG, Brazil). Authors
are grateful to the following colleagues who generously made
available some figures used in this chapter: Dr. Wellington
M. Barbosa (Fig. 1b), Dr. Maria Yumbla-Orbes (Figs. 1h and 4g–i),
Dr. Elyabe M. Matos (Fig.4e, f), and MSc Ludmila N. F. Correia
(Fig. 1g). The Núcleo de Apoio à Pesquisa em Microscopia
Eletrônica Aplicada à Agricultura (NAP/MEPA-ESALQ/USP,
Piracicaba, SP, Brazil) and Núcleo de Microscopia e Microanálises
(NMM/UFV ,Viçosa, MG, Brazil) are also acknowledged.
References
1. Sugimoto K (2015) Plant cell reprogramming improvement: new approaches and modern tech-
as an adaptive strategy. J Plant Res 128:345– niques. Springer, Boston, pp 123–148. https://
347. https://doi.org/10.1007/s10265-015- doi.org/10.1007/978-1-4614-7028-1_3
0718-7 3. Skoog F, Miller CO (1957) Chemical regula-
2. Jamsheed S, Rasool S, Koul S et al (2013) Crop tion of growth and organ formation in plant
improvement through plant tissue culture. In: tissues cultured in vitro. Symp Soc Exp Biol
Hakeem KR, Ahmad P, Ozturk M (eds) Crop 11:118–130
4. Ikeda-Iwai M, Satoh S, Kamada H (2002) 14. Hochedlinger K, Plath K (2009) Epigenetic

Establishment of a reproducible tissue culture reprogramming and induced pluripotency.
system for the induction of Arabidopsis somatic Development 136:509–523. https://doi.
embryos. J Exp Bot 53:1575–1580. https:// org/10.1242/dev.020867
doi.org/10.1093/jxb/erf006 15. Verdeil JL, Alemanno L, Niememack N et al
5. Su YH, Zhao XY, Liu YB et al (2009) Auxin- (2007) Pluripotent versus totipotent plant
induced WUS expression is essential for embry- stem cells: dependence versus autonomy?
onic stem cell renewal during somatic Trends Plant Sci 12:245–252. https://doi.
embryogenesis in Arabidopsis. Plant J 59:448– org/10.1016/j.tplants.2007.04.002
460. https://doi.org/10.1111/j.1365-313X. 16. Rocha DI, Monte-Bello CC, Dornelas MC
2009.03880.x (2015) Alternative induction of de novo shoot
6. Gliwicka M, Nowak K, Balazadeh S et al organogenesis or somatic embryogenesis from
(2013) Extensive modulation of the transcrip- in vitro cultures of mature zygotic embryos of
tion factor transcriptome during somatic passion fruit (Passiflora edulis Sims) is modu-
embryogenesis in Arabidopsis thaliana. PLoS lated by the ratio between auxin and cytokinin
One 8:e69261. https://doi.org/10.1371/ in the medium. Plant Cell Tissue Org
journal.pone.0069261 120:1087–1098. https://doi.org/10.1007/
7. Rocha DI, Kurczynska E, Potocka I et al s11240-014-0663-5
(2016) Histology and histochemistry of 17. Hartmann HT, Kester DE, Davies FT Jr et al
somatic embryogenesis. In: Loyola-Vargas (2010) Hartmann & Kester's plant propaga-
VM, Ochoa-Alejo N (eds) Somatic embryo- tion: principles and practices. Pearson, New
genesis: fundamental aspects and applications. Jersey
Springer International Publishing, Cham, 18. Malik M, Wang F, Dirpaul J et al (2007)
pp 471–494. https://doi.org/10.1007/978-3- Transcript profiling and identification of
319-33705-0_26 molecular markers for early microspore
8. Yang X, Zhang X (2010) Regulation of somatic embryogenesis in Brassica napus. Plant Physiol
embryogenesis in higher plants. Crit Rev Plant 144:134–154. https://doi.org/10.1104/
Sci 29:36–57. https://doi.org/10.1080/ pp.106.092932
07352680903436291 19. Maraschin SF, de Priester W, Spaink HP et al
9. Duclercq J, Sangwan-Norreel B, Catterou M (2005) Androgenic switch: an example of plant
et al (2011) De novo shoot organogenesis: from embryogenesis from the male gametophyte
art to science. Trends Plant Sci 16:597–606. perspective. J Exp Bot 56:1711–1726.
https://doi.org/10.1016/j. https://doi.org/10.1093/jxb/eri190
tplants.2011.08.004 20. Germanà MA (2003) Somatic embryogenesis
10. Karami O, Aghavaisi B, Mahmoudi Pour A and plant regeneration from anther culture of
(2009) Molecular aspects of somatic-to- Citrus aurantium and C. reticulata. Biologia
embryogenic transition in plants. J Chem Biol 58:843–850
2:177–190. https://doi.org/10.1007/ 21. Paiva Neto VB, Botelho MN, Aguiar R et al
s12154-009-0028-4 (2009) Somatic embryogenesis from immature
11. Oliveira EJ, Koehler AD, Rocha DI et al zygotic embryos of annato (Bixa orellana L.).
(2017) Morpho-histological, histochemical, In Vitro Cell Dev Pl 39:629–634. https://doi.
and molecular evidences related to cellular org/10.1079/IVP2003465
reprogramming during somatic embryogenesis 22. Elhiti M, Stasolla C (2011) The use of zygotic
of the model grass Brachypodium distachyon. embryos as axplants for in vitro propagation:
Protoplasma 254(5):2017–2034. https://doi. an overview. Methods Mol Biol 710:229–255.
org/10.1007/s00709-017-1089-9 h t t p s : / / d o i .
12. Rocha DI, Monte-Bello CC, Aizza LCB et al org/10.1007/978-1-61737-988-8_17
(2016) A passion fruit putative ortholog of the 23. Delporte F, Pretova A, du Jardin P et al (2014)
SOMATIC EMBRYOGENESIS RECEPTOR Morpho-histology and genotype dependence
KINASE1 gene is expressed throughout the in of in vitro morphogenesis in mature embryo
vitro de novo shoot organogenesis cultures of wheat. Protoplasma 251:1455–
developmental program. Plant Cell Tissue Org 1470. https://doi.org/10.1007/
125:107–117. https://doi.org/10.1007/ s00709-014-0647-7
s11240-015-0933-x 24. Vasil IK (2007) Molecular genetic improve-
13. Thompson DS (2007) Space and time in the plant ment of cereals: transgenic wheat (Triticum
cell wall: relationships between cell type, cell wall aestivum L.). Plant Cell Rep 26:1133–1154.
rheology and cell function. Ann Bot 101:203– https://doi.org/10.1007/
211. https://doi.org/10.1093/aob/mcm138 s00299-007-0338-3
25. Ikeuchi M, Ogawa Y, Iwase A et al (2016) https://doi.org/10.1007/

Plant regeneration: cellular origins and molec- s11103-005-4547-2
ular mechanisms. Development 143:1442– 35. Evert RF (2006) Esau's plant anatomy, meri-
1451. https://doi.org/10.1242/dev.134668 stems, cells, and tissues of the plant body: their
26. de Almeida M, de Almeida CV, Graner EM structure, function, and development. Johm
et al (2012) Pre-procambial cells are niches for Wiley & Sons, New Jersey
pluripotent and totipotent stem-like cells for 36. Cruz ACF, Rocha DI, Iarema L et al (2014) In
organogenesis and somatic embryogenesis in vitro organogenesis from root culture seg-
the peach palm: a histological study. Plant Cell ments of Bixa orellana L. (Bixaceae). In Vitro
Rep 31:1495–1515. https://doi.org/10.1007/ Cell Dev Pl 50:76–83. https://doi.
s00299-012-1264-6 org/10.1007/s11627-013-9580-2
27. Schmidt EDL, Guzzo F, Toonen MAJ et al 37. Vieira LM, Rocha DI, Taquetti MF et al (2014)
(1997) A leucine-rich repeat containing recep- In vitro plant regeneration of Passiflora setacea
tor-like kinase marks somatic plant cells compe- D.C. (Passifloraceae): the influence of explant
tent to form embryos. Development type, growth regulators, and incubation condi-
124:2049–2062 tions. In Vitro Cell Dev Pl 50:738–745.
28. Somleva MN, Schmidt EDL, De Vries SC https://doi.org/10.1007/s11627-
(2000) Embryogenic cells in Dactylis glomer- 014-9650-0
ata L. (Poaceae) explants identified by cell 38. Lombardi SP, Passos IRS, Nogueira MCS et al
tracking and by SERK expression. Plant Cell (2007) In vitro shoot regeneration from roots
Rep 19:718–726. https://doi.org/10.1007/ and leaf discs of Passiflora cincinnata Mast.
s002999900169 Braz Arch Biol Technol 50:239–247. https://
29. Yumbla-Orbes M, Cruz ACF, Pinheiro MVM doi.org/10.1590/S1516-89132007
et al (2017) Somatic embryogenesis and de 000200009
novo shoot organogenesis can be alternatively 39. Vinocur B, Carmi T, Altman A et al (2000)
induced by reactivating pericycle cells in Enhanced bud regeneration in aspen (Populus
Lisianthus (Eustoma grandiflorum (Raf.) tremula L.) roots cultured in liquid media.
Shinners) root explants. In Vitro Cell Dev Pl Plant Cell Rep 19:1146–1154. https://doi.
53:209–218. https://doi.org/10.1007/ org/10.1007/s002990000243
s11627-017-9800-2 40. Atta R, Laurens L, Boucheron-Dubuisson E
30. Canhoto JM, Mesquita JF, Cruz GS (1996) et al (2009) Pluripotency of Arabidopsis xylem
Ultrastructural changes in cotyledons of pine- pericycle underlies shoot regeneration from
apple guava (Myrtaceae) during somatic root and hypocotyl explants grown in vitro.
embryogenesis. Ann Bot 78:513–521. Plant J 57:626–644. https://doi.
https://doi.org/10.1006/anbo.1996.0149 org/10.1111/j.1365-313X.2008.03715.x
31. Moura E, Ventrella M, Motoike S et al (2008) 41. Sugimoto K, Jiao Y, Meyerowitz EM (2010)
Histological study of somatic embryogenesis Arabidopsis regeneration from multiple tissues
induction on zygotic embryos of macaw palm occurs via a root development pathway. Dev
(Acrocomia aculeata (Jacq.) Lodd. ex Martius). Cell 18:463–471. https://doi.org/10.1016/j.
Plant Cell Tissue Org 95:175–184. https:// devcel.2010.02.004
doi.org/10.1007/s11240-008-9430-9 42. Pulianmackal AJ, Kareem AV, Durgaprasad K
32. Rodriguez AP, Wetzstein HY (1998) A mor- et al (2014) Competence and regulatory inter-
phological and histological comparison of the actions during regeneration in plants. Front
initiation and development of pecan (Carya Plant Sci 5:142. https://doi.org/10.3389/
illinoinensis) somatic embryogenic cultures fpls.2014.00142
induced with naphthaleneacetic acid or 43. Kurczynska E, Gaj M, Ujczak A et al (2007)
2,4-dichlorophenoxyacetic acid. Protoplasma Histological analysis of direct somatic embryo-
204:71–83. https://doi.org/10.1007/ genesis in Arabidopsis thaliana (L.) Heynh.
BF01282295 Planta 226:619–628. https://doi.org/
33. Rocha DI, Vieira LM, Tanaka FAO et al (2012) 10.1007/s00425-007-0510-6
Somatic embryogenesis of a wild passion fruit 44. Fehér A, Pasternak TP, Dudits D (2003)
species Passiflora cincinnata Masters: histocy- Transition of somatic plant cells to an embryo-
tological and histochemical evidences. genic state. Plant Cell Tissue Org 74:201–228.
Protoplasma 249:747–758. https://doi. https://doi.org/10.1023/A:1024033216561
org/10.1007/s00709-011-0318-x
45. Ikeuchi M, Sugimoto K, Iwase A (2013) Plant
34. De Smet I, Vanneste S, Inzé D et al (2006) callus: mechanisms of induction and repres-
Lateral root initiation or the birth of a new sion. Plant Cell 25:3159–3173. https://doi.
meristem. Plant Mol Biol 60:871–887. org/10.1105/tpc.113.116053
46. de Figueiredo Carvalho MA, Paiva R, Alves E 57. Ruzin SE (1999) Plant microtechnique and
et al (2013) Morphogenetic potential of native microscopy. Oxford University Press, Oxford
passion fruit (Passiflora gibertii N. E. Brown.) 58. Martin AB, Cuadrado Y, Guerra H et al (2000)
calli. Braz J Bot 36:141–151 Differences in the contents of total sugars,
47. Jiménez VM, Bangerth F (2001) Endogenous reducing sugars, starch and sucrose in embryo-
hormone levels in initial explants and in genic and non-embryogenic calli from
embryogenic and nonembryogenic callus cul- Medicago arborea L. Plant Sci 154:143–151
tures of competent and non-competent wheat 59. Quiroz-Figueroa FR, Fuentes-Cerda CFJ,
genotypes. Plant Cell Tissue Org 67:37–46. Rojas-Herrera R et al (2002) Histological
https://doi.org/10.1023/A:1011671310451 studies on the developmental stages and differ-
48. Kurczynska EU, Potocka I, Dobrowolska I entiation of two different somatic embryogen-
et al (2012) Cellular markers for somatic esis systems of Coffea arabica. Plant Cell Rep
embryogenesis. In: Sato K (ed) Embryogenesis. 20:1141–1149. https://doi.org/10.1007/
InTech, Rijeka, Croatia, pp 307–332 s00299-002-0464-x
49. Rocha DI, Pinto DLP, Vieira LM et al (2016) 60. Verdeil JL, Hocher V, Huet C et al (2001)
Cellular and molecular changes associated with Ultrastructural changes in coconut calli associ-
competence acquisition during passion fruit ated with the acquisition of embryogenic com-
somatic embryogenesis: ultrastructural charac- petence. Ann Bot 88:9–18. https://doi.
terization and analysis of SERK gene expres- org/10.1006/anbo.2001.1408
sion. Protoplasma 253:595–609. https://doi. 61. Pinto G, Silva S, Neves L et al (2010)
org/10.1007/s00709-015-0837-y Histocytological changes and reserve accumula-
50. de Almeida M, Graner ÉM, Brondani GE et al tion during somatic embryogenesis in Eucalyptus
(2015) Plant morphogenesis: theorical bases. globulus. Trees 24:763–769. https://doi.
Adv Sci 2:13–22 org/10.1007/s00468-010-0446-5
51. Cangahuala-Inocente GC, Steiner N, Santos M 62. Jiménez VM (2001) Regulation of in vitro
et al (2004) Morphohistological analysis and somatic embryogenesis with emphasis on to
histochemistry of Feijoa sellowiana somatic the role of endogenous hormones. Rev Bras
embryogenesis. Protoplasma 224:33–40. Fisiol Veg 13:196–223. https://doi.
https://doi.org/10.1007/s00709- org/10.1590/S0103-31312001000200008
004-0055-5 63. Vidal BC (1970) Dichroism in collagen bun-
52. Etienne H, Bertrand B, Georget F et al (2013) dles stained with Xylidine-Ponceau 2R. Ann
Development of coffee somatic and zygotic Histochim 15:289–296
embryos to plants differs in the morphological, 64. Durzan DJ (1988) Somatic polyembryogenesis
histochemical and hydration aspects. Tree for the multiplication of tree crops. Biotechnol
Physiol 33:640–653. https://doi. Genet Eng Rev 6:341–378. https://doi.org/
org/10.1093/treephys/tpt034 10.1080/02648725.1988.10647852
53. Moura EF, Ventrella MC, Motoike SY (2010) 65. Guerra MP, Steiner N, Farias-Soares FL et al
Anatomy, histochemistry and ultrastructure of (2016) Somatic embryogenesis in Araucaria
seed and somatic embryo of Acrocomia acu- angustifolia (Bertol.) Kuntze (Araucariaceae).
leata (Arecaceae). Sci Agric 67:399–407. In: Germanà MA, Lambardi M (eds) In vitro
https://doi.org/10.1590/S0103- embryogenesis in higher plants. Springer,
90162010000400004 New York, pp 439–450. https://doi.
54. Paim Pinto DL, Barros BA, Viccini L et al org/10.1007/978-1-4939-3061-6_24
(2010) Ploidy stability of somatic 66. Silva ML, Paim Pinto DL, Guerra MP et al
embryogenesis-derived Passiflora cincin- (2009) A novel regeneration system for a wild
nata Mast. plants as assessed by flow cytome- passion fruit species (Passiflora cincin-
try. Plant Cell Tissue Org 103:71–79. https:// nata Mast.) based on somatic embryogenesis
doi.org/10.1007/s11240-010-9756-y from mature zygotic embryos. Plant Cell
55. Silva GM, Cruz ACF, Otoni WC et al (2015) Tissue Org 99:47–54. https://doi.
Histochemical evaluation of induction of org/10.1007/s11240-009-9574-2
somatic embryogenesis in Passiflora edulis Sims 67. Steiner N, Farias-Soares FL, Schmidt ÉC et al
(Passifloraceae). In Vitro Cell Dev Pl 51:539– (2016) Toward establishing a morphological
545. https://doi.org/10.1007/s11627-015- and ultrastructural characterization of proem-
9699-4 bryogenic masses and early somatic embryos of
56. Ventrella MC, Almeida AL, Araújo LN et al Araucaria angustifolia (Bert.) O. Kuntze.
(2013) Histochemical methods applied to Protoplasma 253:487–501. https://doi.
seeds. UFV Publisher, Viçosa org/10.1007/s00709-015-0827-0
68. Steiner N, Vieira FN, Maldonado S et al (2005) 72. Dusi DMA (2015) Hibridização in situ para
Effect of carbon source on morphology and detecção da expressão de genes em tecidos
histodifferentiation of Araucaria angustifolia vegetais. In: Brasileiro ACM, Carneiro VCC
embryogenic cultures. Braz Arch Biol Technol (eds) Manual de transformação genética de
48:895–903. https://doi.org/10.1590/ plantas. Embrapa Publisher, Brasília,
S1516-89132005000800005 pp 303–327
69. Pilarska M, Malec P, Salaj J et al (2016) High 73. Haberlandt G (1902) Kulturversuche mit iso-
expression of SOMATIC EMBRYOGENESIS lierten pflanzenzellen. Sber Akad Wiss Wein
RECEPTOR-LIKE KINASE coincides with initia- 111:69–92
tion of various developmental pathways in in vitro 74. Waris H (1957) A striking morphogenetic
culture of Trifolium nigrescens. Protoplasma 253: effect of amino acid in seed plant. Suom
345–355. https://doi.org/10.1007/s00709- Kemistil 30B:121
015-0814-5 75. Matos EM, Koehler AD, Faria DV et al (2016)
70. Savona M, Mattioli R, Nigro S et al (2012) Somatic embryogenesis in annatto (Bixa orel-
Two SERK genes are markers of pluripotency lana L.). In: Loyola-Vargas VM, Ochoa-Alejo
in Cyclamen persicum Mill. J Exp Bot 63:471– N (eds) Somatic embryogenesis: fundamental
488. https://doi.org/10.1093/jxb/err295 aspects and applications. Springer, Cham,
71. Brown C (1998) In situ hybridization with pp 213–231. https://doi.org/10.1007/
riboprobes: an overview for veterinary patholo- 978-3-319-33705-0_13
gists. Vet Pathol 35:159–167
Chapter 4
Bacterial Endophytes in Plant Tissue Culture:

Mode of Action, Detection, and Control
Mona Quambusch and Traud Winkelmann
Abstract
Endophytic bacteria have been increasingly in the focus of research projects during the last decade. This
has changed the view on bacteria in plant tissue culture and led to the differentiation between artificially
introduced contaminations and naturally occurring endophytes with neutral, negative, or positive impact
on the plant propagation process. This review chapter gives an overview on recent findings about the
impact that bacteria have on the plant physiology in general and during micropropagation. Additionally,
methods for the detection and identification of bacteria in plant tissue are described and, finally, sugges-
tions of how to deal with bacterial endophytes in in vitro culture are given.
Key words Bacteria, Contamination, Culture-dependent, Culture-independent, Endophytes,

Identification, Micropropagation, Plant growth promotion, Quantification
1 Introduction
1.1 Endophytes: Plants are generally inhabited internally by a diverse microbial

Definition and General community including bacteria, archaea, fungi, and phytoplasms
Description [1]. The plant-microorganism interactions include both mutual-
ism and pathogenicity and depend on abiotic and biotic influences
on the interaction partners [2]. The term endophyte was first men-
tioned by the German botanist and mycologist Anton de Bary [3],
and its definition has since then changed several times in accor-
dance with the increased understanding of the endophytic lifestyle.
While De Bary [3] was still thinking of all microorganisms living
inside the plant, Carroll [4] restricted the use of the term to organ-
isms that cause asymptomatic infections within plant tissues. As
further studies revealed that pathogenicity and mutualism can lie
very closely together, and the same organism can switch between
these lifestyles depending on the environmental conditions, a wider
definition of the term was needed. Still up-to-date is the following
definition: “[Endophytes are] all organisms inhabiting plant organs
that at some time in their life, can colonize internal plant tissues
69
70 Mona Quambusch and Traud Winkelmann
without causing apparent harm to their host” [5]. This includes

true symbionts as well as latent pathogens, microorganisms with
both symptomless and saprophytic phases in their life cycle, and
bacteria and fungi that are colonizing the plant after a (dormant)
stage in the soil or on the leaf/root surface as well as those persist-
ing in the tissue over several plant generations.
There are several possibilities for the transfer of endophytes from
one host to the next. Some endophytes persist in the seeds and are
transmitted vertically over several host plant generations. For exam-
ple, Methylobacterium extorquens has been detected in bud meri-
stems, flowers, and seed tissue of scots pine [6], and Methylobacterium
and Pantoea species are frequently detected in seeds of diverse plant
species [7, 8]. Recently, the niches within seeds and even within
embryonic tissues for various endophytic bacterial taxa have been
explored in melon [9]. This enables a very close interaction or even
a coevolution of the plant with its endophytic bacteria or fungi [8].
The most prominent example for symbiosis and coevolution in
plant-bacteria relationships is the rhizobia which are able to fix
atmospheric nitrogen only within special compartments of the root
nodules of Fabaceae, enabling their host to grow with very low or
even without nitrogen source in the soil [10].
In contrast to vertical transmission, the endophyte can infect
new hosts horizontally by air, the soil, insect, or other animal vec-
tors as well as direct plant-to-plant contact of roots or shoots.
Regarding the possible colonization pathways, most plant growth-
promoting bacteria are supposed to enter the plant from the soil or
more precisely the rhizosphere [11]. It is not rare to find endo-
phytes rotating between different ecological niches, as seen, for
example, in the life cycle of Rhizobium leguminosarum, where the
bacterium migrates between the soil (as a heterotroph), the legume
root nodule (as an endosymbiont), and the cereal root (as a
growth-promoting endophyte) [12]. During the handling of
plants by humans (e.g. by grafting, propagation by cuttings,
in vitro propagation, the trimming of trees or ornamental plants),
endophytes can be spread from one plant to the next, and new
microbes can be introduced via the cut surface, the soil, or other
contaminated surfaces and materials.
This review chapter will concentrate on bacterial endophytes
which are, compared to fungal endophytes, far less studied. The
majority of bacterial endophytes that have been detected in the
plant tissue are described as commensals with yet unknown func-
tions in the plant. Although they are sometimes present in high
numbers in the plant tissue, they do neither produce visible damage
nor induce strong defense mechanisms in the plant [13]. For some
bacteria a positive influence has been described, others showed
antagonistic effects on plants. A general classification to a plant-
bacterium interaction group is still limited for most detected species
as most of them have only been analyzed in one or few plant species
Endophytes in Plant Tissue Culture 71
and are only rarely tested over a taxonomically wide spectrum of

plants [1]. Endophytic bacteria have been detected in virtually all
plant tissues, including the root, stem, leaves, meristematic tissues,
flowers, seeds, and fruits, e.g., by in situ hybridization [14, 15] and
GFP-tagging [6, 16]. They can colonize both the intercellular and
intracellular spaces, and some move from the roots to the aerial
plant parts by colonization of the xylem vessels [11].
1.2 Impact Although our understanding is built on a rather small set of experi-
of Bacterial mental conditions, we can conclude that endophytic bacteria play
Endophytes on Plants crucial roles in the physiology of plants. Some endophytes, called
commensals, have no apparent effect on the plant but merely live
on the metabolites produced by their host. The second group con-
fers a beneficial effect on the plant, either in form of a plant growth
promotion or by protection against invading pathogens. A third
group consists of latent pathogens persevering in the plant tissue
until conditions are favorable for a systemic infection and disease
development [17, 18]. This depicts that endophytes can have dif-
ferent effects depending on the abiotic environmental conditions,
the bacterium and host genotype, and the developmental stage.
For example, a reduction of the host fitness can lead to a shift in
the delicate balance in the endophytic community leading to dis-
ease expression by previously favorable bacteria or to saprophytic
lifestyle during host senescence [19, 20]. Bacteria can influence
plant growth either directly, by providing the plant with com-
pounds or by facilitating the uptake of nutrients from the environ-
ment, or indirectly, by the prevention of deleterious effects of
pathogenic organisms [21].
1.2.1 Influence on Plant Endophytic bacteria can trigger defense mechanisms leading to
Health induced systemic resistance (ISR) and confer a higher tolerance to
pathogen infection. It has been described that, at the initial stage
of interaction between beneficial microorganisms and plants, the
immune response is still triggered, while the mutualists prevent
later defense reactions of the plant [22]. For the legume-rhizobium
symbiosis, the mechanism was analyzed on the molecular level
showing an induction of immunity by microbe-associated molecu-
lar patterns (MAMP-triggered immunity) followed by a repro-
gramming of the defense mechanisms leading to a symbiotic
interaction [23]. In addition to the effect on pathogen resistance
by ISR, the bacterial endophytes can support plant health by the
inhibition of pathogens. Endophytes produce a wide spectrum of
antibiotics and volatile organic compounds (VOCs) suppressing
the growth of their competitors, including plant pathogens [24].
The production of siderophores enables the endophyte to protect
the scarce iron sources from their antagonists, thereby again sup-
pressing the growth of potential plant pathogens. The reduction of
abiotic stress through the degradation of the ethylene precursor
1-aminocyclopropane-1-carboxylate (ACC) by the bacterial ACC

deaminase or by reactive oxygen species (ROS) detoxification can
additionally support plant health, and studies on several crops indi-
cate higher drought, chilling, and salt tolerance after inoculation
with endophytes [1, 2]. While the previously described mecha-
nisms protect the plant against other microorganisms, some endo-
phytes even produce insecticidal, nematicidal, and antiviral
compounds [25].
1.2.2 Plant Growth The morphology of the host can directly be influenced through
Promotion the production of plant growth regulators by endophytes. Bacteria
are able to produce a wide range of phytohormones that often play
a crucial role in the bacteria-plant interaction. Indole-3-acetic acid
(IAA) biosynthesis is widespread among plant-associated bacteria,
and different biosynthesis pathways have been identified [26].
Bacteria use this phytohormone to interact with plants as part of
their colonization strategy including phytostimulation but also to
circumvent basal plant defense mechanisms [26]. Auxin-producing
bacterial strains have been reported for representatives of the gen-
era Pseudomonas, Enterobacter, Rhizobium, Bradyrhizobium,
Bacillus, Methylobacterium, Rhodococcus, Acinetobacter, and
Microbacterium among many others [27]. Ali et al. [28] have con-
firmed a positive correlation between bacterial auxin production
and an increased endogenous IAA level of plants (in this case
Triticum aestivum); the amount produced is highly dependent on
the plant host species, however [29].
Other, less well-studied influences on the phytohormone levels
are the production of gibberellins, cytokinins, and abscisic acid
[30, 31], metabolization of abscisic acid [32], degradation of IAA
[26], the induction of abscisic acid and salicylic acid production in
the host plant [33], and the modulation of ethylene levels in the
plant tissue [2]. By these means, endophytes are able to induce
biomass production and shoot and root growth and even delay
flower senescence in cut flowers [34].
Endophytic bacteria can also lead to plant growth promotion
by an increase of nutrient availability. The ability to solubilize
phosphate and other minerals is widely spread among the bacterial
domain [35]. Diazotrophic bacteria, e.g. the plant growth-
promoting bacterium (PGPB) Azospirillum brasilense colonizing
maize roots, are able to fix atmospheric nitrogen and supply the
plant with ammonia [36].
1.3 Role Although this has been the common understanding for several
of Endophytes decades, today it has to be assumed that plant in vitro cultures are
in In Vitro Culture never entirely free of microorganisms [37]. During the establishing
of in vitro cultures, the plant tissue is surface sterilized. Endophytic
bacteria and fungi living inside the tissue will survive this process
and persist in the material [38]. Before the 1990s bacteria observed
in the cultures were by most scientists considered to be “contami-

nants,” introduced to the cultures by human handling of the sam-
ples, and the final aim was elimination of the microorganisms to
obtain a “sterile” culture [39]. The focus was on the negative influ-
ences that especially bacteria can have on the vitality of tissue cul-
tures, for example the browning and early senescence of plant
material [40] or the vigorous growth of bacteria on the surface of
culture media eventually leading to overgrowth of the plant [41].
1.3.1 Presence The presence and function of endophytes in tissue cultures have
of Bacterial Endophytes been increasingly under investigation during the last years (reviewed
in In Vitro Culture by [42]). Several studies have demonstrated the presence or even
positive effect of endophytic bacteria in tissue cultures [43–47],
including tissue cultures of trees [48–55]. An analysis of the
dynamics of several bacterial strains in Prunus avium tissue cul-
tures by quantitative PCR revealed a fluctuation of the bacterial
content both between different subcultures and between in vitro
culture phases (propagation and rooting) [54]. The endophyte
species composition and plant genotype together with tissue cul-
ture conditions seem to have a strong impact on the development
of a negative or positive interaction [55, 56].
The presence of bacterial endophytes in the cultures is often
visually observable after changes in culture conditions, e.g. after
the transfer to rooting medium. In most cases the bacteria occur as
clouds in the culture medium at the base of the microshoot
(Fig. 1a, b), less often on the surface of the culture medium in
contact with the stem or leaves of the explants (Fig. 1c). On the
other hand, endophytic bacteria are revealed from cultures without
visible bacterial growth during propagation once tissue samples are
transferred to the suitable bacterial growth medium (Fig. 1d, e).
The practical experience in our in vitro culture laboratory (Leibniz
Universität Hannover, Institute of Horticultural Production
Systems) with Prunus avium, several cultivars of Malus, and a
diverse group of other plants is that the visual observation of endo-
phytes is not necessarily connected with growth inhibition or other
negative effects on the plant. In some cases, however, a browning
of the tissue in connection with plant senescence was observed
during apparent growth of bacteria, as described by Pirttilä et al.
[56]. It is not known whether the endophytes are involved in
browning by inducing the senescence, or the endophytes simply
take over the already senescing tissue as saprophytes [56].
During in vitro culture, plants are supplied with a sufficient
amount and easily accessible nutrients, and the plant hormones in
the growth medium are optimized for the intended reaction in the
specific cultivation step and morphological status of the propa-
gules. This raises the question of how endophytic bacteria act dur-
ing in vitro culture. Most of the potential growth-promoting traits
mentioned above, especially an increased nutrient availability,
Fig. 1 Visual observation of endophytic bacterial growth in different plant tissue culture materials. (a) Tissue
culture of Solanum tuberosum with bacteria growing out of the basal part of the microshoot, (b) endophytes
emerging from the submerged parts of Helleborus hybrids microshoots, (c) bacteria in Phalaenopsis tissue
culture growing on the surface of the medium, (d) leaves of Prunus avium on bacterial culture medium with
white colonies of Rhodopseudomonas palustris, and (e) yellow colonies of Microbacterium testaceum emerg-
ing at the cut plant surface. Bar = 2 cm
nitrogen fixation, and the production of plant hormones, most

certainly play a minor role under these optimized conditions.
Nevertheless, in several studies a clear and statistically verified
growth-promoting effect was observed after inoculating micro-
propagated plants with potential plant growth-promoting bacte-
ria. To name a few examples, Quambusch et al. [54, 55] observed
a higher percentage of rooted plants and more roots per shoot
after the inoculation of difficult-to-propagate Prunus avium geno-
types with the endophytes Rhodopseudomonas palustris and
Microbacterium testaceum, and Ardanov et al. [57] demonstrated
that inoculated endophytic Methylobacterium spp. strains induce
resistance to pathogens and influence the inherent bacterial com-
munity of Solanum tuberosum and Pinus sylvestris. The growth
(root and shoot dry weight) of Scots pine in vitro seedlings was
significantly increased by the inoculation with Methylobacterium
extorquens (Pohjanen et al. 2014). Additionally, seed germination
and seedling growth were positively affected by the addition of
bacterial strains to Dendrobium nobile and Dendrobium catena-
tum, respectively [58, 59].
1.3.2 Where Do From the previously discussed literature, it can be concluded that
Endophytes Become endophytes can have positive effects during in vitro culture of
Problematic? plants. At the same time, we have to keep in mind that “contami-
nations” do cause serious troubles in commercial in vitro culture
propagation [41, 60]. The shape of the interaction with specific
endophytes is not fixed and can change if biotic or abiotic factors
are altered.
During in vitro culture initiation, explants of various kinds are
submitted to surface disinfection, most commonly employing
chlorine in the form of sodium hypochlorite or alternatively using
mercuric chloride or, for instance, silver nitrate. Since all disinfec-
tants are also harmful to plant cells, the treatment dose is chosen
according to its effect on surface microorganisms and on the viabil-
ity of plant cells. Thus, microorganisms that are less sensitive, such
as gram-negative bacteria (e.g. Pseudomonas, Erwinia,
Agrobacterium, Serratia, Klebsiella spp. [41]), and/or live pro-
tected inside the plant tissue or even inside plant cells may escape
the surface disinfection treatment.
It has been frequently observed that endophytic bacteria after
having remained in a latent state during in vitro propagation
become problematic due to excessive proliferation and outgrowth
of the plant tissue, if culture conditions are changed. A very promi-
nent change of culture conditions is the transfer to rooting medium
which stimulates bacterial growth [41]. Cassells et al. [61]
explained the increased bacterial growth in the rooting phase by
plant exudate production, whereas own observations point to
another possible explanation: in propagation media, often rela-
tively high salt concentrations (e.g. Murashige and Skoog [62]
macro and micro elements) are used, whereas in many rooting
media, the salts are reduced to one half or one third which presum-
ably leads to a culture environment favoring proliferation of several
plant endophytic bacteria. Culture conditions which expose in vitro
cultured plants to additional stresses are also known to enhance
bacterial growth. These include in vitro stress tests, polyploidiza-
tion treatments, and long-term storage approaches, such as cryo-
preservation [63]. Marino et al. [38] observed differences in the
gaseous atmosphere of the culture vessels with increasing CO2 and
decreasing O2 concentrations in jars of contaminated shoots com-
pared to jars without the contaminating bacteria. These changes
were detectable with or without treatment of the cultures with
antibiotics and also in cultures with contaminations that were not
visible in the culture media.
Keeping the balance of the total microbial community seems
to be more promising for successful tissue culture propagation
than the suppression or elimination of bacteria, or, as nicely formu-
lated by Rosenblueth and Martínez-Romero [18]: “It seems there
is an equilibrium of endophytes and plants that under certain
circumstances may be unbalanced to the detriment of one of the
partners.”
2 Detection and Identification of Bacterial Endophytes in Tissue Culture
2.1 Culture- It is common understanding that only a small percentage of bacte-

Dependent vs. ria are culturable by standard techniques. The portion of “as yet
Culture-Independent cultivated” bacteria has been estimated to be below 1% [64]. A
Detection true understanding of the physiology and function of a bacterial
species requires the study of living cells. With the aim to get the
closest approach to the total bacterial community and its potential

function in the plant material, it is therefore necessary to cover
both the culturable and non-culturable fraction of endophytes.
2.1.1 Screening The culture-dependent detection starts with the plating of plant
for Culturable Bacteria material on bacterial culture media to obtain bacterial colonies.
on Nutrient Media Alternatively, in order to catch bacterial taxa that may be present
in lower numbers compared to the dominant taxa, plant material
can be macerated and incubated in buffer or saline solution, which
is then plated in serial dilutions. To identify the isolates, a pure
culture of the bacteria is obtained, the DNA is extracted, and a
target-gene, most commonly the 16S rRNA gene, is amplified by
PCR and sequenced for the taxonomic assignment (Fig. 2a). The
most critical step of this method is the selection of suitable bacte-
rial culture conditions. To enable the growth of a high diversity of
bacteria, the use of media with low nutrient content, the exten-
sion of the incubation time, and the simulation of natural environ-
mental conditions were proposed by Vartoukian et al. [64]. Several
groups tested innovative new techniques for the culture of “as yet
uncultivables,” e.g., the use of a hollow fiber membrane chamber
[65] or magnetic nanoparticle-mediated isolation proposed by
Zhang et al. [66]. Eevers et al. [67] could slightly increase the
number of isolates and the regrowth capacity after the addition of
plant extract to the culture medium. Selective media can be used
to detect a specific group of bacteria. This can be helpful if the
focus of the analysis lies on the detection of a specific bacterial
group, e.g. a pathogen to be excluded from the tissue culture
material. One example from our studies is the isolation of
Mycobacterium spp. The bacteria were detected by a culture-inde-
pendent method in all of the analyzed Prunus avium microshoots,
however, could not be isolated with conventional bacterial growth
media. Only the use of selection medium Middlebrook 7H10
[68], containing malachite green (toxic for bacteria with excep-
tion of mycobacteria), leads to the isolation and successful cultiva-
tion of the slow-growing colonies of Mycobacterium spp. and to
their identification on species level.
2.1.2 Culture- For the culture-independent detection of bacteria, the DNA is

Independent Detection extracted directly from the plant material. Subsequent steps are the
amplification of a target gene by PCR (Fig. 2b). The technical pos-
sibilities to analyze the unculturable fraction of the endophytic
bacteria have been subject of huge changes during the last years by
the invention and dissemination of improved sequencing facilities.
In the classical approach, the 16S rRNA gene is amplified and
cloned in plasmids to separate the sequences. The plasmids can
then be sequenced to identify the single bacterial sequences. A
high number of plasmids have to be analyzed to get a representa-
tive view (coverage) of the bacterial community in the plant tissue.
Fig. 2 Workflow of different approaches used for the detection and identification
of bacterial endophytes in the plant tissue by (a) culture-dependent method or
(b) culture-independent methods. The pros and cons of each approach are given
on the right
To reduce the necessary number of sequencing runs, the clone

library can first be analyzed by an ARDRA (amplified ribosomal
rDNA restriction analysis). Using this method only one clone for
each observed restriction pattern has to be sequenced and com-
pared to database entries for the taxonomic placement as, for
example, conducted for bacterial endophytes in Prunus avium tis-
sue culture [55].
There are several methods that have been used alternatively.
Terminal restriction fragment length polymorphism (T-RFLP)
analysis [69–71], denaturing gradient gel electrophoresis (DGGE),
and temperature gradient gel electrophoresis (TGGE) have been
widely used in microbial ecology including the analysis of endo-
phyte communities, for example by Garbeva et al. [72]; Weinert
et al. [73]; Abreu-Tarazi et al. [45]; Videira et al. [74]; and
Marques et al. [75]. DGGE enabled the separation of 16S rRNA
gene fragments by increasing denaturing conditions and the detection
of nearly 100% of sequence variants [76]. An advantage of the gra-
dient gel methods compared to the clone libraries is the possibility
to compare bacterial community profiles of numerous environ-
mental samples [76] (Fig. 2b).
The named techniques are more and more replaced by high-

throughput methods, also called next-generation sequencing
(NGS). They allow analyses at greater depth so that more low-
abundant taxa can be detected [77]. The most common systems
are Illumina sequencing and 454 pyrosequencing, the latter giving
slightly longer read length but lower read numbers per run. A
drawback of NGS is the lower taxonomic resolution compared to
Sanger sequencing. While the full length 16S rRNA in most cases
enables species identification, the shorter NGS reads (about 300 bp
depending on the used system) provide a resolution at maximum
down to genus level [77]. It can be expected that read length will
increase due to improvements of the technique in near future, [77]
and despite the described limitations, NGS technology allows the
sequencing of total plant microbiomes in short time and with rap-
idly decreasing costs.
2.2 Important The DNA of bacterial isolates can be obtained using commercial
Considerations kits or classical extraction methods from the fast boiling methods
in Molecular Detection to more advanced extraction protocols. Some bacterial cell walls
Methods (e.g. gram-positive bacteria and especially mycobacteria) are not
easy to break making prolonged treatments with proteinase K and
2.2.1 DNA Extraction lysozyme or other cell wall degradants necessary [78]. Physical cell
wall destruction by bead beating or sonication is another alterna-
tive for difficult-to-lyse cell walls [79]. Factors that additionally
affect bacterial cell lysis are the physiological state of the cell and
the cell concentration.
The described difficulties during DNA extraction from bacte-
rial isolates are equally important during the extraction of metage-
nomic DNA. To cover the whole diversity of endophytes, the
complete lysis of all bacterial groups has to be ensured. In addition
to the lysis of all bacterial cells, the protocol has to provide suffi-
cient genomic material and remove plant-derived compounds,
especially polyphenols and polysaccharides. Maropola et al. [80]
tested different protocols (two classical protocols and five
commercial kits) and observed pronounced differences in the

detected bacterial diversity of Sorghum bicolor.
2.2.2 Amplicon The most frequently used sequence for bacterial phylogenetic
Sequencing studies is the approximately 1500 bp long and highly conserved
16S rRNA gene encoding a part of the small subunit of the ribo-
some of bacteria [81, 82]. Because this sequence is used in most
studies, the databases (e.g. NCBI GenBank, Ribosomal Database
Project (RDP) [83], or SILVA [84]) cover a wide spectrum of
bacterial sequences, and identification of rare or non-culturable
species is made possible. Identification by the 16S rRNA gene
sequences is limited when it comes to the differentiation of closely
related species and the classification to species or subspecies level.
In this case sequencing of the internal transcribed spacer (ITS) can
be additionally used to ensure and refine the phylogenetic place-

ment [85]. The ITS is a spacer sequence located between the 16S
and 23S rRNA gene and has a high degree of variation due to rapid
evolution making the differentiation between highly related spe-
cies possible. Although being widely used in the identification of
fungal species, ITS sequences of bacteria are far less covered in the
databases, and for rare or non-culturable species, often no entry of
the same species can be found. The most common primer pair used
to amplify and sequence the nearly full length 16S rRNA gene of
bacterial isolates is 27f and 1492r developed by Weisburg et al.
[86]. A bias in amplicon sequencing can be assumed to result from
the database entries which are dominated by well-studied bacteria,
especially those of importance in human medicine.
All methods for the detection of bacterial communities directly
in the host tissue are faced with the problem of a vast amount of
host DNA compared to a low amount of bacterial DNA in the
samples. During the analysis of the bacterial 16S rRNA gene in
plant samples, especially the mitochondrial and chloroplast DNA
make up a high amount of plasmids in clone libraries and ampli-
cons in NGS sequencing due to the endosymbiotic evolutionary
origin of the organelles and the resulting sequence homologies. A
possibility to reduce the amount of plant organelle DNA in the
samples is the use of selective primers instead of universal bacterial
primers, e.g. the commonly used primer 799f published by Chelius
and Triplett [87]. This selectivity was confirmed in several studies
(e.g. in [55, 88, 89]), but for some host species a low selectivity
[90] or low amplification of bacterial DNA [71] was reported, and
additionally a selective amplification of some bacterial groups can-
not be fully excluded [87]. Shen and Fulthorpe [71] tested an
enzymatic digestion of chloroplast DNA in the PCR template and
were able to reduce, but not eliminate, the chloroplast DNA with
nearly unchanged bacterial species richness. Another recently pub-
lished alternative is the use of blocking primers that bind to
organelle DNA and prevent their amplification, which resulted in
96% of bacterial fragments compared to 0.3% in unblocked sam-
ples for the tested plant material [91].
2.3 Detection Quantitative PCR can be used for the accurate, sensitive, and high-
Methods for Specific throughput detection and quantification of bacteria in plants, and
Bacterial Groups previous protocols are mostly targeting the 16S rRNA coding
region [92, 93]. Several studies have used this method, e.g. to
monitor a growth-promoting strain after inoculation [36, 92, 94,
95]. A detailed study on three bacterial species in in vitro cultures
of Prunus avium revealed strong fluctuations of the endophytes
over time, between different culture phases and between single
microshoots [54]. An alternative to nucleic acid-based methods
are immunodiagnostic assays, e.g. ELISA, primarily used for the
analysis of plant samples for the presence of specific pathogens.
While they have been replaced by nucleic acid-based methods in

research, there are still a high number of immunological detection
tests commercially available [96].
Localization of bacteria within the plant tissue can be visual-
ized by in situ hybridization, for example with digoxigenin-labeled
or fluorophore-labeled 16S RNA probes as shown by Pirttilä et al.
[14] and Lo Piccolo et al. [97], respectively. Optimized signal
intensity was obtained by double labeling of the oligonucleotide
probes (DOPE-FISH) used to analyze endophytes in muskmelon
[9]. Another possibility is the localization by GFP-tagging of bac-
terial strains as applied for the detection of Methylobacterium in
Scots pine seedlings by Koskimäki et al. [6]. Confocal laser scan-
ning microscopy of labeled strains can also be used to visualize
cell-cell interactions and can, in combination with co-occurrence
studies, be used to unravel microbial interaction networks, as
shown for bacteria colonizing lettuce roots [98].
2.4 Linking Biotechnological use and physiological analysis of microorganisms

Microbiome require the isolation and species-specific identification. Armanhi
Composition et al. [99] have described a new method for high-throughput iden-
to Functions tification in a community-based culture collection (CBC) using
multiplex sequencing of amplicons of colonies from primary plat-
ings. Using the PacBio platform, they were able to recover nearly
full-length 16S rRNA gene sequences and to do a cross referencing
with the plant microbial profile analyzed by a culture-independent
method.
The sequencing of total endophyte communities in short time
and with rapidly decreasing costs has, for the first time, allowed the
compilation of the collective genomes of microorganisms associated
with a plant and led to the concept of a plant microbiome relating
to the well-studied human microbiome [1]. Van der Heijden and
Hartmann [100] have highlighted the recent development toward
linking the composition of a microbiome to its function and poten-
tial influence on the plant host performance.
3 Control of Bacterial Endophytes in In Vitro Culture
The control of bacterial endophytes has been the subject of numer-

ous studies but remains a difficult task. Mostly, elimination of
endophytes was the aim of control strategies in the past, whereas
nowadays, we think control should include measures to achieve a
certain balance in plant microbial interactions.
Applying meristem culture, the concentration of certain bacte-
ria in plant tissue or cell cultures can be reduced, but it does not
result in endophyte-free cultures, because bacterial endophytes
have been detected in meristematic cells as well as intracellularly (see

Subheading 1). Incubation of plant material in or on bacterial
growth media may help to identify (and later discard) cultures with
high concentrations of certain endophytes but will neither cover the
non-culturable endophytes nor will all culturable bacteria be
catched. Studies aiming at the elimination of endophytic bacteria
have to be considered with care, since most treatments only will
lead to a reduction in number and suppression of growth. Antibiotics
are frequently used to reduce bacterial endophytes in in vitro cul-
ture, often in combinations. For instance, to obtain visibly clean
cultures of yam (Dioscorea sp.), tetracycline, gentamycin, strepto-
mycin, rifampicin, and vancomycin have been combined [101].
Likewise, the combination of gentamycin, tetracycline, and chlor-
amphenicol proved successful in the reduction of bacterial growth
in Aglaonema in vitro cultures [102]. Besides the high costs of anti-
biotics and the fact that their application will only suppress but not
eliminate bacteria, the main concern of selecting resistant bacterial
strains should restrict their use to rare cases in which the loss of
cultures should be prevented. Broad-spectrum antimicrobials such
as isothiazolinones (ingredients, e.g., in Plant Preservative
MixtureTM and other commercial products) bare less risk for resis-
tance development and have been reported to effectively control
deleterious endophytic bacteria in plant tissue culture [103, 104],
e.g. Dionaea muscipula [105]. However, Luna et al. [106] compar-
ing different commercial biocides containing isothiazolinones
(methylisothiazolinone and chloromethylisothiazolinone in differ-
ent ratios) for controlling bacterial growth pointed to their phyto-
toxicity in Ilex paraguariensis shoot cultures.
As an alternative for antibiotics for controlling endophytic bac-
teria in plant tissue culture, plant extracts have been tested
containing either polyphenols (Melia azedarach fruit extracts

[107]) or essential oils [108] for their antimicrobial activity.
Although some positive effects in reduction of bacteria interfering
with plant tissues were found, the reproducibility and broader
applicability of these approaches as well as their compatibility need
to be proven.
As indicated above, future strategies to control endophytic
bacteria in plant tissue culture should consider plant growth-
promoting bacterial endophytes and strive for a certain balanced
microbial community. However, although first positive results
have been achieved with inoculation of beneficial endophytic
bacteria, their controlled and purposeful application needs inten-
sive research regarding functions, microbial interactions as well
as plant-microbe interactions. It will involve the understanding
of a sensitive balance of bacteria and the plant which is influ-
enced by several external (environmental) as well as internal
(physiological) factors.
4 Conclusions
The knowledge about the diversity and function of endophytes has

increased tremendously, and the view of endophytes has changed
considerably during the last decade. This change is especially obvi-
ous for plant tissue culture, where bacteria were first seen as mere
contaminations, then accepted as endophytes with neutral effects
on plant development. Currently, intense research on the diversity
and potential growth-promoting functions during the propagation
process is conducted. At the same time, new emerging sequencing
technologies gave rise to improved methods for the detection of
bacterial communities.
The functions that endophytic bacteria can have in the plant
are not easy to predict and are most certainly diverse and con-
stantly changing depending on abiotic influences, the physiological
state of the plant host, and competing microorganisms. It also
visualizes the possible switch from a plant growth-promoting
endophytic lifestyle to a saprophytic or even pathogenic lifestyle,
and vice versa. Moreover, the plant is much less flexible than bacte-
rial endophytes concerning the nutrient source, temperature, light
conditions, and other environmental factors. In in vitro culture,
endophytic bacteria can have a growth-inhibiting effect or cover
the medium and plant tissue after excessive growth, sometimes
after prolonged subculturing or after a change in the culture
medium.
Additionally, the safety of the sold product, either the bacterial
inocula or the plant material containing bacteria, needs to be
assessed, especially with regard to human, animal, and plant patho-
genicity. An overview of the registration process and classification
of microbial products in the European Union is given by
Matyjaszczyk [109]. Nevertheless, future tissue culture approaches
should focus on adjusting culture conditions in a way that a favor-
able microbial community is reached, promoting the aspired plant
responses.
References
1. Hardoim PR, van Overbeek LS, Berg G et al Microbiol 16:463–471. https://doi.
(2015) The hidden world within plants: eco- org/10.1016/j.tim.2008.07.008
logical and evolutionary considerations for 3. De Bary A (1866) Morphologie und
defining functioning of microbial endophytes. Physiologie der Pilze, Flechten und
Microbiol Mol Biol Rev 79:293–320. Myxomyceten. Handb der Physiol Bot 2:335
https://doi.org/10.1128/MMBR. 4. Carroll GC (1986) Biology of endophytism
00050-14 in plants with particular reference to woody
2. Hardoim PR, van Overbeek LS, Van Elsas JD perennials. In: Fokkema N, J van den Heuvel
(2008) Properties of bacterial endophytes and (eds) Microbiol. Phyllosph. Cambridge
their proposed role in plant growth. Trends University Press, pp 205–222
5. Petrini O (1991) Fungal endophytes of tree 16. Compant S, Kaplan H, Sessitsch A et al
leaves. In: Andrews J, Hirano S (eds) Microb. (2008) Endophytic colonization of Vitis
Ecol. leaves. Springer, New York, pp 179– vinifera L. by Burkholderia phytofirmans
197. https://doi.org/10.1007/978-1- strain PsJN: from the rhizosphere to inflores-
4612-3168-4_9 cence tissues. FEMS Microbiol Ecol 63:84–
6. Koskimäki JJ, Pirttilä M, Ihantola E-L et al 93. https://doi.
(2015) The intracellular scots pine shoot org/10.1111/j.1574-6941.2007.00410.x
symbiont Methylobacterium extorquens 17. Carroll G (1988) Fungal endophytes in stems
DSM13060 aggregates round the host and leaves: from latent pathogen to mutualis-
nucleus and encodes eucaryote-like proteins. tic symbiont. Ecology 69:2–9. https://doi.
MBio 6:e00039–e00015. https://doi. org/10.2307/1943154
org/10.1128/mBio.00039-15 18. Rosenblueth M, Martínez-Romero E (2006)
7. Mano H, Morisaki H (2008) Endophytic Bacterial endophytes and their interactions
bacteria in the rice plant. Microbes Environ with hosts. Mol Plant-Microbe Interact
23:109–117. https://doi.org/10.1264/ 19:827–837. https://doi.org/10.1094/
jsme2.23.109 MPMI-19-0827
8. Johnston-Monje D, Raizada MN (2011) 19. Promputtha I, Lumyong S, Dhanasekaran V
Conservation and diversity of seed associated et al (2007) A phylogenetic evaluation of
endophytes in Zea across boundaries of evolu- whether endophytes become saprotrophs at
tion, ethnography and ecology. PLoS One host senescence. Microb Ecol 53:579–590.
6:e20396. https://doi.org/10.1371/jour- https://doi.org/10.1007/s00248-
nal.pone.0020396 006-9117-x
9. Glassner H, Zchori-Fein E, Yaron S et al 20. Kozyrovska N (2013) Crosstalk between
(2017) Bacterial niches inside seeds of endophytes and a plant host within informa-
Cucumis melo L. Plant Soil 422:1–13. tion processing networks. Biopolym Cell
https://doi.org/10.1007/ 29:234–243
s11104-017-3175-3 21. Glick BR, Penrose DM, Li J (1998) A model
10. Oldroyd GED, Murray JD, Poole PS, Downie for the lowering of plant ethylene concentra-
JA (2011) The rules of engagement in the tions by plant growth-promoting bacteria.
legume-rhizobial symbiosis. Annu Rev Genet J Theor Biol 190:63–68. https://doi.
45:119–144. https://doi.org/10.1146/ org/10.1006/jtbi.1997.0532
annurev-genet-110410-132549 22. Compant S, Duffy B, Nowak J et al (2005)
11. Compant S, Clement C, Sessitsch A (2010) Use of plant growth-promoting bacteria for
Plant growth-promoting bacteria in the biocontrol of plant diseases: principles, mech-
rhizo- and endosphere of plants: their role, anisms of action, and future prospects. Appl
colonization, mechanisms involved and pros- Environ Microbiol 71:4951–4959. https://
pects for utilization. Soil Biol Biochem doi.org/10.1128/AEM.71.9.4951
42:669–678. https://doi.org/10.1016/j. 23. Zamioudis C, Pieterse CMJ (2012)
soilbio.2009.11.024 Modulation of host immunity by beneficial
12. Yanni YG, Rizk RY, El-Fattah FKA et al microbes. Mol Plant-Microbe Interact
(2001) The beneficial plant growth- 25:139–150. https://doi.org/10.1094/
promoting association of Rhizobium legumi- MPMI-06-11-0179
nosarum bv. Trifolii with rice roots. Funct 24. Ryan RP, Germaine K, Franks A et al (2008)
Plant Biol 28:845–870 Bacterial endophytes: recent developments
13. Reinhold-Hurek B, Hurek T (2011) Living and applications. FEMS Microbiol Lett
inside plants: bacterial endophytes. Curr Opin 278:1–9. https://doi.
Plant Biol 14:435–443. https://doi. org/10.1111/j.1574-6968.2007.00918.x
org/10.1016/j.pbi.2011.04.004 25. Kaymak HC (2010) Potential of PGPR in
14. Pirttilä AM, Laukkanen H, Pospiech H et al agricultural innovations. In: Maheshwari DK
(2000) Detection of intracellular bacteria in (ed) Plant growth heal. promot. bact.
the buds of scotch pine (Pinus sylvestris L.) by Springer-Verlag, Heidelberg, pp 45–79.
in situ hybridization. Appl Environ Microbiol h t t p s : / / d o i .
66:3073–3077. https://doi.org/10.1128/ org/10.1007/978-3-642-13612-2_3
AEM.66.7.3073-3077.2000 26. Spaepen S, Vanderleyden J, Remans R (2007)
15. Kukkurainen S, Leino A, Vähämiko S et al Indole-3-acetic acid in microbial and micro-
(2004) Occurrence and location of endo- organism-plant signaling. FEMS Microbiol Rev
phytic bacteria in garden and wild strawberry. 31:425–448. https://doi.org/10.1111/j.
Hortscience 39:1–5 1574-6976.2007.00072.x
27. Tsavkelova EA, Cherdyntseva TA, Netrusov 37. Herman EB (1990) Non-axenic plant tissue
AI (2005) Auxin production by bacteria asso- culture: possibilities and opportunities. Acta
ciated with orchid roots. Microbiology Hortic 280:233–238. https://doi.
74:46–53. https://doi.org/10.1007/ org/10.17660/ActaHortic.1990.280.40
s11021-005-0027-6 38. Marino G, Altan AD, Biavati B (1996) The
28. Ali B, Sabri AN, Ljung K, Hasnain S (2009) effect of bacterial contamination on the
Auxin production by plant associated bacte- growth and gas evolution of in vitro cultured
ria: impact on endogenous IAA content and apricot shoots. In Vitro Cell Dev Biol Plant
growth of Triticum aestivum L. Lett Appl 32:51–56. https://doi.org/10.1007/
Microbiol 48:542–547. https://doi. BF02823014
org/10.1111/j.1472-765X.2009.02565.x 39. Leifert C, Ritchie J, Waites W (1991)
29. Long HH, Schmidt DD, Baldwin IT (2008) Contaminants of plant-tissue and cell cul-
Native bacterial endophytes promote host tures. World J Microbiol Biotechnol 7:452–
growth in a species-specific manner; phyto- 469. https://doi.org/10.1007/
hormone manipulations do not result in com- BF00303371
mon growth responses. PLoS One 3:e2702. 40. Liu T-H a, Hsu N-W, Wu R-Y (2005) Control
https://doi.org/10.1371/journal. of leaf-tip necrosis of micropropagated orna-
pone.0002702 mental statice by elimination of endophytic
30. Costacurta A, Vanderleyden J (1995) bacteria. In Vitro Cell Dev Biol Plant 41:546–
Synthesis of phytohormones by plant-associ- 549. https://doi.org/10.1079/
ated bacteria. Crit Rev Microbiol 21:1–18. IVP2005673
h t t p s : / / d o i . 41. Leifert C, Cassells A (2001) Microbial haz-
org/10.3109/10408419509113531 ards in plant tissue and cell cultures. In Vitro
31. Salomon MV, Bottini R, de Souza Filho GA Cell Dev Biol Plant 37:133–138. https://
et al (2013) Bacteria isolated from roots and doi.org/10.1079/IVP2000129
rhizosphere of Vitis vinifera retard water 42. Orlikowska T, Nowak K, Reed B (2017)
losses, induce abscisic acid accumulation and Bacteria in the plant tissue culture environ-
synthesis of defense-related terpenes in ment. Plant Cell Tissue Org 128:487–508.
in vitro cultured grapevine. Physiol Plant https://doi.org/10.1007/
151(4):359–374. https://doi.org/10.1111/ s11240-016-1144-9
ppl.12117 43. Thomas P, Swarna GK, Roy PK, Patil P
32. Belimov AA, Dodd IC, Safronova VI et al (2008) Identification of culturable and origi-
(2014) Abscisic acid metabolizing rhizobac- nally non-culturable endophytic bacteria iso-
teria decrease ABA concentrations in planta lated from shoot tip cultures of banana cv.
and alter plant growth. Plant Physiol Biochem Grand Naine. Plant Cell Tissue Org 93:55–
74:84–91. https://doi.org/10.1016/j. 63. https://doi.org/10.1007/
plaphy.2013.10.032 s11240-008-9341-9
33. Wang XM, Yang B, Ren CG et al (2015) 44. Dias ACF, Costa FEC, Andreote FD et al
Involvement of abscisic acid and salicylic acid (2008) Isolation of micropropagated straw-
in signal cascade regulating bacterial endo- berry endophytic bacteria and assessment of
phyte-induced volatile oil biosynthesis in their potential for plant growth promotion.
plantlets of Atractylodes lancea. Physiol Plant World J Microbiol Biotechnol 25:189–195.
153:30–42. https://doi.org/10.1111/ https://doi.org/10.1007/
ppl.12236 s11274-008-9878-0
34. Ali S, Charles TC, Glick BR (2012) Delay of 45. Abreu-Tarazi MF, Navarrete AA, Andreote
flower senescence by bacterial endophytes FD et al (2010) Endophytic bacteria in long-
expressing 1-aminocyclopropane-1-carboxyla term in vitro cultivated “axenic” pineapple
te deaminase. J Appl Microbiol 113:1139– microplants revealed by PCR-DGGE. World
1144. https://doi. J Microbiol Biotechnol 26:555–560. https://
org/10.1111/j.1365-2672.2012.05409.x doi.org/10.1007/s11274-009-0191-3
35. Hilda R, Fraga R (1999) Phosphate solubiliz- 46. Lucero ME, Unc A, Cooke P et al (2011)
ing bacteria and their role in plant growth Endophyte microbiome diversity in micro-
promotion. Biotechnol Adv 17:319–355 propagated Atriplex canescens and Atriplex
36. Faleiro AC, Pereira TP, Espindula E et al torreyi var griffithsii. PLoS One 6:e17693.
(2013) Real time PCR detection targeting https://doi.org/10.1371/journal.
nifA gene of plant growth promoting bacteria pone.0017693
Azospirillum brasilense strain FP2 in maize 47. Jimtha JC, Smitha PV, Anisha C et al (2014)
roots. Symbiosis 61:125–133. https://doi. Isolation of endophytic bacteria from embryo-
org/10.1007/s13199-013-0262-y genic suspension culture of banana and assess-
ment of their plant growth promoting 57. Ardanov P, Sessitsch A, Häggman H et al
properties. Plant Cell Tissue Org 118:57–66. (2012) Methylobacterium-induced endophyte
https://doi.org/10.1007/ community changes correspond with protec-
s11240-014-0461-0 tion of plants against pathogen attack. PLoS
48. Izumi H, Anderson IC, Killham K, Moore One 7:e46802. https://doi.org/10.1371/
ERB (2008) Diversity of predominant endo- journal.pone.0046802
phytic bacteria in European deciduous and 58. Tsavkelova EA, Egorova MA, Leontieva MR
coniferous trees. Can J Microbiol 54:173– et al (2016) Dendrobium nobile Lindl. Seed
179. https://doi.org/10.1139/W07-134 germination in co-cultures with diverse asso-
49. Ulrich K, Stauber T, Ewald D (2008) ciated bacteria. Plant Growth Regul 80:79–
Paenibacillus—a predominant endophytic 91. https://doi.org/10.1007/
bacterium colonising tissue cultures of woody s10725-016-0155-1
plants. Plant Cell Tissue Org 93:347–351. 59. Wang X, Yam TW, Meng Q et al (2016) The
https://doi.org/10.1007/ dual inoculation of endophytic fungi and bac-
s11240-008-9367-z teria promotes seedlings growth in
50. Zaspel I, Ulrich A, Boine B, Stauber T (2008) Dendrobium catenatum (Orchidaceae) under
Occurrence of culturable bacteria living in in vitro culture conditions. Plant Cell Tissue
micropropagated black locust cultures Org 126:523–531. https://doi.
(Robinia pseudoacacia L.). Eur J Hortic Sci org/10.1007/s11240-016-1021-6
73:231–235 60. Kulkarni AA, Kelkar SM, Watve MG,
51. Scherling C, Ulrich K, Ewald D, Weckwerth Krishnamurthy KV (2007) Characterization
W (2009) A metabolic signature of the bene- and control of endophytic bacterial contami-
ficial interaction of the endophyte nants in in vitro cultures of Piper spp., Taxus
Paenibacillus sp. isolate and in vitro-grown baccata subsp. wallichiana, and Withania som-
poplar plants revealed by metabolomics. Mol nifera. Can J Microbiol 53:63–74. https://
Plant-Microbe Interact 22:1032–1037. doi.org/10.1139/w06-106
https://doi.org/10.1094/MPMI- 61. Cassells AC, Harmey MA, Carney BF et al
22-8-1032 (1988) Problems posed by culturable bacte-
52. Donnarumma F, Capuana M, Vettori C et al rial endophytes in the establishment of axenic
(2011) Isolation and characterisation of bac- cultures of Pelargonium domesticum: the use
terial colonies from seeds and in vitro cultures of Xanthomonas pelargonii-specific ELISA,
of Fraxinus spp. from Italian sites. Plant Biol DNA probes and culture indexing in the
13:169–176. https://doi. screening of antibiotic treated and untreated
org/10.1111/j.1438-8677.2010.00334.x donor plants. Acta Hortic 225:153–161.
53. Pohjanen J, Koskimäki JJ, Sutela S et al https://doi.org/10.17660/
(2014) Interaction with ectomycorrhizal ActaHortic.1988.225.16
fungi and endophytic methylobacterium 62. Murashige T, Skoog F (1962) A revised
affects nutrient uptake and growth of pine medium for rapid growth and bio assays with
seedlings in vitro. Tree Physiol 34:993–1005. tobacco tissue cultures. Physiol Plant 15:473–
https://doi.org/10.1093/treephys/tpu062 497. https://doi.
54. Quambusch M, Brümmer J, Haller K et al org/10.1111/j.1399-3054.1962.tb08052.x
(2016) Dynamics of endophytic bacteria in 63. Keller ERJ, Blattner FR, Fritsch R et al (2012)
plant in vitro culture: quantification of three The genus Allium in the Gatersleben plant
bacterial strains in Prunus avium in different collections - progress in germplasm preserva-
plant organs and in vitro culture phases. Plant tion, characterization and phylogenetic analy-
Cell Tissue Org 126:305–317. https://doi. sis. In: Acta Hortic. International Society for
org/10.1007/s11240-016-0999-0 Horticultural Science (ISHS), Leuven,
55. Quambusch M, Pirttilä AM, Tejesvi MV et al Belgium, pp 273–287. https://doi.
(2014) Endophytic bacteria in plant tissue org/10.17660/ActaHortic.2012.969.36
culture: differences between easy- and diffi- 64. Vartoukian SR, Palmer RM, Wade WG
cult-to-propagate Prunus avium genotypes. (2010) Strategies for culture of “uncultur-
Tree Physiol 34:524–533. https://doi. able” bacteria. FEMS Microbiol Lett 309:1–
org/10.1093/treephys/tpu027 7. https://doi.
56. Pirttilä AM, Podolich O, Koskimäki JJ et al org/10.1111/j.1574-6968.2010.02000.x
(2008) Role of origin and endophyte infec- 65. Aoi Y, Kinoshita T, Hata T et al (2009)
tion in browning of bud-derived tissue cul- Hollow-fiber membrane chamber as a device
tures of scots pine (Pinus sylvestris L.). Plant for in situ environmental cultivation. Appl
Cell Tissue Org 95:47–55. https://doi. Environ Microbiol 75:3826–3833. https://
org/10.1007/s11240-008-9413-x doi.org/10.1128/AEM.02542-08
66. Zhang D, Berry JP, Zhu D et al (2015) 76. Muyzer G, Smalla K (1998) Application of
Magnetic nanoparticle-mediated isolation of denaturing gradient gel electrophoresis
functional bacteria in a complex microbial (DGGE) and temperature gradient gel elec-
community. ISME J 9:603–614. https://doi. trophoresis (TGGE) in microbial ecology.
org/10.1038/ismej.2014.161 Antonie Van Leeuwenhoek 73:127–141
67. Eevers N, Gielen M, Sánchez-López A et al 77. Knief C (2014) Analysis of plant microbe
(2015) Optimization of isolation and cultiva- interactions in the era of next generation
tion of bacterial endophytes through addition sequencing technologies. Front Plant Sci
of plant extract to nutrient media. Microb 5:216. https://doi.org/10.3389/
Biotechnol 8:707–715. https://doi. fpls.2014.00216
org/10.1111/1751-7915.12291 78. Van Tongeren SP, Degener JE, Harmsen
68. Middlebrook G, Cohn ML (1958) HJM (2011) Comparison of three rapid and
Bacteriology of tuberculosis: laboratory easy bacterial DNA extraction methods for
methods. AJPH 48:844–853 use with quantitative real-time PCR. Eur
69. Van Overbeek LS, Van Vuurde J, Van Elsas J Clin Microbiol Infect Dis 30:1053–1061.
JD (2006) Application of molecular finger- https://doi.org/10.1007/
printing techniques to explore the diversity of s10096-011-1191-4
bacterial endophytic communities. Microb 79. Rantakokko-Jalava K, Jalava J (2002) Optimal
Root Endophytes 9:337–354. https://doi. DNA isolation method for detection of bacte-
org/10.1007/3-540-33526-9_19 ria in clinical specimens by broad- range
70. Smalla K, Oros-Sichler M, Milling A et al PCR. J Clin Microbiol 40:4211–4217.
(2007) Bacterial diversity of soils assessed by https://doi.org/10.1128/JCM.40.11.4211
DGGE, T-RFLP and SSCP fingerprints of 80. Maropola MKA, Ramond JB, Trindade M
PCR-amplified 16S rRNA gene fragments: do (2015) Impact of metagenomic DNA extrac-
the different methods provide similar results? tion procedures on the identifiable endo-
J Microbiol Methods 69:470–479. https:// phytic bacterial diversity in Sorghum bicolor
doi.org/10.1016/j.mimet.2007.02.014 (L. Moench). J Microbiol Methods 112:104–
71. Shen SY, Fulthorpe R (2015) Seasonal varia- 117. https://doi.org/10.1016/j.
tion of bacterial endophytes in urban trees. mimet.2015.03.012
Front Microbiol 6:1–13. https://doi. 81. Clarridge JE (2004) Impact of 16S rRNA
org/10.3389/fmicb.2015.00427 gene sequence analysis for identification of
72. Garbeva P, Van Overbeek LS, van Vuurde bacteria on clinical microbiology and infec-
JWL et al (2001) Analysis of endophytic bac- tious diseases. Clin Microbiol Rev 17:840–
terial communities of potato by plating and 862. https://doi.org/10.1128/
denaturing gradient gel electrophoresis CMR.17.4.840
(DGGE) of 16S rDNA based PCR fragments. 82. Woo PCY, Lau SKP, Teng JLL et al (2008)
Microb Ecol 41:369–383. https://doi. Then and now: use of 16S rDNA gene
org/10.1007/s002480000096 sequencing for bacterial identification and
73. Weinert N, Meincke R, Gottwald C et al discovery of novel bacteria in clinical microbi-
(2009) Rhizosphere communities of geneti- ology laboratories. Clin Microbiol Infect
cally modified zeaxanthin-accumulating 14:908–934. https://doi.
potato plants and their parent cultivar differ org/10.1111/j.1469-0691.2008.02070.x
less than those of different potato cultivars. 83. Cole JR, Wang Q, Fish JA et al (2014)
Appl Environ Microbiol 75:3859–3865. Ribosomal database project: data and tools
https://doi.org/10.1128/AEM.00414-09 for high throughput rRNA analysis. Nucleic
74. Videira SS, Pereira e Silva MDC, Souza Galisa Acids Res 42:D633–D642. https://doi.
P et al (2013) Culture-independent molecu- org/10.1093/nar/gkt1244
lar approaches reveal a mostly unknown high 84. Quast C, Pruesse E, Yilmaz P et al (2013)
diversity of active nitrogen-fixing bacteria The SILVA ribosomal RNA gene database
associated with Pennisetum purpureum—a project: improved data processing and web-
bioenergy crop. Plant Soil 373:737–754. based tools. Nucleic Acids Res 41:590–596.
https://doi.org/10.1007/ https://doi.org/10.1093/nar/gks1219
s11104-013-1828-4 85. Nesme X, Normand P (2004) Easy individual
75. Marques JM, da Silva TF, Vollu RE et al community typing by rDNA ITS1 analysis.
(2014) Plant age and genotype affect the bac- In: Kowalchuk GA, de Bruijn FJ, Head IM
terial community composition in the tuber et al Mol. Microb. Ecol. Man., 2nd ed.
rhizosphere of field-grown sweet potato Kluwer Academic Publishers, Dordrecht,
plants. FEMS Microbiol Ecol 88:424–435. pp 671–688
https://doi.org/10.1111/ 86. Weisburg WG, Barns SM, Pelletier DA et al
1574-6941.12313 (1991) 16S ribosomal DNA amplification for
phylogenetic study. J Bacteriol 173:697–703. diagnosis of bacterial diseases. Annu Rev

https://doi.org/10.1128/ Phytopathol 42:339–366. https://doi.
jb.173.2.697-703.1991 o r g / 1 0 . 1 1 4 6 / a n n u r e v.
87. Chelius MK, Triplett EW (2001) The diver- phyto.42.040803.140329
sity of archaea and bacteria in association with 97. Lo Piccolo S, Ferraro V, Alfonzo A et al
the roots of Zea mays L. Microb Ecol 41:252– (2010) Presence of endophytic bacteria in
263. https://doi.org/10.1007/ Vitis vinifera leaves as detected by fluores-
s002480000087 cence in situ hybridization. Ann Microbiol
88. Rasche F, Velvis H, Zachow C et al (2006) 60:161–167. https://doi.org/10.1007/
Impact of transgenic potatoes expressing anti- s13213-010-0023-6
bacterial agents on bacterial endophytes is 98. Cardinale M, Grube M, Erlacher A et al
comparable with the effects of plant geno- (2015) Bacterial networks and co-occurrence
type, soil type and pathogen infection. J Appl relationships in the lettuce root microbiota.
Ecol 43:555–566. https://doi. Environ Microbiol 17:239–252. https://doi.
org/10.1111/j.1365-2664.2006.01169.x org/10.1111/1462-2920.12686
89. Sun L, Qiu F, Zhang X et al (2008) 99. Armanhi JSL, de Souza RSC, de Araujo LM
Endophytic bacterial diversity in rice (Oryza et al (2016) Multiplex amplicon sequencing
sativa L.) roots estimated by 16S rDNA for microbe identification in community-
sequence analysis. Microb Ecol 55:415–424. based culture collections. Sci Rep 6:1–9.
https://doi.org/10.1007/ https://doi.org/10.1038/srep29543
s00248-007-9287-1 100. van der Heijden MGA, Hartmann M (2016)
90. Rasche F, Trondl R, Naglreiter C et al (2006) Networking in the plant microbiome. PLoS
Chilling and cultivar type affect the diversity Biol 14:1–9. https://doi.org/10.1371/
of bacterial endophytes colonizing sweet pep- journal.pbio.1002378
per (Capsicum anuum L.). Can J Microbiol 101. Mbah EI, Wakil SM (2012) Elimination of
52:1036–1045. https://doi.org/10.1139/ bacteria from in vitro yam tissue cultures
w06-059 using antibiotics. J Plant Pathol 94:53–58.
91. Arenz BE, Schlatter DC, Bradeen JM, Kinkel https://doi.org/10.4454/jpp.fa.2012.023
LL (2015) Blocking primers reduce co-ampli- 102. Fang JY, Hsu YR (2012) Molecular identifi-
fication of plant DNA when studying bacterial cation and antibiotic control of endophytic
endophyte communities. J Microbiol bacterial contaminants from micropropagated
Methods 117:1–3. https://doi. Aglaonema cultures. Plant Cell Tissue Org
org/10.1016/j.mimet.2015.07.003 110:53–62. https://doi.org/10.1007/
92. Ruppel S, Rühlmann J, Merbach W (2006) s11240-012-0129-6
Quantification and localization of bacteria in 103. Miyazaki J, Tan BH, Errington SG (2010)
plant tissues using quantitative real-time PCR Eradication of endophytic bacteria via treat-
and online emission fingerprinting. Plant Soil ment for axillary buds of Petunia hybrida
286:21–35. https://doi.org/10.1007/ using plant preservative mixture (PPMTM).
s11104-006-9023-5 Plant Cell Tissue Org 102:365–372. https://
93. Andreote F, Azevedo J, Araújo W (2009) doi.org/10.1007/s11240-010-9741-5
Assessing the diversity of bacterial communi- 104. George MW, Tripepi RR (2001) Plant preser-
ties associated with plants. Braz J Microbiol vative MixtureTM can affect shoot regenera-
40:417–432. https://doi.org/10.1590/ tion from leaf explants of chrysanthemum,
S1517-83822009000300001 European birch, and rhododendron.
94. Lacava PT, Li WB, Araújo WL et al (2006) Hortscience 36:768–769
Rapid, specific and quantitative assays for the 105. Bartsch M, Mahnkopp F, Winkelmann T

detection of the endophytic bacterium (2014) In vitro propagation of Dionaea mus-
Methylobacterium mesophilicum in plants. cipula Ellis. Prop Ornam Plants 14:117–124
J Microbiol Methods 65:535–541. https:// 106. Luna C, Acevedo R, Collavino M et al (2013)
doi.org/10.1016/j.mimet.2005.09.015 Endophytic bacteria from Ilex paraguariensis
95. Peralta KD, Araya T, Valenzuela S et al (2012) shoot cultures: localization, characterization,
Production of phytohormones, siderophores and response to isothiazolone biocides. In
and population fluctuation of two root- Vitro Cell Dev Biol Plant 49:326–332.
promoting rhizobacteria in Eucalyptus globu- https://doi.org/10.1007/
lus cuttings. World J Microbiol Biotechnol s11627-013-9500-5
28:2003–2014. https://doi.org/10.1007/ 107. Marino BG, Gaggìa F (2015) Antimicrobial
s11274-012-1003-8 activity of Melia azedarach fruit extracts for
96. Alvarez AM (2004) Integrated approaches for control of bacteria in inoculated in-vitro
detection of plant pathogenic bacteria and shoots of “MRS 2/5” plum hybrid and calla
lily and extract influence on the shoot cul- Org 94:219–223. https://doi.org/10.1007/
tures. Eur J Plant Pathol 141:505–521. s11240-008-9395-8
https://doi.org/10.1007/ 109. Matyjaszczyk E (2015) Products containing
s10658-014-0559-6 microorganisms as a tool in integrated pest
108. Boine B, Naujoks G, Stauber T (2008)
management and the rules of their market
Investigations on influencing plant-associated placement in the European Union. Pest
bacteria in tissue cultures of black locust Manag Sci 71:1201–1206. https://doi.
(Robinia pseudoacacia L.). Plant Cell Tissue org/10.1002/ps.3986
Chapter 5
Digital Photography as a Tool of Research

and Documentation in Plant Tissue Culture
Victor Gaba, Yehudit Tam, Danny Shavit, and Benjamin Steinitz
Abstract
Scientific photography is an important and indispensable tool in plant tissue culture research: photographs
should be taken throughout a project for documentation. The aim of photography in plant tissue culture
should be to illustrate clearly the differentiation, growth, and developmental stages occurring in vitro.
Poor-quality scientific photography in tissue culture research and professional reports results in poor docu-
mentation. If visual aspects of the tissue culture are not well documented or not well reproduced in the
image, an important part of the research is missed, the resulting report is of limited scientific value, and the
research results may not be reproducible. Simple methods for improving the results of photography of
materials from plant tissue culture are described and discussed, along with the necessary photographic
equipment, suitable backgrounds, the construction of photographic plates, and correct use of electronic
files for images. Finally, ethical concerns about image manipulation are discussed.
Key words Photography, Digital photography, Plant tissue culture, Plant development, Image
processing, Image storage, Image manipulation, Ethical considerations
1 Introduction
Photographic documentation is an indispensable tool of plant tis-

sue culture for management, research, documentation, and teach-
ing. Features displayed in photographs support the points made in
reports. Clarity of details in photographs is as essential as the clarity
of tables, graphs, and figures. Unfortunately, photography in plant
tissue culture is often of poor quality because it is not used properly
(e.g., low magnification, insufficient depth of focus, an inadequate
contrast between object and background, the object being in a
culture vessel). Consequently, developmental responses occurring
in vitro are often not well documented and therefore do not con-
stitute scientific evidence so that the report/publication is of lim-
ited scientific value and thus may be a source of irreproducibility.
Additionally, as journals continue to be published in hard copy, the
unfortunate conversion from color to black and white continues to
89
90 Victor Gaba et al.
reduce the quality of final reproduction of images in print.

Fortunately, online journal photoreproduction is now often of
high quality.
Scientific photography in tissue culture shares many features
with scientific photography in general. For a comprehensive and
detailed text on current technologies of scientific photography see
[1]. Photography in plant tissue culture has been discussed previ-
ously [2, 3]. Photomacrography, i.e., close-up photography with
an enlarging lens, is important in plant tissue culture studies as it
permits photographic enlargement of objects too small to be pho-
tographed except with a stereomicroscope (see below) [4–6].
Photomicrography is a separate subject not covered here [7, 8].
There are many cheap and easy-to-implement improvements
in photography possible for plant tissue culture, without sophisti-
cated equipment. Here, we offer guidance on technical aspects
and the use of electronic cameras and advice on the general use of
photography in plant tissue culture studies. This paper is updated
from our previous comments [2] and includes some of the origi-
nal text. We focus on principles of high-quality digital photogra-
phy of plant tissue culture-derived material. These principles apply
to photography of tissue culture in general, as recorded by other
photographic techniques not illustrated in this article. Features of
photographic techniques not included in this chapter concern
development and changes occurring on molecular level in cells
and tissues, such as transgene expression, commonly visualized by
markers, e.g., staining with β-glucuronidase (GUS marker gene)
[9], or fluorescence imaging techniques, e.g., green fluorescent
protein [GFP] [10], or spatial and temporal development and pat-
terning recorded by time-lapse photography, video cell tracking,
and image processing [11–13].
Scientific photography is an essential part of documentation in
plant tissue culture research: photographs should be taken rou-
tinely throughout a project for documentation. Documentation
for scientific experiments and research photography is best per-
formed under controlled conditions, so that at any time it is pos-
sible to return to the same conditions easily. Such control over the
photographic conditions is not possible with a handheld or cell
phone camera.
Use a professional photographer if possible. Electronic cameras
make it easy to take, store, and image-manipulate large numbers of
bad-quality photographs. A professional photographer generally
does a much better job. Professional photography and image pro-
cessing costs are only a very small fraction of the total cost of a
project (when salaries are included), so it is unwise to restrict the
use of photographic services. Remember that sharpness of image
depends more on the skill of the photographer rather than on the
number of megapixels in the photograph.
Photography in Tissue Culture 91
2 Materials
1. Camera: we recommend the use of a digital single-lens reflex

(DSLR) camera (or a camera in which the object is observed via
a screen), on which lenses can be changed. DSLR cameras are
the best for scientific purposes, as what is seen through the
viewfinder is the frame of the camera picture. It is essential that
(a) the camera takes photographs of a minimum of 12 megapix-
els and (b) be able to store the photos in RAW or TIFF formats
(see Note 1). The camera should have manual operation of
aperture and shutter speed, so that the photograph is taken
under controlled conditions, including the depth of field. The
camera needs at least two lenses, a wide-angle to normal-angle
zoom lens (24–70 mm), and a macro lens. Some zoom lenses
are also equipped with a macro lens. A handheld camera must
operate at least as fast as 1/60 s, otherwise use a tripod. Avoid
use of cell phone cameras (see Note 2).
2. Tripod.
3. Cable release.
4. Measuring scale in SI units, i.e., mm (see Note 3).
5. Gray card (see Note 4).
6. Black cloth for background, preferably velvet.
7. Computer with image processing program, preferably Adobe
Photoshop, with enough RAM to handle Adobe Photoshop
without difficulty, and a large storage capacity for the original
photographs and the manipulated images.
8. Computer screen (high quality, calibrated) with controlled
contrast, color, and brightness (price < $1000), which is pref-
erable to a regular screen.
9. Lighting: the minimum photographic installation is a pair of
tungsten-halogen lights of 3200 °K color temperature. High-
intensity LED lighting of the same color temperature is now
commonly used.
10. Stereomicroscope equipped with trinocular head, camera (as
above), and manufacturer’s connector to the camera (see Note 5),
along with a fiber-optic illuminator, preferably with two out-
lets, to illuminate objects evenly.
3 Methods
3.1 Background Careful selection of the background is important. We have reported

Color Contrast on the effect of the use of different colored backgrounds with
material from plant tissue culture, especially if the subject will
finally be published in black and white [2]. Here we show the basic
differences of a black or white background color contrast materials

with tissue culture plants (Fig. 1).
1. Use a black (Fig. 1a, b) or white (Fig. 1c) background, not a
colored background, as this “bleeds” into the subject.
2. Smooth black velvet, or some other black material, is often the
best background for white, yellow, or green tissue culture
organs. The choice of a dark background may also be good in
other circumstances, but it is necessary to test. It is clearly bet-
ter to use a black background (Fig. 1b) for a green plant, rather
than white (Fig. 1c), where the details are observed more
clearly.
3. The white background (Fig. 1c) is less effective: fewer details
can be seen, and the roots are hard to observe. Little of the
different colors of callus with white, green, and brown sectors
can be seen in a black-and-white photograph, although the
best picture is again observed with a black background [2].
4. Do not take pictures of small plants in pots, as the plant will be
indistinguishable against the brown soil background on con-
version of the color picture to black and white for publication
[2]. In such cases it would be better to remove a plant from a
pot and take a photograph against a suitable background (usu-
ally black).
5. Generally, the blue color of β-glucuronidase activity [9] will
not show well against green tissue in a black-and-white photo-
graph. It is best to fix the plant material with ethanol, which
will remove the chlorophyll, and enable easier photography.
3.2 Lighting It is best to use tungsten-halogen light of 3200 °K color tempera-

ture, diffused (indirect) to reduce shadows and reflections. Note
that the color temperature depends on the voltage, so that voltage
changes will be problematic. The minimum photographic installa-
tion is a pair of such light sources, one at each side of the object, so
as not to cast a shadow. Fluorescent lights are not recommended as
they give problems with the color balance, although the balance
can be corrected with a digital camera.
3.3 Taking 1. Set up experiments with extra material specifically for photog-
the Photograph raphy. It is essential to sacrifice the best samples for
photography.
2. Set the date stamp facility of the camera: then you always know
when you took the image. The date image can be removed by
cropping if necessary.
3. Remove the lens cap!
4. Set up lights and camera prior to bringing the plant material
from the growth room, or removal from the test tube, etc., to
prevent the material drying before the photograph is taken.
Fig. 1 Photographs of tissue culture-produced plants within and outside culture vessels, with different contrast
backgrounds. In vitro grown potato plantlets (cv. Nicola) 3 weeks after transfer, grown on Murashige and Skoog
medium [14] with 2 mg/L silver thiosulfate in a 25-mm-wide culture tube, closed with a Steristopper, two
plants per tube. Photographs were taken with a Nikon D800 DSLR camera (36.3 megapixels), with a 24–70 mm
lens, maximum aperture 2.8, illuminated by a 2000 W LED daylight (3200 °K color temperature) bounce
(reflected off the room) light. (a) Plants inside a culture tube are difficult to view, due to the poor optical quality
of the glass and reflections from the glass walls. Even though the tube is not heated, there is no condensation
as is vented by the porous Steristopper; we previously commented [2] on the condensation on the walls of an
unheated magenta box making for poor photography. Additionally, the photograph shows the entire 150 mm
tube with cap, including much empty space, the growth medium, while the plants are only 60–70 mm tall.
Here, even with high-quality photography and without condensation, it is difficult to distinguish details. (b) View
of the potato plants after removal from the culture tube, on a black velvet background. The plants were sacri-
ficed to obtain optimal photographic conditions, and many features are clearly visible. A ruler, not replaced by
a bar, is included for scale. (c) A similar view as in (b) but on a white background. Details of the light-colored
upper stem and the white roots are more difficult to see. (d) Closeup view of a potato plant from (b). The ruler
has been replaced by a scale bar (10 mm). Organs are labeled in white to complement the black background:
root (R), shoot (S), leaf (L)
5. Use a gray card to get the white balance correct (see Note 4).
6. Take the ex/plant out of the box, tube, plate, or jar. The poor
optical qualities of tissue culture containers make quality pho-
tography near impossible. Put nothing between the camera
and the object. Photographs of the object in the container are

the single largest problem with visual documentation in plant
tissue culture. The subject can generally only be photographed
in close-up properly once out of the container. This point is
illustrated in Fig. 1a vs. Fig. 1b and [2] (see Notes 6 and 7).
7. Take closeup photographs. Fill the viewfinder with the object
of interest. General views are not helpful. Convey the informa-
tion best with a good closeup photograph of a single ex/plant
clearly displaying the response(s) of interest. Single explants of
a treatment placed alongside the control may best demon-
strate a point.
8. Take photographs at the maximum resolution of which the
camera is capable (do not reduce picture file size to save storage
space) in RAW format, and save in TIFF format (see Note 1).
9. Take several different photographs, at different exposures, at
different angles for each object. Photograph different ex/
plants showing the same/similar phenomenon—one picture
will often come out rather better than others. Ex/plants are
irregularly shaped objects, and it is hard to predict which shots
will best show the features of interest due to the geometry.
Additionally, the relevance of some details may not be under-
stood until the end of the project when the report/manuscript
is being written. At project summation a good collection of
photographs can be very helpful and will vitiate the necessity
to repeat an experiment for a single observation.
10. After macrophotography of each item, photograph a descrip-
tion of that item on a small paper or card placed on the item.
This enables a permanent record of the event.
11. Have a metric (μm, mm, cm) ruler/scale bar in each picture,
even if it does not look “nice.” The ruler can be excised later
and replaced with a scale bar. Therefore, it is important that
the ruler is spaced apart from the object, so that it can be
removed easily.
12. Obtain a variety of photographs during the project: this is
much easier and cheaper than having to repeat an experiment
to obtain a good photograph. With a range of photographs in
hand, the best and most appropriate picture can be chosen at
leisure. More detail is often visible in photographs when
viewed on a large computer screen. Remember that extra digi-
tal photographs cost no extra.
13. Get good pictures of the whole developmental sequence—this
will help greatly to explain the “story” of the biological response.
Of necessity, the photographs of various developmental stages
will be taken at different times, and the sequence assembled
retroactively. When a particularly good example is observed,
especially of a short-lived developmental phase, sacrifice that
sample to obtain a good picture under optimal photographic

conditions.
14. Get good pictures of the buds emerging from the explant or
the point from which shoots emerge. Do not only show a gen-
eral picture of the explant covered with leaves with no other
details visible.
15. Check the photographs that you have taken immediately, pref-
erably on a good-quality computer screen. If the photograph
does not come out well, repeat until it is of suitable quality. If
what you see is not apparent in the photograph, try again. Try
using a new sample with different geometry and perhaps a dif-
ferent lighting angle.
16. Label photographs soon after the session, as it will be hard to
remember later which treatment was what.
3.4 Photomacro Photographs taken using a good-quality camera and macro lens
graphy as can replace low power stereomicroscopic photographs [4–6].
Replacement for Photomacrography can be used to produce high-quality enlarge-
Stereomicroscopic ments with an improved depth of field compared to conventional
Photography stereophotomicroscopy. This is because when the object is large
enough to photograph with a macro-lens and high-quality DSLR
camera, the photograph can be taken at enough of a distance so
that the entire object is in focus. In consequence, even though the
object does not occupy the entire photographic frame, the object
can be cropped out of the picture and enlarged (with the com-
puter), observing more detail because of the high resolution. With
such a method, it is possible to capture, for instance, the transitory
stage where the meristem dome appears or late stages of somatic
embryo development (depending on the species).
3.5 Stereomicro Taking photographs with a stereomicroscope is an essential part of

scopic Photography plant tissue culture research and documentation. The stereomicro-
scope permits a large working distance and a depth of field, factors
inversely related to resolution: the higher the resolution, the
smaller the depth of field and working distance. A good-quality
camera (as discussed above) is essential and is best fitted to the
stereomicroscope by a trinocular head (so that the sample can be
viewed easily and an image made of the same field), using the man-
ufacturer’s connector (see Note 5).
The field of view of the specimen should be lit evenly if possi-
ble (bilateral illumination), preferably using a fiber-optic device to
avoid heating. A cable release must be used. The major problem is
the depth of field, which is often very small with a stereomicro-
scope. Therefore care has to be taken to focus exactly on the object
of interest, as otherwise it will not be in focus. Some stereomicro-
scopes are equipped with an iris diaphragm between the eyepieces
and the objective lens. Closing the diaphragm increases the depth
of field, greatly improving the picture [3], although with loss of

quality. Photography with the stereomicroscope requires practice.
Record the conditions and magnifications carefully when taking
stereophotomicrographs.
3.6 Image 1. Organize and store original photographs properly, separately

Processing from processed images. The originals are your primary data
and therefore should be conserved; the originals may be
required again (see Notes 8 and 9).
2. Manipulation of images must only be performed on copies (see
Note 9).
3. It is very important to balance the color on the computer
screen (in the image processing program) so that the image
observed on the screen is what appears when printed.
4. Do not enlarge digital pictures to the point that the grain
(individual pixels) is visible.
5. Beware the loss of resolution that will occur from repeated
processing of the same photograph in the JPEG format
(see Note 8).
6. Perform all handling in TIFF format. Save final versions as
high-quality PDF or JPEG files (see Notes 1 and 8).
3.7 Construction Photographic plates with a multiplicity of images are a common

of Photographic Plates feature of plant tissue culture publications. Professional preparation
of such a plate is best; however certain rules should be followed:
1. Use the best possible original images.
2. All photos must be handled (contrast and brightness) in the
same manner (see Note 9). It is very advisable to use the same
photographic conditions so that you do not have to make such
changes. Any changes in contrast should be used for the whole
sequence of photos.
3. Show only the details of interest. Crop images to remove
uninteresting material. It is essential to record the scale of each
photograph. Prior to cropping, an SI scale bar of a known size
(e.g., 0.1, 0.5, 1, 5, or 10 mm) can be constructed for each
photograph from the ruler in the original photograph using
the image processing program. The scale bar should be placed
inside the area to be retained after cropping. The bar will be
maintained in the photograph during subsequent manipula-
tions and serve as an easy permanent record.
4. Lighting should be uniform in each photograph in the plate.
5. The color in the photographs for a plate should be balanced.
6. It is best to try to arrange the images in even rows i.e., 2 × 2,
2 × 3, 3 × 3, etc. Arrangements with images of different sizes
are harder to assemble successfully.
7. Do not use so many pictures that the individual image size is

too small to see the object properly (i.e., no postage stamps).
Avoid photographs that are too small with important details
too difficult to see.
8. Illustrate any feature with the minimal number of photographs.
9. Create composite plates with the explants or plants placed in
the same orientation for easier understanding. One photo-
graph can illustrate several points, saving valuable space, and
assisting in setting the context.
10. Label points of interest clearly on figures with lettering that
will be clearly visible following reduction in size of the figure
for publication. Labeling of figures is best performed at the
end of processing of the images. Label points of interest with
arrows, using clearly understood contractions, i.e., shoot mer-
istem (sm), adventitious meristem (am), bud (B), somatic
embryo (sm), globular embryo (ge), root (R), shoot (S), leaf
(L), etc. Use label colors (black or white) that contrast with
the background (Fig. 1d).
11. Take care that the labels maintain their correct positions dur-
ing further manipulations of the photograph.
12. An intermediate stage in plate construction is illustrated in
Fig. 1b and c and [2], where each picture still has the original
ruler attached (i.e., has not been replaced by a bar), and each
individual photograph still needs to be cropped to remove
unwanted material.
13. Pay close attention to the “Instruction for Authors” for the
journal to which you wish to submit the manuscript as to the
details of numbering and labeling photographic plates, and
consult recently published photographs in that journal. Design
plates to fit the size of the published journal page—single col-
umn or page width [2]—according to the “Instructions for
Authors.”
14. The descriptions in the caption and the text have to match
with what is seen in the photograph.
3.8 Conversion Check every journal publisher’s “Instructions to Authors” prior to

of Color Plates submission of a manuscript. Often color plates are submitted for
to Black and White publication because researchers do not have the facility for process-
for Publication ing black-and-white photography. Following conversion of color
plates to black and white for printing, the quality of the resultant
plate may be poor. This problem is best met by the general improve-
ments in photography discussed above. Additionally, for the con-
version to black and white, it is important to have a good range of
contrast in the original color photograph: the details of interest
especially must be clear. It is possible to use the option (e.g., in
Adobe Photoshop) of “conversion of color to grayscale,” to

observe the color plate after “conversion” to black and white. A
xerographic copy of the color photograph will give a good repre-
sentation of the black-and-white conversion that a publisher
will make.
Manipulation of photographs by an image processing program
prior to conversion of a color plate to black and white involves
management of the highlight, mid-tone, and shadow to obtain
contrast in the black-and-white product not observed in color. As
discussed above, the greater the contrast in the color original, the
easier it is to obtain observable details in the black-and-white
image. Of course, the conversion problem will disappear as the all-
electronic library approaches.
4 Conclusions
Scientific photography is an important facet of plant tissue culture

and has to be worked at to achieve good results, as with any other
technique. The aim of photography in plant tissue culture should
be to illustrate clearly the developmental stages occurring in vitro
and the final plant product. If these are not well documented, time,
effort, and money are being wasted. Plant tissue culture is a very
visual science, and this valuable tool must be used effectively.
5 Notes
1. Briefly, good-quality electronic cameras offer different file for-

mats (JPEG, TIFF, and RAW) to store captured frames [15,
16]. The JPEG format is the most commonly used, although
it is unable to store all the original data, including metadata,
and therefore digital processing is greatly limited by the lack of
available data. JPEG files also lose image quality each time they
are edited and stored. TIFF is rather more useful, and the files
are larger to accommodate the necessary data. TIFF files store
image information in a “lossless” format, in contrast to
JPEG. RAW files contain all the information collected by the
sensors in the camera (literally, the raw data of the frame cap-
ture, i.e., analogous to film negatives), as well as all the camera
metadata. RAW is the only valid scientific storage format and
therefore an excellent basis for subsequent digital processing.
RAW files can be very large (>70 megabytes per frame), which
may also be problematic, and require professional-quality
processing programs such as Adobe Photoshop. RAW files
should be converted to TIFF for processing. Each camera
manufacturer uses their own type of RAW file [15, 16].
2. The picture quality of cell phone cameras is improving, but

really not to the quality of a dedicated quality camera.
Additionally, even good-quality cell phones save photographs
as JPEG files, which are problematic (see Note 1).
3. It is critical that every photograph has a proper SI measure-
ment scale included. It is not adequate to include the ubiqui-
tous marker pen or scales in inches.
4. Purchase a professional gray card (reflects 18% of light) (available
in good camera shops or online) to get the white balance cor-
rect at the start of each photo-session, so that the picture will
always be at the same exposure [17]. Keep the same gray card
so that you have always the same lighting conditions. White
paper can also be used as a balancing card if necessary.
5. The manufacturer’s connector tube between the camera and
the microscope often seems to be ridiculously expensive; some-
times it is possible to make one locally (but often with prob-
lems). Therefore, it is generally rather better just to buy the
part, which will then function without problems for years.
6. It is sometimes possible to take photographs with the explant
out of the laminar flow bench and return the material to axenic
conditions. After optimum illumination for photography has
been set up and the camera focused on the object in the closed
petri dish or tube, remove the lid, readjust the focus slightly for
the state of free optical pathway, take the picture, and immedi-
ately replace the lid. The returned material can continue to
develop in culture; sometimes contamination will occur after
several days, during which further development can be
observed. Sometimes the material does not become contami-
nated. It can be possible to take photographs and with luck
avoid contamination without compromising conditions of
photography (see Note 7).
7. Exceptions for rare material: if the material to be photographed
is rare, or cannot be removed from the container (and there is
very little material that cannot be “sacrificed”), try the follow-
ing procedure. The culture vessels have to be kept “warm” in
the culture room and transferred to the photographic site
(already prepared) as quickly as possible, to prevent condensa-
tion on the lid or walls caused by cold air. Note that vented
tissue culture vessels have much less condensation (Fig. 1a).
Closeup photographs have to be taken so that walls of the
vessels are not within the focal plane of the camera.
8. Resolution: take photographs at maximum resolution that the
camera is capable of (do not reduce picture file size to save
storage space) in RAW format (to preserve maximum original
photograph data), and save in TIFF format.
9. Ethical issues concerning image manipulation.
Nowadays it is critical that no data, including images, have

been fabricated or manipulated to support one’s conclusions. The
original data, including images, should also be available for review-
ers’ and editors’ consideration and, after publication, for colleagues
worldwide [18]. Therefore, storage, documentation and availabil-
ity of the original images are now seen to be very significant.
Moreover, it is essential to note that major publishers now have
strong policies concerning data usage and sharing, i.e., Springer
Nature [19], Nature Publications [20], and Elsevier [21]. EMBO
Publications have a staff member dedicated to checking each image
presented for publication for veracity [22]. Image/data fabrication
and manipulation have become an important issue in plant science
[23]. The journal Plant Cell Reports has a section on “Image
manipulations” in its “Instructions to Authors.” This journal fol-
lows the recommendations formulated by the Rockefeller
University Press [24], and we quote:
(a) No specific feature within an image may be enhanced, obscured,
moved, removed, or introduced. (b) Adjustments of brightness,
contrast, or color balance are acceptable if they are applied to the
whole image and as long as they do not obscure, eliminate, or
misrepresent any information present in the original, including the
background. (c) The grouping of images from different parts of
the same gel, or from different gels, fields, or exposures must be
made explicit by the arrangement of the figure (e.g., dividing
lines) and in the text of the figure legend. (d) If the original data
cannot be produced by an author when asked to provide it, accep-
tance of the manuscript may be revoked.
Acknowledgments
Contribution from the Agricultural Research Organization,

Volcani Center, Rishon LeZion, Israel, No. 570/17.
References
1. Ray S (2015) Scientific photography and Society Handbooks). BIOS Scientific,

applied imaging. CRC Press, Boca Raton, FL Abingdon
2. Gaba V, Shavit D, Steinitz B et al (2004) 5. Branston C (2013) Focus on close-up and
Photography as a tool of research and docu- macro photography. Focal Press, Abingdon
mentation in plant tissue culture. In Vitro Cell 6. Sholik S, Eggers R (2000) Macro and close-up
Dev Biol Plant 40:536–541. https://doi. photography handbook. Amherst Media,
org/10.1079/IVP2004544 Buffalo, NY
3. Gray DJ (2000) Photographic methods for 7. Evennett PJ (1989) Image recording. In:
plant cell and tissue culture. In: Trigiano RN, Lacey AJ (ed) Light microscopy in biology. A
Gray DJ (eds) Plant tissue culture concepts and practical approach. Oxford University Press,
laboratory exercises, 2nd edn. CRC Press, Oxford, pp 61–102
Boca Raton, pp 55–60 8. Lacey AJ (1999) Light microscopy in biology a
4. Bracegirdle B (1994) Scientific practical approach, 2nd edn. Oxford, Oxford
PhotoMACROgraphy. (Royal Microscopical University Press
9. Jefferson RA, Kavanagh TA, Bevan MW tography. Int J Remote Sens 31:2009–2042.
(1987) GUS fusion: β-glucuronidase as a sensi- https://doi.org/10.1080/014311609
tive and versatile gene fusion marker in higher 02929271
plants. EMBO J 6:3901–3909 17. Rouse D. http://digital-photography-school.
10. Sheen J, Hwang S, Niwa Y et al (1995) Green- com/get-your-white-balance-right-in-sec-
fluorescent protein as a new vital marker in onds-using-grey-card/. Accessed 10 May 2017
plant cells. Plant J 8:777–784. https://doi. 18. Stewart CN Jr (2014) Images and imagination:
org/10.1046/j.1365-313X.1995.08050777.x the role of figures in plant cell and molecular
11. Olofsdotter M (1993) Image processing: a biology publications. Plant Cell Rep 33:829–
non-destructive method for measuring growth 830. https://doi.org/10.1007/
in cell and tissue culture. Plant Cell Rep s00299-014-1579-6
12:216–219. https://doi.org/10.1007/ 19. Springer Nature (2016) Research data policies.
BF00237057 http://www.springernature.com/gp/group/
12. Toonen MA, Hendriks T, Schmidt ED et al data-policy/. Accessed 10 May 2017
(1994) Description of somatic-embryo- 20. Nature (undated) Data availability statements
forming single cells in carrot suspension cul- and data citations policy: guidance for authors.
tures employing video cell tracking. Planta http://www.nature.com/authors/policies/
194:565–572. https://doi.org/10.1007/ data/data-availability-statements-data-cita-
BF00714471 tions.pdf. Accessed 10 May 2017
13. Quiroz-Figueroa FR, Rojas-Herrera R, Galaz- 21. Newman A (2013) The art of detecting data
Avalos RM et al (2006) Embryo production and image manipulation. https://www.else-
through somatic embryogenesis can be used to vier.com/editors-update/story/publishing-
study cell differentiation in plants. Plant Cell ethics/the-art-of-detecting-data-and-
Tissue Organ Cult 86:285–301. https://doi. image-manipulation. Accessed 10 May 2017
org/10.1007/s11240-006-9139-6 22. Van Noorden R (2015) The image detective
14. Murashige T, Skoog F (1962) A revised who roots out manuscript flaws. Nature.
medium for rapid growth and bio assays with http://www.nature.com/news/the-image-
tobacco tissue cultures. Physiol Plant 15:473– detective-who-roots-out-manuscript-
497. https://doi. flaws-1.17749. Accessed 10 May 2017
org/10.1111/j.1399-3054.1962.tb08052.x 23. Retraction Watch (2015). http://retraction-
15. Fraser B (2004) Understanding digital raw watch.com/2015/12/04/voinnet-retracts-
capture. http://wwwimages.adobe.com/ highly-cited-paper-bringing-his-total-to-7/.
www.adobe.com/content/dam/Adobe/en/ Accessed 10 May 2017
products/photoshop/pdfs/understanding_ 24. Rossner M, Yamada KM (2004) What's in a
digitalrawcapture.pdf. Accessed 10 May 2017 picture? The temptation of image manipula-
16. Verhoeven GJJ (2010) It's all about the for- tion. J Cell Biol 166:11–15. https://doi.
mat--unleashing the power of RAW aerial pho- org/10.1083/jcb.200406019
Chapter 6
Selection of Molecular Markers for the Estimation

of Somaclonal Variation
Octavio Martínez
Abstract
Tissue culture for plant micropropagation is known to be a source of genetic changes termed “somaclonal
variation”. This protocol is designed to help in the selection of one or more types of molecular marker
systems for the optimal detection and measurement of somaclonal variation. Somaclonal variation is influ-
enced by the reproductive biology of the species, the number of individuals taken as tissue source, and the
tissue culture protocol, while its detection and measurement depends upon the molecular marker system
selected, which can also vary in the intensity of genome sampling. In turn, the intensity of genome sam-
pling can be regulated varying parameters of the molecular technique. These factors are discussed and
illustrated with in silico molecular marker protocols. Software, programed in R, to perform simulation and
evaluation of somaclonal variation is made publicly available.
Key words Molecular markers, Somaclonal variation
1 Introduction
The term “molecular marker” currently means a DNA-based

marker: a polymorphism in the sequence of the genome of the spe-
cies studied that allows to distinguish individuals. At its finer level,
a molecular marker is a difference in a single nucleotide at a given
position on the genome, which is known as “single nucleotide
polymorphism” or SNP [1, 2]. It is important to note that, except
for insertions or deletions (indels) [3] and whole chromosome or
ploidy variations [4], all differences between two or more individ-
ual genomes can be seen as collections of SNPs. However, we
rarely need to know exactly all the differences (SNPs and indels)
between two or more genomes; thus, we usually rely in sampling
those differences by using a specific method of DNA polymor-
phism detection, suited for particular proposes. Here we will dis-
cuss different molecular marker methods to detect and measure
somaclonal variation within tissue culture, to help in the selection
of an optimum plan for each situation.
103
104 Octavio Martínez
“Somaclonal variation” refers to the phenotypic and genotypic

variants originated during cell and tissue culture [5–7]. Here we
use the term to mean exclusively genotypic changes due to the
processes inherent to tissue culture and regeneration [8]. Even
when the exact causes of somaclonal variation are not completely
understood [5, 9], it is clear that the numbers of these variants are
larger, or possibly easier to detect, under tissue culture than in cul-
tivated plant populations [8]. However, it has been demonstrated
that somaclonal variation in regenerant Arabidopsis lineages is
associated with genome-wide elevation in DNA sequence muta-
tion rate [9]. In [10] the author mentions that the most important
factors that affect the variation generated by tissue culture are the
degree of departure from organized growth, the genotype, growth
regulators and tissue source. Further factors are associated with
somaclonal variation in the case of transgenic plants [11].
Somaclonal variation can be considered as an undesirable side
effect of tissue culture when complete genetic homogeneity is
desired among regenerated plants [12] but can also be regarded as
a novel source of genetic variability to be used for breeding pro-
poses [10]. In both cases, it is important to detect and estimate the
degree of such source of genetic diversity. To this aim molecular
markers are a powerful tool; however, there is a plethora of differ-
ent methods (Table 1), and many factors must be taken into
account to select the ones that are likely to give optimum results.
For general proposes, I consider that there is a source of plant
tissues from one or more individuals, which is subjected to tissue
culture and micropropagation, resulting in a set of regenerated
plants. Under this framework, the protocol proposed here is
expected to help in the decisions about the selection of marker type
and degree of genome sampling to obtain estimates of genetic
variability.
To be able to estimate genetic variations due to tissue culture,
we need to know—as a baseline—the genetic variability preexistent
in the source individuals. In turn, this preexistent variability
depends on the reproductive biology of the species, which can be
considered in the spectrum from completely asexual (clonal) repro-
duction, passing through hermaphroditic plants with strict self-
pollination, to full allogamy (cross-fertilization)—in some cases
forced by self-incompatibility—up to unisexual (diclinous) species
[13]. Genetic diversity is positively correlated with the reproduc-
tive system of the species [14]; clonally propagated crops, like
banana or Agave tequilana, present very low diversity between
individuals, while outcrossing species, like maize, will generally
have large genetic diversity [15, 16].
Here we will consider genetic variations that affect single
nucleotides (SNPs) or small insertions or deletions (indels), rang-
ing from one to a few tens of DNA bases. We let out of our a nalyses
large changes which are cytogenetically observable—gain or loss of
Molecular Markers in Somaclonal Variation 105
Table 1
Molecular marker protocols classified by their type and suitability for
detection and measurement of somaclonal variation at genomic level
Acronym Description References

A—Genome-independent (GI) methods suitable for detection of somaclonal
variation
AFLP Amplified fragment length [21]
polymorphism
AP-PCR Arbitrarily primed-PCR [22]
DAF DNA amplification fingerprinting [22]
DArT Diversity arrays technology [23]
RAD-seq Restriction site-associated DNA [24]
sequencing
SRAP Sequence-related amplified [25]
polymorphism
B—Genome-dependent (GD) methods suitable for detection of somaclonal
variation
GBS Genotyping by sequencing [26]
(produces SNPs)
HTG High-throughput genotyping by [27]
whole-genome resequencing
RAD Restriction site-associated DNA [28]
tags
SNP Single nucleotide polymorphism [2]
SNP array Large SNP arrays for plant [29]
genotyping
TILLING Targeting induced local lesions in [30]
genomes
C—Not very useful for detection of somaclonal variation; better alternatives
exist
ISSR Inter-simple sequence repeat [15]
(inter-microsatellite regions)
RAMP Randomly amplified microsatellite [31]
polymorphisms
RAPD Random amplified polymorphic [22]
DNA
SCAR Sequence characterized amplified [32]
region (derived from
RAPD)
SSCP Single-strand conformation [33]
polymorphism
(continued)
Table 1
(continued)
Acronym Description References

SSR Simple sequence repeats or [34]
“microsatellites”
STMS Sequence tagged microsatellite [34]
sites or “microsatellites”
RFLP Restriction fragment length [19]
polymorphism
TRAP Target region amplification [35]
polymorphism
VNTR Variable number of tandem [36]
repeats
D—Transposable elements (TE) related; not optimal to detect somaclonal
variation
IMP Inter-MITE polymorphism [37]
IRAP Inter-retrotransposon amplified [38]
polymorphism
MITES Miniature inverted repeat [39]
transposable elements
MSTD Methyl-sensitive transposon [40]
display
RBIP Retrotransposon-based insertion [41]
polymorphism
REMAP REtransposon-microsatellite [38]
amplified polymorphism
S-SAP Sequence-specific amplification [42]
polymorphism
TD Transposon display [43]
E—Other methods with specific proposes
CAPS Cleaved amplified polymorphic [44]
sequence (SNPs to PCR
markers)
MSAP Methylation-sensitive amplification [18]
polymorphism
RAP-PCR RNA fingerprinting by arbitrarily [45]
primed PCR
RNA-Seq-SNPs SNPs obtained from RNA-Seq [46]
full chromosomes, changes in ploidy [4], as well as epigenetic

changes (methylation/de-methylation) [17], which can be
detected by specialized markers as MSAP (Table 1) using enzymes
sensitive to methylation changes [18].
2 Materials
There are many molecular marker techniques, and here we will not
make a comprehensive review of all of them; methods that had
been surpassed by more modern alternatives, as hybridization-
based techniques—RFLP [19] and alike—or methods with repro-
ducibility problems, as RAPD [20], will not be examined.
We will consider two populations of plants, say the “source” of
tissue, which can be constituted by different individual plants, say
S = (S1, S2, …), and the “regenerant” plants [9], resulting from
tissue culture and posterior regeneration, which will be denoted by
Ri = (Ri1, Ri2, …), where it is understood that all plants on Ri were
regenerated from tissue culture from Si. Somaclonal variation
appears between the “parent” plant, Si, and their regenerants, say
between the pairs Si and Rij, but can also be measured between
regenerants from the same source, say in pairs Rij, Rik where j ≠ k.
If the sources of somaclonal variation are independent in the same
experiment, which appears to be a reasonable assumption, and
denoting by d(x, y), a measure of genetic differences (polymor-
phisms) between individuals x and y, we have that d(Rij, Rik) ≈ 2
d(Si, Rij) or, equivalently, d(Rij, Rik) ≈ 2 d(Si, Rik); i.e., in average,
the genetic differences between two regenerants from the same
source are likely to be twice the differences between the source and
any of the regenerants. Different options to measure genetic differ-
ences, i.e., different forms of “d(x, y)”, are possible for each molec-
ular marker protocol; this will be briefly discussed. We must also
take into account the generation at which somaclonal variation is
measured, for example, we could directly take the population of
regenerants, Ri, or alternatively take plants resulting from self-
pollinated Ri individuals, Rij × Rij. In this last case, any recessive
mutation resulting from tissue culture will have a chance of 1/4 to
be homozygous in that generation [9].
2.1 Molecular We can divide molecular marker techniques first in two main
Marker Protocols groups, say, systems that need information from a reference
to Sample Genome genome and those that do not need such resource. In general,
Diversity protocols that do not need a reference genome depend on restric-
tion enzymes and polymerase chain reaction (PCR) and can give
information about non-located anonymous genome places or
alternatively about a particular locus or set of loci.
Given that we are concerned here with the detection of muta-
tions that arise as a result of somaclonal variation, we can discard
from our discussion techniques that measure variation at a single

locus or at a small set of loci, by measuring the number of tandem
repeated sequences flanked by conserved regions (mini- and mic-
rosatellites, SSR, STMS, VNTR, ISSR, RAMP; see box C in
Table 1). Such methods are very powerful to measure the diversity
of populations, for example, in maize [16]; however, the fact that
they target a single locus at the time, needing the knowledge of the
conserved flanking sequences and thus particular PCR primers for
each locus, made them inefficient for detection of mutations dis-
tributed in a completely random fashion along the whole genome.
Other method that targets specific genes is the TRAP technique
(Table 1).
Transposable elements (TE) [47] are an important source of
genetic and epigenetic genome variations, and activation of quies-
cent transposable elements and retrotransposons has been reported
to occur during tissue culture [48, 49]. There are various marker
systems associated with TE, as IRAP, MITES, MSTD, RBIP, and
REMAP (see box D in Table 1). In general, TE cause genome
modifications that can be considered as insertions or deletions,
when a transposition event creates a new copy of the transposon,
while the original copy remains intact at the donor site, or when
the TE changes its location in the genome [50]. These changes can
also be detected by techniques different to the TE-related markers
mentioned above, and thus, unless there is a strong reason to focus
on the search for TE genome variation, it is more efficient to use
general protocols that will detect, aside from TE-related variations,
other mutations. Also, it has been reported that TE mutations
were not found in sampled regenerants of Arabidopsis, where high
levels of SNPs were found [9]; thus, the relative importance of
somaclonal variation produced by TEs appears to be small when
compared with SNPs.
Having discarded in principle molecular marker protocols that
detect variations in particular loci or depend on TEs (boxes C and
D in Table 1, respectively), we need to decide between methods
that need a reference genome (box B in Table 1) or those that do
not need such resource (box A in Table 1).
As a consequence of next-generation sequencing technologies
(NGS), we have the possibility to re-sequence entire genomes or
sample entire transcriptomes more efficiently and economically
and in greater depth than ever before [51]. In particular, for detec-
tion and measurement of somaclonal variation in species with a
reference genome, it is now possible to employ methods of “geno-
typing by sequencing” or “GBS” [26] which have multiple
protocol variations to reduce genome complexity; see, for example,
[52–55]. Examples of other genome-dependent methods to obtain
SNPs are HTG, RAD, SNP arrays, and TILLING (see box B in
Table 1).
When transcriptome (RNA-Seq) data are accessible for the

species of interest, and even if a reference genome is not available,
it is possible to develop and use SNPs derived from the transcripts
to measure somaclonal variation [46, 56–58]; however, given the
dependence from RNA-Seq data, this method will not be further
discussed.
Finally, when a reference genome is not available, we can
employ one of the genome sampling methods which depend on
restriction enzymes, PCR reactions, and measurement of the
molecular size of DNA fragments, as AFLP, AP-PCR, DAF, DArT,
RAD-seq, or SRAP (see box A in Table 1 for a short description
and references). The selection of one of these particular protocols
depends on considerations of equipment and reactant availability
as well as cost; however, these methods are similarly enough to be
discussed as a group.
To compare the molecular marker protocols for measurement
of somaclonal variation, I selected as representative of those inde-
pendent of a reference genome (GI) the AFLP, and GBS as repre-
sentative of the ones that depend of a reference genome (GD)—see
boxes A and B in Table 1, respectively. GD methods will give as
result SNPs [1, 2], i.e., variations in a single base which are pre-
cisely located at a single genome location. If the corresponding
reference genome is well annotated, we will know for each SNP if
it is situated in a gene and in such case if it is likely to change an
amino acid within a protein, or to change gene regulation, if
located into an important DNA motif within a promotor, etc. In
contrast, GI methods will generally give an anonymous and not
genome located polymorphism, usually as a difference in weight
for DNA fragments. Thus, while GD SNPs can give clues to their
phenotypic effect, anonymous DNA fragments obtained from GI
will not suggest any direct or indirect phenotypic effect.
It is important to keep in mind that both, GD and GI proto-
cols, are methods to sample the genomes, and as such the results
will detect genetic variants (polymorphisms) only in a proportion,
say P, of the genomes in the individuals studied. P determines the
precision (statistical variability) and accuracy (statistical bias) of the
estimates. If the sampling is fully random, i.e., if each base has the
same probability to be included in the sample, the method will be
unbiased or completely accurate, and under such condition, small
values of P will produce precise estimates with narrow confidence
intervals. It is difficult to guarantee that the sampling method will
be “fully random,” because for sampling in both, GD and GI pro-
tocols, we reduce the full genome to a sample by selecting particular
DNA motifs—in general enzyme restriction sites. Thus, the ran-
domness of the sampling depends on the distribution of such sites
in the genome; for GI there is no way to estimate such distribution
a priori, while for GD methods, such distribution can be analyzed
to assure that it is relatively uniform along all reference genome. In
all cases methods that give polymorphisms clustered at particular

loci or genome segments—as the ones presented in boxes C and D
of Table 1—must be avoided to ensure the unbiased and precise
estimation of somaclonal variation.
Other factor to take into account for method selection is if the
detected somaclonal variation will be employed in future plant
breeding programs [10] or if its evaluation is intended simply to
measure the genetic homogeneity of regenerants [12]. Because
GD will always give polymorphisms of known physical genome
location, they are advantageous in the former case (polymorphism
will be used in breeding), while if GI methods are employed, a set
of crosses will be needed to obtain their approximate location in a
recombination map. The high costs in resources and time to per-
form crosses for mapping polymorphisms will almost surly exceed
the differential cost of GI (cheap) compared with GD (relatively
expensive); thus, if a reference genome is available and the markers
will be used in breeding, the wiser decision appears to be to select
a GD protocol. For breeding proposes there are relatively simple
ways to transform SNPs into markers that can be easily evaluated in
populations [44, 59, 60], for example, for marker-assisted selec-
tion [1].
2.1.1 Adjusting In either case, GI or GD, the proportion of the genome sampled,
the Proportion of Sampled P, can be indirectly adjusted to have the desired precision and accu-
Genome racy. For example, in the AFLP protocol [21], representing GI
methods, the selection of the restriction enzymes, selective primers,
and window of molecular weights to be observed can be tuned to
give the desired resolution. In AFLP, as in the other methods pre-
sented in box A of Table 1, inexpensive pilot studies can be per-
formed, with the default parameters recommended in the original
reference and with a small number of regenerants to test the ability
of the corresponding method to detect somaclonal variation.
In AFLP and alike protocols (GI, box A of Table 1), a poly-
morphism between two individuals is evident when a fragment, say
f, is present in one of the individuals but absent in the other. The
only knowledge that we have about f consists on the motifs present
at the 5′ and 3′ extremes of the DNA fragment, corresponding to
the selective primers, and the size of f in base pairs (bp), but we do
not know either the full sequence or the genome position of f.
Fragments with the same 5′ and 3′ flanking sequences and the
same size are assumed to be equal; however, for small fragments
(less than 100 bp), there is a relatively large probability that two
different sequences appear as the same (indistinguishable) frag-
ment; this probability vanishes as the length of the fragments
increases; thus, we can be more confident on the presence/absence
of a fragment representing a true polymorphism in “large” than
“short” fragments. Causes for the polymorphism on the f fragment
when it is present in individual a but absent in individual b are
either the presence of one or more SNPs in the flanking sites rec-
ognized by the enzyme/primer in the individual b or the presence
of an insertion or deletion (indel) within the sequence of the frag-
ment in individual b. There is not a way to discriminate between
these two putative causes. However, detailed studies of the molec-
ular nature of somaclonal variation in Arabidopsis suggest that the
most frequent causes of these variations are point mutations which
are detected as SNPs [9]. Assuming that only SNPs arise as a result
of somaclonal variation, we can estimate the proportion of the
genome sampled by GI methods, P̂ as P ˆ = (l ´ n ) / T , where l is
l
the length of the flanking sites recognized by the enzyme/primer
used, n is the number of fragments found, and Tl is the total length
of the genome. This estimator is obtained under the assumption
that there are not indels present, and thus, it almost surely is under-
estimating the true fraction of the sampled genome, i.e., the
expected value of this estimator is likely to be smaller than the true
value of the parameter, or in symbols E éP̂ ù < P . Under the fur-
ë û
ther assumption that only a single SNP caused each one of the
polymorphisms, an estimator for the number of SNPs between two
individuals will be given by l × n. Again, this estimator is likely to
underestimate the true number of SNPs, given that more than one
SNP could be present in the length of the flanking sites recognized
by the enzyme/primer used (l).
On the other hand, the proportion of genome sampling, P, in
GBS and alike protocols (GD, box B of Table 1) can be controlled
via enrichment or reduction of genome complexity [52]. While
enrichment of specific genomic regions [61] does not appear to be
optimum for the detection of somaclonal variation, we want to
have an even distribution of all genome; reducing genome com-
plexity with restriction enzymes (as in GI methods) will give uni-
formity of sampling over the genome and is specific and highly
reproducible, among other advantages [52]. In GBS and alike pro-
tocols, the proportion of the genome sampled, P, can be con-
trolled by the selection of the restriction enzyme, specific primers,
length of reads sequenced, and number of reads sequenced. In
contrast with GI methods, all SNPs existent between a given
genome and the reference genome can be detected; thus, in these
cases the proportion P can be estimated, assuming completely ran-
dom sampling, as P ˆ = (l ´ n ) / T , where now l is the length of the
l
read (sequence) obtained and n is the number of reads sequenced,
while as before Tl is the total length of the genome. Consequently,
the number of SNPs detected between each sampled genome and
the reference will be equal to the ones present in the total length
of sequence compared: l × n. It is important to note that indels
between the reference and sampled genome will not be directly
estimated. This is a result of the fact that to detect polymorphisms
(SNPs), GD methods align the sampled reads to the reference
genome; if an indel is present in a given read, that read will not be
(correctly) mapped to the reference genome; it will be considered

as an “orphan” read without genome alignment. The proportion
of non-mapped reads will give a coarse estimator for the number of
indels present between the genomes.
To be able to fairly compare GI with GD methods, we must
have a comparable proportion of the sampled genome by each
method, say we need that PGI ≈ PGD, and we also need a common
measure of polymorphisms between the two methods. A common
measure to compare polymorphism’s estimation between methods
is the probability of SNP production; in the following subsections,
I give estimators for such parameter for AFLP, representing GI
methods, and GBS, representing GD methods.
2.1.2 Measuring As can be seen in Subheading 6.3.1.1, an estimator for the true
Somaclonal Variation probability of a point mutation causing a differential fragment in
with GI Methods GI methods, g, is given by ĝ = d/nl, where d is the number of dif-
ferential fragments, n is the total number of detected fragments,
and l is the length in bp of the site(s) recognized by the enzymes/
primers used. This estimator has expectation and variance given by
E[ĝ] = g and V[ĝ] = (g(1 − lg))/nl, respectively. For example, in
the AFLP protocol, if the enzymes EcoRI, a “rare” cutter, digest-
ing at GAATTC motifs, and MseI, a “frequent” cutter digesting at
TTAA motifs, and without using further selective bases, we will
have l = 6 + 4 = 10 and assuming that we observe a total of n = 500
fragments of which only one is differential (d = 1), we get ĝ = 1/
(500 × 10) = 0.0002 with an approximate 95% CI equal to [0,
0.0006].
The estimator ĝ = d/nl is statistically “unbiased”, i.e., E[ĝ] = g;
however, it is important to notice that we are assuming that when
a differential fragment is detected, it is the product of a single SNP
in the sampled region; two or more SNPs within the region recog-
nized by the primer—such region has length l—will be taken as a
single SNP; thus, ĝ could be underestimating the true value of g.
On the other hand, any indel that causes a differential fragment
will also be counted as a SNP; thus, from that point of view, ĝ
could be overestimating the true value of g. In summary, ĝ is sensi-
tive to both, SNPs and indels, and will give an approximate idea of
the variation arising by somaclonal variation.
Also notice that the total number of fragments obtained, n, is
unknown a priori, and the only way that we have to decrease the
variance of ĝ, V [ĝ] = (g (1 − g))/nl, is by increasing the length of
the recognized sequence, l. However, if we increase l, for example,
by selecting enzymes with a longer recognition site or using fur-
ther restrictive bases in the PCR primers, then we will likely reduce
the total number of fragments observed, n, and to certain extent,
that will compensate the decrease in variance achieved by increas-
ing value of l. The only real solution is then to employ more than
one combination of enzymes and primers. For example, if
k-independent combinations of enzymes/primers are employed,

then we have that the quantities to be substituted in the ĝ formula
are given by l = ∑ li, d = ∑ di, n = ∑ ni, i = 1, 2, ···, k, where li,
di, and ni are the length, total number of fragments, and number
of differential fragments obtained with the ith combination. Of
course, as k increases, the precision and accuracy of the estimation
of g will also increase.
An important advantage of GI methods over GD ones is the
fact that GI are less expensive and easy to scale. For example,
assume that you have 50 regenerants from the same source plant.
It is easy to perform the AFLP protocol with the 50 regenerants
and the source in the same experiment, obtaining estimates of g
not only between each regenerant and the source, but also between
each possible pair of distinct regenerants. In contrast, to use GD
protocols, you must perform independent sequencing of the source
and each one of the regenerants, but if the genome of the source is
distinct from the one of the source, only indirect estimation of the
variation produced by somaclonal variation can be obtained.
2.1.3 Measuring With GD methods we can estimate the true proportion of SNPs
Somaclonal Variation between the reference genome and other genome, say g, with the
with GD Methods estimator ĝ = t/rs, where t is the observed number of SNPs, r is the
number of reads (small sequences) obtained, and s is the size (in
bp) of each one of the reads. This estimator has E[ĝ] = g (i.e., it is
an unbiased estimator) and V[ĝ] = g(1 − g)/rs, and thus, increas-
ing r or s or both, i.e., increasing sample size, we can decrease the
variance and thus increase the precision of the estimate. See details
in Subheading 6.3.1.2.
It is important to remark that GD methods give polymor-
phisms only with the reference genome and not directly for the
somaclonal variation between the source and the regenerants. For
example, assume that the species of interest is maize and that the
reference genome available is the inbreed line B73 [62]. Also
assume that the regenerants will be obtained from tropical maize
“X” by the protocol given in [63]. We will be interested in soma-
clonal variation present between regenerants of the plant S ∈ X,
i.e., a specific plant of the variety X used for tissue culture, which
will give regenerants R = (R1, R2, · · ·). Our parameter of interest
is the somaclonal variation produced by tissue culture and regen-
eration of S, that is, all SNPs obtained by comparing the (unavail-
able) genome of S and regenerants R1, R2, …, say the SNPs found
by comparing pairs (S, R1), (S, R2), ….
To clarify this we will denote ĝ(X, Y) as the estimate of g from
samples of genomes X and Y. We want to estimate ĝ(S, Ri), where
S is the genome of the source and Ri is the genome of one of the
regenerants. However, because S is not available, we need to use an
indirect estimate of ĝ(S, Ri), given by the approximated relation
ĝ(S, Ri) ≈ ĝ(G, Ri) − ĝ(G, S), which assumes that the SNPs that
we observe when comparing the reference genome G with the

regenerant Ri are the ones that happened between the reference G
and the source S plus the ones that happened as a result of soma-
clonal variation, i.e., the ones between S and Ri. If experiments are
performed with both, the source and a set of regenerants, say R1,
R2, · · ·, R1k, then an estimator of g(S, R) which uses all available
information is given by
æ i =1 ö
gˆ (S ,R ) = ç å gˆ (S ,Ri ) / k ÷ - gˆ (G ,S )
èk ø
where we are assuming additivity and independence of each one of
the estimates. In Subheading 6.3.1.2, it is demonstrated that this is
an unbiased estimator of somaclonal variation; however, the cost of
not having the source genome available results in an increase of the
variance of the estimator, which is proportional to the sum of the
variances of the estimators of variation between the reference and
the source plus the variation between the reference and regenerant(s).
2.2 In Silico The idea of this section is to display the performance of two molec-
Demonstration ular marker systems, AFLPs and GBS (as representatives of GI and
of Diversity Detection GD methods, respectively), in a controlled and simplified in silico
and Measurement experiment. With this aim I implemented simplified versions of the
AFLP and GBS protocols in a set of computer functions (see
Subheading 6.3.2). These functions can be applied to any species
with a sequenced genome, but for brevity I demonstrate them with
the Arabidopsis thaliana chromosome 2. Briefly, the experiment
consists in generating a known number of point mutations, ran-
domly scattered in the chromosome, and then measure the ability
of the molecular marker systems to detect such mutations, which
represent somaclonal variation.
In [9] the authors found that the rate of SNP mutations gener-
ated by somaclonal variation in Arabidopsis increases by a factor of
between 60 and 350, with reference with the normal mutation rate
in sexual lineages of Arabidopsis, which is estimated to be ≈7 × 10−9
mutations per site per generation [64]. Here, for the in silico
experiment, I used four rates of SNP generation (g values): a “base-
line” value gB = 10−9, on the same order of magnitude than the one
reported in [64] for Arabidopsis; a “low” value, gL = 10−5; an
“intermediate” rate, gI = 10−4; and a “high” rate equal to gH = 10−3.
To mimic what happens in reality during tissue culture, I
assumed that we have as “source” of the experiment a genome
which is not identical to the reference genome. This source has
approximately 10−3 SNPs with the reference (see details in
Subheading 6.3.2). Somaclonal variation was simulated from the
source by obtaining 100 independent sequences mutagenized at
each rate of mutation (gB, gL, gI, and gH). Table 2 summarizes the
process to obtain the sequences analyzed.
Table 2
Summary of process to obtain the sequences analyzed
Row Origin Mutation rate (g) Result n. Seq

1 ch2nN 10−3 Source 1
2 Source gB = 10−9 Base 100
3 Source gL = 10 −5
Low 100
4 Source gI = 10−4
Intermediate 100
5 Source gH = 10−3 High 100
In Table 2 we can see that the origin of all sequences was the
chromosome 2 of A. thaliana, denoted here as “ch2nN.” From
ch2nN I obtained the “source” sequence (row 1 of Table 2), and
from this single sequence, four sets of 100 independently mutated
sequences were obtained from “source” with the four mutation
rates (rows 2–5 in Table 2). The in silico AFLP and GBS protocols
were applied to each one of the sequences obtained to see how
effective and efficient were the protocols to detect and measure the
simulated somaclonal variation.
In silico AFLPs were simulated with restriction enzymes EcoRI
and MseI with no further restrictive nucleotides; thus, the length
of the sites which could result in differential fragments was
6 + 4 = 10 bp, corresponding with the lengths of the sites recog-
nized by the enzymes, six for EcoRI and four for MseI. We have
one original sequence, “ch2nN” from which we obtained one
“source” and from this four sets of 100 mutated sequences, “base,”
“low,” “intermediate,” and “high” (Table 2). Table 3 presents the
results of AFLP comparison between and within the sets and the
corresponding statistics for the g estimators (see Subheading 6.3
for details). The number of possible comparisons performed is
shown in column “N comp.” For example, when doing compari-
sons between all possible pairs of sequences in the “base” set, we
have (100 × (100–1))/2 = 4950 comparisons, etc.
In a real case, it is possible that the researcher does not have
plants from the original genome of the organism (represented here
by “ch2nN”); however, it will have the “source” plant and a set or
regenerants, and the objective of the AFLP protocol will be then
to estimate somaclonal variation produced from source to regener-
ants as a result of tissue culture.
From Table 3 we can see that in the simulation performed, the
rate of SNPs between the reference, ch2nN, and the source,
g = 10−3, is overestimated (ĝ ≈ 0.003, row 1) and also that the
“extra” variation in the base sequences, gB = 10−9, was not detected
by the AFLP protocol (rows 2–4). Somaclonal variation in the low
Table 3
Results of comparisons between in silico AFLP sets
R Comparison N comp. nU nD ĝ Sĝ LL UL
1 ch2Nn vs. source 1 598.00 17 0.002843 0.053318 0.001511 0.004175
2 ch2Nn vs. base 100 598.00 17 0.002843 0.053318 0.001511 0.004175
3 Source vs. base 100 587.00 0 0 0 0 0
4 Base vs. base 4950 587.00 0 0 0 0 0
5 ch2nN vs. low 100 598.03 17.06 0.002853 0.053409 0.001518 0.004187
6 Source vs. low 100 587.03 0.06 1e-05 0.000783 0 3e-05
7 Low vs. low 4950 587.06 0.12 2e-05 0.001542 0 6e-05
8 ch2nN vs. intermediate 100 598.40 17.85 0.002983 0.054592 0.00162 0.004345
9 Source vs. intermediate 100 587.43 0.91 0.000155 0.008994 2e-06 0.000384
10 Intermediate vs. 4950 587.86 1.82 0.000308 0.015143 1.2e-05 0.000695
intermediate
11 ch2nN vs. high 100 600.99 23.44 0.0039 0.062365 0.002354 0.005445
12 Source vs. high 100 590.32 7.10 0.001202 0.034057 0.000344 0.002065
13 High vs. high 4950 593.49 13.9 0.00234 0.04795 0.001135 0.003545
R row; N comp. number of comparisons, nU (average) number of fragments in the union of the sets, nI (average) num-
ber of differential fragments between the sets, ĝ (average) estimate of g, S ĝ (average) estimate of standard deviation for
ĝ, LL and UL lower and upper 95% approximate CI limits for g, respectively
set, gL = 10−5, was overestimated between the reference (ch2nN)

and low group (row 5, parametric value
g + gL = 10−3 + 10−5 = 0.00101; estimated as 0.002853) but accu-
rately estimated between the source and the low group (row 6,
ĝL = gL = 10−5). Also, the average somaclonal variation between
pairs of regenerants of the low group, that given that have the
double of mutation between them, 2gL = 2 × 10−5, present in aver-
age exactly that value (row 7). Estimates obtained with the inter-
mediate and high values of g, gI = 10−4 and gH = 10−3, respectively,
and presented in rows 8–13 in Table 3 give values close to the
expected for the ĝ estimator at each situation. From the data in
Table 3, we can conclude that, with the parameters tested, the
AFLP protocol will tend to detect and give good measures of
somaclonal variation when such variation is relatively large, i.e., for
values of SNP probability g > 10−5.
As mentioned earlier, if the genomes of the reference and the
source are different—as will usually be the case—we will not be
able to directly estimate the somaclonal variation induced in the
regenerants but will need to do at least two GBS experiments, one
to evaluate the SNPs between the reference and the source and
other(s) to evaluate SNPs between the reference and one or more

regenerants.
In silico GBS simulations were performed between the refer-
ence, ch2nN, and the source and each one of the groups of 100
simulated regenerants (“base,” “low,” “intermediate,” and
“high”). Also, I employed two levels of genome sampling, a very
small sample, employing 60 reads of 100 bp for a total of 6000 bp
sampled and a relatively large one with 10,000 reads of 100 bp for
a total sampling of one million bp. The “small” sample size is com-
parable with the number of bases sampled by the AFLP protocol
(around 600 fragments each one exploring 10 bp), while the large
sample of one million bp is in the low end of realistic GBS experi-
ments. Figures 1 and 2 present the most relevant results.
From Fig. 1, we can see how the distribution of the estimated
number of SNPs, ĝ, decreases in amplitude and variance as the
sample size increases. Thus, with samples of around one million bp
Fig. 1 Distributions, as box plots, for the estimated values of g using the in silico GBS method between the
reference (ch2nN) and the source with reads of 100 bp and sampling from 10 to one million of reads (10, 100,
1000, ···, 106) to give 100, 1000, ···, 107 bp sampled. In each case 100 independent experiments were per-
formed. The true frequency of SNPs, g = 10−3, is shown as a red dotted line
Fig. 2 Results of estimations employing the AFLP and GBS protocols in the cases where the regenerants have
a proportion of gH = 10−3 SNPs (“high” group) compared with the source. Black circles correspond to AFLP
and red symbols to GBS. Red crosses were obtained by GBS assuming the genome of the source was known
but sampling only 600 bp, while red triangles were obtained by GBS assuming the genome of the source was
unknown and sampling one million bp
(corresponding here to sequencing 104 reads of 100 bp each), we

have a very accurate and unbiased estimation of g.
To compare the in silico AFLP and GBS protocols, we can
look at Fig. 2. This figure shows the estimates of g under AFLP
(black circles) or two different strategies of GBS sampling (red
symbols).
From Fig. 2, we can see how in all the 100 simulated cases, the
AFLP protocol detects the somaclonal variation between the
source and the 100 regenerants; not a single estimate (black cir-
cles) touches the value of 0; thus, in all simulated cases, somaclonal
variation was detected. The average of the 100 AFLP estimates of
g is 0.0012, very close to the true value of g = 0.001, and those
estimates have a standard deviation of 0.0004. On the same sam-
pling conditions, i.e., sampling only 6000 bp and with the genome
of the source assumed to be known, the GBS estimators (red “+”
symbols in Fig. 2) are less accurate; the raw number of detected
SNPs per sample was 0, 1, and 2 in 60, 30, and 10 of the cases,
giving estimates of g at 0, 0.0017, and 0.0033, respectively, with a
mean of 0.0008 and a standard deviation of 0.001. Thus, at the
same genome coverage, the estimator based on AFLPs appears to
have better statistical properties than the one based on GBS. On
the other hand, if the intensity of genome sampling by GBS is
large, as in the case of using 104 reads, each one of 100 bp for a
genome coverage of one million bases (red triangles in Fig. 2), the
estimation of SNPs by GBS is much better than the one with
AFLPs, having a mean of 0.001 with a standard deviation of
3.9 × 10−5, even when the genome of the source is unknown, but
the number of SNPs existent between reference and source
genomes is accurately estimated—in this case with a value of
g = 0.001.
2.3 Selecting Table 4 summarizes the contrasting characteristics of GI and GD

a Genome- methods for the estimation of somaclonal variation generated
Independent (GI) or by tissue culture and regeneration.
Genome-Dependent If not reference genome is available for the species of interest,
(GD) Method obviously only GI can be selected to measure somaclonal variation,
for the Estimation but even if a reference genome is available, it could be advisable to
of Somaclonal use GI methods with this aim. In fact, given the low technical com-
Variation plexity and cost of GIs, if a large number (from tens to hundreds
or more) of regenerants need to be tested, it will be better to use
GI than GD methods (see rows 4, 5, 7, and 8 of Table 4). In cases
where somaclonal variation will be used for breeding proposes
[10], then the best strategy could be to use first GI methods in all,
or a large proportion of regenerants, and then use GD methods
only for the regenerants which will be used in a breeding program,
for example, those presenting an interesting phenotype or
genotype.
A final warning: given that both, GI and GD methods, are only
sampling a fraction of the genome, the absence of detected poly-
morphisms in any particular case cannot guarantee that there are
not, in fact, some differences between the genomes. In those cases
it is worth to pay attention to the genome coverage (proportion of
the genomes sampled) to give proper interpretation to the results.
3 Notes
3.1 Estimation Assume that the length of genome sampled for each enzymes/
of Mutation Produced primer combination is l and denote as fA, fB the sets of unique frag-
by Somaclonal ments weights observed in a predetermined window when the pro-
Variation cedure is performed in genomes A and B, respectively. Evidently,
fragments with the same weight (in base pairs; bp) in both genomes,
3.3.1 Genome-
i.e., the intersection of the sets fA, fB, represented as fA ∩fB, do not
Independent (GI) Systems
give information about polymorphisms; we assume that fragments
Table 4
Contrasting characteristics of GI and GD molecular marker protocols for
the estimation of somaclonal variation
R GI (As AFLPs) GD (As GBS)

1 Can be employed without any Must have a reference genome
previous knowledge of the of the species studied and
genomes plant material from the
referenced genome
2 Low genome coverage Generally very high genome
coverage
3 Genome coverage unknown a Genome coverage can be
priori; can be controlled by controlled by sequencing
distinct combinations of deepness of libraries; one
restriction enzymes and addition library must be constructed
of restrictive bases to PCR for each genome involved
primers (source and each
regenerant)
4 Direct estimation of somaclonal Only indirect estimation of
variation from source to somaclonal variation (needs
regenerant(s) as well as between also to estimate SNPs
regenerants between reference and
source)
5 Can use the comparisons of Cannot use comparisons
different regenerants for the between regenerants for the
estimation of somaclonal estimation of somaclonal
variation. Thus, if a profile for variation; if libraries are
the source plus profiles for k constructed for the source
regenerants are estimated, then and each one of k
k + k(k-1)/2 estimations are regenerants, only k
available, incrementing the estimations are available
precision of the final estimate
6 Do not give mapped Gives polymorphisms directly
polymorphisms (fragments are as SNPs; they are located
anonymous and not located in into a single location of the
the genome) genome
7 Low cost per unit (regenerant High cost per unit (regenerant
individual) individual)
8 Recommended if large number of Recommended if a small
regenerants must be tested, and number of regenerants with
these will not be employed in particular phenotypes will be
further breeding programs (only genotyped and employed in
homogeneity of regenerants further breeding programs
needs to be evaluated)
of the same size are identical in both genomes. However, frag-

ments present in A but absent in B, say fA − fB, or vice versa, pres-
ent in B but absent in A, say fB − fA, represent each one at least one
SNP polymorphism. Differential fragments found between the two
genomes are then (fA − fB) ∪(fB − fA) = (fA ∪ fB) − (fA ∩ fB), i.e.,
fragments found in A or B but not in both. Thus, the total number
of polymorphisms detected is the norm (number of elements) of
the set (fA ∪ fB) − (fA ∩ fB), say d = |(fA ∪ fB) − (fA ∩ fB)|.
When we observe a differential fragment, we will assume that
a single SNP exists in one, and only one, of the l bases recognized
by the primers, and if we denote by g the probability of a single
SNP, we obtain that the probability of observing a single differen-
tial fragment is given by g × l = gl, that is, the probability of a
mutation in a single base multiplied by the length of the sites
sampled, l.
Both the total number of observed fragments, n = |(fA ∪ fB)|,
and the number of differential fragments, d = |(fA ∪ fB) − (fA ∩ fB)|,
can be considered as random variables, say D and N, respectively.
The distribution of N is a function of the DNA sequences recog-
nized by the primers along the two genomes, but the probability
function for the number of differential fragments given a value of
N = n; n ≥ d, say, P[D = d|N = n], d = 1,2,···, n, will be binomial
with parameters n, lg, say
n!
P [D = d | N = n ] = ( lg ) (1 - lg )
d n -d
d ! (n - d )!

and we have E [D] = nlg and V [D] = nlg(1 − lg). But in fact
we want to estimate g, and the estimator of g is given by ĝ = D/nl
from which we obtain E [ĝ] = g and V [ĝ] = (g(1 − lg))/nl.
An approximate confidence interval (CI) for the true value of
g can then be obtained by
gˆ ± za gˆ (1 - lgˆ ) / nl

where zα is the normal deviance for an error type I of size α, for
example, for a 95% CI, we have z0.05 ≈ 1.96, and if we have l = 10,
n = 500, and d = 1, we have ĝ = 1/(500 × 10) = 0.0002, and thus,
the 95% CI, excluding negative values, is given by [0, 0.0006].
The R function “gi estimates” gives values for the estimate of
g, say, ĝ, as well as its estimated variance, standard deviation, and
CI when n, d, and α are input. This function is included with the
software available for simulation.
3.1.1 Genome- GD methods to estimate polymorphisms (SNPs) between a refer-

Dependent (GD) Systems ence and a source genomes consist in sampling reads (small
sequences) of a random subset of the genome, mapping such reads
to the reference genome, and thus directly detecting the SNPs as
differences between each uniquely mapped read and the corre-

sponding genome location. As mentioned before, indels will result
in not mapped reads and will coarsely estimate the number of such
polymorphisms. In GD methods the randomness of the genome
sample depends on the specific method for reduction of genome
complexity (as selection of restriction enzymes or others), while
the deepness of sampling (sample size) is controlled by two param-
eters, r, the number of reads sampled, and s, the size (in bp) of each
one of the reads. In general, r and s can be approximately set by the
researcher, and given that the product r × s is usually very small
compared with the total length of the genome (Tl), the probability
of obtaining overlapped reads can be ignored, and the total num-
ber of SNPs present in the whole length sampled (r × s) say, t, can
be directly used to estimate the true frequency of SNPs between
the reference and the sampled genome, say, g. In this case the esti-
mate of g is given by ĝ = t/rs, i.e., we estimate the true proportion
of SNPs by the ratio of the observed number of SNPs, t, over the
total length of the sampled space, rs. The number of observed
SNPs, T, has a binomial distribution of parameters rs and g, where
rs is the sample taken (in number of bases) and g is the true fraction
of SNPs that exist between the reference and the sample of inter-
est, that is,
(rs )! t
P [T = t ] = g (1 - g )
rs -t
t ! (rs - t )!

And we have that the expectation and variance of T are given by E
[T] = rsg and V [T] = rsg(1 − g), respectively. Thus, our estimator
ĝ = T/rs has E [ĝ] = g, i.e., it is an unbiased estimator and V
[ĝ] = g(1 − g)/rs. An approximate 1 − α CI for the true value of g
is given by
gˆ ± za gˆ (1 - gˆ ) / rs

As mentioned in the main text, when the source genome, S, is dif-
ferent from the reference genome, G, we must use the indirect
estimator
æ i =1 ö
gˆ (S ,R ) = ç å gˆ (S ,Ri ) / k ÷ - gˆ (G ,S )
è k ø
to estimate somaclonal variation of interest, that is, the variation
between the source and its regenerants. In the previous expression,
ĝ (G, Ri) is the estimate of mutation between the reference genome
and regenerant Ri, I = 1, 2, ··· k. Here we will present the assump-
tion for ĝ (G, Ri) to be a good estimator, as well as its expectation
and variance.
Denote as g∗ the true mutation, or equivalently SNP propor-
tion, between the source S and any regenerant Ri, that is, g∗ = g (S,
Ri), is our parameter of interest. Also denote as gS, gR the true

values of g between the reference genome, G, and the source, S,
and any regenerant, R, respectively, that is, gS = g(G, S), gR = g(G,
Ri). The main assumption that we need to do for the estimation to
be valid is the additivity of the mutation rate g, i.e., we must assume
that gR = gS + g∗ and thus g∗ = gR − gS; the source of somaclonal
variation is equal to the one observed between the reference
genome and the regenerants, gR = g(G, Ri), minus the one observed
between the reference genome and the source, gS = g(G, S). This
assumption will be valid only if the values of g involved are “small”
and independent, i.e., if we neglect the probability that a mutation
happening by somaclonal variation will revert the base to the state
existent in the reference genome. Under this assumption, and tak-
ing the previously presented unbiased estimator of g, ĝ = T/rs, we
know that the estimators used in independent GD experiments are
unbiased, say, E [ĝS] = gS and E [ĝR] = gR, and thus,
æ i =1 ö
E éë gˆ (S ,R ) ùû = ç å E éë gˆ (S ,Ri ) ùû / k ÷ - E éë gˆ (G ,S ) ùû = g R - g S = g *
èk ø
i.e., the proposed estimator is unbiased.
To calculate the variance of ĝ∗ = ĝ(S, R), we need to take into
account the sample sizes employed in each experiment. For this,
we will assume that the same size of reads, s, is used in all experi-
ments and denote as ni = ris the sample size used at each one of the
k experiments performed to obtain the estimate in the ith regener-
ant, Ri; i = 1, 2, ···, k, while nS = rSs will be the sample size in the
experiment to estimate gS. Under these conditions, we have V
[ĝiR] = gR(1 − gR)/ni and V [ĝS] = gS(1 − gS)/nS and, given that all
covariances involved are null by the assumption of independence,
we have that
æ i =1 1 ö 1
V éë gˆ (S ,R ) ùû = V éë gˆ * ùû = g R (1 - g R ) ç å 2 ÷ + g S (1 - g S )
è i =k k ni ø nS

In particular, if the same number of reads, r, is used in all experi-
ments, then ni = ns = n = rs and in that case
1æ 1 ö
V éë gˆ (S ,R ) ùû = V éë gˆ * ùû = ç g R (1 - g R ) + g S (1 - g S ) ÷
nè k ø
and, as before, we can obtain approximate CI for g∗.
3.2 Details of the In For the in silico experiment, I used as ‘genome’ only A. thaliana
Silico Protocol chromosome 2, which corresponds to accession NC 003071 of the
for Detection NCBI and has a total length of 19,698,289 bp. After deleting
and Measurement unknown bases (“N” in the accession), the length of this sequence
of Genetic Diversity was 19,695,783 bp—a decrease in 2506 bp; this sequence was
named “ch2nN.” A “source” genome was obtained by mutating
ch2nN with a rate of g = 10−3. By this a total of 19,696 SNPs were

produced between ch2nN and source; a realized proportion of
19,696/19695783 = 0.001000011 SNPs.
The functions were programed in the R statistical environment
[65]. The functions depend on the R package “seqinr” [66] and
also on the EMBOSS software [67]. The software and data needed
to reproduce the results presented here, or to perform experiments
varying the input (genomes, sequences, enzymes, etc.), including
a README file with instructions to perform the experiments, are
available from the author.
Three main R functions are employed: “mutagenize,” “GBS
sample,” and “AFLP”. The rationale of these functions is pre-
sented in the following pseudo-code sections.
3.2.1 Pseudo-code Description: From a sequence and proportion of point mutation is

for “Mutagenize” obtained a mutated sequence.
1. Input sequence, “s”, and proportion of point mutations to be
obtained, “p”.
2. Calculate length of “s”, say “l(s)”, and number of point muta-
tions, say “n = l(s) × p” (rounded to zero decimals).
3. Obtain the pseudo-random positions of the “n” mutations, say
“m = (m1, m2, …, mn).”
4. For each one of the “n” positions in “m”, change the corre-
sponding base of “s” by a different one, selecting at random one
of the three alternative bases. For example, if at “mi” the base of
“s” is “A”, then the result in the mutated sequence will be
selected at random and with the same probability from “{T, G,
C} = {A, T, G, C} − {A},” etc.
5. Output the mutated sequence.
Note that the number of realized mutations on the input
sequence s is not random, but fixed; only the positions at which the
mutations happen are random.
3.2.2 Pseudo-code Description: Input a sequence to be compared with a reference,

for “GBS Sample” the number of (random) reads that will be obtained (sequenced)
and the length of such reads. Output a vector of statistics for the
true number as well as estimated SNPs.
1. Input the sequence, “s”, the reference (from the genome), “r”,
the number of reads to be sequenced, “n”, the length (in bp) of
each one of the reads to be sequences, “l”, and the proportion
for the confidence interval to be obtained, “c”.
2. Compare “s” and “r” and obtain the true number of SNPs that
exist between those two sequences, say “TSNPs.”
3. Compute the proportion of true SNPs between “s” and “r”, say
“PSNPs”.
4. Obtain the pseudo-random coordinates for each one of the

reads to sample from “s”.
5. For each one of the reads obtained in (4), obtain the number of
detected SNPs (comparing the reference, “r” with each read).
6. Calculate the estimate of the total number of SNPs, say “ Tˆ ”,SNPs
as well as the estimated proportion of SNPs, say “ P̂SNPs”.
7. Calculate an approximate confidence interval (CI, say LL, UL;
lower and upper limits, respectively).
8. Output results; main results are (TSNPs, PSNPs, TˆSNPs , P̂SNPs , LL,
UL)—other auxiliary results are also output.
3.2.3 Pseudo-code Description: Obtain a vector of weights (in bp) of fragments result-
for “AFLP” ing from performing the AFLP protocol in a given sequence.
1. Input sequence s, enzymes to be employed, say “E = (E1, E2)”
[e.g., “E1 = EcoRI, E2 = MseI”], which are the default, as well
as the window (in bp) for the fragment sizes that will be
observed, say “w = (w1, w2)”, the default being w = (100, 1000).
2. In silico digest s with the enzymes E and obtain the sizes of the
fragments, say f = (f1, f2, …, fk).
3. Filter f by selecting the set of unique fragments which are within
the window limits, say f* = {fi ∈f |[fi ≥ w1]∩[fi ≤ w2]}.
4. Sort and output the result f*.
The pseudo-code to perform a complete AFLP/GBS simulation
and analysis experiment is presented in the next list.
3.2.4 Pseudo-code Description: Perform a complete AFLP/GBS simulation and anal-

for a Complete Simulation ysis experiment.
Experiment
1. Input general parameters:
●● The reference sequence, “r”
●● The proportion of point mutations to be obtained per
sequence, “p”
●● The number of individual sequences to be mutagenized
and compared with the reference, “k”
2. Input for the AFLP protocol:
●● The enzymes to be employed in the AFLP protocol, say
“E = [E1, E2]”
●● The window (in base pairs) for the AFLP fragment sizes
that will be observed, say “w = (w1, w2)”
3. Input for the GBS protocol:
●● The number of reads to be sequenced, “n”
●● The length (in base pairs) of each one of the reads to be
sequenced, “l”
●● The proportion for the confidence interval to be obtained,

“c” (type I error probability α = 1 − c)
4. Obtain the AFLP vector of the reference sequence, say ar.
5. Define empty lists of k elements to store the AFLP (A = {a1,
a2,·…, ak}) and GBS (G = {g1, g2,·…, gk}) results.
6. For i in 1 to k (obtain A and G):
●● Mutagenize r obtaining a mutagenized sequence
mi = mutagenize(r).
●● Perform the AFLP protocol obtaining ai = AFLP(mi).
●● Perform the GBS protocol obtaining gi = GBS sample
(mi).
7. Loop ends; results A = {a1, a2, …, ak} and G = {g1, g2, …, gk}
ready.
8. Define an empty list of k elements, say, R = {r1, r2, …, rk}, to
store the comparisons of AFLP of the reference, ar, with each
AFLP result of the mutagenized sequences, ai; i = 1, 2, …, k.
9. For i in 1 to k (comparing AFLP results between the reference
and each mutagenized sequence):
●● Compare ar with ai obtaining ri.
10. Loop ends; comparisons of AFLPs of reference and each

mutagenized sequence (R) ready.
11. Summarize the results in R and G and output summaries.
References
1. Gupta P, Roy J, Prasad M (2001) Single nucle- 6. Karp A (1991) On the current understanding
otide polymorphisms: a new paradigm for of somaclonal variation. Oxford Surveys of
molecular marker technology and DNA poly- Plant Molecular and Cell Biology
morphism detection with emphasis on their use 7. Jain SM, Brar DS, Ahloowalia B (1998)
in plants. Curr Sci 80:524–535 Somaclonal variation and induced mutations in
2. Mah JT, Chia K (2007) A gentle introduction crop improvement. Springer, Netherlands.
to SNP analysis: resources and tools. h t t p s : / / d o i .
J Bioinform Comput Biol 5:1123–1138. org/10.1007/978-94-015-9125-6
https://doi.org/10.1142/ 8. Bairu MW, Aremu AO, J Van Staden J (2011)
S0219720007003090 Somaclonal variation in plants: causes and
3. Väil Ü, Brandström M, Johansson M et al detection methods. Plant Growth Regul
(2008) Insertion-deletion polymorphisms 63:147–173. https://doi.org/10.1007/
[indels] as genetic markers in natural popula- s10725-010-9554-x
tions. BMC Genet 9:8. https://doi. 9. Jiang C, Mithani A, Gan X et al (2011)
org/10.1186/1471-2156-9-8 Regenerant arabidopsis lineages display a dis-
4. Suda J, Krahulcová A, P Trávníek P et al (2006) tinct genome- wide spectrum of mutations
Ploidy level versus DNA ploidy level: an appeal conferring variant phenotypes. Curr Biol
for consistent terminology. Taxon 55:447–450 21:1385–1390. https://doi.org/10.1016/j.
5. Larkin PJ, Scowcroft WR (1981) Somaclonal cub.2011.07.002
variation –a novel source of variability from cell 10. Karp A (1995) Somaclonal variation as a tool
cultures for plant improvement. Theor Appl for crop improvement. Euphytica 85:295–302.
Genet 60:197–214. https://doi. https://doi.org/10.1007/BF00023959
org/10.1007/BF02342540
11. Bhat S, Srinivasan S (2002) Molecular and genome profiling of barley. Proc Natl Acad Sci
genetic analyses of transgenic plants: consider- U S A 101:9915–9920. https://doi.
ations and approaches. Plant Sci 163:673–681. org/10.1073/pnas.0401076101
https://doi.org/10.1016/ 24. Miller MR, Dunham JP, Amores A et al (2007)
S0168-9452[02]00152-8 Rapid and cost-effective polymorphism identi-
12. Sahijram L, Soneji JR, Bollamma K (2003) fication and genotyping using restriction site
Invited review: analyzing somaclonal variation associated DNA [RAD] markers. Gen Res
in micropropagated bananas [Musa spp.]. In 17:240–248. https://doi.org/10.1101/
Vitro Cell Dev Biol Plant 39:551–556. gr.5681207
https://doi.org/10.1079/IVP2003467 25. Li G, Quiros CF (2001) Sequence-related
13. Barrett SC (2002) The evolution of plant sex- amplified polymorphism [SRAP], a new marker
ual diversity. Nat Rev Genet 3:274–284. system based on a simple PCR reaction: its
https://doi.org/10.1038/nrg776 application to mapping and gene tagging in
14. Hamrick JL, Godt MJW, Sherman-Broyles SL brassica. Theor Appl Genet 103:455–461.
(1992) Factors influencing levels of genetic https://doi.org/10.1007/s001220100570
diversity in woody plant species. New For 26. He J, Zhao X, Laroche A et al (2014)
6:95–124. https://doi.org/10.1007/ Genotyping-by-sequencing [GBS], an ultimate
BF00120641 marker-assisted selection [mas] tool to acceler-
15. Nybom H (2004) Comparison of different ate plant breeding. Front Plant Sci 5:484.
nuclear DNA markers for estimating intraspe- https://doi.org/10.3389/fpls.2014.00484
cific genetic diversity in plants. Mol Ecol 27. Huang X, Feng Q, Qian Q et al (2009) High-
13:1143–1155. https://doi. throughput genotyping by whole-genome
org/10.1111/j.1365-294X.2004.02141.x resequencing. Genet Res 19:1068–1076.
16. Hayano-Kanashiro C, Martínez O, Reyes- https://doi.org/10.1101/gr.089516.108
Valdés MH et al (2017) An SSR-based 28. Baird NA, Etter PD, Atwood TS et al (2008)
approach incorporating a novel algorithm for Rapid SNP discovery and genetic mapping
identification of rare maize genotypes facilitates using sequenced rad markers. PLoS One
criteria for landrace conservation in Mexico. 3:e3376. https://doi.org/10.1371/journal.
Ecol Evol 7:1680–1690. https://doi. pone.0003376
org/10.5061/dryad.c9086 29. Ganal MW, Polley A, Graner EM et al (2012)
17. Russo VE, Martienssen RA, Riggs AD (1996) Large SNP arrays for genotyping in crop plants.
Epigenetic mechanisms of gene regulation. Cold J Biosci 37:821–828. https://doi.
Spring Harbor Laboratory Press, New York org/10.1007/s12038-012-9225-3
18. Peredo EL, Arroyo-Garcia R, Revilla MA 30. McCallum CM, Comai L, Greene EA et al
(2009) Epigenetic changes detected in micro- (2000) Targeted screening for induced muta-
propagated hop plants. J Plant Physiol tions. Nat Biotechnol 18:455. https://doi.
166:1101–1111. https://doi.org/10.1016/j. org/10.1038/74542
jplph.2008.12.015 31. KS W, Jones R, Danneberger L et al (1994)
19. Botstein D, White RL, Skolnick M et al (1980) Detection of microsatellite polymorphisms
Construction of a genetic linkage map in man without cloning. Nucleic Acids Res
using restriction fragment length polymor- 22:3257–3258
phisms. Am J Hum Genet 32:314 32. Paran I, Michelmore R (1993) Development
20. Perez T, Albornoz L, Dominguez A (1998) An of reliable PCR-based markers linked to downy
evaluation of RAPD fragment reproducibility mildew resistance genes in lettuce. Theor Appl
and nature. Mol Ecol 7:1347–1357. https:// Genet 85:985–993. https://doi.
doi.org/10.1046/j.1365-294x.1998.00484.x org/10.1007/BF00215038
21. Vos P, Hogers R, Bleeker M et al (1995) AFLP: 33. Orita M, Iwahana H, Kanazawa H et al (1989)
a new technique for DNA fingerprinting. Detection of polymorphisms of human DNA
Nucleic Acids Res 23:4407–4414. https:// by gel electrophoresis as single-strand confor-
doi.org/10.1093/nar/23.21.4407 mation polymorphisms. Proc Natl Acad Sci U
22. Williams JG, Kubelik AR, Livak KJ et al (1990) S A 86:2766–2770. https://doi.
DNA polymorphisms amplified by arbitrary org/10.1073/pnas.86.8.2766
primers are useful as genetic markers. Nucleic 34. Beckmann J, Soller M (1990) Toward a unified
Acids Res 18:6531–6535. https://doi. approach to genetic mapping of eukaryotes
org/10.1093/nar/18.22.6531 based on sequence tagged microsatellite sites.
23. Wenzl P, Carling J, Kudrna D et al (2004) Nat Biotechnol 8:930–932. https://doi.
Diversity arrays technology [DArT] for whole- org/10.1038/nbt1090-930
35. Wang D, Gong Z, Gong Z et al (2003) Target ized genome. BMC Genomics 9:312. https://
region amplification polymorphism [TRAP]: a doi.org/10.1186/1471-2164-9-312
novel marker technique for plant genotyping. 47. Deragon J, Casacuberta J, Panaud O (2008)
Fen zi zhi wu yu zhong 2:740–750. https:// Plant transposable elements. In: Volff J-N (ed)
doi.org/10.1007/BF02772804 Plant genomes, Genome Dyn, vol 4. Karger,
36. Nakamura Y, Leppert M, O’Connell P et al Basel, pp 69–82. https://doi.
(1987) Variable number of tandem repeat org/10.1159/000126007
[VNTR] markers for human gene mapping. 48. Hirochika H (1997) Retrotransposons of rice:
Science 235:1616–1623. https://doi. their regulation and use for genome analysis.
org/10.1126/science.3029872 Plant Mol Biol 35:231–240. https://doi.org/
37. Chang RY, O’donoughue L, Bureau T (2001) 10.1023/A:1005774705893
Inter-mite polymorphisms [IMP]: a high 49. Kaeppler SM, Kaeppler HF, Rhee Y (2000)
throughput transposon-based genome map- Epigenetic aspects of somaclonal variation in
ping and fingerprinting approach. Theor Appl plants. Plant Mol Biol 43:179–188. https://
Genet 102:773–781. https://doi. doi.org/10.1023/A:1006423110134
org/10.1007/s001220051709 50. Agarwal M, Shrivastava N, Padh H (2008)
38. Kalendar R, Grob T, Regina M et al (1999) Advances in molecular marker techniques and
IRAP and REMAP: two new retrotransposon- their applications in plant sciences. Plant Cell
based DNA fingerprinting techniques. Theor Rep 27:617–631. https://doi.org/10.1007/
Appl Genet 98:704–711. https://doi. s00299-008-0507-z
org/10.1007/s0012200511 51. Varshney RK, Nayak SN, May GD et al (2009)
39. Casa AM, Brouwer C, Nagel A et al (2000) Next-generation sequencing technologies and
The MITE family heartbreaker [hbr]: molecu- their implications for crop genetics and breed-
lar markers in maize. Proc Natl Acad Sci U S A ing. Trends Biotechnol 27:522–530. https://
97:10083–10089. https://doi.org/10.1073/ doi.org/10.1016/j.tibtech.2009.05.006
pnas.97.18.10083 52. Elshire RJ, Glaubitz JC, Sun Q et al (2011) A
40. Azman A, Mhiri C, Grandbastien M et al robust, simple genotyping-by-sequencing
(2014) Transposable elements and the detec- [GBS] approach for high diversity species.
tion of somaclonal variation in plant tissue cul- PLoS One 6:e19379. https://doi.
ture: a review. Malays Appl Biol 43:1–12 org/10.1371/journal.pone.0019379
41. Flavell AJ, Knox MR, Pearce SR et al (1998) 53. Davey JW, Hohenlohe PA, Etter PD et al
Retrotransposon-based insertion polymor- (2011) Genome-wide genetic marker discov-
phisms [RBIP] for high throughput marker ery and genotyping using next-generation
analysis. Plant J 16:643–650. https://doi. sequencing. Nat Rev Genet 12:499–510.
org/10.1046/j.1365-313x.1998.00334.x https://doi.org/10.1038/nrg3012
42. Waugh R, McLean K, Flavell A et al (1997) 54. Poland JA, Rife TW (2012) Genotyping-by-
Genetic distribution of bare–1-like retrotrans- sequencing for plant breeding and genetics.
posable elements in the barley genome revealed Plant Genet 5:92–102. https://doi.
by sequence-specific amplification polymor- org/10.3835/plantgenome2012.05.0005
phisms [S-SAP]. Mol Gen Genet 253:687–694. 55. Narum SR, Buerkle CA, Davey JW et al (2013)
https://doi.org/10.1007/s004380050372 Genotyping-by-sequencing in ecological and
43. Va D, De N, Broeck N et al (1998) Transposon conservation genomics. Mol Ecol 22:2841–
display identifies individual transposable ele- 2847. https://doi.org/10.1111/mec.12350
ments in high copy number lines. Plant 56. Barbazuk WB, Emrich SJ, Chen HD et al
J 13:121–129. https://doi.org/10.1046/ (2007) SNP discovery via 454 transcriptome
j.1365-313X.1998.00004.x sequencing. Plant J 51:910–918. https://doi.
44. Komori T, Nitta N (2005) Utilization of the org/10.1111/j.1365-313X.2007.03193.x
CAPS/dCAPS method to convert rice SNPs 57. Haseneyer G, Schmutzer T, Seidel M et al
into PCR- based markers. Breed Sci 55:93–98. (2011) From RNA-seq to large-scale
https://doi.org/10.1270/jsbbs.55.93 genotyping-genomics resources for rye [Secale
45. McClelland M, Welsh J (1994) RNA finger- cereale L.]. BMC Plant Biol 11:131. https://
printing by arbitrarily primed PCR. Genet Res doi.org/10.1186/1471-2229-11-131
4:S66–S81 58. Hiremath PJ, Farmer A, Cannon SB et al
46. Novaes E, Drost DR, Farmerie WG et al (2011) Large-scale transcriptome analysis in
(2008) High-throughput gene and SNP dis- chickpea [Cicer arietinum L.], an orphan
covery in Eucalyptus grandis, an uncharacter- legume crop of the semi-arid tropics of asia and
africa. Plant Biotechnol J 9:922–931. https:// types obtained from calluses containing organ-
doi.org/10.1111/j.1467-7652.2011.00625.x ogenic and embryogenic- like structures
59. Hayashi K, Hashimoto N, Daigen M et al derived from shoot tips. Plant Cell Rep
(2004) Development of PCR-based SNP 21:302–312. https://doi.org/10.1007/
markers for rice blast resistance genes at the Piz s00299-002-0502-8
locus. Theor Appl Genet 108:1212–1220. 64. Ossowski S, Schneeberger L, Lucas-Ledó JI
https://doi.org/10.1007/ et al (2010) The rate and molecular spec-
s00122-003-1553-0 trum of spontaneous mutations in Arabidopsis
60. Shahinnia F, Sayed-Tabatabaei BE (2009) thaliana. Science 327:92–94. https://doi.
Conversion of barley SNPs into PCR-based org/10.1126/science.1180677
markers using dCAPS method. Genet Mol Biol 65. Core Team R (2013) R: a language and envi-
32:564–567. https://doi.org/10.1590/ ronment for statistical computing. R
S1415-47572009005000047 Foundation for Statistical Computing, Vienna,
61. Mamanova L, Coffey AJ, Scott CE et al (2010) Austria
Target-enrichment strategies for next- 66. Charif D, Lobry JR (2007) Seqinr 1.0-2: a con-
generation sequencing. Nat Methods 7:111– tributed package to the R project for statistical
118. https://doi.org/10.1038/nmeth.1419 computing devoted to biological sequences
62. Schnable PS, Ware D, Fulton RS et al (2009) retrieval and analysis. In: Bastolla U, Porto M,
The B73 maize genome: complexity, diver- Roman HE, Vendruscolo M (eds) Structural
sity, and dynamics. Science 326:1112–1115. approaches to sequence evolution. Springer,
https://doi.org/10.1126/ Berlin, Heidelberg, pp 207–232. https://doi.
science.1178534 org/10.1007/978-3-540-35306-5_10

63. O’Connor-Sanchez A, Cabrera-Ponce J, 67. Rice P, Longden I, Bleasby A (2000) Emboss:
Valdez-Melara M et al (2002) Transgenic the European molecular biology open software
maize plants of tropical and subtropical geno- suite. pp. 276–277
Chapter 7
Plant Tissue Culture: A Battle Horse in the Genome Editing

Using CRISPR/Cas9
Víctor M. Loyola-Vargas and Randy N. Avilez-Montalvo
Abstract
Plant tissue culture (PTC) is a set of techniques for culturing cells, tissues, or organs in an aseptic medium
with a defined chemical composition, in a controlled environment. Tissue culture, when combined with
molecular biology techniques, becomes a powerful tool for the study of metabolic pathways, elucidation
of cellular processes, genetic improvement and, through genetic engineering, the generation of cell lines
resistant to biotic and abiotic stress, obtaining improved plants of agronomic interest, or studying the
complex cellular genome. In this chapter, we analyze in general the use of plant tissue culture, in particular
protoplasts and calli, in the implementation of CRISPR/Cas9 technology.
Key words Calli, CRISPR/Cas9, Gene editing, Plant tissue culture, Protoplasts
1 Introduction
Plant tissue culture (PTC) is a set of techniques for the aseptic culture
of cells, tissues, or organs in a medium with a defined chemical
composition in vitro and under a controlled environment [1].
PTC is a powerful tool that was developed to study different
questions about plant cell biology. PTC is currently an essential
instrument of daily use in biotechnology. It is useful for developing
applications such as propagation of species of agronomic interest,
generation of disease-resistant plants, and production of crops to
synthesize secondary metabolites and also for plant genetic

engineering [1]. PTC, when integrated with molecular biology tools,
provides an enormous advantage for the study of cellular processes
such as metabolic pathways, gene function, and epigenetic phenomena
during plant development, among others.
The regeneration of transformed plants is essential to the
success of genetic engineering. Among the most used PTC

techniques are the transformation of protoplast and calli. In this
chapter, we analyze the role that PTC has had for the development
of CRISP/Cas technique in the genome edition of plants.
131
132 Víctor M. Loyola-Vargas and Randy N. Avilez-Montalvo
2 CRISPR/Cas System
Currently, there are several techniques to perform genomic

engineering work with the aim of making specific modifications in
the genome. Zinc finger nucleases (ZFNs) and effector nucleases
(TALENs, transcription activator-like effector nucleases) have
been developed as tools for genomic engineering [2, 3]. Both
techniques rely on the synthesis of a DNA-binding protein fused to
a FokI nuclease; the design of the DNA-binding recognition
domain together with FokI nuclease is crucial for site-specific
cleavage in the DNA [4]. However, the construction of these tools
is not simple and requires a custom design for the DNA-binding
domain; it is also expensive and not always successful [4].
Until the onset of the CRISPR technique, the editing of
genomes, particularly in plants, was a laborious and inefficient task.
This technology is currently revolutionizing genome editing because
it is easy, fast, inexpensive, and powerful [5, 6]. With this technol-
ogy, we can modify a particular locus or delete part of the gen and
produce a set of different mutants. To carry out the job, the system
only needs the enzyme Cas9 and a guide RNA (gRNA) [7]. It does
not require the design of specific proteins to bind to the DNA, in
contrast with TALENs and ZFN techniques [8].
CRISPR technique has become a powerful tool for the deep
understanding of the functions of genes and to modify the genome of
plants, animals, and fungi [7, 9, 10]. CRISPR comes from the b
acterial
adaptive immune systems and arches [11]. This system consists of
regularly spaced and grouped short palindromic repeats and a Cas
endonuclease associated with CRISPR (CRISPR/Cas). CRISPR/
Cas can introduce breaks in double-stranded DNA (DSBs) and
generate site-specific modifications in the DNA sequence. Changes
include insertion of sequences and deletions as well as other mutations
in the host genome.
The Cas9 endonuclease, a component of the CRISPR-Cas type II
Streptococcus pyogenes system, forms a complex with two short RNA
molecules called CRISPR RNA (crRNA) and the crRNA t ransactivator
(transcrRNA) which guides the nuclease to break the DNA in both
strands in a particular site [12]. The CRISPR-Cas9 complex has two
RNA with different functions. crRNA recognizes a specific sequence
of bases in the target gene, and functions as an RNA-guided
endonuclease. transcrRNA keeps the Cas9 proteins close to the

complex. To make available the target nucleic acid sequence, Cas9
unwinds the double DNA helix; then the crRNA binds to its target
[6]. When Cas9 protein forms the complex with the crRNA, the PAM
motif (PAM = Protospacer-Associated Motif; 5′-NGG-3′) interacts
with Cas9, which subsequently, through the complementarity of bases
between the crRNA (20 nt sequence) and the target gene, allows the
precise breaking of the double strand of DNA [13].
CRISPR/Cas9 Genome Editing 133
The structure of Cas9 is characterized by having a bilobular

architecture; the sites are named RuvC-like and HNH. Both active
sites act independently on individual DNA strands. RuvC
participates in the cleavage of the DNA (−) strand, whereas HNH/
McrA, positioned at the central part of Cas9 and located in the
vicinity of the scissile phosphodiester bond, is involved in DNA (+)
strand cleavage bound to the crRNA (20 nucleotides) i ndependently
of PAM motif (Fig. 1) [12].
The breakout of CRISPR/Cas9 technology was the engi-
neering of the two short RNA molecules crRNA and transcrRNA
in only one gRNA [14]. This allows the design of specific targets,
so CRISPR/Cas9 can produce precise modifications in the
genome [14], and these changes are highly inherited to the next
generation [15]. This feature has made CRISPR/Cas9 a
revolutionary tool both for the study of fundamental biological
questions and for biotechnological purposes.
The single guide RNA (gRNA) retains two critical features: the
20-nucleotide sequence at the 5′ end of the gRNA that determines
the DNA target site by Watson-Crick base pairing and an 80-nucle-
otide double-stranded structure at the 3′ side of the guide sequence
that binds a recombinant form of Cas9 protein (Fig. 1) [7, 14, 16].
The gRNA can be programmed to bind to specific sites [14]. The
minimum size to program gRNA-Cas9 is 15 nucleotide pairs
(gRNA seed region; Fig. 1) [17]. Also, CRISPR can simultaneously
edit several target genes [18].
Fig. 1 CRISPR-Cas9. The bacterial antiviral immunity system modified for genome editing in eukaryotes cells.
The crRNA and the tracrRNA were fused in a single, chimeric RNA molecule (gRNA) [14]
Completing the sequencing of a genome is only part of the

task. The next step is its functional characterization. Genetic
mutagenesis had been, since the beginning of genetic studies, the
most efficient and widely used strategies for studying gene f unction.
With CRISPR/Cas9 technology on hand, now is more accessible
to introduce mutations into the genome to characterize the
function of a gene. With CRISPR/Cas9 also, it is possible to
manipulate the regulation of transcription or the remodeling state
of the chromatin; this can help to understand how the genetic
material is organized in the chromatin [19].
The CRISPR system is classified into three main types.
However, within the three categories, subclasses can be found,
mainly based on aspects related to the gene coding for Cas1 [20].
In the type II system, the gRNA forms a complex with the Cas9
protein by digesting the site-specific cleavage and producing a
break in the double strand of DNA, thereby inducing the
mechanism of repair NHEJ producing mutations by insertions or
deletions of nucleotides [21].
A great deal of information on the properties of the CRISPR/
Cas9 system comes from studies in animal systems, so it is necessary
to go deeper into the use of this system in plant tissues, to optimize
and make it more efficient, in particular in species of economic
importance. Until now the CRISPR/Cas9’s ability to cut DNA
has several applications in plants, for example, to perform studies
of gene function in different plant species, such as Arabidopsis
thaliana [22–24], Oryza sativa [25], and Zea mays [26], or for
crop improvement [27–31].
2.1 Gene Editing Nucleases are the main tool in gene editing. The idea of gene
Using CRISPR/Cas9 e diting is simple. A DSB is introduced into a genome site and
is then repaired. The cells have two different mechanisms to
repair these breaks, the homologous recombination (HR)
[32–34] and the nonhomologous end joining (NHEJ) (Fig. 2)
[9]. The HR mechanism can accurately repair the DSBs using
a warm homolog (donor) and generate the insertion of a gene
or its replacement. The NHEJ pathway is often imprecise,
especially in plants, and frequently introduces small deletions
or insertions of one or several nucleotides and arise changes in
the DNA sequence and generate mutants of loss of function
of the target gene [9, 14, 17]. The HR in the higher plants is
very inefficient, and NHEJ is the most useful technique used
to introduce genetic modifications [35].
2.2 CRISPR/Cas The use of CRISPR/Cas system in plants is very recent. Between
in Plants August and October of 2013, the first nine articles were published
describing the modification of plant genomes using the Cas9/
sgRNA system [22, 23, 25, 36–41]. The focus of the research was
Fig. 2 Repair of the induced double-strand breaks by nucleases. DSB repair promotes gene editing. DSBs
induced by Cas9 trigger the DNA repair pathways NHEJ (a, b) and HDR (c, d)
to test the technology, using transient expression assays [42]. In

five of these studies, the regeneration of complete plants carrying
mutations in the target loci was reported.
Since then the CRISPR/Cas9 system has been used to m odify
various plant species, such as Arabidopsis [37, 43–45], tobacco
[18, 38, 46, 47], rice [36, 39, 48–51], wheat [39, 52, 53], maize
[54–56], sorghum [36], Populus tomentosa [57], sweet orange
dulce [58–60], soybean [61, 62], Solanum lycopersicum [63–68],
Solanum tuberosum [69], apple [70], cucumber [59], Brassica
oleracea [71], Brassica napus [72], Marchantia polymorpha [73],
and Camelina sativa [74, 75].
In several cases, efforts have been made to improve the plant
varieties genetically [56, 76, 77] or to increase the shelf life of
tomato [78]. However, it is also a powerful tool to ask transcen-
dental biological questions, such as the one proposed in this
research or the one of the plant-environment interaction [56, 79]
or the function of microRNAs [80]. Another use is the edition of
the epigenome. CRISPR can modulate gene expression to target
the cell phenotype and to elucidate the causative epigenetic
mechanisms of genetic regulation [81, 82].
In most of the studies, the Cas9 Streptococcus pyogenes (SpCas9)
has been utilized. However, in several cases, variants or induced
mutants of SpCas9 have been used. Also, Cas9 proteins from other
bacteria species have worked fine in plants, such as Cas9 from
Staphylococcus aureus [83, 84]. The nucleases Cpf1 from Francisella
novicida, Lachnospiraceae bacterium, and Acidaminococcus sp.
BV3L6 (AsCpf1) have been used recently to modify the genome in
eukaryotes [49, 85, 86]. These nucleases recognize different PAM
sequences. In some cases, the mutation efficiency reported has been
100% using these nucleases [86].
3 The Major Techniques for the Regeneration of Transgenic Plants
PTC is a set of tools for the aseptic culture of cells, tissues, and
organs under in vitro controlled environmental conditions [1].
PTC is an important tool for basic and applied studies. PTC is used
for a variety of biotechnological applications. Among the different
demands of PTC is its use for the regeneration of transgenic plants
to produce new varieties, resistant to pests and diseases, as well as
to improve the quality and quantity of a particular product obtained
from a plant. The genetic engineering of plants is also used to
modify plants able to remove toxic compounds or to test its toxic-
ity (bioremediation) [87, 88], or for metabolic engineering of fine
chemicals, such as antibodies [89, 90].
Among the different PTC systems that can be obtained are
callus, suspension cultures, meristems, anther and ovule cultures,
zygotic and somatic embryos, and protoplasts [1, 91, 92].
For the regeneration of transgenic plants, the most useful
techniques are protoplasts and shoot regeneration. Protoplasts
are plant cells without the cell wall. They are basic tools to study
diverse aspects of development, physiology, and genetics of
plant cells [93, 94]. A significant inconvenient is that the
capacity to isolate protoplasts capable of dividing and

regenerating plants is still tricky, and it is restricted to a limited
number of species.
Several parameters influence the use of protoplasts. Among the
most important are inherent to the plant used as a source of
explants (genotype, physiological conditions, type of explant) and
the culture medium, the osmoticum used, duration of enzyme
incubation, pH of the enzyme solution, and environmental culture
conditions [95]. The use of protoplasts for the genetic engineering
of plants has a significant history. The first genetic transformation
of plant cells was carried out by the Cocking group by the direct
delivery of DNA into protoplasts of petunia [96].
The transformation of a plant cell requires several separated
processes. These processes comprise the introduction of the cloned
DNA into plant cells, the selection of transformed cells, and the
recovering of the fully developed and fertile plants from the
transformed cells [97].
Among the different techniques that can be used to introduce
foreign genes into plant genomes are Agrobacterium-mediated

transformation system, the Gateway technology, which depends on the
site-particular recombination response mediated by b acteriophage λ
DNA fragments flanked by recombination sites, transformation of native
genes lacking a selectable marker, c hloroplast transformation, micropro-
jectile bombardment, electroporation- mediated transformation,
microinjection, vacuum infiltration, nanobiotechnological methods for
transformation of cells, p
olyethylene glycol ( PEG)-interceded
transformation, liposome-mediated transformation strategy, and silicon

c arbide-mediated transformation [97]. Several of these protocols require
the use of protoplasts as the system for transformation.
Once the process has produced the transformed cells, it is
essential to convert these cells into plants. The most used pathway
is from protoplast to produce callus and subsequently the
regeneration of plants through somatic embryogenesis (SE) or
organogenesis. Since DNA insertion is a random process, it is
essential to have on hand an efficient regeneration procedure to
increase the probability of recovering a transgenic plant.
There are two pathways to regenerate a plant from a cell in a
process call morphogenesis: SE and organogenesis. Either of both
processes produces complete plants, and both can take place either
directly or indirectly [98, 99].
The induction of embryogenesis or organogenesis depends on
factors such as the nature and physiological status of the explant, its
genetic background, the concentration and exposure time to the
plant growth regulators (PGRs) employed, the culture medium,
and the incubation conditions used [100]. It has been shown that
several stress treatments such as low or high temperature, nutri-
tion, osmotic shock, and the presence of heavy metals, among
others, might play a crucial role in SE induction, even in the

absence of exogenous PGRs [101–104].
In general, the induction of SE involves the supplement of one
or several growth regulators, mainly auxins, cytokinin, or abscisic
acid, alone or in combination. In some cases, the tissue initially
requires the presence of an auxin. This auxin can be eliminated
later in the somatic embryogenesis induction medium [105]. It is
possible that the function of these PGR is to create appropriate
conditions for some of them to regain totipotency. There are some
cases where ethylene, gibberellic, and abscisic acids pass to play a
significant role during some phases of the SE and the late stages of
development. PGR regulate temporally and spatially the expression
of genes that lead to the changes in the genetic program of somatic
cells, as well as to the transition between the different embryonic
developmental stages.
SE has been used in conjunction with almost every available
transformation protocol to produce transgenic plants from all the
important annual (corn, wheat, rice, sorghum, soybean, and
sugarcane, among others) and perennial crops (Pinus, Picea, Vitis,
Hevea, Citrus, coffee, and several more) , as well as model plants
(Arabidopsis, Nicotiana, and carrot) and pharmacologically
important plants (opium poppy) [106–109].
The other method used to get transgenic plants is through the
direct regeneration of shoots from the transformed explant. The
use of this technique depends on the capacity or regeneration of
the explant. In turn, the balance between auxin and cytokinin
determines the developmental fate of regenerating organs. This

regeneration requires the reprogramming of differentiated somatic
cells [110]. Plants can regenerate shoots from callus or can restore
functional apical meristems when part of these meristems is
removed; in some cases, they can develop new organs such as
axillary shoots and lateral roots.
3.1 PTC and CRISPR/ Since the beginning of the use of the CRISPR/Cas9 system in
Cas9 plants, PTC has been at the center of the development. The PTC
systems to regenerate transgenic plants harboring the modifica-
tions introduced with CRISPR/Cas9 have been protoplast, calli,
suspension culture, SE, and hairy roots (Table 1).
Protoplast has been used for the transformation of m
onocotyledonous
plants, such as Oryza sativa [17, 36, 39, 41, 80, 86, 111–113], Triticum
aestivum [17, 39, 52, 53, 112, 114–118], Zea mays [17, 26, 55, 119],
and Hordeum vulgare [114]. Among the dicotyledonous plants,
Arabidopsis thaliana [22, 23, 37, 111], Nicotiana benthamiana [37], N.
tabacum [18], N. attenuata [111], Lactuca sativa [111], Vitis vinifera
[120], Malus pumila [120], Petunia × hybrida [121], and Solanum
lycopersicum [114, 122, 123] protopasts have been utilized to recover
transgenic plants.
Beyond Arabidopsis, protoplasts are the most widely PTC
system used to produce transgenic plants modified by CRISPR/
Cas9, in particular, in monocotyledons species. The use of
protoplasts allows calculating the efficiency of the transforma-
tion. In O. sativa, using the green fluorescent protein (GFP) as
a marker gene, it was found that 18 h after transformation,
approximately 60% of protoplast expressed GFP. This percentage
increased to 90% after 36–72 h after transformation [41]. Using
gRNA to target phytoene desaturase gene in protoplasts of O.
sativa, the efficiency of mutation reached 25% after 72 h [39].
The targeted mutagenesis of miRNA genes in O. sativa mediated
by CRISPR-Cas9 in regenerated T0 lines ranged from 48 to 89%
at all tested miRNA target sites [80].
The efficiency of transformation can vary widely. In T. aesti-
vum efficiencies, as low as 3.8% of protoplast transformed with a
construct carrying the GFP [115], or as high as 60–80% [52, 116]
have been recorded. In other cases, the efficiency of transformation
was close to 50% [117]. In Z. mays the targeted gene mutagenesis
efficiency was 10.67% [119].
Among the plants regenerated from calli are O. sativa [22, 23,
25, 39, 48, 50, 83, 113, 124–127], H. vulgare [71, 128], Z. mays
[54, 56, 130], T. aestivum [115], S. lycopersicum [63, 67, 78, 129],
Manihot esculenta [131], and Brassica napus [72].
Calli are a PTC system lesser used than protoplasts; however, it
is also very useful to produce transgenic plants. In B. napus, an
important oilseed crop, the average mutation frequency for a
Table 1
Plant tissue culture systems used for transformation of plants with vectors carrying CRISPR
constructions
Tissues Species References

Protoplasts Arabidopsis thaliana [22, 23, 37, 111]
Nicotiana benthamiana [37]
N. tabacum [18]
N. attenuata [111]
Lactuca sativa [111]
Oryza sativa [17, 36, 39, 41, 80, 86, 111–113]
Triticum aestivum [17, 39, 52, 53, 112, 114–118]
Zea mays [17, 26, 55, 119]
Vitis vinifera [120]
Malus pumila [120]
Petunia x hybrida [121]
Solanum lycopersicum [114, 122, 123]
Hordeum vulgare [114]
Calli O. sativa [22, 23, 25, 39, 48, 50, 83, 113,
124–127]
H. vulgare [71, 128]
S. lycopersicum [63, 67, 78, 129]
Z. mays [54, 56, 130]
T. aestivum [115]
Manihot esculenta [131]
Brassica napus [72]
ShC S. lycopersicum [68, 132–134]
S. tuberosum [135]
Cucumis sativus [59]
M. prunifolia x M. pumila [70]
Petunia hybrida [136]
B. napus [137]
Citrus paradisi [138]
C. sinensis [60]
(continued)
Table 1
(continued)
Tissues Species References

HR S. lycopersicum [139]
S. pennellii [139]
Glycine max [61, 140]
Medicago truncatula [140]
B. carinata [141]
SC T. aestivum [40]
SE Ipomoea [Pharbitis] nil [142]
SC suspension culture, SE somatic embryogenesis, ShC shoot culture, HR hairy roots
single-gene targeted sgRNA in the T0 generation ranged from

27.6 to 96.6% [72]. This frequency of mutation is high in S. lycop-
ersicum because it can reach 83.56% [63]. In other cases, the
efficiency of transformation is measurement as a product. The

introduction of a mutation in the C-terminal autoinhibitory
domain of the glutamate decarboxylase of S. lycopersicum increased
GABA accumulation 7- to 15-fold resulting in changes in the fruit
size and yield [129].
Shoot regeneration also has been used widely to regenerate
transgenic plants modified by the CRISPR/Cas9 technology. Among
the plants regenerated using shoot are S. lycopersicum [68, 132–134],
S. tuberosum [135], Cucumis sativus [59], M. prunifolia × M. pumila
[70], Petunia hybrida [136], B. napus [137], Citrus paradisi [138],
and C. sinensis [60].
It is very interesting that only dicotyledonous plants have
been regenerated using shoots. This probably is a reflex that
dicotyledonous plants are easier to regenerate from calli than
monocotyledonous. The modification of the canker susceptibility
gene CsLOB1 in Duncan grapefruit by CRISPR/Cas9 produced
six lines of Duncan grapefruit. Those lines with less than 40% of
mutation rate showed canker symptoms similar to wild-type
grapefruit when inoculated with the pathogen Xanthomonas citri
subsp. citri (Xcc). The lines with a mutation rate higher than 40%
did not show any canker symptoms after 4 days of inoculation
with Xcc [138].
Hairy roots have been used for a long time to the study of
secondary metabolites [143, 144]. Also, hairy roots have been
utilized to regenerate plants, mainly from recalcitrant plants
species [145, 146]. Regeneration of Ri-transformed plants
proved to be very efficient [147]. This capacity has been
exploited to regenerate plants modified by CRISPR/Cas9.

Between these plants are S. lycopersicum and S. pennellii [139],
M. truncatula [140], B. carinata [141], and Glycine max [61,
140]. This system had proved to be very efficient since DNA
mutations were detected in 95% of 88 hairy-root transgenic
events analyzed in G. max [61].
Suspension cultures have been used as the initial material for
the transformation of T. aestivum [40], and SE has been utilized
for the transformation of Ipomoea [Pharbitis] nil [142]. Mutation
of the dihydrolavonol-4-reductase-B of I. nil generated 75% of
transgenic plants with less anthocyanin than the non-transformed
plants [142].
4 Conclusions
For a long time, PTC has been a tool for the study of cellular
processes that occur under certain conditions. Micropropagation
of plant species of agronomic interest, elucidation of metabolic
pathways, and improvement through genomic engineering are
some of the many advantages that the use of CTV has.
Today, PTC, in combination with molecular biology tools,
provides an advantage for the study of molecular mechanisms that
previously could not or limited us to other methods. With the
emergence of the CRISPR/Cas9 genome editing technology, it is
possible to carry out site-directed mutagenesis, insertion of
sequences at specific sites, modulation of gene expression, or
transcriptional repression.
CRISP/Cas is a novel, versatile, efficient tool and has a wide-range
application in molecular biology; however, although it has been pro-
gressing impressively, there is still much to improve and discover. The
use of the CRISPR/Cas9 system for editing the e pigenome is still in
its developmental phase in plants [35, 81, 82, 148].
Recently, it has been demonstrated that RNA can also be
engineered by the CRISPR system, in both mammalian cells and
plants [149, 150]. In this case RNA-guided RNA-targeting
CRISPR-Cas effector Cas13a was used. This breakout opens
important opportunities to the treatment of genetic diseases,
particularly at the RNA level.
Acknowledgments
The work from VMLV laboratory was supported by a grant

received from the National Council for Science and Technology
(CONACyT, Frontiers of Sciences, 1515).
References
1. Loyola-Vargas VM, De-la-Peña C, Sci U S A 109:E2579–E2586. https://doi.
Galaz-
Ávalos RM et al (2008) Plant tissue org/10.1073/pnas.1208507109
culture. In: Walker JM, Rapley R (eds) 13. Nishimasu H, Ran FA, Hsu PD et al (2014)
Molecular biomethods handbook. Humana Crystal structure of Cas9 in complex with
Press, Totowa, pp 875–904. https://doi. guide RNA and target DNA. Cell 156:935–
org/10.1007/978-1-60327-375-6_50 949. https://doi.org/10.1016/j.cell.2014.
2. Urnov FD, Rebar EJ, Holmes MC et al 02.001
(2010) Genome editing with engineered zinc 14. Jinek M, Chylinski K, Fonfara I et al (2012) A
finger nucleases. Nat Rev Genet 11:636–646. programmable dual-RNA-guided DNA
https://doi.org/10.1038/nrg2842 endonuclease in adaptive bacterial immunity.
3. Cermak T, Doyle EL, Christian M et al (2011) Science 337:816–821. https://doi.org/
Efficient design and assembly of custom TALEN 10.1126/science.1225829
and other TAL effector-based constructs for 15. Feng Z, Y Mao NX et al (2014) Multigeneration
DNA targeting. Nucleic Acids Res 39:e82. analysis reveals the inheritance, specificity, and
https://doi.org/10.1093/nar/gkr218 patterns of CRISPR/Cas-induced gene modifi-
4. Tsutsui H, Higashiyama T (2017) pKAMA- cations in Arabidopsis. Proc Natl Acad Sci U S
ITACHI vectors for highly efficient CRISPR/ A 111:4632–4637. https://doi.org/10.1073/
Cas9-mediated gene knockout in Arabidopsis pnas.1400822111
thaliana. Plant Cell Physiol 58:46–56. 16. Shankaran SS, Dahlem TJ, Bisgrove BW et al
https://doi.org/10.1093/pcp/pcw191 (2017) CRISPR/Cas9-directed gene editing
5. Shalem O, Sanjana NE, Hartenian E et al for the generation of loss-of-function mutants
(2014) Genome-scale CRISPR-Cas9 in high-throughput zebrafish F0 screens.
knockout screening in human cells. Science Curr Protoc Mol Biol 119:31.9.1–31.9.22.
343:84–87. https://doi.org/10.1126/ https://doi.org/10.1002/cpmb.42
science.1247005 17. Liang Z, Zong Y, Gao C (2016) An efficient tar-
6. Komaroff AL (2017) Gene editing using geted mutagenesis system using CRISPR/Cas in
CRISPR: why the excitement? JAMA monocotyledons. Curr Protoc Plant Biol 1:329–
318:699–700. https://doi.org/10.1001/ 344. https://doi.org/10.1002/cppb.20021
jama.2017.10159 18. Gao J, Wang G, Ma S et al (2015) CRISPR/
7. Doudna JA, Charpentier E (2014) The new Cas9-mediated targeted mutagenesis in Nicotiana
frontier of genome engineering with CRISPR- tabacum. Plant Mol Biol 87:99–110. https://
Cas9. Science 346:1258096-1–1258096-9. doi.org/10.1007/s11103-014-0263-0
https://doi.org/10.1126/science.1258096 19. Hsu PD, Lander ES, Zhang F (2014)
8. Yamamoto T (2015) Targeted genome edit- Development and applications of CRISPR-
ing using site-specific nucleases. ZFNs, Cas9 for genome engineering. Cell 157:1262–
TALENs, and the CRISPR/Cas9 system. 1278. https://doi.org/10.1016/j.cell.2014.
Springer, Tokyo 05.010
9. Bannikov AV, Lavrov AV (2017) CRISPR/ 20. Makarova KS, Haft DH, Barrangou R et al
CAS9, the king of genome editing tools. Mol (2011) Evolution and classification of the
Biol 51:514–525. https://doi.org/10.1134/ CRISPR-Cas systems. Nat Rev Microbiol 9:467–
S0026893317040033 477. https://doi.org/10.1038/nrmicro2577
10. Yin K, Gao C, Qiu JL (2017) Progress and 21. Liu X, S Wu JX et al (2017) Application of
prospects in plant genome editing. Nat Plants CRISPR/Cas9 in plant biology. Acta Pharm
3:17107. https://doi.org/10.1038/nplants. Sin B 7:292–302. https://doi.org/10.1016/
2017.107 j.apsb.2017.01.002
11. Mojica FJM, Díez-Villaseñor C, García- 22. Feng Z, Zhang B, Ding W et al (2013)
Martínez J et al (2005) Intervening sequences Efficient genome editing in plants using a
of regularly spaced prokaryotic repeats derive CRISPR/Cas system. Cell Res 23:1229–
from foreign genetic elements. J Mol Evol 1232. https://doi.org/10.1038/cr.2013.
60:174–182. https://doi.org/10.1007/ 114
s00239-004-0046-3 23. Mao Y, Zhang H, Xu N et al (2013)
12. Gasiunas G, Barrangou R, Horvath P et al Application of the CRISPR-Cas system for
(2012) Cas-crRNA ribonucleoprotein efficient genome engineering in plants.
complex mediates specific DNA cleavage for Mol Plant 6:2008–2011. https://doi.org/
adaptive immunity in bacteria. Proc Natl Acad 10.1093/mp/sst121
24. Osakabe Y, Osakabe K (2015) Genome edit- pects for a bright future. Plant J 78:727–741.
ing in higher plants. In: Yamamoto T (ed) https://doi.org/10.1111/tpj.12338
Targeted genome editing using site-specific 35. Puchta H (2017) Applying CRISPR/Cas for
nucleases: ZFNs, TALENs, and the CRISPR/ genome engineering in plants: the best is yet
Cas9 system. Springer, Tokyo, pp 197–205. to come. Curr Opin Plant Biol 36:1–8.
https://doi.org/10.1007/978-4-431- https://doi.org/10.1016/j.pbi.2016.
55227-7_13 11.011
25. Miao J, Guo D, Zhang J et al (2013) Targeted 36. Jiang W, Zhou H, Bi H et al (2013)
mutagenesis in rice using CRISPR-Cas sys- Demonstration of CRISPR/Cas9/sgRNA-
tem. Cell Res 23:1233–1236. https://doi. mediated targeted gene modification in
org/10.1038/cr.2013.123 Arabidopsis, tobacco, sorghum and rice.
26. Xing HL, Dong L, Wang ZP et al (2014) A Nucleic Acids Res 41:e18810. https://doi.
CRISPR/Cas9 toolkit for multiplex genome org/10.1093/nar/gkt780
editing in plants. BMC Plant Biol 14:327. 37. Li JF, Norville JE, Aach J et al (2013)
https://doi.org/10.1186/s12870-014- Multiplex and homologous recombination-
0327-y mediated genome editing in Arabidopsis and
27. Korotkova AM, Gerasimova SV, Shumny VK Nicotiana benthamiana using guide RNA
et al (2017) Crop genes modified using the and Cas9. Nat Biotechnol 31:688–691.
CRISPR/Cas system. Russ J Gen Appl Res https://doi.org/10.1038/nbt.2654
7:822–832. https://doi.org/10.1134/S20 38. Nekrasov V, Staskawicz B, Weigel D et al
79059717050124 (2013) Targeted mutagenesis in the model
28. Li X, Xie Y, Zhu Q et al (2017) Targeted plant Nicotiana benthamiana using Cas9
genome editing in genes and cis-regulatory RNA-guided endonuclease. Nat Biotechnol
regions improves qualitative and quantitative 31:691–693. https://doi.org/10.1038/
traits in crops. Mol Plant 10:1368–1370. nbt.2655
https://doi.org/10.1016/j.molp.2017. 39. Shan Q, Wang Y, Li J et al (2013) Targeted
10.009 genome modification of crop plants using a
29. Arora L, Narula A (2017) Gene editing and CRISPR-Cas system. Nat Biotechnol
crop improvement using CRISPR-Cas9 sys- 31:686–688. https://doi.org/10.1038/
tem. Front Plant Sci 8:1932. https://doi. nbt.2650
org/10.3389/fpls.2017.01932 40. Upadhyay SK, Kumar J, Alok A et al (2013)
30. Baltes NJ, Gil-Humanes J, Voytas DF (2017) RNA-guided genome editing for target
Genome engineering and agriculture: oppor- gene mutations in wheat. G3 3:2233–
tunities and challenges. In: PWaB D (ed) 2238. https://doi.org/10.1534/g3.113.
Progress in molecular biology and transla- 008847
tional science gene editing in plants. Academic 41. Xie K, Yang Y (2013) RNA-guided genome
Press, Cambridge, pp 1–26. https://doi. editing in plants using a CRISPR-Cas system.
org/10.1016/bs.pmbts.2017.03.011 Mol Plant 6:1975–1983. https://doi.
31. Chilcoat D, Liu ZB, Sander J (2017) Use of org/10.1093/mp/sst119
CRISPR/Cas9 for crop improvement in 42. Belhaj K, Chaparro-Garcia A, Kamoun S et al
maize and soybean. In: PWaB D (ed) Progress (2013) Plant genome editing made easy: tar-
in molecular biology and translational science geted mutagenesis in model and crop
gene editing in plants. Academic Press, plants using the CRISPR/Cas system.
Cambridge, pp 27–46. https://doi. Plant Methods 9:1–10. https://doi.org/
org/10.1016/bs.pmbts.2017.04.005 10.1186/1746-4811-9-39
32. Rouet P, Smih F, Jasin M (1994) Introduction 43. Gao X, Chen J, Dai X et al (2016) An effec-
of double-strand breaks into the genome of tive strategy for reliably isolating heritable and
mouse cells by expression of a rare-cutting Cas9-free Arabidopsis mutants generated by
endonuclease. Mol Cell Biol 14:8096–8106. CRISPR/Cas9-mediated genome editing.
https://doi.org/10.1128/MCB.14.12.8096 Plant Physiol 171:1794–1800. https://doi.
33. Puchta H, Dujon B, Hohn B (1996) Two dif- org/10.1104/pp.16.00663
ferent but related mechanisms are used in 44. Mao Y, Zhang Z, Feng Z et al (2016)
plants for the repair of genomic double-strand Development of germ-line-specific CRISPR-
breaks by homologous recombination. Proc Cas9 systems to improve the production of
Natl Acad Sci U S A 93:5055–5060 heritable gene modifications in Arabidopsis.
34. Puchta H, Fauser F (2014) Synthetic nucle- Plant Biotechnol J 14:519–532. https://doi.
ases for genome engineering in plants: pros- org/10.1111/pbi.12468
45. Peterson BA, Haak DC, Nishimura MT et al J Genet Genomics 41:63–68. https://doi.
(2016) Genome-wide assessment of efficiency org/10.1016/j.jgg.2013.12.001
and specificity in CRISPR/Cas9 mediated 56. Shi J, Gao H, Wang H et al (2017) ARGOS8
multiple site targeting in Arabidopsis. variants generated by CRISPR-Cas9 improve
PLoS One 11:e0162169. https://doi.org/ maize grain yield under field drought stress
10.1371/journal.pone.0162169 conditions. Plant Biotechnol J 15:207–216.
46. Ji X, Zhang H, Zhang Y et al (2015) https://doi.org/10.1111/pbi.12603
Establishing a CRISPR-Cas-like immune sys- 57. Fan D, Liu T, Li C et al (2015) Efficient
tem conferring DNA virus resistance in CRISPR/Cas9-mediated targeted mutagenesis
plants. Nat Plants 1:15144. https://doi.org/ in Populus in the first generation. Sci Rep
10.1038/nplants.2015.144 5 : 1 2 2 1 7 . h t t p s : / / d o i . o rg / 1 0 . 1 0 3 8 /
47. Baltes NJ, Hummel AW, Konecna E et al srep12217
(2015) Conferring resistance to geminivi- 58. Jia H, Wang N (2014) Targeted genome edit-
ruses with the CRISPR-Cas prokaryotic ing of sweet orange using Cas9/sgRNA. PLoS
immune system. Nat Plants 1:15145. https:// One 9:e93806. https://doi.org/10.1371/
doi.org/10.1038/nplants.2015.145 journal.pone.0093806
48. Zhang H, Zhang J, Wei P et al (2014) The 59. Chandrasekaran J, Brumin M, Wolf D et al
CRISPR/Cas9 system produces specific and (2016) Development of broad virus resis-
homozygous targeted gene editing in rice in tance in non-transgenic cucumber using
one generation. Plant Biotechnol J 12:797– CRISPR/Cas9 technology. Mol Plant Pathol
807. https://doi.org/10.1111/pbi.12200 17:1140–1153. https://doi.org/10.1111/
49. Xu R, Qin R, Li H et al (2017) Generation of mpp.12375
targeted mutant rice using a CRISPR-Cpf1 60. Peng A, Chen S, Lei T et al (2017)
system. Plant Biotechnol J 15:713–717. Engineering canker-resistant plants through
https://doi.org/10.1111/pbi.12669 CRISPR/Cas9-targeted editing of the sus-
50. Li M, Li X, Zhou Z et al (2016) Reassessment ceptibility gene CsLOB1 promoter in citrus.
of the four yield-related genes Gn1a, DEP1, Plant Biotechnol J 15:1509–1519. https://
GS3, and IPA1 in rice using a CRISPR/Cas9 doi.org/10.1111/pbi.12733
system. Front Plant Sci 7:377. https://doi. 61. Jacobs TB, LaFayette PR, Schmitz RJ et al
org/10.3389/fpls.2016.00377 (2015) Targeted genome modifications
51. Ma J, Chen J, Wang M et al (2018) Disruption insoybean with CRISPR/Cas9. BMC
of OsSEC3A increases the content of salicylic Biotechnol 15:1–10. https://doi.org/
acid and induces plant defense responses in 10.1186/s12896-015-0131-2
rice. J Exp Bot. https://doi.org/10.1093/ 62. Li Z, Liu ZB, Xing A et al (2015) Cas9-guide
jxb/erx458 RNA directed genome editing in soybean.
52. Wang Y, Cheng X, Shan Q et al (2014) Plant Physiol 169:960–970. https://doi.
Simultaneous editing of three homoeoalleles org/10.1104/pp.15.00783
in hexaploid bread wheat confers heritable 63. Pan C, Ye L, Qin L et al (2016) CRISPR/
resistance to powdery mildew. Nat Biotechnol Cas9-mediated efficient and heritable tar-
32:947–951. https://doi.org/10.1038/ geted mutagenesis in tomato plants in the first
nbt.2969 and later generations. Sci Rep 6:24765.
53. Zhang Y, Liang Z, Zong Y et al (2016) https://doi.org/10.1038/srep24765
Efficient and transgene-free genome editing in 64. Ali Z, Abulfaraj A, Idris A et al (2015)
wheat through transient expression of CRISPR/Cas9-mediated viral interference in
CRISPR/Cas9 DNA or RNA. Nat Commun plants. Genome Biol 16:238. https://doi.
7 : 1 2 6 1 7 . h t t p s : / / d o i . o rg / 1 0 . 1 0 3 8 / org/10.1186/s13059-015-0799-6
ncomms12617 65. Soyk S, Muller NA, Park SJ et al (2017)
54. Char SN, Neelakandan AK, Nahampun H Variation in the flowering gene SELF
et al (2017) An Agrobacterium-delivered PRUNING 5G promotes day-neutrality and
CRISPR/Cas9 system for high-frequency tar- early yield in tomato. Nat Genet 49:162–168.
geted mutagenesis in maize. Plant Biotechnol https://doi.org/10.1038/ng.3733
J 15:257–268. https://doi.org/10.1111/ 66. Ito Y, Nishizawa-Yokoi A, Endo M et al
pbi.12611 (2015) CRISPR/Cas9-mediated mutagene-
55. Liang Z, Zhang K, Chen K et al (2014) sis of the RIN locus that regulates tomato
Targeted mutagenesis in Zea mays using fruit ripening. Biochem Biophys Res
TALENs and the CRISPR/Cas system. Commun 467:76–82. https://doi.org/
10.1016/j.bbrc.2015.09.117
67. Ueta R, Abe C, Watanabe T et al (2017) different rice varieties. J Int Plant Biol
Rapid breeding of parthenocarpic tomato 60(2):89–93. https://doi.org/10.1111/
plants using CRISPR/Cas9. Sci Rep 7:507. jipb.12501
https://doi.org/10.1038/s41598-017- 78. Yu Q, Wang B, Li N et al (2017) CRISPR/
00501-4 Cas9-induced targeted mutagenesis and gene
68. Nekrasov V, Wang C, Win J et al (2017) replacement to generate long-shelf life tomato
Rapid generation of a transgene-free powdery lines. Sci Rep 7:11874. https://doi.
mildew resistant tomato by genome deletion. org/10.1038/s41598-017-12262-1
Sci Rep 7:482. https://doi.org/10.1038/ 79. Jia H, Orbovic V, Jones JB et al (2016)
s41598-017-00578-x Modification of the PthA4 effector binding
69. Butler NM, Atkins PA, Voytas DF et al (2015) elements in type I CsLOB1 promoter using
Generation and inheritance of targeted muta- Cas9/sgRNA to produce transgenic Duncan
tions in potato (Solanum tuberosum L.) using grapefruit alleviating XccDpthA4:dCsLOB1.3
the CRISPR/Cas system. PLoS One infection. Plant Biotechnol J 14:1291–1301.
10:e0144591. https://doi.org/10.1371/ https://doi.org/10.1111/pbi.12495
journal.pone.0144591 80. Zhou JP, Deng K, Cheng Y et al (2017)
70. Nishitani C, Hirai N, Komori S et al (2016) CRISPR-Cas9 based genome editing reveals
Efficient genome editing in apple using a new insights into microRNA function and
CRISPR/Cas9 system. Sci Rep 6:31481. regulation in rice. Front Plant Sci 8:1598.
https://doi.org/10.1038/srep31481 https://doi.org/10.3389/fpls.2017.01598
71. Lawrenson T, Shorinola O, Stacey N et al 81. Puchta H (2016) Using CRISPR/Cas in
(2015) Induction of targeted, heritable muta- three dimensions: towards synthetic plant
tions in barley and Brassica oleracea using genomes, transcriptomes and epigenomes.
RNA-guided Cas9 nuclease. Genome Biol Plant J 87:5–15. https://doi.org/10.1111/
16:258. https://doi.org/10.1186/s13059- tpj.13100
015-0826-7 82. Thakore PI, D'Ippolito AM, Song L et al
72. Yang H, Wu JJ, Tang T et al (2017) CRISPR/ (2015) Highly specific epigenome editing by
Cas9-mediated genome editing efficiently CRISPR-Cas9 repressors for silencing of dis-
creates specific mutations at multiple loci tal regulatory elements. Nat Meth 12:1143–
using one sgRNA in Brassica napus. Sci Rep 1149. https://doi.org/10.1038/
7:7489. https://doi.org/10.1038/s41598- nmeth.3630
017-07871-9 83. Kaya H, Mikami M, Endo A et al (2016)
73. Sugano SS, Shirakawa M, Takagi J et al Highly specific targeted mutagenesis in
(2014) CRISPR/Cas9-mediated targeted plants using Staphylococcus aureus Cas9. Sci
mutagenesis in the liverwort Marchantia poly- Rep 6:26871. https://doi.org/10.1038/
morpha L. Plant Cell Physiol 55:475–481. srep26871
https://doi.org/10.1093/pcp/pcu014 84. Steinert J, Schiml S, Fauser F et al (2015)
74. Morineau C, Bellec Y, Tellier F et al (2017) Highly efficient heritable plant genome engi-
Selective gene dosage by CRISPR-Cas9 neering using Cas9 orthologues from
genome editing in hexaploid Camelina Streptococcus thermophilus and Staphylococcus
sativa. Plant Biotechnol J 15:729–739. aureus. Plant J 84:1295–1305. https://doi.
https://doi.org/10.1111/pbi.12671 org/10.1111/tpj.13078
75. Jiang WZ, Henry IM, Lynagh PG et al (2017) 85. Zetsche B, Gootenberg J, Abudayyeh O et al
Significant enhancement of fatty acid compo- (2015) Cpf1 is a single RNA-guided endo-
sition in seeds of the allohexaploid, Camelina nuclease of a class 2 CRISPR-Cas system. Cell
sativa, using CRISPR/Cas9 gene editing. 163:759–771. https://doi.org/10.1016/j.
Plant Biotechnol J 15:648–657. https://doi. cell.2015.09.038
org/10.1111/pbi.12663 86. Tang X, Lowder LG, Zhang T et al (2017) A
76. Nejat N, Rookes J, Mantri NL et al (2017) CRISPR-Cpf1 system for efficient genome
Plant-pathogen interactions: toward develop- editing and transcriptional repression in
ment of next-generation disease-resistant plants. Nat Plants 3:17018. https://doi.
plants. Crit Rev Biotechnol 37:229–237. org/10.1038/nplants.2017.18
https://doi.org/10.3109/07388551.2015. 87. Ancona V, Barra Caracciolo A, Grenni P et al
1134437 (2017) Plant-assisted bioremediation of a his-
77. Shen L, Wang C, Fu Y et al (2018) QTL edit- torically PCB and heavy metal-contaminated
ing confers opposing yield performance in area in southern Italy. New Biotechnol
38:65–73. https://doi.org/10.1016/j.nbt. 98. Phillips GC (2004) In vitro morphogenesis in

2016.09.006 plants - recent advances. In Vitro Cell Dev
88. Sobariu DL, Fertu DIT, Diaconu M et al Biol Plant 40:342–345. https://doi.
(2017) Rhizobacteria and plant symbiosis in org/10.1079/IVP2004555
heavy metal uptake and its implications for soil 99. Quiroz-Figueroa FR, Rojas-Herrera R,
bioremediation. New Biotechnol 39:125–134. Galaz-Ávalos RM et al (2006) Embryo pro-
https://doi.org/10.1016/j.nbt.2016.09.002 duction through somatic embryogenesis can
89. Vaghari H, Jafarizadeh-Malmiri H, Anarjan N be used to study cell differentiation in plants.
et al (2017) Hairy root culture: a biotechno- Plant Cell Tissue Org 86:285–301. https://
logical approach to produce valuable metabo- doi.org/10.1007/s11240-006-9139-6
lites. In: Meena VS, Mishra PK, Bisht JK et al 100. Gaj MD (2004) Factors influencing somatic
(eds) Agriculturally important microbes for embryogenesis induction and plant regenera-
sustainable agriculture, Plant-soil-microbe tion with particular reference to
nexus, vol I. Springer, Singapore, pp 131– Arabidopsis thaliana (L.) Heynh. Plant
160. https://doi.org/10.1007/978-981- Growth Regul 43:27–47. https://doi.
10-5589-8_7 org/10.1023/B:GROW.0000038275.
90. Vázquez-Flota FA, Monforte-González M, 29262.fb
de Lourdes Miranda-Ham M (2016) 101. Cabrera-Ponce JL, López L, León-Ramírez CG
Application of somatic embryogenesis to sec- et al (2015) Stress induced acquisition of
ondary metabolite- producing plants. In: somatic embryogenesis in common bean
Loyola-Vargas VM, Ochoa- Alejo N (eds) Phaseolus vulgaris L. Protoplasma 252:559–
Somatic embryogenesis: fundamental aspects 570. https://doi.org/10.1007/s00709-014-
and applications. Springer, Cham, pp 455– 0702-4
469. https://doi.org/10.1007/978-3-319- 102. Ochatt S, Revilla M (2016) From stress to
33705-0_25 embryos: some of the problems for induction
91. Loyola-Vargas VM, Ochoa-Alejo N (2012) and maturation of somatic embryos. In:
An introduction to plant cell culture: the Germanà MA, Lambardi M (eds) In vitro
future ahead. In: Loyola-Vargas VM, Ochoa- embryogenesis in higher plants. Springer,
Alejo N (eds) Plant cell culture protocols, New York, pp 523–536. https://doi.
methods in molecular biology, vol 877. org/10.1007/978-1-4939-3061-6_31
Humana Press, Heidelberg, pp 1–8. https:// 103. Salo HM, Sarjala T, Jokela A et al (2016)
doi.org/10.1007/978-1-61779-818-4_1 Moderate stress responses and specific
92. Loyola-Vargas VM, Ochoa-Alejo N (2016) changes in polyamine metabolism character-
Somatic embryogenesis. Fundamental aspects ize scots pine somatic embryogenesis. Tree
and applications. Springer, Switzerland Physiol 36:292–402. https://doi.
93. Shen J, Fu J, Ma J et al (2014) Isolation, culture, org/10.1093/treephys/tpv136
and transient transformation of plant proto- 104. Krishnan SRS, Siril EA (2017) Auxin and

plasts. Curr Protoc Cell Biol 63:2.8.1–2.8.17. nutritional stress coupled somatic embryo-
https://doi.org/10.1002/0471143030. genesis in Oldenlandia umbellata L. Physiol
cb0208s63 Mol Biol Plants 23:471–475. https://doi.
94. Davey MR, Anthony P, Power JB et al (2005) org/10.1007/s12298-017-0425-z
Plant protoplasts: status and biotechnological 105. Loyola-Vargas VM, Ochoa-Alejo N (2016)

perspectives. Biotechnol Adv 23:131–171. Somatic embryogenesis. An overview. In:
https://doi.org/10.1016/j.biotechadv. Loyola-Vargas VM, Ochoa-Alejo N (eds)
2004.09.008 Somatic embryogenesis. Fundamental aspects
95. Cocking EC (2000) Plant protoplasts. In and applications. Springer, Switzerland,
Vitro Cell Dev Biol Plant 36:77–82. https:// pp 1–10. https://doi.org/10.1007/978-3-
doi.org/10.1007/s11627-000-0018-2 319-33705-0_1
96. Davey MR, Cocking EC, Freeman J et al 106. Canché-Moor RLR, Kú-González A, Burgeff
(1980) Transformation of petunia protoplasts C et al (2006) Genetic transformation of
by isolated Agrobacterium plasmids. Plant Coffea canephora by vacuum infiltration.
Sci Lett 18:307–313. https://doi.org/ Plant Cell Tissue Org 84:373–377. https://
10.1016/0304-4211(80)90121-2 doi.org/10.1007/s11240-005-9036-4
97. Ahmad MM, Ali A, Siddiqui S et al (2017) 107. Arroyo-Herrera A, Ku-Gonzalez A, Canche-
Methods in transgenic technology. In: Abdin Moo R et al (2008) Expression of WUSCHEL
MZ, Kiran U, Kamaluddin et al (eds) Plant in Coffea canephora causes ectopic morpho-
biotechnology: principles and applications. genesis and increases somatic embryogenesis.
Springer, Singapore, pp 93–115. https://doi. Plant Cell Tissue Org 94:171–180. https://
org/10.1007/978-981-10-2961-5_4 doi.org/10.1007/s11240-008-9401-1
108.
Bouchabké-Coussa O, Obellianne M, 119. Zhu J, Song N, Sun S et al (2016) Efficiency
Linderme D et al (2013) Wuschel overexpres- and inheritance of targeted mutagenesis in
sion promotes somatic embryogenesis and maize using CRISPR-Cas9. J Genet Genomics
induces organogenesis in cotton (Gossypium 43:25–36. https://doi.org/10.1016/j.
hirsutum L.) tissues cultured in vitro. Plant jgg.2015.10.006
Cell Rep 32:675–686. https://doi.org/ 120. Malnoy M, Viola R, Jung MH et al (2016)
10.1007/s00299-013-1402-9 DNA-free genetically edited grapevine and
109. Ochoa-Alejo N (2016) The uses of somatic apple protoplast using CRISPR/Cas9 ribo-
embryogenesis for genetic transformation. In: nucleoproteins. Front Plant Sci 7:1904.
Loyola-Vargas VM, Ochoa-Alejo N (eds) https://doi.org/10.3389/fpls.2016.01904
Somatic embryogenesis: fundamental aspects 121. Subburaj S, Chung SJ, Lee C et al (2016)
and applications. Springer, Cham, pp 415– Site-directed mutagenesis in Petunia x hyb-
434. https://doi.org/10.1007/978-3-319- rida protoplast system using direct delivery of
33705-0_23 purified recombinant Cas9 ribonucleopro-
110. Ikeuchi M, Ogawa Y, Iwase A et al (2016) teins. Plant Cell Rep 35:1535–1544. https://
Plant regeneration: cellular origins and molec- doi.org/10.1007/s00299-016-1937-7
ular mechanisms. Development 143:1442– 122. Xu C, Liberatore KL, MacAlister CA et al

1451. https://doi.org/10.1242/dev.134668 (2015) A cascade of arabinosyltransferases
111. Woo JW, Kim J, Kwon SI et al (2015) DNA- controls shoot meristem size in tomato.
free genome editing in plants with preassem- Nat Genet 47:784–792. https://doi.org/
bled CRISPR-Cas9 ribonucleoproteins. Nat 10.1038/ng.3309
Biotechnol 33:1162–1164. https://doi.
123. Andersson M, Turesson H, Nicolia A et al
org/10.1038/nbt.3389 (2017) Efficient targeted multiallelic mutagen-
112. Shan Q, Wang Y, Li J et al (2014) Genome esis in tetraploid potato (Solanum tuberosum)
editing in rice and wheat using the CRISPR/ by transient CRISPR-Cas9 expression in pro-
Cas system. Nat Prot 9:2395–2410. https:// toplasts. Plant Cell Rep 36:117–128. https://
doi.org/10.1038/nprot.2014.157 doi.org/10.1007/s00299-016-2062-3
113. Zhou H, Liu B, Weeks DP et al (2014) Large 124. Xu R, Li H, Qin R et al (2014) Gene target-
chromosomal deletions and heritable small ing using the Agrobacterium tumefaciens-
genetic changes induced by CRISPR/Cas9 in mediated CRISPR-Cas system in rice. Rice
rice. Nucleic Acids Res 42:10903–10914. 7:5. https://doi.org/10.1186/s12284-014-
https://doi.org/10.1093/nar/gku806 0005-6
114. Cermák T, Curtin SJ, Gil-Humanes J et al 125. Baysal C, Bortesi L, Zhu C et al (2016)

(2017) A multipurpose toolkit to enable CRISPR/Cas9 activity in the rice OsBEIIb
advanced genome engineering in plants. gene does not induce off-target effects in the
Plant Cell 29:1196–1217. https://doi.org/ closely related paralog OsBEIIa. Mol Breed
10.1105/tpc.16.00922 36:108. https://doi.org/10.1007/s11032-016-
115. Gil-Humanes J, Wang Y, Liang Z et al (2017) 0533-4
High-efficiency gene targeting in hexaploid 126. Li J, Du Y Sun J et al (2017) Generation of
wheat using DNA replicons and CRISPR/ targeted point mutations in rice by a modi-
Cas9. Plant J 89:1251–1262. https://doi. fied CRISPR/Cas9 system. Mol Plant
org/10.1111/tpj.13446 10:526–529. https://doi.org/10.1016/j.
116. Kim D, Alptekin B, Budak H (2018)
molp.2016.12.001
CRISPR/Cas9 genome editing in wheat. 127. Minkenberg B, Xie K, Yang Y (2017)

Funct Integr Genomics 18:31–41. https:// Discovery of rice essential genes by character-
doi.org/10.1007/s10142-017-0572-x izing a CRISPR-edited mutation of closely
117. Liang Z, Chen K, Li T et al (2017) Efficient related rice MAP kinase genes. Plant
DNA-free genome editing of bread wheat J 89:636–648. https://doi.org/10.1111/
using CRISPR/Cas9 ribonucleoprotein com- tpj.13399
plexes. Nat Commun 8:14261. https://doi. 128. Holme IB, Wendt T, Gil-Humanes J et al
org/10.1038/ncomms14261 (2017) Evaluation of the mature grain phytase
118. Wang Y, Zong Y, Gao C (2017) Targeted candidate HvPAPhy_a gene in barley (Hordeum
mutagenesis in hexaploid bread wheat using vulgare L.) using CRISPR/Cas9 and TALENs.
the TALEN and CRISPR/Cas systems. In: Plant Mol Biol 95:111–121. https://doi.
Bhalla PL, Singh MB (eds) Wheat biotech- org/10.1007/s11103-017-0640-6
nology: methods and protocols. Springer, 129. Nonaka S, Arai C, Takayama M et al (2017)
New York, pp 169–185. https://doi. Efficient increase of g-aminobutyric acid
org/10.1007/978-1-4939-7337-8_11 (GABA) content in tomato fruits by targeted
mutagenesis. Sci Rep 7:7057. https://doi. 140. Michno JM, Wang X, Liu J et al (2015)
org/10.1038/s41598-017-06400-y CRISPR/Cas mutagenesis of soybean and
130. Svitashev S, Schwartz C, Lenderts B et al
Medicago truncatula using a new web-tool
(2016) Genome editing in maize directed by and a modified Cas9 enzyme. GM Crops
CRISPR-Cas9 ribonucleoprotein complexes. Food 6:243–252. https://doi.org/10.1080
Nat Commun 7:13274. https://doi. /21645698.2015.1106063
org/10.1038/ncomms13274 141. Kirchner TW, Niehaus M, Debener T et al
131. Odipio J, Alicai T, Ingelbrecht I et al (2017) (2017) Efficient generation of mutations
Efficient CRISPR/Cas9 genome editing of mediated by CRISPR/Cas9 in the hairy root
phytoene desaturase in cassava. Front transformation system of Brassica carinata.
Plant Sci 8:1780. https://doi.org/10.3389/ PLoS One 12:e0185429. https://doi.
fpls.2017.01780 org/10.1371/journal.pone.0185429
132. Brooks C, Nekrasov V, Lippman ZB et al
142. Watanabe K, Kobayashi A, Endo M et al
(2014) Efficient gene editing in tomato in the (2017) CRISPR/Cas9-mediated mutagenesis
first generation using the clustered regularly of the dihydroflavonol-4-reductase-B (DFR-B)
interspaced short palindromic repeats/ locus in the Japanese morning glory Ipomoea
CRISPR-associated9 system. Plant Physiol (Pharbitis) nil. Sci Rep 7:10028. https://doi.
166:1292–1297. https://doi.org/10.1104/ org/10.1038/s41598-017-10715-1
pp.114.247577 143.
Loyola-Vargas VM, Miranda-Ham ML
133. Xu C, Park SJ, Van Eck J et al (2016) Control (1995) Root culture as a source of secondary
of inflorescence architecture in tomato by metabolites of economic importance. Rec
BTB/POZ transcriptional regulators. Genes Advan Phytochem 29:217–248. https://doi.
Dev 30:2048–2061. https://doi.org/ org/10.1007/978-1-4899-1778-2_10
10.1101/gad.288415.116 144. Flores HE, Vivanco JM, Loyola-Vargas VM
134. Wang L, Chen L, Li R et al (2017) Reduced (1999) “Radicle” biochemistry: the biology
drought tolerance by CRISPR/Cas9- of root-specific metabolism. Trends Plant Sci
mediated SlMAPK3 mutagenesis in tomato 4:220–226. https://doi.org/10.1016/
plants. J Agric Food Chem 65:8674–8682. S1360-1385(99)01411-9
https://doi.org/10.1021/acs.jafc.7b02745 145. David C, Chilton MD, Tempé J (1984)

135. Wang S, Zhang S, Wang W et al (2015)
Conservation of T-DNA in plants renegerated
Efficient targeted mutagenesis in potato by from hairy root cultures. Bio Technol 2:73–
the CRISPR/Cas9 system. Plant Cell Rep 76. https://doi.org/10.1038/nbt0184-73
34:1473–1476. https://doi.org/10.1007/ 146. Hamill JD, Rhodes MJC (1988) A spontane-
s00299-015-1816-7 ous, light independent and prolific plant
136. Zhang B, Yang X, Yang C et al (2016)
regeneration response from hairy roots of
Exploiting the CRISPR/Cas9 system for tar- Nicotiana hesperis transformed by
geted genome mutagenesis in petunia. Sci Agrobacterium rhizogenes. J Plant Physiol
Rep 6:20315. https://doi.org/10.1038/ 133:506–509. https://doi.org/10.1016/
srep20315 S0176-1617(88)80046-4
137. Braatz J, Harloff HJ, Mascher M et al (2017) 147. Jouanin L, Guerche P, Pamboukdjian N et al
CRISPR-Cas9 targeted mutagenesis leads to (1987) Structure of T-DNA in plants regen-
simultaneous modification of different erated from roots transformed by
homoeologous gene copies in polyploid oilseed Agrobacterium rhizogenes strain A4. Mol Gen
rape (Brassica napus L.). Plant Physiol Genet 206:387–392. https://doi.org/
174(2):935–942. https://doi.org/10.1104/ 10.1007/BF00428876
pp.17.00426 148. Springer NM, Schmitz RJ (2017) Exploiting
138. Jia H, Zhang Y, Orbovi-ç V et al (2017) induced and natural epigenetic variation for
Genome editing of the disease susceptibil- crop improvement. Nat Rev Genet 18:563–
ity gene CsLOB1 in citrus confers resistance 575. https://doi.org/10.1038/nrg.2017.45
to citrus canker. Plant Biotechnol J 15:817– 149. Abudayyeh OO, Gootenberg JS,
823. https://doi.org/10.1111/pbi.12677 Essletzbichler P et al (2017) RNA targeting
139. Ron M, Kajala K, Pauluzzi G et al (2014) with CRISPR-Cas13. Nature 550:280–284.
Hairy root transformation using https://doi.org/10.1038/nature24049
Agrobacterium rhizogenes as a tool for explor- 150. Cox DBT, Gootenberg JS, Abudayyeh OO
ing cell type-specific gene expression and et al (2017) RNA editing with CRISPR-
function using tomato as a model. Plant Cas13. Science 358:1019–1027. https://
Physiol 166:455–469. https://doi.org/ doi.org/10.1126/science.aaq0180
10.1104/pp.114.239392
Part III
Protocols
Chapter 8
Micropropagation of Agave Species

Benjamín Rodríguez-Garay and José Manuel Rodríguez-Domínguez
Abstract
The genus Agave originates from the American continent and grows in arid and semiarid places, being
México the center of origin. Many species of the genus are a source of diverse products for human
needs, such as food, medicines, fibers, and beverages, and a good source of biomass for the p
roduction
of biofuels, among many others. These plants are gaining importance as climate change becomes more
evident as heat is reaching temperatures above 40 °C worldwide and rains are scarce. Many species of
the genus grow in places where other plant species do not survive under severe field conditions, due
to their CAM pathway for fixing CO2 where gas exchange occurs at night when stomata are open,
allowing them to avoid excess loss of water. Most of the important species and varieties are usually
propagated by offshoots that develop from rhizomes around the mother plant and by bulbils that
develop up in the inflorescence, which are produced by the plant mostly when there is a failure in the
production of seeds.
Areas for commercial plantations are growing worldwide and therefore in the need of big
amounts of healthy and good quality plantlets. Although many Agave species produce seeds, it takes
longer for the plants to reach appropriate maturity and size for diverse purposes. Micropropagation
techniques for the genus Agave offer the opportunity to produce relatively high amounts of plants
year around in r elatively small spaces in a laboratory. Here, a protocol for micropropagation that has
proven good for several Agave species (including species from both subgenera) is presented in detail
with two different kinds of explants to initiate the process: rescued zygotic embryos and small
offshoots that grow around a mother plant.
Key words Auxins, Cytokinins, Embryo rescue, In vitro propagation, Tequila, Mezcal
1 Introduction
Species of the genus Agave are gaining importance as climate

change becomes more evident when heat is reaching
temperatures above 40 °C worldwide and rains are scarce.

Many species of the genus grow in places where other plant
species do not survive under severe field conditions, due to
their CAM pathway for fixing CO2 where gas exchange occurs
at night when the stomata are open, allowing them to avoid
excess loss of water [1].
151
152 Benjamín Rodríguez-Garay and José Manuel Rodríguez-Domínguez
Agaves are a source of diverse products for human needs, such

as food, medicines, fibers, and beverages such as tequila and m ezcal,
and a good source of biomass for the production of biofuels,
among many others.
The genus Agave is divided into two subgenera, Agave and
Littaea, mainly differentiated by their inflorescence. The first one
bears paniculate inflorescences with flowers in umbellate clusters
on lateral branches, while the second subgenus has spicate
inflorescences with the flowers stuck to the floral stem [2].
On the other hand, areas for commercial plantations are grow-
ing worldwide and therefore in the need of big amounts of healthy
and good quality plantlets. Although many species of the genus
produce seeds, these are of a high genetic variability, and besides it
takes longer for the plants to reach appropriate maturity and size
for diverse purposes.
Micropropagation techniques for the genus Agave offer the
opportunity to produce relatively high amounts of plants year
around in relatively small spaces in a laboratory [3]. Here, a
protocol for micropropagation that has proven good for several
Agave species (including species from both subgenera) is presented
in detail with two different kinds of explants to initiate the process:
rescued zygotic embryos and small offshoots that grow around a
mother plant. Regarding Agave zygotic embryo culture, the pro-
cedure and culture medium here presented work well for many and
diverse Agave species such as A. tequilana, A. angustifolia, A.
applanata, A. salmiana, A. colimana, A. victoria-reginae, A. inae-
quidens, and A. maximiliana, among others. Moreover, the proto-
col here presented is relatively simple, although it is well known
that the composition of the culture medium is more elaborated
and at some extent more c omplicated with regard to nutritional
requirements for initial embryo stages [4]. The initiation of in vitro
culture by using zygotic embryos as explants makes the procedure
an easy one since contamination by microorganisms is minimal.
Also, this is suitable when there is no need for the propagation of
a given genotype since t heoretically each embryo is a different gen-
otype and also for phenotype/genotype selection for the produc-
tion of plant lineages for diverse genetic improvement purposes.
On the other hand, the initiation of in vitro cultures by using
small offshoots that grow around a mother plant is perfect when there
is the need to mass propagate a unique genotype, variety, or elite indi-
viduals. However, sometimes, it is hard to clean or disinfect the
explants when they are taken directly from very dirty environments.
2 Materials
2.1 Biological 1. Zygotic embryos. Immature seeds from immature fruits are
Materials needed when immature zygotic embryos will be used as explants
(see Note 1).
Micropropagation of Agave spp. 153
Fig. 1 Explants of Agave spp. (a) Agave americana mother plant surrounded by its offshoots. (b) Aerial bulbils
of A. desmetiana. (c, d) Explants from an A. tequilana offshoot grown under greenhouse conditions
2. Offshoots. Most of Agave species produce offshoots around the

mother plant (Fig. 1a) or bulbils up in the inflorescence, which
are produced by the plant mostly when there is a failure in the
production of seeds (Fig. 1b). Both of these structures can be
used as explants. It is recommended to take offshoots of selected
mother plants and take them to the greenhouse in order to
make a preliminary clean up with fungicides and bactericides
and maintain the shoots in a good condition with a good irriga-
tion. After 1–2 months, these offshoots will in turn produce
shoots that will be good as explants (Fig. 1c, d). In the case of
the use of bulbils as explants, there is no need for this procedure,
and the plantlets can be taken directly to the laboratory, since
they are not in contact with the soil.
2.2 Tools and Other 1. Plant tissue culture laboratory facilities including horizontal
Materials laminar flow hoods and gas or electrical burners.
and Facilities 2. Thin dissecting forceps.
3. Regular dissecting forceps and scalpel with a No. 11 blade.
4. A sterile piece of glass of about 20 × 20 cm.
5. Baby food glass jars containing the shoot proliferation medium.

6. Incubation facilities at 27 ± 2 °C with a 16 h photoperiod
under fluorescent light (16–25 μmol/s m−2).
2.3 Culture Media 1. Plastic disposable Petri dishes (100 mm × 15 mm) with culture
medium for the maturation and germination of rescued zygotic
embryos [5]. This medium is prepared following Tables 1, 2,
3, 4, 5, and 6 but reducing NH4NO3 to 20 g in the stock solu-
tion in Table 1. No growth regulators are needed.
2. Baby food jars closed with polypropylene-type Magenta B-caps
or any other autoclavable glass or plastic vessels containing
culture medium for axillary shoot proliferation [6]. This

medium is prepared following Tables 1, 2, 3, 4, 5, and 6 with
the addition of 0–12 mg/L 6-benzyladenine (BA) and 0.001–
0.025 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D).
3. Baby food jars closed with polypropylene-type Magenta B-caps
or any other autoclavable glass or plastic vessels containing
culture medium for rooting [6]. As in item 1, this medium is
prepared following Tables 1, 2, 3, 4, 5, and 6 but reducing
NH4NO3 to 20 g in the stock solution in Table 1. No growth
regulators are needed.
3 Methods
Both micropropagation and in vitro rooting are achieved by using

MS culture medium [7] (see Tables 1, 2, 3, 4, 5, and 6) supple-
mented with L2 vitamins [8] (see Table 3). Micropropagation is
performed using the axillary bud proliferation technique using
growth regulators such as BA [0–12 mg/L (0–53.2 μM)] and
2,4-D [0.001–0.025 mg/L (0.04–0.11 μM)] [6], whereas for
rooting, in general, no growth regulators are needed.
3.1 Axillary Shoot 1. Cut the immature fruit from the panicle.
Proliferation Using 2. On the horizontal laminar flow hood, sterilize the immature
Rescued Zygotic fruit by dipping it into ethanol 95% and burn it until the
Embryos as Explants ethanol goes off.
3. Carefully open the sterilized fruit with a scalpel and remove the
immature seed.
4. Open the immature seed with the aid of a thin dissecting
forceps and scalpel with a blade #11.
5. Carefully take the zygotic embryo (globular or torpedo shape)
and place it on a petri dish containing the culture medium for
maturation and germination described previously in
Subheading 2.3 Culture media.
Table 1
MS macronutrients (Murashige and Skoog, 1962) stock solution for up to
50 L of medium
Take to a
volume of
Compound Common name 500 mL
NH4NO3 Ammonium nitrate 82.5 g
KNO3 Potassium nitrate 95.0 g
MgSO4·7H2O Magnesium sulfate 18.5 g
heptahydrate
KH2PO4 Potassium phosphate 8.5 g
monobasic
See Note 4
Table 2
MS micronutrients (Murashige and Skoog, 1962) stock solution for up to
50 L of medium
Take to a
volume of
Compound Common name 500 mL
H3BO3 Boric acid 0.6200 g
MnSO4·H2O Manganese sulfate 1.6900 g
monohydrate
ZnSO4·7H20 Zinc sulfate heptahydrate 0.8600 g
Kl Potassium iodide 0.0830 g
Na2MoO4·2H2O Sodium molybdate dihydrate 0.0250 g
CoCl2·6H2O Cobalt chloride hexahydrate 0.0025 g
CuSO4·5H2O Copper sulfate pentahydrate 0.0025 g
Table 3
L2 vitamins (Phillips and Collins, 1979) stock solution for up to 50 L of
medium
Take to a volume of
Compound 500 mL
Thiamine hydrochloride 0.1000 g
Pyridoxine hydrochloride 0.0250 g
Myo-inositol 12.5 g
Table 4
Calcium chloride stock solution for up to 50 L of medium
Take to a volume
Compound Common name of 500 mL
CaCl2·2H2O Calcium chloride 10 g
Table 5
Fe-EDTA stock solution for up to 50 L of medium
Take to a
volume of
Compound 500 mL
Na2-EDTA (ethylenediaminetetraacetic acid disodium salt 1.392 g
dihydrate)
FeSO4·7H2O (iron(II) sulfate heptahydrate) 1.86 g
Table 6
Blend of stock solutions (Tables 1, 2, 3, 4, and 5) for the final MS culture
medium with L2 vitamins
Stock solution Take to a volume of 1 L

Macronutrients 10 mL
Micronutrients 5 mL
CaCl2·2H2O 22 mL
Fe·EDTA 10 mL
L2 vitamins 10 mL
Sucrose 30 g
Agar 8 g
See Notes 5 and 6
6. Place the petri dishes containing the rescued embryos in an

incubator room at 27 ± 2 °C for 1 week and then transfer to a
16 h photoperiod under fluorescent light (16–25 μmol/s m−2).
7. After 30–60 days, the rescued zygotic embryos will have a size
of about 5–8 cm reached on the maturation-germination
culture medium and will be ready to be transferred to the
axillary shoot proliferation culture medium (Fig. 2a, b).
8. In a laminar flow hood and with the help of forceps and scalpel
over a sterile glass, roots from the plantlets are carefully cut and
Fig. 2 Preparation of Agave angustifolia explants. (a) Four-week-old germinated zygotic embryo. (b) Eight-week-old
plantlets from zygotic embryos ready to be used as explants. (c) Cleaning of an offshoot grown under greenhouse
conditions. (d) Disinfected offshoot ready to be used as explant
discarded taking care not to damage the apical meristem. In case

of very long leaves, they must be cut a little to reduce their size.
9. Transfer the above plantlets or explants to the axillary shoot
proliferation culture medium.
10. Subculture to fresh culture medium for proliferation every 4
weeks. Separate the new shoots trying to subculture groups of
2–3 shoots to the fresh medium for a good proliferation rate in
the next 4 weeks. The proliferation rate varies from three to six
according to the species and/or variety. It takes longer for pro-
liferation when single shoots are subcultured.
3.2 Axillary Shoot 1. Take to the laboratory the new pot grown offshoots produced
Proliferation Using at the greenhouse (Fig. 2c).
Offshoots as Explants 2. Cut off roots and leaves and wash thoroughly with liquid soap
under tap water in the sink (Fig. 2c).
3. Carefully remove the leaves that surround the meristem, t aking

care not to damage the apical meristem (Fig. 2d).
4. At this stage, take the explants to the aseptic environment of a
laminar flow hood and initiate the process of disinfection.
5. Place the explants in a solution of fungicide (such as 1 g/L
captan) + bactericide (300 mg/L cefotaxime) and leave in con-
stant agitation for 24 h (see Notes 2 and 3).
6. Three rinses are given with sterile distilled water under
constant stirring (about 5 min each time) to remove excess
mercuric chloride.
7. Subsequently, place the explants in a 70% (v/v) ethanol
solution for 1 min, stirring constantly.
8. Thereafter, transfer the explants to a solution of 3% (w/v)
sodium hypochlorite for 10 min, stirring constantly.
9. Three rinses are given with sterile distilled water under constant
stirring (about 5 min each time) to remove excess sodium
hypochlorite.
10. Take the surface sterilized explants that are clean of c ontaminant
microorganisms, fungi, and bacteria, and transfer them to the
axillary shoot proliferation medium. Place them individually in
the culture container since there is a high risk of remaining
microbial contamination (Fig. 2d).
11. The beginning of the formation of the new shoots takes from
4 to 20 weeks depending on the species or variety.
12. Subculture the new offshoots and handle the proliferation pro-
cedure as mentioned previously.
The protocols here presented are proven to work well for a num-
ber of Agave selected species; however, it may be necessary to adjust
some growth regulators and concentrations in order to improve the
proliferation rate of a particular species, variety, or elite genotypes.
4 Notes
1. These embryos can be handled by following the protocol

“Application of in casa pollination and embryo rescue
techniques for breeding of Agave species” (Chapter 20 of this
book) or taking immature fruits from the field.
2. In case of contamination with endophytic fungi, expose the
explants to a heat shock treatment, by placing these in hot water at
65 °C for 3 min, and then place them in cold water at 4 °C for
3 min.
3. In case of a very strong microbial contamination, place explants
in a solution of 0.1% mercuric chloride for 3–5 min under con-
stant stirring. This treatment is usually given before the treat-

ment with sodium hypochlorite. Be sure to properly dispose
mercuric chloride after use.
4. When ammonium nitrate and potassium nitrate are mixed, the
solution gets cool too much, so it is very difficult to mix the
other compounds; to solve this, it is necessary to put it to heat.
Do not allow to boil.
5. Mix the stock solutions mentioned in Tables 1, 2, 3, 4, and 5
with the addition of sucrose, and take to a volume of 1 L. Keep
all stock solutions at 4 °C while not in use for a few days, or
keep frozen at −20 °C while not in use for several weeks in
order to avoid growth of microorganisms.
6. Add 6 g Phytagel instead of 8 g agar only for the medium for
maturation and germination of rescued zygotic embryos. Also,
add 500 mg/L L-glutamine and 250 mg/L casein hydroly-
sate. In both cases adjust pH to 5.8 with 1 N NaOH prior to
adding the Phytagel or agar and prior to autoclaving.
References
1. Rodríguez-Garay B (2016) Somatic embryo- 5. Portillo L, Santacruz-Ruvalcaba F, Gutiérrez-Mora

genesis in Agave spp. In: Loyola-Vargas VM, A et al (2007) Somatic embryogenesis in Agave
Ochoa-Alejo N (eds) Somatic embryogenesis: tequilana Weber cultivar azul. In Vitro Cell Dev
fundamental aspects and applications. Springer, Biol Plant 43:569–575. https://doi.org/10.1007/
Switzerland, pp 267–282. https://doi. s11627-007-9046-5
org/10.1007/978-3-319-33705-0_16 6. Santacruz-Ruvalcaba F, Gutiérrez-Pulido H,
2. Gentry HS (1982) Agaves of continental North Rodríguez-Garay B (1999) Efficient in vitro
America. The University of Arizona Press, propagation of Agave parrasana Berger. Plant
Tucson, AZ, p 670 Cell Tissue Organ Cult 56:163–167. https://
3. Gutiérrez-Mora A, Ruvalcaba-Ruiz D, doi.org/10.1023/A:1006232911778
Rodríguez-Domínguez JM et al (2004) Recent 7. Murashige T, Skoog F (1962) A revised
advances in the biotechnology of Agave: a cell medium for rapid growth and bioassays with
approach. Recent Res Dev Cell Biol 2:17–66 tobacco tissue cultures. Physiol Plant 15:473–
4. Haslam TM, Yeung EC (2011) Zygotic embryo 479. https://doi.org/10.1111/j.1399-3054.
culture: an overview. In: Thorpe TA, Yeung EC 1962.tb08052.x
(eds) Methods and protocols, methods in 8. Phillips GC, Collins GB (1979) In vitro tissue
molecular biology, vol 710. Humana Press, culture of selected legumes and plant regenera-
New York, pp 3–15. https://doi.org/10.1007/ tion from callus cultures of red clover. Crop Sci
978-1-61737-988-8_1 19:59–64. https://doi.org/10.2135/cropsci1
979.0011183X001900010014x
Chapter 9
Protocol for the Micropropagation of Coconut

from Plumule Explants
Luis Sáenz, José Luis Chan, María Narvaez, and Carlos Oropeza
Abstract
Coconut is a crop that is economically important in several countries throughout the world. Unfortunately,
production is decreasing because palms are affected by very serious phytoplasma diseases, such as lethal
yellowing, and also most of coconuts are already very old. On the other hand, markets for coconut prod-
ucts have been rapidly growing in recent years. Hence, replanting of most cultivation surface worldwide,
as well as establishing new surface, is urgently needed. This is an immense task, requiring at least a billion
coconut palms that cannot be accomplished by traditional propagation through seed. Therefore the bio-
technological alternative of micropropagation by somatic embryogenesis is needed. Research has been
carried out on this subject in laboratories in several countries studying different approaches, testing differ-
ent types of explants. The most responsive tissue has been plumule from zygotic embryos. A protocol for
micropropagation of coconut based on plumule explants is described here. It involves the use of different
media that are based on Y3 medium complemented with activated charcoal, gelling agent, sucrose, and
growth regulators. These media allow the formation of embryogenic callus and somatic embryos, growth
of shoots, and development of plantlets.
Key words Coconut, Cocos nucifera, Extensive replanting, In vitro culture, Plumule explant, Somatic
embryogenesis
1 Introduction
Coconut (Cocos nucifera L.) is a very important perennial crop. It

significantly contributes to food security, improved nutrition,
employment, and income generation [1]. In recent years its impor-
tance has been growing commercially at a very fast rate for several
high-value products worldwide, such as packed coconut water, and
the giant corporations in this field, Coca-Cola, PepsiCo, and Dr.
Pepper, are already selling packed coconut water products in the
USA and Europe. Also similar trends are occurring for other prod-
ucts, including coconut milk products, virgin coconut oil and
derivatives, fiber-derived products for the automobile industry, and
coco-biodiesel [2].
161
162 Luis Sáenz et al.
The challenge that are facing the suppliers are facing of both
traditional and non-traditional products of coconut is that they are
not able to meet the volumes required now by the global markets,
and this is caused by insufficient and inconsistent supply of raw
materials from coconut growers, particularly smallholders are
attributed with 80–90% of coconut production. This is because
most of the 12 million hectares dedicated to coconut cultivation
around the world are already old with decreasing productivity. In
addition, coconut survival is threatened by several pests and dis-
eases; the most worrying are the devastating phytoplasma-
associated lethal yellowing (LY) diseases that are already present in
every continent where coconut is cultivated [3]. In the Americas,
LY has killed millions of palms in different countries in the
Caribbean region [4].
Therefore in order to maintain the growing market and increas-
ing demand of coconut products, replanting of most cultivation
surface worldwide, as well as establishing new surface, is urgently
needed. This is an immense task, requiring at least a billion coco-
nut palms, which cannot be accomplished by traditional propaga-
tion through seed. This would be an even more difficult task if we
consider propagating selected germplasm resistant to LY and
highly productive. Therefore, the biotechnological alternative of
in vitro propagation or micropropagation by somatic embryogen-
esis, with its great propagation capacity, has been approached in
laboratories in different countries, to try to develop highly efficient
and commercially viable protocols.
During the 1980s and 1990s, different types of tissues were
tested as source of explants for developing coconut micropropaga-
tion such as immature leaves, zygotic embryos, roots, shoot apical
meristem, endosperm, and inflorescences [1], but best results in
terms of reproducibility and efficiency have been obtained so far
with plumules. The use of plumule as explants (shoot meristem
surrounded by leaf primordia) was first reported by Blake et al. [5]
and Hornung [6]; however no data about somatic embryogenesis
efficiency was presented; 3 years later, our laboratory published a
detailed protocol for regeneration of plantlets through somatic
embryogenesis including histology evidence that the regeneration
process occurs through somatic embryogenesis [7], and further
studies have been carried out to improve it using a practical
approach, studying the effect of changes in the medium formula-
tion including plant hormones such as brassinosteroids [8] and
gibberellic acid [1]. Also an indirect approach was followed, carry-
ing out basic studies for further understanding of the somatic
embryogenesis process in coconut: morpho-histological develop-
ment; biochemical and physiological aspects such as absorption of
external auxin, endogenous content of cytokinins; and the charac-
terization in coconut cultures of genes related to early somatic
Micropropagation in Cocos nucifera 163
embryogenesis (SERK) [9], the control of cell cycle (cyclin-

dependent kinase) [10], and shoot apical meristem formation and
maintenance (KNOX family genes) [11]. Results from both types
of studies have shown that activated charcoal is necessary for
somatic embryogenesis [12, 13], and they have been useful to
develop a protocol for the multiplication of embryogenic callus
[14] that has been used as the basis for a massive propagation pro-
cess of coconut, currently under scaling-up in a “bio-factory” in
CICY’s premises in Yucatán.
In addition, in recent studies, encouraging results have been
obtained on the formation of embryogenic callus and plant regen-
eration using explants from floral tissues such as anthers [15],
unfertilized ovaries [15, 16], and rachilla [17], establishing new
venues for developing processes for massive propagation as in the
case of plumule.
The purpose of this chapter is to describe a protocol for the
propagation of coconut palms using plumule explants through the
formation of embryogenic callus, based on the studies reported by
Chan et al. [7], Sáenz et al. [13, 18], and Pérez-Núñez et al. [14].
The protocol does not include the multiplication of embryogenic
callus step since that process is protected as an industrial secret.
2 Materials
2.1 Biological Fruits are harvested 12–14 months after pollination from 15-year-
Materials old coconut palms.
2.2 Reagents, Seventy percent (v/v) ethanol solution, 0.6% (w/v) NaClO solu-
Solutions, tion, 6% (w/v) NaClO, distilled sterile water, machete, cork borer
and Culture Media (1.6 cm diameter), and plastic bags.
2.2.1 Materials
Seventy percent ethanol solution (v/v), 6% NaClO (w/v) solu-
and Solutions for Field
tion, 0.6% NaClO (w/v) solution, all prepared with distilled sterile
Zygotic Embryo Collection
water, blades, scalpel, tweezers, glassware (beakers, measuring cyl-
2.2.2 Materials inders), paper towels, stainless steel strainers, etc.
and Solutions for Laminar
Flow Sterilization Medium is prepared using Y3 medium [19] formulation (Table 1),
supplemented with 3 g/L gelrite, 2.5 g/L activated charcoal, 5%
2.2.3 Media Preparation
sucrose, and 0.6 mM 2,4-dichlorophenoxyacetic acid (2,4-D).
Medium I (for the Induction Adjust pH to 5.75 and dispense a 10 mL volume to each of the
of Callus) 45 mL bottles for tissue culture, place caps, and sterilize.
Medium II (for Medium is prepared using Y3 medium formulation (Table 1), sup-

the Formation of Somatic plemented with 3 g/L gelrite, 2.5 g/L activated charcoal, 5%
Embryos) sucrose, and 0.325 mM 2,4-D. Adjust pH to 5.75 and dispense a
25 mL volume to each of the 150 mL bottles for tissue culture,
place caps, and sterilize.
Table 1
Formulation for the preparation of medium Y3
Stock solution Chemical Amount (g/L) Volume used (mL/L)

A NH4Cl 26.8 20
KNO3 101.2
B KCl 149.6 10
H2NaPO4 27.56
H3B03 0.3092
C MgSO4 · 7H2O 24.8 10
MnSO4 0.848
KI 0.832
CuSO4 0.0248
ZnSO4 · 7H2O 0.72
D NiCl2·6H2O 0.0024 10
CaCl2·2H2O 29.4
CoCl2 0.024
Na2MoO4·2H2O 0.024
E C10H14N2Na2O8·2H2O 3.724 10
Fe2SO4·7H2O 1.5
F Thiamine 0.1012 10
Pyridoxine 0.1028
Nicotinic acid 0.1
Myo-inositol 10
l-Asparagine 8.8
l-Arginine 10
l-Glutamine 10
Medium III (for Medium is prepared using Y3 medium formulation (Table 1), sup-
the Germination of Somatic plemented with 3 g/L gelrite, 2.5 g/L activated charcoal, 5%
Embryos) sucrose, 0.006 mM 2,4-D and 0.3 mM 6-benzyladenine (BA), and
0.0028 mM gibberellic acid (GA3). Adjust pH to 5.75 and dis-
pense a 25 mL volume to each of the 150 mL bottles for tissue
culture, place caps, and sterilize.
Medium IV (for Plantlet Medium is prepared using Y3 medium formulation (Table 1), sup-
Formation) plemented with 3 g/L gelrite, 2.5 g/L activated charcoal, 5%
sucrose, 0.006 mM 2,4-D, and 0.3 mM BA. Adjust pH to 5.75
and dispense a 25 mL volume to each of the 150 mL bottles for

tissue culture, place caps, and sterilize.
Medium V (for Plantlet Medium is prepared using Y3 medium formulation (Table 1), sup-
Growth) plemented with 2.5 g/L activated charcoal and 5% sucrose. Adjust
pH to 5.75 and dispense a 100 mL volume to each of the 300 mL
bottles for tissue culture, place caps, and sterilize.
Plant Grow Regulator Solution of 2,4-dichlorophenoxyacetic acid (2,4-D, 10 mg/mL):

Solutions Preparation dissolve 100 mg of 2,4-D in 8 mL of distilled water and 50–100 μL
1 N NaOH and then add water to 10 mL. Store at 4 °C.
Solution of 6-benzyladenine (BA, 5 mg/mL): dissolve 50 mg
of 6-BA in 8 mL distilled water and 50–100 μL 1 N NaOH and
then add water to 10 mL. Store at 4 °C.
Solution of gibberellic acid (GA3, 2 mg/mL): dissolve 20 mg
of GA3 in 8 mL distilled water and 50–100 μL 1 N NaOH and
then add water to 10 mL. Store at 4 °C. For the treatment with
GA3, 50 μL of stock solution is filtered through a 0.22 μm mem-
brane and then added to 1 L of sterilized Medium III.
3 Methods
1. Mature fruit of 12–14 months after pollination are selected

from the palms and cut transversely with a machete revealing
the area where the embryo is surrounded by solid endosperm
(Fig. 1a). A cylinder of solid endosperm containing the embryo
is excised from the open nuts using a cork borer (1.6 cm diam-
eter; Fig. 1b).
2. Immediately after excision, the endosperm cylinders enclosing
the embryo are placed in a 0.6% (v/v) NaOCl solution. Transfer
to 70% ethanol for 3 min, and rinse three times with sterile dis-
tilled water. Incubate for 20 min with a 3% NaOCl solution and
finally rinse three times with sterile distilled water. The cylinders
are placed inside sterile plastic bags and the bags kept in a poly-
styrene ice box for cooling during transportation from the site
of collection to the laboratory, where they are processed imme-
diately or kept in a refrigerator before processing.
3. For processing, the bags containing the endosperm cylinders
are rinsed with 70% ethanol and introduced to the laminar flow
hood. Then within the hood, the cylinders are taken out from
the bags, rinsed with 70% ethanol, and left for 3 min in a flask
with 70% ethanol; after this, add 6% NaOCl solution, incubate
for 20 min, and rinse three times with distilled sterile water.
Subsequently, the embryos are excised from the endosperm cyl-
inders and finally washed with a 0.6% NaOCl solution for
Fig. 1 (a) Excision of a cylinder of solid endosperm containing the zygotic embryo [ZE]. (b) Excision of the ZE
from the endosperm cylinder. (c) Embryogenic callus [EC] formed from plumule isolated from the ZE. The EC is
covered with embryogenic structures after 90 days of culture. (d left) EC with germinating somatic embryos.
(d right) EC with developing shoots. (f) Individual shoots isolated from EC. (g), (h), (i) Progressive developing
stages of plantlet formation. (j) Plantlets ready for acclimatization in ex vitro conditions
10 min and rinsed three times with sterile distilled water; the
excess of water is eliminated using a sterile stainless steel strainer.
4. Excise the plumule from these embryos under a stereoscopic
microscope and place in medium I for 90 days, under complete
darkness at 27 ± 2 °C and without subculturing. At the end of
this culture period, embryogenic callus is already formed
(Fig. 1c).
5. The embryogenic calluses are transferred to medium II using
sterile tweezers and cultured for 30 days under complete dark-
ness at 27 ± 2 °C and without subculturing. During this period
somatic embryos are formed and start germinating (Fig. 1d
left).
6. The embryogenic calluses with somatic embryos are transferred
to medium III using sterile tweezers and cultured for 90 days
under a 16-h photoperiod (45–60 μmol m−2/s photosynthetic
photon flux density [PPFD]) provided by tri-phosphor (F32 T8,
6500 K, 32 W) daylight tubes at 27 ± 2 °C. During this culture
period, shoots form on the calluses (Fig. 1d right).
7. The embryogenic calluses with germinated somatic embryos
are transferred to medium IV using sterile tweezers and cul-
tured for 120 days under a 16-h photoperiod (45–60 μmol m−2/s
PPFD) provided by tri-phosphor (F32 T8, 6500 K, 32 W) day-
light tubes (MAGGMR, Tlatilco, Mexico) at 27 ± 2 °C and
subcultured every 2 months. During this period shoots grow
on the calluses (Fig. 1e), but during subculturing grown shoots
are separated from the calluses and transferred also to medium
IV (Fig. 1f).
8. Shoots are transferred to medium V using sterile tweezers and
cultured for 180 days under a 16-h photoperiod (45–
60 μmol m−2/s PPFD) provided by tri-phosphor (F32 T8,
6500 K, 32 W) daylight tubes (MAGGMR, Tlatilco, Mexico) at
27 ± 2 °C and subcultured every 2 months. During this period,
plantlets develop (Fig. 1g), and by the end of the period, they
are ready for ex vitro acclimatization (Fig. 1h).
9. For acclimatization plantlets are taken out of the culture con-
tainers and planted in grow plastic bags containing substrate
mix (peat moss/sand/soil 1:1:1) and covered with a transpar-
ent plastic bag. They are kept during 3 months under green-
house conditions for gradual adaptation to a drier environment
(Fig. 2a, b). Plantlets are then transferred to shaded nursery
conditions for 6 months (Fig. 2c) before planting in the field
(Fig. 2d).
Fig. 2 Micropropagated coconut plants obtained by somatic embryogenesis from plumule explants, during ex
vitro acclimatization: in greenhouse (a) and (b), in shaded nursery (c). Plants already established in field condi-
tions in Yucatan (d)
4 Perspectives and Recommendations
The present protocol is reproducible and plants produced are able

to grow and developed into fruit-bearing plants. It is also currently
being scaled up, but at the same time, work is done to improve it.
For instance studies are being carried out on the effect of changes
on the medium formulation (addition of calcium ionophore or
phloroglucinol) or basic studies to understand the control of
somatic embryogenesis in coconut (gene expression and epigenetic
changes), and some of the results obtained so far show promise for
improvement of efficiency of the formation of embryogenic callus
or somatic embryos (CICY, unpublished results). Other approaches
are also being considered such as developing suspension cultures,
but this has not started yet.
In addition it is very important to consider that in Mexico and

other countries where phytoplasma diseases affect coconuts [4], it
is important to screen for coconuts that are resistant to these
pathogens and propagate these plants. Starting traditional propa-
gation or micropropagation from genotypes that are not resistant
to phytoplasma diseases, it is a very high risk, particularly if a very
important effort in time, labor, and investment is involved in any
initiative for large-scale replanting and/or establishment of new
plantations. Then an additional venue of research, that has to be
associated with the improvement of coconut micropropagation, is
the development of rapid and effective protocols for the screening
of resistance to phytoplasma diseases. In this respect, we have
started research on cloning and characterization of disease-
resistance gene candidates from LY-resistant and LY-susceptible
coconut genotypes [20].
References
1. Sáenz-Carbonell L, Montero-Cortés M, Pérez- somatic embryogenesis. Plant Cell Rep
Nuñez T et al (2016) Somatic embryogenesis 17:515–521. https://doi.org/10.1007/
in Cocos nucifera L. In: Loyola-Vargas VM, s002990050434
Ochoa-Alejo N (eds) Somatic embryogenesis: 8. Azpeitia A, Chan JL, Sáenz L et al (2003)
fundamental aspects and applications. Springer, Effect of 22(S),23(S)-homobrassinolide on
Cham, pp 297–318. https://doi. somatic embryogenesis in plumule explants of
org/10.1007/978-3-319-33705-0_18 Cocos nucifera (L.) cultured in vitro. J Hortic
2. Roolant L (2014) Why coconut water is now a Sci Biotechnol 78:591–596. https://doi.org/
one billion industry; NOTE:Lao DA (2009). 10.1080/14620316.2003.11511669
Coco-biodiesel in the Philippines. In: Coconut 9. Pérez-Núñez MT, Souza R, Sáenz L et al
Philippines published by Asia Outsourcing. (2009) Detection of a SERK-like gene in coco-
https://transferwise.com/blog/2014-05/ nut and analysis of its expression during the
why-coconut-water-is-now-a-1-billion-indus- formation of embryogenic callus and somatic
try/. Accessed 02 Nov 2015 embryos. Plant Cell Rep 28:11–19. https://
3. Gurr GM, Johnson AC, Ash GJ et al (2016) doi.org/10.1007/s00299-008-0616-8
Coconut lethal yellowing diseases: a phyto- 10. Montero-Cortés M, Rodríguez-Paredes F,
plasma threat to palms of global economic and Burgeff C et al (2010) Characterisation of a
social significance. Front Plant Sci 7:1521. cyclin-dependent kinase (CDKA) gene expressed
https://doi.org/10.3389/fpls.2016.01521 during somatic embryogenesis of coconut palm.
4. Oropeza CM, Escamilla JA, Mora G et al Plant Cell Tissue Org 102:251–258. https://
(2005) Coconut lethal yellowing. In: Batugal doi.org/10.1007/s11240-010-9714-8
P, Rao R, Oliver J (eds) Status of coconut 11. Montero-Cortés M, Sáenz-Carbonell L,
genetic resources. IPGRI-APO, Serdang, Córdova I et al (2010) GA3 stimulates the for-
Malaysia, pp 349–363 mation and germination of somatic embryos
5. Blake J, Robert M, Taylor F et al (1994) and the expression of a KNOTTED- like
Studies on the in vitro propagation and cloning homeobox gene of Cocos nucifera (L.). Plant
of elite and disease resistant coconut palms. Cell Rep 29:1049–1059. https://doi.
Final Report (The European Commission, org/10.1007/s00299-010-0890-0
Project C11.0764.M) 12. Sáenz L, Herrera-Herrera G, Uicab-Ballote F
6. Hornung R (1995) Micropropagation of Cocos et al (2010) Influence of form of activated
nucifera L. from plumular tissue excised from charcoal on embryogenic callus formation in
mature zygotic embryos. Plant Rech Dévelop coconut (Cocos nucifera). Plant Cell Tissue
2:38–43 Org 100:301–308. https://doi.org/10.1007/
7. Chan JL, Sáenz-Carbonell L, Talavera-May CR s11240-009-9651-6
et al (1998) Regeneration of coconut (Cocos 13. Sáenz L, Souza R, Chan JL et al (2005) 14C-2,
nucifera L.) from plumule explants through 4-dichlorophenoxyacetic acid uptake and for-
mation of embryogenic calli in coconut plumu- callus from coconut immature inflorescence
lar explants cultured on activated charcoal-free explants. In Vitro Cell Dev Biol Plant 52:367–
media. Rev Fitotec Mex 28:151–159 378. https://doi.org/10.1007/s11627-016-
14. Pérez-Núñez MT, Chan JL, Sáenz L et al 9780-7
(2006) Improved somatic embryogenesis from 18. Sáenz L, Azpeitia A, Oropeza C et al (2010)
Cocos nucifera (L.) plumule explants. In Vitro Endogenous cytokinins in Cocos nucifera L. in
Cell Dev Biol Plant 42:37–43. https://doi. vitro cultures obtained from plumular explants.
org/10.1079/IVP2005722 Plant Cell Rep 29:1227–1234. https://doi.
15. Perera PIP, Vidhanaarachchi VRM, org/10.1007/s00299-010-0906-9
Gunathilake TR et al (2009) Effect of plant 19. Eeuwens CJ (1976) Mineral requirements for
growth regulators on ovary culture of coconut growth and callus initiation of tissue explants
(Cocos nucifera L.). Plant Cell Tissue Org excised from mature coconut palms (Cocos
99:73–81. https://doi.org/10.1007/s11240- nucifera) and cultured in vitro. Physiol Plant
009-9577-z 36:23–28. https://doi.org/10.1111/j.1399-
16. Perera PIP, Hocher V, Verdeil JL et al (2007) 3054.1976.tb05022.x
Unfertilized ovary: a novel explant for coconut 20. Puch-Hau C, Oropeza-Salín C, Peraza-
(Cocos nucifera L.) somatic embryogenesis. Echeverría S et al (2015) Molecular cloning
Plant Cell Rep 26:21–28. https://doi. and characterization of disease-resistance gene
org/10.1007/s00299-006-0216-4 candidates of the nucleotide binding site (NBS)
17. Sandoval-Cancino G, Sáenz L, Chan JL et al type from Cocos nucifera L. Physiol Mol Plant
(2016) Improved formation of embryogenic Pathol 89:87–96. https://doi.org/10.1016/j.
pmpp.2015.01.002
Chapter 10
Micropropagation of Yucca Species

Yessica López-Ramírez, Alejandra Palomeque-Carlín,
Lucía Isabel Chávez Ortiz, Ma. de Lourdes de la Rosa-Carrillo,
and Eugenio Pérez-Molphe-Balch
Abstract
Yuccas are plants adapted to arid and semiarid regions and have been used as source of food and raw mate-
rials and for ornamental purposes. Lately, the interest in this genus has grown due to the presence of
potential useful compounds such as saponins and polyphenolics. However, they present very low repro-
ductive rates and virtually all the plants used are wild individuals; as consequence, their natural populations
have been depleted. We present an efficient method to establish in vitro cultures of Yucca species starting
with seeds and then obtaining shoots from the seedling meristems using cytokinins and auxins. These
shoots can be rooted and transferred to soil or can be used as explants for another multiplication cycle.
Hence, it is necessary to acquire seeds just once to establish a large-scale micropropagation protocol.
Key words Acclimatization, Agavaceae, In vitro rooting, Micropropagation, Yucca
1 Introduction
Plants of the genus Yucca are one of the most notable elements
of the arid and semiarid areas of North America. The genus
belongs to the Agavaceae family and comprises 49 species that are
distributed from the south of Canada to Central America. The
largest number of species, 29, is found in Mexico, but the south-
ern region of United States of America is also rich in Yucca spe-
cies [1]. These plants are long-lived perennials, and most have a
tree shape with a well-differentiated trunk and several branches
ending in leaf rosettes. There are some species such as Y. filamen-
tosa and Y. coahuilensis, which have very short stems that confers
them a rosette shape very similar to the plants of the Agave genus.
In addition to its ecological importance, Yucca genus plants have
been used by Native Americans since ancient times as a source of
food (fruits and flowers) and raw materials (fibers and materials
for construction). These plants are still used by the inhabitants of
171
172 Yessica López-Ramírez et al.
the arid and semiarid zones, especially in Central and Northern

Mexico. At present, the greatest interest in these plants lies in
their ability to produce chemicals with high value in the pharma-
ceutical industry. The presence in several Yucca species of com-
pounds with antioxidant, anti-inflammation, antiarthritic,
anticancer, antidiabetic, antimicrobial, and hypocholesterolemic
properties has been reported [2]. The active compounds respon-
sible for these activities are steroidal saponins; polyphenolics,
including resveratrol; and a number of other stilbenes (yuccaols
A, B, C, D, and E) [3]. More recently, the presence of polyphe-
nols with a great photoprotective activity was demonstrated in Y.
periculosa [4]. On the other hand, the use of species of Yucca as
ornamental plants has been increasing steadily in recent years.
This is due to their beauty and also to their low water and main-
tenance requirements.
Currently, almost all Yucca plants used for various purposes
are taken from the wild. This has caused a significant reduction in
wild populations and has placed some species at risk. It is there-
fore important to have methods that allow the efficient produc-
tion of nursery plants. However, most Yucca species do not
reproduce vegetatively, and seed multiplication is limited due to
the pollination system. These plants are known for their obligate
pollination mutualism with Yucca moths (Lepidoptera, Prodoxidae),
where pollinator moths provide yuccas with pollen and, in
exchange, the moth oviposit in the gynoecium of the flower and
larvae feed on the developing seeds. This significantly reduces the
production of viable seeds [5]. In addition, seedlings lack the
mechanisms of resistance to environmental stress possessed by
more developed plants, so the survival rate of the juvenile plants is
very low. These factors make in vitro propagation a valuable
option for this group of plants.
This chapter presents a simple protocol that is efficient for sev-
eral species of Yucca. It is based on the production of new shoots
from the meristematic regions present at the base of the rosettes of
seedlings or young plants. The appearance of these shoots is stimu-
lated with cytokinins alone or combined with low concentrations
of an auxin, depending on the species (Table 1). The most efficient
cytokinins are benzyladenine (BA) and 2-isopentenyladenine (2iP),
while the auxin that gives the best response is indoleacetic acid
(IAA). Shoots develop roots with high efficiency on basal medium
without growth regulators and can be later adapted and transferred
to soil. Since this system is based on the development of preexist-
ing meristems and not on organogenesis or somatic embryogene-
sis, the possibility of somaclonal variation is minimal. Another
advantage of this system is that the shoots generated in each mul-
tiplication cycle can serve as a source of explants for a new cycle.
Therefore, the establishment of in vitro cultures only has to be
done once and then a continuous production of shoots can be
maintained (see Note 1).
Micropropagation of Yucca 173
2 Materials
2.1 Disinfection 1. Viable seeds (see Note 2).

of Seeds 2. Antiseptic liquid soap (active ingredient 0.1% benzalkonium
chloride).
3. Seventy percent ETOH.
4. Twenty percent commercial bleach (active ingredient 5%
sodium hypochlorite) solution.
5. Aluminum foil.
6. Sterile dH2O.
2.2 Culture Media All the media used are based on the original Murashige and Skoog
Preparation medium formula [6].
2.2.1 Medium 1. 900 mL dH2O.
Without Growth Regulators 2. Add MS medium salts and vitamins.
(Germination of Seeds
and Rooting Stage
3. Add 3% sucrose (w/v).
Medium) 4. Adjust to pH 5.7 with 1 N NaOH or HCl.
5. Adjust volume to 1 L.
6. Add 0.8% agar (w/v) and stir.
7. Heat on microwave and stir until agar is completely dissolved
and solution is clear.
8. Pour into culture vessels (see Note 3).
9. Autoclave at 1.2 kg cm−2 and 121 °C for 20 min.
2.2.2 Medium 1. 900 mL dH2O.

with Growth Regulators 2. Add MS medium salts and vitamins (Table 2).
(Initiation
and Multiplication Stage
3. Add 3% sucrose (w/v).
Medium) 4. Add growth regulators.
5. Adjust to pH 5.7 with 1 N NaOH or HCl.
6. Adjust volume to 1 L.
7. Add 0.8% agar (w/v) and stir.
8. Heat on microwave and stir until agar is completely dissolved
and solution is clear.
9. Pour into culture vessels (see Note 3).
10. Autoclave at 1.2 kg cm−2 and 121 °C for 20 min.
3 Methods
3.1 Disinfection 1. Using a magnetic stirrer, wash seeds in a beaker for 5 min with
of Seeds tap water and a few drops of antiseptic liquid soap. Repeat
three times (see Note 4).
2. Wash seeds with 70% ETOH for 30 s. Discard ETOH and
rinse twice using tap water.
3. Prepare a solution containing 20% commercial bleach (see
Note 5).
4. Fill beaker with bleach solution up to 1.5 cm from the rim and
cover with a double layer of aluminum foil.
5. Stir slowly for 20 min on magnetic stirrer. Be careful not to
exceed time as this can affect seed viability.
6. Under a laminar airflow chamber, rinse seeds with sterile dis-
tilled water to remove all traces of surface-sterilizing agents,
and then discard distilled water. Repeat twice.
3.2 Germination 1. Under a laminar airflow chamber using sterile tweezers, place
of Seeds previously sterilized seeds on MS medium without growth
regulators.
2. Seal and label culture vessels.
3. Incubate cultures under a 16:8 h light/dark photoperiod
(54 μmol m−2/s) at 22 ± 3 °C.
4. Seeds should germinate within a few weeks (usually two).
3.3 Initiation Stage 1. Once well-formed plantlets (at least 6 cm high without the
root) are available, transfer to multiplication medium.
2. Under a laminar airflow chamber, use a sterile scalpel to cut the
root of the plantlet being careful to leave the basal meristems
intact.
3. Remove the apical end of the leaves in the same manner.
4. Place the explant on multiplication medium inserting 1 cm of
the base onto the culture media (Fig. 1a). Do not place more
than three explants per culture vessel.
6. Incubate cultures under a 16/8 h light/dark photoperiod
(μmol m−2/s) at 22 ± 3 °C.
3.4 Multiplication 1. Once well-formed shoots are visible (usually every 4–5 weeks)
Stage (Fig. 1b–d), subculture on multiplication medium.
2. Under a laminar airflow chamber using a sterile scalpel, care-
fully separate the shoots and cut the leaf apex.
3. Subculture the explants on fresh multiplication medium insert-
ing 1 cm of the base into the culture media (Fig. 1a).
5. Incubate cultures under a 16:8 h light/dark photoperiod
(μmol m−2/s) at 22 ± 3 °C.
Fig. 1 (a) Explants of Yucca coahuilensis newly placed on multiplication medium. (b) Generation of new shoots
in a Y. filamentosa explant after 30 days of incubation. (c) Generation of new shoots in a Y. periculosa explant
after 35 days of incubation. (d) Generation of new shoots in a Y. coahuilensis explant after 38 days of incuba-
tion. (e) Y. coahuilensis shoots separated and ready to be placed in rooting medium. (f) Y. filamentosa rooted
plants ready for transfer to soil. Bar = 1 cm
6. After reaching the desired number of plants, transfer the shoots

to the rooting media.
3.5 Rooting Stage 1. Under a laminar airflow chamber, separate the shoots (Fig. 1e),
and place well-formed shoots on rooting medium inserting
0.5 cm of the base into the culture media.
2. Incubate in a 16;8 h light/dark photoperiod (μmol m−2/s) at
22 ± 3 °C. Roots should appear within 3–5 weeks (Fig. 1f).
3.6 Acclimatization 1. Remove the seal from the culture vessel and open the lid but
Stage do not remove it. Leave the container covered for 5 days to
balance the humidity inside and outside the vessel.
2. Carefully take the whole plant out of the container using
tweezers.
3. Gently wash roots with tap water to remove agar residues,
being careful not to damage them.
4. Fill a 4-inch-wide by 6-inch-deep pot half-full with substrate
mixture (see Note 6).
5. Place the plant in the pot and fill in with the soil mix until all
roots are covered.
6. Firm soil gently to ensure that there are no air pockets and
plant can stand on its own.
7. Water the substrate.
8. Transfer to a greenhouse.
4 Notes
1. We have maintained in vitro cultures for more than 5 years

without diminishing their ability to produce new shoots.
Neither rooting ability, soil adaptation, nor morphology of the
plants generated from these cultures has been altered.
2. The seeds can be obtained from mature fruits collected in the
field. The fruits should be brought to the laboratory and
washed several times with running water and antiseptic soap.
Then the fruits are split with a knife, and all the areas damaged
by insects, including those affected by the larvae of Yucca
moths, are discarded. Viable seeds, which are recognized by
their dark color, are collected and allowed to dry for 24 h at
room temperature. Once dried, the seeds can be disinfected to
establish in vitro cultures or stored. To store the seeds for a
long time, it is recommended to treat them with a fungicide,
for example, Thiram, and keep them at 4–5 °C in a
desiccator.
3. Due to the shape and size of the Yucca seedlings and shoots
produced in vitro, the use of culture vessels of less than 300 mL
capacity, or less than 15 cm in height, is not recommended.
4. In some seed lots, fungal contamination can be a problem. In
these cases, it is recommended to incorporate a fungicide pow-
der to the tap water and antiseptic liquid soap for the initial
washes and increase the time of each wash up to 30 min.
Fungicides whose active ingredient is Thiram work well for this
purpose.
5. Always use new bleach bottles. Previously opened bottles are
less effective because chlorine is gasified and lost.
6. Yucca plants require well-drained soil poor in organic matter.
A 1:1 mix of commercial potting soil with sand works well. An
inert substrate like vermiculite may be used instead of sand.
References
1. Rocha M, Good-Ávila S, Molina-Freaner et al Prod Bioprospect 2:231–234. https://doi.
(2006) Pollination biology and adaptive radia- org/10.1007/s13659-012-0090-4
tion of Agavaceae, with special emphasis on the 3. Cheeke PR, Piacente S, Oleszek W (2006)
genus Agave. Aliso 22:329–344. https://doi. Anti-inflammatory and anti-arthritic effects of
org/10.5642/aliso.20062201.27 Yucca schidigera: a review. J Inflamm 3:6.
2. Patel S (2012) Yucca: a medicinally significant https://doi.org/10.1186/1476-9255-3-6
genus with manifold therapeutic attributes. Nat
4. García-Bores AM, Bello C, Campos Y et al

6. Murashige T, Skoog F (1962) A revised
(2010) Photoprotective activity of Yucca peric- medium for rapid growth and bioassays with
ulosa polyphenols. B Latinoam Caribe Pl tobacco tissue cultures. Physiol Plant 15:473–
9:100–108 497. https://doi.org/10.1111/j.1399-3054.
5. Pellmyr O (2003) Yuccas, Yucca moths and 1962.tb08052.x
coevolution: a review. Ann Missouri Bot Gard
90:35–55
Chapter 11
Auxin Immunolocalization in Coffea canephora Tissues

Ruth E. Márquez-López, Ángela Ku-González, Hugo A. Méndez-
Hernández, Rosa M. Galaz-Ávalos, and Víctor M. Loyola-Vargas
Abstract
Auxins are plant growth regulators that participate in a variety of biological mechanisms during the growth
and development of plants. The most abundant natural auxin is indole-3-acetic acid (IAA). The physiolog-
ical processes regulated by IAA depend on their temporal space accumulation in different tissues of a plant.
This accumulation is regulated by its biosynthesis, conjugation, degradation, and transport. Therefore
tools that allow us a qualitative and quantitative detection of IAA in plant tissues are very useful to under-
stand the homeostasis of IAA during the life cycle of plants. In this protocol, the complete procedure for
localization of IAA in different tissues of Coffea canephora is described using specific anti-IAA monoclonal
antibodies.
Key words Antibody, Coffea canephora, Immunocytochemistry, Indole-3-acetic acid, Polar auxin
transport
1 Introduction
The plants have sessile lifestyle. They have to adapt to the extreme
environmental conditions around them to survive. Growth, devel-
opment, and defense in the plant are controlled by small signaling
compounds called plant growth regulators (PGRs); these com-
pounds modulate the division, differentiation, and cell elongation of
plants [1]. The most studied growth regulators are auxins; several
biochemical and genetic studies have shown that they participate in
practically all the processes of development and growth of plants
[2–4]. Auxins have become a very important topic in biology [5].
The most abundant natural auxin is indol-3-acetic acid (IAA),
a weak organic acid characterized by having an indole ring with a
side chain formed by a carboxyl group [6]. The IAA was formerly
identified by an in vitro bioassay in which agar blocks, with this
compound, stimulated the growth of oat coleoptiles [7].
The physiological processes regulated by IAA depend on their
temporal space accumulation in different tissues of the plant. IAA
179
180 Ruth E. Márquez-López et al.
can exert multiple functions in response to endogenous and exog-

enous signals through the control of its biosynthesis, catabolism,
conjugation, and transport [3, 8].
The IAA is distributed in two ways: one at long distances, from
biosynthetic tissues to sink tissues through the phloem. The other
transport is a finely regulated cell-to-cell transport called polar
auxin transport (PAT) [9]. The directionality of auxin flux is
dependent on the localization of transmembrane proteins called
PIN. The first identified member of this family was PIN1, thanks
to studies of mutants of Arabidopsis thaliana which did not cor-
rectly develop floral organs and generated a pin-shaped stem [10].
There are eight PIN genes in the C. canephora genome (Fig. 1).
Although PIN proteins have been characterized as transmem-
branal, they can undergo mechanisms of rearrangement in the cell
in response to different stimuli, affecting the global flow of auxin
and accumulation sites [11].
Despite the fact that the use of gene expression and mutagen-
esis techniques has provided insight into the mode of action of IAA,
and some of the factors that regulate its homeostasis, it should not
be forgotten that IAA is a mobile molecule that can be transported
between the cells and form gradients. This requires techniques that
allow qualitative and quantitative detection of IAA in plant tissues.
In recent years, reliable and sensitive quantification methods
have been developed for IAA [12, 13]. However, it is necessary to
know not only the quantity of IAA but also the specific sites of
their accumulation.
On the other hand, auxin-responsive synthetic promoters
fused to reporter genes such as β-glucuronidase, fluorescent pro-
teins, or luciferase have been used to visualize auxin action sites.
One of the most widely used synthetic promoters is DR5, which
consists of 7–9 replicates – TGTCTC auxin-responsive elements
[14]. This promoter has the drawback to respond to other PGRs,
such as brassinosteroids; therefore, it does not specifically show
auxin signaling. In addition, there are auxin-dependent physiologi-
cal processes in which this promoter shows no activity [14].
Other promoters that have provided a new level of sensitivity
in determining the auxin distribution are DII-Venus and DR5v2
[15]. However, there is evidence that these promoters have differ-
ent expression patterns [16, 17]. Also, because these promoters are
bound to the auxin signal transduction system, they depend
directly on auxin signaling pathway inputs as well as the accumula-
tion of co-receptors available in each cell [17]. Therefore, these
promoters limit us to visualize the auxin distribution extra- and
intracellularly and do not provide with a clear vision on the auxin
gradients.
The use of anti-IAA antibodies is a useful tool to visualize the
levels of auxin in situ. This technique has been used in the study of
several physiological processes in multiple species [18–20]. Here,
we present a relatively simple and rapid protocol for
Auxin Immunolocalization 181
Fig. 1 Phylogenetic tree for PIN gene family in several species. The sequences of Coffea canephora PINs were
obtained from http://coffee-genome.org. Rice sequences were obtained from http://rice.plantbiology.msu.edu.
Tomato sequences were obtained from https://solgenomics.net/. Arabidopsis sequences were obtained from
https://www.ncbi.nlm.nih.gov/. The sequences were aligned using the software MEGA 7 (http://www.megas-
oftware.net/). The percentage of replicate trees in which the associated taxa clustered together in the boot-
strap test (1000 replicates) is shown next to the branches. The analysis was conducted in MEGA7 using the
Neighbor-Joining method. Abbreviations: Os Oryza sativa, Sl Solanum lycopersicum, Cc Coffea canephora, At
Arabidopsis thaliana
immunolocalization of IAA in different C. canephora tissues. The

method is based on previously described protocols [21].
2 Materials
2.1 Biological 1. Leaves of Coffea canephora.

Materials
2.2 Glassware 1. Glass Coplin staining jars.

2. Petri dishes (100 × 15 mm).
3. Slides.
4. Coverslips.
5. Vertical glass slide boxes.
6. Humidity chambers.
7. Glass vials.
2.3 Instrumentation 1. Exhaust hood.

2. Desiccator.
3. Vacuum pump.
4. Oven. Temperature range from 37 to 58 °C.
5. Molds.
6. Microtome.
7. Low-profile blades.
8. Vertical glass slide boxes.
9. Humid chambers for slide incubation with the antibody.
10. Glass Pasteur pipettes.
11. Poly-L-lysine slides and coverslips.
2.4 Reagents 1. Sodium chloride.

and Solutions 2. Sodium phosphate dibasic.
3. Monopotassium phosphate.
4. N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydro-
chloride (EDAC).
5. Formaldehyde.
6. Acetic acid.
7. Absolute ethanol.
8. Butanol.
9. Paraplast Plus.
10. Xylene.
11. Ultraclear.
12. Tween 20.
Prepare all solutions using purifying deionized water and ana-
lytical grade reagents. Prepare and store all reagents at room tem-
perature (unless indicated otherwise).
2.4.1 Tissue Fixation 1. Phosphate-buffered saline (PBS) buffer 1×: [150 mM NaCl,
and Dehydration 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.2]. This solution
must be filtrated and stored at 4 °C.
2. Formalin–acetic acid–alcohol (FAA) fixative: 50% absolute eth-
anol, 5% acetic acid, and 10% formaldehyde 37%.
3. Absolute ethanol and dissolved to 85, 70, 50, and 30% in dis-
tilled water.
2.4.2 Tissue Embedding 1. PBS 1×.

2. Liquid parafilm-butanol 1:1 (w/v).
2.4.3 Pretreatment, 1. Poly-L-lysine solution: 0.01% (w/v) poly-L-lysine in distilled

Antibody Labeling, water.
and Mounting 2. Absolute ethanol dissolved to 85, 70, 50, and 30% in water.
3. PBS 1×.
4. Buffer citrate: 10 mM Na3C6H5O7.2H2O, 0.05% Tween 20
pH 6.
5. Blocking solution: 3% BSA in PBS 1x (aliquots can be stored at
−20 °C).
6. Primary antibody solution: Primary antibody IAA monoclonal
antibody is diluted in solution 1% (w/v) BSA in PBS at a con-
centration of 1:100.
7. Secondary antibody solution: Secondary antibody, anti-mouse
Alexa Fluor 488 is diluted in solution 1% (w/v) BSA in PBS at
a concentration of 1:100.
8. Optionally, as cell stain, 1 mg mL−1 calcofluor white aqueous
stock solution, diluted 1:1000 in PBS.
9. Mounting medium: Vectashield® with or without DAPI to stain
nuclei 4′, 6-diamidino-2-phenylindole dihydrochloride (DAPI).
3 Methods
3.1 Fixation Tissue 1. Coffea canephora tissues are prefixed in 3% EDAC in 1×

and Dehydration PBS. The samples are submerged in EDAC solution (3% in PBS
1×) at 4 °C for 30 min, preferably in glass vials (see Note 1).
2. After prefixation the samples are fixed in FAA solution under
vacuum for 48–72 h at 4 °C; change the FAA solution every
24 h.
3. For dehydration, a gradual series of ethanol solutions (from 30
to 85%) in distilled water are freshly prepared before use.
Perform the following dehydration steps keeping samples
applying vacuum for 5 min at each step and maintaining the
samples at 4 °C:
(a) Three washes for 10 min each in PBS 1× solution.
(b) Incubate twice for 2 h in 30% ethanol.
(c) Incubate twice for 2 h in 50% ethanol.
(d) Incubate twice for 2 h in 70% ethanol.
(e) Incubate twice for 2 h in 85% ethanol.
(f) Incubate twice for 30 min in 96% ethanol.
(g) Incubate twice for 30 min in absolute ethanol.
3.2 Embedding 1. After the samples are incubated for 24 h in butanol at room
in Paraplast temperature.
2. After the samples are incubated overnight in butanol with
10–15 flakes of Paraplast Plus at room temperature at 60 rpm.
3. Place the samples at 60 °C, and add 10–15 flakes of paraffin
every 2 h, three times.
4. The butanol excess is removed by discarding half volume of
solution and adding half volume of liquid paraffin every 12 h,
four times.
5. After the last Paraplast change, the samples are placed in the
center of stainless steel base molds previously heated at 60 °C
and embedded in paraffin (see Note 2). Special attention must
be given to the orientation of the sample. The transversal or
longitudinal orientation is determinant at this step.
3.3 Sectioning 1. Prepare the samples for sectioning by trimming the blocks into
a trapezoid shape and leaving about 2–3 mm of wax around
the tissues. It is helpful to keep the samples on ice.
2. The samples are sectioned into 4–5 μm slices using a retracting
microtome with low-profile blades.
3. Sections are collected in ribbons and placed in a 42 °C water
bath to allow the correct expansion of the tissues and then
placed on poly-L-lysine slides (see Note 3).
4. Let the slides dry at 37 °C for at least 2 h to remove the water
excess.
5. Store the slides in sealed plastic boxes at room temperature.
6. The tissue sections can be stored at 4 °C for several months
without losing tissue integrity.
3.4 Immuno- 1. Tissue sections are incubated at 65 °C for 15 min and deparaf-
localization finized in slide staining jars with xylene three times for 10 min
per rinse, and ultraclear four times every 15 min per rinse.
2. The slides are washed twice in absolute ethanol at 100% for
2 min per rinse. Then, the tissue sections were rehydrated with
a series of absolute ethanol-water combinations (96, 85, 70,
50, and 30% for 5 min in each step) and water twice (5 min
each) (see Note 4).
3. Antigen retrieval is carried out by rinsing the slides in citrate
buffer and microwave-heated at high power for 4 min. The
samples are washed three times with PBS buffer for 5 min.
4. Subsequently, the sections are incubated in solutions 3% BSA in
PBS to neutralize possible nonspecific antibody reactions
(blocking). The slides are incubated in a wet chamber at 4 °C
for 1 h.
5. The tissue sections are covered with 100–200 μL of 1% BSA in

PBS containing the primary antibody anti-IAA (1:100) and
left in the humid chamber at 4 °C overnight.
6. After incubation with the anti-IAA antibody, wash the primary
antibody off the sections with PBS 1x in vertical glass boxes
three times for 5 min. Slides are briefly dried in paper towels
and moved from one solution to the next fresh one.
7. The samples are incubated with Alexa Fluor 488 goat anti-
mouse IgG1 (γ1) secondary antibody (1:100) in 1% BSA in
PBS in the humid chamber for 3 h at room temperature in
darkness. The secondary antibody dilution and incubation time
need to be adjusted for each of the C. canephora tissues. The
samples are washed with PBS in vertical glass boxes three times
for 10 min.
8. The specificity of primary and secondary antibodies is verified
using either negative or positive controls in the procedure. To
verify the binding specificity of the primary immunodepletion
assays, the anti-IAA antibody is incubated with 5 mg mL−1
standard IAA solution at a 1:2 (v/v) ratio at 4 °C overnight;
the pre-blocked antibody solution is used as the primary anti-
body for immunofluorescence, following the same protocol
and conditions described above.
9. If you want to stain cells, then pipette calcofluor solution on
each slide, and incubate for 10 min at room temperature. After
this, wash three more times with PBS, 10 min each.
3.5 Slide Before observations, slides are mounted and sealed.

Observation 1. Remove PBS and pipette-mounting solution on each slide. If
staining of the nucleus is desired, it can be applied mounting
medium (see Note 5).
2. Carefully place the coverslip over the specimen, and take care
to prevent air bubble formation. Finally, seal the coverslip with
nail polish.
3. Image the samples with a microscope (Fig. 2).
4 Notes
1. In auxin immunolocalization experiments, it is necessary that

the tissues be prefixed with a solution of EDAC. The EDAC
reagent cross-links the carboxyl group of free IAA to structural
proteins and preserves the antigenicity of the IAA toward the
anti-IAA monoclonal antibody (indoleacetic acid distribution
coincides with vascular differentiation pattern during
Arabidopsis leaf ontogeny).
Fig. 2 Immunolocalization of auxin in Coffea canephora tissues (a, b, c, d). Confocal images of transmitted
light. (a) Somatic embryo stage heart. The IAA is localized in the cells that will become the cotyledons (ct) and
in the cells of the protoderm (pr). (b) Apical meristem. IAA was distributed in leaf primordium (lp), axillary bud
primordium (abp), and shoot apical meristem (sam). (c) Stem. The IAA is mainly localized in the cytoplasm of
the cells of the xylem (xy) and phloem (ph); in the cells of the pith (pt), IAA is localized in the plasmalemma.
The procambium (pc) cells lacked a signal. (d) Transverse section of a root. The IAA is localized in the cyto-
plasm, plasmalemma, and nucleus of pericycle (pe), cortex (co), and epidermis (ep) cells, unlike protophloem
(pp), protoxylem (px), and lateral root cap (lrc) where a smaller signal is present
2. Embedded samples can be stored in a sealed container with a

drying material, such as silica gel, at room temperature for a
long period.
3. Due to their low cost, poly-L-lysine slides are the most used
for tissue adhesion in immunolocalization experiments.
Before the slides are coated with poly-L-lysine, they should
be cleaned and dried. The slides are then submerged in a
Coplin jar with 0.1% w/v poly-L-lysine solution. Before use,

allow the slides to dry.
4. Tissue sections are usually inspected after rehydration to be
sure that the Paraplast/wax is completely removed and that
the tissues have a well-preserved cell structure.
5. As mounting media, we use fluorescence anti-fade Vectashield
and Vectashield + DAPI. More recommended is to observe
the samples as soon as possible after assembly to avoid loss of
signal quality; however, they can be stored at 4 °C for few days
in the dark.
Acknowledgment

(CONACyT, 257436).
References
1. Rockwell NC, Su YS, Lagarias JC (2006) aspects and applications. Springer, Switzerland,
Phytochrome structure and signaling mecha- pp 171–181. https://doi.
nisms. Annu Rev Plant Biol 57:837–858. org/10.1007/978-3-319-33705-0_10
h t t p s : / / d o i . o r g / 1 0 . 1 1 4 6 / a n n u r e v. 9. Zazimalová E, Murphy AS, Yang H et al (2010)
arplant.56.032604.144208 Auxin transporters—why so many? Cold Spring
2. Paque S, Weijers D (2016) Auxin: the plant Harb Perspect Biol 2:a001552. https://doi.
molecule that influences almost anything. org/10.1101/cshperspect.a001552
BMC Biol 14:1–5. https://doi.org/10.1186/ 10. Okada K, Ueda J, Komaki MK et al (1991)
s12915-016-0291-0 Requirement of the auxin polar transport sys-
3. De-la-Peña C, Nic-Can G, Avilez-Montalvo JR tem in early stages of Arabidopsis floral bud
et al (2017) The role of miRNAs in auxin sig- formation. Plant Cell 3:677–684. https://doi.
naling and regulation during plant develop- org/10.1105/tpc.3.7.677
ment. In: Barciszewski J (ed) Plant epigenetics. 11. Adamowski M, Friml J (2015) PIN-dependent
Springer, Cham, pp 23–48. https://doi. auxin transport: action, regulation, and evolu-
org/10.1007/978-3-319-55520-1_2 tion. Plant Cell 27:20–32. https://doi.
4. Mironova V, Teale W, Shahriari M et al (2017) org/10.1105/tpc.114.134874
The systems biology of auxin in developing 12. Ayil-Gutiérrez BA, Galaz-Ávalos RM, Peña-
embryos. Trends Plant Sci 22:225–235. https:// Cabrera E et al (2013) Dynamics of the concen-
doi.org/10.1016/j.tplants.2016.11.010 tration of IAA and some of its conjugates during
5. Zazimalová E, Petrášek J, Benková E (2014) the induction of somatic embryogenesis in
Auxin and its role in plant development. Coffea canephora. Plant Signal Behav 8:e26998.
Springer, Wien Heidelberg New York https://doi.org/10.4161/psb.26998
Dordrecht London 13. Porfírio S, Gomes da Silva MDR, Peixe A et al
6. Ljung K (2013) Auxin metabolism and homeo- (2016) Current analytical methods for plant
stasis during plant development. Development auxin quantification—a review. Anal Chim
140:943–950. https://doi.org/10.1242/ Acta 902:8–21. https://doi.org/10.1016/j.
dev.086363 aca.2015.10.035
7. Went FW, Thiman KS (1937) Phytohormones. 14. Ulmasov T, Murfett J, Hagen G et al (1997)
McMillan Co., New York Aux/IAA proteins repress expression of
8. Nic-Can GI, Loyola-Vargas VM (2016) The reporter genes containing natural and highly
role of the auxins during somatic embryogen- active synthetic auxin response elements. Plant
esis. In: Loyola-Vargas VM, Ochoa-Alejo N Cell 9:1963–1971. https://doi.org/10.1105/
(eds) Somatic embryogenesis. Fundamental tpc.9.11.1963
15. Liao CY, Smet W, Brunoud G et al (2015) Physiol 56:1401–1417. https://doi.
Reporters for sensitive and quantitative mea- org/10.1093/pcp/pcv058
surement of auxin response. Nat Meth 12:207– 1 9. Nishimura T, Toyooka K, Sato M et al
210. https://doi.org/10.1038/nmeth.3279 (2011) Immunohistochemical obser vation
16. Petersson SV, Johansson AI, Kowalczyk M et al of indole-3 -
a cetic acid at the IAA syn-
(2009) An auxin gradient and maximum in the thetic maize coleoptile tips. Plant Signal
Arabidopsis root apex shown by high- Behav 6:2013–2022. https://doi.
resolution cell-specific analysis of IAA distribu- org/10.4161/psb.6.12.18080
tion and synthesis. Plant Cell 21:1659–1668. 20. Hakman I, Hallberg H, Palovaara J (2009)
https://doi.org/10.1105/tpc.109.066480 The polar auxin transport inhibitor NPA
17. Brunoud G, Wells DM, Oliva M et al (2012) A impairs embryo morphology and increases the
novel sensor to map auxin response and distri- expression of an auxin efflux facilitator protein
bution at high spatio-temporal resolution. PIN during Picea abies somatic embryo devel-
Nature 482:103–106. https://doi. opment. Tree Physiol 29:483–496. https://
org/10.1038/nature10791 doi.org/10.1093/treephys/tpn048
18. Rodríguez-Sanz H, Solís MT, López MF et al 21. Nic-Can GI, Hernández-Castellano S,
(2015) Auxin biosynthesis, accumulation, Kú-González A et al (2013) An efficient immu-
action and transport are involved in stress- nodetection method for histone modifications
induced microspore embryogenesis initiation in plants. Plant Meth 9:47. https://doi.
and progression in Brassica napus. Plant Cell org/10.1186/1746-4811-9-47
Chapter 12
Somatic Embryogenesis in Common Bean

Phaseolus vulgaris L.
José Luis Cabrera-Ponce, Itzel Anayetzi González-Gómez,
Claudia G. León-Ramírez, José A. Sánchez-Arreguín,
and Alba E. Jofre y Garfias
Abstract
Common bean Phaseolus vulgaris L. has been shown to be a recalcitrant plant to induce somatic embryo-
genesis (SE) under in vitro conditions. An alternative strategy to yield SE is based upon the use of a cyto-
kinin (benzyladenine) coupled with osmotic stress adaptation instead of the auxin-inducing SE in common
bean. Here we described the induction of proembryogenic masses (PEM) derived from the apical meri-
stem and cotyledonary zone of zygotic embryos, from which secondary SE indirect embryogenesis
emerged. Maturation of SE was achieved by using osmotic stress medium and converted to plants. Long-
term recurrent SE was demonstrated by propagation of PEM at early stages of SE. This protocol is cur-
rently being applied for stable genetic transformation by means of Agrobacterium tumefaciens and
biobalistics as well as basic biochemical and molecular biology research.
Key words Cytokinin, Osmotic stress, Phaseolus vulgaris, Plant regeneration, Somatic embryogenesis
1 Introduction
Common bean (Phaseolus vulgaris L.) is the most important food

legume for direct consumption in the world [1]. Common bean
improvement progress has been achieved mainly by plant breeding
and has succeeded in developing disease- and pest-resistant culti-
vars with improved symbiotic nitrogen fixation and architectural
traits. Although plant biotechnology offers different strategies to
overcome these difficulties, common bean is difficult to regenerate
in vitro; this characteristic has impeded the application of this tech-
nology for stable genetic transformation. Most of the strategies for
in vitro common bean plant regeneration have been based on
shoot development from explants containing meristems, through
direct and/or indirect organogenesis [2–7].
189
190 José Luis Cabrera-Ponce et al.
In addition, to the aforementioned approaches, transgenic

common bean has been also achieved by biobalistics through the
organogenesis pathway [8–12]. Altogether these protocols are not
suitable and reproducible. This becomes a challenging obstacle for
the generation and maintenance of totipotent tissues for long-term
propagation, as well as cloning of transformed cells due to the for-
mation of non-transgenic shoot (chimeric shoots) at the formation
stage in organogenesis [13–15]. Somatic embryogenesis (SE) is
the developmental reprogramming of somatic cells toward the
embryogenesis pathway, which is a notable illustration of cellular
totipotency. SE is a sexual-independent development process that
yields a bipolar embryo derived directly from somatic tissue
through a zygotic-embryogenesis resembling process [16]. SE is
able to give rise to the cellular totipotency in higher plants as well
has the advantage over organogenesis of true type regeneration
and normal seedling development and is able to begin from a sin-
gle cell [17] or small groups of cells [18]. However, up today
whether SE begins from a single cell is an open question to be
answered. Nonetheless, the potential application of SE for plant
genetic transformation would be increased with a subsequent low-
ering in the risk of generating transformed chimera tissues. As
somatic plant cells are derived from zygotic embryos, it is reason-
able to hypothesize that somatic cells would be able to carry out
SE. SE potential is related to a differential and specific gene expres-
sion; however, it is important to take note that SE is a multifacto-
rial process [19]. In common bean the induction of the complete
pathway of SE has not been possible with synthetic auxins [2].
Efforts to establish in vitro cultures and to regenerate plants by
means of SE in common bean using synthetic auxins have been
reported [20–24]. According to these reports, 2,4-D induced the
development of somatic embryo-like structures. Nevertheless,
these structures did not develop into SE when they were trans-
ferred to MS medium with or without 2,4-D. In other species of
Phaseolus, SE has been achieved from intact seedlings of P. coccin-
eus L, P. acutifolius A., P. aureus L., and P. wrightii L. using high
concentrations of cytokinins (10–17 mg L−1) in the induction
medium [25]. Another group described the regeneration of plants
via somatic embryogenesis in P. acutifolius and found that the
explant, culture medium, and illumination conditions were the key
factors [26]. It has been reported that thidiazuron (cytokinin) acts
as an inductor of SE in common bean; however, a clear proof of
ontogeny is needed to accept that the embryogenic pathway of
plant regeneration was induced in both publications [6, 27].
As a consequence, other factors must be considered to induce
SE in common bean, such as explant types, endo- and exogenous
plant growth regulators, nutritional components of culture
medium, light quality, and stress factors, such as heavy metal ions,
dehydration, explant wounding, high temperature, and high
osmotic pressure [28, 29]. Stress-induced SE has been reported in
Somatic Embryogenesis in Phaseolus vulgaris 191
carrot [30], cucumber [31], Arabidopsis [32], and carnation [33].

Osmotic stress (sucrose, mannitol, and NaCl, among others),
heavy metal ions (Cd2+, Fe2+, etc.), and heat shock stress were
applied in these models, and all they were correlated with the
upregulation of several stress-related genes, giving rise to the
hypothesis that SE could be induced by an adaptation process of
in vitro culture of plant cells subjected to different types of stress
[34]. Moreover, there is increasing evidence that has demonstrated
that cytokinins play an important role in the regulation of plant
adaptation to environmental stresses, such as drought and high
salinity involved in SE induction [19, 35, 36]. In 2015, we
described that it is possible to induce the complete morphogenetic
pathway of SE in common bean P. vulgaris. Common bean mani-
fests the totipotentiality of forming SE by using osmotic stress 12%
(0.5 M) sucrose together with a cytokinin (BA) and adenine free
base [37]. The adaptation to osmotic stress and SE induction
seems to be related to the cytokinin family, considered master reg-
ulators, influencing adaptation to environmental stresses and
involved in SE [37]. In this chapter we further analyzed the recent
findings about somatic embryogenesis in common bean.
2 Materials
2.1 Biological 1. Seventeen genotypes have been tested for SE: Negro Querétaro,
Materials Flor de Mayo Criollo, Flor de Mayo Bajío, Flor de Mayo Bajío
14–38, Flor de Durazno, Tenango Apaseo, Flor de Junio
Marcela, Flor de Junio Ana, Flor de Junio Estrella, Mayacoba,
Castellanos, wild-type common bean, Michigan Red, Pinto
Americano Texas, Negro Sinaloa, Azufrado Tapatío, and
BAT93.
2.2 Instrumentation 1. Airflow cabinet.

2. Stereomicroscope.
3. Forceps.
4. Bistoury.
5. Plastic petri dishes.
6. Incubator.
7. Light quality sensors: spectrophotometer and radiometer.
2.3 Reagents, Plant tissue culture medium is prepared following standard labora-
Solutions, and Culture tory procedures. Prepare all solutions using purified deionized
Media water and analytical grade reagents. Prepare and store all reagents
at room temperature (unless indicated otherwise).
2.3.1 Culture Media
1. Sterile distilled water (autoclaving at 1.1 kg cm−2 at 121 °C
during 20 min), 70% ethanol solutions, 5% Extran solution,
30% commercial bleach solution, 2% Plant Preservative

Mixture (PPM).
2. MS medium is based on Murashige and Skoog [38]. The vita-
mins, amino acids, and plant growth regulators are prepared in
independent stock solutions. Mix all ingredients needed for
each culture medium, and adjust the pH to 5.8 with 1.0 N
KOH. The medium is semi-solidified by the addition of 0.25%
(w/v) Gelrite® as a gelling agent and sterilized in an autoclave
at 1.1 Kg cm−2 at 121 °C for 20 min. Pour 40 mL of the
medium into Magenta boxes.
2.3.2 Somatic 1. MS medium. Murashige and Skoog (1962) [38] basal medium
Embryogenesis Induction (macro- and micronutrients and vitamins; see Note 1).
Medium (MIE Medium) 2. Cytokinin, 10 mg L−1 benzyladenine (BA).
3. Adenine-free base 40 mg L−1 (see Note 2).
4. Allantoin 5 mg L−1.
5. Glucose 6% (w/v).
6. Silver nitrate 10 mg L−1.
7. 2.5 g L−1 Gelrite®.
2.3.3 Embryogenic Calli 1. MS medium. Murashige and Skoog [38] basal medium
Maturation (ECM Medium) (macro- and micronutrients and vitamins; see Note 1).
2. BA 0.2 mg L−1.
3. Kinetin 0.1 mg L−1.
4. Gelrite® 7.0 g L−1.
5. Glucose 3%.
6. pH is adjusted to 5.8 with 1 N KOH and sterilized by auto-
claving at 121 °C and 1.05 kg cm−2 for 20 min.
2.3.4 Plant Elongation 1. MS medium. Murashige and Skoog [38] basal medium
Medium (macro- and micronutrients and vitamins; see Note 1).
2. Activated charcoal 3 g L−1.
3 Methods
3.1 Seeds Surface 1. Seeds of Negro Queretaro are treated as follows: immersions
Sterilization in 70% ethanol (v/v) for 10 min and 20% (v/v) sodium
hypochlorite prepared with a commercial bleach (1.2% active
chlorine final), for 30 minutes.
2. Wash the treated seeds five to six times with sterile distilled
water.
3. Seeds are soaked in sterile distilled water for 24 h at 27 °C.
3.2 Mature Zygotic 1. Soaked seeds are dissected with the aid of a stereoscope as fol-
Embryo Dissection lows: cotyledons are removed and the complete embryonic
(Explant axis is separated.
for Embryogenic Calli 2. The plumule and radicle are dissected from the embryonic axis
Induction) using a sharp dissecting scalpel up to the insertion point of the
embryo to the cotyledons (Fig. 1).
3. 4-mm-long fragments of the embryo axis, corresponding to
the cotyledonary node plus the apical dome, are used as
explants (Fig. 1).
4. Explants are cultured on MIE induction medium before
osmotic treatment.
3.3 Osmotic Stress 1. Dissected embryo axis is cultured under osmotic stress and
and Cytokinin (BA) cytokinin-containing medium (MIE induction medium with
Treatment to Induce 12% sucrose) for 3 days and incubated under a 16/8 h photo-
Somatic period at 50 μmol m−2 s−1, provided by day/light fluorescent
Embryogenesis lamps, at 27 °C (Fig. 2; see Note 3).
2. Avoid mechanic damage of embryo axis explants; apical zone
tends to be separated easily. If lost, proembryogenic masses
will not be induced from this area. Use small forceps to manip-
ulate the explants.
3.4 Induction 1. After osmotic treatment, the explants are subcultured on MIE
of Embryogenic Calli medium and incubated under a 16/8 h photoperiod at
50 μmol m−2 s−1, provided by day/light fluorescent lamps at 27 °C.
2. Explants will become necrosed in a few days if osmotic treat-
ment was applied properly.
3. After 3 weeks of culture, only small groups of cells will survive
from the apical meristem and cotyledonary node (Fig. 2; see
Note 4).
4. Somatic embryos are produced from those structures after
1 month in culture, and they differentiate and further produce
proembryogenic masses (PEM) in MIE medium (MS medium
supplemented with BA 10 mg L−1, adenine free base 40 mg L−1,
allantoin 5 mg L−1, silver nitrate 10 mg L−1), under light con-
ditions (Fig. 3) (see Notes 5–10).
5. Efficiency of embryogenic calli induction ranges from 65% in
Negro Queretaro to 10% in BAT93. It will depend on the
quality of seeds.
6. Explants under non-osmotic stress produce shoots from the
apical meristem and cotyledonary node, resembling direct
organogenesis in MIE medium after 3 weeks of culture under
light conditions (Fig. 4).
Fig. 1 Explant of mature zygotic embryos (without radicle and plumules) used for
the induction of somatic embryogenesis of common bean P. vulgaris. AM, apical
meristem; CZ, cotyledonary zone; and ZE zygotic embryo (indicated by arrows).
Scale bar = 1.5 mm
Fig. 2 Explants subjected to osmotic stress. Necrosis of zygotic embryos occurred

after 3 weeks of culture on MIE medium (NZE indicated by arrow). Scale
bar = 1.5 mm
3.5 Propagation 1. It is achieved in the embryogenic induction medium (MIE

of Embryogenic Calli medium) and under light conditions (Fig. 5), while in dark the
embryogenic capability disappears (see Notes 11–15).
2. Growth rate of embryogenic calli cultured in light shows linear
growth behavior while in the dark decreases at the fourth week.
3. Embryogenic calli cultured without adenine also show a
decrease in the growth rate at the fourth week of subculture,
either in the light or in darkness (see Notes 10 and 11).
4. Glucose is also very important, since the use of sucrose (3%) or
maltose (3%) did not maintain the embryogenic capacity of
these structures (see Note 12).
Fig. 3 Proembryogenic masses (PEM indicated by arrow), derived from the coty-
ledonary zone (CZ indicated by arrow), after 1 month of culture on MIE medium
under light conditions. Scale bar = 1 mm
Fig. 4 Shoot development (SH indicated by arrow) derived from the apical meri-
stem (AM indicated by arrow) from untreated explant to osmotic stress. Scale
bar = 0.8 mm
5. Multiple somatic embryos are formed from each PEM in dif-

ferent stages of development after 4 weeks of subculture
(Fig. 6) (see Note 8).
6. Histological and scanning electronic microscopy analysis from
early stages, globular, heart, torpedo, and cotyledonary stages
(mature embryo) reveal the ontogeny of SE of common bean
P. vulgaris L. cv. Negro Querétaro [37].
7. To keep PEM producing secondary SE, an osmotic treatment
has to be applied on MIE medium + sucrose 12% or PEG 8000
4% for 3 days and then subcultured to normal MIE medium
every 2 months (see Notes 13–15).
8. At this point PEM containing SE of common bean can be used
for genetic transformation by Agrobacterium tumefaciens and
biobalistics [39].
9. Cultures of PEM containing SE of common bean in synthetic
auxin-containing medium (2,4-D and dicamba) produce fria-
ble, fast-growing calli resembling those structures described
previously [20–24] (Fig. 7).
10. Suspensor-like structures are produced in a large number
within friable calli. Suspensor of Phaseolus coccineus has been
a classic model system for investigating suspensor function
[40]. Friable embryogenic calli of common bean have the
potential to investigate early stages of somatic embryo
development.
11. Morphological plasticity of these structures is demonstrated
when transferred to a cytokinin-containing medium (MIE).
They became compact and produce PEM structures, and SE
are formed in 1 month of culture (Fig. 8).
Fig. 5 Maintenance of proembryogenic masses (PEM indicated by arrow) on MIE

medium and incubated under light conditions. Scale bar = 5 mm
Fig. 6 Proembryogenic mass (PEM indicated by arrow) with somatic embryos at

different stages of development after 2 months of propagation on MIE medium.
Scale bar = 2 mm
3.6 Plant 1. Successful germination and conversion to plants from a SE are

Regeneration a consequence of its physiological maturity.
2. In our experiments with SE of common bean, most of the
strategies for germination of SE (induced by synthetic auxins)
failed when applied to common bean embryogenic calli.
3. An alternative is to manipulate the water availability of the growth
environment using physical means of control, such as separating
the SE from the growth medium or introducing a gelling agent in
larger than normal quantities (see Notes 16–19).
4. Proembryogenic masses (PEM) containing SE are cultured in
embryogenic calli maturation (ECM) medium: MS medium
supplemented with glucose 3%, BA 0.2 mg L−1, kinetin
0.1 mg L−1, and gellified with 7 g L−1 Gelrite®.
5. Rooting of PEM containing SE occurs after 1 month of cul-
ture (Fig. 7). Individual SE germinates within embryogenic
calli, and they are subsequently transferred to the plant elonga-
tion medium: MS medium supplemented with glucose 1% and
activated charcoal 3 g L−1 to produce complete plants (Figs. 9
and 10) (see Notes 20 and 21).
6. Illumination is a very important factor. Daylight fluorescent
lamps are mixed with one incandescent bulb 60 W (their light
color is almost identical to the sun spectrum).
7. Rooting of PEM containing SE occurs after 1 month of cul-
ture (Fig. 7). Within embryogenic calli, individual SE germi-
nates and produces complete plants (Figs. 9 and 10) (see Notes
20 and 21).
Fig. 7 Friable, fast-growing embryogenic-like calli derived from proembryogenic

masses (PEM) cultured on dicamba (synthetic auxin)-containing medium
(2 mg L−1) after 1 month. Scale bar = 7 mm
Fig. 8 Embryo-like structures (SE indicated by arrow) with suspensor (S indi-

cated by arrow) derived from dicamba-containing medium. Scale bar = 2 mm
Fig. 9 Rooting (R indicated by arrow) of embryogenic calli on embryogenic calli

maturation (ECM medium) after 4 weeks of culture. Scale bar = 2 mm
Fig. 10 Germinating somatic embryo (GSE indicated by arrow) on embryogenic

calli maturation (ECM medium) after 4 weeks of culture. Scale bar = 1 mm
8. Efficiency of conversion to plants is still low (10%); therefore,

more detailed information about the maturation stage of SE is
further needed.
9. A link between embryo maturation and conversion to plants
and light was observed in this work, since plant regeneration
was achieved only when a full spectrum of light was applied.
10. Plants are transferred to a greenhouse to complete their life
cycle and for seed set formation (Figs. 11 and 12).
Fig. 11 Plant regeneration derived from somatic embryo germination cultured on

plant elongation medium. Scale bar = 3 mm
Fig. 12 Regenerated plants in greenhouse conditions
4 Notes
1. pH is adjusted to 5.8 with 1 N KOH and sterilized by

autoclaving at 121 °C and 1.05 kg cm−2 for 20 min.
2. Adenine is added after sterilization, and media are poured in
9-cm-diameter petri dishes; the final pH of medium containing
adenine free base varied from 6.9 to 7.4, since adenine free
base is dissolved with 1 N KOH.
3. Seeds 1-year-old or less produce higher amount of embryo-
genic calli than the older ones. Compact and turgent zygotic
embryos will survive better than old zygotic embryos to stress
conditions.
4. The application of osmotic stress with sucrose 12% (0.5 M)
supplemented with BA and adenine under light conditions is a
key factor to induce SE in common bean P. vulgaris [37].
5. Developed embryogenic calli are product of an enhanced
metabolism and adaptation mechanisms that otherwise will
never be present in common tissue culture strategies. Similar
results in other plant species were reported in carrot, cucum-
ber, Arabidopsis, and carnation [30–33]; in all cases, direct SE
occurs from a specific type of cells (apical meristems and imma-
ture petals).
6. Only competent cells can survive under stress conditions, and
it seems that the ability for in vitro cultures to generate SE is
limited to a group of cells or discrete zones of the embryogenic
calli [41].
7. The use of a cytokinin (BA) and a purine (adenine), precursor
of cytokinins, clearly influences the embryogenic calli develop-
ment in common bean. Members of the cytokinin family are
considered to be master regulators, strongly influencing
adaptation to environmental stresses [35, 36], and are involved
in SE [19], as it is shown in this work.
8. The mechanism is initiated by binding of a cytokinin to histi-
dine kinase receptors and culminates with the transcription of
cytokinin-responsive genes in the nucleus. Type B response
regulators (ARR) encode transcription factors that act as major
players in the transcriptional activation-responsive genes [42];
the participation of other non-ethylene receptor HKs in stress
perception has also been identified [43, 44].
9. Auxin and cytokinin are required for cell differentiation and
specification during embryogenesis [45]. In early stages of
embryogenesis, auxin antagonizes cytokinin signaling through
the direct transcriptional activation of Arabidopsis response reg-
ulator 7 (ARR7) and ARR15, which are feedback repressors
of cytokinin signaling in the basal cell [45–47]. Overexpression
of these genes disturbs RAM (root apical meristem) initiation
and somatic embryo induction [48]. Cytokinin response sig-
nals are detected in specific regions that are correlated with
induced WOX5 expression and subsequent somatic embryo
formation [48].
10. It is known that thidiazuron (TDZ) (synthetic cytokinin)
induces accumulation of purines, either as cytokinins or as a
source of metabolic energy. Assessment of TDZ-treated plants
indicates a sequential increase in the endogenous levels of ATP,

ADP, and AMP; the energy charge ratio is also higher in TDZ-
treated plants indicating an increase in ATP-utilizing system
[49] and is essential for SE induction in pelargonium and in
the legume peanut (Arachis hypogaea L.) [49, 50].
11. In this protocol, long-term embryogenic cultures maintain
their embryogenic characteristics for at least 3 years (or lon-
ger); it depends on the induction medium (MIE medium). In
2001 it was reported that exogenously supplied adenine and
adenosine were easily salvaged and utilized for ATP and nucleic
acid synthesis during all stages of somatic embryo develop-
ment of white spruce [51].
12. Similar results are obtained in Phaseolus coccineus [52].
13. Monthly subcultures to fresh medium plates and selecting pro-
embryogenic masses (PEM) with a few SE at globular or ear-
lier stage tend to prolongate the quality of each PEM unit.
14. Subcultures on MIE medium with sucrose 12% or PEG-8000
4% increased the quality of PEM units, since degenerated tis-
sues die and SE recover their normal phenotype, as it has been
published for date-palm malformed embryos [53].
15. We noticed that, when mechanical damage is done in the sepa-
ration of PEM units, at the time of subculture, either with
forceps or scalpel, more degenerated PEM is produced.
16. In developing zygotic embryos of common bean from the cot-
yledonary stage to the maturation stage in the embryo devel-
opment, water and osmotic potentials are lower (most negative)
in the embryonic axis as compared to the cotyledon, seed coat,
or pod [54].
17. SE are known to be stimulated to develop and mature in cul-
ture if environmental stresses such as heat, nutrient depletion,
and solute-based water stress are imposed or when increased
levels of abscisic acid (ABA) are added exogenously or induced
endogenously.
18. An improved protocol that consists in rescuing immature
(heart-shaped) zygotic embryos 8 days after pollination of
common bean using Phillips salts and 25 mg L−1 ABA increases
the number of growing plants [55].
19. Due to the fact that SE develop without the surrounding nutri-
tive tissues, research has focused on comparing the types and
quantities of storage reserves (lipids, proteins, amino acids,
monosaccharides, and polysaccharides) produced in SE with
those (average levels) in zygotic seeds of the same species.
Exogenous applications of ABA and solutes such as polyethyl-
ene glycol (PEG) have been proposed as useful in enhancing
the levels of storage reserves in plant cells and in particular in
SE [56–58].
20. Light induces phototropism, photomorphogenesis, chloro-

plast differentiation, and various other responses such as flow-
ering and seed germination when blue and red/far-red
wavelength spectra are present.
21. Specific wavelength is sensed by the presence of different light
receptors: phytochromes (red and far red), cryptochromes
(blue, green and UV-A), and phototropins (blue). Also light
and cytokinins regulate many processes; the interaction
between ARR4 and phyB is a mechanism for light and cytoki-
nin signal integration [35].
Acknowledgment
This work was supported in part by SAGARPA (Grant 2003-199).

We thank Miss Sandra Chavez-León for her excellent technical
assistance and Dra. Rosa Maria Rangel-Cano for the critical review
of the manuscript.
References
1. Food and Agricultural Organization of the adenine sulphate. Electron J Biotechnol 13:a06.
United Nations (FAO) (1999) PHASEOLUS https://doi.org/10.4067/S0717-34582010
BEAN: Post-harvest Operations. Organisation: 000100006
Centro Internacional de Agricultura tropical 6. Kwapata K, Sabzikar R, Stcklen MB, Kelly JD
(CIAT) www.cgiar.org/ciat. Author: AL. Jones. (2010) In vitro regeneration and morphogen-
Edited by AGSI/FAO: Danilo Mejia esis studies in common bean. Plant Cell Tissue
(Technical), Beverly Lewis (Language and style) Organ Cult 100:97–105. https://doi.org/
2. Veltcheva M, Svetleva D, Petkova SP, Perl A 10.1007/s11240-009-9624-9
(2005) In vitro regeneration and genetic trans- 7. Collado R, Veitía N, Bermúdez-Caraballoso I
formation of common bean (Phaseolus vulgaris et al (2013) Efficient in vitro plant regeneration
L.)-problems and progress. Sci Hort 107:2–10. via indirect organogenesis for different com-
https://doi.org/10.1016/j.scienta.2005.07. mon bean cultivars. Sci Hort 153:109–116.
005 https://doi.org/10.1016/j.scienta.2013.
3. Delgado-Sánchez P, Saucedo-Ruiz M, 02.007
Guzmán-Maldonado SH et al (2006) An 8. Russell DR, Wallace KM, Bathe JH et al (1993)
organogenic plant regeneration system for Stable transformation of Phaseolus vulgaris via
common bean (Phaseolus vulgaris L.). Plant Sci electric-discharge mediated particle accelera-
170:822–827. https://doi.org/10.1016/j. tion. Plant Cell Rep 12:165–169. https://doi.
plantsci.2005.11.015 org/10.1007/BF00239099
4. Arellano J, Fuentes SI, Castillo-España P, 9. Aragao FJL, Barros LMG, Brasileiro ACM et al
Hernández G (2009) Regeneration of different (1996) Inheritance of foreign genes in trans-
cultivars of common bean (Phaseolus vulgaris genic bean (Phaseolus vulgaris L.) co-trans-
L.) via indirect organogenesis. Plant Cell Tiss formed via particle bombardment. Theor
Org 96:11–18. https://doi.org/10.1007/ Appl Genet 93:142–150. https://doi.org/
s11240-008-9454-1 10.1007/BF00225739
5. Gatica-Arias AM, Muñoz-Valverde J, Ramírez-
10. Aragao FJL, Ribeiro SG, Barros LMG et al
Fonseca P, Valdez-Melara M (2010) In vitro plant (1998) Transgenic beans (Phaseolus vulgaris L.)
regeneration system for common bean (Phaseolus engineered to express viral antisense RNAs show
vulgaris): effect of N6-benzylaminopurine and
delayed and attenuated symptoms to bean golden 22. Saunders JW, Hosfield GL, Levi A
mosaic geminivirus. Mol Breed 4:491–499. (1987) Morphogenetic effects of
https://doi.org/10.1023/A:1009613607559 2,4-dichlorophenoxyacetic acid on pinto bean
11. Kim JW, Minamikawa T (1996) Transformation (Phaseolus vulgaris L.) leaf explants in vitro.
and regeneration of French bean plants by the Plant Cell Rep 6:46–49. https://doi.
particle bombardment process. Plant Sci org/10.1007/BF00269737
117:131–138. https://doi.org/10.1016/0168- 23. Hoyos RA (1990) Somatic embryogenesis in
9452(96)04403-2 common bean (Phaseolus vulgaris L.): influ-
12. Bonfim K, Faria JC, Nogueira EOPL, Mendes ence of media and environmental factors on
EA, Aragao FJL (2007) RNAi-mediated resis- globular and mature embryoid formation.
tance to bean golden mosaic virus in genetically Department of Crop and Soil Science. Michigan
engineered common bean (Phaseolus vulgaris). State University, USA
Mol Plant Microbe In 20:717–726. https:// 24. Collado R, Garcia LR, Angenon G et al (2011)
doi.org/10.1094/MPMI-20-6-0717 Somatic embryos formation from immature
13. Christou P (1990) Morphological description cotyledons in Phaseolus vulgaris cv. CIAP 7247.
of transgenic soybean chimeras created by the Biotechnol Veg 11:235–240
delivery, integration and expression of foreign 25. Malik KA, Saxena PK (1992) Somatic embryo-
DNA using electric discharge particle accelera- genesis and shoot regeneration from intact
tion. Ann Bot 66:379–386. https://doi. seedlings of Phaseolus acutifolius A., P. aureus
org/10.1093/oxfordjournals.aob.a088039 (L.) Wilczek, P. coccineus, and P. wrightii
14. Krastanova S, Perrin M, Barbier P et al (1995) L. Plant Cell Rep 11:163–168. https://doi.
Transformation of grapevine rootstocks with the org/10.1007/BF00232172
coat protein gene of grapevine fanleaf n
epovirus. 26. Garcia LR, Pérez J, Kosky RG et al (2010)
Plant Cell Rep 13:357–360. https://doi. Regeneración de plantas via embriogénesis
org/10.1007/BF00231936 somática en Phaseolus acutifolius A. Gray.
15. Xiang YZ, Ying HS, Zhi JC, Xian SZ (2008) Biotechnol Veg 10:143–149
Cell fate switch during in vitro plant organo- 27. Nafie EM, Taha HS, Mansur RM (2013)
genesis. J Integ Plant Biol 50:816–824. Impact of 24-epibrassinolide on callogenesis
https://doi.org/10.1111/j.1744-7909.2008. and regeneration via somatic embryogenesis in
00701.x Phaseolus vulgaris L. cv Brunca. World Appl Sci
16. Steward FC, Mapes MO, Smith J (1958) J 24:188–200. https://doi.org/10.5829/
Growth and organized development of cul- idosi.wasj.2013.24.02.13191
tured cells. I. Growth and division of freely sus- 28. Fehér A, Pasternak TP, Dudits D (2003)
pended cells. Am J Bot 45:693–703 Transition of somatic plant cells to an embryo-
17. Haccius B (1978) Question of unicellular ori- genic state. Plant Cell Tiss Org 74:201–228.
gin of non-zygotic embryos in callus cultures. https://doi.org/10.1023/A:1024033216561
Phytomorphology 28:74–81 29. Karami O, Saidi A (2010) The molecular basis
18. Raghavan V (1976) Adventive embryogenesis: for stress-induced acquisition of somatic
induction of diploid embryoids. In: Sutchliffe embryogenesis. Mol Biol Rep 37:2493–2507.
JF (ed) Experimental embryogenesis in vascular https://doi.org/10.1007/s11033-009-
plants. Academic Press, London, pp 349–381 9764-3
19. Xu Z, Zhang C, Zhang X et al (2013) 30. Kamada H, Ishikawa K, Saga H, Harada H
Transcriptome profiling reveals auxin and cyto- (1993) Induction of somatic embryogenesis
kinin regulating somatic embryogenesis in dif- in carrot by osmotic stress. Plant Tiss Cult
ferent sister lines of cotton cultivar CCR124. Lett 10:38–44. https://doi.org/10.5511/
J Integr Plant Biol 55:631–642. https://doi. plantbiotechnology1984.10.38
org/10.1111/jipb.12073 31. Lou H, Kako S (1995) Role of high sugar con-
20. Allavena A, Rossetti L (1983) Efforts in centrations in inducing somatic embryogenesis
somatic embryogenesis of Phaseolus vulgaris from cucumber cotyledons. Sci Hort 64:11–
L. Acta Hort 131:239–246. https://doi. 20. https://doi.org/10.1016/0304-4238
org/10.17660/ActaHortic.1983.131.27 (95)00833-8
21. Martins IS, Sondahl MR (1984) Early stages of 32. Ikeda-Iwai M, Umehara M, Satoh S, Kamada
somatic embryo differentiation from callus cells H (2003) Stress-induced somatic embryogen-
of bean (Phaseolus vulgaris L.) grown in liquid esis in vegetative tissues of Arabidopsis thali-
medium. J Plant Physiol 117:97–103. https:// ana. Plant J 34:107–114. https://doi.
doi.org/10.1016/S0176-1617(84)80021-8 org/10.1046/j.1365-313X.2003.01702.x
33. Karami O, Deljou A, Esna-Ashari M, Ostad- acid, drought, and salt stress in Arabidopsis.
Ahmadi P (2006) Effect of sucrose concentra- Proc Natl Acad Sci U S A 104:20623–20628.
tions on somatic embryogenesis in carnation https://doi.org/10.1073/pnas.0706547105
(Dianthus caryophillus L.). Sci Hort 110:340– 44. Jeon J, Kim YN, Kim S et al (2010) A subset of
344. https://doi.org/10.1016/j. cytokinins two-component signaling system
scienta.2006.07.029 plays a role in cold temperature stress
34. Dudits D., J. Györgyey, L. Bögre y L. Bakó, response in Arabidopsis. J Biol Chem
(1995) Molecular biology of somatic embryo- 285:23371–23386
genesis. In: Thorpe TA (ed) In vitro embryo- 45. Müller B, Sheen J (2008) Cytokinin and auxin
genesis in plants, Kluwer Academic Publishers, interaction in root stem-cell specification dur-
Dordrecht, pp 267–308. doi: https://doi. ing early embryogenesis. Nature 453:1094–
org/10.1007/978-94-011-0485-2_8 1097. https://doi.org/10.1038/nature06943
35. Werner T, Schmülling T (2009) Cytokinin 46. Hwang I, Sheen J (2001) Two-component cir-
action in plant development. Curr Opin Plant cuitry in Arabidopsis cytokinin signal transduc-
Biol 12:527–538. https://doi.org/10.1016/j. tion. Nature 413:383–389. https://doi.
pbi.2009.07.002 org/10.1038/35096500
36. Ha S, Vankova R, Yamaguchi-Shinozaki K et al 47. Buechel S, Eibfried A, To JP et al (2010) Role
(2012) Cytokinins: metabolism and function in of A-type ARABIDOPSIS RESPONSE
plant adaptation to environmental stresses. REGULATORS in meristem maintenance and
Trends Plant Sci 17:172–179. https://doi. regeneration. Eur J Cell Biol 89:279–284.
org/10.1016/j.tplants.2011.12.005 https://doi.org/10.1016/j.ejcb.2009.11.016
37. Cabrera-Ponce JL, Lopez L, León-Ramírez CG 48. Su YH, Li YB, Bai B, Zhang XS (2015)
et al (2015) Stress induced acquisition of Establishment of embryonic shoot-root axis in
somatic embryogenesis in common bean auxin and cytokinin response during
Phaseolus vulgaris L. Protoplasma 252:559– Arabidopsis somatic embryogenesis. Front
570. https://doi.org/10.1007/s00709-014- Plant Sci 5:792. https://doi.org/10.3389/
0702-4 fpls.2014.00792
38. Murashige T, Skoog F (1962) A revised 49. Murch SJ, KrishnaRaj S, Saxena PK (1997)
medium for rapid growth and bioassays with Thidiazuron-induced morphogenesis of regal
tobacco tissue culture. Physiol Plant 15:473– geranium (Pelargonium domesticum): a poten-
497. https://doi.org/10.1111/j.1399-3054. tial stress response. Physiol Plant 101:183–191.
1962.tb08052.x https://doi.org/10.1111/j.1399-3054.1997.
39. Barraza A, Cabrera-Ponce JL, Gamboa-Becerra tb01835.x
R et al (2015) The Phaseolus vulgaris PvTRX1h 50. Victor JMR, Murthy BNS, Murch SJ et al
gene regulates plant hormone biosynthesis in (1999) Role of endogenous purine metabolism
embryogenic callus from common bean. Front in thidiazuron induced somatic embryogenesis
Plant Sci 6:577. https://doi.org/10.3389/ of peanut (Arachis hypogea L.). Plant Growth
fpls.2015.00577 Regul 28:41–47. https://doi.
40. Kawashima T, Goldberg RB (2009) The sus- org/10.1023/A:1006251531319
pensor: not just pending the embryo. Trends 51. Ashihara H, Stasolla C, Loukanina N, Thorpe
Plant Sci 15:23–30. https://doi.org/10.1016/ T (2001) Purine metabolism during white
j.tplants.2009.11.002 spruce somatic embryo development: salvage
41. Quiroz-Figueroa F, Rojas-Herrera R, Galaz- of adenine, adenosine and inosine. Plant Sci
Avalos R, Loyola-Vargas V (2006) Embryo 160:647–657. https://doi.org/10.1016/
production through somatic embryogenesis can S0168-9452(00)00441-6
be used to study cell differentiation in plants. 52. Genga A, Allavena A (1991) Factors affecting
Plant Cell Tiss Org 86:285–301. https://doi. morphogenesis from immature cotyledon of
org/10.1007/s11240-006-9139-6 Phaseolus coccineus L. Plant Cell Tiss Org
42. Urao T, Yakubov B, Satoh R et al (1999) A 27:189–196. https://doi.org/10.1007/
transmembrane hybrid-type histidine kinase in BF00041289
Arabidopsis functions as an osmosensor. 53. El Dawayati MM, Abd El Bar OH, Zaid ZE,
Plant Cell 11:1743–1754. https://doi.org/ Zein El Din AFM (2012) In vitro morpho-
10.1105/tpc.11.9.1743 histological studies of newly developed
43. Tran LSP, Urao T, Qin F et al (2007) Functional embryos from abnormal malformed embryos
analysis of AHK1/ATHK1 and cytokinin of date palms cv. Gundila under dessication
receptor histidine kinases in response to abscisic effect of polyethelyne glycol treatments. Ann
Agric Sci 57:117–128. https://doi. partial drying at high relative humidity. Can
org/10.1016/j.aoas.2012.08.005 J Bot 68:1086–1090. https://doi.org/
54. Yeung EC, Brown DCW (1982) The osmotic 10.1139/b90-136
environment of developing embryos of 57. Attree SM, Moore D, Sawhney VK, Fowke LC
Phaseolus vulgaris. Z Pflanzenphysiol 106:149– (1991) Enhanced maturation and desiccation
156. https://doi.org/10.1016/S0044-328X tolerance of white spruce (Picea glauca
(82)80077-9 (Moench) Voss) somatic embryos: effects of a
55. Geerts P, Mergeai G, Baudoin JP (1999) non-plasmolysing water stress and abscisic acid.
Rescue of early-shaped embryos and plant Ann Bot 68:519–525. https://doi.
regeneration of Phaseolus polyanthus Greenm. org/10.1093/oxfordjournals.aob.a088291
And Phaseolus vulgaris L. Biotechnol Agron 58. Flinn BR, Roberts DR, Taylor IEP (1991)
Soc Environ 3:141–148 Evaluation of somatic embryos on interior
56. Roberts DR, Sutton BCS, Flinn BS (1990) spruce. Characterization and developmental
Synchronous and high frequency germination regulation of storage proteins. Physiol Plant
of interior spruce somatic embryos following 82:624–632. https://doi.org/10.1111/j.
1399-3054.1991.tb02956.x
Chapter 13
Induction of Somatic Embryogenesis in Jatropha curcas

Rosa M. Galaz-Ávalos, Heydi G. Martínez-Sánchez,
Abstract
Jatropha curcas has been a promising crop for biofuel production for the last decade. However, the lack of
resistant materials to diseases and improved quality of the oil produced by the seeds has restricted the use
of this promising crop. The genetic modifications in the fatty acid pathway, as well as the introduction of
resistance to different diseases, would change the fate of Jatropha. To achieve these goals, we need to have
a very efficient regeneration system. Here, we report a very useful protocol to induce somatic embryogen-
esis from leaves of Jatropha using cytokinin as the only growth regulator.
Key words Auxins, Cytokinins, Jatropha curcas, Somatic embryogenesis
1 Introduction
Plant tissue culture is an alternative technique for the commercial

propagation of a large number of plant species. Between different
techniques of propagation, the somatic embryogenesis (SE) is the
process more frequently used. SE is the process by which somatic
cells change their genetic program to generate embryogenic cells
able to produce viable somatic embryos [1]. It is known that
growth regulators, mainly auxins, play an important role during
the induction of SE [2]. This growth regulator alone, or in combi-
nation with cytokinins, influences the maturation of somatic
embryos [3]. In some cases, cytokinins alone are able to induce the
SE [4]. However, in most of the cases, it is necessary to adjust the
concentration of growth regulators present in the culture medium,
case by case, to induce the SE process.
Jatropha curcas, also known as the green gold of the desert, is
a drought-resistant shrub belonging to the Euphorbiaceae family.
It produces seeds with a high content of non-edible oil (20–35%)
that can become biodiesel [5, 6]. Jatropha is a small tree or a large
shrub that can reach a height of up to 5 m and has been identified
as a potential source of sustainable biodiesel production [7]. Its
207
208 Rosa M. Galaz-Ávalos et al.
cultivation is simple, and it can grow in terrain ranging from waste/

marginal lands to poor or salty soils with sand, gravel, or stone.
Mexico and continental Central America are the origin and
diversity center for J. curcas [8–11]. J. curcas is cultivated world-
wide including Central and South Africa, India, and the Pacific
regions of Asia.
J. curcas has a considerable potential for biodiesel production.
Traditionally Jatropha is propagated by cuttings, and regarding
agricultural and economic benefits, the full potential of the plant is
far from done. To fulfill this potential, it requires the uses of all the
techniques on hand to provide the elite raw material for biodiesel
production. Biotechnological techniques have the potential to
introduce the desirable traits in Jatropha that are necessary to real-
ize its full potential as a biofuel source [12].
Between biotechnological tools, plant tissue culture, in par-
ticular somatic embryogenesis, is widely used to introduce new
quality characters and resistance to diseases and select elite perfor-
mance plants from the field.
2 Materials
2.1 Biological 1. Jatropha curcas seeds.

Materials
2.2 Glassware 1. Baby food jars.

2. Sterile Petri dishes (15 × 100 mm).
3. Beakers (1000 and 2000 mL).
4. Volumetric flasks.
2.3 Other Materials 1. Forceps.

2. Dissecting forceps and scalpel.
3. Sterile cotton.
4. Aluminum foil.
5. Magenta plastic boxes.
6. Cling film.
2.4 Instrumentation 1. Laminar flow cabinet.

2. Dry hot sterilizer.
3. Stereo microscope.
4. Tissue culture incubators.
5. Autoclave.
6. pH meter.
7. Analytical balance.
Somatic Embryogenesis in Jatropha curcas 209
8. Stirrer with hot plate.

9. Adjustable micropipettes.
10. Rotary shaker.
2.5 Reagents, 1. Sterile distilled water.

Solutions, 2. Ethanol solution.
and Culture Media
3. Extran solution.
4. Detergent solution.
5. Commercial bleach solution (Cloralex).
6. Plant Preservative Mixture (PPM) solution.
independent stock solutions.
8. Plant growth regulators: naphthaleneacetic acid (NAA), kine-
tin (K), and benzyladenine (BA).
9. KOH.
10. HCl.
11. Sucrose.
12. Gelling agent: Gelrite.
Prepare all solutions using purified deionized water and ana-
1. Sterile distilled water (autoclaving at 1.1 kg cm−2 at 121 °C
during 20 min), 70% ethanol solutions, 5% Extran solution,
30% commercial bleach solution, 2% Plant Preservative Mixture
(PPM).
independent stock solutions. Mix all ingredients needed for
each culture medium and adjust the pH to 5.8 with 1.0 N
KOH. The medium is semisolidified by the addition of 0.25%
(w/v) Gelrite as a gelling agent and sterilizes in an autoclave at
1.1 Kg cm−2 at 121 °C during 20 min. Pour 40 mL of the
medium into Magenta boxes.
3 Methods
3.1 Surface 1. The seeds are washed with a detergent solution, rinsed with
Sterilized Seeds water, and air-dried. Next, the coat is removed by manual
of Jatropha curcas manipulation.
2. The seeds were surface sterilized into a laminar flow cabinet:
(1) wash it with 5% Extran solution for 5 min. (2) Rinse with
70% ethanol solution for 3 min, (3) submerge in 30% commer-

cial bleach solution for 15 min, and rinse three times in sterile
distilled water between each step. After this, the seeds are sur-
face sterilized by immersion in 2% PPM for 8 h (see Note 1).
3. Using scalpel and forceps, the zygotic embryos are dissected
out from the seeds and inoculated onto development medium.
The development medium comprised MS basal salts, 3%
sucrose, and 0.25% (w/v) gelling agent (Gelrite) before auto-
claving. The pH of the media was adjusted to 5.8 before add-
ing gelling agent and autoclaved at 1.1 Kg cm−2 at 121 °C for
20 min. (Table 1; first column).
Table 1
The composition of Mediums–MS Medium: inorganic and organic salts, vitamins, and others
supplements
Media
Component DMa PHMb EIMc MMd RMe
Macro salts [mg L−1 (mM)]
NH4NO3 1650 (20.61) 1650 (20.61) 412 (5.15) 1650 (20.61) 825 (10.30)
KNO3 1900 (18.79) 1900 (18.79) 475 (4.7) 1900 (18.79) 950 (9.4)
CaCl2·2H2O 440 (2.99) 440 (2.99) 110 (0.748) 440 (2.99) 220 (1.5)
KH2PO4 170 (1.249) 170 (1.249) 85 (1.249) 170 (1.249) 85 (0.625)
MgSO4·7H2O 370 (1.500) 370 (1.500) 92.5 (0.375) 370 (1.500) 185(0.750)
Micro salts [mg L−1 (μM)]

Kl 0.830 (5) 0.830 (5) 0.830 (5) 0.415 (2.5)
CoCl2·6H2O 0.025 (5) 0.025 (0.1) 0.025 (0.1) 0.012 (0.05)
Na2MO4·2H2O 0.250 (1) 0.250 (1) 0.125 (0.5) 0.250 (1) 0.125 (0.5)
H3BO3 6.2 (100.27) 6.2 (100.27) 3.1 (50) 6.2 (100.27) 3.1 (50.13)
MnSO4·7H2O 22.3 (80.5) 22.300 (80.5) 6.83 (40) 22.3 (80.5) 11.15 (40.25)
CuSO4·5H2O 0.025 (0.1) 0.025 (0.1) 0.05 (0.2) 0.025 (0.1) 0.012(0.05)
ZnSO4·7H2O 8.100 (28) 8.100 (28) 4.3 (15) 8.1 (28) 4.05 (14)
FeSO4·7H2O 27.950 (100) 27.950 (100) 21 (75.53) 27.95 (100) 13.97 (50)
NA2EDTA 37.230 (100) 37.230 (100) 27.9 (74.95) 37.23 (100) 18.615 (50)
Vitamins [mg L (μM)]
−1
Piridoxine –HCl 2 (9.72) 1 (4.86) 2 (9.72) 0.0005

Nicotinic acid 2 (16.24) 1 (8.12) 2 (16.24) 0.0005
(continued)
Table 1
(continued)
Media
Component DMa PHMb EIMc MMd RMe
Thiamine–HCl 4 (11.85) 10 (29.6) 10 (29.6) 4 (11.85) 1.0 (2.9)
Myo-inositol 100 (500) 100 (550) 100 (550) 100 (550) 100 (550)
Ámino acids [mg L (μM)]
−1
Cisteine 25 (158) 25 (158) 25 (158) 25 (158) 25 (158)

Sugars [g L−1 (μM)]
Sucrose 30 (87.64) 30 (87.64) 40 (116.85)
Growth regulator [mg L (μM)]
−1
Naphthalenacetic 0.1 (0.54)

acid
Indolacetic acid 1.0 (5.7)
6-Bencyladenine 1.12 (5.0) 2.0 (8.7)
Kinetine 0.5 (2.32)
Gelling agent 0.25% 0.25% 0.25% 0.25%
(w/v)
The pH of the media are adjusted to 5.8 before autoclaving (15 psi at 121 °C for 20 min)
DM developmental medium, PHM preconditioning hydroponic medium, EIM embryogenesis induction
medium, MM maduration medium, RM rooting medium
a
DM (Murashige, 1962 142 /id)
b
PHM (Quiroz-Figueroa, 2006 25818 /id)
c
EIM (Yasuda, 1985 17604 /id)
d
MM (Mta-Sánchez et al in preparation)
e
RM (Kalimuthu, 2007 2572 /id)
4. Every zygotic embryo is placed in a Magenta plastic box con-

taining 40 mL of medium and incubated at 25 ± 2 °C and
50–60% relative humidity (RH) under 16/8 h (light/dark)
photoperiod in a growth chamber (Fig. 1a). The Magenta
boxes are sealed with strips of cling film. The subculture on
fresh medium is every 30 d (see Note 2).
3.2 Somatic 1. When the plantlet has developed, the cotyledonary and first
Embryogenesis pairs of leaves (Fig. 1c), they are transferred to a precondition-
ing hydroponic medium (PHM) containing 0.54 μM NAA
and 2.33 μM K (Fig. 2a) for 2 weeks (see Note 3).
Fig. 1 Development of zygotic embryos. (a) Zygotic embryos after 3 days of culture. (b) Seedlings after 15 days
with cotyledonary leaves. (c) Plant after 30 days of culture with cotyledonary and first pairs of leaves. (d) Plant
after 60 days of culture
2. The foliar explants (ca. 1 cm2) are placed on direct embryogen-

esis induction medium (EIM) containing 5 μM BA (Fig. 2b) in
a glass bottle (see Note 4). Aluminum sheets are used as tap and
sealed with cling film strip; those bottles are incubated under
dark conditions at 25 ± 2 °C in growth chamber for 82 days,
(Fig. 2c). After, the somatic embryos are changed to photope-
riod condition on a medium containing 8.87 μM BA (see
Table 1. Fourth column) to 135 days (Fig. 2d).
3. For root initiation, the embryos are transferred to the rooting
medium containing 5.7 μM IAA (see Table 1. Fifth column; see
Note 5).
4. Subculturing is made periodically at 30 days interval in devel-
opment medium (Table 1. First column).
Fig. 2 Somatic embryogenesis of Jatropha curcas. (a) Plant in pre-conditioning hydroponic medium (PHM). (b)
Leaf disc explant on embryogenesis induction medium (EIM). (c) Somatic embryos of all stages after 92 days
in dark condition. (d) Somatic embryos of all stages in photoperiod condition. (e) Somatic embryos at different
stages of development. (f) Germination of somatic embryos on development medium (DM)
4 Notes
1. In laminar flow cabinet, the beans are imbibed by immersion in

2% PPM (Plant Preservative Mixture) for 8 h. Microbial con-
tamination is the single most important reason for explant loss
in plant tissue culture. PPM is a broad-spectrum preservative
and biocide for use in plant tissue culture [14].
2. Each Magenta box has a thread in the border that serves as a
filter for gasses interchange.
3. Explants from the first to third pairs of expanding leaves exhibit
a higher response than those from the fourth leaf, suggesting
that the developmental stage of the plant is crucial to deter-
mine its responses to SE induction.
4. The leaf disc position of explant into the EIM is critical for the
correct response of the explant. The adaxial face has to have
direct contact with the medium.
5. After 4 weeks, somatic embryos develop their radicular
system.
Acknowledgment

(CONACYT, 1515).
References
1. Loyola-Vargas VM, Ochoa-Alejo N (2016) breeding and propagation programme. Report
Somatic embryogenesis. An overview. In: 158. Plant Research International,
Loyola-Vargas VM, Ochoa-Alejo N (eds) Wageningen, Netherlands
Somatic embryogenesis. Fundamental aspects 8. Heller J (1996) Phy. Jatropha curcas L. pro-
and applications. Springer, Switzerland, moting the conservation and use of underuti-
pp 1–10. https://doi.org/10.1007/978- lized and neglected crops. Institute of Plant
3-319-33705-0_1 Genetics and Crop Plant Research/
2. Nic-Can GI, Loyola-Vargas VM (2016) The International Plant Genetic Resources
role of the auxins during somatic embryogen- Institute, Gatersleben/Rome, Italy
esis. In: Loyola-Vargas VM, Ochoa-Alejo N 9. Sujatha M, Reddy TP, Mahasi MJ (2008) Role
(eds) Somatic embryogenesis. Fundamental of biotechnological interventions in the
aspects and applications. Springer, Switzerland, improvement of castor (Ricinus communis L.)
pp 171–181. https://doi.org/10.1007/978-3- and Jatropha curcas L. Biotechnol Adv 26:424–
319-33705-0_10 435. https://doi.org/10.1016/j.biotechadv.
3. Swamy NR, Ugandhar T, Praveen M et al 2008.05.004
(2005) Somatic embryogenesis and plantlet 10. Achten WM, Nielsen LR, Aerts R et al (2010)
regeneration from cotyledon and leaf explants Towards domestication of Jatropha curcas.
of Solanum surattense. Ind J Biotecnol Biofuels 1:91–107. https://doi.org/10.4155/
4:414–418 BFS.09.4
4. Quiroz-Figueroa FR, Monforte-González M, 11. Sunil N, Kumar V, Varaprasad K (2013) Origin,
Galaz-Ávalos RM et al (2006) Direct somatic domestication, distribution and diversity of
embryogenesis in Coffea canephora. In: Jatropha curcas L. In: Bahadur B, Sujatha M,
Loyola-Vargas VM, Vázquez-Flota FA (eds) Carels N (eds) Jatropha, challenges for a new
Plant cell culture protocols. Humana Press, energy crop, Genetic improvement and bio-
Totowa, New Jersey, pp 111–117. https:// technology, vol 2. Springer, New York,
doi.org/10.1385/1-59259-959-1:111 pp 137–151. https://doi.org/10.1007/978-1-
5. de Oliveira JS, Leite PM, de Souza LB et al 4614-4915-7_9
(2009) Characteristics and composition of 12. Galaz-Ávalos RM, Avilez-Montalvo RN,
Jatropha gossypiifolia and Jatropha curcas L. Ucan-Uc CM et al (2012) Jatropha curcas una
oils and application for biodiesel production. alternativa para la obtención de biodiésel sin
Biomass Bioenergy 33:449–453. https://doi. afectar el sector alimentario. Biotecnología
org/10.1016/j.biombioe.2008.08.006 16:92–112
6. Barros TFS, Arriel NHC, Queiroz MF et al 13. Murashige T, Skoog F (1962) A revised medium
(2015) Fatty acid profiles of species of Jatropha for rapid growth and bioassays with tobacco tis-
curcas L., Jatropha mollissima (Pohl) Baill. And sue cultures. Physiol Plant 15:473–497.
Jatropha gossypiifolia L. Ind Crop Prod https://doi.org/10.1111/j.1399-3054.1962.
73:106–108. https://doi.org/10.1016/j. tb08052.x
indcrop.2015.04.003 14. George MW, Tripepi RR (2001) Plant preserva-
7. Jongschaap REE, Corré WJ, Bindraban PS tive mixture can affect shoot regeneration from
et al (2007) Claims and facts on Jatropha cur- leaf explants of chrysanthemum, European birch,
cas L.: global Jatropha curcas evaluation, and rhododendron. Hort Science 36:768–769
Chapter 14
In Vitro Proliferation of Female Buds for Induction

of Somatic Embryogenesis from False Horn Plantain
(AAB, cv. Curraré)
Rosa Maria Escobedo-Gracia-Medrano, Carlos Iván Cruz-Cárdenas,
Lucila Aurelia Sánchez-Cach, José Roberto Ku-Cauich,
and Wilma Aracely González-Kantún
Abstract
Most cultivated bananas (Musa spp.) are polyploids, and their fruits are seedless and propagated exclusively
vegetatively; however, they can also be cloned by micropropagation techniques, viz., direct organogenesis
(DO) or somatic embryogenesis (SE). Banana indirect SE (ISE), with an embryogenic callus phase, is pos-
sible using young male or female flowers as direct explant depending on the genotype or shoot tips (scalps).
For the False Horn Plantain, cv. Curraré (AAB, plantain subgroup), which has a degenerating male bud,
female flowers are used to regenerate plants through ISE. Here, a protocol for increasing the number of
initial explant material from a single mother plant and its embryogenic response is described. For those
purposes, hands with young female buds are in vitro proliferated in the presence of 1 μM indole-3-acetic
acid and 2.5 μM thidiazuron. Friable embryogenic cultures, here called ISE-2, obtained from the new
proliferative secondary female bud clusters are initiated on medium containing auxins. Embryogenic sus-
pensions are then established from the ISE-2 cultures. Regeneration of plants is achieved from embryo-
genic suspensions after plating on semisolid medium free of plant growth regulators; greenhouse
acclimatized plantlets are ready for banana farming. This study demonstrates that proliferative female buds
are a proper choice for ISE.
Key words Clonal propagation, In vitro, Musa spp., Plantain, Plant growth regulator
1 Introduction
The genus Musa comprises around 75 wild seminiferous species

and many edible bananas. Present-day cultivated varieties are
mainly triploid that evolved from the two wild diploid species,
Musa acuminata Colla (donor of A genome) and Musa balbisiana
Colla (donor of B genome); the edible clones are classified into
genome groups according to the contribution of their parental
species. Triploids (2n = 3× = 33 chromosomes), dessert bananas
(AAA and AAB), cooking and beer East African bananas (AAA),
215
216 Rosa Maria Escobedo-Gracia-Medrano et al.
cooking bananas (ABB), and plantains (AAB) are the most eco-
nomically important cultivated banana types [1].
The triploid bananas are almost sterile and develop fruit by
parthenocarpy. The banana plants are asexually propagated. Thus,
for the establishment of plantations, two kinds of planting material
are utilized, viz., conventional and from in vitro tissue culture [2].
Traditional material usually comprises sword suckers so-called
seedlings (two per plant). However, suckers are often infected with
some pathogens and nematodes, and due to variation in the size
and age of the suckers, the crop may not be uniform, and field
management becomes difficult. Consequently, in vitro regenerated
plants obtained through direct organogenesis (DO) or somatic
embryogenesis (SE) are highly recommended for the planting of
banana and plantain materials in the tropics, since they are disease
free, showed consistent growth, and enhanced yielding [3–5].
Somatic embryogenesis is a biological process in which, under
suitable conditions, embryogenic cells are generated from somatic
cells, and subsequently, through a series of biochemical and mor-
phological changes, perfectly organized embryos are attained [6].
SE is a useful tool for banana clonal propagation and conservation
of germplasm, as well as an excellent system for the regeneration of
plants subjected to genetic engineering [5, 7].
In Musa spp., different tissues are used as explants to induce
embryogenic cultures. These include immature zygotic embryos
[8–10], basal leaf sheaths, and rhizome tissue [11], directly from
male [9, 12–15] and female flowers [16] or indirectly after the
proliferation of shoot tip meristems (scalps) [17] and male buds
(curds) [18]. In addition to secondary embryogenesis [19], direct
SE from protoplasts of banana has been reported [20].
The proliferation of initial explants such as shoot meristems
(scalps) [21], and male flowers (curds) [18], is a method for
increasing the number of explants for initiation of SE used for the
clonal propagation of a single or few elite plants.
The protocol herein describes the regeneration of False Horn
Plantain (AAB, cv. Curraré) plants through indirect somatic
embryogenesis here called ISE-2, using proliferated secondary
female flower clusters as initial explant for embryogenic callus
formation.
2 Materials
2.1 Biological False Horn Plantain (AAB, cv. Curraré) plants were grown in the
Materials same type of soil (Cambisol, CMX) at the banana collection in the
Uxmal Experimental Site of the Instituto Nacional de Investigaciones
Forestales Agrícolas y Pecuarias (INIFAP) Yucatán, México (20°
24′ 27.72” Lat. N, and 89° 45′ 06.66″ Long. W, elevation 44.0 m
above sea level) and tropical wet dry climate (AW0).
Plantain Somatic Embryogenesis 217
2.2 Reagents Prepare all the stock solutions, plant grow regulators (PGR), and
2.2.1 Stock Solutions tissue culture media with distilled and deionized water (ddH2O).
All PGR are prepared at 1 mg mL−1 solution (molar concentra-
tion), TDZ (4.54 μM), IAA (5.70 μM), and 2,4-D (4.52 μM).
Dissolve the quantity in a small volume of 1 M of KOH and ddH2O
to the desired volume. Store the concentrated solutions and PGR
at 4 °C. Vitamins of Murashige and Skoog (1962) (MS) [22] and
Morel and Wetmore (1951) (MW) [23] (Tables 2 and 3) are pre-
pared with ddH2O and filter sterilized (0.2 μm) and store pro-
tected from light at 4 °C.
2.2.2 Sterilization Media is autoclaved for 20 min at 121 °C, 15 lb. of pressure, and
of Media after cooled the sterile culture media are stored at 25 ± 2 °C in the
dark.
2.2.3 Culture Media 1. Medium FPM (female flower proliferation medium)

The FPM medium (Table 1) (Table 1 is cited after Tables
2 and 3; it is advisable to reorder them to follow a logic cita-
tion in the text) is composed of the mineral salts and vitamin
mixture of MS (Tables 2 and 3) supplemented with 87 mM
sucrose and added with 1.0 μM indole-3-acetic acid (IAA) and
2.5 μM thidiazuron (TDZ). TDZ was filter sterilized (0.2 μm)
and added to autoclaved (described above) medium cooled to
50 °C before disposing 25 mL in sterile baby glass containers
and covered with plastic caps.
2. Medium MA 1 (callogenesis induction medium)
The MA1 medium (Table 1) is composed of basal salts and
vitamins from MS (Tables 2 and 3), added with 4.1 μM of
biotin, 18.1 μM of 2,4-D, 5.7 μM of IAA, 5.4 μM of NAA,
87 mM sucrose, 0.2% Gelrite, and pH 5.7 [12]. In a beaker
dissolved in 850 mL ddH2O, all the culture medium compo-
nents except for the gelling agent (Gelrite), adjust the pH to
5.7 with 1 N KOH/HCl 1 N and dilute to the mark of 1 L,
add the Gelrite, and mix. Dispense 25 mL of culture medium
in 100 mL capacity baby jar glass containers, cover with plastic
caps, and sterilize and store as described above.
3. Medium M1/30 (callus proliferation medium)
The M1/30 medium (Table 1) is composed of half macro-
elements and complete microelements from MS (Table 2) and
vitamins of MW (Table 4), supplemented with 4.52 μM of
2,4-D, 87 mM sucrose, 0.2% Gelrite, and pH 5.7. The medium
is dissolved, pH adjusted, Gelrite added, dispensed, auto-
claved, and stored as described above.
4. Medium M2 (cell suspension medium)
The M2 medium (Table 1) is composed of basal salts and
vitamins of MS, added with 4.1 μM of biotin, 4.52 μM of 2,4-
Table 1
Composition of culture media for indirect somatic embryogenesis (ISE-2) of False Horn Plantain
(AAB, cv. Curraré)
Culture media
Components FPM MA1 M1/30 M2 MM GM G2M

Macroelements MS MS 1/2 MS MS MS MS
MS
Microelements MS MS MS MS MS MS MS
Vitamins MS MS MW MS MW MS MS
KH2PO4 (mM) 1.25 1.25 1.25 1.25
Biotin (μM) 4.1 4.1
PGR
2,4-D (μM) 18 4.52 4.52
IAA (μM) 1 5.71
NAA (μM) 5.4
TDZ (μM) a
2.5
Supplements
Malt extract 100
(mg L−1)
Glutamine (μM) 684
Sucrose (mM) 87.6 87.6 87.6 87.6 131.4 87.6 87.6
Gelrite (g L−1) 2 2 2 2 3 2
Filter paper no. 1 √
(Whatman)
pH 5.8 5.7 5.7 5.3 5.8 5.8 5.8
Culture conditions
Light/dark (h) 0/24 0/24 0/24 0/24 0/24 16/8 16/8
Temperature (°C) 25 ± 2 °C 27 ± 2 °C
Subculture (days) 15–30 90 30 7 90 30 30
Time in culture Subculture 90 days 150 90 days on a 90 days
(days) twice every without days rotary without
15 days; then subculture or > shaker at subculture
every 30 days 100 rpm
for 90 d
MS Murashige and Skoog [22], MW Morel and Wetmore [23], FPM female flower proliferation medium, MA1 embryo-
genic callus induction medium, M1/30 callus proliferation medium, M2 cell suspension medium, DMM embryo
development-maturation medium, GM embryo germination medium, and G2M plantlet growth medium
a
TDZ is filter (0.2 μm) sterilized, autoclave medium, and add the PGR after cooling the medium to 50 °C
Table 2
Salt components of Murashige and Skoog medium [22]
Concentration
Macroelements mg L−1 Molarity (mM)
MgSO4·7H2O 370 1.5
KH2PO4 170 1.25
KNO3 1900 18.8
NH4NO3 1650 20.6
CaCl2·2H2O 440 2.99
Microelements mg L −1
Molarity (μM)
H3BO3 6.2 100.3
MnSO4·H2O 16.9 100.0
ZnSO4·7H2O 8.6 29.9
Na2MoO4·H2O 0.25 1.03
CuSO4·5H2O 0.025 0.10
KI 0.83 5.0
FeSO4·7H2O 27.8 100.0
Na2 EDTA 37.3 100.2
Table 3
Murashige and Skoog [22] vitamins (100×)
Components Concentration (mg L−1) Molar concentration (μM)

Myoinositol 100.0 555.06
Nicotinic acid 0.5 4.06
Pyridoxine-HCl 0.5 2.43
Thiamine-HCl 0.1 0.296
Glycine 2.0 26.64
D, 648 μM glutamine, 100 mg L−1 malt extract, and 87 mM

sucrose, and the pH adjusted to 5.3. In a beaker dissolve all the
culture medium components in 850 mL ddH2O, adjust the
pH to 5.3 with 1 N KOH/HCl 1 N, and dilute to 1 L. Dispense
200 mL of the culture medium in 500 mL capacity glass con-
tainers, sterilize, and store as described above.
Table 4
Morel and Wetmore [23] vitamins (100×)
Components Concentration (mg L−1) Molar concentration (μM)

Myoinositol 100.0 555.06
Nicotinic acid 1.0 8.12
Pyridoxine-HCl 1.0 4.86
Thiamine-HCl 1.0 2.96
Calcium pantothenate 1.0 4.18
Biotin 0.01 0.0409
5. Medium MM (embryo development-maturation medium)

The MM semisolid medium (Table 1) is composed of basal
salts of MS, the vitamins of MW, and added with 1.25 mM
KH2PO4, 0.2% Gelrite, and pH 5.8. In a beaker mix all the
stock components of the culture medium in 850 mL ddH2O
except for Gelrite, and adjust the pH to 5.8 with 1 N KOH/
HCl 1 N; later adjust the final volume to 1 L and add the
Gelrite. Dispense the medium in 250 mL aliquots in 500 mL
flasks autoclaved as described above. After autoclaving, the
medium is cooled to 50 °C, distribute 25 mL volumes of
medium in sterile empty 100 × 15 mm Petri dishes, then wait
for the medium to polymerized, cover the dishes and seal them
with plastic wrap (Egapack), and store in the dark until use.
6. Medium GM (embryo germination medium)
The GM semisolid medium (Table 1) contains the salts
and vitamins of MS, added with 1.2491 mM KH2PO4, 87 mM
sucrose, 0.3% Gelrite, and pH 5.8. The medium is prepared as
describe above, and then dispense 25 mL aliquots into culture
flasks of 100 mL capacity and sterilize by autoclaving as
described above. Store in the dark until use.
7. Medium G2M (plant growth and root development)
The G2M medium is the same as GM except that 0.2%
Gelrite is used. Aliquots of 50 mL medium are dispensed in
375 mL Magenta boxes and sterilized as describe above; after
polymerizing the media are stored in the dark until use.
2.2.4 Nursery Plant After in vitro germination and growth, the regenerated plants are
Acclimatization established in nursery bags of 13 × 14 cm, filled with black soil: sun-
in the Glasshouse shine 3: 1 (v/v) and irrigated with ¼ Hoagland solution. The nurs-
ery bags are covered with cellophane bags and kept under this
condition for 3 days. Afterward, the tips of the cellophane bags are
cut to reduce the inside humidity and to allow greater gas exchange
between the plant and the glasshouse environment; the plants are
left for 5 days in this condition, and then the cellophane bag
removed. The plants are watered every third day, and after they have
around five expanded leaves, the plants are transplanted to the field.
3 Methods
3.1 Isolation 1. Young female buds are harvested from healthy plants, as
and Disinfection described by Grapin et al. [16]. Briefly, healthy plants of nearly
of Young Female Buds 7 months of age (22–25 leaves) are selected. The pseudostem
is cut at the base and the upperpart to 1 m high and then is
opened lengthways and leaves removed until reaching a swol-
len part, indicative of the presence of differentiated female
flowers. Extract the female buds.
2. Selected buds of nearly 10 cm are surface disinfected with 70%
v/v ethanol.
3. Then bracts are removed under aseptic conditions, and hands
of female flowers (3–5 mm) are extracted and used as explant
for female bud proliferation (Fig. 1a).
3.2 Culture The protocol established here is based on a modification to the

Conditions previously reported protocol for male flowers [18].
3.2.1 Proliferation
1. Hands of young female flowers 3–5 mm (Fig. 1a) used as
of Secondary Female Bud
explant are placed on semisolid flower proliferation medium,
Clusters (FPM Medium)
FPM, added with 1.0 μM indole-3-acetic acid (IAA) and
2.5 μM thidiazuron (TDZ) and cultured in the dark (Table 1).
2. During the first month, the medium is changed twice every 15
days and then every 30 days for 90 days. Cultures are main-
tained as described (Table 1).
3. Secondary proliferated female bud clusters of ~3 mm, called
“curds” by Pérez-Hernandez and Rosell-Garcia [18], are first
seen after the second subculture, and by the third subculture,
the cluster is bursting of curds (Fig. 1b, insert).
3.2.2 Induction 1. Curd of ~3 mm (Fig. 1b, insert) used as explant is placed on

of Embryogenic Callus semisolid MA1 medium (Table 1).
(MA1 Medium) 2. They are maintained on the same medium without refresh-
ment in the dark for approximately 2.5 months, time when
isolated somatic embryos and some embryogenic callus are
first recognized (Fig. 1c). At this point the embryogenic callus
is transferred to proliferation medium as described below.
Fig. 1 Plant regeneration of False Horn Plantain (AAB, cv. Curraré) via indirect somatic embryogenesis. (a)
Primary explant, hand with young female flowers, used to induce the proliferation of buds in the presence of
TDZ and IAA on female flower proliferation medium (FPM). (b) Secondary proliferated clumps (“curds”) of
female buds after the fourth subculture from excised hands on the same medium. Insert shows a 3-mm curd.
(c) Embryogenic response of curds after 3 months on MA1 medium, showing formation of single embryos*. (d)
Embryogenic callus derived from curds after 4 months in culture on MA1. (e) Embryogenic cell suspension in
M2 culture medium. (f) Embryo development-maturation in MM medium. (g) In vitro derived plant from a
somatic embryo (embling) 25 d after germination. (h) Development of emblings in the nursery. (i) Regenerated
plants of cv. Curraré derived from somatic embryogenesis in the vegetative growth phase
3.2.3 Proliferation 1. Embryogenic cultures are proliferated on semisolid M1/30

of Embryogenic Callus medium for 3 months with monthly refreshment of the
(M1/30 Medium) medium and callus division (Fig. 1d; Table 1).
2. Proliferation on the same medium can be continued with
medium refreshment each month, up to almost 1½ years or
more (Fig. 1d). Conditions as described (Table 1).
3.2.4 Embryogenic Cell 1. To initiate the embryogenic cell suspension (ECS) cultures,
Suspension Cultures (M2 approximately five portions of embryogenic callus (1–2 cm3)
Medium) are placed into 25 mL of M2 liquid medium in 125 ml
Erlenmeyer flasks (Table 1).
2. During the first 30 days, the medium is changed every 7 days.
Subsequently, two thirds of the medium volume is weekly
renewed.
3. After the first month in culture, proliferated ECS cultures
(Fig. 1e) are transferred and maintained in 250 mL Erlenmeyer
flasks containing 50 mL of M2 medium. For subculturing,
approximately a density of 3% cell suspension (~1.5 mL of
settled cell volume/50 mL medium) is maintained in each

flask. Containers are placed on a rotary shaker at 100 rpm, in
the dark.
3.2.5 Somatic Embryo 1. The ECS culture is sieved through a mesh 200; the filtered
Development-Maturation cells are collected in a Falcon tube and allowed to settle for
(MM Medium) 20 min; the packed cell volume (PCV) is adjusted to 3% (v/v)
with M2 medium.
2. After 3 weeks of subculture by refreshing two thirds of M2
media weekly, the ECS is ready to induce the embryo
development-maturation. The ECS should show under the
microscope a two-cell, four-cell proembryos and globular
embryos, along with embryogenic cell clusters.
3. To prepare the ECS to be plated on MM medium, the ECS is
washed three times with 20 mL of fresh M2 medium without
PGR. This is done by letting the embryogenic cells to settle in
a 50-mL Falcon tube and media exchange. In the last step, the
packed cell volume (PCV) is adjusted to 3% (v/v). All steps are
done under sterile conditions in a laminar flow hood.
4. The 3% adjusted ECS with M2 medium without PGR is used
to carry out the plating and dispersing homogeneously 250 μL
of the ECS over a filter paper (Whatman #1), which is placed
on semisolid MM medium (Table 1) or over a semisolid MM
medium with 0.3% Gelrite. Mature somatic embryos are gen-
erated under both conditions, although the former is preferred
to avoid much clumping of the developing embryos in the cen-
ter of the plate (Fig. 1f).
5. The inoculated Petri dishes are stored in darkness for
80–90 days at 25 ± 2 °C.
3.2.6 Embryo 1. For germination of matured embryos (~90 d), coleoptile

Germination (GM Medium) stage-selected embryos (five embryos per flask) are transferred
to GM (Table 1) and kept for a week in the dark at 25 ± 2 °C.
2. By the second week, cultures are incubated under photoperiod
conditions (16 h light/8 h dark) at 25 ± 2 °C.
3. Evidence of plumule and radicle emergence, as a marker for
germination, and greening of the somatic embryos are detected
after about 2 weeks of culture. The percentage of germination
is then estimated by counting the number of germinated
embryos divided by the total number of initially inoculated
embryos in the GM medium. A rate of ~90% somatic embryo
germination is obtained for False Horn Plantain cv. Curraré
with this protocol.
3.2.7 Plant Growth 1. For plant growth and root development, the small plantlets
and Root from the germinated embryos are individualized into culture
Development (G2M) flasks with rooting medium (G2M).
2. The whole root is removed before transference to the fresh
medium, and cultures are kept under photoperiod (16 h
light/8 h dark) at 25 ± 2 °C.
3.2.8 Adaptation 1. After in vitro germination and growth (Fig. 1g), the containers
of Plantlets Rooted with rooted regenerated plants (emblings) are covered with
in Nursery Bags cellophane bags and are transferred to the greenhouse (Fig. 1h,
arrow in the lower right corner) and left there for 3 days.
Afterward, the tips of the cellophane bags are cut to reduce the
inside humidity and to allow greater gas exchange between the
plant and the glasshouse environment; the plants are left for 7
days in this condition.
2. After 10 days in the greenhouse, the emblings are removed
from the containers with cellophane bags, and the roots are
washed with tap water to remove the gelling gum before trans-
fer to nursery bags.
3. Plantlets are transferred to nursery bags of 13 × 14 cm
(Fig. 1h), filled with black soil: sunshine 3:1 (v/v) (Fig. 1h).
Plants are watered with ¼ Hoagland solution every 3 days.
The solution is prepared by dissolving Hoagland’s No. 2 basal
salt mixture in H2O.
4. After 3 weeks, foliar fertilizer (NutriGrow) is applied to bagged
plantlets twice per week. The fertilizer contains N (20%): P
(30%): K (10%), Fe (0.15%), Zn (0.15%), Ca (0.006%), S
(0.84%), and Mn (0.03%). The fertilizer is prepared by dissolv-
ing 3 g of the powder per liter of water.
5. When the plants reach around 30 cm and they have more than
five expanded leaves, they are transferred to the field under a
shaded area for 2 weeks and foliar fertilized.
6. Afterward regenerated and acclimatized plants are transplanted
to the field soil, with a survival rate of 100% (Fig. 1i).
4 Conclusions
The protocol reported herein allows the regeneration of False

Horn Plantain (cv Curraré) plants. Accordingly, secondary prolif-
erated female flower clumps (curds) are suitable explants for initia-
tion of ISE-2. Furthermore, the embryogenic culture response
using proliferative female buds is approximately 18 times higher
(52%) than the most responsive genotype of the two Curraré culti-
vars (1.9–2.9%) reported by Grapin et al. [16], using female flow-
ers directly as explants. The percentage of germination of 90 days
matured somatic embryos and plant conversion is 90% and 100%,

respectively. Moreover, all regenerated plants develop a good root-
ing system and are well adapted in nursery bags; they also grow
healthy and survive under field conditions. They are currently
under phenotype and genotype assessment.
Acknowledgments
The authors would like to express their gratitude to the govern-

ment of México through FORDECYT-CONACYT (Consejo
Nacional de Ciencia y Tecnología) Research Project #116886 and
a CONACYT-studentship No. 50323 (CICC).
References
1. Ortiz R (1997) Morphological variation in N (eds) Somatic embryogenesis: fundamental

Musa germplasm. Genet Resour Crop Evol aspects and applications. Springer International
44:393–404. https://doi. Publishing, Cham, pp 381–400. https://doi.
org/10.1023/a:1008606411971 org/10.1007/978-3-319-33705-0_21
2. Robinson JC, Galán SV (2010) Banana and 8. Escalant JV, Teisson C (1989) Somatic embryo-
plantains. In: Robinson JC, Galán SV (eds) genesis and plants from immature zygotic
Crop production science in horticulture series, embryos of the species Musa acuminata and
vol vol 19, 2nd edn. CABI International, Musa balbisiana. Plant Cell Rep 7:665–668.
Cambridge, MA, pp 125–138. https://doi. https://doi.org/10.1007/bf00272056
org/10.1079/9781845936587.0000 9. Navarro C, Escobedo RM, Mayo A (1997) In
3. Njuguana J, Nguthi S, Wambugu F, Gitau D, vitro plant regeneration from embryogenic cul-
Karuoya M (2011) Enhancing banana crop tures of a diploid and a triploid, Cavendish
management by use of tissue-cultured derived banana. Plant Cell Tiss Org 51:17–25. https://
planting material in Kenya. Acta Hort doi.org/10.1023/a:1005965030075
897:459–463. https://doi.org/10.17660/ 10. Maldonado-Borges JI, Ku-Cauich JR, Escobedo-
ActaHortic.2011.897.62 GraciaMedrano RM (2013) Annotation of dif-
4. Ortiz R, Swennen R (2014) From crossbreed- ferentially expressed genes in the somatic
ing to biotechnology-facilitated improvement embryogenesis of Musa and their location in the
of banana and plantain. Biotechnol Adv banana genome. Sci World J 2013:535737.
32:158–169. https://doi.org/10.1016/j. https://doi.org/10.1155/2013/535737
biotechadv.2013.09.010 11. Novak FJ, Afza R, Van Duren M et al (1989)
5. Khalid N, Tan BC (2016) A to Z on banana Somatic embryogenesis and plant regeneration
micropropagation and field practices. In: Anis in suspension cultures of dessert (AA and AAA)
M, Ahmad N (eds) Plant tissue culture: propa- and cooking (ABB) bananas (Musa spp.). Nat
gation, conservation and crop improvement. Biotech 7:154–159. https://doi.
Springer, Singapore, pp 101–118. https://doi. org/10.1038/nbt0289-154
org/10.1007/978-981-10-1917-3_6 12. Ma SS (1991) Somatic embryogenesis and
6. Quiroz-Figueroa F, Rojas-Herrera R, Galáz- plant regeneration from cell suspension culture
Avalos R, Loyola-Vargas V (2006) Embryo of banana. In: Proceedings of symposium on
production through somatic embryogenesis can tissue culture of horticultural crops, Taipei,
be used to study cell differentiation in plants. Taiwan, 8–9 March 1988. pp. 181–188
Plant Cell Tiss Org 86:285–301. https://doi. 13. Escalant J-V, Teisson C, Cote F (1994)
org/10.1007/s11240-006-9139-6 Amplified somatic embryogenesis from male
7. Escobedo-GraciaMedrano RM, Enríquez- flowers of triploid banana and plantain cultivars
Valencia AJ, Youssef M, López-Gómez P et al (Musa spp.). In Vitro Cell Dev Biol-Plant
(2016) Somatic embryogenesis in banana, 30:181–186. https://doi.org/10.1007/
Musa ssp. In: Loyola-Vargas VM, Ochoa-Alejo bf02823029
14. Côte FX, Domergue R, Monmarson S et al Rep 27:965–971. https://doi.org/10.1007/

(1996) Embryogenic cell suspensions from the s00299-008-0509-x
male flower of Musa AAA cv. Grand Nain. 19. Khalil S, Cheah K, Perez E, Gaskill D, Hu
Physiol Plant 97:285–290. https://doi. J (2002) Regeneration of banana (Musa spp.
org/10.1034/j.1399-3054.1996.970211.x AAB cv. Dwarf Brazilian) via secondary
15. Youssef M, James A, Mayo-Mosqueda A et al somatic embryogenesis. Plant Cell Rep
(2010) Influence of genotype and age of 20:1128–1134. https://doi.org/10.1007/
explant source on the capacity for somatic s00299-002-0461-0
embryogenesis of two Cavendish banana culti- 20. Panis B, Van Wauwe A, Swennen R (1993)
vars (Musa acuminata Colla, AAA). Afr Plant regeneration through direct somatic
J Biotechnol 9:2216–2223 embryogenesis from protoplasts of banana
16. Grapin A, Ortíz JL, Lescot T et al (2000) (Musa spp.). Plant Cell Rep 12:403–407.
Recovery and regeneration of embryogenic https://doi.org/10.1007/BF00234701
cultures from female flowers of false horn plan- 21. Strosse HDR, Panis B, Escalant JV, Côte F
tain. Plant Cell Tiss Org 61:237–244. https:// (2003) Banana and plantain embryogenic cell
doi.org/10.1023/a:1006423304033 suspensions INIBAP Thechnical Guidelines 8.
17. Strosse H, Schoofs H, Panis B et al (2006) The International Network for the
Development of embryogenic cell suspen- Improvement of Banana and Plantain.
sions from shoot meristematic tissue in International Plant Genetic Resources Institute,
bananas and plantains (Musa spp.). Plant Sci Monpellier, France, p 36
170:104–112. https://doi.org/10.1016/j. 22. Murashige T, Skoog F (1962) A revised medium
plantsci.2005.08.007 for rapid growth and bio assays with tobacco tis-
18. Pérez-Hernández J, Rosell-García P (2008) sue cultures. Physiol Plant 15:473–497. https://
Inflorescence proliferation for somatic embryo- doi.org/10.1111/j.1399-3054.1962.tb08052.x
genesis induction and suspension-derived plant 23. Morel G, Wetmore RH (1951) Tissue culture
regeneration from banana (Musa AAA, cv. of monocotyledons. Am J Bot 38:138–140.
‘Dwarf Cavendish’) male flowers. Plant Cell https://doi.org/10.2307/2437836
Chapter 15
Somatic Embryogenesis in Theobroma cacao L.

Claudia Garcia, Jean-Philippe Marelli, Juan Carlos Motamayor,
and Cristiano Villela
Abstract
Theobroma cacao L. is a tropical tree originating in the Amazon, where it grows naturally in the shade of
tropical rainforests. Cacao sub-products, such as butter and powder, are produced as principal components
of chocolate and contain important nutritional compounds such as polyphenols and flavonoids. However,
bean production is decreasing because plantations are antiquated and unproductive. Cacao propagation
has been traditionally performed through classical propagation methods, such as grafting or rooted cut-
tings, but those methods are not sufficient to obtain large quantities of planting material with the desired
genetic quality and optimal plant health. In the search for solutions to this problem, somatic embryogen-
esis (SE) is a vegetative method used for cacao propagation that has the potential to be explored. SE is a
type of clonal propagation by which totipotent cells in the somatic tissue can develop into embryos and
subsequently convert into plants.
This method offers significant technological advantages because it is possible to obtain a large quan-
tity of disease-free planting material with good agronomic characteristics and genetic stability. In T. cacao,
tow techniques of in vitro micropropagation have been reported as direct and indirect SE. Indirect SE
requires the additional step of cell dedifferentiation, unlike direct SE, which does not require this step.
Here, we report a protocol using direct and indirect SE techniques using two types of culture methodolo-
gies—solid and liquid culture media.
Key words Somatic embryogenesis, Theobroma cacao
1 Introduction
Somatic Embryogenesis is a morphogenetic event that serves as

proof that plant cells are totipotent. The induction and expression
of SE are only possible if the somatic plant cells have acquired the
necessary features and have begun the process of embryogenesis
[1]. For the expression of SE, several sequences of events are nec-
essary in a morphogenetic phenomenon that occurs after different
phases or stages, which can be characterized by distinct biochemi-
cal and molecular events [2].
227
228 Claudia Garcia et al.
Somatic Embryogenesis has five events (induction, expression,

maturation, and conversion into plants). The first event in SE is the
induction phase, where cells acquire differentiated somatic embryo-
genic capacity by direct somatic embryogenesis (DSE) or indirect
somatic embryogenesis (ISE). DSE occurs when minimal cell divi-
sion precedes embryo formation, while in ISE, high amounts of
callus proliferate before embryo formation [3]. SE is only possible
if the cells are competent and receive an appropriate inducing stim-
ulus [4]. Two types of inductive conditions have been recognized
to permit differentiated cells to become undifferentiated compe-
tent cells: internal and/or external phytohormone levels in tissue
(PGRs, plant growth regulators) and stress factors, as osmotic
shock substances exhibit different concentration changes (sucrose,
polyethylene glycol, and abscisic acid, among others), dehydration
culture medium, water stress, ions of heavy metals, changes in pH
of the culture medium, cold treatments and thermal shock,
hypoxia, antibiotics, ultraviolet radiation, and chemical or mechan-
ical treatments [5, 6].
Auxins alone or in combination with cytokinins are considered
the most important PGRs in cell division and differentiation and
SE induction. In indirect SE induction, 2,4-dichlorophenoxyacetic
acid (2,4-D) plays an important role as a cell stressor and possibly
in reprogramming cells by DNA methylation. There is evidence
that SE follows highly organized patterns of DNA methylation or
demethylation, and the acetylation or deacetylation of histones has
been observed during stages of cellular differentiation and/or
dedifferentiation [5, 7]. In carrots, citrus fruits, coffee, and olives,
it has been confirmed that somatic embryo development requires
2,4-D [8]. It is possible that 2,4-D plays roles in cell polarity and
asymmetric cell division because it causes different changes in mor-
phology, physiology, metabolism, and gene expression in cells,
triggering epigenetic changes when SE is starting or beginning to
develop [9–11].
In T. cacao, several tissue culture studies have been performed
with the aim of producing in vitro plants. Entities such as Penn
State University, the USDA, and Nestle have developed protocols
for the mass propagation of cocoa plants by SE with good results,
but many aspects remain to be unveiled. Studies on SE in cacao
have been performed for over 30 years. In the late 1980s and
1990s, considerable efforts were made in tissue culture for the pro-
duction of cocoa plants by SE. These procedures were complicated
in their execution because they used different hormones at each
step (e.g., embryo germination and their conversion into plants).
Additionally, the source of explant used (i.e., immature zygote
embryos) was not suitable for the initiation of cultures in vitro
because it could lead to genetic variation in the results [4, 9, 12].
The first moderately successful cacao SE protocol was devel-
oped by Li et al. (1998). Their exhaustive study highlights the
Somatic Embryogenesis in Theobroma cacao 229
importance of genotypic variation in the SE response. Staminodes

from 19 cacao genotypes were evaluated for their capacity to
undergo SE; the diverse genotypes produced primary somatic
embryos (PSEs) at very different rates. The explant response (cal-
lus growth) ranged from 1 to 100%, and the number of somatic
embryos per responsive explant ranged from 1 to 46 [13].
This basic cacao SE protocol was further optimized by
Maximova et al. [14], who developed a key method for secondary
somatic embryogenesis (SSE) using cotyledon explants from PSEs.
In this study, eight genotypes were tested, and 4.8–24.7 secondary
somatic embryos (SSEs) were generated per explant within a
12-month SSE protocol [14]. Another SE protocol (using flower
petals) was developed by Lopez-Báez et al. [15] using Murashige
and Skoog (MS) salt-based induction medium that included test-
ing of carbohydrates (sucrose, glucose, and maltose) and PGRs
(2,4-D or 2,4,5-T and kinetin) in 12 diverse genotypes [15].
Again, a high genotype response variance was noted. Although the
collective impression from cacao SE research indicates that an
ideal, genotype-independent protocol has not yet been developed,
several key efficiency determinants have been identified, including
the concentration and type of sugar used in the culture medium
[16–18].
One of the most recent works in propagating cocoa seedlings
was a patent published by Nestec SA [19] using a temporary
immersion system and liquid culture. However, these protocols
use 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as a source of
auxin in the culture medium to stimulate the embryogenic capacity
in tissues via indirect embryogenesis. Although frequently used in
SE protocols, these powerful synthetic auxins have potentially neg-
ative effects in later stages of development, such as low conversion
rates (less than 50%) of somatic embryos into plants and greater
proportions of abnormal somatic embryos and somaclonal varia-
tion [17, 18].
Seeking to improve the production of somatic embryos and
their conversion into plants, MARS, Inc. developed new and useful
strategies to induce direct and indirect SE to produce cacao plants
in liquid or solid media that improved the propagation process
[20]. DSE methodology does not require the production of the
embryogenic callus; therefore, it does not require the use of 2,4-D
and provides a way of obtaining a high number of normal embryos
in a short time compared with the ISE procedures in other proto-
cols. We have also made some improvements in the ISE methodol-
ogy from the protocol published by Penn State University [21]
that increases the germination and conversion rates from embryos
into plantlets. The methodology presented here regarding SE in T.
cacao via DSE and ISE used a combination of solid or/and liquid
cultures at different steps of the process.
2 Materials
2.1 Biological 1. Theobroma cacao seeds.

Materials
2.2 Instrumentation, 1. Flow cabinet, orbital shaker, autoclave, dry hot sterilizer, scis-
Glassware, and Other sors, 50-mL conical-bottom centrifuge tubes, laboratory plas-
Materials tic film (Parafilm), sterile 100 × 20 mm Petri dishes, Pyrex
brand laboratory bottles (1 and 0.5 L), glass vessel with air
recirculation on the top (capacity of 300 mL), No. 11 scalpel
blades with handle, micro forceps, sterile distilled and deion-
ized water, bioreactor for temporary immersion system (TIS)
with a 5-L capacity, sterile paper towels, and 70% (v/v)
ethanol.
2.3 Reagents, 1. Chemical recommendations and media preparation condi-

Solutions, tions. The pH of the medium is adjusted using 1 N KOH prior
and Culture Media to autoclaving. All media are autoclaved for 20 min at
121 °C. However, due to the hygroscopic nature of the
reagents, we use stock solutions containing the chemical com-
ponents of the different salts, hormones, and vitamin solutions
used for medium preparation. Macronutrients in the Driver
and Kuniyuki (DKW) medium [22] are separated into A and B
stock solutions to avoid chemical interactions between inor-
ganic salts at high concentrations and to prevent salt precipita-
tion during storage. A powder from Lloyd and McCown [23]
woody plant salt mixture is obtained from Sigma Chemical.
Fresh stock solutions of growth regulators, including thidia-
zuron (TDZ), 6-benzyladenine (BA), kinetin, and 2,4-dichlo-
rophenoxyacetic acid (2,4-D), are prepared every 3 months.
Calcium hypochlorite [Ca(OCl)2] is obtained from Aldrich
Chemical Company.
2. Incubation conditions. A dark incubation area with a constant
temperature at 27 ± 2 °C and a light incubation area with daily
cycle of 16 h (light) and 8 h (dark) photoperiod and photosyn-
thetic active radiation (PAR) 50–190 μmol m−2 s−1.
3. Medium preparation for indirect somatic embryogenesis.
Prepare the stock solution of DKW salts, DKW vitamins (see
Note 1), and amino acids (see Note 2) as indicated in Table 1.
All reagents should be applied in the correct order to avoid
precipitation. Before the media is sterilized by autoclave, the
pH should be calibrated to 5.8 with 1 N KOH. Plant growth
regulators stock solutions and media should be prepared fol-
lowing the indications below.
(a) TDZ solution (0.5 mg mL−1). Dissolve 5 mg thidiazuron
in 100 μL of 1 N KOH, and add Milli-Q water to a final
volume of 10 mL. Store at 4 °C.
Table 1
Composition of amino acids and DKW stock solutions (macro and micro salts and vitamins)
Indirect somatic embryogenesis stock solutions
Amino acid
DKW 10× DKW 10× DKW 100× DKW 1000× 1000× stock
macro solution macro solution micro solution vitamin solution solution
Component A (per liter) B (per liter) C (per liter) (per 100 mL) (100 mL)
NH4NO3 14.16 g – – – –
Ca(NO3)2 19.68 g – – – –
4H2O
K2SO4 – 15.59 g – – –
MgSO4 7H2O – 7.40 g – – –
CaCl2 2H2O – 1.49 g – – –
KH2 PO4 – 2.65 g – – –
Zn(NO3)2 – – 1.70 g – –
6H2O
MnSO4 H2O – – 3.34 g – –
FeSO4 7H2O – – 3.38 g – –
Na-EDTA – – 4.54 g – –
H3BO3 – – 0.48 g – –
CuSO4 5H2O – – 25 mg – –
Na2MoO4 – – 39 mg – –
2H2O
Myoinositol – – – 10.0 g –
Thiamin-HCl – – – 0.2 g –
Nicotinic acid – – – 0.1 g –
Glycine – – – 0.2 g –
Tryptophan – – – 0.1 g –
L-lysine – – – – 45.65 mg
L-Leucine – – – – 32.80 mg
L-tryptophan – – – – 51.05 mg
Arginine – – – – 43.55 mg
Glycine – – – – 18.76 mg
(b) 2,4-D solution (10 mg mL−1). Dissolve 100 mg 2,4-D in

8 mL of 100% ethanol, and then add Milli-Q water to
10 mL. Store at 4 °C.
(c) Kinetin and BA solutions (10 mg mL−1). Dissolve 10 mg
kinetin or BA in 50 μL 1 N NaOH, and add Milli-Q water
to 1 mL. Store at −20 °C.
(d) Primary callus growth (PCG) medium is prepared by add-
ing 100 mL each of DKW solutions A and B, 10 mL DKW
micro solution, 1 mL DKW vitamin solution, 20 g glu-
cose, 250 mg glutamine, 100 mg (= 200 mg L−1) myoino-
sitol, 200 μL (= 2.0 mg L−1) 2,4-D solution, 10 μL (=
5 μg L−1) TDZ solution, and 2.0 g Phytagel to a final vol-
ume of 1 L.
(e) Secondary callus growth (SCG) solid or liquid medium is
prepared by adding 2.3 g McCown’s, 1 mL Gamborg’s
[24] vitamin solution, 20 g glucose, 200 μL (= 2 mg L−1)
2,4-D solution, 5 μL (= 0.05 mg L−1) BA solution or
30 μL (= 0.3 mg L−1) kinetin solution, and 2.2 g Phytagel
to a final volume of 1 L.
(f) Embryo development (ED4) medium is prepared by add-
ing 100 mL each of DKW macro solutions A and B, 10 mL
DKW micro solution, 1 mL DKW vitamin solution, 40 g
sucrose, and 2 g Phytagel to a final volume of 1 L (see
Note 3).
(g) Embryo development (ED3) medium is prepared by add-
Note 3).
(h) Embryo development (ED6) medium is prepared by add-
Note 3).
(i) Embryo germination and conversion (EDL) medium is
prepared by adding 100 mL each of DKW macro solutions
A and B, 10 mL DKW micro solution, 1 mL DKW vita-
min solution, 1 mL amino acid solution, 20 g glucose,
0.3 g KNO3, and 1.8 g Phytagel to a final volume of 1 L.
(j) Plant regeneration (PR) medium, used when the root is
missing, should be prepared by adding 50 mL each of
DKW macro solutions A and B, 5 mL DKW micro solu-
tion, 0.5 mL DKW vitamin solution, 1 mL amino acid
solution, 4.5 mg L−1 indole-3-butyric acid (IBA), 10 g
glucose, 5 g sucrose, 0.3 g KNO3, and 2 g Phytagel to a
final volume of 1 L.
4. Medium preparation for direct somatic embryogenesis. Prepare

the stock solution of Murashige and Skoog salts (MS) [25],
which can be immediately diluted to the preferred concentra-
tion before use (Table 2). Macronutrient solutions are better
prepared as stock solutions of ten times the strength of the
final operative medium. Micronutrient stock solutions are
made 100 times the quantity of the final concentration of the
working medium. Stock solutions can be stored in a refrigera-
tor at 2–4 °C. DSE can be stimulated using induction medium
(IM) and expression medium (EM) to produce embryos, fol-
lowed by maturation, germination, and conversion steps.
Prepare the IM and EM following the components in Tables 3
and 4, respectively. Calibrate the pH to 5.8 using a solution of
1 N KOH. In the other steps of this protocol, such as matura-
tion, germination, and conversion of embryos into plants, the
EDL medium that is used in the ISE methodology should be
used.
3 Methods
3.1 Indirect Primary The vegetal material includes staminodes and petal base tissues
Somatic used as culture explants. Although immature flower buds with a
Embryogenesis range of sizes can be collected, large flower buds should be chosen
because such flower buds are easier to dissect and handle in the
absence of a dissecting microscope. Depending on the genotype,
you can choose buds between 6 and 8 mm. In addition, stami-
nodes and petal base explants should be separated from associated
floral parts, such as stamen filaments and petal tissue, to minimize
possible interactions that may affect the in vitro growth of explants.
We found that stamen-derived calli were incapable of producing
somatic embryos and that petal tissues turned brown quickly and
released phytotoxic-phenolic compounds into the medium.
Collection and surface sterilization of flower buds
1. Collect immature flower buds in a 50-mL centrifuge tube con-
taining cold water in the morning before 9:00 h (see Note 4).
2. Prepare 1% (w/v) calcium hypochlorite solution by dissolving
0.5 g Ca(OCL)3 in 50 mL sterile water in a sterile 50-mL cen-
trifuge tube.
3. Inside the transfer hood, decant the cold water from the cen-
trifuge tube containing the immature flower buds, and transfer
all of the flower buds into the sterile centrifuge tube contain-
ing the calcium hypochlorite solution.
4. Immerse flower buds in the calcium hypochlorite solution for
25–30 min. Remove all of the solution, and add 40 mL sterile
water to rinse the flower buds. Rinse at least three times.
Table 2
Components of macro and micro salts of Murashige and Skoog medium
[25]
Components MS (mg/L)
CaCl2.2H2O 440
CoCl2.6H2O 0.025
CuSO4.5H2O 0.025
FeSO4.7H2O 27.8
H3BO3 6.2
KH2PO4 170
KI 0.83
KNO3 1900
MgSO4.7H2O 370
MnSO4 16.9
Na2EDTA.2H2O 37.3
Na2MoO4.2H2O 0.25
NaH2PO4.2H2O 170
NH4NO3 1650
ZnSO4.7H2O 8.6
Table 3
Components of induction medium (IM) for direct somatic embryogenesis
Components Amount
Macronutrients MS 25%
Micronutrients MS 50%
KH2PO4 42.5 mg L−1
Fe-EDTA 21.5 mg L−1
Pyridoxine 1 mg L−1
Nicotinic acid 1 mg L−1
Thiamine 10 mg L−1
BA 1 mg L−1
Sucrose 40 g L−1
Myoinositol 100 mg L−1
Phytagel (solid media only) 2.0 g L−1
Table 4
Components of expression medium (EM) for direct somatic
embryogenesis
Components Amount
Macronutrients MS 100%
Micronutrients MS 100%
Calcium pantothenate 1 mg/L
Fe-EDTA 21.5 mg L−1
Pyridoxine 1 mg L−1
Nicotinic acid 1 mg L−1
Thiamine 1 mg L−1
Biotin 0.1 mg L−1
Gibberellic acid 0.6 mg L−1
Sucrose 40 g L−1
Myoinositol 100 mg L−1
KNO3 0.3 g L−1
Phytagel (solid media only) 2.2 g L−1
Amino acid stock solution 1000× 1 mL L−1
5. Transfer flower buds to a Petri dish, and cover the plate to

prevent desiccation.
Dissection of flower buds and callus induction for primary
somatic embryogenesis
6. Place two to three layers of sterile paper towels in the transfer
hood. Dry four flower buds on the top surface of the paper
towels, and then transfer them onto a Petri dish cover.
7. Cut across the flower buds at a position approximately 1/3 of
the flower length from the base using a sterile scalpel blade
(Fig. 1a). Extract staminodes and petal base explants together
from the part of the flower bud using a pair of sterile forceps.
Remove any attached petal tissue from the petal base explants
(Fig. 1b).
8. Transfer staminodes and petal base explants from five to ten
flower buds into a Petri dish containing 30 mL of PCG
medium. Separate any fused staminodes and petal base
explants, and distribute explants evenly across the medium.
9. Seal the Petri dishes with double layers of parafilm, and main-
tain cultures in the dark at 25 ± 2 °C for 14 days.
Fig. 1 Flower buds. (a) Flower buds cut crosswise at a position approximately 1/3 of the flower length from
the base. (b) Staminodes (red arrow) and petals from flower buds (blue arrow)
10. Transfer the staminodes to a Petri dish containing 30 mL of

SCG medium and the petal base explants to another identical
Petri dish. Seal the dishes, and maintain cultures in the dark
for another 14 days. There should be an average of 25 explants
per plate.
Somatic embryo expression and maintenance
11. Transfer staminodes and petal base explants separately to Petri
dishes containing 30 mL of ED4 medium, and incubate the
cultures in the dark for 14 days.
12. Subculture explants onto fresh ED3 medium 3–6 times.
Maintain embryo cultures in the dark at 25 ± 2 °C, with a sub-
culture interval of 14 days until somatic embryos reach matu-
rity (see Note 5). From the third ED3 medium, the embryos
should be separated more easily from the callus mother. Place
10–15 embryos separately per Petri dish to give the embryos
good medium availability.
3.2 Secondary 1. Collect epicotyls of primary embryos 10–40 mg in weight

Somatic (Fig. 2a), cut them into small pieces (Fig. 2b), and place them
Embryogenesis in a Petri dish with 30 mL of SCG medium (with BA or kinetin
Process Using depending on the genotype) in the dark or in a flask with
the Indirect Technique 25 mL of SCG liquid medium every 14 days in the light with
a 16:8 h light/dark photoperiod or in complete darkness. Put
the flasks in a shaker set at 100 rpm. The incubation can be
performed at temperatures between 25 and 30 °C.
2. Transfer the little pieces to a Petri dish containing 30 mL of
ED4 solid medium in the dark or in a flask with 25 mL of ED4
liquid medium every 14 days in the light with a 16:8 h light/
dark photoperiod or in complete darkness for 14 days. Put the
Fig. 2 Primary somatic embryos. (a) Epicotyl (red arrow) from primary somatic embryos with 10–40 mg in
weight. (b) Epicotyl from primary somatic embryos cut into small pieces
flasks in a shaker set at 100 rpm. The incubation can be per-

formed at a temperature between 25 and 30 °C.
3. Subculture explants onto a Petri dish containing 30 mL of
fresh ED3 solid medium in the dark or in a flask with 25 mL of
ED3 liquid medium every 14 days in the light with a 16:8 h
light/dark photoperiod or in complete darkness. Place the
flasks in a shaker set at 100 rpm. The incubation can be per-
formed at a temperature between 25 and 30 °C.
4. Transfer the embryos into a bioreactor at a concentration of
10–40 mg of fresh weight per mL of ED3 (globular and heart,
Fig. 3a–c) or ED6 (early torpedo stage, Fig. 3d–e) liquid
medium with temporary immersion six times a day with
1–2 min per immersion, and change the liquid medium every
20–30 days (1 or 2 times) (see Note 6). Incubate at 25–30 °C
with a 12:12 h light/dark photoperiod or preferably in com-
plete darkness until the embryos reach complete maturation
(Fig. 4a–b).
3.3 Secondary 1. For the production of direct SSEs, epicotyls are taken from
Somatic PSEs (size: 1 cm long and weight: 40 mg), cut into 10–15
Embryogenesis Using pieces, and placed into a flask with 25 mL of liquid medium for
the Direct Technique IM (Table 3) every 5 weeks. The culture is exposed to a 16:8 h
light/dark photoperiod at a temperature of 27 ± 2 °C and a
PAR or photosynthetic photon flux density (PPFD) of
80–190 μmol m−2 per second.
2. After this period, the direct somatic embryos in the globular
stage (Fig. 3f) are transferred into a Petri dish in semisolid EM
or a flask with 50 mL of the same medium without Phytagel. A
Fig. 3 Somatic embryo at different stages. (a) Somatic embryo in the globular stage. (b) Somatic embryo in
the globular stage in a bioreactor. (c) Somatic embryo in the heart stage. (d) Somatic embryo in the early
torpedo stage. (e) Somatic embryos in the torpedo stage produced in liquid culture. (f) Direct somatic embryo
in the globular stage
21-day culture period is used in light conditions until the

embryos develop into the heart or early torpedo stage
(Fig. 3b–c).
3. Afterward, the cultures are transferred into the Petri dish in
EDL medium with the same culture conditions but in the
dark, with transfers every 14 days for embryo maturation.
3.4 Embryo In liquid medium using temporary immersion system bioreactors

Conversion and Plant
1. In this period, the embryos mature, and the medium is changed
Establishment
to EDL liquid medium (2 mL of EDL medium per mature
embryo) with temporary immersion 6–8 times a day with
Fig. 4 Somatic embryo. (a) Mature somatic embryo. (b) Somatic embryo matured in a bioreactor
Fig. 5 Germination and conversion process. (a) Somatic embryo converted into plants with radicles and four
leaves in liquid medium using a bioreactor. (b) Somatic embryo converted into complete plants in liquid
medium ready for acclimation. (c) Somatic embryo germinated with radicles and two leaves in solid medium.
(d) Somatic embryo converted into complete plants in solid medium
1–2 min per immersion. The liquid medium is changed every

20–30 days (1–2 times) until the embryos have a radicle and
2–4 leaves (Fig. 5a–b). They are then transferred to a green-
house for acclimatization and incubated at 25–30 °C with a
16:8 h light/dark photoperiod.
In solid medium using Petri dishes and glass vessels
2. Take mature somatic embryos, and transfer them onto Petri
dishes containing 30 mL of EDL medium (6 embryos per
plate) with a 16:8 h light/dark photoperiod. Maintain embryo
cultures for 3 months with 14-day subculture intervals until
somatic embryos are pre-germinated (Fig. 5c).
3. Select pre-germinating somatic embryos with an extended
radicle, preferably from Type II embryos (see Note 7), and
insert them vertically into EDL medium in a glass vessel with
300 mL capacity (80 mL of medium per vessel). Place 2–3
embryos in each vessel. Maintain the cultures in EDL medium
until the embryos have a radicle and 3–5 leaves (Fig. 5d), and
then transfer them to a greenhouse for acclimatization.
4. Seal the culture vessel with Parafilm. Maintain cultures under
light (16 h photoperiod) at 25 ± 2 °C for 20 days.
5. For Type I embryos (see Note 7), select pre-germinated
embryos (Fig. 5c) and transfer them onto Petri dishes contain-
ing 30 mL PR medium (without roots).
6. Maintain cultures under light with a 16 h photoperiod for
20 days (in an incubator room).
7. After 20 days in PR medium, transfer the Type I embryos to
EDL medium in a glass vessel until the embryos have a radicle
and 3–5 leaves, and then transfer them to a greenhouse for
acclimation (Fig. 5d).
8. Maintain cultures as described in steps 22 and 26 with subcul-
ture into fresh EDL medium every 20 days for 3 months with
an incubation temperature of 25–30 °C.
3.5 Acclimation 1. Transplant plantlets with developing green leaves and healthy
Process taproots into 4-inch plastic pots (cone) containing sterile
Carolina soil substrate, cucumber fiber, and perlite in 1:1:1
proportions. Pour water into the pot to saturate the soil mix-
ture. Cover the plantlet using a plastic bag (Fig. 6a). Maintain
plants in the greenhouse with 80% humidity with an automatic
misting system. Add water regularly to maintain in adequate
moisture content for optimal plant growth. The acclimation
process requires 3 months.
2. When the plant produces a new leaf, remove the cover vessel.
Apply regular amounts of fertilizers to enhance plant growth
(Fig. 6b).
Fig. 6 Acclimation process. (a) SE samples covered with plastic bags. (b) Somatic embryos completely accli-
mated with 3 months
Fig. 7 Primary and secondary embryogenesis process in solid medium culture

Fig. 8 Primary and secondary embryogenesis process in liquid medium culture
The cycle about the SE techniques in solid medium (Fig. 7)

and liquid medium (Fig. 8) is presented with all the SE process.
4 Notes
1. The DKW vitamin solution can be distributed in 1-mL ali-

quots to Eppendorf tubes and stored at −20 °C. Use 1 mL per
1 L of medium. DKW salts can be stored at 4 °C.
2. Amino acid solution can be stored at −20 °C as aliquots, with
replacement every 3–4 months. Use 1 mL per 1 L of medium.
3. After autoclaving, ED3, ED4, and ED6 media often solidify
quickly, possibly due to their high content of calcium salts,
which may trigger chemical reactions with Phytagel. Thus,

precautions must be taken during distribution of the sterile
medium into Petri dishes to prevent overcooling and prema-
ture solidification of the medium.
4. The bud flower collection should be made before 9:00 h to
prevent the immature flowers from opening. Contamination
can occur even when the bud flowers are open or when there
are holes or fissures in their surfaces.
5. Mature embryos have brown striations and/or brown spotting
on their axes.
6. In this step, it is important to evaluate if bacteria appear in the
tissue or to add antibiotic to the medium. It is possible to use
stock solutions of kanamycin (50 mg mL−1) and moxalactam
(100 mg mL−1). Use 1 mL of moxalactam stock solution per
500 mL of medium (final concentration 200 mg mL−1) and
500 μL of kanamycin stock solution per 500 mL of medium
(final concentration 50 mg mL−1) for 20 days of culture in the
first medium.
7. Two types of somatic embryos can be identified based on sev-
eral characteristics. During extended culture on ED3 medium,
mature Type I embryos tend to remain dormant or without
roots. After being transferred to EDL medium, these embryos
show extensive cotyledonary growth, followed by the develop-
ment of true leaves. Root development in germinating Type I
embryos is normally slow or does not occur. Type II somatic
embryos are whitish in color and have a defined embryonic axis
structure. These embryos undergo spontaneous germination
upon reaching maturity on ED3 medium. After being trans-
ferred to EDL medium, these embryos turn green quickly,
exhibit significant hypocotyl elongation, and produce a strong
taproot within a short period of time. Epicotyl development
and true leaf production often occur 2–3 weeks after transfer.
5 Perspectives and Recommendations
SE is a multifactorial process in which variables such as environ-

mental conditions of the donor plant must be reduced. The posi-
tion of the flowers on the tree is very important (the place on the
tree where closed flowers are collected are always the same and may
be the same as the flower size), the process is highly dependent on
the genotype, and some genotypes such as CCN 51 are recalcitrant
to this protocol (i.e., they produce small quantities of PSEs).
Primary SE is not widely used to produce cacao plants due to
its high dependency on genotype. Additionally, SE is influenced by
PGR type and balance as well as sugar concentration. If you are
starting a new genotype using this protocol, we recommend you to

use both petals and staminodes as explants because some clones
have better results on one or another explant. It is important to
search for new sources of explants to make the primary SE process
more efficient.
Commercial cacao propagation is possible, but more research
into its physiology, molecular biology, and genetics is needed to
understand all of these processes. Thus, it will be important to
adjust this protocol for new clones where there is no preliminary
information available. SSE is more efficient than primary somatic
embryogenesis. Therefore, we recommend that future experiments
focus on large-scale production using SSE in bioreactors, with the
aim of avoiding manual labor and reducing production costs.
References
1. Fehér A, Pasternak T, Dudits D (2002) 8. Schumann G, Ryschka U, Klocke E (1995)
Activation of embryogenic cell division in leaf Anatomy of somatic embryogenesis. In: Bajaj
protoplast-derived alfalfa cells: the role of auxin YPS (ed) Biotechnology in agriculture and for-
and stress. Acta Biol Szeged 46:13–14 estry, Somatic embryogenesis and synthetic
2. Suprasanna P, Bapat VA (2006) Differential seed I, vol 30. Springer, Berlin, Heidelberg,
gene expression during somatic embryogene- pp 71–86. https://doi.org/10.1007/
sis. In: Mujib A, Samaj J (eds) Somatic embryo- 978-3-662-03091-2_6
genesis. Springer, Berlin, Heidelberg, 9. Fehér A, Pasternak TP, Dudits D (2003)
pp 305–320. https://doi.org/10.1007/ Transition of somatic plant cells to an embryo-
7089_038 genic state. Plant Cell Tiss Org 74:201–228.
3. Karami O, Aghavaisi B, Mahmoudi A (2009) https://doi.org/10.1023/A:1024033216561
Molecular aspects of somatic to embryogenic 10. Fehér A (2008) The initiation phase of somatic
transition in plants. J Chem Biol 2:177–190. embryogenesis: what we know and what we
https://doi.org/10.1007/ don’t. Acta Biol Szeged 52:53–56
s12154-009-0028-4 11. Ardebili SH, Shariatpanahi ME, Amiri R et al
4. Jiménez VM (2001) Regulation of in vitro (2011) Effect of 2,4-D as a novel inducer of
somatic embryogenesis with emphasis on to embryogenesis in microspores of Brassica
the role of endogenous hormones. Rev Bras napus L. Czech J Genet Plant Breed 47:4–122
Fisiol Veg 13:196–223. https://doi. 12. Germana MA, Lambardi M (2016) In vitro
org/10.1590/S0103-31312001000200008 embryogenesis in higher plants. Springer,
5. Zavattieri MA, Frederico AM, Lima M et al New York, NY, pp 1–577
(2010) Induction of somatic embryogenesis as 13. Li Z, Traore A, Maximova S, Guiltinan MJ
an example of stress-related plant reactions. (1998) Somatic embryogenesis and plant
Electron J Biotechnol 13:1–9. https://doi. regeneration from floral explants of cacao
org/10.4067/S0717-34582010000100012 (Theobroma cacao L.) using thidiazuron. In
6. Gaj MD (2004) Factors influencing somatic Vitro Cell Dev Biol Plant 34:293–299.
embryogenesis induction and plant regeneration https://doi.org/10.1007/BF02822737
with particular reference to Arabidopsis thaliana 14. Maximova SN, Alemanno L, Young A et al
(L.) Heynh. Plant Growth Regul 43:27–47. (2002) Efficiency, genotypic variability, and
h t t p s : / / d o i . o r g / 1 0 . 1 0 2 3 / B : G R O W. cellular origin of primary and secondary
0000038275.29262.fb somatic embryogenesis of Theobroma cacao
7. Tchorbadjieva M, Pantchev I (2004) DNA L. In Vitro Cell Dev Biol Plant 38:252–259.
methylation and somatic embryogenesis of https://doi.org/10.1079/IVP2001257
orchard grass (Dactylis glomerata L.). Bulg 15. Lopez Baez O, Bollon H, Eskes A, Pétiard V
J Plant Physiol 30:3–13 (1993) Embryogenèse somatique du cacaoyer
Theobroma cacao L., à partir des pièces florales. worldwide.espacenet.com/searchResults?subm

C R Acad Sci III Sci Vie 16:579–584 itted=true&locale=en_EP&DB=EPODOC&S
16. Tan C, Furtek D (2003) Development of an T=advanced&TI=&AB=&PN=wo201507736
in vitro regeneration system for Theobroma 5&AP=&PR=&PD=&PA=&IN=&CPC=&IC
cacao L. from mature tissues. Plant Sci 21. Young A, Miller C, Antunez de Mayolo G et al
164:407–412. https://doi.org/10.1016/ (2003) Cacao tissue culture protocol book. The
S0168-9452(02)00428-4 Pennsylvania State University USA 1:4:1-32
17. Solano-Sanchez W (2008) Embriogénesis 22. Driver JA, Kuniyuki AH (1984) In vitro propa-
somática en clones superiores de cacao gation of paradox walnut rootstock [Juglans
(Theobroma cacao L.) obtenidos en el programa hindsii X Juglans regia, tissue culture]. Hort
de mejoramiento genético del CATIE. Tesis de Sci 19:507–509
pos graduación del programa de master, 23. Lloyd G, McCown B (1980) Commercially
CATIE, Costa Rica, 1–92 feasible micropropagation of mountain Laurel,
18. Vaca CIC (2004) Inducción de la embriogéne- Kalmia latifolia, by use of shoot-tip culture.
sis somática en clones superiores de cacao Proc Int Plant Prop Soc 30:421–442
(Theobroma cacao L.), con resistencia a enfer- 24. Gamborg OL (1996) Aromatic metabolism in
medades fungosas. Tesis de pos graduación del plants. II. Enzymes of the shikimate pathway in
programa de master, CATIE, Costa Rica, 1–86 suspension cultures of plant cells. Can
19. Florin BJ, Masseret B, Vachet CDM (2010) J Biochem 44:791–779. https://doi.
Cocoa somatic embryogenesis. Patent number org/10.1139/o66-097
US 20100236143Al 25. Murashige T, Skoog FA (1962) A revised
20. Garcia C, Dias C and Marelli J-P (2015) medium for rapid growth and bioassays with
Production of plants using somatic embryo- tobacco tissue cultures. Physiol Plant 15:473–
genesis. International: A01h4/00. European 479. https://doi.org/10.1111/j.1399-3054.
Patent Office. Wo2015077365 (A1). http:// 1962.tb08052.x
Chapter 16
Somatic Embryogenesis of Quercus suber L.

From Immature Zygotic Embryos
Pilar S. Testillano, Aránzazu Gómez-Garay, Beatriz Pintos,
and María C. Risueño
Abstract
Quercus suber L., cork oak, is a forest tree of high social and economic value. The cork is traditionally used
in the wine industry to produce bottle stoppers, but it is also a very good material for both thermal and
acoustic insulation in construction. Since its harvest does not harm the tree, the use of cork in the industry
has a positive impact on the environment.
Somatic embryogenesis is considered a feasible system for in vitro regeneration procedures, with
many advantages in woody species. Classical genetic breeding programs have important limitations in
forest trees, like cork oak, due to their long life span and difficulties of seed conservation and vegetative
reproduction. Therefore, somatic embryogenesis has a great potential for large-scale propagation and
cryopreservation of elite genotypes, as well as for transformation strategies. In the case of Q. suber, several
in vitro propagation systems through somatic embryogenesis have been reported, with different effi-
ciency rates.
In the present chapter, updated information is reported about an efficient protocol for induction of
somatic embryogenesis of Q. suber from immature zygotic embryos, as well as methods for proliferation
and maturation of somatic embryos, germination, plantlet regeneration, and acclimatization.
Key words Cork oak, Embryo differentiation, Embryogenic masses, Embryo maturation, Somatic
embryogenesis, Plant cell reprogramming
1 Introduction
Quercus suber, cork oak, is a forest tree of high social and economic
value in Southern Europe. The cork is a raw natural material tradi-
tionally used in the wine industry to produce bottle stoppers.
Moreover, since cork does not conduct either heat or sound well,
it is a very good material for both thermal and acoustic insulation.
Due to these properties, there is an increasing section of the cork
market in which this material is employed to produce cork-based
composite materials, with applications in construction and space
industries. Another good property of cork is the fact that its harvest
247
248 Pilar S. Testillano et al.
does not harm the tree, as the material is only separated from the
trunk; therefore, the use of cork in the industry has a positive
impact on the environment. All these properties have made cork at
present as a material with much greater potential, already employed
in many industrial sectors, with new applications being developed,
and with a positive impact on the environment.
Somatic embryogenesis in vitro systems are very useful for bio-
technological applications in plant breeding, propagation, and
conservation strategies [1, 2]. Classical genetic breeding programs
have important limitations in forest trees, like cork oak, due to
their long life span and difficulties of seed conservation and vegeta-
tive reproduction. Therefore, somatic embryogenesis has a great
potential for large-scale propagation and cryopreservation of elite
genotypes, as well as for transformation strategies. Induction of
somatic embryogenesis has been reported in several Quercus spe-
cies like Quercus robur, Q. ilex, and Q. alba [3–6]. In the case of Q.
suber, several in vitro propagation systems through somatic
embryogenesis have been reported, with different efficiency rate
[7–9]. The effects on somatic embryogenesis efficiency of various
culture conditions and medium components have been described
[10, 11], as well as changes in the proteome of cells during somatic
embryogenesis of Q. suber [12, 13]. Several studies on the cellular
rearrangements and factors involved in the somatic embryogenesis
induction and progression process have permitted to characterize
the process at the cellular level and to point out the relevance of
epigenetic marks, like DNA methylation, pectins of cell wall, and
endogenous phytohormones, especially auxin, in the induction
and progression of in vitro embryogenesis of Q. suber [14–16].
In Q. suber, as in many other systems, somatic embryogenesis
is a complex process, not completely understood yet, that begins
with the induction process. After induction, some responsive cells
of the explants are reprogrammed, acquire totipotency, follow the
embryogenesis developmental pathway, and produce embryos by
direct somatic embryogenesis. In many in vitro systems, repro-
grammed cells can also proliferate and originate masses of embryo-
genic cells that give rise to somatic embryos by indirect
embryogenesis or continue proliferating and produce more
embryogenic masses. Moreover, developing somatic embryos can
in turn produce new embryos by recurrent secondary embryogen-
esis. This process permits the in vitro system to produce much
more somatic embryos by cycling processes and during longer
time.
In the present chapter, updated information is reported about
an efficient protocol for induction of somatic embryogenesis of Q.
suber from immature zygotic embryos, as well as methods for pro-
liferation and maturation of somatic embryos, germination, plant-
let regeneration, and acclimatization.
Somatic Embryogenesis of Cork Oak 249
2 Materials
2.1 Plant Material 1. Immature pollinated acorns were collected from Quercus suber
L. (cork oak) trees every week during the fruit development
period (late August and September) from two selected trees in
the E.T.S.I. de Montes (Universidad Politécnica de Madrid)
and three selected trees from El Pardo, Madrid, Spain.
2. Immature acorns selected at the appropriate developmental
stage (see Note 1) for somatic embryogenesis induction are
kept at 4 °C for 1 week before in vitro culture initiation.
2.2 Instrumentation 1. Laminar flow hood for plant in vitro culture.

2. Autoclave for sterilization.
3. pH meter.
4. General tissue culture laboratory equipment and tools: for-
ceps, scalpels, magnetic stirrers, automatic pipettes, etc.
5. Sterile Petri dishes of 90 mm diameter.
2.3 Culture Media 1. Micronutrients of MS medium [17] (Table 1).

Mixture 2. Vitamins of MS medium [17] (Table 2).
3. Macronutrients of Sommer medium [18] (Table 3).
Table 1
Micronutrients of MS medium
Stock solution Volume of stock for 1 L Final concentration in

Component concentration (g L−1) of medium (mL) medium (mg L−1)
FeSO4·7H2O 2.78 10 27.8
Na2EDTA 3.75 10 37.5
H3BO3 0.62 10 6.2
MnSO4·H2O 1.69 10 16.9
ZnSO4·7H2O 0.86 10 8.6
KI 0.083 10 0.83
Na2MoO4·2H2O 0.025 10 0.25
CuSO4·5H2O 0.0025 10 0.025
CoCl2·6H2O 0.0025 10 0.025
Table 2
Vitamins and amino acids of MS medium

Component concentration (g L−1) of medium medium (mg L−1)
Glycine 0.2 10 2.0
Myoinositol 10 10 100
Nicotinic acid 0.5 10 5.0
Pyridoxine- 0.5 10 5.0
HCl
Thiamine- 0.1 10 1.0
HCl
Ascorbic acid 0.2 10 2.0
Table 3
Macronutrients of Sommer medium

Component concentration (g L−1) of medium medium (mg L−1)
KNO3 100 10 1000
NaH2PO4·2H2O 12.95 10 129.5
MgSO4·7H2O 25 10 250
(NH4)2SO4 20 10 200
KCl 30 10 300
CaCl2·2H2O 15 10 150
3 Methods
3.1 Culture Media 1. Four solid culture media are prepared and used in the different
Preparation steps of somatic embryogenesis: induction, proliferation, mat-
uration, and germination media, with the composition detailed
in Table 4.
2. The pH of the media is adjusted to 5.6. Culture media are
supplemented, as indicated in the Table 4, with the growth
regulator 2,4-D, glutamine, and agar (see Note 2).
3. After sterilization, medium is dispensed in Petri dishes and
leave at room temperature to solidify. Plates are sealed with
parafilm and kept in sterile conditions until their use for in vitro
culture.
Table 4
Composition of media for somatic embryogenesis of Quercus suber L
Induction medium Proliferation medium Maturation medium Germination medium

2,4-D (0.5 mg L−1) Act. Charcoal (10 g L−1) BA (50 mg L−1)
Glutamine (0.5 g L−1) Glutamine (0.5 g L−1) Glutamine (0.5 g L−1) IBA (0.1 mg L−1)
Sucrose (30 g L−1) Sucrose (30 g/l) Sucrose (30 g L−1) Sucrose (15 g L−1)
Agar (8 g L−1) Agar (8 g L−1) Agar (8 g L−1) Agar (10 g L−1)
Sommer macronutrients
MS micronutrients
MS vitamins and amino acids
pH 5.6
3.2 Explant Excision Immature zygotic embryos are carefully excised from the acorns by
and Sterilization dissecting the surrounding tissues with the help of scalpel and for-
ceps. Immature zygotic embryos are sterilized by immersion in
70% ethanol for 30 s and in 2% sodium hypochlorite for 20 min,
followed by three rinses in sterile distilled water of 10 min each.
3.3 Induction 1. Immature zygotic embryos are first cultured on induction

of Somatic medium (see Note 3), which contains 0.5 mg L−1 2,4-D (Table 4),
Embryogenesis for 1 month at 25 °C and 16/8 h light/darkness. During this
induction period, cell reprogramming occurs in some responsive
cells which initiate the embryogenesis pathway.
2. By the fourth week of culture on induction medium, the
responsive cells have reprogrammed, start to divide, and give
rise to clusters of proliferating cells that can originate embryo-
genic masses and small globular embryos; both types of struc-
tures appear at the surface of the explants, emerging from their
interior. Embryogenic masses are rounded/nodular masses of
cellular aggregates that arise from the explants after induction,
as the first morphological sign of embryogenic response; they
contain embryogenic cells that can give rise to somatic embryos
by indirect embryogenesis or proliferate and produce more
embryogenic masses. Globular embryos are small and rounded
white structures with smooth surface; somatic embryos can be
produced directly from reprogrammed cells of the explants
(direct somatic embryogenesis) or from cells of the embryo-
genic masses (indirect somatic embryogenesis) (Fig. 1).
3. Microscopic analysis reveals that embryogenic cells and early
embryo cells show typical features of active proliferating cells,
i.e., small cell size, medium-large nucleus, slightly dense cyto-
plasm, and low vacuolation (Fig. 2).
Fig. 1 Main stages of somatic embryogenesis of Quercus suber. (a) Immature zygotic embryo, at the begin-
ning of the culture. (b) Induction of somatic embryogenesis: embryogenic masses and early embryos emerge
from the explants surface. (c) Early torpedo embryo (lateral view) formed by direct embryogenesis and emerg-
ing from the explants. (d) Proliferation period: clumps of embryogenic masses of different sizes and groups of
embryos of various developmental stages showing recurrent embryogenesis. (e) Immature cotyledonary
embryo formed during the proliferation period. (f) Mature cotyledonary embryo. (g) Plantlet regenerated in vitro
after germination of a mature somatic embryo. (h) Acclimatization ex vitro of a plant regenerated from somatic
embryogenesis. Bars in (a–c), 1 mm; in (d–f), 2 mm
Fig. 2 Cellular organization during induction and progression of somatic embryogenesis of Quercus suber.
Samples of somatic embryogenesis cultures at different stages after fixation and Technovit resin embedding
for microscopy analysis. Micrographs of semithin sections stained by toluidine blue and observed in a light
microscope under bright field. (a) Rounded masses of embryogenic cells emerging from the surface of the
explants. (b) High magnification of embryogenic cells showing characteristic features. (c) Globular embryo. (d)
Initiation of secondary embryogenesis by formation of a new protrusion of embryogenic cells from somatic
embryos. (e) Developing heart-shaped embryo. Bars in (a, b), 50 μm; in (c), 100 μm; in (d, e), 200 μm
3.4 Multiplication 1. After 1 month on the induction medium, immature zygotic

of Somatic embryos are transferred to proliferation medium (Table 4),
Embryogenic Cultures with the same composition but growth regulator-free (without
2,4-D). During the next weeks of culture in the proliferation
medium, embryogenic masses proliferate and protrude from
different parts of the explants; they produce new embryogenic
masses and embryos, which in turn give rise to new embryos
by recurrent somatic embryogenesis (see Note 4).
2. To maintain the proliferation of the embryogenic masses, they
are excised from explants and transferred to fresh proliferation
medium every month. Monthly refreshed subcultures can be
maintained in proliferation for several months, at 25 °C and
16/8 h light/darkness.
3. Small embryos at globular, heart, and torpedo stage and

embryogenic masses cultured on proliferation medium suffer
recurrent somatic embryogenesis where new somatic embryos
and embryogenic masses are originated from previously exist-
ing somatic embryos (see Note 5).
4. Some of these embryos stop recurrent embryogenesis, con-
tinue their development, and differentiate as individual imma-
ture cotyledonary embryos which are translucent and 2–3 mm
long, with two small cotyledons and an embryo axis.
3.5 Maturation 1. Well-shaped immature cotyledonary embryos from plates of

of Somatic Embryos the proliferation medium are separated and cultured on matu-
ration medium which has a basal composition (growth regula-
tor-free) plus 1% activated charcoal (Table 4).
2. Immature cotyledonary embryos are cultured for a period of
4 weeks at 25 °C in darkness. During this period, embryos
accumulate reserve nutrient substances in cotyledons and
increase their weight, giving rise to mature somatic embryos.
Mature somatic embryos are larger (more than 8 mm in
length), opaque ivory-colored, with well-formed large cotyle-
dons, embryo axis, and hypocotyl.
3.6 Germination 1. Prior to transfer to germination medium, as a pretreatment,

of Somatic Embryos mature embryos are incubated for 2 months at 4 °C on matu-
and Conversion ration medium.
to Plantlets 2. For germination, mature somatic embryos are transferred to
Petri dishes, with germination medium which has lesser sucrose
and higher agar concentrations than the maturation medium,
and contains the growth regulators 6-benzyladenine (BA) and
indole-3-butyric acid (IBA) (Table 4) (see Note 6).
3. Somatic embryos are maintained in Petri dishes with germinat-
ing medium at 25 °C and 16 h light conditions for several
weeks. During this period, embryos start to germinate, develop
radicle, and turn the color of cotyledons to green.
4. When embryos exhibit a well-developed radicle and green cot-
yledons, they are transferred individually to a glass culture ves-
sel with germinating medium under the same culture
conditions, where they have better conditions and more space
for further growth.
3.7 Hardening 1. Germinating somatic embryos are cultured for 6–8 weeks in

and Acclimatization vessels where they develop true leaves and a more complex
root system, with small lateral roots, and give rise to plantlets
that growth during this period.
2. In vitro-rooted plantlets are carefully extracted from vessels,
washed to remove the agar, and then cultured ex vitro for hard-
ening and acclimatization. They are first transferred to trays with

a sterile potting mix of peat/vermiculite, 3:1; trays are covered
with a transparent cover to maintain a high humidity environ-
ment, and they are maintained in a growth chamber with con-
trolled temperature and photoperiod (25 °C and 16 h light).
3. Finally, plants are transferred to pots with the same peat/ver-
miculite mix and put in the greenhouse.
4 Notes
1. The immature acorns that are most appropriate/responsive to

somatic embryogenesis induction are those with small size,
around 1 cm diameter, and green color; they contain immature
zygotic embryos at the early cotyledonary stage.
2. The pH of the media is adjusted to 5.6 with NaOH prior to
adding the solidifying agent (agar). Growth regulators and
agar are added before autoclaving, and after that glutamine is
added by filter sterilization using filters of 0.22 μm.
3. Induction medium is dispensed in 90 mm Petri dishes (around
25 mL per dish), and five immature zygotic embryos (previ-
ously sterilized) are placed per Petri dish.
4. Since development is asynchronous and recurrent secondary
embryogenesis can happen any time in each individual embryo,
plates of proliferation medium usually exhibit a wide repertoire
of embryogenic masses of different sizes and somatic embryos
at various developmental stages, from early globular, torpedo
till immature cotyledonary embryos.
5. Somatic embryogenesis cultures in the proliferation medium
maintain their embryogenic capacity for many months and are
used as a continuous source of new somatic embryos.
6. To promote germination, partial desiccation of mature
embryos can be performed prior to transfer to germination
medium, although it can be achieved without this
pretreatment.
Acknowledgments
Work supported by projects funded by the Spanish Ministry of

Economy and Competitiveness, MINECO, and the European
Regional Development Fund (ERDF/FEDER) of the European
Commission (BFU2011-23752, AGL2014-52028-R, AGL2017-
82447-R).
References
1. Germanà MA, Lambardi M (2016) In vitro mixture. Ann For Sci 67:205. https://doi.
embryogenesis in higher plants. Springer, org/10.1051/forest/2009098
New York/Heidelberg/Dordrecht/London. 11. García-Martín G, Manzanera JA, González-
https://doi.org/10.1007/978-1-4939-3061-6 Benito E (2005) Effect of exogenous ABA on
2. Loyola-Vargas VM, Ochoa-Alejo N (2016) embryo maturation and quantification of
Somatic embryogenesis: fundamental aspects endogenous levels of ABA and IAA in Quercus
and applications. Springer, New York/ suber somatic embryos. Plant Cell Tiss Org
Heidelberg. https://doi. 80:171–177. https://doi.org/10.1007/
org/10.1007/978-3-319-33705-0 s11240-004-1056-y
3. Maury PV, Manzanera JA (2003) Induction, 12. Gómez-Garay A, López JA, Camafeita E et al
maturation and germination of holm oak (2013) Proteomic perspective of Quercus suber
(Quercus ilex L.). Plant Cell Tiss Org 74:229– somatic embryogenesis. J Proteome 93:314–
235. https://doi.org/10.1023/A:10240729 325. https://doi.org/10.1016/j.jprot.2013.
13021 06.006
4. Corredoira E, Toribio M, Vieitez E (2014) 13. Gómez-Garay A, López JA, Pintos B et al
Clonal propagation via somatic embryogenesis (2009) Proteomic analysis from haploid and
in Quercus spp. In: Ramawhat KG, Mérillon diploid embryos of Quercus suber L. identifies
JM, Ahuja MR (eds) Tree biotechnology. CRC qualitative and quantitative differential expres-
Press, Boca Raton, FL, pp 262–302 sion patterns. Proteomics 9:4355–4367.
5. Corredoira E, Cano V, Bárány I et al (2017) https://doi.org/10.1002/pmic.200900179
Initiation of leaf somatic embryogenesis 14. Bueno MA, Gómez A, Sepulveda F et al (2003)
involves high pectin esterification, auxin accu- Microspore-derived embryos from Quercus
mulation and DNA demethylation in Quercus suber anthers mimic zygotic embryos and main-
alba. J Plant Physiol 213:42–54. https://doi. tain haploidy in long-term anther culture.
org/10.1016/j.jplph.2017.02.012 J Plant Physiol 160:953–960. https://doi.
6. Barra-Jiménez A, Blasco M, Ruiz-Galea M et al org/10.1078/0176-1617-00800
(2014) Cloning mature holm oak trees by 15. Ramírez C, Testillano PS, Pintos B et al (2004)
somatic embryogenesis. Trees 28:657–667. Changes in pectins and MAPKs related to cell
https://doi.org/10.1007/s00468-014- development during early microspore embryo-
0979-0 genesis in Quercus suber L. Eur J Cell Biol
7. Bueno MA, Astorga R, Manzanera JA (1992) 83:213–225. https://doi.org/10.1078/
Plant regeneration through somatic embryo- 0171-9335-00368
genesis in Quercus suber L. Physiol Plant 16. Rodríguez-Sanz H, Manzanera JA, Solís MT
85:30–34. https://doi.org/10.1111/j.1399- et al (2014) Early markers are present in both
3054.1992.tb05259.x embryogenesis pathways from microspores and
8. Manzanera JA, Astorga R, Bueno MA (1993) immature zygotic embryos in cork oak, Quercus
Somatic embryo induction and germination in suber L. BMC Plant Biol 14:224. https://doi.
Quercus suber L. Silvae Genet 42:90–93 org/10.1186/s12870-014-0224-4
9. Hernández I, Celestino C, Toribio M (2003) 17. Murashige T, Skoog F (1962) A revised medium
Vegetative propagation of Quercus suber L. by for rapid growth and bio assays with tobacco tis-
somatic embryogenesis. I: factors affecting the sue cultures. Physiol Plant 15:473–497. https://
induction in leaves from mature cork oak trees. doi.org/10.1111/j.1399-3054.1962.tb08052.x
Plant Cell Rep 21:759–764. https://doi. 18. Sommer HE, Brown CL, Kormanik PP (1975)
org/10.1007/s00299-003-0604-y Differentiation of plantlets in longleaf pine
10. Pintos B, Manzanera JA, Bueno MA (2010) (Pinus palustris Mill.) tissue culture in vitro.
Oak somatic and gametic embryos maturation Bot Gaz 136:196–200. https://doi.
is affected by charcoal and specific amino acids org/10.1086/336802
Chapter 17
Cryotherapy: A Novel Method for Virus Eradication

in Economically Important Plant Species
Min-Rui Wang, Long Chen, Zhibo Zhang, Dag-Ragnar Blystad,
and Qiao-Chun Wang
Abstract
Virus diseases have been a great threat to production of economically important crops. In practice, the use
of virus-free planting material is an effective strategy to control viral diseases. Cryotherapy, developed
based on cryopreservation, is a novel plant biotechnology tool for virus eradication. Comparing to the
traditional meristem culture for virus elimination, cryotherapy resulted in high efficiency of pathogen
eradication. In general, cryotherapy includes seven major steps: (1) introduction of infected plant materials
into in vitro cultures, (2) shoot tip excision, (3) tolerance induction of explants to dehydration and subse-
quent freezing in liquid nitrogen (LN), (4) a short-time treatment of explants in LN, (5) warming and
post-culture for regeneration, (6) re-establishment of regenerated plants in greenhouse conditions, and (7)
virus indexing.
Key words Cryotherapy, Droplet-vitrification, Encapsulation-dehydration, RT-PCR, Shoot tips,

Virus eradication
1 Introduction
Horticultural crops such as fruit trees, floricultural species and

ornamentals, tuber crops including potato, sweet potato and cas-
sava, and all cash crops are economically important crop species.
Virus diseases constitute a major constraint for high yield and
quality production of crops [1, 2]. Most of the economically
important crops are vegetatively propagated by either grafting or
rooting of cuttings in order to maintain the unique straits of the
cultivars, thus resulting in virus transmission from the infected
stock plants to the propagating materials. Unlike other diseases
induced by fungus and bacterium, viral diseases cannot be con-
trolled by chemical, once they are infected. Cultivation of virus-
free plants has long been/is being used for efficient control of viral
diseases in commercial production of economically important
257
258 Min-Rui Wang et al.
crops [3–8]. The usage of virus-free plant materials has brought

great benefits to sustainable production of crops [9–11].
Production of certified stock plants is a prerequisite for the use
of virus-free plants. To date, various methods have been estab-
lished, including meristem culture [12, 13], micrografting [14,
15], thermotherapy, and thermotherapy followed by meristem cul-
ture [16–19]. Continuous development of simpler, lower-cost,
and more efficient methods for virus eradication would improve
sustainable agricultural production.
Cryotherapy refers to a short-time treatment of the infected sam-
ples in liquid nitrogen (LN) to eradicate pathogens from them [20]
and is developed based on cryopreservation [20, 21]. Since Brison
et al. [22] reported for the first time successful eradication of Plum
pox virus (PPV) from the infected shoot tips of the interspecific
Prunus rootstock cv. Fereley-Jaspi (R), cryotherapy has been applied
to eradication of 19 viruses, 2 phytoplasmas, 2 viroids, and 1 bacte-
rium in various crops including annual and perennial crops and her-
baceous and woody species grown in various climatic regions ranging
subtropical to temperate zones (Table 1). Interestingly, all of the
above studies concentrated on economically important crops.
Virus is unevenly distributed inside plants [38]. Virus titer
decreases as the distance increases from apical dome of the shoot
tip, thus resulting in very low virus titer or even a virus-free area in
shoot tips [23, 28, 29]. When shoot tips are treated in LN, only
cells locating in top layers of the apical dome (AD) are able to sur-
vive, while cells locating in lower parts of the AD are killed [23, 28,
29]. Thus, plants regenerated from cryo-treated shoot tips can be
free of virus infection.
Compared to the more traditional methods such as meristem
culture, several characteristics of cryotherapy are summarized as
follows: (1) cryotherapy of shoot tips consistently results in high
frequency of pathogen eradication [22, 24, 25, 28, 29, 34]; (2)
although size of the shoot tips may affect virus eradication fre-
quency, the size that can efficiently eradicate virus is much bigger
than that required in the meristem culture [12, 24, 34, 39], thus
avoiding difficulties in excision of small meristems, which requires
skillful technicians and is time-consuming; (3) frequency of virus
eradication is not affected by cryotherapy methods [25]. Since
various cryogenic procedures are available for specific species or
genotypes, if a cryogenic protocol fails in the species or genotype,
others can be applied; (4) cryotherapy does not require extra
equipment and chemical, as required by the meristem culture.
Furthermore, time period for production of virus-free plants is
similar to, or even shorter than, the meristem culture; (5) plant
regeneration produced by cryotherapy is generally lower than that
by the meristem culture but high enough to be acceptable in terms
of production of nuclear stock plants; (6) a genotype-specific
response is common, which is also found in meristem culture for
virus eradication [12].
Cryotherapy and Virus Eradication 259
Table 1
Application of cryotherapy of shoot tips to pathogen eradication
Cryopreservation Pathogen
Plant method eradicated Ref.
Prunus Vitri PPV [22]
Banana Vitri CMV, BSV [23]
Vitis Vitri GVA [24]
Potato 4.1.1.1. Encap-dehy, PLRV, PVY [25]
Encap-vitri, Drop-vitri
Citrus Vitri HLB [26]
Sweet potato Encap-dehy SPLL [27]
Raspberry Encap-vitri RBDV [28]
Sweet potato Encap-vitri SPCSV, SPFMV [29]
Vitis Encap-dehy GVA [30]
Dioscorea opposita Encap-dehy YMV [31]
Cynara scolymus Vitri ALV [32]
Apricot Vitri PPV [33]
Malus Encap-dehy ASPV [34]
Malus Vitri ACLSV, ASPV, [35]
ASGV, ApMV
Garlic Vitri OYDV, LYSV, [36]
GCLV
Chrysanthemum Vitri CSVd, CChMVd [37]
Drop-vitri droplet-vitrification, Encap-dehy encapsulation-dehydration, Encap-vitri
encapsulation-vitrification, Vitri vitrification, Drop-vitri droplet-vitrification, PPV Plum
pox virus, CMV Cucumber mosaic virus, BSV banana streak virus, GVA Grapevine virus
A, PLRV Potato leafroll virus, PVY Potato virus Y, HLB Huanglongbing, SPLL Sweet
potato little leaf phytoplasma, RBDV Raspberry bushy dwarf virus, SPCSV Sweet
potato chlorotic stunt virus, SPFMV Sweet potato feathery mottle virus, YMV Yam
mosaic virus, ALV Artichoke latent virus, ASPV Apple stem pitting virus, ACLSV Apple
chlorotic leafspot virus, ASGV Apple stem grooving virus, ApMV Apple mosaic virus,
OYDV Onion yellow dwarf virus, LYSV Leek yellow strip virus, GCLV Garlic common
latent virus, CSVd Chrysanthemum stunt viroid, CChMVd Chrysanthemum chlorotic
mottle viroid
In this chapter, encapsulation-dehydration and droplet-

vitrification, the two efficient cryotherapies described by Li et al.
[34] for eradication of apple stem pitting virus (ASPV), are taken
to demonstrate cryotherapy for eradication of ASPV from diseased
apple “Gala.” Main steps involved in these two methods for virus
eradication are shown in Fig. 1.
Fig. 1 Main steps in cryotherapy of shoot tips for pathogen eradication by encapsulation-dehydration (1) and
droplet-vitrification (2). LN = liquid nitrogen. In many cases a loading step was conducted before PVS2 treat-
ment by using a loading solution (2 M glycerol +0.4 M sucrose)
2 Materials
Unless otherwise stated, all materials, media, solutions, and equip-

ment are sterile, usually by surface-sterilization or autoclaving, as
required in in vitro tissue culture.
2.1 General 1. Aluminum foil strips.

Equipment 2. Binocular microscope.
3. Disposable pipette tips (10 μL, 200 μL, 1 mL).
4. Gel electrophoresis apparatus.
5. Gel imaging system with UV light.
6. LN supply tank (25–50 L).
7. PCR thermal cycler.
8. Peat substrate.
9. Pipettes (10 μL, 200 μL, 1 mL).
10. Plastic pots (30 cm).
11. Screw-capped bottles (250 mL, 500 mL, 1000 mL).
12. Standard tissue culture facilities.
13. Sterile filter paper.
14. Sterile Petri dishes (9 cm).
15. Styrofoam containers for LN (1–2 L).
16. Water bath (set at 38 °C).
2.2 Chemicals 1. Agar.

and Agents 2. 6-Benzyladenine (BA).
2.2.1 Establishment 3. Distilled water.
and Maintenance of In Vitro 4. Ethanol (75%).
Cultures
5. Indole-3-butyric acid (IBA).
6. Murashige and Skoog basal medium powder [40].

7. Sodium hypochlorite.
8. Sucrose.
2.2.2 Cryotherapy, Plant 1. Agar.

Regeneration, 2. 6-Benzyladenine (BA).
and Reestablishment
3. Calcium chloride.
of Plants in Soil
4. Dimethyl sulfoxide (DMSO).
5. Ethylene glycol.
6. Glycerol.
7. Indole-3-butyric acid (IBA).
8. Liquid nitrogen.
9. Murashige and Skoog basal medium powder [40].
10. Naphthaleneacetic acid (NAA).
11. Sodium alginate.
12. Soil mix.
13. Sucrose.
2.2.3 Virus Detection 1. Agarose.

2. dNTPs (10 mM).
3. Ethidium bromide.
4. Ethylenediaminetetraacetic acid (EDTA).
5. Liquid nitrogen.
6. MgCl2 (25 mM).
7. 10× PCR buffer [200 mM Tris-HCl (pH 8.4) plus 500 mM KCl].
8. Primers for the target virus.
9. Taq DNA polymerase (2 U).
10. RNase-free water.
11. RNaseOUT™ (40 units μL−1).
12. Spectrum™ Plant Total RNA Kit.
13. SuperScript™ II Reverse Transcriptase.
14. Tris-acetate.
2.3 Media 1. Basic medium (BM): MS containing 30 g L−1 sucrose, 0.25 g L−1

and Solutions BA, 0.01 g L−1 IBA, solidified by 8 g L−1 agar (pH, 5.8).
2. CaCl2 solution: liquid MS medium containing 0.1 M calcium
chloride, 2 M glycerol, and 0.4 M sucrose (pH, 5.8).
3. Hypochlorite solution (1%): commercial bleach solution
diluted in autoclaved distilled water.
4. Preculture medium I: MS medium supplemented with 0.75 M

sucrose, solidified by 8 g L−1 agar (pH, 5.8).
5. Preculture medium II: MS medium supplemented with 2 M
glycerol and 0.8 M sucrose, solidified by 8 g L−1 agar (pH, 5.8).
6. PVS2 vitrification solution: liquid MS medium added with
0.4 M sucrose, 30% glycerol (v/v), 15% ethylene glycol (v/v),
and 15% DMSO (v/v) (pH, 5.8).
7. Rooting medium (RM): MS supplemented with 30 g L−1
sucrose, 0.5 mg L−1 NAA, and 8 g L−1 agar (pH, 5.8).
8. Sodium alginate solution: liquid MS medium containing 3% (w/v)
sodium alginate, 2 M glycerol, and 0.4 M sucrose (pH, 5.8).
9. Tris-acetate (TAE) buffer [40 mM Tris-acetate, 1 mM EDTA
(pH, 8.0)].
10. Unloading solution: liquid MS medium added with 1.2 M
sucrose (pH, 5.8).
3 Methods
Plant materials are maintained in in vitro conditions, and all

experiments are performed, as required in in vitro culture.
3.1 Establishment 1. Shoots are collected from virus-infected trees grown in the
of Virus-Infected orchards or in greenhouse conditions.
In Vitro Stock Shoots 2. The shoots are cut into nodal segments, each being 0.5 cm in
length and containing one bud. The nodal segments are
surface-
sterilized, according to the standard procedure
required in in vitro culture.
3. Following surface-sterilization, buds (5.0 mm in length) are
excised from the nodal segments and cultured on BM.
4. The cultures are kept at a constant temperature of 24 ± 2 °C
under a 16-h photoperiod with light intensity of 50 μEs−1 m−2
provided by cool-white fluorescent tubes. Subculture is
performed once every 4 weeks. In vitro stock shoots are estab-
lished in about 6 months.
3.2 Excision Shoot tips (1.0–1.5 mm) containing 4–5 leaf primordia (LPs) are
of Shoot Tips excised from 4-week-old stock cultures and maintained on BM for
1 day (see Note 1).
3.3 Cryotherapy 1. Shoot tips are suspended in sodium alginate solution.

3.3.1 Encapsulation- 2. The mixture of sodium alginate solution with shoot tips is
Dehydration dropped with a sterile pipette (1 mL) into CaCl2 solution and
maintained for 20 min to form beads, each being 4–5 mm in
diameter and containing one shoot tip (see Note 2).
3. Beads are taken out with forceps from the CaCl2 solution and
are surface-dried with sterilized filter papers for a few seconds.
4. The beads are precultured on the preculture medium I for
7 days (see Note 3).
5. After surface dry with sterile filter papers for a few seconds, the
precultured beads are transferred onto new sterile filter papers
placed on sterile Petri dishes, with 20 beads per each Petri dish.
6. The beads are air-dried in the laminar flow cabinet, to reduce
the water content of the beads to about 20% (see Note 4).
7. At the end of dehydration, the beads are transferred into cryo-
tubes (ten beads/cryotube) and immersed directly in LN for
30 min.
8. Cryotubes are removed from LN and rapidly placed in a water
bath set at 38 °C for 2 min.
3.3.2 Droplet-Vitrification 1. Shoot tips are precultured on preculture medium II in the dark
for 1 day.
2. Precultured shoot tips are exposed to PVS2 vitrification solu-
tion contained in Petri dishes and placed on rotary shaker at
50 rpm for 30–40 min at room temperature (see Note 5).
3. After PVS2 treatment, shoot tips are transferred into 3 μL
PVS2 droplets carried on aluminum foil trips (2 cm × 0.8 cm),
with each droplet containing one shoot tip. After then, the
aluminum foil trips are directly immersed in LN for 30 min.
4. Frozen aluminum foil strips are removed from LN and imme-
diately transferred into unloading solution at room tempera-
ture for 20 min (see Note 6).
3.4 Post-Thaw 1. Frozen-thawed beads from encapsulation-dehydration and

Culture for Shoot shoot tips from droplet-vitrification are cultured on BM for
Recovery recovery at 24 ± 2 °C in the dark.
and Establishment 2. The samples are transferred onto fresh BM every 16–24 h for
of Plants in Soil three times, to reduce browning (see Note 7).
3. After 3 days of culture in the dark, the samples are transferred
into the light conditions for shoot recovery.
4. Shoots (≥5.0 mm) regenerate directly, without callus forma-
tion, from cryopreserved shoot tips in about 8 weeks. Shoots
are further cultured on BM until shoots (≥2.0 cm) are
produced.
5. Shoots (≥2.0 cm) are transferred onto RM and cultured under
the light conditions. After 4 weeks of rooting, shoots with
well-developed roots are produced.
6. Rooted shoots are transferred into 30-cm pots containing peat

and grown for further growth in net-proofed greenhouse con-
ditions under a 16-h photoperiod and at 24/20 °C of day/
night temperatures (see Note 8). The plants are irrigated and
fertilized, according to practical recommendations. After
10 months of establishments of the plants in soil, samples are
taken and used for virus detection by RT-PCR.
3.5 Virus Detection Fully opened leaves are taken from three to five nodes of the
by RT-PCR greenhouse-grown plants and used for RT-PCR analysis.
3.5.1 RNA Extraction Total RNA is extracted from leaf tissue (0.1 g, fresh weight) and
and Purification purified using SpectrumTM Plant Total RNA Kit, according to the
manufacturer’s instructions.
3.5.2 cDNA Synthesis cDNA is synthesized in 1–5 μg of total RNA using SuperScript™ II
Reverse Transcriptase with RNaseOUT™ (40 units μL−1), accord-
ing to the manufacturer’s instructions.
3.5.3 PCR 1. PCR reaction solution contains 2.5 μL 10 × PCR buffer

[200 mM Tris-HCl (pH 8.4) plus 500 mM KCl], 0.75 μL
50 mM MgCl2, 0.5 μL 10 mM dNTP Mix, 0.5 μL forward
primer (10 μM), 0.5 μL reverse primer (10 μM), 0.25 μL Taq
DNA polymerase (5 U μL−1), 2 μL cDNA, and 18 μL RNase-
free water.
2. PCR amplification is carried out in a thermal cycler, using the
program recommended for the specific virus.
3.5.4 Gel Electrophoresis Gel electrophoresis of PCR products is performed in gel electro-
of PCR Products phoresis apparatus according to the standard program. PCR prod-
ucts in the gel are visualized using a gel imaging system under the
UV light.
4 Notes
1. Excision of shoot tips may cause mechanical injury or physical

stress to them. Culture of freshly excised shoot tips for 1 day
on BM helps to stabilize them and is beneficial to cryother-
apy [41].
2. Alginate concentration influences hardness of the beads and
the ability of cryo-treated shoot tips to grow out of the beads
following cryotherapy. Size of the beads affects time duration
of dehydration to reach a suitable water content of the beads.
Usually, calcium alginate solution containing 3% (w/v) algi-

nate is used [42]. Each bead is 4–5-mm in diameter and con-
tains one shoot tip [41].
3. Freshly harvested shoot tips are usually hard to survive freez-
ing in LN. Preculture of shoot tips with high sugar concentra-
tions (0.3–1.0 M) is usually used to induce tolerance of shoot
tips to dehydration and subsequent freezing in LN [42, 43].
Malus plants are tolerant to high sucrose concentration [41].
However, in some cases, stepwise preculture with increasing
sucrose concentrations is preferred to avoid deleterious effects
of direct exposure to high sucrose concentrations [24, 44].
4. Physical dehydration can be performed either by air-drying in
laminar flow cabinet or over silica gel [45]. Usually, the water
content for achieving optimal recovery of cryo-treated shoot
tips is about 20% (on fresh weight basis), regardless of dehy-
dration methods used [46].
5. In the vitrification-based procedures, freezable intracellular
water can be removed by exposing naked or encapsulated
shoot tips to a highly concentrated vitrification solution such
as PVS2 [47] or PVS3 [48]. The duration and temperature of
vitrification treatment are critical for the recovery of cryo-
treated shoot tips. According to Li et al. [49], the highest level
of recovery in Malus plants following cryotherapy can be
obtained by exposure of the samples to PVS2 solution at room
temperature for 30–50 min.
6. In droplet-vitrification, cryo-treated shoot tips are usually
rewarmed and unloaded in one step by placing the frozen alu-
minum foil into the unloading solution at room temperature
for 20 min [49, 50]. Use of unloading solution can remove
PVS from the shoot tips, which is toxic to the samples.
7. Apple plant contains high levels of polyphenols, which fre-
quently cause browning of cryo-treated shoot tips [51].
Transfer of cryo-treated shoot tips to fresh medium could effi-
ciently reduce browning [41].
8. Growing of plants in net-proofed greenhouses can avoid risks
of reinfection of the plants by other pathogens including
virus [25].
Acknowledgments
The authors acknowledge financial support from the fund pro-

vided by the Department of Science and Technology of Shaanxi
Province (2014KTCL02-05).
References
1. Loebenstein G, Akad F (2006) The local lesion J 62:499–504. https://doi.org/10.2503/
response. In: Loebenstein G, Carr JP (eds) jjshs.62.499
Natural resistance mechanisms of plants to 12. Plopa C, Preda S (2013) Elimination of Apple
viruses. Springer, Dordrecht, pp 99–124. mosaic virus by tissue culture of some infected
https://doi.org/10.1007/1-4020-3780-5_5 apple cultivars. Acta Hortic 981:517–522.
2. Hadidi A, Barba M (2011) Economic impact https://doi.org/10.17660/
of pome and stone fruit viruses and viroids. In: ActaHortic.2013.981.83
Hadidi A, Barba M, Candresse TH, Jelkmann 13. Quak F (1977) Meristem culture and virus free
W (eds) Virus and virus-like diseases of pome plants. In: Reinert J, Bajaj YPS (eds) Applied
and stone fruits. APS Press, Paul, MN, pp 1–7. and fundamental aspects of plant cell, tissue
http://hdl.handle.net/11698/52779 and organ culture. Springer, Berlin, Heidelberg,
3. Faccioli G, Marani F (1998) Virus elimination pp 598–615. https://doi.
by meristem tip culture and tip micrografting. org/10.1007/978-3-662-02279-5_5
Plant virus disease control. APS Press, St. Paul, 14. Huang SC, Millikan DF (1980) In vitro micro-
MN, pp 346–380 grafting of apple shoot tips. Hortscience
4. Mink G, Wample R, Howell W (1998) Heat 15:741–743
treatment of perennial plants to eliminate phy- 15. Dobránszki J, Da SJ (2010) Micropropagation
toplasmas, viruses and viroids while maintain- of apple—a review. Biotechnol Adv 28:462–
ing plant survival. Plant virus disease control. 488. https://doi.org/10.1016/j.
APS Press, St. Paul, MN, pp 332–345 biotechadv.2010.02.008
5. Laimer M, Barba M (2011) Elimination of sys- 16. Ucman R, ŽEl J, Ravnikar M (1998)
temic pathogens by thermotherapy, tissue cul- Thermotherapy in virus elimination from gar-
ture, or in vitro micrografting. In: Hadidi A, lic: influences on shoot multiplication from
Barba M, Candresse TH, Jelkmann W (eds) meristems and bulb formation in vitro. Sci
Virus and virus-like diseases of pome and stone Hortic (Amsterdam) 73:193–202. https://
fruits. Paul, MN, APS Press, pp 389–393. doi.org/10.1016/S0304-4238(98)00074-0
http://hdl.handle.net/11698/52862 17. Paprstein F, Sedlak J, Polak J et al (2008)
6. EPPO (1998) Certification schemes PM4/1– Results of in vitro thermotherapy of apple cul-
26. European and Mediterranean Plant tivars. Plant Cell Tiss Org 94:347–352.
Protection Organization, Paris https://doi.org/10.1007/
7. Loebenstein G, Thottappilly G (2013) Virus s11240-008-9342-8
and virus-like diseases of major crops in devel- 18. Tan RR, Wang LP, Hong N, Wang GP (2010)
oping countries. Springer-Science + Business Enhanced efficiency of virus eradication fol-
Media, Berlin. https://doi. lowing thermotherapy of shoot-tip cultures of
org/10.1007/978-94-007-0792-7 pear. Plant Cell Tiss Org 101:229–235.
8. Brink JA, Woodward BR, DaSilva EJ (1998) https://doi.org/10.1007/
Plant biotechnology: a tool for development in s11240-010-9681-0
Africa. Electron J Biotechnol 1:14–15. 19. Wang L, Wang G, Hong N et al (2006) Effect
https://doi.org/10.4067/ of thermotherapy on elimination of Apple stem
S0717-34581998000300004 grooving virus and Apple chlorotic leaf spot
9. Cieślińska M, Rutkowski K (2008) Effect of virus for in vitro-cultured pear shoot tips.
Apple chlorotic leaf spot virus on yield and Hortscience 41:729–732
quality of fruits from ‘Golden delicious’ and 20. Wang QC, Valkonen JPT (2009) Cryotherapy
‘Sampion’ apple trees. Acta Hortic 781:119– of shoot tips: novel pathogen eradication
124. https://doi.org/10.17660/ method. Trends Plant Sci 14:119–122.
ActaHortic.2008.781.17 https://doi.org/10.1016/j.
10. Li JW, Wang B, Song XM et al (2013) Potato tplants.2008.11.010
leafroll virus (PLRV) and Potato virus Y (PVY) 21. Wang Q, Panis B, Engelmann F et al (2009)
influence vegetative growth, physiological Cryotherapy of shoot tips: a technique for
metabolism, and microtuber production of pathogen eradication to produce healthy plant-
in vitro-grown shoots of potato (Solanum ing materials and prepare healthy plant genetic
tuberosum L.). Plant Cell Tiss Org 114:313– resources for cryopreservation. Ann Appl Biol
324. https://doi.org/10.1007/ 154:351–363. https://doi.
s11240-013-0327-x org/10.1111/j.1744-7348.2008.00308.x
11. Koike H, Makita H, Tsukahara K (2008) Effect 22. Brison M, de Boucaud MT, Pierronnet A,
of an apple chlorotic leaf spot virus-free M.9 Dosba F (1997) Effect of cryopreservation on
rootstock on the growth of apple trees. Hortic the sanitary state of a cv Prunus rootstock
experimentally contaminated with Plum Pox 33. Şekerz MG, Süzerer V, Elibuyuk I, Çiftçi YÖ
Potyvirus. Plant Sci 123:189–196. https:// (2015) In vitro elimination of PPV from
doi.org/10.1016/S0168-9452(97)04581-0 infected apricot shoot tips via chemotherapy
23. Helliot B, Panis B, Poumay Y et al (2002) and cryotherapy. Int J Agric Biol 17:1066–
Cryopreservation for the elimination of cucum- 1070. https://doi.org/10.17957/
ber mosaic and banana streak viruses from IJAB/15.0024
banana (Musa spp.). Plant Cell Rep 20:1117– 34. Li BQ, Feng CH, Hu LY et al (2016) Shoot tip
1122. https://doi.org/10.1007/ culture and cryopreservation for eradication of
s00299-002-0458-8 Apple stem pitting virus (ASPV) and Apple
24. Wang Q, Mawassi M, Li P et al (2003) stem grooving virus (ASGV) from apple root-
Elimination of grapevine virus A (GVA) by stocks ‘M9’ and ‘M26’. Ann Appl Biol
cryopreservation of in vitro-grown shoot tips 168:142–150. https://doi.org/10.1111/
of Vitis vinifera L. Plant Sci 165:321–327. aab.12250
https://doi.org/10.1016/ 35. Romadanova NV, Mishustina SA, Gritsenko
S0168-9452(03)00091-8 DA et al (2016) Cryotherapy as a method for
25. Wang Q, Liu Y, Xie Y, You M (2006) reducing the virus infection of apples (Malus
Cryotherapy of potato shoot tips for efficient sp.). CryoLetters 37:1–9
elimination of Potato leafroll virus (PLRV) and 36. Vieira RL, da Silva AL, Zaffari GR et al (2015)
Potato virus Y (PVY). Potato Res 49:119–129. Efficient elimination of virus complex from
https://doi.org/10.1007/ garlic (Allium sativum L.) by cryotherapy of
s11540-006-9011-4 shoot tips. Acta Physiol Plant 37:1733.
26. Ding F, Jin S, Hong N et al (2008) Vitrification– https://doi.org/10.1007/
cryopreservation, an efficient method for elimi- s11738-014-1733-3
nating Candidatus Liberobacter asiaticus, the 37. Jeon SM, Naing AH, Kim H-H et al (2016)
citrus Huanglongbing pathogen, from in vitro Elimination of Chrysanthemum stunt viroid
adult shoot tips. Plant Cell Rep 27:241–250. and Chrysanthemum chlorotic mottle viroid
https://doi.org/10.1007/ from infected Chrysanthemum by cryopreser-
s00299-007-0467-8 vation. Protoplasma 253:1135–1144. https://
27. Wang Q, Valkonen J (2008) Efficient elimina- doi.org/10.1007/s00709-015-0874-6
tion of sweetpotato little leaf phytoplasma from 38. White PR (1934) Multiplication of the viruses
sweet potato by cryotherapy of shoot tips. of tobacco and Aucuba mosaics in g rowing
Plant Pathol 57:338–347. https://doi. excised tomato root tips. The Rockefeller
org/10.1111/j.1365-3059.2007.01710.x Institute, USA, p 581
28. Wang Q, Cuellar WJ, Rayamäkl ML et al 39. Wang MR, Li BQ, Feng CH, Wang QC (2016)
(2008) Combined thermotherapy and cryo- Culture of shoot tips from adventitious shoots
therapy for efficient virus eradication: relation can eradicate Apple stem pitting virus but fails
of virus distribution, subcellular changes, cell in Apple stem grooving virus. Plant Cell Tiss
survival and viral RNA degradation in shoot Org 125:283–291. https://doi.org/10.1007/
tips. Mol Plant Pathol 9:237–250. https:// s11240-016-0948-y
doi.org/10.1111/j.1364-3703.2007.00456.x 40. Murashige T, Skoog F (1962) A revised
29. Wang Q, Valkonen J (2008) Elimination of medium for rapid growth and bio assays with
two viruses which interact synergistically from tobacco tissue cultures. Physiol Plant 15:473–
sweet potato by shoot tip culture and cryother- 497. https://doi.
apy. J Virol Methods 154:135–145. https:// org/10.1111/j.1399-3054.1962.tb08052.x
doi.org/10.1016/j.jviromet.2008.08.006 41. Feng CH, Cui ZH, Li BQ et al (2013)
30. Bayati S, Shams-Bakhsh M, Moini A (2011) Duration of sucrose preculture is critical for
Elimination of grapevine virus A (GVA) by shoot regrowth of in vitro-grown apple shoot-
cryotherapy and electrotherapy. J Agr Sci tips cryopreserved by encapsulation-dehydra-
Technol 13:442–450 tion. Plant Cell Tiss Org 112:369–378.
31. Hee Shin J, Kyoon Kang D, Keun Sohn https://doi.org/10.1007/
J (2013) Production of yam mosaic virus s11240-012-0245-3
(ymv)-free Dioscorea opposita plants by cryo- 42. Kushnarenko SV, Romadanova NV, Reed BM
therapy of shoot-tips. CryoLetters (2009) Cold acclimation improves regrowth of
34:149–157 cryopreserved apple shoot tips. CryoLetters
32. Taglienti A, Tiberini A, Barba M (2013) 30:47–54
Cryotherapy: a new tool for the elimination of 43. Sakai A, Matsumoto T (1999) Cryopreservation
artichoke viruses. J Plant Pathol 95:597–602 of in vitro-cultured axillary shoot tips of Vitis
by vitrification. Acta Hortic 538:177–181. 48. Nishizawa S, Sakai A, Amano Y, Matsuzawa T

https://doi.org/10.17660/ (1993) Cryopreservation of asparagus
ActaHortic.2000.538.28 (Asparagus officinalis L.) embryogenic suspen-
44. Niino T, Sakai A (1992) Cryopreservation of sion cells and subsequent plant regeneration by
alginate-coated in vitro-grown shoot tips of vitrification. Plant Sci 91:67–73. https://doi.
apple, pear and mulberry. Plant Sci 87:199– org/10.1016/0168-9452(93)90189-7
206. https://doi. 49. Li BQ, Feng CH, Wang MR et al (2015)
org/10.1016/0168-9452(92)90151-B Recovery patterns, histological observations
45. Forni C, Braglia R, Beninati S et al (2010) and genetic integrity in Malus shoot tips cryo-
Polyamine concentration, transglutaminase preserved using droplet-vitrification and
activity and changes in protein synthesis during encapsulation-dehydration procedures.
cryopreservation of shoot tips of apple variety J Biotechnol 214:182–191. https://doi.
Annurca. CryoLetters 31:413–425 org/10.1016/j.jbiotec.2015.09.030
46. Wang Q, Tanne E, Arav A, Gafny R (2000) 50. Halmagyi A, VăLimăReanu S, Coste A et al
Cryopreservation of in vitro-grown shoot tips (2010) Cryopreservation of Malus shoot tips
of grapevine by encapsulation-dehydration. and subsequent plant regeneration. Rom
Plant Cell Tiss Org 63:41–46. https://doi.org Biotechnol Lett 15:79–85
/10.1023/A:1006411829738 51. Wang QC, Tang H, Quan Y, Zhou GR (1994)
47. Sakai A, Kobayashi S, Oiyama I (1990) Phenol induced browning and establishment
Cryopreservation of nuclear cells of navel of shoot-tip explants of ‘Fuji’ apple and ‘Jinhua’
orange (Citrus sinensis Osb. var. brasiliensis pear cultured in vitro. J Hortic Sci 69:833–
Tanaka) by vitrification. Plant Cell Rep 9:30– 839. https://doi.org/10.1080/14620316.19
33. https://doi.org/10.1007/BF00232130 94.11516519
Chapter 18
Cryopreservation of Pineapple Shoot Tips by the Droplet

Vitrification Technique
Fernanda Vidigal Duarte Souza, Everton Hilo de Souza, Ergun Kaya,
Lívia de Jesus Vieira, and Ronilze Leite da Silva
Abstract
Cryopreservation is a technique that allows the conservation of many species for long periods. Among the
protocols used for cryopreservation, droplet vitrification has shown efficient results in preserving shoot tips
of various wild and cultivated pineapple genotypes. The method consists of extraction of shoot tips from
plants grown in vitro, dehydration for a period of 48 h in a preculture medium supplemented with a high
concentration of sucrose, treatment in a plant vitrification solution (PVS2), and immersion in liquid nitro-
gen. The method described in this chapter has produced survival and regeneration indices of around 70%,
depending on the genotype and physiological conditions of the initial explants. The objective of this chap-
ter is to describe in detail a droplet vitrification protocol for shoot tips that is easy to perform for cryo-
preservation of pineapple germplasm.
Key words Ananas comosus, Conservation, Plant vitrification solution
1 Introduction
Pineapple (Ananas comiosus L. Merrill) is one of the world’s most

popular tropical fruits [1] and Brazil is one of the centers of origin
and genetic diversity of this species [2, 3]. However, anthropiza-
tion and the use of only a few varieties for commercial cultivation
have caused serious genetic erosion of the genus, requiring urgent
actions to conserve the species. Among the main conservation
strategies employed are conservation in field conditions or green-
houses/covered areas, slow growth in vitro conservation, and
cryopreservation [3–5].
In recent decades, due to the advances achieved with cryo-
preservation techniques, it has become an extremely interesting
alternative, since it can maintain species for long periods at ultralow
temperatures (−196 °C) or in the nitrogen vapor phase (−150 °C)
[5–14]. The use of this preservation strategy allows maintaining
large collections of biological material without the need of periodic
269
270 Fernanda Vidigal Duarte Souza et al.
interventions, as occurring with in vitro conservation, since at

ultralow temperatures, the cell metabolism is so slow that biologi-
cal deterioration is virtually halted [15]. The cessation of the plant
metabolism while maintaining the cellular integrity makes this
form of preservation attractive, as does the relatively low cost [16].
The most expensive aspect of this technique is the cost of establish-
ing the basic storage structure, namely, the cryogenic tanks and
nitrogen flow system [17, 18]. However, the widespread use of
this technique still requires research and adjustments of factors
considered to be limiting. One of these limiting aspects is the high
level of specificity in the behavior of species when submitted to
ultra-frozen conditions, creating a genotype dependence on the
development of protocols [19]. Hence there is a need for studies
aimed at species of interest. To be successful, cryopreservation pro-
cedures demand precision and meticulous attention to the details
of each step. In the case of pineapple, studies in this respect began
in the 1990s [6]. More recently, Souza et al. [5] established an
efficient droplet vitrification protocol for 16 genotypes and 4 vari-
eties, both wild and cultivated, achieving regeneration rates of
around 70%. This protocol has been since then applied to other
pineapple genotypes with good results and is presented in this with
sufficient detail to allow its replication.
The same authors have demonstrated the efficiency of this
technique and the causes of tissue injuries by means of light and
scanning electron microscopy.
2 Materials
Prepare all the solutions using ultrapure water and reagents with
high analytical purity grade. The solutions should be prepared and
stored at a temperature of 4 °C. The culture media should be
stored at room temperature in a dry and clean place, protected
from light. The residues generated should be treated and discarded
according to the applicable national or institutional regulations.
2.1 Culture Medium 1. MS culture medium [20] (basal salts), according to the manu-
for Multiplication facturer’s instructions, 0.05 μM of naphthalene acetic acid
of Explants (NAA) + 0.09 μM of benzyladenine (BA) and 0.09 M of
sucrose, 2.4 g L−1 of Phytagel® or 7 g L−1 of agar as solidifier,
pH 5.8 (see Note 1).
2.2 Preculture 1. MS culture medium [20] (basal salts) according to the manu-
Medium facturer’s instructions, 0.3 M of sucrose and 2.4 g L−1 of
Phytagel® or 7 g L−1 of agar as solidifier, pH 5.8 (see Note 2).
2.3 PVS2 Solution 1. Solution of MS [20] (basal salts) according to the manufac-
turer’s instructions, 30% (w/v) glycerol, 15% (w/v) ethylene
glycol, 15% (w/v) DMSO, and 0.4 M of sucrose (see Note 3).
Cryopreservation of Pineapple 271
2.4 Washing Solution 1. Solution of MS [20] (basal salts) according to the manufac-
turer’s instructions, 1.2 M of sucrose (see Note 4).
2.5 Regeneration 1. MS culture medium [20] (basal salts) according to the manu-
Medium facturer’s instructions, 0.22 μM of BAP, 0.09 M of sucrose,
2.4 g L−1 of Phytagel®, or 7 g L−1 of agar as solidifier, pH 5.8
(see Note 5).
2.6 Metal Supports 1. Sheets of aluminum foil with thickness of 0.25 mm,

for the Shoot Tips 2.5 cm × 0.5 cm (see Note 6).
3 Methods
Perform all procedures under standard laboratory conditions.

Some must be aseptic, in a laminar flow chamber.
3.1 Type of Explant 1. Buds from pineapple plants grown in vitro that have been iso-
to Use lated and subcultured for 45 days in a multiplication medium.
for Cryopreservation
3.2 Obtaining 1. Plants previously established in vitro [21] should be subcul-

and Multiplying tured in a laminar flow chamber every 45 days in the multipli-
the Explants cation culture medium (Fig. 1a).
2. The explants generated should be transferred to fresh multipli-
cation medium and incubated in a growth chamber (27 ± 1 °C;
photoperiod of 16 h) for 45 days to standardize all the starting
material (Fig. 2b) (see Note 7).
3.3 Excision 1. The shoot tips with maximum length of 0.5 mm should be
and Preculturing excised in an aseptic environment (laminar flow chamber) with
of Shoot Tips the aid of tweezers, scalpel (sterilized), and a stereoscopic
microscope (Fig. 2a), leaving a single leaf primordium (see
Note 8).
2. The shoot tips should be distributed in a Petri dish (Fig. 2b)
containing preculture medium (see Note 9) and then incu-
bated in an incubation chamber for 48 h at 26 ± 1 °C, photo-
period 16 h, and light intensity of 22 μmol m−2 s−1 to favor the
dehydration of the meristems.
3.4 Droplet 1. The precultured shoot tips should be deposited on aluminum

Vitrification of Shoot foil strips containing 4 μL droplets of the PVS2 vitrification
Tips in PVS2 Solution solution (Fig. 3) (see Note 10), remaining in contact with the
PVS2 solution for 45 min.
3.5 Immersion 1. The foil strips containing the shoot tips should be inserted in
of Shoot Tips in Liquid the sterile cryotubes and rapidly immersed in a bowl with liq-
Nitrogen uid nitrogen (see Note 11).
Fig. 1 (a) Multiplication procedure for generation of buds. (b) Standardized buds after cultivation in multiplica-
tion culture medium
Fig. 2 (a) Excised pineapple shoots with 1 mm length. (b) Shoot tips distributed in Petri dishes. Bars: 1 mm
2. After being quickly closed, the cryotubes should be attached to

the cannulas and immersed in the cryogenic tank at
-196 °C. This closure should preferably be done with part of
the cryotubes still immersed in the liquid nitrogen, to prevent
any possibility of variation of the internal temperature. The
immersion in the LN2 should be immediate.
Fig. 3 (a–b) Shoot tips being transferred and deposited on droplets of PVS2 on aluminum foil strips
3. The samples should remain in liquid nitrogen for the time

necessary.
3.6 Washing 1. The aluminum foil strips should be removed from the cryo-
and Culturing tube with the help of tweezers, and the face containing the
the Cryopreserved shoot tips should be placed in direct contact with the washing
Shoot Tips solution so that they come loose and remain immersed in the
solution at room temperature for 20 min. This entire proce-
dure should be performed in a laminar flow chamber.
2. The shoot tips should be cultured in Petri dishes containing
regeneration medium (see Note 12).
3. The dishes should be kept in a growth chamber with partial
absence of light in the first 48 h.
4. Cover the plates with white paper to reduce the incidence of
light on the tips recently removed from the LN2.
5. After this period, the dishes should remain in the growth
chamber (27 ± 1 °C; photoperiod of 16 h).
4 Notes
1. To prepare 1000 mL of the multiplication medium, follow

these steps: in a 1000 mL beaker, place 30 g of ultrapure
sucrose. Then add MS (basal salts) according to the manufac-
turer’s instructions and the BA and NAA regulators. Next add
a small volume of sterile deionized water until the beaker is
filled almost to 500 mL and homogenize the solution by swirl-
ing the beaker. Adjust the pH to 5.8 using a digital pH meter.
In another 1000 mL beaker, place about 500 mL of sterile
deionized water and 2.4 g of Phytagel®. Completely melt the
Phytagel® in a microwave oven and add the first solution. Top

up the volume to 1000 mL with sterile deionized water using
a test tube and distribute 80 mL aliquots of the culture medium
in a series of glass flasks with capacity of 800 mL, closing them
with lids. Autoclave the flasks at 120 °C for 20 min. Use the
culture medium only after it completely cools and solidifies
and within 1 month after its preparation.
2. To prepare 250 mL of culture medium, follow these steps: in a
250 mL beaker, place 25.675 g of ultrapure sucrose and 1.11 g
of MS (basal salts) according to the manufacturer’s instruc-
tions. Add a small volume of sterile deionized water until the
beaker is filled almost to 250 mL and homogenize the solution
by swirling the beaker. Adjust the pH to 5.8 using a digital pH
meter. Top up the volume with sterile deionized water to
250 mL using a test tube. Place 0.6 g of Phytagel® in a 500 mL
Erlenmeyer flask and add 0.6 g of the first solution. Seal the
Erlenmeyer flask and sterilize the solution by autoclaving at
121 °C for 20 min. In a laminar flow chamber, distribute the
culture medium in Petri dishes. Use the culture medium only
after it completely cools and solidifies and within 1 month after
its preparation.
3. To prepare 250 mL of the PVS2 solution, follow these steps.
In a 250 mL beaker, place 75 g of glycerol (purity > 99.5%),
34.1 mL of dimethyl sulfoxide (DMSO) (purity > 99.5%), and
33.8 mL of ethylene glycol (purity > 99.5%). To this mixture
add 34.25 g of ultrapure sucrose and 1.11 g of MS (basal salts)
according to the manufacturer’s instructions. Add a small vol-
ume of sterile deionized water until the beaker is filled almost
to 250 mL and homogenize the solution for several minutes by
swirling the beaker. Adjust the pH to 5.8 using a digital pH
meter. Top up the volume with sterile deionized water to
exactly 250 mL using a test tube. Take the solution to the lam-
inar flow chamber and carry out ultrafiltration using a syringe
and filter with pore diameter smaller than 0.22 μm. The recipi-
ent flask must be sterile, and the volume can be divided into
two or more Erlenmeyer flasks, which should be protected
from light and can be stored at 4 °C for up to 1 month. The
PVS2 solution cannot be sterilized by autoclaving, because it
contains volatile substances that can be lost during the
process.
4. To prepare 250 mL of the washing solution, follow these steps:
in a 250 mL beaker, place 102.69 g of ultrapure sucrose. Then
add 1.11 g of MS (basal salts) according to the manufacturer’s
instructions. Next, add a small volume of sterile deionized
water until the beaker is filled almost to 250 mL and homog-
enize the solution by swirling the beaker. Adjust the pH to 5.8
using a digital pH meter, and top up the volume with sterile
deionized water to exactly 250 mL utilizing a test tube. Take

the solution to the laminar flow chamber, and carry out ultra-
filtration using a syringe and filter with pore diameter smaller
than 0.22 μm. The recipient flask must be sterile, and the vol-
ume can be divided into two or more Erlenmeyer flasks, which
should be protected from light and can be stored at 4 °C for
up to 1 month. The washing solution also should be sterilized
by autoclaving. However, the solution can become darker in
color due to the start of caramelization of the sucrose.
5. To prepare 250 mL of the regeneration medium, follow these
steps: in a 250 mL beaker, place 7.5 g of ultrapure sucrose.
Then add MS (basal salts) according to the manufacturer’s
instructions. Next, add 12.5 μg of BA followed by a small vol-
ume of sterile deionized water until the beaker is filled almost
to 250 mL, and homogenize the solution by swirling the bea-
ker. Adjust the pH to 5.8 using a digital pH meter, and top up
the volume with sterile deionized water to exactly 250 mL
using a test tube. In a 500 mL Erlenmeyer flask, place 0.6 g of
Phytagel® and add the first solution. Seal the Erlenmeyer flask,
and sterilize the solution by autoclaving at 120 °C for 20 min,
and distribute the medium in Petri dishes with diameter of
90 mm. Use the culture medium only after it completely cools
and solidifies and within 1 month after its preparation.
6. Open the aluminum foil on a totally smooth countertop.
Moisten a cotton swab with acetone (purity > 99.5%) and pass
it over the aluminum foil several times, until the surface is
smooth and homogeneous. Using a ruler, fold the foil into two
parts and form a double strip with width of 1 cm. Cut into nar-
rower strips with width of 0.5 cm and length of 2 cm. Deposit
the strips in glass flasks and autoclave them at 120 °C for
20 min.
7. The number of buds should be twice the number of shoot tips
intended for extraction, because losses during retrieval are fre-
quent. At the moment of excising the shoot tips, the buds
should have a standard size, obtained by subculturing for
45 days, as mentioned in Subheading 3.2. If there is any sign
of etiolation of the plants, they should not be used to dissect
shoot tips. To prevent this, the incubation conditions should
be constant and precisely monitored.
8. Instruments (tweezers and scalpels) with small points should
be used to excise the shoot tips with the size necessary for
cryopreservation, since they facilitate removal of leaves around
the tips without causing injury to the surrounding tissue. This
is a process that requires great skill of the operator but can be
achieved with sufficient training and practice. To confirm that
the tips have length of 1 mm, a strip of ruled millimeter graph
paper (sterile) can be used as a reference. The removal of the

shoot tips is a crucial step for the technique’s success, because
the regeneration will only occur if the vegetative structures
have been preserved.
9. The shoot tips should be distributed with spaced 1 cm apart,
directed upward, with the base partially immersed in the
medium.
10. Aluminum foil strips should be distributed in the Petri dishes
over small blocks of sterile ice, and one of the ends of each strip
should be folded to facilitate handling. Sterile eyedroppers
should be used to distribute the droplets of the PVS2
solution.
11. The whole process of immersion in the liquid nitrogen and
transfer to the cryogenic tank should be carried out as fast as
possible to avoid sudden temperature variations. It is recom-
mended first to cool the cryotubes and to introduce the alumi-
num foil strips with the shoot tips within the LN2 in the bowl.
12. The excess solution should be removed using sterilized filter
paper. The tips should be placed on this paper for a few min-
utes and then distributed in the Petri dishes with the regenera-
tion medium, spaced 1 cm apart, directed upward, with the
base partially immersed in the medium.
Acknowledgments
The authors acknowledge Fundação de Amparo à Pesquisa do

Estado da Bahia (FAPESB), Conselho Nacional de Desenvolvimento
Científico e Tecnológico (CNPq), Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES)/
EMBRAPA program, and Embrapa Mandioca e Fruticultura for
financial support and Helder Lima Carvalho, technician of the
Laboratório de Cultura de Tecido de Plantas, for his valuable col-
laboration in preparing this chapter.
References
1. Food and Agriculture Organization, FAO 4. Silva RL, Ferreira CF, Lêdo CAS et al (2016)
(2017) Database. United States: database, Viability and genetic stability of pineapple
United States: FAO/FAOSTAT. http://fao- germplasm after 10 years of in vitro conserva-
stat.fao.org/. Accessed 28 Mar 2017 tion. Plant Cell Tiss Org 127:123–133.
2. Leal F, Antoni MG (1981) Espécies del género https://doi.org/10.1007/
Ananas: origem y distribución geográfica. Rev s11240-016-1035-0
Fac Agron 29:5–12 5. Souza FVD, Kaya E, Vieira LJ et al (2016)
3. Souza EH, Souza FVD, Costa MAPC et al Droplet-vitrification and morphohistological
(2012) Genetic variation of the Ananas genus studies of cryopreserved shoot tips of culti-
with ornamental potential. Genet Resour Crop vated and wild pineapple genotypes. Plant Cell
Evol 59:1357–1376. https://doi. Tiss Org 124:351–360. https://doi.
org/10.1007/s10722-011-9763-9 org/10.1007/s11240-015-0899-8
6. González-Arnao MT, Ravelo MM, Urra C et al preservation of doubled haploid explants of
(1998) Cryopreservation of pineapple (Ananas Malus x domestica Borkh. ‘Golden delicious’.
comosus) apices. CryoLetters 19:375–382 Sci Hortic 209:189–191. https://doi.
7. González-Arnao MT, Ravelo MM, Urra C et al org/10.1016/j.scienta.2016.06.030
(2000) Cryopreservation of pineapple (Ananas 14. Rathwell R, Popova E, Shukla MR, Saxena PK
comosus) apices by vitrification. In: Engelmann (2016) Development of cryopreservation
F, Takagi H (eds) Cryopreservation of tropical methods for cherry birch (Betula lenta L.), an
plant germplasm. JIRCAS/IPGRI, Japan, endangered tree species in Canada. Can J For
Italy, pp 390–392 Res 46:1284–1292. https://doi.
8. Gamez-Pastrana R, Martinez-Ocampo Y, org/10.1139/cjfr-2016-0166
Beristain CI, González-Arnao MT (2004) An 15. Engelmann F (2004) Plant cryopreservation:
improved cryopreservation protocol for pine- progress and prospects. In Vitro Cel Dev Biol
apple apices using encapsulation-vitrification. Plant 40:427–433. https://doi.org/10.1079/
CryoLetters 25:405–414 IVP2004541
9. Martinez-Montero ME, Martínez J, 16. Benson EE (2008) Cryopreservation of phyto-
Engelmann F, González-Arnao MT (2005) diversity: a critical appraisal of theory and prac-
Cryopreservation of pineapple [Ananas como- tice. Crit Rev Plant Sci 27:141–21910. https://
sus (L.) Merr] apices and calluses. Acta Hortic doi.org/10.1080/07352680802202034
666:127–130. https://doi.org/10.17660/ 17. Reed BM (2008) Plant cryopreservation: a prac-
ActaHortic.2005.666.12 tical guide. Springer, New York, NY. https://
10. Martinez-Montero ME, González-Arnao MT, doi.org/10.1007/978-0-387-72276-4
Engelmann F (2012) Cryopreservation of 18. Panis B (2009) Cryopreservation on Musa
tropical plant germplasm with vegetative prop- germplasm. Practical Guide, 2nd edn.
agation: review of sugarcane (Saccharum spp.) Bioversity International, Rome, Italy
and pineapple (Ananas comosus (L.) Merrill) 19. Engelmann F, Takagi H (eds) (2000)
cases. In: Katkov I (ed) Current frontiers in Cryopreservation of tropical plant germplasm.
cryopreservation. Intech, Croatia, pp 359– Current research progress and application.
396. https://doi.org/10.5772/32047 Japan International Research Center for
11. Adu-Gyamfi R, Wetten A, Lopez CMR (2016) Agricultural Sciences, Tsukuba, Japan/
Effect of cryopreservation and post- International Plant Genetic Resources Institute,
cryopreservation somatic embryogenesis on Rome, Italy
the epigenetic fidelity of cocoa (Theobroma 20. Murashige T, Skoog FA (1962) A revised
cacao L.). PLoS One 11:1–13. https://doi. medium for a rapid growth and bioassays with
org/10.1371/journal.pone.0158857 tobacco tissues cultures. Plant Physiol 15:473–
12. O’Brien C, Constantin M, Walia A et al (2016) 479. https://doi.
Cryopreservation of somatic embryos for avo- org/10.1111/j.1399-3054.1962.tb08052.x
cado germplasm conservation. Sci Hortic 21. Souza EH, Souza FVD, Carvalho MJS et al
211:328–335. https://doi.org/10.1016/j. (2012) Growth regulators and physical state of
scienta.2016.09.008 culture media in the micropropagation of orna-
13. Poisson AS, Berthelot P, Le Bras C et al (2016) mental pineapple hybrids. Plant Cell Cult
A droplet-vitrification protocol enabled cryo- Microprop 8:1–12
Chapter 19
Cryopreservation of Pollen Grains of Pineapple and Other

Bromeliads
Fernanda Vidigal Duarte Souza, Everton Hilo de Souza,
and Ronilze Leite da Silva
Abstract
Cryopreservation of pollen grains is an efficient technique to overcome asynchronous flowering and to
support actions for genetic improvement and conservation of important alleles. It can be used both by
germplasm curators and plant breeders. In the case of Bromeliaceae, a family with wide diversity but also
high vulnerability, the form of conservation can be crucial to prevent the increasing problem of genetic
erosion. This chapter describes a method of cryopreservation of pollen grains of different Bromeliaceae
species, including pineapple, after dehydration with silica and subsequent immersion in liquid nitrogen.
The efficiency of this protocol has been demonstrated by the high pollen viability percentage and produc-
tion of seeds after in vivo pollination with cryopreserved grains. The protocol can be used for cryopreserv-
ing pollen of many species of bromeliads and is easy to perform.
Key words Bromeliaceae, Conservation of genetic resources dehydration with silica, Genetic improve-
ment, Pollen conservation
1 Introduction
The family Bromeliaceae is well known around the world not only
for its many species of ornamental plants but also because pineap-
ple is one of the most popular and lucrative fruit crops [1–3].
However, the genetic erosion of the family has been increasing in
recent years, requiring strategic conservation actions.
Cryopreservation of pollen is a tool that can make a significant
contribution to the development of crosses/hybrids, in particular
to overcome asynchronous flowering and to preserve important
alleles [2, 3].
Studies of cryopreservation of pollen grains at low moisture
levels have been reported for various species, involving many dif-
ferent methods [2–6].
Different techniques have been used to prove the efficiency of
preserving pollen grains, from histochemical analysis to in vitro
279
germination tests, including in vitro hybridization, which is the

most reliable way to demonstrate the viability of preserved pollen.
Souza et al. [2], by microscopic examination, demonstrated the
effects of conserving Aechmea bicolor pollen under different envi-
ronmental conditions on the grains’ morphology and ultrastruc-
ture. They observed that without a dehydration step,
cryopreservation causes degradation of the cytoplasmic content
and formation of ice crystals, directly affecting the structural,
osmotic, and colligative integrity of the cells, causing physical rup-
tures and other mechanical injuries.
The dehydration time to obtain the most efficient moisture
level is variable among species. In the case of pineapple, Silva et al.
[3] conducted a study of genotypes of different botanical varieties
and found the best results after 6 h of dehydration with silica gel.
For bromeliads, Souza et al. [2] found 3 h to be the best dehydra-
tion time. Parton et al. [7, 8] reduced the moisture of anthers for
intervals between 3 and 6 h using silica gel and obtained satisfac-
tory results. Investigating germination, Towill [9] reported that
for efficient cryopreservation of pollen grains, the moisture level
should be reduced to 15–20%.
Factors such as temperature, physiological stage of the flower,
relative humidity in the storage environment, and moisture level in
the pollen should be considered in the treatments before freezing
and to maintain the viability of cryopreserved pollen grains [10, 11].
Determination of the ideal moisture level is crucial, both for
survival and maintenance of viability of pollen grains, because dur-
ing freezing and storage, ice crystals can form, rupturing the tissues
and damaging the structure [12–14]. Therefore, prior dehydration
of pollen grains with silica is essential but requires care because
excessive water removal can make the grains unviable [2, 15].
The viability of preserved pollen grains for crossbreeding
should be between 50 and 80%, and they should have well-
developed tubes [16]. As the grains age, the germination percent-
age and tube length tend to decrease.
The purpose of this chapter is to describe in detail a simple,
fast, inexpensive, and widely applicable method for cryopreserva-
tion of pollen grains of pineapple and other bromeliad species.
2 Materials
Cryopreservation of pollen grains requires accuracy due to the

small size of the structures to be conserved. The solutions should
be prepared with ultrapure water and reagents having high analyti-
cal purity grade. The residues generated should be treated and
discarded according to the applicable national or institutional

regulations.
Pollen Conservation of Bromeliads 281
2.1 Collection 1. Ethanol (70% in water), sterile Petri dishes, small tweezers,
of Pollen Grains writing pens, and label stickers for identification.
2.2 Dehydration 1. Aluminum foil sheet measuring 4 × 4 cm, ruler, silica gel, and
of Pollen Grains desiccator (see Note 1).
2.3 Immersion 1. Cryogenic tubes with volume of 2 mL, cryogenic bottle

of Anthers with Pollen equipped with canisters and liquid nitrogen.
Grains in Liquid
Nitrogen
2.4 In Vitro 1. BK [17] culture medium: 0.01% H3BO3, 0.03%

Germination of Pollen Ca(NO3)2·4H2O, 0.02% MgSO4·7H2O, 0.01% KNO3, 15%
Grains sucrose, and 0.8% agar as solidifier, distilled water, pH 6.5.
2. Precision scale, beaker, Erlenmeyer flask, magnetic stirrer,
spatulas, Petri dishes, small tweezers, autoclave, BOD incuba-
tor, laminar flow chamber, and stereoscopic microscope (see
Note 2).
3. Toluidine blue (0.05%), glass funnel, filter paper, amber flask.
2.5 In Vivo 1. Voile bags to enclose the inflorescences, label stickers, writing
Viability Test pen, small tweezers, and liquid nitrogen bottle to transport the
samples.
3 Methods
Before starting the cryopreservation procedures, it is necessary to

know the viability of the pollen grains in natural conditions, the
timing of floral anthesis and stigma receptivity, and the details of
the reproductive system of the species under study. In the case of
pineapple, pollen viability ranges from 10% to 46% [3], while for
other bromeliads in general, it is between 60% and 98% [18, 19].
3.1 Collection 1. The infructescences (in the case of pineapple) and inflores-
of Anthers with Pollen cences (other bromeliads) must be protected 1 day before col-
Grains lection of the anthers with pollen grains (Fig. 1a; see Note 3).
2. The anthers with pollen grains should be collected with twee-
zers from recently opened flowers (anthesis), deposited in Petri
dishes, and immediately taken to the laboratory (Fig. 1b; see
Note 4).
3.2 Dehydration 1. The anthers with pollen grains should be separated into lots
of the Pollen Grains and placed in aluminum foil envelopes measuring 4 × 4 cm (see
Note 5).
Fig. 1 (a, b) Protected infructescence (pineapple) and inflorescence for collection of pollen grains. (c) Collection
of anthers with pollen grains from recently opened flowers and placement in Petri dishes
Fig. 2 (a) Separation of the anthers in aluminum foil envelopes. (b) Anthers with pollen grains in the desiccator
with activated silica gel
2. Distribute the open envelopes in a desiccation chamber with

activated silica gel.
3. Leave the envelopes with the anthers open in the desiccator for
a period of 3–6 h (Fig. 2; see Note 6).
3.3 Immersion 1. Close the envelopes and place them individually in cryogenic
of the Anthers tubes with capacity of 2 mL (see Note 7).
with Pollen Grains 2. Seal the cryogenic tubes to avoid direct contact with the liquid
in Liquid Nitrogen nitrogen (see Note 8).
3. Place the cryogenic tubes in cannulas and immerse the samples
in liquid nitrogen at −196 °C (see Note 9).
4. Keep the samples preserved in liquid nitrogen for the necessary
time.
3.4 Preparation 1. On a precision scale, weigh separately all the ingredients of the
of the Culture Medium BK culture medium [17]. 0.01% H3BO3, 0.03%
Ca(NO3)2·4H2O, 0.02% MgSO4·7H2O, 0.01% KNO3, 15%
sucrose, and 0.8% agar as solidifier, distilled water, pH 6.5 (see

Note 10).
2. Dissolve the salts and sucrose in ultrapure distilled water.
3. Adjust the pH to 6.5 using a digital pH meter.
4. Add the agar.
5. Sterilize the culture medium by autoclaving at 121 °C for
20 min.
6. In a laminar flow chamber, distribute the culture medium in
Petri dishes (see Note 11).
3.5 In Vitro 1. With the aid of tweezers, distribute the pollen grains in Petri
Germination dishes containing culture medium (see Note 12).
of the Pollen Grains 2. Keep the Petri dishes with the pollen grains in the dark in a
BOD incubator at temperature of 27 ± 1 °C (Fig. 3a; see Note
13).
3. The germination should be evaluated in the interval of 8–24 h
after inoculation on the culture medium (see Note 14).
4. Spread droplets of toluidine blue homogeneously in each dish
(see Note 15).
5. The germination can be evaluated by direct counting or pho-
tomicrographs obtained with a stereoscopic microscope
(Fig. 3b; see Note 16).
3.6 In Vivo Viability 1. Receptor flowers (female parent) of different plants of the
Testing same species, and if possible from different populations (see
Note 17), should be emasculated on the day before (pre-
anthesis) to avoid self-fertilization.
2. Protect the flowers with voile bags to prevent contamination
by pollen grains of other species.
3. The cryopreserved pollen grains should be removed from the
liquid nitrogen and taken to the place for pollination immedi-
ately. The envelopes containing the anthers with the pollen
grains should be opened so the grains can be distributed with
tweezers on the surface of the stigma (Fig. 4a).
4. Protect the flowers again in voile bags to prevent contamina-
tion by pollen grains of other species.
5. The pollinated flowers should be identified and labeled
(Fig. 4b; see Note 18).
6. After ripening, evaluate the formation of fruits and number of
seeds per fruit (Fig. 4c; see Note 19).
Fig. 3 (a) Petri dishes containing germinated pollen grains, contrasted with toluidine blue. (b) Evaluation of the
pollen grains with a stereoscopic microscope. (c) Photomicrograph of germinated pollen grains, showing good
uniformity in the dish. (d) Photomicrograph of germinated pollen grains, showing agglomeration, impairing
evaluation (arrow = unviable pollen grains). Bars = 0.5 mm
4 Notes
1. The silica gel should be activated for use. For this purpose, the
silica should be placed in an oven, with temperature of about
60 °C, 24 h before being used to dehydrate the pollen grains.
2. A stereoscopic microscope with a photodocumentation system
should be used in the evaluations.
3. The inflorescences should be protected before (pre anthesis),
during (anthesis), and after the pollinations (post anthesis) to
prevent contamination with undesirable pollen grains brought
by pollinators or wind.
4. The timing of anthesis among bromeliad species is diversified
and can happen in the morning, afternoon, or night. Therefore,
it is necessary to know this timing in advance so as to perform
the emasculations and pollinations at the proper time. Each
time samples of a new genotype are collected; the tweezers
Fig. 4 (a, b) Pollination with cryopreserved pollen grains of pineapple and another bromeliad. (c) Pollinated
flowers should be identified and labeled. (d, e) Formation of fruits and seeds from cryopreserved pollen grains
of pineapple and another bromeliad
should be cleaned with 70% ethanol to prevent mixing of pol-

len grains of different genotypes.
5. Since the pollen grains are not disinfested, the procedures
should be carried out in a clean place and, if possible, in a lami-
nar flow chamber.
6. The dehydration time can vary according to the size of the pol-
len grains, exine thickness, and ambient humidity, among
other factors. Also, according to the findings of Souza et al. [2]
and Silva et al. [3], the moisture of the pollen grains should be
between 15 and 30%. Larger grains, such as those of the genera
Ananas, Vriesea, and Alcantarea, should be dehydrated for
6 h, while those of the genera Aechmea and Tillandsia should
be dried for only 3 h. A sample of pollen grains after dehydra-
tion should be tested for viability.
7. The envelopes should be closed carefully so as not to crush the
anthers and then inserted in the cryogenic tubes, always leav-
ing some open space in the tube.
8. Souza et al. [2] and Silva et al. [3] observed that direct contact
of liquid nitrogen with anther tissues causes injuries to the
exine of the pollen grains, impairing their viability. Therefore,
the cryotubes should be well sealed to prevent liquid nitrogen
from entering.
9. The process of immersion in liquid nitrogen and transfer to the
cryogenic tank should be carried out as fast as possible, to
avoid sudden temperature variations, which can harm the pol-
len grains.
10. To prepare 250 mL of culture medium, follow these steps: in a
250 mL beaker, add 37.5 g of ultrapure sucrose, 0.025 g of
boric acid (H3BO3), 0.075 g of calcium nitrate tetrahydrate
[Ca(NO3)2·4H2O], 0.05 g of magnesium sulfate heptahydrate
(MgSO4·7H2O), and 0.025 g of potassium nitrate (KNO3).
Add a small volume of sterile deionized water almost to
250 mL, and homogenize the solution by swirling the beaker
until all the ingredients dissolve. Adjust the pH to 6.5 using a
digital pH meter. Complete the volume to 250 mL with sterile
deionized water using a test tube. In a 500 mL Erlenmeyer
flask, add 1.25 g of agar, and then mix in the first solution. Seal
the Erlenmeyer flask, and sterilize the content by autoclaving
at 121 °C for 20 min. In a laminar flow chamber, distribute the
culture medium in Petri dishes.
11. Use the culture only after complete cooling and solidification,
within 1 month after preparation.
12. The pollen grains should be uniformly distributed with twee-
zers before autoclaving, preferably without puncturing the cul-
ture medium. If the grains are agglomerated, it will be hard to
count them (Fig. 3c, d).
13. Another option is to use a growth room for the tissue cultures,
with controlled temperature. If a dark place is not available, the
dishes should be enclosed in aluminum foil.
14. If the objective is also to measure the pollen tube length, this
should be done 24 h after emergence. At that time, growth of
various microorganisms can start to appear, since the pollen
grains did not undergo any disinfestation process and the cul-
ture medium is rich in sucrose, favoring the growth of these
organisms.
15. The addition of toluidine blue is only to facilitate observation
by better contrast in the photomicrographs. The solution
should be prepared, filtered through filter paper, and stored at
room temperature.
16. To ascertain the germination percentage, all the pollen grains
in each photomicrograph or dish should be counted. Pollen
grains are considered germinated when they have a tube with
length greater than or equal to the grain diameter.
17. The family Bromeliaceae presents different reproductive sys-
tems, and in some species, self-incompatibility is present, as is
the case of pineapple. Great care should be taken in the polli-
nation step, and the failure to form seeds is not always due to
unviability of the pollen grains but rather because of reproduc-
tive barriers.
18. The date of pollination and identity of the parents should be
recorded.
19. The fruit ripening among bromeliads is highly diversified and
can involve color change or dehiscence (subfamily
Tillandsioideae). In the case of pineapple plants, the formation
of fruits should be disregarded because this does not involve
infructescence but instead formation of seeds in each polli-
nated fruitlet.
Acknowledgments
The authors acknowledge Fundação de Amparo a Pesquisa do

Estado da Bahia (FAPESB), Conselho Nacional de Desenvolvimento
Científico e Tecnológico (CNPq), Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES)/
EMBRAPA program, and Embrapa Mandioca e Fruticultura for
financial support.
References
1. Souza EH, Souza FVD, Costa MAPC et al 2. Souza EH, Souza FVD, Rossi ML et al (2015)
(2012) Genetic variation of the Ananas genus Viability, storage and ultrastructure analysis of
with ornamental potential. Genet Resour Crop Aechmea bicolor (Bromeliaceae) pollen grains,
Evol 59:1357–1376. https://doi.org/ an endemic species to the Atlantic forest.
10.1007/s10722-011-9763-9 Euphytica 204:13–28. https://doi.org/
10.1007/s10681-014-1273-3
3. Silva RL, Souza EH, Vieira LJ et al (2017) Biot 8:111–118. https://doi.

Cryopreservation of pollen of wild pineapple org/10.12702/1984-7033.v08n02a03
accessions. Sci Hortic 219:326–334. https:// 12. Yates IE, Sparks D (1989) Hydration and tem-
doi.org/10.1016/j.scienta.2017.03.022 perature influence in vitro germination of pecan
4. Grout BWW, Roberts AV (1995) Storage of pollen. J Am Soc Hortic Sci 114:599–605
free pollen, pollen embryos and the zygotic 13. Taylor LP, Hepler PK (1997) Pollen germina-
embryos of seed by cryopreservation and freeze tion and tube growth. Annu Rev Plant Physiol
drying. In: Grout BWW (ed) Genetic preserva- Plant Mol Biol 48:461–491. https://doi.
tion of plant cells in vitro. Springer- Verlag, org/10.1146/annurev.arplant.48.1.461
Berlin, pp 63–74. https://doi. 14. Ganeshan S, Rajasekharan PE, Shashikumar S,
org/10.1007/978-3-642-78661-7_5 Decruze W (2008) Cryopreservation of pollen.
5. Tai PYP, Miller JD (2002) In vivo viability In: Reed BM (ed) Plant cryopreservation: a
assay of sugarcane pollen stored at ultra low practical guide. Springer, New York, pp 281–
temperature following preservation treatments. 332. https://doi.
J Am Soc Sugarcane Technol 22:135–136 org/10.1007/978-0-387-72276-4_17
6. Vendrame WA, Carvalho VS, Dias JMM, 15. Benson EE (2008) Cryopreservation theory.
Maguire I (2008) Pollination of dendrobium In: Reed BM (ed) Plant cryopreservation. A
hybrids using cryopreserved pollen. practical guide. Springer, New York, pp 15–32.
Hortscience 43:264–267 https://doi.org/10.1007/978-0-387
7. Parton E, Deroose R, De Proft MP (1998) -72276-4_2
Cryostorage of Aechmea fasciata pollen. 16. Scorza R, Sgerman WB (1995) Peaches. In:
CryoLetters 19:355–360 Janik J, Morre JN (eds) Fruit breeding. John &
8. Parton E, Vervaeke R, Delen BR et al (2002) Sons, New York, pp 325–440
Viability and storage of bromeliad pollen. 17. Brewbaker JL, Kwack BH (1963) The essential
Euphytica 125:155–161. https://doi.org/10. role of calcium ion in pollen germination and
1023/A:1015884019619 pollen tube growth. Am J Bot 50:859–865
9. Towill LE (1985) Low temperature and freeze- 18. Souza EH (2013) Reprodução e hibridação
vacuum-drying preservation of pollen. In: interespecífica e intergenérica em bromeliáceas
Kartha KK (ed) Cryopreservation of plant cells com potencial ornamental. Tesis (Doctoral)
and organs. CRC Press, Boca Raton, University of São Paulo, Piracicaba, São Paulo.
pp 171–198 p. 256
10. Akihama T, Omura M, Kosaki I (1979) Long- 19. Souza EH, Souza FVD, Rossi, ML, Packer
term of fruit tree pollen and its application in RM, Cruz-Barros MAV, Martinelli AP (2017)
breeding. Trop Agr Res 13:238–241 Pollen morphology and viability in
11. Soares TL, Silva SO, Costa MAPC et al (2008) Bromeliaceae. Ann Braz Acad Sci 89:3067–
In vitro germination and viability of pollen 3082. http://dx.doi.org/10.1590/0001-376
grains of banana diploids. Crop Breed Appl 5201720170450
Chapter 20
Application of in Casa Pollination and Embryo Rescue

Techniques for Breeding of Agave Species
Benjamín Rodríguez-Garay, Sigifredo López-Díaz,
José Manuel Rodríguez-Domínguez, Antonia Gutiérrez-Mora,
and Ernesto Tapia-Campos
Abstract
Species of the genus Agave are distributed originally in the tropical and subtropical areas of the American
continent with about 200 taxa and 136 species, and its center of origin is probably limited to México.
These kind of plants usually grow and live in extreme environmental conditions such as heat and drought
where their CAM pathway for fixing CO2 allow them to survive in conditions where other plants cannot
survive. Although this kind of plants resist harsh environmental conditions, climate change is imposing
stronger kinds of stress that diminish their productive potential and in some cases are cause of death.
Because of this, genetic improvement becomes a need of fundamental importance in this kind of species.
Despite their economic importance, Agave species have received scarce attention with regard to its genetic
improvement, probably due to their unique botanical features such as plant architecture, spines, long life
span, and monocarpy, among others, which make hybridization a difficult task for the intra- and interspe-
cific gene transfer and creation of genetic variability among many other breeding techniques.
The protocol here presented is a combination of a novel hybridization technique and biotechnological
tools, and allows the use of several procedures for the genetic improvement of agaves such as pollen selec-
tion, clonal selection, and somatic cell selection, among others, since the rescued embryos can be used for
micropropagation, for phenotype/genotype selection or the production of cell lineages for diverse genetic
improvement purposes.
Key words Agave spp., Breeding, Embryo rescue, Pollination
1 Introduction
Species of the genus Agave are distributed originally in the tropical

and subtropical areas of the American continent with about 200
taxa and 136 species, and its center of origin is probably limited to
México [1]. However, nowadays the use of these plants is gaining
importance worldwide mainly due to their Crassulacean Acid
Metabolism (CAM) which allows them to survive under extreme
drought conditions. This genus is divided into two subgenera:
289
290 Benjamín Rodríguez-Garay et al.
Littaea and Agave mainly based on the architecture of the inflores-

cence; the subgenus Littaea has a spicate or racemose inflorescence
while plants of the subgenus Agave have a paniculate inflorescence
with flowers in umbellate clusters on lateral branches [1].
Several species of the genus are commercially important for the
production of beverages, fiber and recently the high possibilities for
the production of biofuels because of their rusticity (CAM charac-
teristics) and because they do not compete with food crops [2].
Although this kind of plants resist harsh environmental conditions,
climate change is imposing stronger kinds of stress that diminish
their productive potential and in some cases are cause of death.
Also, for the multiplication of commercial Agave species, the
most common practice is done by using suckers that propagate veg-
etatively through rhizomes, in which apical meristems emerge at a
certain distance from the mother plant forming new individuals
which are used to start new plantations. This practice generates
genetic homogeneous populations, a condition that makes them
highly vulnerable to diseases, parasites, and environmental stress [3].
Because of this, genetic improvement becomes a need of fun-
damental importance in this kind of species. Despite their eco-
nomic importance, Agave species have received scarce attention
with regard to its genetic improvement, probably due to their
unique botanical features such as plant architecture, spines, long
life span, and monocarpy, among others, which make hybridization
a difficult task for the intra- and interspecific gene transfer and cre-
ation of genetic variability among many other breeding techniques.
Some of the most important Agave industrial species belong to the
subgenus Agave, among them, plants in the groups Rigidae and
Sisalanae. One important physiological characteristic in the late
groups is the content of carbohydrates at maturity in many parts of
the plant, such as the floral stem, panicles, and floral tissues [4].
On the other hand, there exists an old report on the produc-
tion of hybrids of henequen (A. fourcroydes) and sisal (A. sisalana)
by conventional means where researchers used a scaffold for con-
struction in order to reach flowers to make hybridizations [5].
Recently, some efforts for genetic improvement have been made
by using biotechnological approaches such as plant regeneration
by organogenesis, somatic embryogenesis [6], cell selection [7],
and genetic transformation [8], among others.
The protocol here presented is a combination of a novel
hybridization procedure and biotechnological tools. The proce-
dure is the “in casa hybridization” which consists in the produc-
tion of hybrids by sexual means carried inside a house or laboratory
taking advantage of the putative existing energy (carbohydrates)
stored in the floral stem separated from the plant for the successful
completion of fruits and seeds production, and the subsequent use
of embryo rescue and in vitro culture as a biotechnological tool.
This protocol allows the use of several procedures for the genetic
Rescue of Embryos 291
improvement of agaves such as pollen selection, clonal selection,

and somatic cell selection, among others, since the rescued embryos
can be used for micropropagation, for phenotype/genotype selec-
tion or the production of cell lineages for diverse genetic improve-
ment purposes.
2 Materials
2.1 Biological It is important to be prepared with all the materials for the season.
Materials Blooming season is different for several species of the genus. In this
regard, the researcher knows its own plant materials and must be
aware of when the first flowers open in order to collect the panicles
or the entire floral stem.
1. The plant material can be single panicles or the whole floral
stem with panicles, depending on the available laboratory space
or also depending on the characteristics of a given species
(Fig. 1a, b). For example, Agave tequilana and A. angustifolia
that belong to the group Rigidae of the subgenus Agave work
well in both forms. However, panicles of species belonging to
the group Crenatae such as A. cupreata, A. inaequidens, and A.
maximiliana need to be attached to the floral stem in order to
produce good fruits and seeds. When the floral stem is neces-
sary, this should be cut at least 1 m below the first panicle
(Fig. 1b). In the case of the use of panicles, these should be cut
at the place of attachment to the floral stem (Fig. 1b, c). A good
moment for the collection of plant material is when in the floral
stem some of the panicles have some open flowers and others in
the form of mature and immature flower buds. It is important
to mention that when some unopened flower buds begin to fall
out of the panicle, this means that they lack nutrients and
energy. To solve this problem, simply remove a few buds so that
some remain good to produce fruits with seeds.
2.2 Glassware, 1. Thin dissecting forceps and scalpel with blade #11.
Instrumentation,
and Other Materials 2. Regular dissecting forceps.
3. Regular scissors for paper.
4. Buckets for water (vases) between 10 and 20 L.
5. Any commercial product that does not allow the development
of mosquitoes in the vases. Daily change of water is a good
practice to avoid mosquitoes.
6. Small jars or containers for pollen storage of about 10 mL
volume.
7. Desiccator with silica gel for pollen storage.
8. Refrigerator at 4 °C.
Fig. 1 Procedure for in casa pollination and embryo rescue techniques for breeding of Agave species. (a)
Collection of panicles from selected mother plants. (b) Floral stem and panicles in Buckets with water (vases).
(c) Single panicle. (d) Emasculation. (e) Mature flower showing the height of the style and nectar at the base
of the style. (f) Pollination drop over a stigma of a mature flower. (g) Pollination performed with a fine paint
brush. (h) Agave breeder finishing the pollination procedure and protecting the pollinated flowers with bags
from contamination with undesired pollen in the case of a pollination with more than one pollen source. (i)
Immature fruits resulting from in casa pollination and ready for embryo rescue. (j–l) Immature embryos ready
for rescue. (m) Plantlets from germinated rescued embryos
9. Freezer at −20 °C.
10. Tissue culture laboratory including horizontal hoods and elec-
trical or gas burners.
11. Ethanol 95%.
12. Microscope slides.
13. Cover glasses.
14. Compound microscope.
15. Aniline blue 1% in lactophenol.
16. Stereo microscope.
2.3 Reagents, 1. Plastic disposable Petri dishes (size 60 mm × 15 mm) with

Solutions, and Culture culture medium for testing pollen viability [9] (see Table 1 and
Media Note 1).
2. Disposable Petri dishes (size 60 mm × 15 mm) with culture
medium for the maturation and germination of rescued
embryos [6]. Please see protocol for preparation of this culture
medium in Chapter 19 of this book (see Note 2 this chapter).
Prepare all solutions using purified deionized water, and ana-
3 Methods
For in casa hybridization/pollination all procedures are carried out

at room temperature in a comfortable place inside a laboratory or
house.
3.1 Flower 1. Select the mother plants that will be used for hybridization.
Emasculation, Pollen Plant selection must be according to the needs of the breeder’s
Collection, program.
and Storage 2. Collect the flower stem or the panicles at any time of the day
according to the directions given in Subheading 2.1.
3. Pull the anthers to detach them from the filament at the
moment/day the bud opens (Fig. 1d).
4. Place the anthers over a clean piece of paper. A white sheet for
printer works well. Allow 1–2 days for the maturation of the
collected anthers. At this time anthers will open and release the
pollen grains.
5. Clean the pollen grains by eliminating anther debris.
6. Store pollen in a small glass/plastic vial and place it inside a
desiccator with silica gel and store it at 4 °C, if the use is
intended within a few days up to 3–6 months. If the pollen
Table 1
Culture medium for Agave pollen germination following López-Díaz and
Rodríguez-Garay [9] (7 Note 1)
Compound Take to a volume of 1 L (g)

Sucrose 102.69
Boric acid 0.020
Calcium nitrate 0.287
Agar 5.0
storage is for 1 year, then mix it with a volume of olive oil

necessary to cover the pollen grains in the same vial and store
at −20 °C [9].
3.2 Pollination 1. Female organs of the flower will mature 3–5 days after
emasculation.
2. Identify the maturity/receptivity of the female organs of the
flower. The style has to reach at least the height that had the
filaments with anthers at the moment of the emasculation.
There should be nectar visible at the base of the style. Sometimes
a pollination drop is visible over the stigma (Fig. 1e, f).
3. Take the vial with pollen from the refrigerator 3–5 min before
pollination in order to allow pollen to reach room
temperature.
4. Perform a test for pollen viability by placing a very small
amount of pollen grains over the culture medium for pollen
germination [9] (see Table 1 and Note 1). Good pollen viabil-
ity starts with a germination percentage of 50. Or carry the
viability test in a drop of aniline blue 1% in lactophenol [10] by
looking for the same germination percentage.
5. Apply a generous amount of pollen over the stigma with a fine
paint brush (Fig. 1g).
6. It may be necessary to protect pollinated flowers with glassine
paper bags to avoid undesired pollen when several pollen
sources are used in the same panicle (Fig. 1h).
7. Let the fertilization to take place. The point of development of
the fruit for embryo rescue will take from 3 to 6 weeks accord-
ing to the species (Fig. 1h).
3.3 Embryo Rescue The embryo rescue procedure is used when a further work with
biotechnological tools is going to be conducted, such as micro-
propagation by axillary shoot proliferation and somatic embryo-
genesis, cell selection, and transformation among many other
techniques. If this is not the case, allow the maturation of fruits

and seeds for about 3–4 months according to the species. Follow
conventional horticultural procedures in order to produce good
and healthy plants.
1. Cut the immature fruit from the panicle (Fig. 1i).
2. Sterilize the immature fruit by dipping it into ethanol 95% and
burn it until the ethanol goes off.
3. Carefully open the sterilized fruit with a scalpel and remove the
immature seed.
4. With the aid of a stereo microscope, open the immature seed
with the aid of thin dissecting forceps and scalpel with a
blade #11.
5. Carefully take the clean zygotic embryo (globular or torpedo
shape) and place it in a Petri dish containing the culture
medium for maturation and germination (Fig. 1m).
6. Place the Petri dishes containing the rescued embryos in an
incubator room at 27 ± 2 °C for 1 week, then transfer to a 16 h
photoperiod under fluorescent light (16 μmol s−1 m−2).
7. According to the needs, the rescued embryos can go directly
to a culture medium for the induction of somatic embryogen-
esis [6] (Fig. 1j, k, l). This medium consists in MS basal
medium with the addition of L2 Vitamins, 2 mg L−1
2,4-dichlorophenoxyacetic acid (2,4-D) and 0.3 mg L−1
6-benzyladenine (BA). Follow Tables 1 to 6 of Chapter 8 of
this book.
3.4 Hybrid In order to confirm the hybrid status of the individuals resulting
Confirmation from the “in casa” hybridization protocol, molecular makers can
be used. Several techniques are currently available; however,
Amplified Fragment Length Polymorphisms (AFLPs) in spite of
their anonymous nature have worked well for the confirmation of
Agave hybrids.
3.4.1 DNA Isolation DNA may be obtained by using different protocols; a CTAB-based
protocol like the one reported by Saghai-Maroof et al. works prop-
erly [11] as follows:
1. Collect very young and visibly healthy leaves from each puta-
tive hybrid (from embryo rescue or seed germination) and the
parents, label, pack in ice, and store at −80 °C
2. Grind 2 g of fresh or stored tissue in a mortar with liquid
nitrogen. Place the ground powder into 15 mL polypropylene
tubes, add 9 mL of warm (60 °C) extraction buffer [100 mM
Tris pH 7.7; 700 mM NaCl; 50 mM ethylenediaminetetraac-
etate (EDTA), pH 8.0; 1% CTAB (mixed alkyltrimethyl-
ammonium bromide); 140 mM β-mercaptoethanol], mix all
compounds, and incubate for 60 min at 65 °C in oven. Mix

gentle each 10 min to homogenize.
3. Add 4.5 mL chloroform/isoamyl alcohol (24:1) and centri-
fuge at 1500 × g for 10 min at room temperature. Transfer the
supernatant to a new tube and repeat the chloroform/isoamyl
alcohol step. Add 30 μL of RNase (10 mg mL−1) and incubate
at 37 °C for 45 min.
4. Add an equal volume of isopropanol (2-propanol), mix, and
incubate at −20 °C for 15 min. Precipitated DNA is centri-
fuged for 10 min at 1500 × g at room temperature.
5. Dry the pellet, dissolve in 1 mL of TE (Tris-EDTA) buffer,
and precipitate DNA with 50 μL NaCl and 2 mL of absolute
EtOH.
6. Remove the precipitated DNA and immerse in a 2 mL tube
and add 1 mL of EtOH, mix gentle for 5 min.
7. Transfer the precipitated DNA to a new 2 mL tube and add
1 mL of 70% EtOH, mix gentle for 5 min.
8. Transfer the precipitated DNA to a new 1.5 mL tube and let
dry at room temperature. Alternatively the DNA can be dried
using a speed vacuum. Once dried dissolve it in 200 μL of
distilled water and store at 4 °C.
9. The DNA content can be estimated using agarose gel or using
a spectrophotometer and adjust to 50 ng μL−1, to be used in
the AFLP procedure.
3.4.2 AFLP Analysis 1. The AFLP methodology is based on the protocol of Vos et al.
[12] as follows:
2. Use at least 500 ng of genomic DNA and two pairs of restric-
tion endonucleases in a final volume of 50 μL (in agave hybrid
detection the use of Mse I plus Eco RI give good results). First,
use Mse I (2.5 U) and its respective buffer, incubate it for 2 h
at 37 °C and then add Eco RI enzyme (2.5 U) and incubate
the mix for two more hours at 37 °C. It is important to equal-
ize the salt level for Eco RI (using the Invitrogen enzyme adds
NaCl to reach 100 mM).
3. Produced fragments are ligated to adaptors. The Eco 1 and Eco
2 adaptors are prepared at 50 μM and the Mse 1 and Mse 2
adaptors are prepared at 5 μM (Table 1) and annealed (95 °C
15 min, 65 °C 10 min, and 37 °C 10 min). Add 10 μL of liga-
tion mix [1× ligation buffer, 50 pmoles of Mse I adaptor, 5
pmoles of Eco RI adaptor and 1 U of T4 DNA ligase (1 U μL−1
Invitrogen)] to the samples previously digested and incubate
it at room temperature for 2 h.
4. The next step consists in a preamplification using complemen-
tary primers to the adaptors (Table 1). Add 21 μL of preamplifi-
cation mix [1× buffer Taq polymerase (10x Invitrogen),

0.56 μM Mse I primer (10 μM), 0.56 μM Eco RI primer
(10 μM), 0.2 mM dNTPs, 1.5 mM MgCl2 (50 mM) and 1 U
of Taq polymerase (5 U μL−1 Invitrogen) and water to reach
21 μL] and 4 μL of DNA previously ligated. Use the pream-
plification program: 25 cycles of 94 °C for 30 s, 56 °C for
1 min, and 72 °C for 1 min. Preamplified products can be veri-
fied in agarose 1% and then diluted 1:10 with ultrapure water.
5. Finally, products from preamplification are selectively ampli-
fied using primers with three selective bases (Eco + 3 and
Mse + 3). The most accurately primers +3 used in Agave
hybrid confirmation are shown in Table 2. Add 18 μL of mix
[1× buffer of Taq polymerase, 0.25 μM Mse primer, 0.10 mM
Eco primer, 0.2 mM dNTPs, 1.5 mM MgCl2, and 0.75 U Taq
polymerase enzyme (5 U μL−1 Invitrogen)] plus 2 μL of pre-
amplified and diluted DNA. Use the amplification program:
10 cycles of 94 °C for 1 min, 65 °C for 60 s (decreasing 1 °C
each cycle), and 72 °C for 90 s; followed by 23 cycles of 94 °C
for 30 s, 56 °C for 30 s, and 72 °C for 60 s.
6. Products produced from selective amplification are analyzed
on 6% acrylamide gel (Urea 42%, 1× TBE, 6% acrylamide)
using 1× TBE (Tris-Borate EDTA) buffer on a Bio-Rad
sequencing gel apparatus at 100 W for 3 h.
7. Fragment detection can be done by using the Basam and

Caetano-Anolles protocol which uses the silver nitrate frag-
ment staining [13] as follows:
(a) Separate the crystals from the chamber and immerse the
crystals with the acrylamide gel in a plastic tray with at
least 1.5 L of fixation solution (7.5% acetic acid), mix gen-
tle for 45 min (retain the fixation solution at 4 °C until
used in the development interruption)
(b) When the fixing time is finished, immerse the gel in another
tray with at least 1.5 L of deionized water for washing for
3 min (mix gentle). Repeat the wash 2 more times.
(c) Immerse the gel in another tray containing at least 1.5 L of
silver nitrate solution (1.5 g L−1 AgNO3, 0.056%
formaldehyde).
(d) Wash the gel again as in (b) but only for 20 s and immedi-
ately transfer the gel to the developer solution.
(e) Immerse the gel in other tray containing at least 1.5 L of
developer solution (30 g L−1 Na2CO3, 0.056% formalde-
hyde, 400 μg L−1 sodium thiosulfate). When optimal frag-
ments are visualized, the developing reaction is stopped
quickly by using the cold fixing solution reserved in (a).
Table 2
Sequence of adaptors and primers used in Agave hybrid detection (see Note 3)
Adaptor EcoRI Adaptor MseI

5′ CTCGTAGACTGCGTACC 3′ 5′ GACGATGAGTCCTGAG 3′
5′AATTGGTACGCAGTC 3′ 5′ TACTCAGGACTCAT 3′
Primers Eco + A Primers Mse + C
5′GACTGCGTACCAATTCA 3′ 5′GATGAGTCCTGAGTAAC 3′
Primers Eco + 3 Primers Mse + 3
5′GACTGCGTACCAATTC + ACG 3′ 5′ GATGAGTCCTGAGTAA+CAT 3′*
5′GATGAGTCCTGAGTAA + CAG 3′
5′ GATGAGTCCTGAGTAA+CTG 3′**
5′GACTGCGTACCAATTC + ACT 3′ 5′GATGAGTCCTGAGTAA + CAT 3′
5′ GATGAGTCCTGAGTAA+CAG 3′
5′ GATGAGTCCTGAGTAA+CTG 3′* , **
(f) Wash the gel again in at least 1 L of deionized water for
10 min (mix gentle).
8. The AFLP band patterns obtained from the parents and their
putative hybrids is compared in order to find fragments in
common which can support the hybrid status in Agave
individuals [14] (Fig. 2).
4 Notes
1. When the medium for pollen germination is used immediately

there is no need for sterilization in autoclave since the test for
pollen viability is performed under no aseptic conditions.
However, if this medium is stored for several days prior to its
use, then sterilization in autoclave is needed in order to avoid
contamination by microorganisms.
2. Add 6 g Phytagel instead of 8 g agar only for the medium for
maturation and germination of rescued zygotic embryos. Also,
add 500 mg L−1 l-glutamine and 250 mg L−1 casein hydroly-
sate. In both cases adjust pH to 5.8 with 1 N NaOH prior add-
ing the Phytagel or agar and prior to autoclave.
3. In general, the use of the six primers combinations used in
Agave characterization are useful, however, in the hybrid detec-
tion for A. tequilana X A. angustifolia crosses, primers marked
with * were more accurate, while for hybrid detection for A.
angustifolia X A. colimana, primers marked with ** were more
accurate. Based in the number of fragments and level of poly-
morphism. From Meyer-Nava [14].
Fig. 2 Sections from AFLP gel. (a, b) Parents and hybrids from the crosses between A. tequilana (At) and A.
angustifolia (Aa). (c, d) Parents and hybrids from the crosses between A. angustifolia (Aa) and A. colimana (Ac).
E: 50 pb ladder; arrows show those fragments present in at least one parent and some putative hybrids. From
Meyer-Nava [14]
Acknowledgments
This work was supported (to B.R.G.) by Consejo Nacional de

Ciencia y Tecnología, México (CB-24554) and Sistema Nacional
de Recursos Fitogenéticos para la Alimentación y la Agricultura-
Servicio Nacional de Inspección y Certificación de Semillas, México
(BEI-AGA-10-8, BEI-AGA-11-8).
References
1. Gentry HS (1982) Agaves of continental North tumefaciens and particle bombardment. Plant
America. The University of Arizona Press, Cell Tiss Org 91:215–224. https://doi.
Tucson, Arizona, p 670 org/10.1007/s11240-007-9287-3
2. Rodríguez-Garay B (2016) Somatic embryo- 9. López-Díaz S, Rodríguez-Garay B (2008)
genesis in Agave spp. In: Loyola-Vargas VM, Simple methods for in vitro pollen germination
Ochoa-Alejo N (eds) Somatic embryogenesis: and pollen preservation of selected species of
fundamental aspects and applications. Springer the genus Agave. e-Gnosis 6:2. http://www.e-
International Publishing, Cham, pp 267–282. gnosis.udg.mx/index.php/e-gnosis/article/
h t t p s : / / d o i . view/80/0
org/10.1007/978-3-319-33705-0_16 10. Hauser EJP, Morrison JH (1964) The cyto-
3. Zadocks J, Shein R (1979) Epidemiology and chemical reduction of nitroblue tetrazolium as
plant disease management. Oxford Univ. Press, an index of pollen viability. Am J Bot 51:748–
New York, p 427 752. https://doi.org/10.2307/2440215
4. Avila de Dios E, Gomez Vargas AD, Damián 11. Saghai-Maroof MA, Soliman K, Jorgensen RA
Santos ML et al (2015) New insights into plant et al (1984) Ribosomal DNA spacer- length
glycoside hydrolase family 32 in Agave species. polymorphisms in barley: Mendelian inheri-
Front Plant Sci 6:594. https://doi. tance, chromosomal location, and population
org/10.3389/fpls.2015.00594 dynamics. Proc Natl Acad Sci U S A
5. Vidal R (1925) Breeding work with henequen 81:8014–8018
and sisal. J Hered 16:9–12. https://doi. 12. Vos P, Hogers R, Bleeker M et al (1995) AFLP:
org/10.1093/oxfordjournals.jhered.a102510 a new technique for DNA fingerprinting.
6. Portillo L, Santacruz-Ruvalcaba F, Gutiérrez- Nucleic Acids Res 23:4407–4414. https://
Mora A et al (2007) Somatic embryogenesis in doi.org/10.1093/nar/23.21.4407
Agave tequilana weber cultivar Azul. In Vitro 13. Bassam BJ, Caetano-Anolles G (1993) Silver
Cell Dev Biol Plant 43:569–575. https://doi. staining of DNA in polyacrylamide gels. Appl
org/10.1007/s11627-007-9046-5 Biochem Biotech 42:181–188. https://doi.
7. Gutiérrez-Mora A, Ruvalcaba-Ruiz D, org/10.1007/BF02788051
Rodríguez-Domínguez JM et al (2004) Recent 14. Meyer-Nava S (2009) Identificación de híbri-
advances in the biotechnology of Agave: a cell dos interespecificos de Agave tequilana, A.
approach. Recent Res Dev Cell Biol 2:17–36 angustifolia ‘Lineño’ y A. colimana por marca-
8. Flores-Benítez S, Jiménez-Bremont JF, dores AFLP. Universidad Autónoma de
Rosales-Mendoza S et al (2007) Genetic trans- Guadalajara. Tesis de licenciatura. Guadalajara,
formation of Agave salmiana by Agrobacterium Jalisco, México. p. 82
Chapter 21
Haploid and Doubled Haploid Plant Production in Carrot

Using Induced Parthenogenesis and Ovule Excision In Vitro
Agnieszka Kiełkowska, Adela Adamus, and Rafal Baranski
Abstract
Haploid plants have a gametophytic number of chromosomes (n) in the sporophyte. A doubled haploid
(DH) plant results from doubling the chromosome set of a haploid plant, as a consequence a homozygos-
ity plant is produced at every locus (true homozygous plant). DH plants are of great significance in breed-
ing programs for the improvement of plants. Here we describe a protocol for the production of doubled
haploid plants in carrot (Daucus carota L.) using parthenogenesis induced by wide pollination.
Key words Daucus carota, Doubled haploid, Ovule culture, Wide pollination
1 Introduction
Carrot (Daucus carota L. ssp. sativus; 2n = 2x = 18) is among top

ten economically important vegetables in the world. Modern car-
rot breeding is focused on the production of F1 hybrids. Hybrid
breeding programs require the production of inbred populations.
In outcrossing, insect-pollinated species, like carrot, inbreeding is
time-consuming and difficult due to an adverse effect of inbreed-
ing depression that limits the success of self-pollination [1]. In
consequence, inbreeding is performed for several generations and
the obtained progenies remain highly heterozygous [2].
Alternatively to self-pollination, true homozygous plants can be
obtained by inducing production of doubled haploid (DH) plants.
Haploid and DH plants can originate from both male and female
gametophyte cells. Induction of haploids from male gametophyte
cells refers to androgenesis and is performed by culturing whole
anthers or microspores isolated from anthers in vitro [3].
Androgenesis has been successfully induced for many crop plants
[4] although not for carrot despite several attempts in the recent
two decades. Regenerants developed in carrot anther culture, as
proved by molecular analyses, had not gametic origin [5, 6];
whereas in microspore culture, low efficiency of embryos was
301
302 Agnieszka Kiełkowska et al.
reported [7, 8]. An alternative to androgenesis is the induction of

haploid cell development in a female gametophyte. Haploid cells in
the embryo sac can be stimulated to divisions by pretreatment of
the donor plant and specific in vitro culture conditions (gynogen-
esis), or can be stimulated by pollination with irradiated or foreign
pollen resulting in a lack of fertilization (induced parthenogenesis)
[9–11].
We elaborated a protocol enabling the production of haploid
and doubled haploid plants in carrot from female gametophyte cells
stimulated to development by a wide pollination [12, 13]. Our stud-
ies showed that several species, i.e., celery, parsnip, and parsley, can
be used as pollen sources to induce parthenogenic development in
carrot; however, induction caused by parsley pollen was the most
effective. Parsley pollen germinates on the carrot stigma, but the
pollen tube does not reach the carrot embryo sac and fertilization
does not occur. In experiments with pollination of carrot flowers
with parsley pollen, we did not observe viable seed formation. Our
results showed that wide pollination with parsley pollen and carrot
ovule culture in vitro is both essential for embryo formation. A
proper time of ovule excision was found to be a very important fac-
tor, as the highest frequency of embryo formation was observed
when ovules were isolated 20–22 days after pollination (DAP).
Excision of younger ovules resulted in a higher frequency of callus
tissue development. It was reported, that during interspecific or
intergeneric crosses the application of plant growth regulators can
promote embryo development [14, 15]. In carrot, the post-pollina-
tion application of 2,4-dichlorophenoxyacetic acid (2,4-D) increased
the number of developing ovules in comparison to untreated con-
trol; however, mainly callus tissue formation was observed. In our
study, a vast majority of regenerants were diploids; therefore, it was
necessary to identify their origin. For this purpose, we elaborated a
two-step procedure relying on a selection of heterozygous donor
plants and later screening for homozygosity in the obtained regener-
ants using molecular tools. Selected donor plants were heterozygous
for three independent loci (pgi-2, chs2, and ipi3) and the obtained
diploid regenerants being homozygous at the same loci were consid-
ered as developed from cells of gametic origin that passed a sponta-
neous chromosome doubling during tissue culture [8, 16] and
finally resulting in the production of doubled haploid carrot plants.
2 Materials
2.1 Plant Material In the season preceding experiment save enough number of roots
and Growing of carrot and parsley and subject them to vernalization for 3 months
Conditions at 4 °C in a cold storage room (see Note 1).
Haploids Induction in Carrot 303
1. Healthy and undamaged roots of carrot and parsley.

2. 5 L pots.
3. Peat moss and coarse sand.
4. Nett isolation cages.
2.2 Tissue Cultures 1. Equipment: laminar flow cabinet, autoclave, pH meter, labora-
tory scale, stereomicroscope.
2. Materials: sterile 60-mm plastic Petri dishes, sterile glass cul-
ture vials (160 × 28 mm) with aluminum foil caps, sterile
microscope slides, sterile forceps, and excision needles.
3. Growth room with regulated temperature and light intensity.
4. Plant material sterilization solutions: 70% ethanol, 10% chlora-
mine T (w/v) (see Note 2), sterile distilled water in 250 mL
glass jars.
5. Culture media components: distilled water (dH2O), Murashige
and Skoog (MS) [17] macro- and microelements including
vitamins in powder, sucrose, Lab-agar, indole-3-acetic acid
(IAA), glycine, 0.1 M HCl, and 0.1 M NaOH.
2.3 Flow Cytometry 1. Equipment: Flow cytometer, test tubes.

2. Materials: razor blades, nylon filter with 30 μm pore size, plas-
tic Petri dishes −35 mm.
3. Lysis buffer: in 200 mL of dH2O dissolve 12.1 g Tris pH 7.0,
0.5 g MgCl2· 6H2O, 0.5 g NaCl, 1 g polyvinylpyrrolidone
(PVP), and 1 mL TRITON X-100. Mix and measure pH, if
needed adjust pH to 7.0 with 1 N HCl. Adjust with water to
1 L. Solution can be stored in the dark at room temperature
(RT) for about 2 months.
4. 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI): dis-
solve 10 mg DAPI in 10 mL of water. Store in the dark at 4 °C
for use. For long-term storage, place at −20 °C.
2.4 Molecular 1.
Equipment: electrophoresis tank (Helena Biosciences,
Analyses Gateshead, UK) (see Fig. 1a) with a power supply.
2.4.1 Glucose-6- 2. Materials: Cellulose acetate TITAN III plate 76 × 76 mm and
Phosphate Isomerase (PGI, the Super Z-12 applicator (Helena Biosciences, Gateshead,
EC 5.3.1.9) Analysis UK) (see Fig. 1b, c), plastic box with cover, automatic pipettes
and tips, 20 mL glass beaker.
3. 0.1 M Tris–HCl pH 8.0 buffer: weigh 6.05 g Tris, dissolve in
400 mL dH2O, mix, and check pH. If necessary adjust the pH
to 8.0 with 1 N HCl. Make up to 500 mL with dH2O. Store
at RT.
Fig. 1 Equipment for isozyme analyses. Electrophoresis tank (a); Super Z-12
applicator (b); 76 × 76 mm cellulose acetate TITAN III plate (c)
4. Extraction buffer: Mix 10 mL of 0.1 M Tris–HCl pH 8.0 buf-

fer, 1% (w/v) reduced glutathione, and 20 μL
β-mercaptoethanol. Store in the dark at 4 °C.
5. Electrophoresis buffer (0.025 M Tris–glycine pH 8.0): in
500 mL of dH2O dissolve 2 g Tris, 9.3 g glycine. Make up to
900 mL and measure pH. If needed adjust the pH to 7.8 with
1 N HCl. Make up to 1 L with dH2O. Store at RT.
6. Staining solution (per one acetate plate): 1 mL of 0.1 M Tris–
HCl pH 8.0, 0.02 mg nicotinamide adenine dinucleotide
phosphate (NADP), 1 mg thiazolyl blue tetrazolium bromide
(MTT), 5 mg fructose-6-phosphate, 0.02 mg phenazine
methosulfate (PMS), and 5 U glucose-6-phosphate dehydro-
genase (G-6-PDH). Prepare fresh before each use. Use imme-
diately after preparation.
7. Loading dye: weigh 4 g sucrose and 25 mg bromophenol blue
and dissolve in 10 mL dH2O. Store at 4 °C.
8. 1.6% Lab-agar. Prepare 100 mL of fresh solution before use
(see Note 3).
9. 3% acetic acid. Store at RT.
2.4.2 DNA Analysis 1. Equipment: freezer (−20 °C), NanoDrop spectrophotometer,

2.4.2.1 DNA Isolation
vacuum dryer, vortex, centrifuge (14,243 × g), Thermoblock,
automatic pipettes, and tips.
2. Materials: 2.0 mL Eppendorf tubes, mortars and pestles, a box
with ice.
3. CTAB extraction buffer: take 100 mL of deionized water,
weigh and dissolve 2.4 g Tris, 1.4 g 2,2′,2″,2″′-(ethane-1,2-
diyldinitrilo) tetraacetic acid (EDTA), 8.0 g cetyltrimethylam-
monium bromide (CTAB), 2.0 g PVP, and 16.3 g NaCl. Mix
and make up to 200 mL with deionized water.
4. Buffer II: take 100 mL of deionized water, weigh and dissolve
20.0 g CTAB and 8.2 g NaCl. Mix and make up to 200 mL
with deionized water.
5. RNase A: 1 mg/mL RNase A, 100 U/mL RNase TI (see Note
4). Store in aliquots at −20 °C.
6. 0.1XTE buffer: 1.0 mM Tris (pH 8.0), 0.1 mM EDTA
(pH 8.0).
7. 70% EtOH.
8. Isopropanol cooled at −20 °C.
9. Chloroform/isoamyl alcohol 24:1 (v/v) solution.
10. Liquid nitrogen.
2.4.2.2 PCR 1. Equipment: thermal cycler, horizontal gel electrophoresis

and Electrophoresis apparatus and power supply, UV transilluminator and gel doc-
umentation system.
2. Materials: Eppendorf (0.5 mL) and PCR (0.2 mL) tubes,
automatic pipettes and tips, a box with ice.
3. Primer pairs (5′–3′):
(a)
Chalcone synthase, chs2—CTC AAG GAG AAG TTT
AGG CGG ATG and ATG AGG CCA TGT ACT CGC
AGA AAC [18].
(b)
Isopentenyl diphosphate isomerase, ipi3—CTG TAC
AGG GAG TCC GAG CTT ATC and CCA ATC CAA
GAC ATT TAC CAT AGG TC.
Store primers at −20 °C.
4. PCR reaction mixture (per single sample): 1 μL 10× Taq buf-
fer, 0.8 μL 25 mM MgCl2, 0.25 μL 10 mM dNTPs, 0.5 μL of
each 10 μM primer, 0.1 μL Taq DNA polymerase, and 5.85 μL
of sterile deionized water. Prepare new mixture before each
PCR.
5. Ethidium bromide (EtBr) solution: dissolve 1.3 μg of EtBr in
1 mL of dH2O (see Note 5).
6. Loading dye: 4 g sucrose, 25 mg bromophenol blue dissolved

in 10 mL dH2O. Store at 4 °C.
7. 5× TBE electrophoresis buffer (pH 8.2–8.4): weigh and dis-
solve in dH2O 54 g Tris, 27.5 g H3BO3, 4.6 g EDTA adjust
with dH2O to 1 L.
8. DNA molecular weight marker −1 kb ladder.
9. 1% (w/v) agarose gel
3 Methods
3.1 Plant Growth 1. Vernalize roots of carrot and parsley plant in 5 L pots contain-
in the Greenhouse ing a mixture of peat moss, and coarse sand (1:1 v/v), and
and Pollination transfer to the greenhouse (see Note 6).
2. After 2–3 weeks of growth collect leaf samples from each car-
rot plant separately for molecular analyses. Samples for isozyme
analyses should be fresh, while for DNA analyses froze leaves in
liquid nitrogen and store at −20 °C until use. Only plants het-
erozygous at all checked loci (pgi-2, chs2, and ipi3) should be
maintained further and subjected for pollination. The remain-
ing plants should be removed.
3. At the beginning of flowering, transfer carrot plants to netted
isolation cages (see Note 7). Parsley plants should be trans-
ferred into separate cages (see Note 8).
4. Observe carefully carrot umbels (see Note 9). Pollination
should be done when the majority of carrot flowers within the
umbel has a receptive stigma. A simple method for assessment
of sigma receptivity in carrot is a visual inspection of flowers.
At this stage, a pistil with a pair of clearly separated styles forms
a V-shape structure (see Fig. 2). Remaining umbellets at earlier
developmental stages should be removed.
5. Collect parsley umbels containing flowers at anthesis (see
Fig. 3).
6. Pollinate by hand, by smearing carrot flowers with a single
umbel of parsley (see Note 10).
7. After pollination close the cage carefully and leave plants
untouched until harvesting the umbels (see Note 11).
3.2 Tissue Cultures 1. Prepare culture medium (H, ½-strength MS based). Weigh
2.2 g of MS macro- and microelements including vitamins
powder, dissolve in 200 mL of dH2O. Add 0.01 mg of IAA and
20 g sucrose. Mix and make up to 1 L with dH2O. Adjust pH
to 5.8 with 0.1 M HCl/NaOH. Pour the medium into 1 L
glass bottle and add 7 g Lab-agar. Sterilize the medium by
autoclaving (20 min at 121 °C; 1.4 × 104 kgm−2) (see Note 12).
Fig. 2 Umbel of carrot with flowers having receptive stigma forming a V-shaped
structure
Fig. 3 Umbel of parsley with flowers at anthesis

2. Prepare regeneration (R) medium. Weigh 4.4 g of MS macro-

and microelements including vitamins powder and dissolve in
200 mL of dH2O, add 3 mg glycine and 20 g sucrose. Mix and
make up to 1 L with dH2O. Adjust pH to 5.8 with 0.1 M
HCl/NaOH. Pour the medium into 1 L glass bottle and add
7 g Lab-agar. Sterilize the medium by autoclaving (20 min at
121 °C; 1.4 × 104 kg·m−2). For rooting, supplement the R
medium with 0.02 mg IAA per 1 L.
3. Following sterilization pour the H medium to the sterile plas-
tic 60-mm Petri dishes, with 5 mL of medium per dish. Pour
R medium to the glass vials with 20 mL of the medium per
vial. Seal vials with aluminum foil caps.
4. Prepare a laminar airflow cabinet and equip with sterile forceps
and excision needles, sterile microscope slides, dishes with cul-
ture medium, jars with sterile water, and stereomicroscope.
5. Twenty to twenty-two days after pollination, harvest carrot
umbels from the greenhouse plants and transfer to the
laboratory.
6. Sterilize umbels in 70% ethanol for 5 min, next in 10% chloramine
T for 20 min, and transfer umbels to the laminar airflow cabinet.
7. Wash sterilized umbels with sterile distilled water for 5 min;
repeat washing two more times.
8. Using forceps, detach single ovaries from the umbel and place
them onto a microscope slide (see Note 13). Transfer the slide
with ovaries on the stereomicroscope table.
9. Using preparation needles gently open a green, enlarged ovary
and isolate a whitish-colored ovule (see Note 14 and Fig. 4).
10. With the needle place the ovule on the culture medium sur-
face. Place 20 ovules per dish (see Note 15).
11. Maintain cultures at 25 ± 2 °C in the dark.
12. Observe cultures weekly. The development of embryos and
calli should be noted after 6–8 weeks of culture.
13. Transfer embryos and calli to culture boxes with the R medium.
14. Keep cultures at 25 ± 2 °C (16 h day, 55 μmol m−2 s−1).
15. Pass cultures to a fresh medium every 4 weeks until plantlets
will develop. When necessary, for rooting, transfer shoots to R
medium with 0.02 mg/L IAA.
16. From regenerants which developed 4–5 leaves, collect leaf
samples to determine ploidy level using a flow cytometer.
17. All regenerants identified as diploids have to be screened for
PGI isozyme variants and DNA polymorphism at chs2 and ipi3
loci according to the protocols used for evaluation of the ovule
donor plants.
Fig. 4 Enlarged carrot ovary with excised ovule
3.3 Flow Cytometry Prepare the sample tissue of a reference standard (of known ploidy)
(see Note 16) and the tested samples.
1. Take approximately 0.5–1.0 cm2 of leaf tissue and place in a
Petri dish.
2. Slice the tissue with a razor blade in the presence of 1 mL of
the lysis buffer with the addition of 1 mL of DAPI solution.
3. Filter the suspension through a 30 μm nylon filter into a test
tube and leave for 5 min at RT (see Note 17).
4. Run the sample on a flow cytometer immediately or within a
short time. Do not store the suspension.
5. Ploidy is determined by comparing a position of the peak of
the diploid standard, with the position of the peak correspond-
ing to G1 nuclei of the regenerants.
3.4 Molecular 1. Prepare an electrophoresis tank and fill it with the electropho-
Analyses resis buffer. Soak cellulose acetate plates in the electrophoresis
buffer (see Note 18).
3.4.1 Glucose-6-
2. Homogenize 50 mg of fresh leaf tissue from each sample in
Phosphate Isomerase (PGI,
100 μL of the extraction buffer.
EC 5.3.1.9) Analysis
3. Using the Super Z-12 applicator, load 1 μL of the extract from
each sample to a cellulose acetate plate. Add 1 μL of bromo-
phenol blue solution to the first and the last sample.
4. Transfer the plates to the electrophoresis tank.
5. Run electrophoresis at 240 V, 100 mA for about 35–40 min
until the bromophenol blue dye reaches the ¾ length of the
cellulose acetate plate.
6. Take out the acetate plate and place in a plastic box. In 20 mL
glass beaker, prepare 1 mL of the staining solution and mix
with 1 mL of melted 1.6% agar (see Note 19).
7. Cover the cellulose acetate plate with a warm mixture and
incubate in the dark at RT for ca. 20 min, until dark purple
bands appear.
8. Wash out agar layer with running tap water and fix the electro-
pherogram by immersing the plate in 3% acetic acid for 5 min.
9. Analyze results (see Fig. 5).
10. Donor plants: plants identified as heterozygotes (three bands
at pgi-2 locus) are used in further experiments.
11. Regenerants: regenerants identified as heterozygotes at pgi-2
locus are discarded, as they are of somatic cell origin. All homo-
zygous plants (single bands at pgi-2 locus) should be subjected
to DNA analysis.
3.4.2 DNA Isolation 1. Prepare a box with ice and chill mortars and pestles. Take the
sample tissue from the −20 °C and place on ice (see Note 20).
2. Grind frozen sample tissue in liquid nitrogen. Transfer approx-
imately 130–150 mg of tissue to the chilled 2.0 mL Eppendorf
tube and add 700 μL of the CTAB extraction buffer and mix.
3. Add 4 μL of RNase A. Vortex shortly and incubate in a ther-
moblock set to 65 °C for 20 min.
4. Centrifuge with the speed of 14,243 × g for 5 min.
5. Transfer the supernatant to a new 2.0 mL Eppendorf tube.
Add 600 μL of the chloroform/isoamyl alcohol solution
(24:1) and mix thoroughly to form an emulsion.
6. Centrifuge with the speed of 12,281 × g for 10 min at RT.
7. Collect the supernatant solution from the top (aqueous phase)
into a new tube (see Note 21). Discard the lower (chloroform)
phase. Add 50 μL of buffer II and mix.
8. Add 500 μL of the chloroform/isoamyl alcohol solution (24:l)
and mix thoroughly.
9. Centrifuge with the speed of 12,281 × g for 5 min at RT.
10. Take 400 μL of the supernatant to a new tube and add 400 μL
of ice-cold (−20 °C) isopropanol and mix gently.
Fig. 5 Variation of isozyme pattern at PGI-2 zone in carrot after electrophoresis using cellulose acetate plate.
Lines 1 and 10—homozygotes for Pgi-2.1 allele; lines 2, 7, 9, and 12—homozygotes for Pgi-2.3 allele; lines
3–6, 8, and 11—are heterozygotes
11. Centrifuge with the speed of 12,281 × g for 10 min at

RT. Discard the supernatant.
12. Add 400 μL of 70% ethanol, mix.
13. Centrifuge with the speed of 12,281 × g for 5 min, at
RT. Discard the supernatant.
14. Dry in a vacuum dryer for 5–10 min until the liquid is
evaporated.
15. Rehydrate the pellet in 50 μL of the 0.1xTE buffer. Store at
−20 °C.
16. Check the DNA quantity by measuring the absorbance using
NanoDrop (see Note 22) and DNA quality by running elec-
trophoresis in 1% agarose gel.
3.4.3 PCR 1. Take 0.2 mL PCR tube and mix 9 μL of PCR reaction mixture
and Electrophoresis with 1 μL (10–20 ng) of DNA. Repeat for each sample. Hold
on ice.
2. Place tubes in the thermal cycler and run for amplification set-
ting the following program:
Initial step 2 min at 94 °C (denaturation)
30 cycles 30 s at 94 °C (denaturation)
30 s at 55 °C (annealing)
3 min at 68 °C (extension)
One cycle 10 min at 68 °C (extension)
Final cycle 4 °C (hold)
3. Prepare the 1% agarose gel with EtBr by mixing 300 mL of the

agarose solution with 30 μL of EtBr solution and pour it into
a plastic form. Place a comb in the form and leave for solidifica-
tion in RT (see Note 23).
4. Take 8 μL of PCR amplification product into 0.5 mL Eppendorf

tube and add 2 μL of the loading dye.
5. Load samples into 1% agarose gel bathed in 1 × TAE electro-
phoresis buffer. Load also a DNA molecular mass ladder.
6. Run electrophoresis at 120 V and 400 mA until the bromo-
phenol blue from the loading dye reaches a point of ¾ length
of the gel.
7. Visualize products using a transilluminator with UV light,
photograph the gel, and analyze the presence of desired
products.
8. The amplified fragments have sizes of 820 or 900 bp for chs2,
and 1050 or 1100 bp for ipi3 (see Note 24). The presence of
a single band for a given locus indicates homozygosity at that
locus while the presence of two bands is an evidence of
heterozygosity.
Donor plants: plants that were heterozygous for all three
(pgi-2, chs2, ipi3) loci are selected and used in further experi-
ments as ovule donors.
Regenerants: to be considered of gametic origin, regener-
ants have to be homozygous at all three (pgi-2, chs2, or ipi3)
checked loci.
4 Notes
1. Roots should be stored in boxes filled with a peat moss or sand

to protect from water loss. At least 2 months of vernalization
are required, but some roots need more time to induce genera-
tive phase. If roots with developed leaf rosette are vernalized
dimmed light should be ensured.
2. Prepare fresh solution of chloramine each time before use.
Chloramine in solution tends to crystallize.
3. Storing agar solution is not recommended, as it gets contami-
nated by bacteria or fungi.
4. The solution should be heated to 90–100 °C for at least
10 min, and then allowed to cool at RT. This allows destroying
any DNases.
5. EtBr is a heavy mutagen intercalating with DNA. It is absorbed
through the skin and is highly toxic by inhalation. Working
with EtBr requires safety procedures. Wear nitrile gloves, as
latex gloves offer less protection from EtBr. Use a fume hood
to avoid inhalation. EtBr can be replaced by other fluorescent
DNA stains with lower toxicity.
6. Plant protection against pests is very important at this step,
therefore perform necessary actions regularly. Mites and thrips
are very undesirable as they damage flowers and might cause

difficulties in control of pollination. Plants of both species
should be kept at optimum conditions (temperature, watering,
fertilization, etc.).
7. Supply enough space in each cage. Plants should not be in
contact with each other. Make sure that the distribution of the
plants in the cages allows for necessary action (plant protec-
tion, watering, fertilization, and pollination).
8. Parsley plants might be placed densely in cages.
9. Usually, in carrot anther dehiscence and falling occur before
the stigma become receptive (protandry). During this period
umbels might be sprayed with distilled water to remove
pollen.
10. Pollination is most effective on the primary umbels. Both car-
rot and parsley have very small flowers and pollination process
is laborious. Pay attention to smear parsley pollen directly on
the carrot stigma.
11. During the period covering the pollination up to harvesting do
not perform plant protection (especially sprays) as it might
wash off the pollen or damage the plants.
12. Perform sterilization on the same day after media preparation,
do not store unsterile solution. Store sterilized media at 4 °C.
13. Excision of ovules on a microscope slide allows minimizing the
contaminations and easy exchange subsequent ovaries during
isolation. Place 1 or 2 ovaries at one slide and make sure they
are wet (covered with single drops of water). Drying of ovaries
and ovules is not recommended.
14. Do not damage the ovules. Damaged ovules will get brown
quickly and eventually die on the culture medium. Damaged
ovules should be discarded.
15. To avoid dehydration, transfer the newly isolated ovules to the
culture medium immediately after excision and keep the dish
closed during subsequent isolation. Placing the excised ovules
in 4 rows of 5 ovules each allows for easy observations of the
culture.
16. We used diploid (2n = 2x = 18) carrot cultivar Dolanka.
17. Incubation is needed for the proper stain of the nuclei.
18. In cellulose acetate plates proteins are separated due to capil-
lary force. Electrophoresis tank is designed in the way that the
cellulose plate is the only medium allowing current flow
between electrodes immersed in two separate electrophoresis
buffer chambers (see Fig. 1a). Alternative electrophoresis sys-
tems, e.g., starch gels submerged in a horizontal electrophore-
sis tank, can be used but electrophoresis parameters must be
adjusted and a staining procedure will require larger amounts

of reagents.
19. Use hot agar mixture. Heat in a microwave oven. If it starts
solidifying, need to be heated again. Mix the staining solution
with warm but not hot agar by pipetting. Act quickly as agar
might solidify.
20. We performed the isolation according to the method by Rogers
and Bendich [19], but other method allowing for isolation of
total genomic DNA of good quality can be used.
21. Two phases should be seen: aqueous with nucleic acid on top
and chloroform phase at the bottom of the tube.
22. Spectrophotometer equipped with a UV lamp and UV-
transparent cuvettes can be used NanoDrop instead.
Fluorimeter is another option giving more reliable DNA quan-
tification but does not allow for estimation of protein
contamination.
23. For agarose melting use microwave oven. Use a fume hood to
avoid inhalation. Add EtBr when agarose solution is cooled to
about 40 °C and mix quickly.
24. Other fragment sizes may occur depending on plant genotypes
[20].
Acknowledgments
The research project was funded by the Polish Ministry of

Agriculture and Rural Development (Grant No. HORhn4040
dec – 1/08, 2008-2013).
References
1. Rubatzky VE, Quiros CF, Simon PW (1999) 6. Staniaszek M, Habdas H (2006) RAPD tech-
Carrots and related vegetable Umbelliferae. nique application for intraline evaluation of
CABI Publ, New York androgenic carrot plants. Folia Hort 18:87–97
2. Simon PW (2000) Domestication, historical 7. Matsubara S, Dohya N, Murakami K (1995)
development, and modern breeding of carrot. Callus formation and regeneration of adventi-
Plant Breed Rev 19:157–190 tious embryos from carrot, fennel and mitsuba
3. Forster BP, Heberle-Bors E, Kasha KJ, Touraev microspores by anther and isolated microspore
A (2007) The resurgence of haploids in higher cultures. Acta Hort 392:129–137
plants. Trends Plant Sci 12:368–375. https:// 8. Li J-R, Zhuang F-Y, Ou C-G, Hu H, Zhao
doi.org/10.1016/j.tplants.2007.06.007 Z-W, Mao J-H (2013) Microspore embryo-
4. Thomas WTB, Forster B, Gertsson B (2003) genesis and production of haploid and doubled
Doubled haploids in breeding. In: Maluszynski haploid plants in carrot (Daucus carota L.).
M, Kasha KJ, Forster BP, Szarejko I (eds) Plant Cell Tiss Org 112:275–287. https://doi.
Doubled haploids production in crop plants. org/10.1007/s11240-012-0235-5
Kluwer Academic Publisher, Dordrecht, 9. Bohanec B, Jakše M, Ihan A, Javornik B (1995)
pp 337–349 Studies of gynogenesis in onion (Allium cepa
5. Adamus A, Michalik B (2003) Anther cultures L.): induction procedures and genetic analysis of
of carrot (Daucus carota L.). Folia Hort regenerants. Plant Sci 104:215–224. https://
15:49–58 doi.org/10.1016/0168-9452(94)04030-K
10. Lim W, Earle ED (2008) Effect of in vitro and 16. Monakhova MA, Tyukavin GB, Shmykova NA
in vivo colchicine treatments on pollen produc- (1998) Change of ploidy during formation of
tion and fruit set of melon plants obtained by regenerated plants from androgenous and
pollination with irradiated pollen. Plant Cell gynogenous embryos of carrot in vitro. In:
Tiss Org 95:115–124. https://doi. Proceedings of the IX international congress
org/10.1007/s11240-008-9422-9 on plant tissue and cell culture, plant biotech-
11. Kantartzi SK, Roupakias G (2009) In vitro nology and in vitro biology in the 21st century.
gynogenesis in cotton (Gossypium sp.). Plant Jerusalem, Israel, p 122
Cell Tiss Org 96:53–57. https://doi. 17. Murashige T, Skoog F (1962) A revised medium
org/10.1007/s11240-008-9459-9 for rapid growth and bioassays with tobacco tis-
12. Kiełkowska A, Adamus A (2010) In vitro cul- sue cultures. Physiol Plant 15:473–497.
ture of unfertilized ovules in carrot (Daucus https://doi.org/10.1111/j.1399-3054.1962.
carota L.). Plant Cell Tiss Org 102:309–319. tb08052.x
https://doi.org/10.1007/s11240-010- 18. Budahn H, Baranski R, Grzebelus D,
9735-3 Kiełkowska A, Straka P, Metge K, Linke B,
13. Kiełkowska A, Adamus A, Baranski R (2014) Nothnagel T (2014) Mapping genes governing
An improved protocol for carrot haploid and flower architecture and pollen development in
doubled haploid plant production using a double mutant population of carrot (Daucus
induced parthenogenesis and ovule excision carota L.). Front. Plant Sci 5:504. https://doi.
in vitro. In Vitro Cell Dev Biol-Plant org/10.3389/fpls.2014.00504
50(3):376–383. https://doi.org/10.1007/ 19. Rogers SO, Bendich AJ (1988) Extraction of
s11627-014-9597-1 DNA from plant tissues. In: Gelvin SB,
14. Brazauskas G, Pasakinskiene I, Jahoor A (2004) Schilperoort RA (eds) Plant molecular biology
AFLP analysis indicates no introgression of manual. Kluwer, Academic Publishers, Boston,
maize DNA in wheat x maize crosses. Plant pp l–10
Breed 123:117–121. https://doi. 20. Grzebelus D, Gladysz M, Baranski R (2015)
org/10.1046/j.1439-0523.2003.00927.x Gene-specific length polymorphism - a simple
15. Manickam S, Sarkar KR (1999) Foreign pollen tool for routine analysis of homogeneity of car-
tube growth in maize after chemical treat- rot (Daucus carota L.) breeding stocks.
ments. Ind J Genet Plant Breed 59:53–58 Acta Hort 1099:691–694. https://doi.org/
10.17660/ActaHortic.2015.1099.85
Chapter 22
Using Flow Cytometry Analysis in Plant Tissue Culture

Derived Plants
Rosa María Escobedo-Gracia-Medrano, Martha Josefa Burgos-Tan,
José Roberto Ku-Cauich, and Adriana Quiroz-Moreno
Abstract
Somaclonal variation (SC) in plants regenerated from tissue culture, via organogenesis or somatic
embryogenesis, is frequently associated with abnormalities in the content of deoxyribonucleic acid (DNA),
viz., aneuploidy and polyploidy. Flow cytometry (FCM) using the nucleic acid-specific fluorochrome prop-
idium iodide has proven to be a rapid, simple, and reproducible technique for assessment of DNA content
and ploidy variation occurring in plant tissue cultures. Here an outline of the sample preparation of suspen-
sion with intact nuclei by the two-step standard method, and FCM analysis of DNA ploidy stability in plants
regenerated from embryogenic cell suspension (ECS) of banana Musa acuminata, AAA, cv. Grand Naine
(Cavendish subgroup) using an internal standard is described.
Key words Clonal propagation, DNA content, Flow cytometry, Musa spp., Ploidy level, Somatic
embryogenesis
1 Introduction
Flow cytometry (FCM) is a valuable technique with broad

applications from animal cell biology, to plant systematics,

evolutionary biology, biogeography, and biotechnology, among

others [1–4]. The cytometer is an instrument composed of basically
three parts, the fluidic, optic, and electronic, in addition to the
informatics component [1]. The analysis of a considerable number
of isolated particles/nuclei in a very short time and the ability to
individually measure the particles from a mixed population of interest
at high speed (e.g., analysis of 100–10,000 particles per second) are
two advantages that make FCM an excellent analytical tool [1].
Since the introduction of FCM to plant science around the
1980s, its application in breeding and biotechnology spreads by the
simplicity of sample preparation. Several procedures exist for
preparing and staining suspensions of intact plant nuclei. They d
iffer
in the way the nuclei are released from the cells, e.g., mechanical
317
318 Rosa María Escobedo-Gracia-Medrano et al.
isolation by chopping of leaf tissues [5] or in vitro callus cultures,

lysis of protoplast preparations [6] and by the bead beating protocol
[7]. They vary by the composition of the isolation buffers [8–10],
and the type of fluorochrome used for nuclei staining [11, 12]. The
accuracy of plant nuclear DNA content, DNA ploidy, and cell cycle
phase estimates is greater when isolated nuclei are analyzed. Plant
cell wall and the cytoplasmic constituents may be autofluorescent,
and stainability of DNA nonspecifically with DNA-fluorochromes
due to interference by secondary metabolites, such as tannic acid
[13] or chlorogenic acid [14], decreases the accuracy of nuclear
DNA determinations.
The purpose of the extraction buffer is to preserve and to
stabilize the integrity of the nuclei during their release from intact
plant cells and protect the DNA from nuclease activity to allow the
optimum conditions for fluorochrome stoichiometrically staining
of DNA [10, 15]. There is various nuclear isolation buffers most
commonly used in plant FCM (Table 1) [20]. Although they differ
in chemical composition, the choice of buffer for a plant species
and tissue is empirical. If no prior information exists in the
literature, a good practice is to test several buffers to select the best
performing one on your material [10, 20].
For the estimation of DNA content and ploidy by FCM, nuclei
are stained with a fluorescent dye that binds stoichiometrically to
nucleic acids, whereby the number of molecules of the dye bound is
equivalent to the number of molecules of DNA that are present [21].
The fluorochromes commonly used for nucleic acid labeling and
FCM analysis are categorized into two groups. Those that intercalate
with the double-stranded nucleic acid, e.g., propidium iodide (PI)
and ethidium bromide (EtBr) [12], and SYBER Green [14]; and
those dyes and drugs that show a base preference AT and GC, respec-
tively, e.g., 4′,6′-diamidino-2-phenylindole (DAPI) and bisbenzimide
(Hoechst 33,258), mithramycin (MI), chromomycin A3 (CH), and
olivomycin (OL) [12]. PI is preferred for absolute estimation of DNA,
whereas DAPI or Hoechst 33258 is used for analysis of DNA ploidy.
For genome size and ploidy estimations, conversion of fl
uorescence
intensities record by FCM to relative and absolute values requires the
use of a reference standard, that is, plant samples with known ploidy
level and nuclear DNA content. Several plant reference standard
species are recommended for that purpose (Table 2) [4, 27].
In plant biotechnology, FCM is a highly competitive tool for
the screening the genetic stability/instability of large population of
regenerated plants of many species, at the DNA ploidy (in relative
units) and quantity (C-value, in absolute units) level. The alterna-
tive conventional chromosome counting method, besides the need
of a well-trained person (cytologist), is frequently difficult to be
utilized for assessing large number of samples, and by the need to
have tissues (usually meristems) with high rates of mitotic division.
In contrast, FCM does not require dividing cells [26, 27]; however,
DNA Ploidy Stability in Regenerated Plants 319
Table 1
Frequently used buffers for the isolation of plant nuclei for FCM
Buffer Composition References

Galbraith 20 mM MOPS, 45 mM MgCl2, 30 mM sodium citrate, 0.1%(v/v) Triton [5]
X-100, pH = 7.0
LB01 15 mM Tris, 2 mM Na2EDTA, 20 mM NaCl, 80 mM KCl, 0.5 mM [6, 10]
spermine tetrahydrochloride, 0.1% (v/v) Triton X-100, 15 mM
β-mercaptoethanol, pH 7.5
MgSO4 9.53 mM MgSO4·7 H2O, 47.7 mM KCl, 4.8 mM HEPES, 6.5 mM DTT, [16]
0.25% (v/v) Triton X-100, pH = 8.0
Otto’s Otto I: 0.1 M citric acid monohydrate, 0.5% (v/v) Tween 20, [9, 17]
Otto II: 0.4 M Na2HPO4 ·12 H2O
Marie 50 mM HEPES, 50 mM glucose, 15 mM NaCl, 15 mM KCl, 5 mM [18]
Na2EDTA, 50 mM sodium citrate, 0.5% (v/v) Tween 20, pH = 7.2, add
5 μL mL−1 of β-mercaptoethanol (added fresh)
Tris·MgCl2 0.2 M Tris, 4 mM MgCl2·6 H2O, 0.5% (v/v) Triton X-100 pH = 7.5 [19]
MOPS 4-morpholinepropane sulfate, Tris tri-(hydroxymethyl)-aminomethane, DTT dithiothreitol, HEPES 4-(hydroxy-
methyl)piperazine-1-ethanesulfonic acid
Table 2
Several plant reference standard species and cultivars recommended for
genome size estimation in absolute units
Plant species and cultivar 2C DNA content (pg DNA) References

Oryza sativa “IR-36” 1.01 [22]
Raphanus sativus “Saxa” 1.11 [12]
Solanum lycopersicum 1.96 [12]
“Stupiké polní rané”
Glycine max Polanka 2.50 [23]
Petunia hybrida “PxPc6” 2.85 [18]
Zea mays “CE-777” 5.43 [24]
Pisum sativum “Ctirad” 9.09 [25]
Secale cereale “Dankovske” 16.19 [25]
Vicia faba “Inovec” 26.90 [12]
Alllium cepa “Alisa Craig” 33.50 [22]
Allium cepa “Alicie” 34.89 [25]
sometimes karyological information is necessary to unambiguously

corroborate the occurrence of aneuploidies, and detect c hromosomal
variations, e.g., duplications and deletions. When chromosome
counts are not made, the ploidy level analyzed by FCM should
always be referred to as “DNA ploidy level” [2].
The ability of somatic plant cells to represent the progenitor of a
new individual in vitro is of great value for the clonal propagation of
crop plants. The occurrence of genetic, karyological, epigenetic, or
phenotypic variation, among plants regenerated from in vitro cultures
[28–30], termed somaclonal variation (SV) [31], is considered a
burden to commercial micropropagation wherein the regenerated
population is expected to be homogenous. Somaclonal variation, on
the other hand, offers a prospect for recovery of useful mutants in
tissue culture and for genetic improvement of selected in vitro
variants of crops which are vegetatively propagated [32–36].
The SV found in regenerated plants depends on what happened
at the genomic level during the different stages of in vitro culture.
This variation may be attributed to: (1) preexisting variation in the
somatic cells of the explant tissue, due to changes in chromosome
numbers, i.e., polyploidy and aneuploidy, chromosome structural
changes [28, 30, 37] or, (2) generated variation during the tissue
culture [38, 39], and at the DNA sequence level, mutations and
epigenetic changes that can occur [39–41]. Even though SV is a
phenomenon quite poorly understood, the evidences indicate that
stress caused by the in vitro culture environment, viz., type and
concentration of applied plant growth regulators (PGRs), the
explant genetic conformation, and total number and duration of
subcultures, can affect the characteristics of regenerated plants [42].
Since its first application for estimation of nuclear DNA content
and ploidy level analysis in the genus Musa [23, 26, 43–45], FCM
has become a good alternative and supportive tool to chromosome
counting, for the investigation of cytogenetical instabilities associ-
ated to SV of plants regenerated from short- and long-term embryo-
genic cell suspension (ECS) cultures or cultures that involve a callus
phase, or high rates of multiplication treatments [40, 46, 47].
Cytogenetic instabilities, viz., aneuploidies, in banana-regenerated
plants have been recorded in true-to-type and off-type triploid
banana plants obtained from in vitro shoot tip cultures, or by ECS
cultures [40, 48]. True-to-type diploid plants regenerated from
short-term ECS cultures showed cytogenetic stability, and emblings
derived from longer-term cultures that showed higher DNA amount
conserved their euploid (2n = 2x = 22) status [47].
This chapter describes the procedure for evaluating DNA
ploidy stability, by FCM, in plants regenerated from an embryogenic
cell suspension (ECS) of banana Musa acuminata, AAA, cv. Grand
Naine (Cavendish subgroup) using an internal reference standard
of the same species.
2 Materials
2.1 Biological 1. For sampling select rapidly growing young leaves from healthy
Materials plants. The 50 banana plants regenerated from SE (emblings)
were selected randomly from 200 regenerated plants [49].
Samples (30 mg) of the youngest regenerated banana Musa
acuminata, AAA, cv. Grand Naine (Cavendish subgroup) leaf
plus 25 mg of the internal standard (Musa acuminata ssp.
malaccensis (accession name Selangor, ITC 250; 2n = 2x = 22),
2C = 1.23 pg [44, 47]. Samples (30 mg) of two sucker plants
collected from the explant donor plant (cv. Grand Naine,
3n = 3x = 33, and 2C = 1.9 pg) [43, 47] were analyzed as
control of the 50 selected in vitro SE-regenerated plants.
2.2 Glassware 1. Plastic Petri dishes (9.0 cm diameter), razor blades: double-
edged with blade holder.
2. Graduated laboratory glass bottles, with PP screw caps, capacity
50, 100, 250, and 500 mL.
3. Volumetric glass flasks, 10, 25, 500, 100, and 500 mL.
4. Polystyrene sample tubes suitable for the flow cytometer (e.g.,
BD Falcon, 12 × 75 mm, 5 mL round bottom tube, capped).
5. Sample tube rack, and ice box.
6. Nylon mesh: PARTEC Cell Trics 30 μm and 20 μm.
7. Micropipettes and appropriate tips (0.1, 0.2, and 1 mL).
2.3 Instrumentation
1.
BD FACSCalibur cytometer (Becton–Dickinson
Immunocytometry System, San Jose, CA, USA) equipped with
a 15/mW, 488/nm argon-ion laser and detectors for three
fluorescence parameters. The laser light is focused onto the flow
cell. As the fluorescent-labeled particles intercept the laser light
in the flow cell, scattered and fluorescent light provides
information about the particle size, shape, granularity, and

fluorescence intensity. BD CellQuest Pro acquisition software,
samples run manually, measure PI of samples by using an FL2
detector set at 585/42 nm to read the relative fluorescence
intensities and provide 2C nuclei histograms data. Then, data is
analyzed with ModFit software (Verity Software, USA).
Although the information presented here pertains to the BD
FACSCalibur instrument, the methodology applies to other
brands of c ytometers. The manner histograms are set up, and
the analysis s oftware may be quite different between devices.
2.4 Reagents All reagents must be analytical or molecular biology grade.

and Solutions
1. Citric acid monohydrate.
2. Sodium phosphate dibasic dodecahydrate, Na2HPO4·12H2O.
3. Tween 20, the cell culture tested reagent is recommended for

obtaining good resolution DNA content histograms [27].
4. Propidium iodide ≥98.0% (HPLC). Caution: PI is a DNA
intercalating agent and must be treated and disposed
appropriately.
5. Ribonuclease A from bovine pancreas molecular biology grade,
a product prepared by a chromatographic method for elimina-
tion of DNase activity (see Note 1).
6. Chicken red blood cell nuclei (CRBC), are used as a daily
standard for alignment of the FCM, and checking its linearity,
by comparing the peak position of nuclei singles and clumps of
doubles and triples nuclei, etc. (see Note 2).
7. Bulk fluids: BD FACS, Flow sheath fluid. Cleaning: BD FACS,
clean solution or 10% household bleach solution. Rinsing solu-
tion or deionized (DI) distiller water. Waste decontamination:
full-strength bleach.
Prepare all the stock solutions with sterile double distilled
deionized water (ddH2O) with a conductivity of 18 MΩ-cm at
25 °C. Stoke solutions are made at room temperature, and
stored as indicated.
8. RNase stock solution, 1 mg mL−1. Weigh 25 mg of the enzyme,
dissolve in 20 mL ddH2O, and adjust the volume to 25 mL
using a volumetric flask (see Note 1). Filter through a 0.22 μm
nylon membrane. Store 500 μL aliquots in Eppendorf micro-
centrifuge tubes at −20 °C. The solution should not be frozen
after thawing.
9. Propidium iodide, 1 mg mL−1. Weigh 50 mg of propidium
iodide, dissolve in 40 mL ddH2O, and adjust the volume to
50 mL using a volumetric flask. Filter through a 0.22 μm nylon
membrane to remove small particles, store in aliquots of
500 μL at −20 °C protected from light. The solution should
not be frozen after thawing. Caution: this reagent is extremely
carcinogenic, so be very careful when handling.
2.4.1 Nuclear Extraction 1. Otto’s buffer is a good choice to study banana plants regener-
Buffers ated from in vitro tissue cultures [23, 26, 40, 47, 51].
2. Otto, I buffer [9, 17], 0.1 M citric acid monohydrate, 1%
(v/v) Tween 20. Dissolve 2.1 g of citric acid in 90 mL ddH2O
and add 1 mL 1% Tween 20 solution, adjust the volume to
100 mL. Sterilize by filtration using a sterile 0.22 μm nylon
filter, and store at 4 °C. Prepare the required volume of solu-
tion to be employed in a working week.
3. Otto II buffer [9, 17], 0.4 M Na2HPO4·12H2O. Dissolve
7.1625 g of the reagent in 40 mL ddH2O at 50–60 °C, adjust
the final volume to 50 mL, sterilize by filtration using 0.22 μm
nylon filter, store in 10 mL aliquots in 16 mL Falcon sterile
tubes at room temperature. The solution is stable for several

weeks.
4. CRBC solution I (Locke-Ringer isotonic solution) is composed
of 148.69 mM NaCl (8.69 g), 4.16 mM KCl (0.31 g), 1.8 mM
CaCl2 (0.20 g), 0.05 mM MgCl2 (0.10 g), 1.1 mM dextrose
(2.0 g), 1.15 mM K2HPO4 (0.2 g), and 5.88 mM KH2PO4
(0.8 g). Weigh the quantities given in parenthesis and dissolve
in 800 mL ddH2O. Adjust the pH to 6.3 with 1 N KOH, bring
the volume to 1000 mL, and sterilize by filtration.
5. CRBC buffer solution II (Doležel, unpublished information),
140 mM NaCl (0.41 g), 5% (v/v) Tritón X-100 (2.5 mL).
Dissolve the components in 40 mL ddH2O, then bring the
volume to 50 mL, and sterilize by filtration.
6. CRBC buffer solution III (Doležel, unpublished information),
1 mM Tris (60.57 mg), 15 mM MgSO4·7H2O (1.849 g),
320 mM sucrose (54.77 g), 15 mM de β-mercaptoethanol
(524.5 μL). Dissolve the components in 400 mL ddH2O. Adjust
the pH to 7.1, then bring the volume to 500 mL, and sterilize by
filtration.
2.4.2 Preparation The procedure of CRBC nuclei suspension preparation is a modi-

of CRBC Nuclei Suspension fication of Doležel (unpublished information).
for Alignment of the FCM
1. Heparinized blood is obtained from chickens by heart puncture.
In 15 mL centrifuge glass tubes mix 1 mL of fresh chicken blood
(extracted from one-day-old baby chicken) with 3 mL of isotonic
Locke-Ringer CRBC solution I. Centrifuge at 100 × g for 5 min.
2. Discard the supernatant, add 3 mL Locke-Ringer solution I
and mix gently. Centrifuge at 100 × g for 5 min. Repeat the
procedure twice or until all the plasma is removed (the wash-
ing solution I should be clear).
3. Discard the supernatant, and suspend the pellet in 2 mL of
CRBC buffer II, and vortex briefly.
4. Immediately add 2 mL CRBC buffer III, and mix briefly.
5. Centrifuge at 250 × g for 5 min. Discard the supernatant, add
2 mL CRBC buffer III, and mix gently.
6. Centrifuge at 120 × g for 5 min and discard the supernatant.
The pellet is then transferred to a clean tube, add 2 mL CRBC
buffer III, and mix gently.
7. Centrifuge at 90 × g for 5 min and discard the supernatant.
8. Suspend the pellet in 2 mL of chilled (−20 °C) fresh fixative
(ethanol: acetic acid, 3:1) [6], (see Note 3). Allow the CRBC
to settle overnight at 4 °C, do not agitate.
9. Softly remove the fixative, then, the pellet of nuclei is suspended
in 3 mL of chilled 70% (v/v) ethanol, vortex for a short time,
and then syringe the suspension first through a 25G needle
until CRBC suspension pass through without plugging the

needle, and then through a 30G needle.
10. The CRBC nuclei suspension is filtered through a 30 μm

nylon filter to remove large clumps. If the concentration of the
nuclei is too high, dilute it to ~36 × 106 CRBCs/mL using
cold 70% ethanol. Store in aliquots of 500 μL at −20 °C.
2.5 FCM Setup Check sheath fluids (BD FACS solution) daily for proper function.
Fill the sheath reservoir to 75% capacity. Empty the waste tank.
When working with propidium iodide, the 4 L sewage tank should
be filled with 400 mL chloride to inactivate the iodide molecules.
Check the flow cell for air bubbles, the fluidic mode on high
PRIME removes bubbles from the flow cell. At completion, the
instrument goes into STANDBY mode. For detail cytometer setup
and management of acquisition software, check the BD
FACSCalibur Instructions for Use guide (bdbiosciences.com, Part
No. 643271 Rev. A, November 2007), https://www.bdbiosci-
ences.com/documents/BD_FACSCalibur_instructions.pdf
3 Methods
For regenerated banana plants, the suspensions of isolated nuclei

are prepared according to the two-step protocol using Otto I and
Otto II buffers [27].
3.1 Protocol 1. Collect a piece of the youngest (cigar) leaf samples, experimental,
for Preparing control (explant of donor banana, AAA, cv. Grand Naine) and
Suspensions of Intact internal reference standard (M. acuminata ssp. malaccensis,
Nuclei from Plant Selangor), from healthy banana plants free of pests and patho-
Tissues gens grown in the glasshouse. Wrap the collected material in a
paper towel saturated with a solution containing 2% detergent
and 0.5% sodium metabisulfite to prevent it from oxidizing,
place it in a plastic Petri dish labeled with sample data, and
transport to the laboratory.
2. In the lab, wash the leaf material with abundant ddH2O,
remove excess of water with a paper towel. Weigh samples,
30 mg of the experimental and control (leaf of a sucker from
the donor explant plant) and 25 mg of internal reference, and
place the samples in the center of a Petri dish (see Note 4). Add
1 mL chilled (4 °C) Otto I buffer to the Petri dish kept on ice,
while chopping the other samples incubated with 1 mL of
chilled Otto I in the Petri dishes at 4 °C.
3. Prepare the sample by simultaneously chopping for 1 min (see
Note 5) with a new razor blade, the tissue(s) of the internal
reference and the unknown experimental sample, and of each
sample individually (and the control). Keep the Petri dish
slightly inclined on ice, to avoid evaporation of the buffer and

drying out of the tissue, and incubate for 15 min.
4. Collect the suspension homogenate from the Petri dish with
1 mL micropipette tip, cut at the tip, mix carefully by pipetting
twice up and down preventing the formation of air bubbles.
5. Then, filter the homogenate through a 20-μm nylon mesh
(Partec Cell Trics) into a labeled sample tube. To avoid the loss
of nuclear suspension, saturate the nylon mesh with Otto I
buffer shortly before filtration.
6. Pellet the nuclei in a swinging bucket centrifuge, equilibrate
the sample tubes using Otto I, then centrifuge for 5 min at
150 × g. As the suspensions of nuclei are stable in the Otto I
buffer, it is possible to prepare several samples in advance.
7. Discard the supernatant, and add 100 μL ice-cold Otto I solu-
tion and suspend the nuclei by gentle shaking with the thumb.
8. At this step, various samples can be prepared before analysis
with the FCM, and the nuclear suspension may be kept at 4 °C
for 1 h, mixing occasionally, and ready for the next t staining
step.
3.2 Fluorochrome For estimation of DNA ploidy and DNA content of banana-
for Staining DNA regenerated plants, PI is used for nuclei staining.
3.2.1 Propidium Iodide 1. Add to the 100 μL nuclear suspension 500 μL of Otto II, fol-
Staining lowed by 30 μL of RNase and 30 μL of propidium iodide, and
incubate 15 min in the dark. The RNase and PI final concen-
tration is 50 μg mL−1, respectively.
2. The sample should be analyzed within 15–20 min after adding
Otto II buffer. The isolated nuclei may not be stable for pro-
longed periods in Otto II buffer. Therefore, staining of sus-
pension must be done one at a time.
3. Incubate in the dark for 15 min at room temperature.
4. Run the samples on the flow cytometer to analyze the DNA
ploidy and nuclear DNA content as described below (Step 3.4).
3.3 Alignment Align the FCM with CRBC nuclei.

of the FCM
1. Suspend an aliquot of CRBC nuclei suspension in 70% ethanol
(FACSCalibur
by intensely mixing with a vortex.
Cytometer BD)
2. Take 150 μL of the nuclei suspension and in a sample tube add
100 μL Otto1 and 1.4 mL, using the Otto II (see Note 6).
3. Add PI (82.5 μL) to a final concentration of 50 μg mL−1.
4. Incubate in the dark for 15 min.
5. Resuspend the CRBC nuclei with a vortex.
6. Place the sample tube of stained nuclei in the FCM injection

port, adjust the sample rate at a low speed, and run after a few
seconds to stabilize the sample.
7. Locate the average of the first peak of single nuclei approximately
to the channel 200 ± 5 by adjusting the voltage (FL2 detec-
tor); the coefficient of variation of the fluorescent peak should
be less than or equal to 3%. Check that the equipment linearity
is 2.0, by comparing the peak position of nuclei singles and
clumps (doubles, triples). This calibration setup step is done
every day before running the samples to be analyzed.
3.4 Calibration The protocol using plant internal reference and PI staining is as
with the Plant Internal follows:
Reference Standard 1. Prepare the sample as described in step 3.1.3 to 3.2 for the
internal reference (in this example, Selangor banana) with
known ploidy (chromosome number, 2n = 2x = 22) and the
unknown regenerated banana plant(s) sample(s), and control
donor plant.
2. Place in the injection port the sample tube with the internal refer-
ence stained nuclei and RUN at medium speed for a few seconds.
3. Locate the G1 peak to the required position on the abscissa by
adjusting the voltage, and verify the linearity (the 4C/2C peak
ratio should be in the range of 1.98–2.02); this is done only
once, and measure the following samples with the same instru-
ment settings.
4. Remove the internal reference from the injection port, place
the sample of interest and verify that the peak(s) do not overlap
with that of the reference.
5. Remove the sample of interest from the injection port and
place the mixture containing the internal reference and the
sample of interest (regenerated banana cv. Grand Naine), verify
that 2C peak of the interest sample does not overlap with the
internal reference and appears on the correct scale, otherwise
fine-adjust the amplitude Gain (FL2-width) to define clearly
the histogram peak(s), (see Note 7).
6. Remove the mixture from the injection port. FCM is ready to
proceed step 3.5.
3.5 Measurement 1. With the FCM ready, acquire the data of samples (mix of the
of Relative standard, M. acuminata ssp. malaccensis, plus the sample of
and Absolute DNA interest, SE-regenerated Grand Naine) to be studied. For each
Content of Unknown run measure 15,000 events and save the data.
Samples 2. Repeat the analysis on at least three replicates on the same SE-
regenerated plant and continue evaluating, in the same way, all
individuals.
3. Also, run the analysis samples (three replicates) of at least two

sword suckers from the plant that donate the explant for the
SE induction. Alternatively, if no plenty suckers are available,
three replicates of the same plant should be run (see Note 8).
4. After collecting the data, calculate the average 2C nuclear
DNA content per plant and complete the statistical analysis
as required. The mean DNA value(s) is followed by a measure
of the individual measurements deviation (e.g., standard
deviation, s.d.; standard error of mean, s.e.m.).
3.6 Ploidy Analysis 1. Internal reference: diploid banana 2n = 2x = 22 (M. acuminata
with Internal Standard ssp. malaccensis, Selangor) with known genome size
and Estimation (2C = 1.23 pg) [47].
of Nuclear DNA 2. Samples of interests, 50 SE-regenerated banana (Grand Naine)
Content plants [50].
3. Two sword suckers utilized as control of the mother donor
plant of the explant tissue for the in vitro culture.
3.6.1 DNA Ploidy DNA ploidy calculated for the unknown experimental sample(s) is
Estimation as follows:
1. Sample ploidy (x) = reference ploidy (2x) × (mean position of the
G1 sample peak/mean position of the G1 reference peak) [27].
2. Results: ploidy of regenerated plant = 2x (201/131.7) =
2 × 1.526 = 3.05x (Fig. 1).
3. When running a mix of the sample of interest (SE-regenerated
plant) with a control plant (sucker of explant donor plant
Grand Naine) the perfect overlap of 2C peaks of both sample(s)
confirmed the same ploidy (Fig. 2).
3.6.2 Estimation 1. The amount of nuclear DNA of the unknown experimental

of Nuclear DNA Content sample(s), SE-regenerated Grand Naine plants, was calculated
in Absolute Units (Genome as follows:
Size)
Sample 2C value (DNA pg) = reference 2C value × (sample 2C
mean peak position/ reference 2Cmean peak position) [23, 26].
Reference DNA content (M. acuminata ssp. malaccensis):
1.23 pg.
Result: sample 2C value (DNA pg) = 1.23 pg × (200/130) =
1.23 × 1.538 = 1.89 pg (Fig. 1).
4 Notes
1. Boiling the stock solutions of the RNase A is not necessary; it

may cause precipitation of RNase and possible loss of enzy-
matic activity. Other RNase products might need boiling to
inactivate DNases. Please check the product information sheet.
1
2
Peak Mean FL Dl CV%
400 1 130.01 1.00 3.23%
2 200.00 1.53 3.38%
300
Number of nuclei
200
100
0
0 200 400 600 800 1000
Fluorescence intensity (Channel number)
Fig. 1 Histogram of relative nuclear DNA content obtained after simultaneous analysis of nuclei isolated from
leaves of a true-to-type SE-regenerated plant cv. Grand Naine (GN3x) and diploid Musa acuminata ssp. malac-
censis (2x, Selangor), the latter serving as an internal reference standard. The FCM was adjusted so that Peak
1 of diploid banana Selangor was localized near channel 130, and Peak 2 correspond to somatic embryogenesis
(SE)-regenerated true-to-type banana. DI represents the DNA index. The x-axis indicates the florescence sig-
nal intensity (canal number), which stoichiometrically relates to DNA content
2. When preparing new CRBC nuclei for instrument alignment,

the new batch should be tested against the old batch. This
practice helps avoid the introduction of a systematic error.
3. The fixed CRBC nuclei are suitable for instrument alignment.
Fixed nuclei should not be used as an internal standard for estimation
of nuclear DNA content in absolute units (genome size).
4. The amount of material is empirically determined by checking,
in the FCM, the concentration of nuclei in the sample and the
debris background on the histogram of DNA content (ordi-
nate = number of events, and abscissa = channel number).
5. The extent of chopping is determined empirically, as for Note
4, check the concentration of nuclei in the sample and the
amount of debris background on the histogram of DNA
content.
6. Large CRBC nuclei aggregates can plug the injection port of
FCM; thus to avoid difficulties, it is advised to use Otto I buf-
fer to disperse large CRBC nuclei aggregates due to the pres-
ence of detergent in the buffer.
G1 = 79.5% at 50.0
1600 G2 = 6.2% at 100.0
S = 14.3%
G2/G1 = 2.0
% CV = 3.32%
1200
Number of nuclei
800
400
0
0 50 100 150 200 250
Relative fluorescence (Channel number)
Fig. 2 Typical histogram of propidium iodide-labeled nuclei at pre-DNA synthesis (G1), synthesis (S), and
post-synthesis (G2) from a mix of control triploid (2n = 3x = 33) M. acuminata AAA, cv. Grand Naine and a
true-to-type SE-regenerated GN3x plant. The abscissa axis indicates the florescence signal intensity (canal
number), which stoichiometrically relates to DNA content. The results indicate measurements of 6700
individual nuclei. G1, S, and G2 cell-cycle compartments were resolved with a peak-reflect algorithm analysis
using Gaussian curves (ModFit Software)
7. Once the equipment is adjusted, and while the samples are

running, no further adjustment to the voltage nor to the gain
are allowed. It is recommended to check after six sample runs
the calibration of the FCM with the reference standard for any
alteration in alignment, and if needed reestablish the G1 peak
position.
8. Analysis of the sample of interest and the control donor plant
material individually permits assessment of ploidy variations in
regenerants vs. control plants. Because the donor plant is a
triploid (2n = 3x = 33) with known DNA content, another
approach to verify any change in ploidy during tissue culture is
by c hopping equal amount (25 mg) of leaf samples from regen-
erated plants and the control of sucker plants from the donor
plant. In this case, the overlapping of the 2C peak(s) confirms
the euploidy condition of the regenerants established with the
internal reference standard.
5 Conclusions
The protocol described herein allows verifying the stability of M.

acuminata cv. Grand Naine regenerated plants at the DNA ploidy
and DNA content level. Cytogenetic stability for the 50 emblings
analyzed was confirmed at DNA ploidy level 3x (triploid) and 2C
nuclear DNA content, 2C = 1.897 ± 0.004 pg (value similar to
that reported for the mother plant [43, 44, 47]). The present data
support previous findings of the trueness-to-type of the SE derived
emblings [49] by genetic analysis of regenerants, which are cur-
rently under phenotypic assessment of the field grown plants.
Acknowledgments
The authors would like to express their gratitude to the government

of México through SAGARPA-CONACYT Research Project No.
0048160 (RME) and studentship project (# 0048160) to MJBT.
References
1. Robinson JP, Grégori G (2007) Principles of flow 6. Doležel J, Binarová P, Lcretti S (1989) Analysis
cytometry. In: Flow cytometry with plant cells. of nuclear DNA content in plant cells by flow
Wiley-VCH Verlag GmbH & Co. KGaA, cytometry. Biol Plant 31:113–120. https://
Weinheim, pp 19–40. https://doi. doi.org/10.1007/bf02907241
org/10.1002/9783527610921.ch2 7. Roberts AV (2007) The use of bead beating to
2. Suda J, Kron P, Husband BC, Trávníček P prepare suspensions of nuclei for flow cytome-
(2007) Flow cytometry and ploidy: applica- try from fresh leaves, herbarium leaves, petals
tions in plant systematics, ecology and evolu- and pollen. Cytometry A 71A:1039–1044.
tionary biology. In: Flow cytometry with https://doi.org/10.1002/cyto.a.20486
plant cells. Wiley-VCH Verlag GmbH & Co. 8. Galbraith DW, Lambert GM, Macas J, Doležel
KGaA, Weinheim, pp 103–130. https://doi. J (2001) Analysis of nuclear DNA content and
org/10.1002/9783527610921.ch5 ploidy in higher plants. Curr Protoc Cyt
3. Doležel J, Greilhuber J, Suda J (2007) Flow 2(7.6):7.6.1–7.6.22. https://doi.
cytometry with plants: an overview. In: Doležel org/10.1002/0471142956.cy0706s02
J, Greilhuber J, Suda J (eds) Flow cytometry 9. Doležel J, Göhde W (1995) Sex determination
with plant cells. Wiley-VCH Verlag GmbH & in dioecious plants Melandrium album and M.
Co. KGaA, Weinheim. https://doi. rubrum using high-resolution flow cytometry.
org/10.1002/9783527610921.ch3 Cytometry 19:103–106. https://doi.
4. Pellicer J, Leitch IJ (2014) The application of org/10.1002/cyto.990190203
flow cytometry for estimating genome size and 10. Loureiro J, Rodriguez E, Doležel J, Santos C
ploidy level in plants. In: Besse P (ed) Molecular (2006) Comparison of four nuclear isolation buffers
plant taxonomy: methods and protocols. for plant DNA flow cytometry. Ann Bot 98:679–
Humana Press, Totowa, NJ, pp 279–307. 689. https://doi.org/10.1093/aob/mcl141
h t t p s : / / d o i . 11. Sgorbati S, Levi M, Sparvoli E et al (1986)
org/10.1007/978-1-62703-767-9_14 Cytometry and flow cytometry of
5. Galbraith DW, Harkins KR, Maddox JM et al 4′,6-diamidino-2-phenylindole (DAPI)-
(1983) Rapid flow cytometric analysis of the stained suspensions of nuclei released from
cell cycle in intact plant tissues. Science fresh and fixed tissues of plants. Physiol Plant
220:1049–1051. https://doi.org/10.1126/ 68:471–476. https://doi.
science.220.4601.1049 org/10.1111/j.1399-3054.1986.tb03384.x
12. Doležel J, Sgorbati S, Lucretti S (1992) amount in diploid bananas (Musa acuminata
Comparison of three DNA fluorochromes for and M. balbisiana). Biol Plant 36:351–357.
flow cytometric estimation of nuclear DNA https://doi.org/10.1007/bf02920930
content in plants. Physiol Plant 85:625–631. 24. Lysak MA, Doležel J (1998) Estimation of
h t t p s : / / d o i . nuclear DNA content in Sesleria (Poaceae).
org/10.1111/j.1399-3054.1992.tb04764.x Caryologia 51:123–132. https://doi.org/10.
13. Loureiro J, Rodriguez E, Doležel J, Santos C 1080/00087114.1998.10589127
(2006) Flow cytometric and microscopic anal- 25. Doležel J, Greilhuber J, Lucretti S et al (1998)
ysis of the effect of tannic acid on plant nuclei Plant genome size estimation by flow cytome-
and estimation of DNA content. Ann Bot try: inter-laboratory comparison. Ann Bot
98:515–527. https://doi.org/10.1093/aob/ 82:17–26. https://doi.org/10.1006/
mcl140 anbo.1998.0730
14. Ronildo CW, Roberto CC (2011) Flow cyto- 26. Roux NS, Toloza A, Radecki Z et al (2003)
metric analysis using SYBR green I for genome Rapid detection of aneuploidy in Musa using
size estimation in coffee. Acta Histochem flow cytometry. Plant Cell Rep 21:483–490.
113:221–225. https://doi.org/10.1016/j. https://doi.org/10.1007/s00299-002-0512-6
acthis.2009.10.005 27. Doležel J, Greilhuber J, Suda J (2007)
15. Loureiro J, Rodriguez E, Doležel J, Santos C Estimation of nuclear DNA content in plants
(2007) Two new nuclear isolation buffers for using flow cytometry. Nat Protoc 2:2233–
plant DNA flow cytometry: a test with 37 spe- 2244. https://doi.org/10.1038/
cies. Ann Bot 100:875–888. https://doi. nprot.2007.310
org/10.1093/aob/mcm152 28. D'Amato F, Bayliss MW (1985) Cytogenetics of
16. Arumuganathan K, Earle ED (1991) Estimation plant cell and tissue cultures and their regener-
of nuclear DNA content of plants by Flow ates. CRC Crit Rev Plant Sci 3:73–112. https://
Cytometry. Plant Mol Biol Rep 9:229–233. doi.org/10.1080/07352688509382204
https://doi.org/10.1007/BF02672073 29. Binarová P, Doležel J (1988) Alfalfa embryo-
17. Otto FJ (1992) Preparation and staining of genic cell suspension culture: growth and
cells for high-resolution DNA analysis. In: ploidy level stability. J Plant Physiol 133:561–
Radbruch A (ed) Flow cytometry and cell sort- 566. https://doi.org/10.1016/
ing. Springer, Berlin, pp 65–68. https://doi. S0176-1617(88)80008-7
org/10.1007/978-3-662-02785-1_8 30. Gupta PK (1998) Chromosomal basis of soma-
18. Marie D, Brown SC (1993) A cytometric exer- clonal variation in plants. In: Jain SM, Brar DS,
cise in plant DNA histograms, with 2C values Ahloowalia BS (eds) Somaclonal variation and
for 70 species. Biol Cell 78:41–51. https:// induced mutations in crop improvement.
doi.org/10.1016/0248-4900(93)90113-S Springer, Netherlands, pp 149–168. https://
19. Pfosser M, Heberle-Bors E, Amon A, Lelley T doi.org/10.1007/978-94-015-9125-6_9
(1995) Evaluation of sensitivity of flow cytom- 31. Larkin PJ, Scowcroft WR (1981) Somaclonal
etry in detecting aneuploidy in wheat using variation—a novel source of variability from
disomic and ditelosomic wheat–rye addition cell cultures for plant improvement. Theor
lines. Cytometry 21:387–393. https://doi. Appl Genet 60:197–214. https://doi.
org/10.1002/cyto.990210412 org/10.1007/bf02342540
20. Greilhuber J, Temsch EM, Loureiro JCM 32. Sahijram L, Soneji JR, Bollamma KT (2003)
(2007) Nuclear DNA content measurement. Analyzing somaclonal variation in micropropa-
In: Flow cytometry with plant cells. Wiley- gated bananas (Musa spp.). In Vitro Cell Dev
VCH Verlag GmbH & Co. KGaA, Weinheim, Biol-Plant 39:551–556. https://doi.
pp 67–101. https://doi. org/10.1079/ivp2003467
org/10.1002/9783527610921.ch4 33. Hwang S-C, Ko W-H (2004) Cavendish
21. Ochatt SJ (2008) Flow cytometry in plant banana cultivars resistant to fusarium wilt
breeding. Cytometry A 73A:581–598. acquired through somaclonal variation in
https://doi.org/10.1002/cyto.a.20562 Taiwan. Plant Dis 88:580–588. https://doi.
22. Bennett MDS, Smith JB (1991) Nuclear DNA org/10.1094/pdis.2004.88.6.580
amounts in angiosperms. Philos Trans R Soc 34. Tang CY (2005) Somaclonal variation: a tool
Lond Ser B Biol Sci 334:309–345. https:// for the improvement of Cavendish banana cul-
doi.org/10.1098/rstb.1991.0120 tivars. International Society for Horticultural
23. Doležel J, Doleželová M, Novák FJ (1994) Science (ISHS), Leuven, pp 61–66. https://
Flow cytometric estimation of nuclear DNA doi.org/10.17660/ActaHortic.2005.692.6
35. Giménez C, de García E, Haddad O (2008) 44. Kamaté K, Brown S, Durand P et al (2001)
Genetic and resistance stability to black Nuclear DNA content and base composition in
Sigatoka disease during micropropagation of 28 taxa of Musa. Genome 44:622–627.
Musa CIEN BTA-03 somaclonal variant. https://doi.org/10.1139/g01-058
Phyton 77:65–79 45. Asif MJ, Mak C, Othman RY (2001)
36. Ghag SB, Shekhawat UK, Ganapathi TR Characterization of indigenous Musa species
(2014) Characterization of Fusarium wilt based on flow cytometric analysis of ploidy and
resistant somaclonal variants of banana cv. nuclear DNA content. Caryologia 54:161–
Rasthali by cDNA-RAPD. Mol Biol Rep 168. https://doi.org/10.1080/00087114.20
41:7929–7935. https://doi.org/10.1007/ 01.10589223
s11033-014-3687-3 46. Bairu MW, Fennell CW, van Staden J (2006)
37. D'Amato F (1990) Somatic nuclear mutations The effect of plant growth regulators on soma-
in vivo and in vitro in higher plants. Caryologia clonal variation in Cavendish banana (Musa
43:191–204. https://doi.org/10.1080/0008 AAA cv. ‘Zelig’). Sci Hortic (Amsterdam)
7114.1990.10796998 108:347–351. https://doi.org/10.1016/j.
38. Evans DA, Sharp WR, Medina-Filho HP scienta.2006.01.039
(1984) Somaclonal and gametoclonal varia- 47. Escobedo-GraciaMedrano RM, Maldonado-
tion. Am J Bot 71:759–774 Borges JI, Burgos-Tan MJ et al (2014) Using
39. Bairu M, Aremu A, Van Staden J (2011) flow cytometry and cytological analyses to
Somaclonal variation in plants: causes and assess the genetic stability of somatic embryo-
detection methods. Plant Growth Regul derived plantlets from embryogenic Musa acu-
63:147–173. https://doi.org/10.1007/ minata Colla (AA) ssp. malaccensis cell
s10725-010-9554-x suspension cultures. Plant Cell Tiss Org
40. Roux NSH, Toloza A, Panis B, Doležel J (2004) 116:175–185. https://doi.org/10.1007/
Detecting ploidy level instability of banana s11240-013-0394-z
embryogenic suspension cultures by flow cytome- 48. Schoofs HPB, Strosse H, Mayo MA et al
try. In: Jain MS, Swennen R (eds) Banana improve- (1999) Bottlenecks in the generation and
ment: cellular, molecular, biology, and induced maintenance of morphogenic banana cell sus-
mutations. Proceedings from a meeting held pensions and plant regeneration via somatic
September 24–28, 2001, in Leuven, Belgium. Sci. embryogenesis therefrom. Info Musa 8:3
Publishers Inc, Enfield, NH, pp 251–261 49. Youssef M, Ku-Cauich R, James A,
41. De-la-Peña C, Nic-Can GI, Galaz-Ávalos RM Escobedo-GM RM (2011) Genetic analysis of
et al (2015) The role of chromatin modifica- somatic embryogenesis derived plants in
tions in somatic embryogenesis in plants. Front banana. Assiut J Agric Sci 42:287–300
Plant Sci 6:635. https://doi.org/10.3389/ 50. Youssef MA, James A, Mayo-Mosqueda A et al
fpls.2015.00635 (2010) Influence of genotype and age of
42. Konieczny R, Sliwinska E, Pilarska M, Tuleja explant source on the capacity for somatic
M (2012) Morphohistological and flow cyto- embryogenesis of two Cavendish banana
metric analyses of somatic embryogenesis in cultivars (Musa acuminata Colla, AAA). Afr
Trifolium nigrescens Viv. Plant Cell Tiss Org J Biotechnol 9:2216
109:131–141. https://doi.org/10.1007/ 51. Pillary MOE, Tenkouano A, Doležel J (2006)
s11240-011-0081-x Ploidy and genome composition of Musa
43. Lysák MA, Doleželová M, Horry JP et al germplasm at the International Institute of
(1999) Flow cytometric analysis of nuclear Tropical Agriculture (IITA). Afr J Biotehnol
DNA content in Musa. Theor Appl Genet 5:1224
98:1344–1350. https://doi.org/10.1007/
s001220051201
Chapter 23
Procedure for Estimating the Tolerance and Accumulation

of Heavy Metals Using Plant Cell Cultures
Antonio Bernabé-Antonio, Amalia Maldonado-Magaña,
María Elena Estrada-Zúñiga, Leticia Buendía-González,
and Francisco Cruz-Sosa
Abstract
The tolerance index (TI) and the bioaccumulation factor (BF) for the estimation of accumulation and
tolerance of different heavy metals in cell suspension cultures are reviewed. Procedures for measuring these
parameters are described for the purposes of phytoremediation research.
Key words Bioaccumulation, Cell suspension culture, Heavy metals, Phytoremediation
1 Introduction
The mineral nutrients of plants can be divided into micronutrients

(Fe, Zn, Mn, Cu, B, Cl, Mo, and Ni) and macronutrients (N, K,
Ca, Mg, P, and S). However, other elements such as C, H, and O
are also accepted as being essential for the growth of plants [1].
There are additional elements (Co, Na, Si, Se, I, and V) that can be
found in certain species of plants. In contrast, plants are also able to
absorb heavy metals (HMs) such as cadmium (Cd) and chromium
(Cr), which are nonessential minerals and can be toxic. Moreover,
HMs are detrimental to the growth and development of the plant
[1, 2]. The absorption of HMs by plants results from a nonselective
mechanism of cation uptake [2]. Plant tissue cultures are a powerful
tool for phytoremediation research and can be used as a model to
identify the biochemical responses of plant cells to environmental
contaminants, the metabolic capabilities of plant tissues, and the
reaction products formed [3]. Various investigations have shown
that cell suspension cultures and regenerated plants exhibit charac-
teristics of tolerance and accumulation of HMs [4, 5]. Cell suspen-
sion cultures can be used to evaluate the accumulation of different
HMs and the tolerance of plants to such metals [6].
333
334 Antonio Bernabé-Antonio et al.
2 Materials
2.1 Reagents, 1. Standard tissue culture facilities.

Solutions, 2. Cell cultures in suspension of any species with phytoremedia-
and Culture Media tion potential and stable growth.
3. All culture media can be prepared based on Murashigue and
Skoog’s medium [7] using deionized water (see Note 1).
4. Stock solution of cadmium chloride hemi(pentahydrate)
(CdCl2.2½H2O), potassium dichromate (VI) (K2Cr2O7),
nickel (II) chloride hexahydrate (NiCl2.6H2O), lead (II)
nitrate [Pb(NO3)2], or zinc sulfate heptahydrate (ZnSO4.7H2O)
are prepared separately by dissolving 1 mg in 100 mL of deion-
ized water. Keep refrigerated between 5 and 8 °C.
3 Methods
3.1 Establishment 1. To establish a cell suspension culture from any species with
of Cell Suspension phytoremediation potential, the formulated culture medium
Cultures and Growth can be the same as that used to induce callus (with 0.0–
Kinetics 5.0 mg L−1 auxins and 0.0–5.0 mg L−1 cytokinins) but without
the gelling gel (see Note 2).
2. Briefly, between 8 and 10% (w/v) of friable callus fresh bio-
mass (FW) of 4 weeks old is incubated in 125-mL Erlenmeyer
flasks containing 25 mL of liquid culture medium with the
same plant growth regulators used for inducing callus. Next,
the flasks are incubated on an orbital rotatory shaker at 110 rpm
at 25 ± 2 °C for a photoperiod of 16 h with white fluorescent
light (50–60 μmol m−2 s−1). Once the suspension culture is
established, the cells can be subcultured every 3–4 weeks for
3–6 months in 500-mL flasks containing 100 mL of liquid cul-
ture medium and 5.0–6.0% (w/v) of biomass (FW) to increase
the biomass. Furthermore, to determine the growth kinetics,
125-mL flasks containing 25 mL of liquid culture medium are
inoculated with 8% (w/v) biomass (FW). The biomass pro-
duced is harvested every 2–3 days over a 30-day period from
culture flasks, and the biomass is dried at 60 °C for 72 h. The
dried biomass (DW) is used to determine the growth kinetics:
the growth specific rate (μ) and the doubling time (dt). The
growth specific rate (μ) is defined as the increase in cell mass
per time unit and was calculated by plotting cell growth data in
the form of natural logarithm versus time; doing so yielded a
straight line over the exponential phase growth. The slope of
the linear part of the plot corresponds to the specific cell
growth rate and is defined per time unit. The time required for
Tolerance to Heavy Metals 335
the biomass to double (dt) was computed from the μ experi-

mental data. All of the experiments must be performed at least
in duplicate with three (n = 3) or more replicates [8].
3.2 Heavy Metal 1. Stock solutions of 10 mg L−1 HMs are prepared by dissolving
Bioassay in Cell salts containing metallic elements: CdCl2.2½H2O for Cd,
Suspension Culture K2Cr2O7 for Cr, NiCl2.6H2O for Ni, Pb(NO3)2 for Pb,
ZnSO4.7H2O for Zn, and so on, respectively, in deionized water.
Aliquots of these stock solutions are added to the liquid culture
medium [7], but some of the mineral elements of the MS
medium have to be prevented from being precipitated with the
HMs (see Note 1). This nutrient may be substituted to achieve
the desired concentrations of the HMs to be evaluated (0.0, 0.5,
1.0, 2.0, and 3.0 mM). Inoculum (8% FW) is added to the flasks;
the incubation conditions are the same as those used for estab-
lishing cell suspensions (see Note 3). All of experiments are per-
formed in duplicate with three (n = 3) replicates. After 24 days
of culture (see Note 4), the cells are filtered and washed with
deionized water and 10 mM ethylene-diamine-tetra-acetic solu-
tion to remove extracellular adsorbed metals and dried at 60 °C
for 72 h (see Note 5). Dry biomass (DW) measurements is used
to determine the tolerance index (TI), which is the ratio between
a measured variable in treated plants and that same variable mea-
sured in control plants expressed as a percentage. The TI is cal-
culated using Eq. (1) with the biomass dry weight (see Note 6)
already defined [9]:
( Biomass withHMs )
TI ´100 (1)
( Biomass withoutHMs )
3.3 Determination 1. The harvested biomass is used to determine the HMs content.
of Heavy Metals Dry biomass (100 mg) is powdered and then digested with
in Biomass 5 mL HNO3 (69–70%) and 4 mL of deionized water for
15 min in a microwave digestion system (CEM Corporation,
Mathews, North Carolina, USA). The final volume of the sam-
ple is adjusted to 10 mL using deionized water and passed
through a syringe filter (0.45 μM) and transferred to high-
density polyethylene flasks. The digested samples can be ana-
lyzed using an atomic absorption spectrometer (Agilent
Technologies, Santa Clara, California, USA). Calibration
curves are carried out using pure metal ion standard solutions.
The HMs concentration measurements are used to determine
the bioaccumulation factor (BF). The BF is the ratio of the
plant HMs concentration to the HMs concentration of the
culture medium (see Note 7); it is defined by Eq. (2):
336 Antonio Bernabé-Antonio et al.
mgHMs
kgcell biomass
BF = (2)
mgHMs
Lculture medium

where BF is the bioaccumulation factor and HMs is the HM
concentration found in the biomass (mg/kg DW) or in the culture
medium (mg/L) [10, 11].
3.4 Biochemical 1. The biomass samples (DW) can be used for the preparation of
and Physiological extract for phytochemical studies (e.g., phenolic compound
Studies content or antioxidant activity, which are associated with the
phytoremediation process) (see Note 8). On the other hand,
the biomass samples (FW) can be ground with liquid nitrogen
in a mortar and homogenized with buffer to prepare crude
extracts, which can then be used for antioxidant enzymatic
activities (e.g., glutathione reductase, peroxidase, catalase,
ascorbate peroxidase activities) or for glutathione determina-
tion and analysis of proteins [12]. These activities and protein
content have been associated with the mechanism of plant cell
tolerance and detoxification by HMs stress.
4 Notes
1. The MS medium is rich in mineral elements and also has a high

concentration of salts. Various salts within metals may react
with some ions produced in aqueous solutions of the salts of
the MS medium. Therefore, water-insoluble HMs can be
formed or the HMs can be reduced, reducing bioavailability or
little toxic for plant cells. For these reasons, it is important to
compare the composition of the culture medium and the com-
position of the source salt of the HMs.
2. To eliminate the effect of soil physicochemical factors, experi-
ments must be performed using an in vitro system.
3. Plant cell cultures can exhibit stress symptoms prior to the
introduction of HMs via cell oxidation. To avoid cell oxida-
tion, 100 mg L−1 citric acid and 150 mg L−1 ascorbic acid, or
500 mg L−1 polyvinylpyrrolidone, can be included in the cul-
ture medium.
4. The harvest time varies according to the species, but the cells
must be harvested during the stationary phase or during the
maximum accumulation of biomass in the growth kinetics.
5. All glassware and apparatus must be washed with 0.1 N HNO3
prior to determining HMs in the biomass.
Tolerance to Heavy Metals 337
6. A TI value of at least 1 indicates that the plant cells are tolerant

to HMs and that growth has not been affected.
7. A BF value far exceeding 1 is indicative of accumulator or
hyperaccumulator plant species.
8. The phenolic compound content can be determined using the
Folin-Ciocalteu method [13]. This colorimetric reaction is
widely used in the spectrophotometric method, and it is easy
to perform, rapid and applicable in routine use, and low cost.
On the other hand, the quantification of antioxidant activity
occurs via the α, α-diphenyl-β-picrylhydrazyl free radical scav-
enging method. This first approach is suitable for evaluating
the antioxidant potential of a compound, an extract or another
biological source.
References
1. Grusak MA (2001) Plant macro- and micronu- tobacco tissue cultures. Physiol Plant 15:473–
trient minerals. Encyclopedia of life sciences. 497. https://doi.
Nature Publishing Group, London. www.els. org/10.1111/j.1399-3054.1962.tb08052.x
net 8. Galaz-Ávalos RM, Aguilar-Díaz S, Xool-
2. Maldonado-Magaña A, Orozco-Villafuerte J, González PA et al (2012) Callus, suspension
Buendía-González L et al (2013) Establishment culture, and hairy roots. Induction, mainte-
of cell suspension cultures of Prosopis laevigata nance and characterization. In: Loyola-Vargas
(Humb. & Bonpl. ex Willd) M.C. Johnst to VM, Ochoa-Alejo N (eds) Plant cell culture
determine the effect of zinc on the uptake and protocols, methods in molecular biology, vol
accumulation of lead. Rev Mex Ing Quím 877. Humana Press, Heidelberg, pp 29–40.
12:489–498 h t t p s : / / d o i .
3. Doran PM (2009) Application of plant tissue org/10.1007/978-1-61779-818-4_3
cultures in phytoremediation research: incen- 9. Kumar GP, Yadav SK, Thawale PR et al (2008)
tives and limitations. Biotechnol Bioeng Growth of Jatropha curcas on heavy metal con-
103:60–76. https://doi.org/10.1002/ taminated soil amended with industrial wastes
bit.22280 and Azotobacter: a greenhouse study. Bioresour
4. Vera-Estrella R, Miranda-Vergara MC, Technol 99:2078–2082. https://doi.
Bronwyn JB (2009) Zinc tolerance and accu- org/10.1016/j.biortech.2007.03.032
mulation in stable cell suspension cultures and 10. Audet P, Charest C (2007) Heavy metal phy-
in vitro regenerated plants of the emerging toremediation from a metal-analytical perspec-
model plant Arabidopsis halleri (Brassicaceae). tive. Environ Pollut 147:231–237. https://
Planta 229:977–986. https://doi. doi.org/10.1016/j.envpol.2006.08.011
org/10.1007/s00425-008-0882-2 11. Uysal Y (2013) Removal of chromium ions
5. Buendía-González L, Orozco-Villafuerte F, from wastewater by duckweed, Lemna minor
Cruz-Sosa F et al (2010) Prosopis laevigata a L. by using a pilot system with continuous flow.
potential chromium (VI) and cadmium (II) J Hazard Mater 263:486–492. https://doi.
hyperaccumulator desert plant. Bioresour org/10.1016/j.jhazmat.2013.10.006
Technol 101:5862–5867. https://doi. 12. Zhang T, Lu Q, Su C et al (2017) Mercury
org/10.1016/j.biortech.2010.03.027 induced oxidative stress, DNA damage, and
6. Bernabé-Antonio A, Álvarez-Berber LP, activation of antioxidative system and Hsp70
Buendía-González L et al (2015) Accumulation induction in duckweed (Lemma minor).
and tolerance of Cr and Pb using a cell suspen- Ecotox Environ Safe 143(1):46–56. https://
sion culture system of Jatropha curcas. Plant doi.org/10.1016/j.ecoenv.2017.04.058
Cell Tiss Org 120:221–228. https://doi. 13. Singleton VL, Rossi JA (1995) Colorimetry of
org/10.1007/s11240-014-0597-y total phenolics with phosphomolybdic–phos-
7. Murashige T, Skoog F (1962) A revised photungstic acid reagents. Am J Enol Viticult
medium for rapid growth and bioassays with 16:144–158
Chapter 24
Proteomics as a Tool to Study Molecular Changes During

Plant Morphogenesis In Vitro
André Luis Wendt dos Santos, Ricardo Souza Reis,
Angelo Schuabb Heringer, Eny Iochevet Segal Floh,
Claudete Santa-Catarina, and Vanildo Silveira
Abstract
Proteome analysis represents a promising approach for plant tissue culture since it is now possible to
identify and quantify proteins on a large scale. Biomarker discovery and the study of the molecular events
associated with in vitro plant morphogenesis are considered potential targets for application of proteomics
technologies. This chapter describes a protocol for application in in vitro plant material using two pro-
teomics approaches: 2-DE coupled to mass spectrometry and liquid chromatography-linked tandem mass
spectrometry.
Key words Bioinformatics, Mass spectrometry, Morphogenesis, Plant tissue culture, Protein electro-
phoresis, Proteomics
1 Introduction
The use of proteomic approaches for monitoring and understand-

ing protein changes in biological processes can provide a potential
strategy to study molecular events during in vitro plant growth and
development. Many studies have recently been published suggest-
ing the use of proteomics for discovery of biomarkers associated
with specific morphogenetic events, as well as in understanding the
complex metabolic pathways that govern in vitro plant morpho-
genesis [1–6]. Currently, two main proteomic workflows are used
for large-scale protein identifications [7, 8]. The first is the two-
dimensional electrophoresis (2-DE), which initially separates pro-
teins by molecular charge (isoelectric focusing) and molecular size
(SDS-PAGE), followed by enzymatic digestion of isolated spots
and protein identification by mass spectrometry. The second
approach is the shotgun or gel-free proteomics, which begins with
the enzymatic digestion of proteins in a complex mixture of
339
340 André Luis Wendt dos Santos et al.
eptides, followed by separation and identification of peptides

p
using a liquid chromatography coupled to a mass spectrometer.
Two-dimensional electrophoresis remains a technology widely
applied in proteomics, especially for species with absence of well-
annotated and completed genome sequences [9]. However, cur-
rently, the shotgun proteomics, with high-resolution orthogonal
separation coupled to tandem mass spectrometry (2D-nanoLC-MS/
MS) has become a popular approach [10]. This technology has
enabled the identification of low-abundant proteins, which are
often missed when using 2-DE [11, 12]. Advances in technologies
for the peptide separation and identification by mass spectrometry,
and the development of bioinformatic tools are raising the devel-
opment of numerous possibilities and applications for plant
proteomics.
The goal of this chapter is to present in detail protocols for
extraction of proteins in samples from in vitro plant material, and
subsequent detection and identification of proteins and peptides
using proteomics technologies. These include 2-DE coupled to
mass spectrometry, as well as liquid chromatography-linked tan-
dem mass spectrometry.
2 Materials
2.1 Protein 1. Ceramic mortar and pestle.

Extraction: Urea/ 2. Urea/thiourea extraction buffer containing 7 M urea, 2 M
Thiourea Method thiourea, 1% (w/v), dithiothreitol (DTT), 2% (v/v) Triton
X-100, 0.5% (v/v) pharmalyte, 1 mM phenylmethylsulfonyl
fluoride (PMSF), and 5 μM pepstatin (see Note 1).
3. 1.5-mL microtubes.
4. Vortex mixer.
5. Centrifuge 5415R (Eppendorf).
6. 2-D Quant Kit (GE Healthcare).
7. Ultrafreezer.
2.2 Protein 1. Ceramic mortar and pestle.

Extraction: 2. Prechilled TCA/acetone extraction buffer containing 10%
Trichloroacetic Acid (w/v) TCA in acetone and 20 mM DTT.
(TCA)/Acetone Method
3. Prechilled wash buffer containing acetone and 20 mM DTT.
4. Urea/thiourea extraction buffer containing 7 M urea, 2 M
thiourea, 1% (w/v) DTT, 2% (v/v) Triton X-100, 0.5% (v/v)
pharmalyte, 1 mM PMSF, and 5 μM pepstatin.
5. 1.5-mL microtubes (Axygen).
6. Vortex mixer.
Proteomics During Plant Morphogenesis 341

8. 2-D Quant Kit (GE Healthcare).
9. Ultrafreezer.
2.3 Two-Dimensional 1. Rehydration buffer (7 M urea, 2 M thiourea, 4% (w/v)

Electrophoresis (2-DE) 3-[(3-cholamidopropyl) dimethylammonio]-1-
propanesulfonate (CHAPS), 0.5% (v/v) IPG buffer, pH 4–7
2.3.1 Gel Analysis
or 3–10, 1% (w/v) DTT and 0.002% bromophenol blue.
2. 18 cm IPG strips (pH 4–7 or 3–10) (GE Healthcare).
3. IPGphor II apparatus (GE Healthcare).
4. Reduction buffer containing 50 mM Tris–HCl, 6 M urea, 30%
(v/v) glycerol, 2% (w/v) sodium dodecyl sulfate (SDS),
0.002% (w/v) bromophenol blue, and 125 mM DTT.
5. Alkylation buffer containing 50 mM Tris–HCl, 6 M urea, 30%
(v/v) glycerol, 2% (w/v) SDS, 0.002% (w/v) bromophenol
blue, and 125 mM iodoacetamide.
6. 18 cm strip-holder unit.
7. Protean II xi 20 cm apparatus with IPG conversion kit
(Bio-Rad).
8. PowerPac™ Universal power supply (Bio-Rad).
9. Coomassie stain solution containing 0.1% (w/v) Coomassie
brilliant blue G250, 1.2% (v/v) ortho-phosphoric acid (85%),
and 10% (w/v) ammonium sulfate.
10. Image Scanner III (GE Healthcare).
11. Image Master Platinum v.7 software (IMP7) (GE Healthcare).
2.3.2 In-Gel Digestion 1. 50% (v/v) Acetonitrile prepared in 25 mM ammonium

bicarbonate.
2. Trypsin (Promega) solution (50 ng μL−1) prepared in 50 mM
ammonium bicarbonate.
4. TFA (v/v) prepared in 50 mM ammonium bicarbonate.
5. 5% FA (v/v) prepared in 50% (v/v) acetonitrile.
6. Sonicator.
7. CentriVap.
2.3.3 Zip Tip Desalting 1. C-18 Zip-Tip tip (Millipore).

2. Activation solution containing 100% acetonitrile.
3. Equilibration (and washing) solution containing 0.1% (v/v)
TFA and mass spectrometry (MS)-grade water.
4. Elution solution containing 60% (v/v) acetonitrile, 0.1% (v/v)
TFA and MS-grade water.
2.4 Shotgun 1. MS-grade water.

Proteomics 2. MS-grade methanol.
2.4.1 Methanol/ 3. MS-grade chloroform.
Chloroform Precipitation 4. Resuspension buffer containing 7 M urea and 2 M thiourea.
2.4.2 Protein Desalting 1. 8 M urea.

2. 50 mM ammonium bicarbonate.
3. Amicon Ultra 0.5 mL 3 kDa (Merck Millipore).
2.4.3 Protein Digestion 1. RapiGest® (Waters, Milford, CT, USA).

2. Eppendorf Thermomixer® (Eppendorf).
3. Vortex mixer.
4. 100 mM DTT solution.
5. 300 mM iodoacetamide solution.
6. Trypsin (50 ng μL−1) prepared in 50 mM ammonium
bicarbonate.
7. 5% (v/v) TFA prepared in 50 mM ammonium bicarbonate.
8. Total Recovery Vials (Waters).
2.4.4 Mass Spectrometry 1. nanoAcquity UPLC connected to a Synapt G2-Si mass spec-
Analysis trometer (Waters).
2. nanoAcquity UPLC 5 μm C18 trap column (180 μm × 20 mm,
Waters).
3. nanoAcquity HSS T3 1.8 μm analytical reversed phase column
(75 μm × 150 mm).
4. Phase A solution containing MS-grade water and 0.1% (v/v)
formic acid.
5. Phase B solution containing MS-grade acetonitrile and 0.1%
(v/v) formic acid.
6. External calibration solution containing 100 fmol μL−1 human
[Glu1]-fibrinopeptide B (Waters).
2.4.5 Bioinformatics 1. Progenesis QI for Proteomics Software V.2.0 (Nonlinear

Dynamics).
2. Blast2Go PRO software (BioBam Bioinformatics, see Note 2).

3 Methods
3.1 Urea/Thiourea 1. Collect at least three biological samples (300 mg) of plant

Extraction material per treatment (see Note 3).
2. Grind the sample in liquid nitrogen until a fine powder is got.
3. Transfer the powder to a 1.5-mL microtube and add 1 mL of
urea/thiourea extraction buffer.
4. Vortex the extract for at least 5 min and keep on ice for 30 min.
5. Centrifuge the extracts at 15,000 g and 4 °C for 20 min.
6. Collect and transfer the supernatants to 1.5 mL microtubes.
7. Quantify the total protein content by 2-D Quant Kit.
8. Store protein extracts at −80 °C until proteomic analyses.
3.2 TCA/Acetone 1. Collect at least three biological samples (300 mg) of plant

Extraction material per treatment (see Note 4).
2. Grind the sample in liquid nitrogen until a fine powder is got.
3. Transfer the powder to a 1.5-mL microtube and add 1 mL of
TCA/acetone extraction buffer.
4. Vortex the extract for at least 5 min.
5. Precipitate extract at −20 °C for 1 h.
6. Centrifuge at 15,000 × g for 30 min at 4 °C and then discard
the supernatant.
7. Wash pellets with acetone and DTT solution, vortex briefly,
and centrifuge at 15,000 × g for 5 min at 4 °C. Discard super-
natant and repeat twice more.
8. Dry the pellet at room temperature to remove the excess of
acetone (see Note 5).
9. Resuspend the pellet in 1 mL of urea/thiourea extraction
buffer.
10. Centrifuge at 15,000 × g for 20 min at 4 °C.
11. Collect and transfer the supernatants to 1.5 mL microtubes.
12. Quantify total protein content by 2-D Quant Kit.
13. Store protein extracts at −80 °C until proteomic analyses.
3.3 Two-Dimensional 1. First, samples are precipitated (500 μg of proteins) using

Electrophoresis (2-DE) methanol/chloroform method, then the pellets are resus-
3.3.1 Gel Analysis pended in 375 μL of rehydration buffer.
2. Load samples onto the strip-holder unit and place the 18 cm
IPG strip on the sample with gel upside down (pH 4–7 or
3–10).
3. In the IPGphor II, the strips are kept 12 h in the rehydration
step.
4. Isoelectric focusing is performed for a total of 35 kVh at
20 °C.
5. The IPG strips are then subjected, first, to a reduction step
(reduction buffer) for 15 min, and, then, to an alkylation step
(alkylation buffer) for another 15 min.
6. The strips are placed onto the top of a 12% polyacrylamide gel.
7. Electrophoresis is performed at 25 mA per gel using a Protean
II apparatus.
8. The gels are stained with Coomassie stain solution.
9. The Coomassie-stained 2-DE gels are digitized and then ana-
lyzed using Image Master Platinum v.7 software.
10. The authenticity and the outline of each protein spot is vali-
dated via visual inspection and edited when necessary.
11. The identification and selection of the differentially expressed
proteins are achieved through comparative analysis of the gels,
and the volume of individual spots is obtained following the
program’s instructions.
12. To eliminate gel-to-gel variations, the individual spot volume
in each gel is normalized relative to the total valid spot vol-
ume, expressing the protein abundance as the relative volume
(%vol), and the values obtained for the treatments are com-
pared using Student’s t-test.
3.3.2 In-Gel Protein 1. Manually excise the spots and destain with acetonitrile 50%
Digestion (v/v) prepared in 25 mM ammonium bicarbonate during 24 h
at 8 °C.
2. Wash spots in water for 5 min, then add 190 μL of acetonitrile
100% (v/v), and keep them in this solution until the spots
become opaque.
3. Dry the spot in CentriVap at 30 °C for 30 min.
4. Add 10 μL of trypsin solution or until the excised spots are
covered.
5. Incubate on ice for 60 min.
6. Recover the trypsin solution remaining in the microtube and
discard.
7. Incubate at a thermomixer at 58 °C for 30 min.
8. Stop the reaction with 1 μL of 5% TFA solution.
9. Add 30 μL of 5% FA solution.
10. Vortex for 20 s, sonicate for 10 min, and vortex for 20 s.
11. Recover the solution with the peptides and transfer to a new
0.6-mL microtube.
12. Repeat steps 9, 10, and 11 and combine the fractions (approx-
imately 60 μL).
13. Concentrate the recovered digested protein on Centri Vap at
30 °C for 5 min until remains approximately 10 μL of
sample.
3.3.3 Sample Desalting 1. Activate the tip by depressing the plunger to a dead stop using
Using Zip Tip the maximum volume setting 10 μL (do it for every step of
aspiration and dispensation). Aspirate and dispense the activa-
tion solution for 10 cycles.
2. Aspirate and dispense the equilibration solution for 8 cycles.
3. Aspirate and dispense the digested protein sample for 10 cycles.
4. Wash tip and dispense to waste using the equilibration (wash-
ing) solution for 8 cycles.
5. Aspirate and dispense the elution solution for 10 cycles in a
new 0.6-mL microtube.
6. Transfer the desalted and digested proteins to the Total
Recovery vials.
3.3.4 Mass Spectrometry From this step, the procedure is the same used in the shotgun pro-
Analysis teomics described in Subheadings 3.4.3 and 3.4.4. Because it is a
less complex sample, the running time can be optimized.
3.4 Shotgun 1. Adjust the protein aliquot (100 μg of protein) to 100 μL with
Proteomics water (see Note 6).
3.4.1 Methanol
2. Add 400 μL of methanol and vortex.
and Chloroform 3. Add 100 μL of chloroform and vortex.
Precipitation 4. Add 300 μL of water and vortex.
5. Centrifuge at 15,000 × g for 10 min at 20 °C to separate
phases.
6. The upper aqueous phase must be carefully discarded (pro-
teins will be between the two phases).
7. Add 300 μL of methanol to the organic phase and vortex.
8. Centrifuge at 15,000 × g and 20 °C for 10 min.
9. Discard the supernatant and dry the pellet at room
temperature.
10. Resuspend the protein pellet with 50 μL of resuspension

buffer.
3.4.2 Protein Sample 1. Wash the Amicon Ultra-0.5 3k centrifugal filter with 300 μL of
Desalting 8 M urea solution and centrifuge at 15,000 × g for 5 min at
room temperature (see Note 7).
2. Add the protein sample (from methanol and chloroform pre-
cipitation) and 300 μL of 8 M urea and centrifuge at 15,000 × g
for 10 min at room temperature (see Note 8).
3. Repeat step 2.
4. Add 300 μL of 50 mM ammonium bicarbonate and centrifuge
at 15,000 × g for 10 min at room temperature.
5. Repeat step 4. It should remain approximately 50 μL of sample
volume.
6. Turn the device upside down in a clean tube and centrifuge at
1000 × g for 2 min to recover the sample.
7. Collect and transfer the desalted protein sample into a 1.5 mL
microtube.
3.4.3 Protein Digestion 1. Add 25 μL of 0.2% (v/v) RapiGest® in the desalted protein
sample microtube.
2. Vortex and incubate at a thermomixer at 80 °C for 15 min.
3. Add 2.5 μL of 100 mM DTT.
4. Vortex and incubate at thermomixer at 60 °C for 30 min
under agitation.
5. Add 2.5 μL of 300 mM iodoacetamide.
6. Vortex and incubate in the dark for 30 min at room
temperature.
7. Add 5 μL of 100 mM DTT to perform the quenching of the
excess of iodoacetamide and incubate at 37 °C for 30 min.
8. Add 20 μL of trypsin solution and incubate at 37 °C in a ther-
momixer overnight.
9. Add 10 μL of 5% (v/v) TFA and incubate at 37 °C for 30 min
for RapiGest precipitation and trypsin activity inhibition.
10. Centrifuge for 30 min at 16,000 × g.
11. Collect and transfer the supernatant containing the digested
proteins to the Total Recovery vials.
3.4.4 Mass Spectrometry 1. During chromatographic separation, samples are injected (2 μg
Analysis of sample) and loaded onto the trap column with a flux of
99.9% water at 5 μL min−1 during 3 min and then onto the
analytical column at 400 nL min−1, with a column temperature
of 45 °C. Binary gradient elution starts at 7% B, then ramped
from 7% B to 40% B up to 91.12 min, and from 40% B to
99.9% B until 92.72 min, being maintained at 99.9% until
106.00 min, then decreasing to 7% B until 106.1 min and kept
7% B until the end of experiment at 120.00 min. Mass spec-
trometry is performed in positive and resolution mode (V

mode), 35,000 FWHM, and in data-independent acquisition
(DIA) mode; ion mobility separation (HDMSE) using IMS
wave velocity of 600 m s−1, and helium and IMS gas flow of
180 and 90 mL/min, respectively; the transfer collision energy
ramp from 19 V to 55 V in high-energy mode; cone and capil-
lary voltages of 30 and 2750 V, respectively; and a source tem-
perature of 70 °C. In TOF parameters, the scan time is set to
0.5 s in continuum mode with a mass range of 50–2000 Da.
Human [Glu1]-fibrinopeptide B at 100 fmol μL−1 is used for
calibration (every 30 s). Mass spectra acquisition is performed
by MassLynx v4.0 software.
3.4.5 Bioinformatics 1. The spectra processing is performed with specific protein

FASTA databank. When the database information is not avail-
able for the species, the PhyloT phylogenetic tree generated
from all plant species databases available at Uniprot (http://
itol.embl.de) can be used. Choose the closest related taxon
with available database.
2. The generated raw files are imported in the Progenesis QI for
Proteomics software using the following MSE identification
parameters: lock mass calibration activated (m/z 785.8426),
low energy threshold equal to 150 counts, elevated energy
threshold equal to 50 counts and intensity threshold equal to
750 counts. After importing, raw files are processed automati-
cally using de following parameters: automatic alignment
of runs, peak picking limits to sensitivity equal to five (auto-
matic), and maximum ion charge equal to eight. Peptide iden-
tification uses the following search parameters: trypsin as digest
reagent, one missed cleavage, minimum fragment ion per pep-
tide equal to three, minimum fragment ion per protein equal
to seven, minimum peptide per protein equal to two, fixed
modifications of carbamidomethyl (C) and variable modifica-
tions of oxidation (M) and phosphoryl (STY), and a default
false discovery rate (FDR) value at a 1% maximum. For Label-
free protein quantitation is selected the option relative quanti-
tation using non-conflicting peptides. Normalizations are
performed automatically by Progenesis QI software using the
recommended default parameters. Prior to export protein and
peptide results, peptides with score less than four and mass
errors greater than 10 ppm are filtered.
3. Label-free relative quantitative analyses are performed based
on the ratio of protein ion counts among contrasting samples.
After data processing and to ensure the quality of results, only
proteins present in all of the three runs of biological repetitions
are accepted. A protein will be considered differentially
abundant only when both the Progenesis generated ANOVA
lesser than 0.05 and the minimum fold change value selected
are satisfied (see Note 9).
4. Functional classification is performed using Blast2Go software
and UniProtKB (http://uniprot.org) (see Note 10).
4 Notes
1. Pharmalyte is only needed for 2-DE sample preparation (see

Subheading 2.1, item 2).
2. Blast2Go software has a freeware basic version (see Subheading
2.4.5, item 2).
3. This protocol has been tested for contaminant-free samples
such as callus and some types of seeds (see Subheading 3.1,
step 1).
4. This protocol has been tested for samples presenting pig-
ments, such as leaves, and also for roots (see Subheading 3.2,
step 1).
5. Excessive dryness may hamper protein resuspension (see
Subheading 3.2, step 8).
6. For sample volumes higher than 100 μL, subtracts the differ-
ence from the 300 μL water addition step (see Subheading
3.4.1, step 1).
7. Low temperatures may hamper the flow through of buffer (see
Subheading 3.4.2, step 1).
8. After each washing step, it remains approximately 100 μL of
sample in the filter unit (see Subheading 3.4.2, step 2).
9. Progenesis generated ANOVA can be replaced by a t-test. The
fold change value usually varies between 1.2 and 2.0. Because
of that, the fold change of 1.5 is a widely used intermediary
value. However, it is recommended to choose the highest
value whenever possible to ensure a rigorous analysis of data
(see Subheading 3.4.5, step 3).
10. Eventually, the NCBI and Phytozome blast may be used to
complement the analysis of functional classification (see
Subheading 3.4.5, step 4).
Acknowledgments
This work was supported by grants from São Paulo Research

Foundation—FAPESP (Proc. 15/21075-4), Carlos Chagas Filho
Foundation for Research Support in the State of Rio de Janeiro—
FAPERJ (Proc. E26/201.574/2014) and National Council for
Scientific and Technological Development-CNPq (Proc.
454451/2014-8).
References
1. Vale EM, Heringer AS, Barroso T et al (2014) 7. Schluter H, Apweiler R, Holzhutter H et al
Comparative proteomic analysis of somatic (2009) Finding one’s way in proteomics: a pro-
embryo maturation in Carica papaya tein species nomenclature. Chem Central
L. Proteome Sci 12:1–18. https://doi. J 3:11. https://doi.
org/10.1186/1477-5956-12-37 org/10.1186/1752-153X-3-11
2. Heringer AS, Barroso T, Macedo AF et al 8. Jorrín-Novo JV, Pascual J, Sánchez-Lucas R
(2015) Label-free quantitative proteomics of et al (2015) Fourteen years of plant proteomics
embryogenic and non-embryogenic callus dur- reflected in proteomics: moving from model
ing sugarcane somatic embryogenesis. PLoS species and 2DE-based approaches to orphan
One 10:e0127803. https://doi. species and gel-free platforms. Proteomics
org/10.1371/journal.pone.0127803 15:1089–1112. https://doi.org/10.1002/
3. dos Santos ALW, Elbl P, Navarro BV et al pmic.201400349
(2016) Quantitative proteomic analysis of 9. Rogowska-Wrzesinska A, Le Bihan MC,
Araucaria angustifolia (Bertol.) Kuntze cell Thaysen-Andersen M et al (2013) 2D gels still
lines with contrasting embryogenic potential. have a niche in proteomics. J Proteome 88:4–
J Proteome 130:180–189. https://doi. 13. https://doi.org/10.1016/j.
org/10.1016/j.jprot.2015.09.027 jprot.2013.01.010
4. Fraga HPF, Vieira LN, Heringer AS et al 10. Chen EI, Hewel J, Felding-Habermann B et al
(2016) DNA methylation and proteome pro- (2006) Large scale protein profiling by combi-
files of Araucaria angustifolia (Bertol.) Kuntze nation of protein fractionation and multidi-
embryogenic cultures as affected by plant mensional protein identification technology
growth regulators supplementation. Plant Cell (MudPIT). Mol Cell Proteomics 5:53–56.
Tiss Org 125:353–374. https://doi. https://doi.org/10.1074/mcp.
org/10.1007/s11240-016-0956-y T500013-MCP200
5. Reis RS, Vale EM, Heringer AS et al (2016) 11. Washburn MP, Wolters D, Yates JR (2001)
Putrescine induces somatic embryo develop- Large-scale analysis of the yeast proteome by
ment and proteomic changes in embryogenic multidimensional protein identification tech-
callus of sugarcane. J Proteome 130:170–179. nology. Nat Biotech 19:242–247. https://doi.
https://doi.org/10.1016/j. org/10.1038/85686
jprot.2015.09.029 12. Angelo Schuabb Heringer, Claudete Santa-
6. Heringer AS, Reis RS, Passamani LZ et al Catarina, Vanildo Silveira, (2018) Insights
(2017) Comparative proteomics analysis of the from Proteomic Studies into Plant Somatic
effect of combined red and blue lights on sug- Embryogenesis. PROTEOMICS 18
arcane somatic embryogenesis. Acta Physiol (5-6):1700265
Plantarum 39:52. https://doi.org/10.1007/
s11738-017-2349-1
Chapter 25
Proteomic Analysis of Non-model Plant Tissues Using

Phenol Extraction, Two-Dimensional Electrophoresis,
and MALDI Mass Spectrometry
Petra Peharec Štefanić, Mario Cindrić, and Biljana Balen
Abstract
Separation of plant proteins by means of electrophoretic techniques is quite challenging since different
compounds typical for plant cells can interfere and/or reduce the effectiveness of the protein isolation.
This is particularly problematic for two-dimensional electrophoresis (2-DE). Therefore, it is important to
optimize protein extraction and to establish a robust protocol for 2-DE and downstream processing,
primarily mass spectrometry (MS) analysis. Here we give a detailed protocol for protein extraction using
phenol method, 2-DE, and MALDI-MS analysis.
Key words De novo sequencing, Isoelectric focusing, Phenol extraction, SDS-PAGE,

Two-dimensional electrophoresis, MALDI-MS/MS
1 Introduction
Two-dimensional polyacrylamide gel electrophoresis (2-DE)

coupled to mass spectrometry (MS) is one of the most powerful
proteomic tools as it resolves thousands of intact protein species in
a single run, enabling the simultaneous analysis of total protein
complement, including isoforms and posttranslational modifica-
tions [1]. To obtain 2-D gels of good quality, resolution, and
reproducibility, effective protein extraction and solubilization are
essential. From the protein extraction point of view, plants are gen-
erally considered as heavily demanding tissues due to several plant
cell characteristic features: (i) presence of the rigid cellulose cell
wall; (ii) high cell vacuolization and, thus, low protein content;
(iii) presence of proteases and oxidative enzymes; and (iv) second-
ary metabolism products, which all interfere and/or reduce the
effectiveness of the protein isolation [2]. Moreover, separation of
plant proteins by means of electrophoretic techniques is quite chal-
lenging, since polysaccharides, lipids, phenolic compounds, and
351
352 Petra Peharec Štefanić et al.
other “contaminants” typical for plant cells can cause protein

degradation or modification. This is particularly problematic for
two- dimensional electrophoresis (2-DE), where on 2-DE gels
such contaminants cause horizontal and vertical streaking and
smearing and reduce protein resolution [3]. Therefore, it is impor-
tant to optimize protein extraction and to establish a robust proto-
col for two-dimensional gel electrophoresis (2-DE) and further
analyses. However, majority of the methods for plant proteomic
analysis has focused on model organisms, such as Arabidopsis and
rice, the species most used for proteomics studies [4], thus leaving
heavily neglected numerous non-model plants that are essential as
food, feed, or energy resource [5]. Some features and processes,
e.g., crassulacean acid metabolism (CAM) photosynthesis, are
unique to particular plant species or families and cannot be studied
via a model plant.
Comparison of three different methods for 2-DE protein
extraction (acetone, TCA/acetone, and phenol extraction) from
sugar beet (Beta vulgaris L.), cactus Mammillaria gracilis Pfeiff.,
and common houseleek (Sempervivum tectorum L.), all non-model
plants, has revealed that the phenol method, although more labori-
ous and time-consuming, was in every aspect superior since it
resulted in the highest protein yield and the least protein contami-
nation [6]. This method was successfully applied for the analysis of
effects of salt and osmotic stress on M. gracilis tissues grown in
vitro on the proteome level [7].
The use of MS to identify and characterize biological mole-
cules is a fundamental technology in protein biochemistry and pro-
teomic analysis. The strategies used to prepare individual proteins
or more complex proteomic samples for MS analysis involve many
steps [8]. The key steps are the preparation of the protein sample
for digestion, enrichment for any particular peptides of interest,
and cleanup or desalting of the final peptide mixture prior to MS
analysis by either MALDI-TOF-MS/MS (matrix-assisted laser
desorption/ionization time-of-flight tandem mass spectrometry)
or LC-ESI-MS/MS (liquid chromatography-electrospray ioniza-
tion tandem mass spectrometry). Excess salts or trace amounts of
detergents interfere with peptide ionization and also increase the
chemical noise or background in the mass spectra. Sample cleanup
can be performed either manually, using ZipTip® pipette tip with
bed of chromatography media fixed at its end, or automated, using
Bravo Automated Liquid Handling Platform (AssayMAP Bravo),
which is a powerful easy-to-use automation solution specifically
designed for biomolecule sample preparation. It supports a broad
range of protein quantification and characterization workflows and
is of significant help dealing with difficult-to-identify proteins and
proteins from non-model/non-genome sequenced organisms
(unpublished data).
Proteomic Analysis of Non-model Plant Tissues 353
A novel method of negative chemically activated fragmenta-

tion/positive chemically activated fragmentation (CAF−/CAF+)
based on N-terminal disulfonation and peptide de novo sequenc-
ing in two MS modes (positive and negative ion mode), upgraded
with the BLASTp (Basic Local Alignment Search Tool) algorithm
[9, 10], can be used to investigate proteome profile of non-genome
sequenced plant organism (unpublished data). Peptides obtained
by digestion with trypsin are derivatized with CAF−/CAF+
reagent (5-formyl-1,3-benzenedisulfonic acid) and used for high-
sensitivity de novo peptide sequencing by MALDI-TOF/
TOF-MS/MS. Peptide sequences obtained from MS/MS spectra
are matched against the National Center for Biotechnology
Information nonredundant (NCBIprot) database and confirmed
by the MS data of elucidated peptide mass sequences derived from
the annotated genome. This improved de novo protein identifica-
tion method highlights plant homologous proteins in the pro-
teome of non-model and non-genome sequenced plant organisms.
Differentially expressed proteins identified exclusively by peptide
sequence reading provide promising results for CAF−/CAF+
implementation in a standard proteomics workflow especially for
difficult-to-identify proteins from non-model and non-genome
sequenced plants.
A detailed protocol comprising protein extraction, 2-DE
performance, sample preparation for MS, and MS analysis is
presented here.
2 Materials
All solutions and buffers should be prepared by using ion-free

ultrapure water (18.2 MΩ-cm resistivity at 25 °C) and analytical
grade reagents, unless stated otherwise. All solutions and buffers
should be stored at 4 °C, unless indicated otherwise.
2.1 Protein 1. Extraction buffer. 500 mM Tris, 50 mM ethylenediaminetet-

Extraction and Sample raacetic acid (EDTA), 700 mM sucrose, 100 mM potassium
Preparation for IEF chloride (KCl), 1 mM phenylmethylsulfonyl fluoride (PMSF),
and 2% β-mercaptoethanol. Weigh 3.0825 g of Tris and dis-
solve it in about 25 mL of water in a glass beaker at the mag-
netic stir. Subsequently weigh and dissolve 0.9306 g of EDTA,
11.9805 g of sucrose, and 0.3728 g of KCl, and transfer the
solution to the cylinder. Add water to a volume of 50 mL (see
Note 1). For preparation of 1 mM PMSF, weigh 0.0087 g of
PMSF, put in the 1.5 mL plastic tube, add 1 mL of 96% etha-
nol, and resuspend and vortex (it is now a 50 mM PMSF solu-
tion). Transfer the 50 mL of extraction buffer to the glass
beaker, add the whole volume (1 mL) of 50 mM PMSF solu-
tion, and mix it at the magnetic stir. Lastly, add 1 mL of
β-mercaptoethanol (see Note 2).
2. Precipitation solution. 0.1 M ammonium acetate. Weigh

0.77 g of ammonium acetate in 100 mL of methanol and store
at −20 °C.
3. Ice-cold acetone. Keep the bottle with 200 mL of acetone at
−20 °C.
4. IEF buffer: 9 M urea and 4% (w/v) 3-[(3-cholamidopropyl)
dimethylammonio]-1-propanesulfonate (CHAPS). Weigh the
5.4 g of urea and put it in a glass beaker. Place the glass with
urea in a larger glass beaker with warm water (around 40 °C)
on the magnetic stir (see Note 3). Add 4 mL of water and let it
dissolve (add more water if necessary). After urea is dissolved,
add CHAPS. When it is dissolved, transfer the solution to the
cylinder and add water up to 10 mL. Make aliquots of 1 mL
and store at −20 °C.
5. Bradford stock solution: 0.01% Coomassie Brilliant Blue
(CBB) G-250, 31.35% (v/v) ethanol, 58.6% (v/v) phosphoric
acid (H3PO4). For the 300 mL of the solution, weigh 350 mg
of CBB G-250, and dissolve in the mixture of 100 mL of 95%
ethanol and 200 mL of 88% phosphoric acid in a glass beaker
at magnetic stir. Solution is stable at room temperature for a
long time.
6. Bradford working solution: 2.85% (v/v) ethanol, 5.28% (v/v)
H3PO4, 6% (v/v) Bradford stock solution. For the 500 mL of
the solution, mix 15 mL of 95% ethanol, 30 mL of 88% H3PO4,
and 30 mL of Bradford solution in a glass beaker at magnetic
stir. Transfer to cylinder and fill with water up to 500 mL, filter
through Whatman No. 1 filter paper, and store in a dark bottle
at room temperature.
2.2 SDS 1. Acrylamide/bis-acrylamide solution (AA/Bis). 29.2% (w/v)

Polyacrylamide Gel acrylamide, 0.8% (w/v) bis-acrylamide. For the preparation of
100 mL of the solution, weigh 29.2 g of acrylamide and 0.8 g
of bis-acrylamide, and dissolve together in 50 mL of water in a
glass beaker at the magnetic stir. Transfer the solution to the
cylinder and fill up to the 100 mL with water. Filter through
Whatman No. 1 filter paper and store at 4 °C.
2. 1.5 M Tris-HCl pH 8.8 buffer. Weigh 18.2 g of Tris and dis-
solve in 70 mL of water in a glass beaker at the magnetic stir.
Use 6.0 M HCl to adjust pH to 8.8. Transfer the solution to
the cylinder and fill up with water up to 100 mL. Filter through
Whatman No. 1 filter paper and store at 4 °C.
3. Ammonium persulfate (APS). 10% solution in water. Weigh
500 mg of APS and dissolve in 4 mL of water in a glass beaker
on the magnetic stir. Transfer to cylinder and fill up with water
up to 5 mL. Store at 4 °C (see Note 4).
4. Ten percent sodium dodecyl sulfate (SDS). 10% solution in

water. Weigh 500 mg of SDS and dissolve in 4 mL of water in
a glass beaker on the magnetic stir. Transfer to cylinder and fill
up with water up to 5 mL. Store at room temperature.
5. Electrode buffer (10× concentrated). 0.25 M Tris, 1.92 M
glycine, 10% (w/v) SDS, pH 8.3. Weigh 30 g of Tris and dis-
solve in 700 mL of water in a glass beaker at the magnetic stir.
Subsequently weigh and add 144 g of glycine and 10 g of
SDS. Use 6.0 M HCl to adjust pH to 8.3. Transfer to cylinder
and fill up with water up to 1 L. Store at 4 °C (see Note 5).
6. Twelve percent resolving gel buffer. Mix 21 mL of water;
15 mL of 1.5 M Tris-HCl, pH 8.8; and 24 mL of AA/Bis
solution in a vacuum flask, and remove air by vacuum pump.
Add 600 μL of 10% SDS, 300 μL of 10% APS, and 25 μL of
tetramethylethylenediamine (TEMED).
7. Equilibration buffer. 0.05 M Tris-HCl pH 8.8, 6 M urea, 2%
SDS (w/v). Weigh 9 g of urea and dissolve in 5 mL of water
in a glass beaker with heating. To this solution add 0.83 mL of
Tris-HCl pH 8.8 and 2.5 mL of 20% SDS. For dissolving add
additional 5 mL of water, and when it is dissolved, transfer it
to the cylinder and fill it up to 25 mL with water. Buffer can
be stored at room temperature for 2 weeks.
8. 0.5% agarose solution. Weigh 125 mg of agarose, dissolve it in
25 mL of 1× electrode buffer in a glass beaker at the magnetic
stir, and add 25 μL of brome phenol blue dye.
9. Gel staining solution. 0.1% (w/v) CBB R-250, 45% (v/v)
methanol, 10% (v/v) acetic acid. For preparation of 100 mL
of gel staining solution, weigh 0.1 g of CBB R-250, and dis-
solve it in the mixture of 45 mL of methanol, 10 mL of acetic
acid, and 20 mL of water in a glass beaker on the magnetic stir.
Transfer to cylinder and fill up with water up to 100 mL. Store
at 4 °C. Filter through Whatman No. 1 filter paper before use.
10. Gel destaining solution. 10% (v/v) acetic acid, 20% (v/v)

methanol. For preparation of 1 L of destaining solution, in
cylinder mix 100 mL of acetic acid and 200 mL of methanol,
and add deH2O up to 1 L (see Note 6).
2.3 Sample 1. Gel pieces destaining solution. 10% (v/v) acetic acid, 40%
Preparation of Non- (v/v) methanol.
derivatized Samples 2. Digestion buffer. 50 mM ammonium hydrogen carbonate
for MS Analysis (NH4HCO3) pH 7.8. Weigh 0.0395 g of NH4HCO3 and dis-
solve it in a 10 mL of water in a glass beaker at the magnetic stir.
3. Fifty percent (v/v) acetonitrile in digestion buffer. Add 500 μL
of 100% acetonitrile to 500 μL digestion buffer and mix by
vortexing.
4. 25 mM NH4HCO3 buffer. Mix equal volumes of 50 mM

NH4HCO3, pH 7.8, and water.
5. Trypsin stock solution. Add 50 μL of water to 50 μg of
sequencing-grade modified and lyophilized trypsin. Dissolve
the trypsin by repeatedly drawing the solution in and out of
the pipette tip. Split the solution (1 mg/mL) in aliquots and
store at −20 °C.
6. Trypsin working solution. For the gel pieces, prepare 20 μg/
mL of trypsin in 25 mM NH4HCO3, pH 7.8. Take 7 μg of
trypsin stock solution (1 mg/mL), and add 343 μL of 25 mM
NH4HCO3, pH 7.8 (see Note 7).
7. Five percent trifluoroacetic acid (TFA). Add 50 μL of TFA to
950 μL of water and mix by vortexing.
8. Extraction solution. 50% (v/v) of 5% TFA in acetonitrile. Add
500 μL of 5% TFA to 500 μL of 100% acetonitrile and mix by
vortexing.
9. 0.1% TFA: Add 10 μL of TFA to 10 mL of water and mix by
vortexing.
2.4 Sample Before peptide derivatization, prepare the samples as described in

Preparation Subheading 2.3 items 1–9.
of Derivatized Samples
1. Derivatization solution: 0.8 mM CAF reagent (5-formyl-1,3-
for MS Analysis
benzenedisulfonic acid), disodium salt hydrate (pro analysis syn-
thetic product, Ruđer Bošković Institute) (see Note 8), and
16 mM of sodium cyanoborohydride (NaBH3CN) dissolve in
10 mM monopotassium phosphate buffer (KH2PO4), and adjust
to pH 4.5 with phosphoric acid (H3PO4). Dissolve 1 mg of CAF
in 1 mL of 10 mM KH2PO4 and 4 mg NaBH3CN in 1 mL of
10 mM KH2PO4. Mix them in ratio NaBH3CN:CAF = 4:1. The
derivatization mixture should be maintained at 4–8 °C for at
least 3 h, as described in Cindrić et al. [9].
2.5 Manual Sample 1. Eighty percent (v/v) acetonitrile in 0.1% TFA. Add 800 μL of
Cleanup (ZipTip C18 or 100% acetonitrile to 200 μL of 0.1% TFA and mix by
C4 Columns) vortexing.
2. Fifty percent (v/v) acetonitrile in 0.1% TFA. Add 500 μL of
100% acetonitrile to 500 μL of 0.1% TFA and mix by
vortexing.
3. 0.1% TFA for column conditioning. Add 10 μL of TFA to
10 mL of water and mix by vortexing.
2.6 Automated 1. Equilibration buffer. 0.1% TFA for column conditioning: add
Sample Cleanup 54 μL of TFA to 54 mL of water and mix by vortexing.
(AssayMAP Bravo) 2. Priming buffer. 50% (v/v) acetonitrile in 0.1% TFA: add 25 mL
of 100% acetonitrile to 25 mL of water and add 50 μL of TFA
and mix by vortexing.
3. Elution buffer. 70% (v/v) acetonitrile in 0.1% TFA: add 28 mL

of 100% acetonitrile to 12 mL of water and add 40 μL 0.1%
TFA and mix by vortexing (see Note 9).
2.7 MALDI Sample 1. Matrix solution. Prepare 5 mg of α-cyano-4-hydroxycinnamic

Loading acid (CHCA) matrix substance in 1 mL of 1:1 mixture of 0.1%
TFA and acetonitrile.
3 Methods
Since the procedures involved in the following protocols include

usage of some potentially dangerous chemicals, wear protective
clothes and gloves. Moreover, to protect your protein samples
from contamination with keratin from your hair and/or skin, wear
protective clothes, gloves, and mask during preparation of samples
for mass spectrometry.
3.1 Protein For the protein extraction, you should prepare on the bench the
Extraction and Sample following: paper towel, mortar and pestle, metallic or plastic spat-
Preparation ula, ice box, and plastic tubes of 15 mL (place them in an ice box).
1. Ground approximately 1.5 g of tissue (see Note 10) in liquid
nitrogen using previously precooled mortar and pestle.
2. Add 3 mL of extraction buffer to the ground tissue and stir
with spatula (see Note 11). Transfer the extract from the mor-
tar to the 15 mL plastic tube. Vortex it shortly and then place
it horizontally and cover with ice and incubate on ice for
10 min on agitator.
3. After incubation, add 3 mL of phenol to the extract in plastic
tube (see Note 12), vortex, and incubate at room temperature
10 min on agitator.
4. Centrifuge for 10 min at 4 °C and 5500 × g (see Note 13).
5. Remove the supernatant (phenolic phase) (Fig. 1a) in a clean
15 mL plastic tube with a 1 mL pipette, and add 3 mL of
extraction buffer. Vortex and incubate at room temperature
for 3 min on agitator.
6. Centrifuge at 5500 × g and 4 °C for 10 min (see Note 13).
7. Transfer the supernatant (Fig. 1b) in a clean 15 mL plastic
tube, and add 4 volumes of ice-cold precipitation solution
(approximately 8 mL per sample), invert tubes a few times,
and leave overnight for precipitation at −20 °C.
8. After the overnight precipitation, centrifuge at 5500 × g and
4 °C for 10 min (see Note 13), and discard supernatant.
9. Wash the pellet 3× with 3 mL ice-cold precipitation solution
(resuspend with pipette) and 1 (last) × with 3 mL of ice-cold
Fig. 1 Phenolic phases obtained (a) after first centrifugation step and (b) after second centrifugation step
during protein extraction
acetone. Between every washing step, centrifuge at 5500 × g

and 4 °C for 10 min (see Note 14).
10. While samples are in the last centrifuge with acetone, defrost
aliquots of IEF buffer, and add 2 mg/mL of dithiothreitol
(DTT) and 5.2 μL/mL of ampholyte (see Note 15).
11. After the last centrifugation step, leave the pellet to air dry
(for acetone to vaporize) for a few minutes (see Note 16).
12. Each pellet should be dissolved in 500 μL of IEF buffer with
DTT and ampholyte (see Note 17).
13. Put dissolved pellets in 1.5 mL plastic tubes and centrifuge at
20,800 × g for 5 min at room temperature.
14. Transfer supernatants in clean 1.5 mL plastic tubes and discard
pellet.
15. For determination of protein concentration, a modified

Bradford method [11] should be applied. In 15 mL plastic
tubes, mix 10 μL of 0.1 M HCl, 20 μL of sample, 70 μL of
water, and 3.5 mL of Bradford working solution, vortex, and
leave it at room temperature for 10 min protected from light.

For zeroing of the spectrophotometer, use the same mixture,
but instead of your sample, add 20 μL of IEF buffer with DTT
and ampholyte.
16. For the calibration curve preparation, mix 10 μL of 0.1 M
HCl, 20 μL of bovine serum albumin (BSA) solutions of
known concentrations (0.2–2.0 mg/mL), 70 μL of water, and
3.5 mL Bradford working solution in 15 mL plastic tubes.
BSA samples should be prepared in IEF buffer with DTT and
ampholyte.
17. All mixtures should be transferred from plastic tubes to

cuvettes, and all measurements should be performed at
595 nm (see Note 18).
18. According to the obtained protein concentration in your sam-
ple, calculate the sample volume which contains 500 μg of
proteins (for gel staining with dye Coomassie Brilliant Blue,
CBB), pipette the exact volume, and add IEF buffer with DTT
and ampholyte up to 400 μL (volume which should be loaded
on IPG strips). In each sample add 5 μL of bromophenol blue,
vortex, and centrifuge at 20,800 × g and at room temperature
for 5 min.
19. Prepare your samples for rehydration step. Take out the super-
natant of your sample, and transfer it to the rehydration tray
(one sample solution in each well). Put one IPG strip with the
gel facing down in each well and avoid formation of air bub-
bles. Cover each IPG strip with 900 μL of cover fluid, and
leave for rehydration for 12–16 h or overnight at room
temperature.
3.2 First Dimension: 1. Place the manifold on IPGphor.

Isoelectric Focusing 2. Carefully drain each IPG strip by light pressing on the paper
(IEF) towel, and then place it on the top of the manifold (take care
of length and orientation of IPG strips).
3. Add 150 μL of deH2O on each electrode paper.
4. Place electrode papers at both gel ends (half on the gel, half
outside of the gel).
5. Place electrodes on the top of the electrode papers (approxi-
mately at ¼ of the paper—electrode should be placed on the
gel and on the paper).
6. Cover with 110 mL cover fluid across the whole manifold
surface.
7. Switch IPGphor and start IEF (see Note 19).
8. After the IEF is finished (see Note 20), store IPG strips at
−80 °C.
3.3 Second 1. Cast large 12% SDS gels up to 0.5 cm below the upper edge of
Dimension: SDS-PAGE glass plate (see Note 21).
2. Take the certain volume of equilibration buffer (see Note 22),
and dissolve DTT for the first equilibration step.
3. Take out IPG strips from −80 °C and leave at room tempera-
ture for 5 min to defrost.
4. Place IPG strips in the wells of the equilibration tray, and add 2.5
or 3 mL (for 13 or 17 cm IPG stripes, respectively) of equilibra-
tion buffer with DTT in each well and agitate for 15 min.
5. Take the certain volume of equilibration buffer (see Note 23),
and dissolve iodoacetamide (IAA) for the second equilibra-
tion step.
6. Take out the IPG stripes from the equilibration buffer with
DTT, and drain them by gently pressing against the paper
towel. Transfer them in clean wells of the equilibration tray,
and add 2.5 or 3 mL (for 13 or 17 cm IPG stripes, respec-
tively) of equilibration buffer with IAA in each well and agitate
for 15 min.
7. Equilibrated gels should be soaked in 1× electrode buffer and
placed on the top of the SDS gel (Fig. 2) (see Note 24).
8. Put 5 μL of molecular mass marker on the square piece
(approximately 0.5 cm × 0.5 cm) of Whatman No. 1 filter
paper, and place it on the SDS gel on the − (minus) end of the
IPG strip.
9. Pour the 0.5% agarose solution above the IPG stripe (Fig. 3)
and wait until it solidifies.
10. Start the second dimension, SDS-PAGE, firstly, at 100 V for
30 min and then at 220 V till the end (total approximately 5 h).
11. Stain the gel with CBB dye. Incubate the gels in staining solu-
tion for 2 h on a shaker at room temperature. Discard the gel
staining solution, and incubate in gel destaining solution on a
shaker at room temperature (see Note 25).
12. Scan gel and store it in 10% acetic acid at 4 °C (Fig. 4).
13. Analyze gels by applying 2-D gel image analysis software.
3.4 Sample 1. Cut out the selected protein spots from the gel using plastic
Preparation of Non- pipette tip (200 μL) whose tip was shortened by 1 cm.
derivatized Samples 2. Transfer the gel pieces in 1.5 mL plastic tubes filled with 1 mL
for MS Analysis of destaining solution, and incubate on thermomixer at
500 rpm overnight at room temperature (see Note 26).
3. Discard destaining solution (see Note 27).
4. Rinse the gel pieces in 500 μL of the digestion buffer by
incubation in thermomixer at 500 rpm and room temperature
2 × 5 min.
Fig. 2 Placing the IPG stripe on the SDS gel
Fig. 3 Pouring the 0.5% agarose solution above the IPG stripe
Fig. 4 Total soluble proteins of onion (Allium cepa) root cells extracted by phenol
method and separated by 2-DE. Gel is stained with CBB stain. M—molecular
marker mass (kDa). Circle marks the protein spot identified by CAF−/CAF+
technology
5. Rinse the gel pieces for the third time in 500 μL of the digestion
buffer at 500 rpm and room temperature for 30 min.
6. Remove the digestion buffer, and add 500 μL of 50% (v/v)
acetonitrile in digestion buffer, and incubate in thermomixer
at 500 rpm and room temperature for 30 min.
7. Remove the acetonitrile solution, and add 100 μL of 100%
acetonitrile, and incubate in thermomixer at 500 rpm and
room temperature for 5 min (see Note 28).
8. Remove the acetonitrile, and dry gel pieces in vacuum concen-
trator at 30 °C until they dry (~15 min) (see Note 29).
9. Transfer dried gel pieces to 200 μL plastic tubes (see Note 30),
and add 10 μL of 10 μg/mL trypsin solution in 25 mM
NH4HCO3, and centrifuge for a few seconds (see Note 31).
10. Place plastic tubes in thermomixer for trypsin digestion at
400 rpm and 37 °C, 18 h.
11. After digestion, leave the gel pieces in the present 200 μL plas-
tic tube, and remove trypsin solution to clean 1.5 mL plastic
tubes, and dry it in vacuum concentrator at 30 °C until solution
dried (~15–30 min).
12. Add 10 μL of extraction solution to gel pieces left in the
200 μL plastic tubes, and incubate in ultrasonic bath at
room temperature for 30 min to extract remained proteins
from the gel.
13. Incubate gel pieces in the same extraction solution on thermo-

mixer for 15 min at 500 rpm and room temperature.
14. Remove extraction solution from the gel pieces, and transfer it
to the same 1.5 mL plastic tubes with dried peptides, and dry
it again in vacuum concentrator at 30 °C until solution is dried
(~ 15–30 min).
15. Store dried peptides at −80 °C.
16. Dissolve dried peptides in 10 μL of 0.1% (v/v) TFA for man-
ual cleanup or 35 μL of 0.1% TFA for automated cleanup (see
Note 32).
17. Perform manual or automated sample cleanup (see Note 33).
3.5 Sample Before peptide derivatization, prepare the samples according to

Preparation steps 1–14 as described in Subheading 3.4.
of Derivatized Samples 1. Each sample that, contained the dried tryptic peptide mixture
for MS Analysis (after peptide extraction step), reconstitute with a 15 μL vol-
ume of derivatization solution, resuspend with pipette, vortex,
and spin down.
2. Put around ten tubes in Styrofoam stalk and heat in the micro-
wave at 180 W, 8 min.
3. Dissolve dried peptides in 10 μL of 0.1% (v/v) TFA for manual
cleanup or 35 μL of 0.1% TFA for automated cleanup (see
Note 32).
4. Perform manual or automated sample cleanup (see Note 33).
3.6 Manual Sample 1. Prepare the ZipTip C18 or C4 columns for protein sample
Cleanup (ZipTip C18 or purification by rinsing the columns first 3× with 10 μL of 80%
C4 Columns) (v/v) acetonitrile in 0.1% TFA, then 3× with 10 μL of 50%
(v/v) acetonitrile in 0.1% TFA, and finally 3× with 10 μL of
0.1% (v/v) TFA.
2. Place the prepared ZipTip column in the tube with dissolved
peptides, and purify peptides by repeatedly drawing the solu-
tion in and out of the pipette tip back into the plastic tube for
at least 10× (see Note 34).
3. Desalt peptides bound to the ZipTip column by rinsing the
column 5× with 10 μL of 0.1% (v/v) TFA.
4. Finally elute the peptides bound to the column with 10 μL of
80% (v/v) acetonitrile in 0.1% TFA by repeatedly drawing the
solution in and out of the pipette tip back into the clean plastic
tube 10×.
5. Dry the purified peptides in the vacuum concentrator at 30 °C
until solution is dry (~30–40 min), and store them at −20 °C
until MS analysis.
3.7 Automated 1. Dissolve dried peptides in 35 μL of 0.1% (v/v) TFA and place
Sample Cleanup them in 96 well PCR tubes.
(AssayMAP Bravo) 2. Put the C18 cartridge or reverse phase (RPS) cartridge to the
AssayMAP Bravo head, and follow the instructions for protein
cleanup (see Note 35).
3.8 MS Analysis 1. Resuspend purified tryptic peptides in 4 μL of matrix solution

and Protein (CHCA), and spot them onto the MALDI plate.
Identification of Non- 2. Perform MS analysis (see Note 36).
derivatized Samples
3. For protein identification use Global Protein Server (GPS)
Explorer software for Mascot search against NCBIprot data-
base (see Note 37).
3.9 MS Analysis 1. Resuspend purified tryptic peptides in 4 μL of matrix solution

and Protein (CHCA), and spot them onto the MALDI plate.
Identification 2. Perform MS analysis (see Note 38).
of Derivatized Samples
3. For protein identification use ProteinPilot software (Applied
Biosystems, Carlsbad, CA, USA) for Mascot search against
NCBIprot database (see Note 39) (Figs. 5 and 6).
4 Notes
1. Volume of the extraction buffer should be adjusted to the

number of samples that you are preparing for the analyses.
Keep in mind that 6 mL of extraction buffer is required for
one sample.
2. Extraction buffer composed of Tris, EDTA sucrose, and KCl
can be prepared in advance and stored at 4 °C for 7 days. If
you want to keep it for a longer time, it can be frozen for
30 days. However, PMSF solution always needs to be freshly
prepared, and both PMSF solution and β-mercaptoethanol
have to be added to the extraction buffer just prior to use.
3. The dissolution of urea in water is an endothermic process.
Therefore, when dissolving urea in water, you should be care-
ful to avoid its crystallization. To prevent that, it is recom-
mendable to perform the dissolution on a magnetic stir with
heating or in a water bath (in previously heated glass beaker).
Be careful to keep the temperature around 40 °C; too high
temperature will cause degradation of urea.
4. Prepared 10% APS solution can be split into aliquots of
0.5 mL, which can be stored in plastic tubes at −20 °C for 1
month. Defrosted APS can be used for 1 week if stored at
4 °C.
Fig. 5 MALDI-MS/MS spectra obtained in negative CAF− (a) and positive CAF+ (b) ion mode. De novo sequenc-
ing of derivatized peptides was performed by DUST algorithm in positive and negative ion mode (b-series ions
in negative MS/MS, reading direction from N- to C-terminus; y-series ions in positive MS/MS, reading direction
from C- to N-terminus). Derivatized peptide fragment m/z 2294.9688 (protein spot marked as a circle in
Fig. 4—identified as homologue protein ascorbate peroxidase, Accession #Q9FE01.1, Oryza sativa)
a
Score Expect Identities Gaps
62.5 4.0E-8 14/15 (93.0)% 1/14
Algorithm query DEDAFFADYAEAHXK
Protein part PAKRPL VEKYAADEDAFFADYAEAHLKLSELGF 226..238
b
Score Expect Identities Gaps
55.4 2.0E-8 16/16 (66.67%) 0/16
Algorithm query YAADEDAFFADYAEAH
Protein part RPLVEKYAADEDAFFADYAEAHLKLSEL 223..238
Fig. 6 De novo reading driven by BLASTp algorithm for the peptide sequence reading in negative (a) and posi-
tive (b) ion mode for peptide fragment m/z 2294.9688. Red letters mark mismatched amino acids or gaps after
comparison of a peptide query to the NCBIprot database
5. The 10× concentrated electrode buffer should be diluted 10×

before use. Diluted buffer can be stored at 4 °C. Before load-
ing the samples, fill in the wells with freshly diluted and pre-
cooled 1× electrode buffer. The used 1× electrode buffer can
be stored in electrophoresis tank and be used 3–4 times.
6. To avoid methanol in gel destaining solution, you can use 10%
ethanol instead.
7. Volume of the trypsin working solution should be adjusted to
the number of samples that you are preparing for the diges-
tion. Keep in mind that 350 μL of trypsin working solution is
required for 35 samples.
8. Commercially available 4-formyl-1,3-benzenedisulfonic acid
(Sigma-Aldrich, St. Louis, MO, USA) can be used as derivatiza-
tion reagent instead of 5-formyl-1,3-benzenedisulfonic acid
under the same aforementioned conditions, except prolonged
incubation time (at least 12 h).
9. 54 mL of equilibration buffer, 50 mL of priming buffer, and
40 mL of elution buffer are required for 96 samples.
10. For protein extraction you can use 1.5 g of fresh tissue or tis-
sue frozen at −80 °C. However, some plant tissues, especially
cultured in vitro, can be hyperhydrated and/or recalcitrant
and therefore difficult for effective protein extraction.
Therefore, you can alternatively use 0.15 g of lyophilized tis-
sue; in that way you will obtain dry tissue which is devoid of
extensive water and can be more easily grounded.
11. After the addition of extraction buffer to the ground tissue in
the mortar, the tissue might freeze. Leave it shortly at the
bench at room temperature to defrost and then stir with
spatula.
12. Since phenol is a volatile compound with an unpleasant odor,
use laboratory fume hood to add phenol to your extracts.
Moreover, phenol is covered with protective liquid; therefore
you should pipette carefully in order to avoid taking out non-
phenol part.
13. If the centrifuge in your lab cannot reach recommended speed,
you can prolong the duration of the centrifugation to, e.g.,
20 min to achieve the equally good separation of the phases.
Furthermore, the swing out rotor in the centrifuge is recom-
mendable for good separation.
14. Keep the plastic tubes with sample tubes on ice in laboratory
fume hood. After each centrifugation step, discard the super-
natant, and add 3 mL of precipitation solution on the pellet.
Resuspend each pellet with 1 mL pipette, and keep the pipette
tips for following washings with either precipitation solution
or acetone.
15. It is enough to take 500 μL of IEF buffer per sample; how-

ever, it is advisable to prepare more due to the determination
of protein concentration; for example, take 5 mL of IEF buffer
for six samples.
16. Drying of samples should not be too long; otherwise they will
become very difficult to dissolve. The procedure that works
best for us is to invert the plastic tubes with pellet and to press
them gently on the paper towel several times until there is no
more wet mark on the paper. Alternatively, you can leave the
tubes with samples horizontally for a few minutes to air dry in
laboratory fume hood.
17. Pellets should be carefully resuspended with 1 mL pipette in
several steps. After the first resuspension step, leave the pipette
tips in tubes and place the tubes on agitator for 10 min.
Resuspend again. If pellets are particularly difficult to dissolve,
you can also put them in the ultrasonic bath for 35–45 sec.
Repeat the whole procedure until the pellets are dissolved,
although it should last for maximum 1 h.
18. If the protein concentration in your sample is too high consid-
ering your calibration curve, decrease sample volume to 10 μL,
and increase volume of water to 80 μL.
19. The IEF program that we use for our samples is 500 V for 1 h
(step and hold), 1000 V for 1 h (gradient), 8000 V for 3 h
(gradient), and 8000 V for 4 h (step and hold). The number
of IPG strips should always be checked and adjusted before
starting the IEF.
20. IEF lasts approximately 8 h; the end is at 45 kVh for 17 cm
IPG strips and at 30 kVh for 13 cm IPG strips.
21. Gels for the second dimension can be prepared 1 day in

advance and stored at 4 °C. They should be taken out at room
temperature at least 1 h before loading with IPG stripes.
22. For two IPG stripes of 17 cm, weigh 120 mg of DTT and dis-
solve it in 6 mL of equilibration buffer; for two IPG stripes of
13 cm, weigh 100 mg of DTT and dissolve it in 5 mL of equil-
ibration buffer.
23. For two IPG stripes of 17 cm, weigh 150 mg of IAA and dis-
solve it in 6 mL of equilibration buffer; for two IPG stripes of
13 cm, weigh 125 mg of IAA and dissolve it in 5 mL of equili-
bration buffer.
24. Pay attention to the orientation of the IPG stripes. We have set
out the rule for ourselves to put the + end of the IPG stripe
always on the left side of the gel.
25. Gel destaining solution should be changed several times until
the gel background becomes colorless. For faster destaining,
place the piece of the folded paper towel at the margin of the
vessel; the paper will absorb the dye and expedite destaining
procedure. However, if you are performing the destaining over-

night, make sure to remove the paper towel from the vessel.
26. Gel pieces which cannot be destained in destaining solution
can be heated in microwave oven at defrost option until com-
plete destaining is achieved.
27. Since the gel piece is colorless and small, it is advisable to place
a smaller pipette tip (10 μL) on the top of the present pipette
tip (200 μL) to insure not to take up the gel piece with the
destaining solution.
28. After incubation in 100% acetonitrile, gel piece shrinks and
becomes white since acetonitrile binds water from the gel and
in that way enables complete penetration of trypsin solution in
the gel without undesirable dilution.
29. Check the gels if they dry out by tapping the plastic tube. If
they are not stick to the tube, they are dry.
30. Be careful while doing this since the gel pieces are very light
after drying.
31. The purpose of this centrifugation step is to compress the tube
content to the bottom to insure that the gel pieces are com-
pletely covered with the trypsin solution. If the gels are not
covered completely, it is better to chop a gel into smaller pieces
than to add too much of trypsin solution.
32. TFA neutralizes peptides in the water solution.
33. Both non-derivatized peptides and derivatized peptides can be
purified manually using ZipTip C4 or C18 columns or auto-
mated on AssayMAP Bravo instrument.
34. Each movement should be carried out slowly, to give good
contact time between the sample and the column, and care-
fully, to avoid passing a large amount of air through the tip.
35. Since the AssayMAP Bravo platform supports a broad range of
protein quantification and characterization workflows includ-
ing affinity purification, enzymatic digestion, protein and pep-
tide cleanup, peptide mapping, peptide fractionation, N-glycan
analysis, and phosphopeptide enrichment, each purification
has its own protocol, so be careful to choose the right protocol
for your purification step.
36. In our study, mass spectra were obtained using MALDI-TOF
mass spectrometer (4800 Plus MALDI TOF/TOF analyzer,
Applied Biosystems, USA) in positive reflector mode. For each
spot, 1600 shots per spectrum were taken in MS analysis and
2000 shots in MS/MS analysis, covering the mass range of
800–4000 Da, focus mass 2000 Da, and delay time 450 ns.
Trypsin autolysis peaks were used as internal standards.
Automated spectrum interpretation was performed, choosing
ten most intense peaks of each MS spectrum (excluding peaks

generated from trypsin autolysis, matrix, or acrylamide) for
subsequent MS/MS analysis. MS/MS was achieved by 1 kV
collision-induced dissociation (CID).
37. In our study, monoisotopic peptide masses were used for com-
bined MS and MS/MS database searches with the following
search parameters: maximum allowed peptide mass error,
50 ppm; fragment mass tolerance, ± 0.3 Da; minimum 5 S/N;
and a maximum of two incomplete cleavages per peptide. All
searches were evaluated based on the significant scores
obtained from Mascot. The number of trypsin digested pep-
tides matched for each protein was between 9 and 13. The
protein score confidence interval percentage and total ion
score confidence interval percentage were both set above 95%,
and the significance threshold was P = 0.05 for the MS/
MS. Gene ontology (GO, http://www.geneontology.org)
analysis was derived through Universal Protein Resource
(UniProt) hit accessions for all protein identifications accord-
ing to three categories which describe biological process, cel-
lular component, and molecular function.
38. MS acquisition (CAF−/CAF+) was performed with a 4800
Plus MALDI TOF/TOF analyzer (Applied Biosystems,
Carlsbad, CA, USA) equipped with a 200 Hz, 355 nm
Nd:YAG laser. Ions were analyzed in reflectron mode using
positive and negative polarity (Fig. 5). The instrument param-
eters were set using the 4000 Series Explorer software (version
3.5.3, Applied Biosystems). Mass spectra were obtained by
averaging 1800 laser shots covering a mass range of m/z 1000
to 5000. Internal calibration of the mass range was performed
with trypsin autolysis fragments. MS/MS of the ten most
intense precursor signals after derivatization (excluding tryp-
sin autolysis fragments) from MS negative spectra was achieved
by 1 keV c ollision energy in positive ion mode with air as a
collision gas, CAF+. In the negative ion mode, the same ten
most intense fragile precursor signals (obtained after derivatiza-
tion) were fragmented without using collision-induced disso-
ciation (CID), CAF−.
39. Protein identification and a protein homology search were
performed by de novo sequencing of the MS and MS/MS
spectra from both positive and negative ion modes followed
by a BLASTp search against the NCBIprot database (Fig. 6).
Peptide de novo sequencing analysis was performed by modi-
fied in-house developed DUST algorithm [12].
References
1. Oliveira BM, Coorssen JR, Martins-de-Souza Org 122:127–146. https://doi.org/10.1007/

D (2014) 2DE: the phoenix of proteomics. s11240-015-0756-9
J Proteome 104:140–150. https://doi. 8. Gundry RL, White MY, Murray CI, Kane LA,
org/10.1016/j.jprot.2014.03.035 Fu Q, Stanley BA, Van Eyk JE (2009)
2. Isaacson T, Damasceno CM, Saravanan RS Preparation of proteins and peptides for mass
et al (2006) Sample extraction techniques for spectrometry analysis in a bottom-up pro-
enhanced proteomic analysis of plant tissues. teomics workflow. Curr Protoc Mol Biol
Nat Protoc 1:769–774. https://doi. 88:VI:10.25.1–VI10.25.23. https://doi.
org/10.1038/nprot.2006.102 org/10.1002/0471142727.mb1025s88
3. Jellouli N, Salem AB, Ghorbel A, Jouira HB 9. Cindrić M, Kraljević PS, Horvatić A, Dodig I
(2010) Evaluation of protein extraction meth- (2010) Mass spectrometry-based protein iden-
ods for Vitis vinifera leaf and root proteome tification. Patent from PCT Int. Appl. WO
analysis by two-dimensional electrophoresis. 2011089453
J Integr Plant Biol 52:933–940. https://doi. 10. Butorac A, Dodig I, Bačun-Družina V et al
org/10.1111/j.1744-7909.2010.00973.x (2013) The effect of starvation stress on
4. Champagne A, Boutry M (2013) Proteomics Lactobacillus brevis L62 protein profile deter-
of nonmodel plant species. Proteomics mined by de novo sequencing in positive and
13:663–673. https://doi.org/10.1002/ negative mass spectrometry ion mode. Rapid
pmic.201200312 Commun Mass Spectrom 27:1045–1053.
5. Carpentier SC, Panis B, Vertommen A et al https://doi.org/10.1002/rcm.6528
(2008) Proteome analysis of non-model plants: 11. Faurobert M, Pelpoir E, Chaïb J (2007) Phenol
a challenging but powerful approach. Mass extraction of proteins for proteomic studies of
Spectrom Rev 27:354–377. https://doi. recalcitrant plant tissues. In: Thiellement H,
org/10.1002/mas.20170 Zivy M, Damerval C et al (eds) Plant pro-
6. Pavoković D, Križnik B, Krsnik-Rasol M teomics: methods and protocols. Humana
(2012) Evaluation of protein extraction meth- Press, Totowa, NJ, pp 9–14. https://doi.
ods for proteomic analysis of non-model recal- org/10.1385/1-59745-227-0:9
citrant plant tissues. Croat Chem Acta 12. Butorac A, Mekić MS, Hozić A et al (2016)
85:177–183. https://doi.org/10.5562/ Benefits of selective peptide derivatization with
cca1804 sulfonating reagent at acidic pH for facile
7. Rogić T, Horvatić A, Tkalec M et al (2015) matrix-assisted laser desorption/ionization de
Proteomic analysis of Mammillaria gracilis novo sequencing. Rapid Commun Mass
Pfeiff. In vitro-grown cultures exposed to iso- Spectrom 30:1687–1694. https://doi.
osmotic NaCl and mannitol. Plant Cell Tissue org/10.1002/rcm.7594
Chapter 26
Chromatin Immunoprecipitation (ChiP) Protocol

for the Analysis of Gene Regulation by Histone
Modifications in Agave angustifolia Haw
Rosa Us-Camas and Clelia De-la-Peña
Abstract
Chromatin is a dynamic entity that regulates different biological processes crucial for the proper functioning
of the cell. Chromatin regulation depends largely on the interactions that occur between DNA with his-
tones and nonhistone proteins. The chromatin immunoprecipitation assay (ChiP) is a widely used technique
for the study of these DNA-histone and DNA-nonhistone interactions and their biological repercussions.
Here we describe a ChiP protocol that allows in vivo analysis of the associations of histone modifications
with genomic DNA in Agave angustifolia Haw. Although this protocol is established for A. angustifolia,
it can be used in other species to obtain similar results. We also propose a strategy to shorten the times in
some steps of the standard protocol.
Key words Agave angustifolia, ChiP, H3K4me3, H3K27me3, LCYβ, PEPCase, RubS
1 Introduction
In eukaryotes, genomic DNA is compacted into a more complex

structure called chromatin. Chromatin is a dynamic entity that
regulates a large number of cellular functions such as transcription,
replication, DNA repair, cell differentiation, and development [1,
2]. The regulation of these processes depends on the association of
DNA with histones and other nonhistone proteins [1–3], so the
understanding of how these interactions affect biological processes
is of great biological importance. The basic unit of chromatin
organization is the nucleosome, which consists of 147 base pairs
of genomic DNA wrapped around an octamer of histones contain-
ing two copies of H2A, H2B, H3, and H4 [4]. The N-terminal
tails of H2A, H2B, H3, and H4 are subjected to different post-
translational modifications such as ubiquitination, sumoylation,
phosphorylation, acetylation, and methylation [5–7].
371
372 Rosa Us-Camas and Clelia De-la-Peña
The chromatin immunoprecipitation (ChiP) assay is used to

study specific interactions between DNA and histone m odifications
and other nonhistone proteins. Alternative ChiP methods, such as
ChiP on chip and ChiP-Seq, have been developed to study the
global patterns of histone modifications and to obtain a high-
resolution map of the histone modifications—DNA-binding loci [8,
9]. The general steps of the ChiP assay consist of the cross-linking of
protein-DNA interactions with formaldehyde, done in vivo; then
the chromatin is isolated and sheared into fragments between 200
and 1000 bp (a smear of ~500 bp is observed when the shear is effi-
cient). The sheared chromatin is then incubated with antibodies that
recognize specific proteins or histone modifications, the cross-link-
ing is reversed, and the DNA is released from the antibody and asso-
ciated proteins. Finally, the DNA is precipitated and then subjected
to PCR using specific primers for the gene of interest (Fig. 1).
Here we describe a ChiP protocol in A. angustifolia, one of
the economically important crops of Mexico and used for the prep-
aration of mezcal, a famous alcoholic beverage [10]. Although the
ChiP protocol presented here was established with A. angustifolia,
this protocol can be used in other species to obtain similar results.
The protocol presents some modifications with respect to the orig-
inal [11], such as adapting of the duration of cross-linking to the
Agave tissue and increasing in the volume of chromatin resuspen-
sion buffer, which helps to reduce sonication cycles and therefore
chromatin damage. In order to reduce the background, we
increased the preclearing time and reduced the incubation time
with the agarose beads during the immunoprecipitation. Also, we
added an incubation step with RNase to eliminate RNA contamina-
tion. We also suggest a rapid and standard protocol that is adapted
to the time available for the realization of the ChiP protocol
(Fig. 2). In both cases good DNA quality is obtained.
During the ChiP assay, we analyzed the gene regulation of
PEPCase (phosphoenolpyruvate carboxylase), RubS (ribulose-1,5-
bisphosphate carboxylase/oxygenase small subunit), and LCYβ
(β-lycopene cyclase) against H3K4me3 and H3K27me3. Ubiquitin
(UBI11) was used as a positive control that carries the trimethyl-
ation of Lys 4 histone H3 [12].
2 Materials
2.1 Biological 1. Micropropagated A. angustifolia plantlets are grown on MS

Materials medium [13] supplemented with 2,4 dichlorophenoxyacetic
acid (2,4-D) (0.11 μM) and 6-benzyladenine (BA) (22.2 μM)
and solidified with agar (0.2%) and gelrite (0.2%) [14]. The
cultures are maintained at 25 ± 2 °C under photoperiod condi-
tions of 12 h. For the ChiP assay, 2 g of young leaf tissue from
micropropagated plants between 4 and 6 cm in height are
collected during light conditions.
Epigenetics in Agave angustifolia 373
Fig. 1 Schematic representation of the ChiP protocol. The experimental steps, cross-linking, chromatin shear-
ing, immunoprecipitation, reverse cross-linking, DNA purification, and PCR analysis, are shown
2.2 Reagents, Prepare a stock solution for some reagents:

Solutions, and Culture
1. 1 M sucrose.
Media
2. 0.5 M Tris–HCl pH 8 (adjust pH with concentrate HCl
solution).
3. 1 M Tris–HCl pH 6.5 (adjust pH with concentrate HCl
solution).
4. 0.1 M EDTA pH 8 (adjust pH with NaOH solution).
5. 2 M glycine.
6. 0.1 M PIPES (1,4-piperazinediethanesulfonic acid) pH 6.8
(adjust pH with NaOH solution).
7. 0.1 M MgCl2.
8. 1 M KCl.
9. 5 M NaCl.
10. 0.1 M CaCl2.
Fig. 2 Comparison between the rapid and standard protocol. +At this step the process can be stopped and the
fixed tissue stored at −80 ° C until use. *At this step the process can be stopped; store the sample at −20 °C,
and continue the process the next day. However, once the immunoprecipitation is initiated, it is preferable to
continue the process to the end. The ChiP assay can also be stopped until the cross-linking reversal; store the
sample at −4 °C
11.
0.5 M HEPES (N-(2-hydroxyethyl) piperazine-N′-(2-
ethanesulfonic acid) pH 7.5 (adjust pH with NaOH).
12. 0.1 M sodium butyrate.
13. 1 M LiCl.
14. 0.5 M NaHCO3.
15. 3 M sodium acetate pH 5.2 (adjust pH with glacial acetic
acid).
16. 10% sodium deoxycholate.
17. 10% SDS.
18. Protease inhibitors: 0.2 M PMSF (phenylmethanesulfonyl flu-
oride) (dilute with 100% ethanol). 1 mg mL−1 aprotinin (dilute
in water). 1 mg mL−1 pepstatin A (dilute in ethanol).
19. 20 mg mL−1 proteinase K (dilute in water).
20. 20 mg mL−1 RNase A (dilute in water).
21. Triton X-100.
22. Phenol/chloroform/isoamyl alcohol (25:24:1 (v/v)).
23. 100% ethanol.
24. Formaldehyde 37%.
25. Protein A agarose/Salmon Sperm DNA.

26. Glycogen.
27. Anti-histone H3 (trimethyl K4) antibody (abcam, Cat. #

ab8580).
28. Anti-histone H3 (trimethyl K27) antibody (abcam, Cat. #

mAbcam6002).
29. DreamTaq DNA polymerase.
30. Agarose.
31. Gelred.
32. Liquid nitrogen.
2.2.1 ChiP Solutions Prepare ChiP solutions immediately before use using sterile bi-
distilled water, and keep at 4 °C or in ice. Only the elution buffer
is maintained at room temperature.
1. Cross-linking buffer: 0.4 M sucrose, 10 mM Tris–HCl pH 8,
1 mM EDTA pH 8, 1 mM PMSF, and 1% (v/v) of formalde-
hyde 37%. Prepare the protease inhibitor immediately prior to
use; add while fresh (see Note 1).
2. Stop cross-linking reaction: add 3.3 mL of 2 M glycine to
sample for a final concentration of 0.125 M.
3. Nuclei isolation buffer: 0.25 M sucrose, 15 mM PIPES
pH 6.8, 5 Mm MgCl2, 60 Mm KCl, 15 Mm NaCl, 5 mM
CaCl2, 0.8% (v/v) Triton X-100, 1 mM PMSF, 2 μg mL−1
pepstatin A, and 2 μg mL−1 aprotinin. Prepare the protease
inhibitor immediately prior to use and add while fresh.
4. Nuclear lysis buffer: 50 mM HEPES pH 7.5, 0.15 M NaCl,
1 mM EDTA pH 8, 1% (v/v) Triton 100-X, 0.1% (v/v)
sodium deoxycholate, 0.1% SDS, 1 mM PMSF, 10 mM
sodium butyrate, 2 μg mL−1 pepstatin A, and 2 μg mL−1 apro-
tinin. Prepare the protease inhibitors prior to use and add
while fresh.
5. ChiP dilution buffer: 16.7 mM HEPES pH 7.5, 0.167 M
NaCl, 2 mM EDTA, and 1.1% (v/v) Triton X-100.
6. Low-salt wash buffer: 0.15 M NaCl, 20 mM Tris–HCl pH 8,
2 mM EDTA pH 8, 0.1% (v/v) Triton X-100, and 0.1% (v/v)
SDS.
7. High-salt wash buffer: 0.5 M NaCl, 20 mM Tris–HCl pH 8,
2 mM EDTA pH 8, 0.1% (v/v) Triton X-100, and 0.1% SDS.
8. LiCl wash buffer: 0.25 M LiCl, 1% (v/v) sodium deoxycho-
late, 10 mM Tris–HCl pH 8, 1 mM EDTA pH 8, and 1%
(v/v) NP-40.
9. Elution buffer: 1% SDS and 0.1 M NaHCO3.
10. 1× TE buffer: 10 mM Tris–HCl pH 8 and 1 mM EDTA pH 8.
2.2.2 Other Materials 1. Mortar and pestle.

2. Kitasato flask with stopper.
3.
Micropipettes and tips (2–20 μL, 20–200 μL, and
100–1000 μL).
4. Falcon tubes (50 mL).
5. Sorvall centrifuge tubes (50 mL).
6. Eppendorf centrifuge tubes (1.5 and 2 mL).
7. Sterile cheesecloth.
8. Paper towels, sterile.
2.3 Instrumentation 1. Refrigerated centrifuge.

2. Sorvall centrifuge (Sorvall RC 5B Plus).
3. Sonicator.
4. Vacuum pump.
5. Vortex.
6. Rotating mixer.
7. Freezer (−80 °C).
8. Cooler room or refrigerator (4–8 °C).
9. Thermocycler.
10. Agarose electrophoresis equipment.
11. UV transilluminator.
3 Methods
3.1 Tissue 1. Harvest 2 g of fresh leaf tissue, place it inside the Büchner flask,
Cross-Linking add 50 mL of cross-linking buffer, and apply vacuum for 15 min
at room temperature. Constantly move the flask so that the
cross-linking is homogeneous. Stop the vacuum infiltration
when the whole sheet is observed to be translucent (see Note 2).
2. Immediately stop cross-linking by adding 3.3 mL of 2 M gly-
cine (to final concentration of 0.125 M). Apply vacuum for 5
more minutes at room temperature by constantly moving the
Büchner flask.
3.2 Nuclei Isolation 1. Remove the cross-linking solution, and wash the tissue three
and Chromatin times with sterile water until all cross-linking buffer and gly-
Shearing cine residues are removed. Remove excess water from tissue
with sterile paper towels, and then freeze with liquid nitrogen.
In this step, cross-linked tissue can be stored at −80 °C for
several months until use (see Note 3).
2. Grind the sample to a fine power with liquid nitrogen using a
prechilled mortar and pestle. Prevent sample from thawing
during grinding. Collect the fine power in a prechilled 50 mL

Falcon tube.
3. After completion, add 20 mL of cold nuclei isolation buffer.
Move the tube with gentle movements till the solution is
homogenous, and incubate on ice for 15 min. Filter the
solution through four layers of sterile cheesecloth into a new
prechilled centrifuge Sorvall tube. After this step the sample
is always kept on ice.
4. Centrifuge the solution at 14,500 × g for 20 min at 4 °C.
5. Gently remove the supernatant, and resuspend the white pellet
(the pellet may have a slightly green pigmentation) in 3 mL of
cold nuclei lysis buffer (see Note 4).
Transfer 10 μL of this sample into a new Eppendorf centrifuge
tube, and store at −20 °C. This sample will be used for the com-
parison of extracted chromatin and chromatin shearing.
6. Divide the sample in aliquots of 600 μL into 1.5-mL Eppendorf
centrifuge tubes. Sonicate each sample (see Note 5). We use
the following conditions: five cycles with 20% amplitude and
pulsations of 5 s with intervals of 59 s using an ultrasonic pro-
cessor (see Note 6). The size of DNA sheared must be around
200–1000 pb. In an efficient sonication, the smear will be
around ~500 pb (Fig. 3).
Set aside 10 μL from the sample to compare the sonicated
chromatin with the extracted chromatin from step 5.
Check the sonication efficiency using 10 μL of the sample from
the extracted chromatin and 10 μL of sample from the shearing
chromatin. Mix the samples with 1 μL of loading buffer, and load
on a 1.5% agarose gel supplemented with 0.3 μL of Gelred®. Run
the electrophoresis at 80 V for 60 min. Visualize the resolved DNA
fragments in a UV transilluminator. Use a DNA ladder to estimate
the sizes of the shearing chromatin (Fig. 3) (see Notes 6 and 7).
7. Once the sonication conditions have been established, centri-
fuge the tubes at 18,000 × g for 10 min at 4 °C to remove the
debris. Transfer the supernatant to a new 2-mL Eppendorf
centrifuge tube (see Note 8).
Reserve 100 μL of sonicated chromatin for each sample and
store it at −20 °C. This sample is the input or the starting material
and is used to determine the quality and quantity of the DNA
present in the samples for the PCR analysis. This sample is incor-
porated again in step 5 of Subheading 3.4.
3.3 Preclearing 1. Take 100 μL of the sonicated chromatin, and dilute tenfold
with ChiP dilution buffer (see Note 9).
It is also important to include a negative control, using the
same chromatin without antibody (−Ab). After this step, you will
have two tubes for each sample.
Fig. 3 Sonicated chromatin using an ultrasonic processor (Model VCX-130). Ten

microliter of the sample was loaded onto a 1.5% agarose gel. After five cycles of
sonication, most of the fragments are between 200 and 1000 bp with an accu-
mulation at ~500 bp. (1) HyperLadder I, (2) extracted chromatin, and (3) shearing
chromatin with five cycles of sonication
2. To reduce non-specific background, preclear the 1 mL of

diluted chromatin by adding 50 μL of pre-equilibrated Salmon
Sperm DNA/Protein A agarose beads and rotating gently for
2 h at 4 °C (see Note 10).
3. Centrifuge the tubes at 850 × g and 4 °C for 2 min. Recover the
supernatants in a new Eppendorf centrifuge tube, and leave the
beads in the tube, and keep on ice. Keep the −Ab tube over-
night at 4 °C and then proceed to step 2 of Subheading 3.4.
3.4 Immunopre- 1. Add 5 μL of antibody (H3K4me3 or H3K27me3) to the

cipitation supernatant fraction of the other tube, and incubate overnight
(12–15 h) at 4 °C with gentle rotation (see Note 11).
2. After this step the −Ab tube is incorporated, subjecting it to
the same procedure as the tube with the antibody. Add 70 μL
of pre-equilibrated Salmon Sperm DNA/Protein A agarose
beads to each tube, and incubate for 1.5 h at 4 °C with gentle
rotation (see Note 10). In this step, the tube with the antibody
has already formed the Protein A/antibody/histone/DNA
complex.
3. To pellet the Protein A/antibody/histone/DNA complex,

centrifuge at 850 × g and 4 °C for 2 min.
4. Carefully remove the supernatant, and proceed to wash the
Protein A/antibody/histone/DNA complex for 5 min with
gentle rotation using 1 mL of each freshly prepared buffer in
the order listed below:
(a) Wash once with low-salt wash buffer.
(b) Wash once with high-salt wash buffer.
(c) Wash once with LiCl wash buffer.
(d) Wash twice with 1× TE buffer.
Preferably use cold buffers. Carefully pipette all wash buffer,
avoiding removing the agarose beads. For each wash, pellet the
Protein A/antibody/histone/DNA complex by centrifuging at
850 × g and 4 °C for 2 min.
5. After washing, remove all liquid, and elute the immune com-
plex from the antibody by adding 250 μL of elution buffer
prepared fresh. Incubate for 15 min with gentle rotation at
room temperature. Centrifuge the sample at 850 × g and 4 °C
for 2 min, and recover the supernatant in a new Eppendorf
centrifuge tube of 1.5 mL. Repeat this step, and combine the
eluents to obtain a final volume of ~500 μL.
In this step include the input set aside in the step 7 of
Subheading 3.2, and add 400 μL of elution buffer. From this step,
the input tube is subjected to the same procedure as the tubes with
and without the antibody.
3.5 Reverse 1. To reverse the DNA-histone cross-link, add 20 μL of 5 M of

Cross-Linking NaOH (4 μL per 100 μL of sample), and incubate for 4 h at
65 °C or overnight.
2. Add 1 μL of RNase A to the samples and incubate at 37 °C for
30 min. This step serves to eliminate RNA contamination
within the sample.
3. After that, add 10 μL of 0.5 M EDTA, 20 μL 1 M Tris–HCl
pH 6.5, and 1 μL of proteinase K (20 mg mL−1), and incubate
at 45 °C for 2 h. This step serves to digest the associated
proteins.
3.6 DNA 1. For DNA precipitation use one volume of phenol/chloro-

Precipitation and PCR form/isoamyl alcohol (25:24:1 (v/v)) per sample volume, mix
Analysis with vortex, and centrifuge at 18,000 × g and 4 °C for 15 min.
2. Carefully remove the upper aqueous phase (~450 μL), and
transfer it into a new Eppendorf centrifuge tube of 2 mL. Add
the following reagents per sample volume: 1/10 volume of
3 M sodium acetate pH 5.2, 4.5 μL of glycogen (use 1 μg of
glycogen per 20 μL of sample solution), and 2.5 volume of

100% ethanol.
3. Incubate at −80 °C for 2 h or overnight at −20 °C.
4. Centrifuge at 18,000 × g and 4 °C for 15 min. Discard the
supernatant.
5. Wash the pellet with 1 mL of 70% ethanol, and centrifuge at
18,000 × g and 4 °C for 10 min. Remove the supernatant, and
air-dry the pellet at room temperature (30–40 min).
6. Dissolve the pellet with 20 μL of 1× TE, and store at −80 °C
until its use.
7. The PCR reactions should be performed using specific primers
for ubiquitin (UBI11) as a control gene, phosphoenolpyruvate
carboxylase (PEPCase), ribulose-1,5-bisphosphate carboxyl-
ase/oxygenase small subunit (RubS), and β-lycopene cyclase
(LCYβ) genes (Table 1). Each reaction contains 40 ng μL−1 of
template, 1.25 μL of 10× DreamTaq buffer, 0.25 μL of dNTP
mix (10 mM), 0.25 μL of forward primer (5 mM), 0.25 μL
reverse primer (5 mM), and 0.075 μL of DreamTaq DNA
polymerase (0.375 U); the whole is adjusted with water to a
final volume of 12.5 μL. The amplification program for UBI11,
PEPCase, RubS, and β-LCY is initial denaturation at 95 °C for
4 min, followed by denaturation at 95 °C for 40 s, an anneal-
ing temperature for each gene (Table 1; Fig. 4) for 40 s, and
an amplification at 72 °C for 2 min with a final extension at
72 °C for 10 min. The program should be run for 40 cycles (see
Note 12).
Table 1
Sequences of the primers used for the PCR analysis of the ChiP assay
Primer sequence
Gene (5′ → 3′) Tm (°C) Approximate size (bp)
UBI11 Forward: GACGGGCGCCAACCTTGCGGATTAC 62 150
Reverse: TCCTGGATCTTCGCCTTGACATTG
PEPCase Forward: TCAGCCACCAGACACAATC 60 197
Reverse: CCACAACAGCCATCTCATC
RubS Forward: TTACCTCCCTCCCTTGTC 55 310
Reverse: GCTCCTTCACAACCTGG
LCYβ Forward: TGAGGCCATGGACCTTTTAG 55 290
Reverse: CCACTTGATATCCGGGATTG
Fig. 4 PCR analysis of the ChiP assay performed using chromatin from young leaves of A. angustifolia and
specific antibodies against trimethylated Lys 4 of histone H3 and trimethylated Lys 27 of histone H3. Purified
DNA was analyzed by the amplification of the gene body of ubiquitin (UBI11), phosphoenolpyruvate carboxyl-
ase (PEPCase), ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (RubS), and β-lycopene
cyclase (LCYβ) genes. Ubiquitin is used as a positive control and carries the trimethylation of Lys 4 histone H3.
Input or positive control, genomic DNA; −Ab or negative control, no antibody; H3K4me3, immunoprecipited
chromatin with anti-Histone H3 (trimethyl K4) antibody; and H3K27me3, immunoprecipited chromatin with
anti-histone H3 (trimethyl K27) antibody
4 Notes
1. Caution: formaldehyde is very toxic and can cause corrosion

to the skin and eyes; inhalation may damage the respiratory
tract.
2. Vacuum infiltration helps formaldehyde penetrate inside the
plant tissue. This step is critical: a longer duration of vacuum
infiltration can decrease the chromatin shearing and the cross-
linking reversal, while a short duration generates an inefficient
cross-linking. In both cases ChiP efficiency is affected. The
time of cross-linking varies depending on the type of tissue
used. Preferably use healthy young tissue. In our experience,
less cross-linking time is needed for young tissues. Ten min-
utes of vacuum infiltration is sufficient for the cross-linking of
Agave plantlets 2 cm in height. Also, tissue dissection helps
formaldehyde penetrate the cell more quickly and reduces
fixation time.
3. It is important to remove excess water before freezing because
the ice reduces the grinding efficiency.
4. Use a proportional volume of the nuclei lysis buffer to the
amount of tissue used. For example, use 1.5 mL of cold nuclei
lysis buffer for 1 g of tissue. For quantities less than 0.5 g of
tissue, resuspend the pellet in 600 μL of nucleic lysis buffer.
This is to facilitate the sonication of the sample.
5. Sonication is the most critical step of the ChiP. The optimal

chromatin fragmentation can be reached empirically by testing
various sonication conditions. Always keep the sample on ice
to avoid heating; if the sample is heated, the proteins will
denature. You can also add ethanol to the ice to keep the sam-
ples cooler. Submerge the tip of the probe, but avoid touching
the bottom and sides of the tube; this prevents foaming, which
reduces the efficiency of sonication. Do not proceed with the
following ChiP steps until you optimize the sonication step.
6. The sonication conditions depend on the type of tissue and
the type of sonicator. We recommend not using a high power
in combination with several pulses to avoid heating and the
formation of bubbles. Preferably use an interval of 1 min in
each sonication cycle to prevent the sample from being heated.
7. The sonication efficiency can also be evaluated by incubating
100 μL of the sonicate chromatin with 4 μL of 5 M NaOH at
65 °C for 4 h or overnight, followed by DNA precipitation with
phenol/chloroform/isoamyl alcohol (25:24:1 (v/v)) (from step
21 to the end). Run 5 μL of the sample on a 1.5% agarose gel to
visualize the efficiency of sonication (as described in step 7).
8. Sonicated chromatin can be stored at −80 °C for at least a few
months, but avoid freezing and thawing samples multiple times.
9. It is also important to include a negative control, using the
same chromatin without antibody (−Ab). After this step, you
will have two tubes for each sample.
10. The pre-equilibration of the Salmon Sperm DNA/Protein A
agarose beads is performed by taking the specified volume of
the agarose beads and placing it in an Eppendorf centrifuge
tube of 1.5 mL, after which 100 μL of nuclear lysis buffer is
added and then incubated with gentle agitation for 1 min at
4 °C. Then centrifuge at 100 × g and 4 °C for 1 min, discard
the supernatant carefully, and repeat the whole procedure
once again. At the end, resuspend the agarose beads with
nuclear lysis buffer using the initial volume.
11. We recommend incubating with the antibody overnight for
better results.
12. We recommend performing the PCR reactions as soon as pos-
sible with the purified DNA to avoid loss of DNA quality. The
amount of purified DNA depends on the abundance in the
sample of the protein that is immunoprecipitated. In general,
we perform 10–15 PCR reactions per immunoprecipitated
sample. The PCR program is established empirically for each
chromatin region to be analyzed as well as the amount of
DNA to be used for PCR reaction. The pair of primers used
should be designed to amplify smaller sizes than sonicated
chromatin. In our case and for PCR, we use primers that
amplify sizes smaller than 500 bp.
Acknowledgments
The work from CDLP laboratory was supported by a grant

(CONACyT, 1515).
References
1. Vaquero A, Loyola A, Reinberg D (2003) The ations in the human genome. Cell 129:823–
constantly changing face of chromatin. Sci 837. https://doi.org/10.1016/j.
Aging Knowl Environ 2003:Re4. https://doi. cell.2007.05.009
org/10.1126/sageke.2003.14.re4 9. Huebert DJ, Kamal M, O’Donovan A,
2. Margueron R, Reinberg D (2010) Chromatin Bernstein BE (2006) Genome-wide analysis of
structure and the inheritance of epigenetic histone modifications by ChIP-on- chip.
information. Nat Rev Genet 11:285–296. Methods 40:365–369. https://doi.
https://doi.org/10.1038/nrg2752 org/10.1016/j.ymeth.2006.07.032
3. Pfluger J, Wagner D (2007) Histone modifica- 10. Núñez Noriega L (2001) La producción de
tions and dynamic regulation of genome acces- mezcal bacanora: una oportunidad económica
sibility in plants. Curr Opin Plant Biol para Sonora. Centro de Investigación en
10:645–652. https://doi.org/10.1016/j. Alimentación y Desarrollo, Hermosillo, Sonora
pbi.2007.07.013 11. Saleh A, Alvarez-Venegas R, Avramova Z
4. Luger K, Mader AW, Richmond RK et al (2008) An efficient chromatin immunoprecipi-
(1997) Crystal structure of the nucleosome tation (ChIP) protocol for studying histone
core particle at 2.8 Å resolution. Nature modifications in Arabidopsis plants. Nat Protoc
389:251–260. https://doi. 3:1018–1025. https://doi.org/10.1038/
org/10.1038/38444 nprot.2008.66
5. Cosgrove MS, Wolberger C (2005) How does 12. De-La-Peña C, Nic-Can G, Ojeda G et al
the histone code work? Biochem Cell Biol (2012) KNOX1 is expressed and epigenetically
83:468–476. https://doi.org/10.1139/ regulated during in vitro conditions in Agave
o05-137 spp. BMC Plant Biol 12:203. https://doi.
6. Bannister AJ, Kouzarides T (2011) Regulation org/10.1186/1471-2229-12-203
of chromatin by histone modifications. Cell 13. Murashige T, Skoog F (1962) A revised
Res 21:381–395. https://doi.org/10.1038/ medium for rapid growth and bio assays with
cr.2011.22 tobacco tissue cultures. Physiol Plant 15:473–
7. Zhang K, Sridhar VV, Zhu J et al (2007) 497. https://doi.
Distinctive core histone post-translational org/10.1111/j.1399-3054.1962.tb08052.x
modification patterns in Arabidopsis thaliana. 14. Robert ML, Herrera-Herrera JL, Castillo E
PLoS One 2:e1210. https://doi. et al (2006) An efficient method for the micro-
org/10.1371/journal.pone.0001210 propagation of Agave species. Methods Mol
8. Barski A, Cuddapah S, Cui K et al (2007) Biol 318:165–178. https://doi.
High- resolution profiling of histone methyl- org/10.1385/1-59259-959-1:165
Chapter 27
Transcription Factors: Their Role in the Regulation

of Somatic Embryogenesis in Theobroma cacao L.
and Other Species
Claudia Garcia, Dahyana Britto, and Jean-Philippe Marelli
Abstract
Transcription factors are proteins that help with the control and regulation in the transcription of the DNA
to mRNA by binding to special DNA sequences. With the aim to understand more about gene transcrip-
tion regulation in Theobroma cacao L., this review outlines the principal transcription factors that were
reported in other plants especially Arabidopsis thaliana and attempts at looking for the homologies with
transcription factors in T. cacao. The information cited in this work is about the initiation, development,
and maturation of the cacao somatic embryos and other crops. It is important to underline that there are
very few publications in T. cacao discussing transcription factors that control the somatic embryogenesis
process, but there is some information about transcription factors in other crops that we have used as a
guide to try to understand this process.
Key words Cacao, LEC1, ABI3, LEC2, Somatic embryogenesis, Transcription factors
1 Introduction
Theobroma cacao L. (cacao) is a tropical tree that grows naturally in

the rain forest of the Amazon and in the Orinoco Valleys, where it
has been identified to be its origin [1]. After being harvested and
postharvested, cocoa is the main ingredient for chocolate, as well
as cocoa butter, which is extracted and used in chocolate prepara-
tion and in the cosmetic industry. In addition, cocoa flavanols are
promissory products because they are natural antioxidants and are
shown to contribute to human health (e.g., cardiovascular health)
[2]. This crop supports the income for numerous smallholders
(almost 70% of the cacao beans supplied to the world currently
comes from small farms in West Africa) and also makes part of the
chocolate business [3, 4]. Therefore, it has an important social and
economic impact in the world.
A lot of the existing cacao plantations are old and unproduc-
tive, and some of the varieties or genotypes that are highly productive
385
in the field are susceptible to pest and diseases [5]. One of the ways
to increase productivity is to replace the old trees via traditional
techniques, such as grafting and rooted cuttings. Micropropagation
through somatic embryogenesis (SE) is another alternative.
Cacao propagation via SE has been developed since 1958, but
there are still a lot of details in the technique that require improve-
ments [6]. SE in T. cacao is still a challenge for plant production
commercially because cacao is a recalcitrant plant when submitted
to tissue culture. Many SE protocols have yielded good results, but
the rate of production of the primary embryos is very poor or
absent [7–11]. The main bottlenecks that need to be resolved are
(1) lower or no production of primary embryos in some geno-
types, (2) embryos with abnormal morphologies that induce poor
maturation and germination, and, as a consequence, (3) the low
conversion rate of those embryos into plants. Thus, the quality in
the maturation and germination of the somatic embryos as well as
healthy plants (with good morphology) are indicators that the
plants will survive during the acclimation process.
Some explanations for this could be that the whole process is
highly genotype-dependent; there is also the necessity to obtain
embryos from another source of tissue, as well as the necessity to
obtain more information about the physiology, genetics, and
molecular biology of the cacao SE process to try to overcome the
recalcitrance problem. This kind of information still is incipient. In
order to get a higher success rate for this process, the scientific com-
munity needs to obtain more knowledge on how those mechanisms
work and to make a link between all the mechanisms to better
understand their interaction and/or their interferences [11, 12].
Moreover, morphogenesis is a fundamental aspect in the devel-
opmental biology. An organism can develop its structure and form
throughout its entire life. Morphogenesis controls the spatial dis-
tribution of the cells during embryo development, and it plays an
important role in both zygotic and somatic embryos. Hormones,
environmental conditions, and mechanical or chemical stress in
nature stimulate morphogenesis. It can also be stimulated under
artificial conditions (e.g., “in vitro” culture) by the same mecha-
nisms, and this event is a key determinant in the SE process [12].
SE as a morphogenetic event is modulated by a series of cell
intrinsic factors such as transcription factors, chromatin remodel-
ing, small RNAs, DNA methylation or acetylation, and transposable
elements [13]. Morphogenesis is also modulated by extrinsic fac-
tors such as the environment and other biotic or abiotic factors, as
well as the phenology of the donor plant [14]. These factors will act
by modulating cellular activity to a specific development into a spe-
cific direction or by cell reprogramming with the restoration of its
totipotency characteristics. Another important issue in morphogen-
esis is the ability to integrate growth and differentiation mediated
by continued cell division (mitosis in the somatic cells), in which
Transcription Factors in Somatic Embryogenesis 387
several transcription factors are involved. This review presents a

literature study about transcription factors as mediators in the SE
process in some plants (e.g., Arabidopsis thaliana as a model plant)
and especially in T. cacao. To understand better how the transcrip-
tion factors work in SE, we decided to divide this review into
two sections: (1) initiation and development of embryos and (2)
transition to embryo maturation.
2 T ranscription Factors Implicated in the Somatic Embryogenesis Initiation

and Development
The plant kingdom has two different routes of morphogenesis in

higher plants for asexual reproduction (without fusion of the gam-
etes), such as organogenesis and SE. These events may happen
in vitro or in vivo (nature) and are an example of totipotency that
can be exploited for mass propagation of in vitro plants because, in
theory, any cell or tissue in the plant can generate a new plant with
the same genotype as the maternal parent. Somatic embryos can
develop bipolar structures without vascular connection with the
mother tissue. In that case, the embryos produced should be free
of (pathogenic) microorganism contamination [15].
The somatic cells in plants have plasticity. Both single cells (cells
determinate embryonically) or a group of cells that need stimula-
tion for SE expression (cells not determinate embryonically) under
the special culture conditions can regenerate new plants identically
to the mother plant by SE. It is important to mention that there are
two different ways to produce embryos by SE: (1) indirect SE with
previous callus formation and stimulation of the callus to produce
embryos and (2) direct SE, which does not need a previous callus
formation from the mother tissue. In the latter case, the embryos
are produced from the tissue directly, sometimes from the proto-
derm or from the mesophyll layers [16]. During the induction step,
differential gene expression results in the synthesis of new mRNA
and proteins that eventually switch on the new developmental pro-
gram in the cells. The new expression patterns stimulate a cascade
of genetic triggers turning on or off the expression of specific genes
controlled by the transcription factors [17]. By definition, tran-
scription factors are proteins that can control the transcription of
the genetic information from DNA to mRNA, by binding to spe-
cific domains of DNA sequence, which can be DNA enhancer (reg-
ulatory) or promoter sequences. In this way TF can stimulate or
repress transcription of particular genes [17].
Cells not determinated embryonically need to be stimulated by
stressor agents such as 2,4-dichlorophenoxyacetic acid (2,4-D).
2,4-D is the most used stressor agent for stimulation of SE in a
diversity of plants, and there is a relation between the concentra-
tion of the 2,4-D and the level of stress in the tissue. If the stress
level exceeds cellular tolerance (for the growth regulators outside

and inside), the cells might die [18]. In addition, 2,4-D is a potent
synthetic auxin that in high concentrations might cause unwanted
somaclonal variation [19]. When the tissue is submitted to stress
treatment, the activity of mitogen-activated protein kinases
(MAPK) can promote the transcription factors to activate the
phosphorylation cascades that link oxidative stress responses to
auxin signaling, cell cycle regulation, and growth control in eukary-
otes. This means that if the cell after the treatment with the stressor
is still alive, the cell is probably adapted for the new program
expression, which in this case will be SE [18].
Currently, it is necessary to look for other stress sources to
avoid somaclonal variations or mutations. For SE to happen, it is
necessary to turn off the old gene expression program and to stim-
ulate a new DNA program to express the SE and to start the devel-
opment of a new morphogenic program. Besides differential gene
expression, there are various signal transduction pathways for acti-
vation or repression of numerous gene sets that are not yet identi-
fied, and most of them are mediated by transcription factors [13].
The SOMATIC EMBRYOGENESIS RECEPTOR KINASE
(SERK) gene has been identified as a potential candidate gene in SE
induction. Numerous investigations mentioned that this gene was
identified in Daucus carota competent cell cultures expressed in vac-
uolated cells [20]. In addition, the SERK gene is expressed during
the early stage of SE, such as the globular stage, and in embryo
development. Gene homologues were reported in SE initiation in
several studies such as A. thaliana (AtSERK1), Cocos nucifera
(CnSERK), Citrus unshiu (CuSERK1), Dactylis glomerata
(DgSERK), Helianthus annuus (HaSERK), Medicago truncatula
(MtSERK), Oryza sativa (OsSERK), Solanum tuberosum (StSERK1),
T. cacao (TcSERK), Triticum aestivum (TaSERK), and Vitis vinifera
(VvSERK) [21]. When this gene was overexpressed, it led to three-
or fourfold increase in the embryogenic competence [20].
In the Daucus carota and Arabidopsis investigations, when
SERK is overexpressed at the cell surface, it can recognize the
molecular signals that intermediate the binding to extracellular pro-
teins in the LRR regions of the SERK protein. SERK binding
induces a signaling cascade inside the cell that includes components
of the brassinosteroid signaling pathway such as
BRASSINOSTEROID-INSENSITIVE 1 (BRI1) and its co-receptor
BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1)/SERK3
[22]. These signals can identify different targets and mediate molec-
ular alterations via chromatin remodeling to enhance the expression
of genes in the early stages of SE [e.g., Leafy Cotyledon (LEC) and
Baby Boom (BBM)] leading the cells or tissue to embryogenesis
transition [20, 22]. As mentioned before, SERK mediates response
of varied gene expression patterns, and it is probably the key for
somatic cells to become somatic embryos as a transition in the SE
process [21]. In cacao, TcSERK is a functional gene that plays an

important role during cacao embryogenesis, mainly in competent
callus for SE and in somatic embryos in globular stage if repetitive
cultures are maintained in the same medium [23]. This medium is
usually the primary callus growth (PCG) medium [20, 22].
Although SE initiation has been studied in different plants, the
biology of the process is still not clear, and therefore it becomes an
empiric investigation. Some publications have reported the interac-
tion of housekeeping genes (including potential transcription
factors) that are in constant activity in cell division and cell wall
formation at the various stages of embryo initiation and differentia-
tion [19]. Doubts exist on how a differentiated cell can acquire
totipotency and become a stem cell with the capacity of producing
a new individual. Another question is why the totipotent or embryo-
genic cells are restricted to some tissues such as explants, cells, and
genotypes when submitted to in vitro conditions. In the initiation
step of SE, there are two details of foremost importance: recalci-
trant genotypes and a proper explant selection. This can be resolved,
in part, by optimizing growth conditions, but not in all of the cases
[17]. In contrast, apomixis occurs in some plants that have capacity
of producing embryos (e.g., Kalanchoë, Bryophyllum). These plants
can generate easily new plants with apex shoot and roots.
The transcription factors regulate numerous genes (up- or
downregulation) that are important in the SE initiation process.
For example, during the alfalfa SE initiation stage, there are two
histone-coding genes, H3-1 and H3-11, which are specifically acti-
vated in culture conditions by auxin treatments. Most likely, the
H3-1 and H3-11 are enhancing the transcription of some SE genes
by reorganization of the chromatin, allowing RNA transcription
specifically for SE [15]. SE also requires auxin for the establish-
ment of the shoot apical meristem (SAM) that is mediated by the
homeodomain transcription factor WUSCHEL (WUS), which is
essential for stem cell initiation and at the same time for flowering
and meristem maintenance [24]. It is possible that WUS plays an
important role in the generation of the stem cells for SE initiation.
The WUS transcription, by itself, is regulated by the CLAVATA
signaling pathway receptors [24].
In Arabidopsis, BABY BOOM (BBM) is a member of the AP2
family of transcription factors, and at the same time, AP2 is part of
AP2/ERF superfamily. BBM can induce somatic embryo forma-
tion without plant growth regulators. In cacao, the expression of
TcBBM gene in somatic embryos was high during embryo develop-
ment and comparable with the TcBBM expression in zygotic
embryos [25]. When TcBBM is overexpressed in somatic tissue, the
explants generate embryos in an accelerated quantity, but the
embryos are maintained at the globular stage. In contrast, when
this gene is expressed in moderate levels, the production of embryos
is acceptable, and they acquire globular, heart, and torpedo stages.
TcBBM overexpression appears to inhibit subsequent embryo

development [25].
Another transcription factors from the AP2 family are
GmBBM1, GmAIL5, and GmPLT2 that were found in SE cultures
of soybean (Glycine max L.). GmAIL5 and GmPLT2 were homol-
ogous to Arabidopsis AINTEGUMENTA-like5 (AIL5) and
PLETHORA2 (PLT2), respectively [26]. These particular tran-
scription factors are involved in maintenance of stem cell division
during the initiation of embryogenic callus, and AP2 oversees the
maintenance of the stem cell niche of the shoot meristem. All
the members of the transcription factor family mentioned before
function in diverse processes such as plant growth, reproduction,
and environmental interactions [26]. In addition, it is important to
mention that PLETHORA (PLT1 and PLT2), which control root
stem cells and maintenance, functions redundantly with BBM
and PLT3/AIL6 in root meristem and embryo differentiation.
Moreover, AINTEGUMENTA-like (AIL) genes are involved in
division-competent state of the cells [26].
When a WUS-related gene, PLANT GROWTH ACTIVATOR
(PGA), is overexpressed, it induces high-frequency SE in tissues
from Arabidopsis or other vegetal materials in a hormone-
independent way [27]. The suggestion is that the WUS/PGA gene
modulates SE by promotion of the embryogenic transition of
somatic cells or in the maintenance of the embryogenic compe-
tence in the cells [27]. Although the regulation of WUS expression
by auxin during SE is poorly understood, the establishment of
auxin gradients is correlated with its expression. The auxin gradi-
ents also appear to activate PIN1 family genes for polar localization
within the embryonic callus. This could indicate that the establish-
ment of auxin gradients and PIN1-mediated polar auxin transport
are important for WUS induction and for SE [28].
PIN-FORMED (PIN) is a family of plant-specific transmembrane
proteins that transport the plant signal molecules (phytohormones,
especially auxin) as their substrate. The cell-to-cell polar transport of
auxin is mediated by PIN influx and efflux carrier proteins, and it is
very important in the critical control of the development process [29].
In Arabidopsis, there are eight members of the PIN gene family
(AtPIN1 to AtPIN8). Each member has a tissue-specific expression
pattern, and the efflux and influx are asymmetrically localized, as well
as the transport of the auxin in the cells. When PIN1 is mutated, the
endogenous auxin gradient fails, leading to the abnormal formation
development of shoots, roots, embryos, and inflorescence [29].
When SE is activated in the plant competent cells, the
EUKARYOTIC ELONGATION FACTOR 1 COMPLEX (CEM1)
and CEM6 transcripts are detected when the cells are either in
mitosis, in division forming the globular and heart stage, and in the
new protein synthesis for housekeeping genes in the cell [30]. The
CEM6 cDNA encodes a glycine-rich protein containing hydropho-
bic signal sequences like domain, which stimulates the early

embryo-specific expression and plays an important role as a cell
wall protein in embryogenesis [17, 18]. Other genes such as the
DNA topoisomerase I encode a key enzyme that is involved in the
cellular cycle, and high quantity of this enzyme is detected at the
torpedo stage of somatic embryos in carrots [31]. This accumula-
tion of the reported topoisomerase shows that a reprogramming of
gene expression occurs at the transition from globular to more
mature embryo forms. At that stage, both division and differentia-
tion events give rise to the tissues and organs of the future adult
plant [31]. Other genes identified in early events of morphogenesis
in SE of Zea mays are globulins GLB102, GLB103, and GLB201.
Transcript levels for GLB102 and GLB201 increase during the early
stages of SE. These proteins are regulated by abscisic acid [32].
Another key enzyme involved in the endogenous auxin biosyn-
thesis at the embryos is the YUCCA (YUC) family, required for
establishing the basal part of the embryo [33]. Induction of YUC
mutation (yuc1, yuc4, yuc10, and yuc11) impaired the local auxin
distribution and resulted in embryos with severe developmental
abnormalities such as the absence of hypocotyl or root meristem.
These results resemble those of the mutations of PIN genes, indi-
cating that the presence of auxin biosynthesis or polar transport is
required for normal development of somatic embryos [33].
Meanwhile in Arabidopsis, ethylene biosynthesis decreases during
the production of somatic embryos (because in high ethylene pre-
cursor concentration, SE is inhibited), whereas in other cultures like
Medicago truncatula, ethylene promotes SE formation [34, 35].
In Medicago truncatula the transcription profile of embryo-
genic callus produced from mesophyll protoplasts indicates upreg-
ulation of the ethylene biosynthesis, showing that this
phytohormone is necessary for SE in this species. The AP2/ERF
superfamily and ERF subfamily of transcription factors play an
important role in this species. M. truncatula SOMATIC EMBRYO
RELATED FACTOR1 (MtSERF1) is induced by ethylene and is
expressed in callus formation and in globular somatic embryos
[35], but in Arabidopsis, a strong inhibition of the ERF022 gene of
the ERF family is associated with induction of SE. The results sug-
gest that this gene may control the 1-aminocyclopropane-1-
carboxylate synthase 7 (ACS7) gene involved in the biosynthesis of
ethylene and the ERF1 and ETR1 genes, which participate in eth-
ylene signaling. The negative impact of ethylene on the induction
of SE in Arabidopsis is probably due to its role on the modulation
of auxin-related genes that control the embryogenic transition in
somatic cells [36]. ERF022 interacts with the LEAFY
COTYLEDON2 (LEC2) gene, and it is possible that they both
are involved in the auxin-ethylene crosstalk that operates in SE
induction in Arabidopsis [36].
LEC1 as well as BBM1 also plays an important role in the

initiation of SE and subsequent development. In Arabidopsis,
LEC1 is an important regulator of embryo development that acti-
vates the gene transcription required for both embryo morpho-
genesis and cellular differentiation. Besides, LEC1 and LEAFY
COTYLEDON 1-LIKE (L1L) encode homologues of the Heme-
Activated Proteins 3 (HAP3) subunit of the CCAAT-box-binding
factor. In consequence, LEC1 and L1L are thought to be key tran-
scription factors in the regulation of somatic embryo development
until cotyledon stage in Arabidopsis and L1L is required for normal
embryo development [12]. LEC1 has also been known as a regula-
tor of expression of ABI3 and FUS3 [37]. TcL1L, found in the
cacao genome, is expressed in young immature somatic embryos,
but not in mature embryos [38].
3 T ranscription Factors Implicated in the Somatic Embryogenesis Transition

to Maturation
The transition from embryo induction to development and matu-

ration shares some transcription factors, but they work in different
ways. LEC is a member of the nuclear factor Y (NF-Y) family of
transcription factors and is part of a large family of B3 domain-
containing proteins involved in a wide variety of functions, which
includes LEC1, LEC2, and FUS3. During the initiation process,
LEC is important to maintain the SE expression and to produce
globular embryos, but it also functions in the formation of the
suspensor and to specify the identity of cotyledons. In the late
stage of the embryogenesis, LEC functions in maturation, including
the acquisition of desiccation tolerance and the accumulation of
storage reserves [39].
In Arabidopsis, as well as in cacao, LEC2 mediates activation
of the YUC pathway of auxin biosynthesis, since a significant
increase of indole-3-acetic acid content was demonstrated in
explant tissue that was undergoing embryogenic transition [40].
LEC2 is expressed in developing zygotic embryos during the
early and late stages in Arabidopsis. At the same time, it plays a
role in the maintenance of the suspensor and cotyledons and for
desiccation tolerance to inhibit a premature germination.
Mutated lec2 zygotic embryos grow with abnormal suspensor
anatomy and abnormal cotyledons with trichomes. The activa-
tion of the shoot apical meristem is precocious, and the embryos
have highly pigmented cotyledons with prominent anthocyanin
accumulation and show a reduced accumulation of seed storage
compounds [41].
LEC2 can lead a cascade effect over other transcription factors
that can control different developmental stages or/and different
metabolic pathways in the cells. LEC2 can also turn on or turn off
other genes in a direct or indirect way. For example, WRINKLED1

(AtWRI1) is another key transcription factor crucial to embryo
development. It is a direct target of AtLEC2 that is necessary to
regulate normal fatty acid biosynthesis. On the other hand,
TcLEC2 is targeted by 2,4-D in SE. The exogenous application of
auxins, such as 2,4-D, or/and cytokinins are necessary to induce
SE. In cacao, TcLEC2 is upregulated during the induction stage
when 2,4-D is applied exogenously [41, 42].
In addition, overexpression of AtLEC2 in transgenic immature
zygotic embryos can induce direct SE, with low callus formation
and without hormone applications. In the Arabidopsis genome, 87
genes were previously annotated as B3 domain and were classified
into five different families, such as auxin response factor (ARF),
abscisic acid-insensitive 3 (ABI3), and ABI3-VP1 (RAV) in repro-
ductive meristems [42]. In tobacco, LEC2 is responsible for some
of the mechanisms in SE. Ectopic expression of LEC2 induces the
accumulation of embryo-specific proteins such as seed storage pro-
teins, late embryogenesis abundant (LEA) proteins, fatty acid bio-
synthetic enzymes, products of steroid biosynthesis-related genes,
and key regulatory genes of the embryo development [43].
In T. cacao, three families in the B3 domain have been identi-
fied, such as HIS, ABI3, and RAV [42]. These cacao gene clusters
have similarities with the Arabidopsis ABI3 subfamily. Comparing
the sequences between both A. thaliana and T. cacao (Criollo gen-
otype B97-61/B2), three cacao genes that were identified as
Tc04g004970, Tc01g024700, and Tc06g015590 are orthologues in
Arabidopsis for AtFUS3, AtABI3, and AtLEC2, respectively. In
particular, TcLEC2 and AtLEC2 strongly indicate functional
similarities. TcLEC2 acts in the overexpression of AGL15 and

WRI1 genes in cacao SE too [41].
In T. cacao several transcription factors that play an important
role in maturation comparing somatic embryos with zygotic
embryos were reported in a genome-wide analysis. TcLEC1,
TcLEC2, TcWRI1, TcAGL15, and TcFUS3 show a dramatically
increased expression values in mature somatic embryos compared
with mature zygotic embryos. Expression of those genes is higher
in the mature stage of both zygotic and somatic embryos when
they are compared with the less mature torpedo stage of both types
of embryos [40]. In addition, constitutive expression of TcAGL15
enhances competence of somatic embryo formation from the shoot
apical meristems, and TcWRI1, besides being involved in embryo
development, is also implicated in the regulation of fatty acid
biosynthesis [40].
Other genes that are expressed differently between zygotic and
somatic embryos are TcBBM and TcABI5, which show a slight
decrease in expression from the torpedo stage until the mature stage
in zygotic embryos, while the expression of those same genes is
higher in both torpedo and mature stage of somatic embryos [40].
The same genome-wide analysis shows the importance of eth-

ylene during the SE process in cacao [40]. Twenty-six transcrip-
tion factors in the ethylene metabolism and ethylene response were
reported. Nineteen of those transcription factors exhibit higher
expression levels in somatic embryos compared with zygotic
embryos. Those genes belong to the ERF/AP2 family, which con-
trol the synthesis of proteins implicated in physiological and devel-
opmental responses [40, 41]. Ethylene, as stress response hormone
in plants, and its accumulation in the culture system, affects embryo
development. The TcEIN3-binding F-box protein 1, (TcEBF1,
Tc09g011440), TcETHYLENE INSENSITIVE 3 (TcEIN3,
Tc09g033150), and TcIndole-3-acetate beta-glucosyltransferase 2
(TcUGT1, Tc02g020270) are expressed in the ethylene signaling
pathways [40, 41]. Probably, the ethylene signaling pathway is
upregulated in cacao somatic embryos.
Complementing the importance of ethylene in SE, in the same
work, the authors explain how ethylene is also involved in the
upregulation of flavanol biosynthesis incrementing the expression
of genes involved in flavonoid biosynthesis in cacao somatic
embryos relative to zygotic embryos. These flavanols are associated
with stress responses and controlling growth and development
when the tissue (for SE) is exposed to auxin hormones, confirming
the existence of the modulation of auxin response with interaction
by stress between auxins and ethylene levels in the cultures [40].
4 Conclusion
In summary, there are many transcription factors identified in the

model plant Arabidopsis thaliana that can help us to understand
the landscape of the gene expression regulation in SE in T. cacao.
The identification of transcription factors in cacao is poorly under-
stood, and it is important to investigate more in depth what are the
mechanisms inside the cacao somatic cell and how the transcription
factors regulate the SE process. The role that ethylene plays in the
regulation of large numbers of genes involved in cell function is
consistent with the hypothesis that ethylene-mediated stress
response in SE plays a significant role in the abnormal development
of cacao somatic embryos.
References
1. Motamayor JC, Risterucci AM, Lopez PA et al 3. Franzen M, Borgerhoff MM (2007) Ecological,
(2002) Cacao domestication I: the origin of the economic and social perspectives on cocoa
cacao cultivated by the Mayas. Heredity 89:380– production worldwide. Biodivers Conserv
386. https://doi.org/10.1038/sj.hdy.6800156 16:3835–3849. https://doi.org/10.1007/
2. Pucciarelli D (2013) Cocoa and heart health: a s10531-007-9183-5
historical review of the science. Nutrients 5:3854– 4. Motamayor JC, Lachenaud P, da Silva e Mota
3870. https://doi.org/10.3390/nu5103854 JW et al (2008) Geographic and genetic popu-
lation differentiation of the Amazonian choc- from mesophyll cells of Dactylis glomerata. In
olate tree (Theobroma cacao L). PLoS One Vitro Cell Dev Biol-Plant 36:51–56. https://
e3311:3. https://doi.org/10.1371/journal. doi.org/10.1007/s11627-000-0012-8
pone.0003311 17. Fehér A (2005) Why somatic plant cells
5. Turnbull CJ, Hadley P (2017) International start to form embryos? In: Mujib A, Samaj
Cocoa Germplasm Database (ICGD). [Online J (eds) Somatic embryogenesis. Springer,
Database]. CRA Ltd. ICE Futures Europe Berlin, Heidelberg, pp 85–101. https://doi.
University of Reading, UK. httpwww.icgd. org/10.1007/7089_019
reading.ac.uk. Accessed 18 Jan 2017 18. Fehér A, Pasternak TP, Dudits D (2003)
6. Sondahl MR, Laurel MT, Chen Z, et al. (1994) Transition of somatic plant cells to an embryo-
Somatic embryogenesis and plant regeneration genic state. Plant Cell Tissue Org 74:201–228.
of cacao. US5312801 A, 1–22 https://doi.org/10.1023/A:1024033216561
7. Lopez Baez O, Bollon H, Eskes A, Pétiard V 19. Sharma M, Anand SK (2002) Swarming:
(1993) Embryogenèse somatique du cacaoyer a coordinated bacterial activity. Curr Sci
Theobroma cacao L., à partir des pièces flo- 83:707–714
rales. Comptes Rendus Académie Sci Sci Vie 20. Hecht V, Vielle-Calzada J-P, Hartog MV et al
316:579–584 (2001) The Arabidopsis somatic embryogenesis
8. Bajaj YPS (1995) Biotechnology in agricul- receptor kinase 1 gene is expressed in developing
ture and forestry. Somatic embryogenesis ovules and embryos and enhances embryogenic
and synthetic seed I. Springer-Verlag, Berlin, competence in culture. Plant Physiol 127:803–
Heidelberg 816. https://doi.org/10.1104/pp.010324
9. Maximova SN, Alemanno L, Young A et al 21. Pandey DK, Chaudhary B (2014) Role of
(2002) Efficiency, genotypic variability, and cel- plant somatic embryogenesis receptor kinases
lular origin of primary and secondary somatic (serks) in cell-to-embryo transitional activ-
embryogenesis of Theobroma cacao L. In Vitro ity: key at novel assorted structural subunits.
Cell Dev Biol-Plant 38:252–259. https://doi. Am J Plant Sci 05:3177–3193. https://doi.
org/10.1079/IVP2001257 org/10.4236/ajps.2014.521334
10. Tan C, Furtek D (2003) Development of an
22. Albrecht C, Russinova E, Kemmerling
in vitro regeneration system for Theobroma B et al (2008) Arabidopsis SOMATIC
cacao from mature tissues. Plant Sci EMBRYOGENESIS RECEPTOR KINASE
164:407–412. https://doi.org/10.1016/ proteins serve brassinosteroid-dependent
S0168-9452(02)00428-4 and -independent signaling pathways.
11. Garcia C, Corrêa F, Findley S et al (2016) Plant Physiol 148:611–619. https://doi.
Optimization of somatic embryogenesis proce- org/10.1104/pp.108.123216
dure for commercial clones of Theobroma cacao 23. de Oliveira Santos M, Romano E, Yotoko
L. Afr J Biotechnol 15:1936–1951. https:// KSC et al (2005) Characterisation of the cacao
doi.org/10.5897/AJB2016.15513 somatic embryogenesis receptor-like kinase
12. Karami O, Aghavaisi B, Mahmoudi Pour (SERK) gene expressed during somatic embryo-
A (2009) Molecular aspects of somatic-to- genesis. Plant Sci 168:723–729. https://doi.
embryogenic transition in plants. J Chem org/10.1016/j.plantsci.2004.10.004
Biol 2:177–190. https://doi.org/10.1007/ 24. Lee C, Clark SE (2015) A WUSCHEL-
s12154-009-0028-4 independent stem cell specification path-
13. Fehér A (2015) Somatic embryogenesis – stress- way is repressed by PHB, PHV and CNA in
induced remodeling of plant cell fate. Biochim Arabidopsis. PLoS One 10:e0126006. https://
Biophys Acta 1849:385–402. https://doi. doi.org/10.1371/journal.pone.0126006
org/10.1016/j.bbagrm.2014.07.005 25. Florez SL, Erwin RL, Maximova SN et al
14. Issali AE, Traoré A, Ngoran JAK et al (2015) Enhanced somatic embryogenesis
(2009) Relationship between some pheno- in Theobroma cacao using the homologous
logical parameters and somatic embryogen- BABY BOOM transcription factor. BMC
esis in Theobroma cacao L. J Crop Sci Biotech Plant Biol 15:121. https://doi.org/10.1186/
11:23–30 s12870-015-0479-4
15. Estabrooks T, Dong Z (2004) Gene expres- 26. El Ouakfaoui S, Schnell J, Abdeen A et al
sion during indirect somatic embryogenesis (2010) Control of somatic embryogenesis and
of plants. Proc Nova Scotian Inst Sci 42:411– embryo development by AP2 transcription fac-
419. http://hdl.handle.net/10222/70938 tors. Plant Mol Biol 74:313–326. https://doi.
16. Vasilenko A, McDaniel JK, Conger BV (2000) org/10.1007/s11103-010-9674-8
Ultrastructural analyses of somatic embryo ini- 27. Pasternak TP (2002) The role of auxin, pH,
tiation, development and polarity establishment and stress in the activation of embryogenic
cell division in leaf protoplast-derived cells of 36. Nowak K, Wójcikowska B, Gaj MD (2015)
alfalfa. Plant Physiol 129:1807–1819. https:// ERF022 impacts the induction of somatic
doi.org/10.1104/pp.000810 embryogenesis in Arabidopsis through the
28. Su YH, Zhao XY, Liu YB et al (2009) ethylene-related pathway. Planta 241:967–985.
Auxin-induced WUS expression is essen- https://doi.org/10.1007/s00425-014-2225-9
tial for embryonic stem cell renewal dur- 37. Ledwoń A, Gaj MD (2011) LEAFY
ing somatic embryogenesis in Arabidopsis. COTYLEDON1, FUSCA3 expression and
Plant J 59:448–460. https://doi. auxin treatment in relation to somatic embryo-
org/10.1111/j.1365-313X.2009.03880.x genesis induction in Arabidopsis. Plant
29. Křeček P, Skŭpa P, Libus J et al (2009) The Growth Regul 65:157–167. https://doi.
PIN-FORMED (PIN) protein family of auxin org/10.1007/s10725-011-9585-y
transporters. Genome Biol 10:249. https:// 38. Alemanno L, Devic M, Niemenak N et al
doi.org/10.1186/gb-2009-10-12-249 (2008) Characterization of leafy cotyledon1-
30. Sasikumar AN, Perez WB, Kinzy TG (2012) like during embryogenesis in Theobroma
The many roles of the eukaryotic elonga- cacao L. Planta 227:853–866. https://doi.
tion factor 1 complex: the many roles of the org/10.1007/s00425-007-0662-4
eukaryotic elongation factor 1 complex. Wiley 39. Lee H, Fischer RL, Goldberg RB, Harada JJ
Interdiscip Rev RNA 3:543–555. https://doi. (2003) Arabidopsis LEAFY COTYLEDON1
org/10.1002/wrna.1118 represents a functionally specialized subunit of
31. Balestrazzi A, Bernacchia G, Pitto L et al the CCAAT binding transcription factor. Proc
(2001) Spatial expression of DNA topoisomer- Natl Acad Sci U S A 100:2152–2156. https://
ase I genes during cell proliferation in Daucus doi.org/10.1073/pnas.0437909100
carota. Eur J Histochem 45:31–38. https:// 40. Maximova SN, Florez S, Shen X et al
doi.org/10.4081/1611 (2014) Genome-wide analysis reveals diver-
32. Duncan DR, Kriz AL, Paiva R, Widholm JM gent patterns of gene expression during
(2003) Globulin-1 gene expression in regener- zygotic and somatic embryo maturation
able Zea mays (maize) callus. Plant Cell Rep of Theobroma cacao L., the chocolate tree.
21:684–689. https://doi.org/10.1007/ BMC Plant Biol 14:185. https://doi.
s00299-002-0568-3 org/10.1186/1471-2229-14-185
33. Bai B, Su YH, Yuan J, Zhang XS (2013) 41. Zhang Y, Clemens A, Maximova SN, Guiltinan
Induction of somatic embryos in Arabidopsis MJ (2014) The Theobroma cacao B3 domain
requires local YUCCA expression mediated transcription factor TcLEC2 plays a dual role
by the down-regulation of ethylene biosyn- in control of embryo development and matu-
thesis. Mol Plant 6:1247–1260. https://doi. ration. BMC Plant Biol 14:106. https://doi.
org/10.1093/mp/sss154 org/10.1186/1471-2229-14-106
34. Sato S, Toya T, Kawahara R et al (1995) 42. Ledwoń A, Gaj MD (2009) LEAFY
Isolation of a carrot gene expressed specifi- COTYLEDON2 gene expression and auxin
cally during early-stage somatic embryogen- treatment in relation to embryogenic capac-
esis. Plant Mol Biol 28:39–46. https://doi. ity of Arabidopsis somatic cells. Plant Cell Rep
org/10.1007/BF00042036 28:1677–1688. https://doi.org/10.1007/
35. Mantiri FR, Kurdyukov S, Lohar DP et al s00299-009-0767-2
(2008) The transcription factor MtSERF1 of 43. Guo F, Liu C, Xia H et al (2013) Induced
the ERF subfamily identified by transcriptional expression of AtLEC1 and AtLEC2 dif-
profiling is required for somatic embryogenesis ferentially promotes somatic embryogen-
induced by auxin plus cytokinin in Medicago esis in transgenic tobacco plants. PLoS One
truncatula. Plant Physiol 146:1622–1636. 8:e71714. https://doi.org/10.1371/journal.
https://doi.org/10.1104/pp.107.110379 pone.0071714
Chapter 28
MicroRNA Expression and Regulation During Maize

Somatic Embryogenesis
Brenda Anabel López-Ruiz, Vasti Thamara Juárez-González,
Elva Carolina Chávez-Hernández, and Tzvetanka D. Dinkova
Abstract
MicroRNAs are tiny molecules that strikingly change their expression patterns and distribution during
somatic embryogenesis induction and plant regeneration. It is of great relevance to analyze simultaneously
the microRNA and target mRNA fates to understand their role in promoting an adequate embryogenic
response to external stimulus in the regenerating tissues. Here we describe a method to evaluate the
expression patterns of miRNAs or other sRNAs and their target regulation in distinctive tissues observed
during maize plant regeneration. Key features of the method include the classification of regenerating
plant material with reproducibly distinctive morphological characteristics and a purification procedure that
renders high-quality small and large RNA separation from the same sample for qRT-PCR analysis.
Key words In vitro tissue culture, Maize, MicroRNA, Somatic embryogenesis
1 Introduction
MicroRNAs (miRNA) and other small RNAs (sRNA) are impor-

tant regulators in plant development and stress responses, includ-
ing the zygotic and somatic embryogenesis processes [1–3].
MicroRNAs are 21–22 nt RNAs derived from longer precursors by
Dicer-like (DCL) endonuclease activity and recruited to protein
complexes by Argonaute (AGO) to target specific mRNA repres-
sion, either through degradation or translation inhibition [4].
Their particular role in somatic embryogenesis (SE) has been high-
lighted through the regulation of their target mRNAs, including
important transcription factors and key proteins for stress and
hormone signaling pathways. For maize (Zea mays L.), SE is
usually induced by the culture of immature embryos at 15–18
days after pollination in the presence of synthetic auxin
2,4-dichlorophenoxyacetic acid (2,4-D) in darkness [5]. Plants can
be regenerated when somatic embryos are depleted of external
hormones and are exposed to a photoperiod. It is important to
397
398 Brenda Anabel López-Ruiz et al.
discern different stages in plant regeneration and between non-

differentiating and differentiating tissues during this process to
better understand the role of miRNA-mediated target regulation.
There are evidences that sRNAs are mobile elements that can affect
neighboring tissues by target regulation [6, 7]. Hence, it is impor-
tant to follow the expression profile of particular miRNAs along
with the physiological response of the differentiating tissues and,
more importantly, with the profile of their target mRNAs. In
maize, miR528, miR156, miR166, miR168, miR390, miR164,
miR167, miR398, miR397, miR408, and miR319 have been
reported as important species during SE induction [8]. Recently,
we followed the profile of miR156, miR159, miR164, miR168,
miR397, miR398, miR408, miR528, and some of their predicted
targets (SBP23, GA-MYB, CUC2, AGO1c, LAC2, SOD9, GR1,
SOD1A, and PLC) in response to hormone depletion and photo-
period during maize plant regeneration through SE [2]. Results
from that work demonstrated that hormone depletion exerted a
great influence on specific miRNA expression independently of the
photoperiod, but their targets were additionally influenced by the
presence of photoperiod. Here we provide detailed methods to
analyze miRNAs or other sRNAs and their targets in distinctive
tissues observed during maize plant regeneration. First, we provide
a detailed description of the physiological analysis performed dur-
ing plant regeneration through maize somatic embryogenesis to
distinguish between the callus types used for the sRNA and target
analysis. Then we describe a quantitative approach to measure the
sRNA abundance in each tissue along with their target analysis
using a single purification method that allows separating sRNAs
(17–200 nt) and large RNAs (>200 nt).
2 Materials
Prepare all solutions with ultrapure deionized water and analytical

grade reagents. Sterilize by autoclaving, and store all stock solu-
tions at room temperature (unless indicated otherwise). Diligently
follow all waste disposal regulations when disposing hazardous
materials. All reagents are purchased from Sigma-Aldrich, except
when indicated.
2.1 In Vitro Tissue 1. Initiation medium (N6I): N6 salts [9], vitamin cocktail 20
Culture Media [10], 2 mg L−1 2,4-D, 10 mg L−1 adenine, 2.76 g L−1 proline,
200 mg L−1 casein hydrolysate, 30 g L−1 sucrose, and 3.3 g L−1
GelzanTM (see Note 1).
2. Proliferation medium (N6P): N6 salts [9], vitamin cocktail 20
[10], 2 mg L−1 2,4-D, 0.1 mg mL−1 6-furfurylaminopurine
(kinetin), 10 mg L−1 adenine, 2.76 g L−1 proline, 200 mg L−1
miRNA in Somatic Embryogenesis 399
casein hydrolysate, 30 g L−1 sucrose, and 3.3 g L−1 GelzanTM

(see Note 2).
3. Murashige and Skoog (MS) medium: Salts and vitamins are
prepared as described by Murashige and Skoog [11] with the
addition of 30 g L−1 sucrose and 3.3 g L−1 GelzanTM (see
Note 3).
2.2 Plant Material 1. Immature embryos: We use maize (Zea mays L.) cultivar
designed as “Tuxpeño VS-535” [12], which has been previ-
ously described to present high embryogenic potential [5].
2. 70% ethanol: Prepare with absolute ethanol in sterile water.
3. Chlorine solution: 50% chlorine bleach (commercially avail-
able), eight drops of Microdyn (colloidal silver 0.15%), and
three drops of Tween 20 or Triton X-100 per 250 mL of solu-
tion in sterile water.
4. 0.25 g mL−1 cefotaxime.
5. Scalpel and blade.
6. Tweezers.
2.3 Ribonucleic Acid 1. Quick-RNATM MiniPrep (Zymo Research) or TRIzol® Reagent

Isolation (Invitrogen).
and Purification 2. RNA clean and concentrator TM −5 (Zymo Research).
3. Diethylpyrocarbonate (DEPC)-treated water: incubate deion-
ized water with 0.1% DEPC overnight under agitation, and
then autoclave it at 120 °C for 15 min to ensure sterility and
DEPC inactivation.
4. Sample loading buffer: 0.1% bromophenol and 0.1% xylene cya-
nol are dissolved in 100% formamide.
5. Resolving buffer 5x TBE: 54 g of Tris base, 27.5 g of boric
acid, and 20 mL of 0.5 M EDTA (pH 8.0) are dissolved in 1 L
of H2O. The pH of the concentrated stock buffer should be
~8.3.
6. 1% agarose—0.5× TBE: 1 g of agarose in 100 mL of 0.5× TBE
(100 mL of 5× TBE stock solution and 900 mL of sterile
water).
7. Microcentrifuge.
8. Horizontal electrophoresis equipment.
2.4 Small RNA 1. RNasin® Ribonuclease Inhibitor (Promega).

Analysis by qRT-PCR 2. Reverse transcriptase system ImProm-IITM (Promega).
3. Nuclease-free water.
4. dNTP mix (dATP, dGTP, dTTP, dCTP; 10 mM each)
(Invitrogen).
5. Stem-loop RT primer (1 μM).

6. Forward specific small RNA primer (1 μM).
7. Reverse universal primer (1 μM).
8. Maxima SYBR Green/Rox qPCR Master Mix (ThermoFisher
Scientific).
9. A thermal cycler for end-point PCR is used for reverse tran-
scription and initial checking on amplifications. We use the
Applied Biosystems Veriti Thermal Cycler (ThermoFisher
Scientific).
10. A real-time PCR equipment. We use the 7500 Real-Time PCR
System (ThermoFisher Scientific).
2.5 Target mRNA 1. RNasin® Ribonuclease Inhibitor (Promega).

Analysis by qRT-PCR 2. Reverse transcriptase system ImProm-IITM (Promega).
3. Nuclease-free water.
4. Oligo-dT primer (10 mM).
5. dNTP mix (dATP, dGTP, dTTP, dCTP; 10 mM each)
(Invitrogen).
6. Maxima SYBR Green/Rox qPCR Master Mix (ThermoFisher
Scientific).
7. Specific primers for target mRNAs (10 μM).
8. Real-time PCR equipment. We use the 7500 Real-Time PCR
System (ThermoFisher Scientific).
3 Methods
3.1 Somatic 1. Collect maize immature ears at 15–18 days upon pollination,
Embryogenesis and process them immediately (see Note 4).
Induction 2. Divide each ear in portions of 6–8 cm, wash them for 1 min
with 70% ethanol, and rinse with sterile deionized water, then
with a chlorine solution for 15 min, and finally three times
with sterile deionized water, 5 min each.
3. Carefully excise the embryos from each kernel, and place them
in sterile deionized water supplemented with 0.25 g mL−1
cefotaxime.
4. Place 20–30 embryos faced down (meristems down, scutellum
up) on N6I medium in Petri dishes (100 mm diameter) for 2
weeks at 25 ± 2 °C in darkness.
5. Upon 2 weeks on N6I medium, callus induction should be
observed on all embryos. Take with the tweezers the whole
tissue (the callus + the original explant), and place it on N6P
medium in Petri dishes (100× 15 mm) for 2 weeks at 25 ± 2 °C

in darkness.
6. After this time, most of the original explant degenerates and
can be easily removed from the callus in further subculture.
3.2 Embryogenic 1. Upon somatic embryogenesis induction, subculture the gener-

Callus Proliferation ated callus masses on N6P medium in Petri dishes
(100 × 15 mm) for 2–3 weeks twice (see Note 5).
2. After these subcultures, remove rusty brownish tissues, and
perform monthly subcultures of the proliferating embryogenic
callus on N6P in Gerber jars (see Note 6). During Tuxpeño
VS-535 somatic embryogenesis, three distinguishable calli
form (1) an embryogenic callus, (2) a yellow non-embryogenic
callus, and (3) a white non-embryogenic callus (Fig. 1). While
the embryogenic callus is able to regenerate plants, both the
yellow and the white non-embryogenic calli are unable to
regenerate plants and occasionally form roots through
organogenesis.
3.3 Selection 1. Embryogenic callus: upon somatic embryogenesis induction,

of Different Callus this callus appears as compact, friable, and translucent tissue
Tissues (Fig. 1) and maintains these features during subsequent subculture
passages on N6P. In plant regeneration, different regenerative
spots appear on its surface and are able to develop into a whole
plant.
2. Yellow non-embryogenic callus: upon somatic embryogenesis
induction, this callus appears as watery yellowish to brownish
tissue which is able to proliferate in subculture passages on
N6P. In plant regeneration, this callus is unable to regenerate
plants and is prone to oxidation. Occasionally, roots appear on
its surface in darkness, but not under a photoperiod.
3. White non-embryogenic callus: upon somatic embryogenesis
induction, this callus appears as white, opaque, and compact
tissue, which is not friable. In plant regeneration, this callus is
unable to regenerate plants, but it could develop aberrant
organogenesis of leaves or roots both in darkness and
photoperiod.
3.4 Plant 1. Select the subculture time to start plant regeneration (see Note 7).
Regeneration 2. Place approximately 1 g of embryogenic callus on N6P medium
and Tissue Selection with 50% hormone (2,4-D and kinetin) concentration in round
(Fig. 2) glass Gerber jars (see Note 8). If you wish to assay separately
the effect of hormone reduction and the photoperiod, place
several (minimum 4) Gerber jars in darkness and several under
a photoperiod (16 h light, 8 h darkness). In this first step of
regeneration (1 week upon subculture), collect samples
(Fig. 2a) and store them at −70 °C until used.
Fig. 1 Different callus types for Tuxpeño VS-535 somatic embryogenesis at N6P subcultures. (a) Translucid
embryogenic callus. (b) Yellow non-embryogenic callus. (c) White non-embryogenic callus
Fig. 2 Developmental stages from maize plant regeneration through somatic embryogenesis considered for
small RNA analysis. (a), (b) Representative regenerative spots observed in N6P with 50% hormones. (c) Apical
growth from a regenerative spot in N6P with 0% hormones. (d) The regenerative spot has developed a differ-
entiated leaf structure still adhered to the callus and without root in MS. (e), (f) Regenerated plantlets showing
roots in MS (arrows). (g) Yellow non-embryogenic callus in MS after completing all the regeneration stages. (h)
White non-embryogenic callus in MS showing and aberrant regeneration upon completing all stages
3. Two weeks later, subculture the callus on N6P without

hormones (2,4-D and kinetin), and keep them under the same
conditions (darkness or photoperiod) (see Note 9). Collect
samples (Fig. 2c) and store them at −70 °C until used.
4. Upon 2 weeks, excise any regenerated plantlet keeping the sur-
rounding callus tissue, and place it on MS medium. Collect
samples (Fig. 2e) from regenerated plantlet once you observe
rooting in the medium (see Note 10). Store samples at −70 °C.
3.5 Ribonucleic Acid 1. Homogenize in liquid nitrogen 100 mg of each sample of

Isolation different tissues obtained during plant regeneration
and Purification independently.
2. Isolate total RNA with the Quick-RNATM MiniPrep system
(Zymo Research) according to the manufacturer’s instruc-
tions, including DNase I treatment (see Note 11).
Fig. 3 Evaluation of RNA integrity and separation. Lane 1: Visible 28S and 18S
rRNA represent the pool of large RNAs; no contamination of small RNAs is
observed. Lane 2: small RNAs appear at the bottom of a 1% agarose gel as a
single band; no contamination of 28S and 18S rRNAs is observed
3. The system allows the enrichment of small (17–200 nt) and

large RNAs (>200 nt) into separate fractions.
4. Calculate the RNA concentration for each sample by measur-
ing the absorbance at 260 nm in a NanoDrop (ThermoFisher
Scientific).
5. Check the RNA quality by electrophoresis on 1% agarose—0.5×
TBE gels (Fig. 3). Using ~100 mg of any tissue, the yield is
~600 ng for the large RNA fraction and ~150 ng for the small
RNA fraction.
6. If you observe contamination between each kind of RNAs, use
the RNA Clean & ConcentratorTM-5 to separate, in the same
way, large and small RNAs, according to the manufacturer’s
instructions.
3.6 Small RNA 1. Design the stem-loop RT and forward primers for small RNA
Analysis by qRT-PCR detection according to Chen et al. [13]. As an example, the
sequences for miR390 are indicated in Table 1, and the graphic
representation is observed in Fig. 4 (see Note 12).
2. Synthesize the stem-loop, forward specific, and universal
reverse primers (Table 1) with the desired provider.
3. Prepare a master mix by scaling the volumes listed below
to the desired number of reverse transcription reactions
(see Note 13):
Table 1
The design of stem-loop, forward specific, and universal reverse primers in the case of miR390 as an
example (see Note 12). Letters in italics correspond to the miRNA sequence.
miR390 miRNA sequence 5′- AAG CUC AGG AGG GAU AGC GCC -3′
miRNA antisense sequence 5′- GGC GCT ATC CCT CCT GAG CTT -3′
miRNA sense sequence 5′- AAG CTC AGG AGG GAT AGC GCC -3′
miRNA stem-loop primer [13] 5′- GTC GTA TCC AGT GCA GGG TCC GAG GTA
TTC GCA CTG GAT ACG ACG GCG CT -3′
miRNA forward primer 5′- TCT GCG AAG CTC AGG AGG GAT -3’
Universal reverse primer 5′- GTG CAG GGT CCG AGG TA -3’
Fig. 4 Designing primers for small RNA qRT-PCR analysis through the stem-loop RT primer [13]. The stem-
loop primer is shown in black and specific small RNA sequence in red. The universal reverse primer to be used
is shown in green. For sequence details, see Table 1
(a) 0.75 μL stem-loop RT primer (1 μM) for each small RNA.

(b) 0.25 μL U6 snRNA primer (1 μM).
(c) 1 μL 10 mM dNTP mix.
(d) 9.1 μL nuclease-free water.
4. Distribute 11.1 μL master mixes into PCR tubes, and add
1 μL of small RNAs (250 ng μL−1).
5. Incubate the reactions at 65 °C for 5 min and then on ice for
2 min.
6. Centrifuge briefly and add (see Note 14):
(a) 2.4 μL MgCl2 (25 mM; provided with ImProm-IITM).
(b) 4 μL transcriptase buffer ImProm-IITM 5× (Promega).
(c) 0.5 μL RNasin® Ribonuclease Inhibitor (20 units).
(d) 1 μL ImProm-II™ Reverse transcriptase.
7. Perform pulsed RT: load the thermal cycler, and incubate at
16 °C for 30 min, followed by pulsed RT of 60 cycles at 30 °C
for 30 s, 42 °C for 30 s, and 50 °C for 1 s.
8. Terminate reactions by incubating at 85 °C for 5 min to inac-
tivate the reverse transcriptase.
9. Prepare Maxima SYBR Green/Rox qPCR 2× Master Mix
(ThermoFisher Scientific) according to manufacturer’s
instructions. The final reaction volume is 10 μL. Include 10%
overage to cover for pipetting errors.
10. Add the following components to a nuclease-free microcentri-
fuge tube:
(a) 2 μL nuclease-free water.
(b) 5 μL 2× Maxima SYBR Green/Rox qPCR Master Mix.
(c) 1 μL forward primer (2 μM).
(d) 1 μL universal reverse primer (2 μM).
(e) 1 μL RT product.
11. Mix gently and centrifuge.
12. Perform real-time PCR: incubate samples at 95 °C for 5 min,
followed by 35–45 cycles of 95 °C for 5 s, 60 °C for 10 s, and
72 °C for 1 s (Fig. 5a).
13. For melting curve analysis, denature samples at 95 °C, and
then cool to 65 °C at 20 °C per second (Fig. 5b).
14. Collect fluorescence signals at 530 nm wavelength continu-
ously from 65 to 95 °C at 0.2 °C per second [14].
15. Calculate relative abundances using the 2−∆∆Ct method [15]
(see Note 15).
3.7 Small RNA Target 1. Design specific primers for small RNA target sequences to span
Analysis by qRT-PCR the predicted cleavage site in the mRNA using Primer3Plus [16].
2. Perform cDNA synthesis with the large RNA (>200 nt) sample,
an oligo(dT) primer and the ImProm-II™ Reverse transcriptase
(Promega) according to the manufacturer’s instructions.
3. Set up the Maxima SYBR Green/Rox qPCR 2× Master Mix
(ThermoFisher Scientific) according to manufacturer’s instruc-
tions. The final reaction volume is 10 μL. Include 10% overage
Fig. 5 miR390 analysis by qRT-PCR. (a) Amplification plots for different cDNA concentrations for miR390
(purple) and the housekeeping U6 snRNA (green) used in calibration curves (12.5, 2.5, and 0.5 ng of cDNA). (b)
Melting curve for miR390 (purple) and U6 snRNA (green). (c) Fold change of miR390 levels between embryo-
genic callus (EC, 100% hormones and darkness) and fully regenerated plantlet
to cover pipetting errors. Prepare triplicate reactions per sam-

ple including triplicate negative control reactions “non-tem-
plate control,” with nuclease-free water instead of cDNA, for
each primer pair.
4. Add the following components to a nuclease-free microcentri-
fuge tube:
(a) 3.6 μL nuclease-free water.
(b) 5 μL Maxima SYBR Green/Rox qPCR Master Mix (2×).
(c) 0.2 μL forward primer (10 μM).
(d) 0.2 μL reverse primer (10 μM).
(e) 1 μL RT product.
5. Mix gently and centrifuge.
6. Perform real-time PCR in a Real-Time PCR System: incubate
samples at 95 °C for 5 min, followed by 40 cycles of 95 °C
for 15 s and 60 °C for 1 min.
7. Calculate relative abundance using the 2−∆∆Ct method [16]
(see Note 15).
4 Notes
1. Adjust pH at 5.7 before adding GelzanTM, and sterilize at

120 °C for 18 min in an appropriate Erlenmeyer flask (con-
sider an appropriate volume of the flask 3:1 to the medium
volume). Cool to 45 °C, and pour approximately 25 mL in
Petri dishes (100 × 15 mm) under sterile conditions in a lami-
nar flow hood. Let the medium solidify and keep at 4 °C until
use (at most 1 week).
2. Adjust pH at 5.7 before adding GelzanTM, heat the solution
to dissolve the GelzanTM, and pour 30 mL in second stage
round glass Gerber jars (5.5 cm width × 6.7 cm height). Cover
each jar with a polypropylene cap, and sterilize at 120 °C for
18 min. Let the medium solidify and keep at 4 °C until use (at
most 1 week).
3. Adjust pH at 5.7 before adding GelzanTM, heat the solution
to dissolve the GelzanTM, and pour 30 mL in third stage
round glass Gerber jars (5.5 cm width × 9.2 cm height). Cover
each jar with a polypropylene cap and sterilize at 120 °C for
18 min. Let the medium solidify and keep at 4 °C until use (at
most 1 week).
4. Manual pollination is recommended to ensure the age of
immature embryos in the maize ears. Collect immature maize
ears early in the morning, and remove the leaves and stigmas
for processing.
5. Upon induction, the three first subcultures on N6P medium
are of utmost importance to produce healthy embryogenic
callus. It is crucial to perform as less as possible tissue manipu-
lation. Take with tweezers the tissue generated on the scutel-
lum of the embryo, and carefully place it at the center of fresh
N6P medium Petri dish. Repeat this process with all embryos
until forming a central tissue heap. It is important to position
the tissue in the same orientation as it was on the previous
subculture.
6. During callus subcultures, take preferentially the embryogenic
callus, distinctive by its features. However, it is not recom-
mended to completely remove the yellow non-embryogenic
callus, which is tightly interconnected with embryogenic
tissues. Always remove the white non-embryogenic callus that
could be easily separated from the rest of tissues.
7. All callus types are easily distinguished at the 6–8 months of
subcultures, and there should be enough material for plant
regeneration and RNA analysis.
8. The step of hormone concentration reduction in half (50%)
could be avoided. However, we recommend its inclusion if
small RNAs are under analysis, since there is an important

influence of hormone concentration on their levels [2]. At
this point, separate embryogenic and non-embryogenic cal-
lus if you wish to analyze them independently. Each embryo-
genic callus portion measures approximately 1 cm and
should be separated from another one by at least 0.5 cm.
During the first week with hormone reduction, locate peri-
odically (every 2–3 days) regenerating spots (Fig. 2a). In
order to facilitate tissue separation, observe the callus with
stereoscopic microscope.
9. During the subculture in hormone-free medium (N6P with-
out 2,4-D and kinetin), you can notice that most structures
acquire a leaf shape without the appearance of roots (Fig. 2c).
Keep the callus together with the regenerative tissue, separat-
ing the rest of the surrounding callus (at this step callus is eas-
ily friable with the minimum effort). If you observe the
appearance of roots before the leaf, keep in mind that this tis-
sue will not complete the regeneration of a plantlet.
10. Upon 2 weeks of subculture in the absence of 2,4-D and kine-
tin (N6P, 0% hormones), place the regenerating callus on MS
without hormones. The regeneration process takes about 42
days and is considered completed once both leaves and roots
have differentiated (Fig. 2e, f).
11. As alternative, it is possible to use the Trizol Reagent

(Invitrogen, USA) to isolate total RNA and then use the RNA
Clean & ConcentratorTM-5 (Zymo Research) to separate, in
the same way, large and small RNAs, according to the manu-
facturer’s instructions.
12. The specificity of stem-loop RT primers to small RNAs is given
by six nucleotides extension at the 3′ end of the standard stem
loop [13, 17]. This extension is a reverse complement of the
last six nucleotides at the 3′ end of the small RNA. Forward
primers are specific to the small RNA sequence but exclude
the last six nucleotides at the 3′ end of the small RNA. A 5′
extension of 5–7 nucleotides is added to each forward primer
to increase the melting temperature (~60 °C). These sequences
are chosen randomly and are CG-rich. The use of primer
design software is recommended to assess the quality of for-
ward primers [14]. The universal reverse primer is derived
from the stem-loop sequence [13] and is common to all
designed stem-loop RT primers with this method (Fig. 4).
13. You can use up to four different stem-loop RT primers and the
U6 snRNA stem-loop primer for normalization (Table 2).
Setting up the reverse transcription in this way will allow using
Table 2
Primers for normalization of sRNA, U6 snRNA [17], and targets, 18S, in the
qRT-PCR
U6 snRNA Primer stem loop 5′- GTG CAG GGT CCG AGG

TTT TGG ACC ATT TCT CGA
T -3′
Forward primer 5′- GGA ACG ATA CAG AGA AGA
TTA GCA -3′
Reverse universal 5′- GTG CAG GGT CCG AGG T
primer -3′
18S Forward primer 5′- TCC TAT TGT TGG CCT TCG
G -3′
Reverse primer 5′- TCC TTG GCA AAT GCT TTC
GC -3′
the same cDNA for quantification of several small RNAs and

the U6 snRNA [18].
14. The final volume for the reverse transcription reaction is

20 μL. It is recommended to include 10% overage to cover for
pipetting errors. Include control reactions with “no RNA”
and “no reverse transcriptase.”
15. To use the 2−∆∆Ct method, perform calibration reactions with
different cDNA concentrations, and evaluate the qPCR effi-
ciency of your primers [16]. An efficiency of around 100%
implies that the change of one cycle in the threshold (Ct) cor-
responds to twofold change in the template (miRNA or tar-
get). Normalize the miRNA levels with U6 snRNA and the
target levels with rRNA 18S as internal housekeeping controls.
Then compare the levels for each tissue to that found in the
starting sample (100% hormones, darkness). Express the results
as fold change with respect to the starting sample (Fig. 5c).
Acknowledgment
Research performed in Dr. Dinkova’s lab is supported by grants

from Consejo Nacional de Ciencia y Tecnología, 238439,
Programa de Apoyo a Proyectos de Investigación e Innovación
Tecnológica, IN211215, IN214118, and PAIP 5000-9118. The
authors appreciate the technical assistance provided by Maria
Teresa de Jesús Olivera Flores during in vitro plant tissue culture.
References
1. Nodine MD, Bartel DP (2010) MicroRNAs through comparative experiments on the nitrogen
prevent precocious gene expression and enable sources. J Sci China Math 18:659–668
pattern formation during plant embryogenesis. 10. Loza-Rubio E, Rojas E, Gómez L et al (2008)
Genes Dev 24:2678–2692. https://doi. Development of an edible rabies vaccine in
org/10.1101/gad.1986710 maize using Vnukovo strain. In: Dodet B,
2. Chávez-Hernández C, Alejandri-Ramírez NA, Fooks AR, Müller T, Tordo N, Scientific and
Juárez-González VT, Dinkova TD (2015) Technical Department of the OIE (eds)
Maize miRNA and target regulation in Towards the elimination of rabies in Eurasia.
response to hormone depletion and light expo- Developments in Biologicals, vol 131. Karger,
sure during somatic embryogenesis. Front Basel, pp 477–482
Plant Sci 6:555. https://doi.org/10.3389/ 11. Murashige T, Skoog F (1962) A revised
fpls.2015.00555 medium for rapid growth and bioassays with
3. Szyrajew K, Bielewicz D, Dolata J et al (2017) tobacco tissue cultures. Physiol Plant 15:473–
MicroRNAs are intensively regulated during 497. https://doi.org/10.1111/j.1399-3054.
induction of somatic embryogenesis in 1962.tb08052.x
Arabidopsis. Front Plant Sci 8:18. https://doi. 12. INIFAP (2010) Reporte Anual 2009 Ciencia y
org/10.3389/fpls.2017.00018 Tecnología para el Campo Mexicano, 1st edn.
4. Rogers K, Chen X (2013) Biogenesis, turn- México DF
over, and mode of action of plant MicroRNAs. 13. Chen C, Ridzon DA, Broomer AJ et al (2005)
Plant Cell 25:2383–2399. https://doi. Real-time quantification of microRNAs by
org/10.1105/tpc.113.113159 stem-loop RT-PCR. Nucleic Acids Res 33:e179.
5. Garrocho-Villegas V, de Jesús-Olivera MT, https://doi.org/10.1093/nar/gni178
Quintanar ES (2012) Maize somatic embryo- 14. Varkonyi-Gasic E, Wu R, Wood M et al (2007)
genesis: recent features to improve plant regen- Protocol: a highly sensitive RT-PCR method
eration. In: Loyola-Vargas VM, Ochoa-Alejo N for detection and quantification of microR-
(eds) Plant cell culture protocols, methods in NAs. Plant Meth 3:12. https://doi.
molecular biology, vol 877. Springer, org/10.1186/1746-4811-3-12
Heidelberg, pp 173–182. https://doi. 15. Livak KJ, Schmittgen TD (2001) Analysis of
org/10.1007/978-1-61779-818-4_14 relative gene expression data using real- time
6. Hisanaga T, Miyashima S, Nakajim K (2014) quantitative PCR and the 2(−Delta Delta
Small RNAs as positional signal for pattern for- C(T)) method. Methods 25:402–408.
mation. Curr Opin Plant Biol 21:37–42. https://doi.org/10.1006/meth.2001.1262
https://doi.org/10.1016/j.pbi.2014.06.005 16. Untergasser A, Nijveen H, Rao X, Bisseling T,
7. Pyott D, Molnar A (2015) Going mobile: non- Geurts R, Leunissen JAM (2007) Primer3Plus,
cell-autonomous small RNAs shape the genetic an enhanced web interface to Primer3. Nucleic
landscape of plants. Plant Biotechnol J 13:306– Acids Res 35:W71–W74. https://doi.org/10.
318. https://doi.org/10.1111/pbi.12353 1093/nar/gkm306
8. Shen Y, Jiang Z, Lu S, Lin H et al (2013) 17. Turner T, Adhikari S, Subramanian S (2013)
Combined small RNA and degradome Optimizing stem-loop qPCR assays through
sequencing reveals microRNA regulation dur- multiplexed cDNA synthesis of U6 and miR-
ing immature maize embryo dedifferentiation. NAs. Plant Signal Behav 8(8):e24918. https://
Biochem Biophys Res Commun 441:425–430. doi.org/10.4161/psb.24918
https://doi.org/10.1016/j. 18. Romero-Pérez PS (2015) Análisis de microR-
bbrc.2013.10.113 NAs específicos de leguminosas de respuesta a
9. Chu C-C, Wang C-C, Sun C-S, Hsu C, Yin déficit hídrico en Medicago truncatula. Master
K-C, Chu C-Y, Bi F-Y (1975) Establishment of Thesis Dissertation, Universidad Nacional
an efficient medium for anther culture of rice Autónoma de México
Chapter 29
Elaboration of Transcriptome During the Induction

of Somatic Embryogenesis
Elsa Góngora-Castillo, Geovanny I. Nic-Can, Rosa M. Galaz-Ávalos,
Abstract
Somatic embryogenesis (SE) is one of the most studied developmental processes due to its applications,
such as plant micropropagation, transformation, and germplasm conservation. The use of massive tech-
niques of sequencing, as well as the use of subtractive hybridization and macroarrays, has led to the iden-
tification of hundreds of genes involved in the SE process. These have been important developments to
study the molecular aspects of the progress of SE. With the advent of the new massive techniques for
sequencing RNA, it has been possible to see a more complete picture of whole processes. In this chapter
we present a technique to handle the elaboration of the transcriptome from the extraction of RNA until
the assembly of the complete transcriptome.
Key words Bioinformatics, Coffea canephora, Somatic embryogenesis, Transcriptome
1 Introduction
Which is the signal that changes the genetic program of a somatic

cell and leads to the development of a new organism? This is one
of the most challenging questions in biology. This is one of the
most studied developmental processes due to its applications, such
as plant micropropagation, transformation, and germplasm con-
servation [1–5]. Somatic embryogenesis has been induced in many
different species [6–8].
Although the stages of development of somatic embryos
resemble those of the zygotic embryos, there are important differ-
ences between them [9, 10]. Some of the most evident are the lack
of suspensor and cotyledons, as well as the continuity between the
development of the embryo and its germination, among others. In
order to solve this important problem, it is required the use of
cutting-edge technologies.
The initial use of massive techniques to identify genes related
to SE was with a suspension of Medicago sativa [11]. The use of
411
412 Elsa Góngora-Castillo et al.
subtractive hybridization and macroarrays led to the identification

of more than 1800 and 600 genes regulated from pooled samples
of somatic embryo compared to non-embryogenic cells in Elaeis
guineensis and Gossypium hirsutum, respectively [12, 13].
The use of high-throughput sequencing technology has
improved the number of genes expressed during the induction of
SE, e.g., in cotton (Gossypium hirsutum); the Illumina digital gene
expression platform was used to analyze the transcriptional profile
during SE. This platform generated 32,108,458 clean tags of
21 bp long from all RNA samples evaluated [14].
Recently the de novo transcriptomes from G. hirsutum, Cocos
nucifera, Larix leptolepis, Cinnamomum camphora, Dimocarpus
longan Lour., Araucaria angustifolia, and Zea mays showed the
presence of genes not recorded before during the development of
somatic embryos [15–21].
Currently, with the new massive sequencing technologies of
RNA, together with the possibility of isolating nucleic acids from a
single cell, we can study a specific space and time phenomenon.
Cost and coverage can be the two mainly factors leading to the
use of different platforms available today. The other factor to be
taken into consideration is whether the genome of plant in study
has been sequenced. This is of particular importance since today
we have more than 100 plant sequenced genomes [22, 23].
This chapter describes sample preparation, assembly and anno-
tation methods for de novo assembly and annotation of somatic
embryogenesis transcriptomes.
2 Materials
2.1 Biological 1. Coffea canephora plantlets are grown in magenta boxes con-
Materials taining 40 mL of Murashige and Skoog medium (MS) [24] at
25 ± 2 °C under photoperiod conditions (16/8-h light/dark-
ness) and transferred to fresh medium every 30 days according
to Quiroz-Figueroa et al. [25]. One plantlet is put in each
container (see Notes 1 and 2).
2. When the plantlets have six-to-eight pair leaves, they can be
used as the source of explants. Use only the second and third
pair of leaves.
2.2 Glassware/ 1. Magenta boxes.

Plasticware 2. Scissors.
3. Petri plates.
4. Scalpel.
5. Forceps.
Somatic Embryogenesis Transcriptome 413
6. Cork borer.
7. Microcentrifuge tubes (1.5 and 2 mL).
8. RNase-free tips.
2.3 Instrumentation 1. Flow cabinet.

2. Dry-hot sterilizer.
3. Automatic pippetors.
4. Microcentrifuge.
5. −80 °C freezer.
6. Vortex.
7. NanoDrop spectrophotometer.
8. Gel electrophoresis equipment.
9. Gel documentation system.
2.4 Reagents 1. Murashige and Skoog medium (MS) [24].

and Solutions 2. Modified Yasuda medium (YM) [25].
3. RLY buffer (containing 30–60% guanidinium thiocyanate,
pH 6.5 provided in the ISOLATE II RNA Plant kit).
4. MEM buffer (containing 30–60% guanidinium thiocyanate,
35% ethanol, pH 6.7 provided in the ISOLATE II RNA Plant
kit).
5. RW1 buffer (containing 30–60% guanidinium thiocyanate,
35% ethanol, pH 7.0 provided in the ISOLATE II RNA Plant
kit).
6. RW2 buffer (100% ethanol).
7. 50 TAE buffer (2 M Tris, 1 M acetic acid, 50 mM EDTA).
8. RNA loading buffer (95% formamide, 0.025% SDS, 0.025%
bromophenol blue, 0.025% xylene cyanol, 0.5 mM EDTA).
9. Agarose (Cat. # 16500500, Invitrogen).
10. GelRed (Cat. # 41003, Biotium).
3 Methods
3.1 Induction The induction of somatic embryogenesis in C. canephora is carried

of Somatic out as reported previously [25]. Briefly:
Embryogenesis
1. For the embryogenic induction, the plantlets are transferred
to MS medium, supplemented with 0.54 μM naphthalene ace-
tic acid (NAA) and 2.32 μM kinetin (Kin) for 14 days, and
incubated at 25 ± 2 °C under photoperiod conditions (16/8-h
light/darkness).
2. After 14 days of pretreatment, the explants are obtained from

the second and third pairs of leaves with a cork borer avoiding
the midvein and edges (see Fig. 1a) (see Note 3).
3. The circular foliar explants (1 cm in diameter) are placed on
direct embryogenesis induction medium (Table 1) in the pres-
ence of 5 μM 6-benzyladenine (BA). Aluminum sheet or plas-
tic is used as tap (see Note 4) and sealed with cling film strip
(see Fig. 1b). The explants are incubated under darkness at
25 ± 2 °C and rotate at 60 rpm.
4 . Somatic embryo can be observed 21 days after induction.
By week sixth the explant is covered with somatic embryos (see
Fig. 1c, d).
3.2 RNA Isolation Before starting it must be always taken into account to work in
RNase-free environment. Mortars and pestles should be com-
pletely decontaminated either by baked at 300 °C for 4 h or treated
with RNaseZAP® decontamination solution (AM9780, Ambion,
Thermo Fisher Scientific). Microcentrifuge tubes (1.5 and 2 mL)
Fig. 1 Direct embryogenesis system in Coffea spp. (a) Cut usual of explant leaf avoiding midvein and edges.
(b) Glass bottle with plastic tap where direct embryogenesis is induced. (c) Direct somatic embryos obtained
after 6 weeks embryogenesis induction. (d) Close-up of (c), showing a cotyledonary somatic embryo. (e)
Different stages of embryo germination; arrows, radicular system; head arrows, first pair of leaves
Table 1
Composition of the media used for the maintenance of the plantlets [24] and the induction of the
somatic embryogenesis [25]
Chemical compound MS YM
Macroelements mg/L (mM) mg/L (mM)
NH4NO3 1650 (20.60) 412 (5.15)
KNO3 1900 (18.80) 475 (4.7)
CaCl2·2H2O 440 (3.00) 110 (0.748)
KH2PO4 170 (1.25) 85 (0.624)
FeSO4·7H2O 27.80 (100) 21 (75.53)
Na2EDTA 37.30 (100) 27.9 (74.95)
MgSO4·7H2O 370 (1.50) 92.5 (0.375)
Microelements mg/L (μM) mg/L (μM)
Na2MoO4·2H2O 0.25 (1.0) 0.125 (0.5)
H3BO3 6.20 (100.0) 3.100 (50)
*MnSO4·4H2O *22.30 (100.0) **6.83 (40)
**MnSO4·H2O
CuSO4·5H2O 0.025 (0.1) 0.05 (0.2)
ZnSO4·7H2O 8.60 (30.0) 4.3 (15)
KI 0.83 (5.0)
CoCl2·6H2O 0.025 (0.1)
Organic components mg/L (μM) mg/L (μM)
Piridoxine HCl 0.5 (2.43) 1 (4.86)
Nicotinic acid 0.5 (4.06) 1 (8.12)
Thiamine HCl 0.1 (0.30) 10 (29.6)
Myo-inositol 100.0 (555.10) 100 (550)
Glycine 2.0 (26.60)
Sucrose 30,000 (87.64 mM) 30,000 (87.64 mM)
pH 5.7–5.8 5.8
and disposable tips (10, 200, and 1000 μL) should also be RNase-
free. Additionally, scissors, tissue paper, and petri dishes should be
sterilized, whereas pipettes and latex gloves should be swabbed
with RNaseZAP throughout sample manipulation to avoid any
RNase contamination.
Fig. 2 Take of the sample. Cut only the first 2–3 mm from the edge of the leaves
Other aspect to take in account is the sampling days. To elabo-

rate the transcriptome, several samples must be taken. To sampling
the plantlets during the pretreatment, use the following steps:
1. Collect the second and third pairs of leaves of plantlets with
scissors, and cut the explants with a cork borer into circles of
one cm in diameter. Once excised, the leaf explants should be
frozen in liquid nitrogen immediately to avoid RNA degrada-
tion and stored at −80 °C until RNA isolation.
To sampling the leaves during the induction of somatic
embryogenesis, and in order to avoid tissues that can be not
involved in the response to induction of somatic embryogenesis,
take only the first millimeters of tissue around the explant using a
cork borer (see Fig. 2). Once excised, the tissue should be frozen in
liquid nitrogen immediately to avoid RNA degradation and stored
at −80 °C until RNA isolation.
Once the samples have been collected, proceed as follows:
1. Grind 100 mg of explants by using a pestle and mortar previ-
ously precooled with liquid nitrogen. Grind the plant tissue
into fine powder adding liquid nitrogen as necessary, and
transfer the tissue powder into a precooled liquid nitrogen
microcentrifuge tube. Tissue samples should be kept in liquid
nitrogen or stored at −80 °C until processing further.
2. Typically, TRIzol™ (also known as TRI Reagent) is a widely
reagent used for the isolation of total RNA from tissue samples
including human, plant or bacteria. TRIzol and chloroform
dissolve nucleic acids from samples and lead to separation of

the mixture into three phases after a centrifugation, being the
clear aqueous phase the one containing the RNA. The precipi-
tation and subsequent washes of RNA with ethanol take less
than 1 h. However, the extraction of high-quality RNA from
woody tissues is often difficult due to the high concentration
of phenolic compounds, which can bind to RNA and hinder
downstream applications. To eliminate such interferences, sev-
eral commercial kits have been developed for the purification
of high-quality RNA; however, they must be adapted, depend-
ing on the different types of tissues and the amount to be
used. ISOLATE II RNA Plant kit (Cat. # Bio-52,077, Bioline)
can be utilized for RNA isolation from a little amount of sam-
ple and from recalcitrant tissues according to the m
anufacturer’s
instructions, including all precautions mentioned above.
3. By using the ISOLATE II RNA Plant kit, each sample should
be treated as follows. First, retrieve the plant samples (tissue
powder) from the liquid nitrogen or −80 °C freezer and thaw
slowly in ice. Immediately add 350 μL of RLY buffer per
50–100 mg of tissue and 3.5 μL of β-mercaptoethanol and
vortex vigorously during 30 s.
4. Place lysate into an ISOLATE II filter (spin column), and cen-
trifuge at 11,000 × g for 1 min.
5. Transfer the filtrate into a new microcentrifuge tube, and add
350 μL of 70% ethanol and mix by inverting. Load the lysate
in an ISOLATE II RNA Plant column, and centrifuge for 30 s
at 11,000 × g.
6. Place the ISOLATE II RNA Plant column in a new 2 mL
tube, and add 350 μL MEM buffer and centrifuge at
11,000 × g for 2 min to dry the silica membrane.
7. Discard the filtrate and apply 95 μL DNase I solution (mix
100 μL of RDN buffer and 10 μL of DNase I (provided in the
ISOLATE II RNA Plant kit)) onto center of the silica mem-
brane of the column, and incubate for 30 min at room
temperature.
8. Add 250 μL of wash RW1 buffer to the column and centrifuge
for 30 s at 11,000 × g, and then add 600 μL wash RW2 buffer
and centrifuge at 11,000 × g for 30 s. Transfer the column into
a new tube and add 250 μL wash buffer RW2 and centrifuge
at 11,000 × g for 2 min to dry the membrane, and then place
the column into a new 1.5 mL tube.
9. At the end of the procedure, elute the RNA from the column
with 40 μL RNase-free water, incubate for 10 min at room
temperature, and then centrifuge at 11,000 × g for 90 s.
10. Immediately after, verify the quantity and the purity of RNA
by using a NanoDrop spectrophotometer. Typically, the absor-
bance 260/280 and the 260/230 ratio must be higher than
1.9 (see Note 5). Integrity of RNA ribosomal subunits should

also be assessed with an Agilent 2100 Bioanalyzer. An RNA
integrity number (RIN) ≥ 8 indicates high-quality RNA.
11. Determine the quality of extracted ARN, running 2 μL of each
sample, previously mixed with 2 μL of RNA loading buffer, by
electrophoresis on 1.5% agarose gel (see Note 6) at 80 V for
40 min in 1× TAE buffer. View and register the stained gel
with a gel documentation system. Total RNA samples should
clearly show 25S rRNA and 18S rRNA strands.
12. The total RNA should be free of any DNA contamination and
should pass the quality control mentioned above, before to
begin with the RNA fragmentation and conversion into a
cDNA library for sequencing. Details of each step in the process,
from cDNA library construction to whole transcriptome RNA
sequencing, are described below.
3.3 Generation Usually, sequencing cost set the limits to the amount of sequences
of Next-Generation to be generated and, consequently, the biological outcomes.
Whole Transcriptome However, there are a few things to consider when working with
Sequences RNA-seq:
3.3.1 Transcriptome 1. Sequencing mode. In single-end mode (SE), the sequencer

Sequencing reads a fragment from only one end to the other. In paired-end
Recommendation mode (PE), the reading starts at one end, finishes this direction,
and then starts another round of reading from the opposite end
of the fragment. The use of paired-end reads rather than single-
end reads will significantly improve the transcriptome assembly;
however, paired-end reads are more expensive and time-
consuming to perform than single-end reads.
2. Read length. It is possible to specify the number of base pairs
for the read length. Longer reads can provide more reliable
information and is a major driver in the robustness of a de
novo transcriptome assembly; however, it is usually more
expensive to generate longer reads.
3. Coverage. Determining coverage for RNA sequencing is com-
plicated since transcripts are expressed at different levels. This
means that more reads will be sequenced from highly expressed
genes and few sequences will be captured for low-expressed
genes. Several review articles describe highlighting the consid-
erations for coverage estimation, and the reader is referred to
these for an in-depth discussion of the coverage for RNA-seq
studies [26, 27].
3.3.2 Transcriptome The sequences have to be checked for quality and pre-processed as
Assembly Methods needed before assembling because NGS transcriptome assemblers
such as Trinity [28] and Velvet/Oases [29] are not quality-aware:
1. Quality assessment of sequences. To measure the quality of the
sequences reads for one or more files, run FASTQC program
[30] by typing the following commands in a terminal window:

fastqc –o My_output_directory –f fastq sequences_file1
sequences_file2 … sequences_fileN.
The output is an HTML file containing a series of QC analy-

ses. Each analysis is flagged as pass, warning, or fail. The HTML
file can be visualized using an Internet browser such as Chrome,
Firefox, etc. Briefly, the QC analyses include the following mea-
surements: (1) per base sequence quality, (2) per sequence quality
scores, (3) per base sequence content, (4) per base GC content, (5)
per sequence GC content, (6) per base N content, (7) sequence
length distribution, (8) sequence duplication levels, (9) overrepre-
sented sequences, and (10) Kmer content.
Per base sequence quality analysis is represented in a
BoxWhisker plot (see Fig. 3). Based on Phred quality scores [31],
Quality scores across all bases (Sanger / Illumina 1.9 encoding)

40
38
36
34
32
30
28
26
24
22
20
18
16
14
12
10
8
6
4
2
0
1 2 3 4 5 6 7 8 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49
Position in read (bp)
Fig. 3 The BoxWhisker plot shows an overview of quality values across all bases at each position in the read
(x-axis). The y-axis shows the quality scores. The background of the graph is divided in three colors: (1) green
for the very good quality calls, (2) orange for calls of reasonable quality, and (3) red for calls of poor quality. It
is common to see base calls falling into the orange area toward the end of a read; this is due to the quality of
calls (for most sequencing platforms) that will degrade as the sequencing run progresses
the quality for each base is shown on the Y-axis. A minimum

quality of 20 is recommended. Each base of the read sequence is
shown on the X-axis. It is more likely to observe homogeneous
quality in “short” reads (<76 bp) than longer reads (>76 bp) due
to a decrease in the quality of the sequence in each sequencing
cycle. The overrepresented sequences analysis will show if the data-
set is contaminated with sequencing adaptors. The reader is
referred to the manual for more information about the FASTQC
output [30] (see Subheading 5).
2. Preprocessing of the reads (optional). To remove low-quality
bases from the 3′ end, low-quality sequences and, in some
cases, trim the adapters, use cutadapt [32]. The key parame-
ters are –b flag that specifies the adapter sequence and searches
for the adapter at the 5′ and 3′ end; −q flag that specifies the
quality cutoff for 3′ end; −m flag, the minimum length, that
discards reads that are shorter than this length after trimming;
and –o flag that specifies the output file (see Notes 7 and 8).
We encourage the reader to read first cutadapt’s publication
and manual for a better understanding of the methods [32]
(see Subheading 5). The basic command line for cutadapt is /
path/to/cutadapt/cutadapt –b ATGC –q 20 –o output.fastq
input.fastq.
3. De novo transcriptome assembly. The algorithms for assem-
bling de novo a transcriptome sequenced with NGS are based
on the mathematical concept of the de Bruijn graphs, which is
a set of vertices or nodes that can be connected by edges [33–
35] (see Note 9). It is important to emphasize that NGS tran-
scriptome assemblers are not quality-aware, and therefore,
reads need to be checked for quality and preprocessed (if
needed) prior assembling. Among the RNA-seq assemblers,
Trinity [28, 36] has become one of the most popular and used
transcriptome assemblers. Briefly, Trinity’s assembly pipeline
consists of three consecutive modules: inchworm, which
examines each unique Kmer in decreasing order of abundance
and generates transcript contigs using a greedy extension
based on (k-1)-mer overlaps. Next, chrysalis clusters related
contigs into components, using the raw reads to group tran-
script based on shared reads support and paired reads informa-
tion, when available, and then encode the structural complexity
of contigs by building a de Brujin graph for each cluster.
Finally, butterfly processes the individual graphs in parallel and
reports full-length transcripts for alternatively splice forms and
teasing apart transcripts that correspond to paralogous genes
[36]. Thus, Trinity per se is a Perl script that “glues” the mod-
ules all together.
Because NGS transcriptome assemblers are not quality-aware,

the quality information in the fastq file is not needed during the
assembly; an optional step for the reader is to convert the fastq files
to fasta format to decrease the files sizes and make them more
manageable and, consequently, save disk space. This step can be
done using the FASTX-toolkit using the fastq_to_fasta tool (see
Subheading 5). The key parameters are −v flag which reports the
number of processed sequences and the report is printed to
STDOUT, −i that specifies the input file in fastq format, and −o
flag that specifies the output file in fasta format. The basic com-
mand line to convert fastq to fasta file is /path/to/fastx-toolkit/
bin/fastq_to_fasta –v –i my_sequence_file.fastq –o my_sequence_
file.fasta.
Trinity assembler can perform assemblies for single-end (SE)
or paired-end (PE) reads (see Note 10). The key parameters to
assembly PE reads are --seqType flag that specifies the sequences
format (fasta or fastq); --left and --right flags that specify the read
end for 1 and 2, respectively; --max_memory flags that specify the
maximum amount of RAM memory to be used during the assem-
bly; --CPU flag that specifies the number of CPU to be used dur-
ing the assembly; and --output flag that specifies the output
directory. We highly encourage the reader to first read Trinity wiki
webpage for a better understanding of the methods and more
options to run the assembly (see Subheading 5). The basic com-
mand line to assemble paired-end read data is /Path/to/Trinity/
trinity --seqType fq --left reads_1.fq --right reads_2.fq --CPU 2
--max_memory 20G --output trinity_out_directory.
When Trinity completes the assembly, it will create a “Trinity.
fasta” output file located in the trinity_out_directory (or the out-
put directory specified by the reader). The reader is referred to
Trinity wiki webpage for more detailed information about the out-
put file (see Subheading 5).
4. Assembly quality assessment. To measure the quality of the
assembly, it is recommended a combination of metrics: (a) con-
tig length statistics, the N50 length and average contig size (an
N50 length around 1 kb is recommended); (b) proportion of
reads mapping to an assembly to measure the completeness of
the assembly (ideally, at least ~80% of the RNA-seq reads should
be represented in the transcriptome assembly, and the unas-
sembled reads likely correspond to low-expressed transcripts
with insufficient coverage); and (c) number of unigenes with
hits to an external database such as NCBI’s nonredundant pro-
tein (NR) [37], Kyoto Encyclopedia of Genes and Genomes
(KEGG) [38], Swiss-Prot [39], etc. [40–44].
To calculate the transcriptome contig length statistics, Trinity
toolkit utilities can be used. The traditional method is estimating
N50 length, defined as the length of the smallest contig such that
at least 50% of the bases can be found in a contig of at least the
N50 length value. The basic command line to run the script
TrinityStats.pl in the Trinity toolkit is (see Note 11) /Path/to/
Trinity/util/TrinityStats.pl Trinity.fasta.
A good quality transcriptome assembly will have the vast
majority of all the reads mapping back to the assembly, 80% of the
RNA-seq reads approximately [40]. Bowtie 2 can be used to align
the reads to the transcriptome and estimate the proportion of the
mapped reads to an assembly [45]. First, a Bowtie 2 index needs to
be built for the transcriptome /path/to/bowtie2/bowtie2-build
Trinity.fasta Trinity.fasta.
Then, the alignment is performed to capture the read align-
ment statistics. The key parameters are −q flag that specifies that
reads are in fastq files; −x flag that specifies the base name of the
index; −1 and − 2 flags that specify paired-end reads input files for
read_1 and read_2, respectively; and −S flag that specifies the
alignment output file in SAM (Sequence Alignment/Map) format
[46] (see Note 12 and useful links). The basic command line to
run bowtie2 is /path/to/bowtie2/bowtie2 –q –x Trinity.fasta −1
reads_1.fq −2 reads_2.fq –S alignments_output_file.sam.
When Bowtie 2 finishes running, it prints an alignment sum-
mary. This message is printed to the “standard error” (STDERR)
file handle. The reader is referred to Bowtie 2 manual for more
detailed information of the program (see Subheading 5).
Finally, a high-quality annotation is expected to estimate the
number of transcripts that appear to be full-length or nearly full-
length. This analysis can be supported using BLAST+ (Basic Local
Alignment Search Tool) [47], and it is discussed in the next section.
3.3.3 Functional One of the metrics for evaluating the good quality of the de novo
Annotation transcriptome assembly is to examine the number of assembled
transcripts that align to a reference sequences set (proteome or
transcriptome). For non-model organisms, the assembled tran-
scripts can be compared to a closely related, high-quality transcrip-
tome to identify full-length coverage. BLAST+ can be used to
search the assembled sequences against all known proteins or
closely related transcriptome. Useful protein databases to search
include (1) Swiss-Prot, (2) TrEMBL [39, 48], and (3) UniRef100
[49] (see Note 13).
To run BLAST+, a database of the reference sequences is
required. This can be done using the command makeblastdb. The
main parameters are −in flag that specifies the input file in FASTA
format; −dbtype flag that specifies the molecule type (nucl/prot);
and –parse_seqid flag that enables retrieval of sequences based
upon sequences identifier. The basic command line to create a
BLAST+ dabase is /path/to/blast/makeblastdb –in my_refer-
ence_proteome_set.fasta –parse_seqid –dbtype prot.
Following the example above, the de novo assembled tran-

scriptome will be searched against the reference proteome data-
base using the blastx option from BLAST+. Blastx application will
translate the query sequences (assembled transcriptome) into pro-
tein sequences. The key parameters are −db flag that specifies the
database name; −query flag that specifies the query sequences file;
−out flag that specifies the output file name; −evalue flag that spec-
ifies the E value threshold (an E value of 1e−10 or smaller is recom-
mended); −num_alignments flag that specifies the number of
alignments to show in the output file; and –num_descriptions flag
that specifies the number of one-line descriptions in the output file.
The basic command line to run BLAST+ using blastx application is
/path/to/blast/blastx –db my_reference_proteome_set.fasta –
query Trinity.fasta –out my_blast_result.txt –evalue 1e-10 –num_
descriptions 20 –num_alignments 20.
The BLAST+ output will report the degree of similarity
between the query sequences and the reference proteome based on
the defined parameters (i.e., E value, etc). The reader is referred to
“the command line application user manual” for an in-depth dis-
cussion of BLAST+ options and its applications (see Subheading 5).
4 Notes
1. In vitro plantlets should be carefully inspected to discard any

bacterial or fungal contamination, since both might compro-
mise the transcriptomic studies and led to misinterpretation of
the biological.
2. Each magenta box has a thread in border that services as filter
to gasses interchange.
3. The position of leaves on the plant is very important, because
the first two pairs of leaves do show poor embryogenic
response as compared with the mature leaves. Also, explants
coming from the distal part of the leaf are less responsive than
those coming from the basal part of the leaf [50].
4. When glass bottle is covered with aluminum, the embryogenic
yield is higher than when a plastic tap is used.
5. If absorbance ratios (260/280 and 260/280) are lower than
1.6, this may indicate the presence of potential contamination
(protein, phenol, or other contaminants); therefore, an addi-
tional column purification needs to be performed to obtain a
superior sample quality.
6. Prepare the agarose gel solution with 1× TAE buffer and dilute
the GelRed into the molten agarose gel solution at 1:10,000
and mix thoroughly.
7. For paired-end reads, the quality assessment and pre-processing

of the reads need to be applied to each file in the pair.
8. Pre-processing step could be time-consuming depending on
the file size.
9. We strongly encourage the reader to refer for an in-depth dis-
cussion and better understanding of the de Bruijn graph-based
assemblers.
10. To assemble unpaired reads, use the –single option followed
by the sequences file.
11. The de novo transcriptome assembly algorithms attempt to
resolve as many loci isoforms as supported in the read pool.
Thus, the transcriptome will contain single transcripts and
transcripts with multiple isoforms. This could overestimate the
contig N50 values. To mitigate this effect, the N50 values
should be computed using only the single longest isoform per
“gene” [41].
12. The Sequence Alignment/Map (SAM) format is a generic
alignment format for storing read alignments. The SAMtools
software package has implemented various utilities for post-
processing alignments in SAM format [46].
13. The reader is referred to the following links to download the
protein databases: (a) ftp://ftp.uniprot.org/pub/databases/
uniprot/current_release/ knowledgebase/complete/uni-
prot_sprot.fasta.gz and (b) ftp://ftp.uniprot.org/pub/ data-
bases/uniprot/current_release/knowledgebase/complete/
uniprot_trembl.fasta.gz
5 Useful Links
1. FASTQC manual:https://biof-edu.colorado.edu/videos/
dowell-short-read-class/day-4/fastqc-manual
2. Cutadapt manual:https://media.readthedocs.org/pdf/cut-
adapt/v1.7.1/ cutadapt.pdf
3. FASTX-toolkit:http://hannonlab.cshl.edu/fastx_toolkit/
4. BLAST+ manual:https://www.ncbi.nlm.nih.gov/books/
NBK279675/
5. Trinity transcriptome assembler:https://github.com/trinityr-
naseq/ trinityrnaseq/wiki
https://github.com/trinityrnaseq/trinityrnaseq/wiki/
Output-of-Trinity-Assembly
6.
Bowtie 2 alignment:http://bowtie-bio.sourceforge.net/
bowtie2/ manual.shtml
7. SAMtools:http://samtools.sourceforge.net/
Acknowledgment

(CONACyT, 1515).
References
1. Anis M, Ahmad N (2016) Plant tissue culture: Springer, Switzerland, pp 11–22. https://doi.
a journey from research to commercialization. org/10.1007/978-3-319-33705-0_2
In: Anis M, Ahmad N (eds) Plant tissue culture: 9. Etienne H, Bertrand B, Georget F et al (2013)
propagation, conservation and crop improve- Development of coffee somatic and zygotic
ment. Springer, Singapore, pp 3–13. https:// embryos to plants differs in the morpho-
doi.org/10.1007/978-981-10-1917-3_1 logical, histochemical and hydration aspects.
2. Martinez-Montero ME, Gonzalez-Arnao MT, Tree Physiol 33:640–653. https://doi.
Engelmann F (2012) Cryopreservation of org/10.1093/treephys/tpt034
tropical plant germplasm with vegetative prop- 10. Jin F, Hu L, Yuan D et al (2014) Comparative
agation – review of sugarcane (Saccharum spp.) transcriptome analysis between somatic
and pineapple (Ananas comusus (L.) Merrill) embryos (SEs) and zygotic embryos in cotton:
cases. In: Katkov II (ed) Current frontiers in evidence for stress response functions in SE
cryobiology. InTech, Rijeka, Croatia, pp 359– development. Plant Biotechnol J 12:161–173.
396. https://doi.org/10.5772/32047 https://doi.org/10.1111/pbi.12123
3. Ahmad MM, Ali A, Siddiqui S et al (2017) 11. Giroux RW, Pauls KP (1997) Characterization
Methods in transgenic technology. In: Abdin of somatic embryogenesis-related cDNAs
MZ, Kiran U, Kamaluddin M et al (eds) Plant from alfalfa (Medicago sativa L). Plant Mol
biotechnology: principles and applications. Biol 33:393–404. https://doi.org/10.102
Springer, Singapore, pp 93–115. https://doi. 3/A:1005786826672
org/10.1007/978-981-10-2961-5_4 12. Lin HC, Morcillo F, Dussert S et al (2009)
4. Loyola-Vargas VM, Vázquez-Flota FA (2006) Transcriptome analysis during somatic
An introduction to plant cell culture: back to embryogenesis of the tropical monocot Elaeis
the future. In: Loyola-Vargas VM, Vázquez- guineensis: evidence for conserved gene func-
Flota FA (eds) Plant cell culture protocols. tions in early development. Plant Mol Biol
Humana Press, Totowa, NJ, pp 1–8 70:173–192. https://doi.org/10.1007/
5. Loyola-Vargas VM, Ochoa-Alejo N (2012) An s11103-009-9464-3
introduction to plant cell culture: the future 13. Zeng F, Zhang X, Zhu L et al (2006) Isolation
ahead. In: Loyola-Vargas VM, Ochoa-Alejo and characterization of genes associated to
N (eds) Plant cell culture protocols, meth- cotton somatic embryogenesis by suppres-
ods in molecular biology, vol 877. Humana sion subtractive hybridization and macroar-
Press, Heidelberg, pp 1–8. https://doi. ray. Plant Mol Biol 60:167–183. https://doi.
org/10.1007/978-1-61779-818-4_1 org/10.1007/s11103-005-3381-x
6. Loyola-Vargas VM, Ochoa-Alejo N (2016) 14. Yang X, Zhang X, Yuan D et al (2012)
Somatic embryogenesis. An overview. In: Transcript profiling reveals complex auxin
Loyola-Vargas VM, Ochoa-Alejo N (eds) signalling pathway and transcription regulation
Somatic embryogenesis. Fundamental involved in dedifferentiation and redifferen-
aspects and applications. Springer, tiation during somatic embryogenesis in cot-
Switzerland, pp 1–10. https://doi. ton. BMC Plant Biol 12:11010. https://doi.
org/10.1007/978-3-319-33705-0_1 org/10.1186/1471-2229-12-110
7. Loyola-Vargas VM, Ochoa-Alejo N (2016) 15. Xu Z, Zhang C, Zhang X et al (2013)
Somatic embryogenesis. Fundamental aspects Transcriptome profiling reveals auxin and cyto-
and applications. Springer, Switzerland. https:// kinin regulating somatic embryogenesis in
doi.org/10.1007/978-3-319-33705-0 different sister lines of cotton cultivar CCRI24.
8. Loyola-Vargas VM (2016) The history of J Int Plant Biol 55:631–642. https://doi.
somatic embryogenesis. In: Loyola-Vargas org/10.1111/jipb.12073
VM, Ochoa-Alejo N (eds) Somatic embryo- 16. Elbl P, Lira BS, Andrade SCS et al (2015)
genesis. Fundamental aspects and applications. Comparative transcriptome analysis of early
somatic embryo formation and seed devel- erations in genomic analyses. Nat Rev Genet
opment in Brazilian pine, Araucaria angus- 15:121–132. https://doi.org/10.1038/
tifolia (Bertol.) Kuntze. Plant Cell Tiss Org nrg3642
120:903–915. https://doi.org/10.1007/ 27. Goodwin S, McPherson JD, McCombie
s11240-014-0523-3 WR (2016) Coming of age: ten years of
17. Lai Z, Lin Y (2013) Analysis of the global next-generation sequencing technologies.
transcriptome of longan (Dimocarpus lon- Nat Rev Genet 17:333–351. https://doi.
gan Lour.) embryogenic callus using org/10.1038/nrg.2016.49
Illumina paired-end sequencing. BMC 28. Grabherr MG, Haas BJ, Yassour M et al (2011)
Genomics 14:56110. https://doi. Full-length transcriptome assembly from
org/10.1186/1471-2164-14-561 RNA-Seq data without a reference genome.
18. Salvo SAGD, Hirsch CN, Buell CR et al Nat Biotechnol 29:644–652. https://doi.
(2014) Whole transcriptome profiling of org/10.1038/nbt.1883
maize during early somatic embryogenesis 29. Schulz MH, Zerbino DR, Vingron M et al
reveals altered expression of stress factors and (2012) Oases: robust de novo RNA-seq assem-
embryogenesis-related genes. PLoS One bly across the dynamic range of expression lev-
9:e11140710. https://doi.org/10.1371/ els. Bioinformatics 28:1086–1092. https://
journal.pone.0111407 doi.org/10.1093/bioinformatics/bts094
19. Zhang Y, Zhang S, Han S et al (2012) 30. Andrews S, A FastQC (2015) A quality control
Transcriptome profiling and in silico analysis of tool for high throughput sequence data. 2010.
somatic embryos in Japanese larch (Larix lepto- Google Scholar. www.bioinformatics.babra-
lepis). Plant Cell Rep 31:1637–1657. https:// ham.ac.uk/projects/fastqc
doi.org/10.1007/s00299-012-1277-1 31. Ewing B, Hillier L, Wendl MC et al (1998)
20. Rajesh MK, Fayas TP, Naganeeswaran S et al Base-calling of automated sequencer traces
(2015) De novo assembly and characteriza- using Phred. I. Accuracy assessment. Genome
tion of global transcriptome of coconut palm Res 8:175–185. https://doi.org/10.1101/
(Cocos nucifera L.) embryogenic calli using gr.8.3.175
Illumina paired-end sequencing. Protoplasma 32. Martin M (2011) Cutadapt removes adapter
253:913–928. https://doi.org/10.1007/ sequences from high-throughput sequencing
s00709-015-0856-8 reads. EMBnet journal 17:10–12. https://doi.
21. Shi X, Zhang C, Liu Q et al (2016) De novo com- org/10.14806/ej.17.1.200
parative transcriptome analysis provides new 33. Compeau PEC, Pevzner PA, Tesler G (2011)
insights into sucrose induced somatic embryo- How to apply de Bruijn graphs to genome
genesis in camphor tree (Cinnamomum cam- assembly. Nat Biotechnol 29:987–991.
phora L.). BMC Genomics 17:2610. https:// https://doi.org/10.1038/nbt.2023
doi.org/10.1186/s12864-015-2357-8
34. Martin JA, Wang Z (2011) Next-generation
22. Michael TP, Jackson S (2013) The first 50 plant transcriptome assembly. Nat Rev Genet 12:671–
genomes. Plant Genome 6:10. https://doi. 682. https://doi.org/10.1038/nrg3068
org/10.3835/plantgenome2013.03.0001in
35. Garber M, Grabherr MG, Guttman M et al
23. Veeckman E, Ruttink T, Vandepoele K (2016) (2011) Computational methods for transcrip-
Are we there yet? Reliably estimating the com- tome annotation and quantification using
pleteness of plant genome sequences. Plant Cell RNA-seq. Nat Meth 8:469–477. https://doi.
28:1759–1768. https://doi.org/10.1105/ org/10.1038/nmeth.1613
tpc.16.00349
36. Haas BJ, Papanicolaou A, Yassour M et al
24. Murashige T, Skoog F (1962) A revised (2013) De novo transcript sequence recon-
medium for rapid growth and bio- struction from RNA-Seq: reference gen-
assays with tobacco tissue cultures. eration and analysis with trinity. Nat Prot
Physiol Plant 15:473–497. https://doi. 8:1494–1512. https://doi.org/10.1038/
org/10.1111/j.1399-3054.1962.tb08052.x nprot.2013.084
25. Quiroz-Figueroa FR, Monforte-González 37. NCBI RC (2016) Database resources of
M, Galaz-Ávalos RM et al (2006) Direct the National Center for Biotechnology
somatic embryogenesis in Coffea canephora. Information. Nucleic Acids Res 44:D7–D19.
In: Loyola-Vargas VM, Vázquez-Flota FA https://doi.org/10.1093/nar/gkv1290
(eds) Plant cell culture protocols. Humana
Press, Totowa, NJ, pp 111–117. https://doi. 38. Kanehisa M, Goto S (2000) KEGG: Kyoto
org/10.1385/1-59259-959-1:111 encyclopedia of genes and genomes.
Nucleic Acids Res 28:27–30. https://doi.
26. Sims D, Sudbery I, Ilott NE et al (2014) org/10.1093/nar/28.1.27
Sequencing depth and coverage: key consid-
39. Wu CH, Apweiler R, Bairoch A et al (2006) assessment of de novo transcriptome assem-
The universal protein resource (UniProt): an blies. Genome Res 26:1134–1144. https://
expanding universe of protein information. doi.org/10.1101/gr.196469.115
Nucleic Acids Res 34:D187–D191. https:// 45. Langmead B, Salzberg SL (2012) Fast
doi.org/10.1093/nar/gkj161 gapped-read alignment with bowtie 2. Nat
40. Góngora-Castillo E, Fedewa G, Yeo Y et al Meth 9:357–359. https://doi.org/10.1038/
(2012) Genomic approaches for interrogating nmeth.1923
the biochemistry of medicinal plant species. 46. Li H, Handsaker B, Wysoker A et al (2009)
In: David AH (ed) Methods in enzymology, The sequence alignment/map format and
Natural product biosynthesis by microorgan- SAMtools. Bioinformatics 25:2078–2079.
isms and plants, Part C, vol 517. Academic https://doi.org/10.1093/bioinformatics/
Press, Boston, pp 139–159. https://doi. btp352
org/10.1016/B978-0-12-404634-4.00007-3 47. Altschul SF, Gish W, Miller W et al (1990)
41. Góngora-Castillo E, Buell CR (2013) Basic local alignment search tool. J Mol Biol
Bioinformatics challenges in de novo transcrip- 215:403–410. https://doi.org/10.1016/
tome assembly using short read sequences in S0022-2836(05)80360-2
the absence of a reference genome sequence. 48. UniProt Consortium (2008) The universal
Nat Prod Rep 30:490–500. https://doi. protein resource (UniProt). Nucleic Acids Res
org/10.1039/C3NP20099J 36:D190–D195. https://doi.org/10.1093/
42. Li B, Fillmore N, Bai Y et al (2014) Evaluation nar/gkm895
of de novo transcriptome assemblies from 49. Suzek BE, Huang H, McGarvey P et al (2007)
RNA-Seq data. Genome Biol 15:553. https:// UniRef: comprehensive and non-redundant
doi.org/10.1186/s13059-014-0553-5 UniProt reference clusters. Bioinformatics
43. Honaas LA, Wafula EK, Wickett NJ et al 23:1282–1288. https://doi.org/10.1093/
(2016) Selecting superior de novo transcrip- bioinformatics/btm098
tome assemblies: lessons learned by lever- 50. Fuentes-Cerda CFJ, Monforte-González M,
aging the best plant genome. PLoS One Méndez-Zeel M et al (2001) Modification
11:e0146062. https://doi.org/10.1371/ of the embryogenic response of Coffea ara-
journal.pone.0146062 bica by nitrogen source. Biotechnol Lett
44. Smith-Unna R, Boursnell C, Patro R et al 23:1341–1343. https://doi.org/10.102
(2016) TransRate: reference-free quality 3/A:1010545818671
Chapter 30
Induction of Specialized Metabolism in In Vitro Cultures

of Capsicum chinense Jacq
Felipe A. Vázquez-Flota and María de Lourdes Miranda-Ham
Abstract
A protocol for the elicitation of capsaicinoids, the pungent principle of peppers, as well as for the biosyn-
thetic intermediaries vanillin and ferulic acid was developed for in vitro cell suspension cultures, and immo-
bilized placentas of Capsicum chinense Jacq. in vitro cultures were exposed to different doses of methyl
jasmonate and salicylic acid, which were effective in eliciting specialized metabolism in both of these cul-
tures, resulting in an increased accumulation of the analyzed metabolites.
Key words Capsicum chinense, Elicitation, Phenolics, Specialized metabolism
1 Introduction
In addition to a relatively reduced number of compounds involved

in basic cell functions and maintenance, plants produce a wide
diversity of chemicals that although not essential for their growth
and development can confer sharp adaptive advantages to adverse
environmental cues. Given their role in ecological interactions, the
synthesis of these compounds, collectively known as secondary or
specialized metabolites, is affected by environmental conditions,
including temperature, water availability, or contact with other liv-
ing organisms, such as microbes and herbivores [1]. In vitro cul-
tures can also respond to external stimuli triggering routes leading
to the synthesis of specialized metabolites [2]. Elicitation of in vitro
cultures consists of mimicking those environmental conditions that
lead to the synthesis of specialized metabolites in nature. This is
achieved through exposure of in vitro cultures to agents or events
prompting this response, such as UV radiation, extreme illumina-
tion, temperature, pH, reduced water availability, or the presence of
heavy metals [2]. However, simulating an attack by pathogens is
one of the most efficient and commonly employed strategies [3].
Cultures are exposed to cell components from cultured microor-
ganisms capable of activating defense pathways or to the chemical
429
430 Felipe A. Vázquez-Flota and María de Lourdes Miranda-Ham
mediators involved in this response, such as jasmonates or salicylic

acid. Although transcriptional activation of biosynthetic genes in
elicited cell suspensions is frequently detected, accumulation of the
final products is not always achieved due to requirements of a mul-
ticellular organization, which is absent in undifferentiated cell cul-
tures [4]. Although the relationship between cell organization and
specialized metabolism has long been established in plants, it is of
frequent occurrence that in less than ideal conditions, metabolite
accumulation is reduced significantly, rather than showing a com-
plete shutdown. Moreover, the use of well-differentiated organ cul-
tures can overcome this limitation [5]. The synthesis of capsaicinoids
(CPS), the pungent principle of peppers, provides a good example
of the relationship occurring between tissue organization and accu-
mulation of specialized metabolites. CPS are mainly produced and
accumulated in the placental tissue of hot Capsicum genotypes.
When CPS begin to accumulate, placental epithelial cells swell
forming blisters, which can only be observed in hot pepper cultivars
[6]. These structures are absent in cell cultures, and, therefore, a
limited CPS accumulation can be recorded. Interestingly, sections
of placental tissue of peppers can be maintained in vitro as metaboli-
cally active primary cultures [7]. A protocol for the elicitation of
both cell suspension and immobilized placental tissue cultures of
Capsicum chinense is described below. Methyl jasmonate (MeJa)
and salicylic acid (SA) were employed as elicitors, and responses to
them were dependent on the type of culture.
2 Materials
2.1 Biological Cell suspension cultures are induced from placentas of habanero
Materials pepper (Capsicum chinense Jacq). Unripe pods (ca. 6.0 × 2.5 cm)
are collected and disinfected with sodium hypochlorite and etha-
nol solutions:
1. Sodium hypochlorite [0.6% solution (v/v)]: Dilute 20 mL of a
commercial bleach solution (6% chlorine) in 200 mL of dis-
tilled water.
2. Ethanol [70% solution (v/v)]: Dilute 140 mL of ethanol in
200 mL of distilled water.
2.2 Culture Media All media for in vitro cultures must be prepared with deionized
water and are based on the Murashige and Skoog (MS) [8] formu-
lation, supplemented with 25 g/L sucrose and adjusted to pH 5.8.
Media are poured into Erlenmeyer flasks and sterilized in autoclave
20 min at 121 °C. For cell suspension cultures, 1.0 mg/L of
(2,4-D) is added, whereas calcium alginate-immobilized placentas
are kept in media free of growth regulators:
Capsaicinoid Synthesis in C. chinense In Vitro Cultures 431
1. 2,4-D (1.0 mg/mL) stock: Dissolve 100 mg 2,4-D in 10 mL

0.1 N KOH, and adjust volume to 100 mL with deionized
water.
2. Sodium alginate [2.5% solution (w/v)]: Dissolve 6.25 g of
sodium alginate in 250 mL of water, and autoclave at 121 °C.
3. Calcium chloride [CaCl2; 1% solution (w/v)]: Dissolve 10 g of
CaCl2 in 1 L of water, and autoclave at 121 °C. Keep at 4 °C.
2.3 Chemical 1. 10 mM methyl jasmonate stock solution: Dilute 22.9 μL MeJa
Elicitors (95%, ρ = 1.030 g/mL) in a total volume of 10 mL ethanol.
Sterilize the solution by filtration using 0.2 μm pore size nylon
sterile membranes.
2. 10 mM salicylic acid stock solution: Dissolve 13.8 mg SA
(99%) in 5 mL ethanol, and adjust the volume to 100 mL with
water. Sterilize the solution by filtration using 0.2 μm pore size
nylon sterile membranes.
2.4 CPS Analysis All reagents and solvents are of analytical grade and used without
further purification.
1. Pre-coated aluminum sheets (20 × 20 cm) and silica gel
60 F254 should be used.
2. Capsaicin (CAP), vanillin (VA), ferulic acid (FA) stock solutions:
Dissolve 10 mg of each capsaicin, vanillin, and ferulic acid stan-
dards in 1 mL absolute ethanol (10 μg/μL stock solution), and
use them to prepare dilution series from 1 to 10 μg/μL in
ethanol.
3. Acetone is used for extraction, while a 7:2:1 mixture of cyclo-
hexane, chloroform, and acetic acid (by vol.) is utilized for
chromatographic separation. This mixture is prepared by com-
bining 7.0, 2.0, and 1.0 mL of each solvent in a beaker shortly
before chromatographic development.
3 Methods
3.1 Induction of Cell suspension cultures are directly initiated from placentas
C. chinense Cell exscinded from C. chinense green (unripen) pods:
Suspension Cultures
1. Collect pepper pods (see Note 1) and soak them in soapy water
for 30 min, rinse them with tap water, and blot on paper tow-
els. Disinfect the pods by subsequent washes in 70% ethanol
(3 min), 0.6% sodium hypochlorite (15 min), and sterile
distilled water. Carry out these operations aseptically in a lami-
nar airflow cabinet.
2. Cut open the pods and extract the placenta using scalpel and
tweezers, remove the seeds, and rinse the tissue in sterile water
Fig. 1 Procedure for the extraction of placental tissues from habanero pepper pods. (a) Placentas are exscinded
from peppers with a scalpel. (b) Aspect of the entire placentas, previous to sectioning for immobilization
and MS medium free of sucrose and growth regulators (Fig. 1).

Carry out these operations aseptically in a laminar airflow
cabinet.
3. Incubate the entire placentas from two or three pods (see Note
2) in MS medium with 1.0 mg/L 2,4-D and 25 g/L sucrose
(MS-D) at 25 ± 2 °C in the dark with continuous agitation at
100 rpm. Use 25 mL of culture medium contained in 125 mL
Erlenmeyer flasks. Tissue disaggregation occurs after 1 week;
transfer suspended cells to fresh MS-D media, and then main-
tain them in the same media by biweekly subcultures at
25 ± 2 °C with continuous agitation at 100 rpm and continu-
ous light (photon flux density of 40–60 μmol m−2 s−1), pro-
vided by 39 W fluorescent lamps.
3.2 Immobilized 1. Collect, disinfect, and process pepper pods as described before
Cultures of (steps 1 and 2).
C. chinense Placenta 2. Cut sections of placental tissue of approximately 0.5 × 0.5 cm
(0.25 cm2), and suspend them in 2.5% sodium alginate at room
temperature inside a laminar airflow cabinet with constant,
gentle stirring (see Note 3).
3. Using a blunt 10 mL glass pipette, drop the placentas sus-
pended in alginate into sterile, cold 1% CaCl2, keeping con-
stant, gentle stirring (see Note 4). Alginate beads of ca. 0.7 mm
diameter should form, encapsulating the tissue sections.
Incubate at 4 °C for 90 min, and then wash with cold, distilled
water to eliminate excess calcium. Carry out these operations
aseptically in a laminar airflow cabinet.
4. Transfer between 35 and 40 beads to 40 mL of MS medium

without growth regulators. Keep immobilized tissues for up to
a 21-day culture period, either continuously or with a renewal
of medium after 14 days. Keep cultures at 25 ± 2 °C with con-
tinuous agitation at 100 RPM and light regime.
3.3 Elicitation of Cell Ten-day-old cell cultures, in the linear growth phase, are used in all
Suspension Cultures experiments:
1. Transfer 5 mL of the C. chinense cell suspension (containing
between 0.20 and 0.25 g FW/mL) to a 250 mL Erlenmeyer
flask, containing 40 mL of MS-D medium and cultivated for
10 days, as described in previous sections.
2. On the tenth day of culture, expose suspensions to a final con-
centration of 200 μM of each elicitor, by adding either 0.8 mL
of MeJa or SA stock solutions. This volume will render the
desired final concentration of 200 μM for either MeJa or
SA. Mock induce controls with the addition of 0.8 mL water.
3. Collect samples (triplicates) after 0, 24, 48, 72, and 96 h of
exposure to the elicitors. Collect cell package by filtration,
weigh, freeze in liquid nitrogen, and keep at −80 °C until
analysis.
3.4 Elicitation Fourteen-day-old cultures are used in all experiments:

of Immobilized
1. Expose alginate-immobilized placental cultures to a final con-
Placenta Cultures
centration of 200 μM of either elicitor, by adding 0.8 mL MeJa
or SA stock solutions. This volume will render the desired final
concentration of 200 μM for either MeJa or SA. Mock induce
controls with the addition of 0.8 mL of water.
2. Collect samples (triplicates) after 0, 24, 48, 72, and 96 h of
exposure to the elicitors. Collect alginate beads by filtration,
freeze in liquid nitrogen, and keep at −80 °C until analysis.
3.5 Extraction Metabolites are extracted from freeze-dried tissue and quantified
and Quantitation by densitometry after separation by thin layer chromatography
of Metabolites (TLC) in a Camag dual wavelength TLC Scanner 4 (Muttenz,
Switzerland) controlled by the WinCATS 1.4.10 planar chroma-
tography manager, as reported previously in [9]:
1. Homogenize 100 mg of freeze-dried tissue with 10 mL ace-
tone, and incubate at 45 °C for 2 h with gentle shaking.
Separate and eliminate cell debris by filtration, and dry the
extracts at low pressure. Dissolve the residue in 1 mL methanol
(see Note 5).
2. Load between 1 and 2 μL of the extract on silica gel 60 F254
chromatography plates (see Note 6).
3. In the same plate, load increasing volumes of a 1:10 dilution of

the standard solution, so that reference plots from 1 to 10 μg
can be built (see Note 7).
4. Separate metabolites on the TLC plate, using a mobile phase
of cyclohexane: chloroform: acetic acid (7:2:1 by vol.).
5. After chromatography, allow solvent mixture to evaporate and
visualize metabolites on the plate with short wave UV light
(254 nm). CAP, VA, and FA are identified as spots with Rf val-
ues of 0.16, 0.38, and 0.22, respectively, in this system (see
Note 8).
6. Quantify metabolites on the plates by in situ densitometry
using a Camag chromatoscanner with absorbance set to
280 nm.
CPS contents in immobilized placentas of habanero pepper
prior to elicitation reach values around 2.0 mg/g DW, whereas
those of VA and FE are much lower, in the order of 2.0 and
1.5 μg/g DW, respectively. Both treatments increase these values
between about five- and tenfold after 72–96 h. In cell suspensions,
CAP, VA, and FE accumulation reach around 6, 14, and 5 μg/g
DW, respectively, and the most marked increases are observed with
the SA treatment, particularly in VA contents (around tenfold after
48 h).
4 Notes
1. Peppers prior to full ripeness must be collected. This should

happen around 21 days after anthesis, once they are fully grown
(ca. 5.5 × 3 cm; long × width), but before color turning.
2. Exscinded placental tissue from two to three pods at the previ-
ously described stage should account for ca. 1.0 g FW.
3. For around 100 squares of placental tissue, use a 500 mL bea-
ker containing between 200 and 250 mL of the alginate solu-
tion. For better results, do not keep placentas in this solution
for longer than 2 h.
4. It is important to adjust the stirring speed, so that tissue sec-
tions get distributed evenly throughout the complete volume
of the solution in the beaker, avoiding the formation of a deep
vortex.
5. After grinding alginate beads, the powder is mixed with the
solvent and allowed to settle down for about 30 min. Alginate
residues are decanted, and tissue powder can be manually
recovered.
6. Alternatively, extracts can be diluted 5× in methanol and up to
10 μL loaded in the plates.
7. Once a complete reference plot (1–10 μg) has been obtained

and reproduced at least twice, two known amounts of the
standards should be loaded in each plate as references.
8. CPS refers to the contents of both CPS and dihydrocapsaicin,
since these compounds cannot be resolved in the chromato-
graphic plate.
References
1. Hartmann T (2007) From waste products to Biotechnol Lett 31:591–595. https://doi.

ecochemicals: Fifty years research of plant sec- org/10.1007/s10529-008-9881-4
ondary metabolism. Phytochemistry 68:2831– 6. Baas-Espinola FM, Castro-Concha LA,
2846. https://doi.org/10.1016/j. Vázquez-Flota F, Miranda-Ham ML (2016)
phytochem.2007.09.017 Capsaicin synthesis requires in situ phenylala-
2. Ramírez-Estrada K, Vidal-Limón H, Hidalgo nine and valine formation in in vitro maintained
D et al (2016) Elicitation, an effective strategy placentas from Capsicum chinense. Molecules
of the biotechnological production of bioactive 21:799. https://doi.org/10.3390/
high-added value compounds in plant cell fac- molecules21060799
tories. Molecules 21:182. https://doi. 7. Aldana-Iuit JG, Sauri-Duch E, Miranda-Ham
org/10.3390/molecules21020182 ML, Castro-Concha LA, Cuevas-Glory LF,
3. Guízar-González C, Monforte-González M, Vázquez-Flota F (2015) Nitrate promotes cap-
Vázquez-Flota F (2016) Yeast extract induction saicin accumulation in Capsicum chinense
of sanguinarine biosynthesis is partially depen- immobilized placentas. BioMed Res Intl
dent of the octadecanoic pathway in cell cul- 2015:1. https://doi.
tures of Argemone mexicana L., the Mexican org/10.1155/2738/794084
poppy. Biotechnol Lett 38:1237–1242. 8. Murashige T, Skoog F (1962) A revised
https://doi.org/10.1007/ medium for rapid growth and bioassays with
s10529-016-2095-2 tobacco tissue cultures. Plant Physiol 15:473–
4. Vázquez-Flota F, Loyola-Vargas V (2003) In 497. https://doi.
vitro plant cell culture as the basis for the devel- org/10.1111/j.1399-3054.1962.tb08052.x
opment of a research institute in Mexico: 9. Monforte-González M, Medina-Lara F,
Centro de Investigación Científica de Yucatán. Gutiérrez-Carbajal MG, Vázquez-Flota F
In Vitro Cell Dev-Pl 39:250–258. https://doi. (2007) Capsaicinoid quantitation by in situ
org/10.1079/IVP2002398 densitometry of thin layer chromatography
5. Vázquez-Flota F, Hernández-Domínguez E, plates. J Liq Chromatogr Relat Technol
Miranda-Ham ML, Monforte-González M 30:1697–1704. https://doi.
(2009) A differential response to chemical elici- org/10.1080/10826070701225041
tors in Catharanthus roseus in vitro cultures.
Chapter 31
Analysis of Terpenoid Indole Alkaloids, Carotenoids,

Phytosterols, and NMR-Based Metabolomics
for Catharanthus roseus Cell Suspension Cultures
Mohd Zuwairi Saiman, Natali Rianika Mustafa, and Robert Verpoorte
Abstract
The plant Catharanthus roseus is a rich source of terpenoid indole alkaloids (TIA). Some of the TIA are
important as antihypertensive (ajmalicine) and anticancer (vinblastine and vincristine) drugs. However,
production of the latter is very low in the plant. Therefore, in vitro plant cell cultures have been considered
as a potential supply of these chemicals or their precursors. Some monomeric alkaloids can be produced by
plant cell cultures, but not on a level feasible for commercialization, despite extensive studies on this plant
that deepened the understanding of the TIA biosynthesis and its regulation. In order to analyze the
metabolites in C. roseus cell cultures, this chapter presents the method of TIA, carotenoids, and phytoster-
ols analyses. Furthermore, an NMR-based metabolomics approach to study C. roseus cell culture is
described.
Key words Gas chromatography, High-performance liquid chromatography (HPLC), Metabolomics,

Nuclear magnetic resonance (NMR), Periwinkle, Plant cell suspension, Tissue culture
1 Introduction
The plant Catharanthus roseus has been traditionally used to treat

numerous ailments such as diabetes, cough, sore throat, and eye
infections and has been reported to have astringent and diuretic
activity [1]. These medicinal properties are contributed to an array
of terpenoid indole alkaloids (TIA) in the plant. In the roots,
ajmalicine and serpentine are the major alkaloids of which the for-
mer is used as an antihypertensive drug. In the leaves, very low
amounts of the bisindole/dimeric alkaloids vinblastine and vincris-
tine are present. These alkaloids are pharmaceutically important
antitumor drugs. Besides the isolation of these alkaloids, their
much more abundant precursors vindoline and catharanthine are
isolated and used for a biomimetic coupling to yield the dimeric
alkaloids [2, 3]. Cell suspension cultures are extensively studied for
the possible commercial production of the mentioned alkaloids,
437
438 Mohd Zuwairi Saiman et al.
but the p roduction of the TIA is too low for any commercial pro-
duction. To engineer the metabolic pathway in the plant or the
plant cell cultures requires an in-depth understanding of the TIA
pathway. For example, recent studies on the C. roseus cell cultures
resulted in the full elucidation of the iridoid pathway leading
toward secologanin that together with tryptamine give strictosi-
dine, the universal precursor of a large number of TIA in many
different plant species [3–5].
Since more than 40 years, different HPLC methods have been
reported for detecting TIA in C. roseus plants and cell cultures [6].
This chapter presents the procedure for simple and rapid analysis of
TIA in C. roseus cell cultures [7, 8]. The methods of extraction,
detection, and quantification of TIA and precursors were adapted
from previous reports [9, 10]. To understand the channeling of
carbon in the terpenoid pathways, carotenoids and phytosterols
analyses were carried out for C. roseus cell cultures [7, 8]. The phy-
tosterol analysis using GC-FID is our in-house protocol. For carot-
enoids, the extraction method [11] and HPLC analysis were
modified from different previously reported methods [12, 13]. In
the last part, the NMR-based metabolomics analysis in C. roseus
cell cultures is described [8, 14]. As compared to the targeted TIA,
carotenoids, and phytosterol analyses, NMR-based metabolomics
is considered as an untargeted approach for profiling all kind of
metabolites or to evaluate changes of metabolome due to biotic or
abiotic treatments.
2 Materials
2.1 Cell Harvesting 1. C. roseus cell suspension cultures.

2. Filter apparatus: Büchner funnel, Büchner flask, filter paper
(size according to Büchner funnel), and vacuum pump.
3. Distilled water or Milli-Q water.
4. Spatula.
5. Fifty milliliter Falcon tubes.
6. Tissue papers and rubber bands.
7. A cryogenic vessel filled with liquid nitrogen.
2.2 Analysis of TIA 1. Ten milliliter glass tubes with screw cap and a tube rack.
2. Measuring cylinders, micropipettes, and pipette tips.
3. Organic solvent for extraction: methanol (ACS grade).
4. Acid solution for extraction: 1 M phosphoric acid (H3PO4).
Transfer 6.78 mL of concentrated orthophosphoric acid (85%,
1.685 g/mL) into a 250 mL glass bottle and dilute with
93.22 mL of water.
Natural Products from Catharanthus roseus 439
5. Extraction equipment: vortex, sonicator, centrifuge, 25 mL

round bottom flasks, rotavapor, syringe filter (0.45 μm), and
HPLC vials.
6.
Standard compounds: Strictosidine and secologanin
(Phytoconsult, The Netherlands), loganic acid, loganin,
tabersonine·HCL, and vindoline (Phytolab, Germany),
tryptamine·HCl (Aldrich Chemical, USA), L-tryptophan and
ajmalicine·HCL (Sigma-Aldrich, USA), serpentine·HCL
(ROTH, Germany), catharanthine sulfate, anhydrovinblastine
sulfate, vinblastine sulfate, and vincristine sulfate (Pierre Fabre,
France). Dissolve compounds in water or methanol depending on
their solubility and the stock concentration required for calibration
curves in a suitable concentration range for each alkaloid.
7. HPLC solvents for TIA analysis (Method 1): 5 mM Na2HPO4
(pH 6) is used as solvent A. Weigh 1.42 g of Na2HPO4,
dissolve in 100 mL of water to make 0.1 M Na2HPO4, and
dilute 50 mL of this solution (0.1 M Na2HPO4) with 950 mL
of water to make 1 L of 5 mM Na2HPO4. Subsequently, add
about 2.5–3 mL of 1 M H3PO4 to adjust the pH solvent to 6.
Acetonitrile (HPLC grade solvent) is used as solvent B.
8. HPLC mobile phase for analysis of TIA precursors (Method
2): A mixture of 0.01 M phosphoric acid (H3PO4) and aceto-
nitrile (85:15, v/v) is used. To make 0.01 M of H3PO4, dilute
10 mL of 1 M H3PO4 with 900 mL of water. Transfer 150 mL
of the solution (0.01 M H3PO4) to a 500 mL glass bottle and
mix with 150 mL of acetonitrile. Filter the mixture and degas
for 20 min.
9. HPLC systems: Analysis of TIA (Method 1) was performed
using an Agilent Technologies 1200 series chromatograph
(Agilent Technologies Inc., USA), and analysis of TIA precur-
sors (Method 2) was performed using a Waters HPLC system
(Waters, USA). Both systems are equipped with autosampler
and photodiode array detector (DAD). HPLC column: Zorbax
Eclipse XDB-C18 (250 mm × 4.6 mm column) (Agilent,
USA) with a SecurityGuardTM column (Phenomenex, USA).
2.3 Analysis 1. Ten milliliter amber glass vials and 15 ml glass tubes with
of Carotenoids screw cap.
3. Solvent for crude extraction: methanol (ACS grade solvent).
4. Solvent for carotenoid extraction: chloroform (ACS grade)
containing 0.1% butylated hydroxytoluene (BHT, w/v) by
adding 100 mg of BHT into 100 mL of chloroform.
5. Prepare 200 mL of 50 mM Tris buffer (pH 7.5) containing
1 M sodium chloride (NaCl) and 0.1% BHT (w/v) by adding
1.21 g Tris, 11.69 g NaCl, and 200 mg BHT.
6. Extraction apparatus: vortex, centrifuge.

7. Ice and icebox (to keep the samples at about 0–4 °C).
8. Nitrogen gas to dry the solvent.
9. HPLC: methanol (HPLC grade) as a solvent, an HPLC sys-
tem (Waters, USA) equipped with autosampler and photodi-
ode array detector (DAD), and a Vydac 201TP54 C18 column
(250 mm × 4.6 mm, particle size 5 μ) (Grace, USA).
10. Standard compounds: β-carotene (Sigma-Aldrich, USA) and
lutein (Phytolab, Germany).
2.4 Analysis 1. Ten milliliter glass tubes with screw cap.

of Phytosterols 2. Measuring cylinders, micropipettes, and pipette tips.
3. A stock solution (0.5 mg mL−1) of an internal standard
5α-cholestan-3β-ol. Weigh 12 mg of the standard compound,
transfer in a 50 mL glass bottle, and dissolve in 25 mL of
n-hexane.
4. One molar potassium hydroxide (KOH) in 95% ethanol: dis-
solve 1.12 g of KOH in 1 mL water, followed by 19 mL of
absolute ethanol. This mixture must be freshly made.
5. n-Hexane, n-hexane containing 0.01% BHT, n-hexane/ethyl
acetate (95:5, v/v).
6. Distilled water or Milli-Q water.
7. BondElut Silica SPE cartridge (1 mL size).
8. Pyridine.
9. N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) contain-
ing 1% trimethylchlorosilane (TMCS) – purchased as premix
reagent.
10. Apparatus: SpeedVac, vortex, sonicator, heating block, centri-
fuge, and horizontal shaker.

11. GC-FID system: an Agilent GC 6890 series (Agilent
Technologies Inc., USA) equipped with a flame ionization
detector (FID). The column is a DB-5 (5%-phenyl-methylpoly-
siloxane) capillary column (30 m length, 0.25 mm internal
diameter, film thickness of 0.25 μm) (J&W Scientific Inc., USA).
12. Standard compounds: β-sitosterol, campesterol, and stigmas-
terol (Sigma-Aldrich, USA).
2.5 NMR-Based 1. Two milliliter microcentrifuge tubes.

Metabolomics 2. NMR tubes (5 mm).
Analysis
4. Methanol–d4 (CD3OD) 99.8%.
5. KH2PO4 (ACS reagent).
6. Deuterium oxide (D2O) > 99.9% atom D.

7. Sodium deuteroxide (NaOD) 99.5% (40% in D2O).
8. 3-(trimethylsilyl)propionic-2,2,3,3-d4 acid sodium salt (TSP),
99% atom D.
9. Prepare phosphate buffer (90 mM, pH 6.0) by adding 1.232 g
of KH2PO4 and 10 mg of TSP (0.01%) to 100 mL of
D2O. After stirring until total dissolution, adjust the pH using
1.0 M NaOD. Prepare 1.0 M NaOD by adding 1 mL of
NaOD (40%, 10 M) to 9 mL of D2O and mix them well.
10. NMR system: Bruker AV 600 MHz spectrometer equipped
with cryoprobe.
11. Software for phasing, baseline correction, and calibration of
spectra: XWIN-NMR/TopSpin (Bruker).
12. Bucketing software: AMIX (Bruker).
13. Multivariate data analysis software: SIMCA-P+ (Umetrics) or
comparable software.
3 Methods
3.1 Cell Harvesting 1. Harvest C. roseus cell suspension cultures by filtering the cells
under reduced pressure using a Büchner funnel. Wash cells
with distilled water or Milli-Q water three times (see Note 1).
2. Transfer the cells into a 50 mL Falcon tube and close the tube
with tissue paper tied with a rubber band. Plunge the tube in
liquid nitrogen. Lyophilize the cells for 72 h in a freeze dryer
(see Note 2).
3. Store the dried cells at room temperature in the dark until fur-
ther analysis.
3.2 Analysis 1. Weigh 100 mg of the C. roseus freeze-dried cells, transfer into
of Terpenoid Indole a clean glass tube with screw cap.
Alkaloids 2. Transfer 5 mL of methanol into the tube, close the tube, vor-
and Precursors tex the mixture for 10 s, ultrasonicate for 20 min, and centri-
fuge at 4000 × g for 30 min. Pool the supernatant into a 25 mL
round bottom flask. Repeat these steps twice. Concentrate the
pooled supernatant to dryness under reduced pressure using
rotavapor (see Note 3).
3. Resuspend the residue in 1 mL of 1 M phosphoric acid
(H3PO4), vortex for 10 s, and centrifuge at 16,000 × g for
10 min. Filter the supernatant through syringe filter (0.45 μm)
before analysis.
4. Two different methods are used for TIA and TIA precursor
analysis. Method 1 is to analyze a number of TIA, i.e., stricto-
sidine, ajmalicine, serpentine, catharanthine, tabersonine,

vindoline, anhydrovinblastine, vinblastine, and vincristine.
Prepare solvent A (5 mM Na2HPO4, pH adjusted to 6.0 with
H3PO4) and solvent B (acetonitrile). Inject 50 μL of sample
dissolved in 1 M H3PO4 to the HPLC-DAD system (Agilent
Technologies 1200 series chromatograph). The flow rate is
1.5 mL min−1. The eluent profile (volume of solvent A/vol-
ume of solvent B) is as follows: 0–20 min (linear gradient from
80:20 to 20:80); 20–25 min (isocratic elution with 20:80
(v/v)); 25–30 min (linear gradient from 20:80 to 80:20); and
30–31 min (isocratic elution with 80:20 (v/v)). The UV wave-
length is set to record the spectra at 220 nm (strictosidine,
ajmalicine, catharanthine, anhydrovinlastine, vinblastine,
vincristine), 254 nm (serpentine), 280 nm (strictosidine,
ajmalicine, catharanthine, anhydrovinblastine, vinblastine,
vincristine,), 306 nm (serpentine, vindoline), and 320 nm
(tabersonine). The column is a Zorbax Eclipse XDB-C18
(250 mm × 4.6 mm column) (Agilent, USA) with a
SecurityGuardTM column (Phenomenex, USA).
5. Method 2 is to analyze TIA precursors, i.e., tryptophan,
tryptamine, loganic acid, loganin, and secologanin. Prepare a
solvent mixture of 0.01 M H3PO4: acetonitrile (85:15, v/v).
Inject 50 μL of sample dissolved in 1 M H3PO4 to the HPLC
system (Waters, Milford, MA, USA). The flow rate is
1.5 mL min–1 with an isocratic elution. The UV absorption is
280 nm for tryptophan and tryptamine and 236 nm for loganic
acid, loganin, and secologanin. The column was a Zorbax
Eclipse XDB-C18 as mentioned in Method 1 (see Note 4).
6. Identify peaks by comparing the retention time and the UV
spectra of the target peaks with those of the standard com-
pounds (Figs. 1, 2, and 3). Make calibration curves of the
standard compounds for quantitative analysis.
3.3 Analysis 1. Weigh 100 mg of freeze-dried cells, transfer them into a 15 mL
of Carotenoids glass tube with screw cap, and extract with 3 mL of methanol
by vortexing for 10 s. Subsequently, add 0.5 mL of water and
perform liquid-liquid extraction by adding 2.5 mL of chloro-
form (containing 0.1% butylated hydroxytoluene [BHT,
w/v]), followed by vortexing for 10 s. Place the tube (the
mixture) on ice (~4 °C) in the dark for 10 min (see Note 5).
2. Add 3 mL of 50 mM Tris buffer (pH 7.5) containing 1 M
sodium chloride and 0.1% BHT (w/v). Vortex for 1 min and
incubate again on ice in the dark for 10 min.
3. Centrifuge the mixture at 3000 × g (4 °C) for 10 min. Transfer
the chloroform phase into a 10 mL amber vial. Reextract the
polar phase residue twice with 1.5 mL chloroform (containing
a
mAU
7
800
600
1
400 2 3 4
5
6
200 8
9
5 10 15 20 25 min
b
mAU
1
1750
1500
1250
1000
750
2
500
250
5 10 15 20 25 min
Fig. 1 HPLC-DAD chromatograms of the standard terpenoid indole alkaloids (a) and Catharanthus roseus CRPP
cell line (b) at 254 nm wavelength using Method 1. 1, strictosidine; 2, serpentine; 3, vincristine; 4, vinblastine;
5, catharanthine; 6, vindoline; 7, ajmalicine; 8, anhydrovinblastine; and 9, tabersonine
0.1% BHT, w/v), incubate on ice (~4 °C) in the dark for

10 min, and pool the chloroform phase in the vial.
4. Concentrate the chloroform extract to dryness under nitrogen
gas flow. Redissolve the residue in 1 mL methanol (containing
0.1% BHT, w/v) and transfer into a 1.5 mL microcentrifuge
tube. Centrifuge the sample at 16,000 × g for 5 min, transfer
the clear supernatant to an HPLC vial, and analyze using
HPLC-DAD [12].
Fig. 2 HPLC-DAD chromatograms of the standard 1, loganic acid; 2, tryptophan; 3, tryptamine; 4, loganin; and
5, secologanin at 236 nm using Method 2
5. Load 40 μL of sample into a Waters HPLC system (Waters).

Use a Vydac 201TP54 C18 column (250 mm × 4.6 mm, particle
size 5 μm) (Grace, Deerfield, IL, USA). The mobile phase is an
isocratic elution of 100% methanol (HPLC grade) with a flow
rate of 1 mL min−1. Identification of peaks is by comparing the
retention time and the UV spectra wavelength at 450 nm for
the detection of carotenoids and 436 nm for the detection of
chlorophylls [12, 13] (Fig. 4). Calibration curves of the
standard compounds lutein and β-carotene are made for quan-
titative analysis (see Note 6).
3.4 Analysis 1. Transfer 60 μL of internal standard 5α-cholestan-3β-ol

of Phytosterols (0.5 mg mL−1) (see Note 7) into a 10 mL glass tube and dry
under reduced pressure using a SpeedVac. Add 50 mg of
freeze-dried samples into the tube.
2. Add 1 mL of 1 M potassium hydroxide in 95% ethanol (w/v)
(see Note 8). Vortex for 10 s, ultrasonicate for 5 min, and
subsequently incubate the sample at 80 °C for 30 min on a
heating block (see Note 9).
3. Cool the sample to room temperature, add 1 mL of water, and
centrifuge at 4000 × g for 5 min. Transfer the supernatant into
a clean glass tube and add 1 mL of water and 1 mL of n-hexane
(containing 0.01% BHT, see Note 10). Agitate the sample hor-
izontally on a shaker for 5 min. Centrifuge at 4000 × g for
5 min and transfer the hexane layer into a clean glass tube (see
Note 11). Repeat this step one more time. Evaporate the
pool hexane extract to dryness using a SpeedVac.
0.50
221.0 0.80 225.7 249.3
0.006
0.70 Serpentine
0.40
0.004 Strictosidine 0.60 Ajmalicine 249, 306, 363
221, 280 226, 280
0.002 0.50 0.30 306.2
0.40
AU
AU
AU
0.000
0.20
0.30
-0.002
0.20 280.0
0.10
-0.004 0.10 363.3
321.6 383.6
0.00 0.00
-0.006
220.00 380.00 220.00 380.00 220.00 380.00
nm nm nm
1.20 223.4 212.8 0.22 327.6
0.50 0.20
1.00 0.18
0.40 0.16
0.80 Catharanthine Vindoline 0.14
223, 282 0.30
213, 253, 305 0.12
AU
0.60
AU
AU
0.10 Tabersonine
0.20 0.08 220, 302, 328
0.40
282.4 0.06
252.8
0.20 0.10 305.0 0.04
0.02
0.00 0.00 0.00
220.00 380.00 220.00 380.00 220.00 380.00

nm nm nm
0.20 215.1 222.2 226.9

0.25
0.18
0.25
0.16 0.20
0.14 0.20 Vincristine
0.12 222, 255, 297 0.15
Vinblastine Loganic acid
0.10 0.15
215, 268 227
AU
AU
AU
0.08 0.10
0.10 255.2 296.7
0.06 268.2
0.04 0.05 0.05

0.02
387.4
366.8 366.7
0.00 0.00 0.00
220.00 380.00 220.00 380.00 250.00 300.00 350.00

nm nm nm
236.3 236.3 219.8

2.00 0.10
1.00
1.80
1.60 0.08
0.80 Tryptophan/
1.40
Tryptamine
1.20 0.06
Secologanin 0.60 220, 279
Loganin
AU
AU
AU
1.00
236
0.80 236 0.04
0.40 278.9
0.60
0.40 0.02
0.20
0.20
0.00 345356.6
3870.0
0.00 0.00
250.00 300.00 350.00 250.00 300.00 350.00 250.00 300.00 350.00

nm nm nm
Fig. 3 UV absorption spectra of terpenoid indole alkaloids and precursors
4. Dissolve residue in 100 μL of n-hexane. Clean up the sample

from carotenoids using 1 mL BondElut Silica SPE cartridge
with 5 mL of n-hexane. Repeat this step one more time. Elute
the target compounds from the cartridge with 5 mL of
Fig. 4 HPLC-DAD chromatograms of carotenoids and chlorophylls in Catharanthus roseus CRPP and CRPM
cell line at 450 nm wavelength
n-hexane/ethyl acetate (95:5, v/v), collect this fraction (see

Note 12), and evaporate to dryness using a SpeedVac.
5. Dissolve residue in 200 μL of pyridine and 100 μL of N,O-
bis(trimethylsilyl)trifluoroacetamide (BSTFA) containing 1%
trimethylchlorosilane (TMCS). Vortex the mixture for 10 s
and incubate at 80 °C for 30 min on a heating block. Cool the
sample at room temperature prior to analysis with gas
chromatography.
6. Load 5 μL of sample into the GC system, an Agilent GC 6890
series (Agilent Technologies Inc.), equipped with a flame ion-
ization detector (FID) and a DB-5 (5%-phenyl-
methylpolysiloxane) capillary column (30 m length, 0.25 mm
internal diameter, film thickness of 0.25 μm) (J&W Scientific
Inc., Folsom, CA, USA). Set the injector temperature to
280 °C, a split ratio of 1:10 and a carrier gas (N2) flow rate of
1 mL min−1. Program the oven temperature starting at
200 °C. The initial temperature starts at 200 °C for 1 min,
subsequently increase from 200 °C to 290 °C at 10 °C min−1
and hold at 290 °C for 15 min, providing a total run time of

25 min per sample. Set the FID detector temperature to
300 °C. Identify the peaks by the retention time compared
with those of authentic references (Fig. 5). Make calibration
curves of the standard references for quantitative analysis.
3.5 NMR-Based 1. Weigh 25 mg of freeze-dried cells and put in 2 mL microcen-
Metabolomics trifuge tube (see Note 13).
Analysis 2. Add 1.2 mL of deuterated methanol (CD3OD) and followed
by 0.3 mL of KH2PO4 buffer in D2O (pH 6.0, containing
0.01% w/w trimethylsilylpropanoic acid (TSP) as internal
standard) (see Note 14).
3. Vortex the mixture for 10 s, sonicate for 10 min, and centri-
fuge at 16,000 × g for 15 min.
4. Transfer 800 μL of the supernatant into NMR tube. Measure
samples using a Bruker AV 600 MHz NMR spectrometer with
cryoprobe (see Note 15).
5. The parameters for 1H-NMR are as follows: spectra are
recorded at 25 °C, consisted of 128 scans requiring 10 min
and 26 s acquisition, 0.16 Hz/point, pulse width of 30
(11.3 μs), and relaxation delay of 1.5 s. Methanol-d4 is used
as the internal lock. A presaturation sequence is used to sup-
press the residual water signal with low-power selective irra-
diation at the water frequency during the recycle delay. Free
induction decay was Fourier transformed with a line-
broadening (LB) factor of 0.3 Hz (see Note 16).
6. The parameters for 2D-NMR are as follows: J-resolved spectra
are acquired using 8 scans per 64 increments for F1 and
1638.4 k for F2 using spectral widths of 6009.6 Hz in F2
(chemical shift axis) and 50 Hz in F1 (spin-spin coupling con-
stant axis). A 1.5 s relaxation delay. Datasets are zero filled to
512 points in F1, and both dimensions are multiplied by sine-
bell functions (SSB = 0) prior to double complex FT. The
1H-1H correlated spectroscopy (COSY) spectra were acquired
with a 1.0 s relaxation delay and 6009.6 Hz spectral widths in
both dimensions. The window function for the COSY spectra
was sine-bell (SSB = 0). The HMBC spectra are obtained with
1.0 s relaxation delay, 30,183 Hz spectral width in F2, and
27,164 Hz in F1. Qsine (SSB = 2.0) is used for the window
function of the HMBC (see Note 17).
7. Process the resulting 1H-NMR spectra with phasing, baseline
correction, and calibration to TSP at 0.0 ppm by using soft-
ware XWIN-NMR/TopSpin (Bruker). Reduce 1H-NMR
spectra to an ASCII file, with total intensity scaling, using the
software AMIX (Bruker). Bucket the spectral data to equal
width (δ 0.04) corresponding to the region of δ 0.40–10.00
a
pA
3
120 2
110
100
1
90
80
70
60
50
40
5 7.5 10 12.5 15 17.5 20 22.5 min
b
pA
200 5
180 1
160
140 3
120
100
4
80
60 2
40
5 7.5 10 12.5 15 17.5 20 22.5 min
Fig. 5 GC-FID chromatograms of standard phytosterols (a) and Catharanthus roseus CRPP cell line (b). 1,
campesterol; 2, stigmasterol; 3, β-sitosterol; 4, cholestane (internal standard); and 5, phytol
(see Note 18). Remove the regions of δ 4.75–4.90 and δ

3.30–3.35 (see Note 19).
8. Manually phase all 2D-NMR spectra and correct the baseline.
The J-resolved spectra are tilted by 45o, symmetrized about
the central line along F2. Calibrate all spectra to the internal
standard (1H (TSP = 0.0 ppm) and 13C (CD3OD = 49.0 ppm)).
Fig. 6 Score plot (a) and loading plot (b) of orthogonal projection to latent structures discriminant analysis
(OPLS-DA) of jasmonic acid elicited (●) and control (○) samples of the Catharanthus roseus CRPP cell line
measured by 1H-NMR. The numbers in the score plot are harvesting time (hour) after treatments. Figure taken
from reference [8]
9. Apply the 1H-NMR data to multivariate data analysis (see Note

20, Fig. 6) using SIMCA-P+ software (Umetrics, Umeå,
Sweden).
10. Identify metabolites by comparing 1H-NMR and 2D-NMR
spectra to the reference spectra or database (Table 1, Fig. 7).
4 Notes
1. Set up the apparatus for cell filtering using a Büchner funnel,

a Büchner flask, and a vacuum pump. Place a filter paper on
the Büchner funnel and pour the cell culture onto the paper
Table 1
Characteristic signals of 1H chemical shift (δ in ppm) and coupling constants (J in Hz) of some
metabolites detected in Catharanthus roseus cell cultures
Compounds Chemical shift (ppm) and coupling constant (Hz)

Leucine δ 0.97 (d, J = 6.8); δ 0.99 (d, J = 6.8)
Isoleucine δ 0.96 (t, J = 7.5); δ 1.03 (d, J = 7.0)
Valine δ 1.01 (d, J = 7.0); δ 1.06 (d, J = 7.0)
Loganic acid δ 1.08 (d, J = 6.7); δ 4.68 (d, J = 8.0); δ 5.27 (d, J = 3.5); δ 7.08 (s)
Threonine δ 1.34 (d, J = 6.6)
Alanine δ 1.49 (d, J = 7.2)
Acetic acid δ 1.92 (s)
Glutamic acid δ 2.04 (m); δ 2.12 (m); δ 2.39 (m)
Glutamine δ 2.13 (m); δ 2.46 (m)
Succinic acid δ 2.51 (s)
Malic acid δ 2.68 (dd, J = 15.4, 3.3); δ 4.28 (dd, J = 9.5, 3.2)
Aspartic acid δ 2.82 (dd, J = 17.0, 8.0); δ 2.95 (dd, J = 16.8, 4.0); δ 3.92 (dd, J = 8.4, 4.0)
Sucrose δ 4.18 (d, J = 8.6); δ 5.41 (d, J = 3.8)
Glucose δ 4.58 (d, J = 8.0, β-form); δ 5.19 (d, J = 3.8, α-form)
Fumaric acid δ 6.52 (s)
Tyrosine δ 6.85 (d, J = 8.5) δ 7.19 (d, J = 8.5)
Tryptophan δ 7.14 (t, J = 7.5); δ 7.22 (t, J = 7.5); δ 7.29 (s); δ 7.48 (d, J = 8.0); δ 7.73 (d,
J = 8.0)
Tryptamine δ 7.14 (t, J = 7.5); δ 7.22 (t, J = 7.5); δ 7.28 (s); δ 7.48 (d, J = 8.0); δ 7.65 (d,
J = 8.0)
Phenylalanine δ 7.36 (m)
Strictosidine δ 7.07 (t, J = 7.5); δ 7.16 (t, J = 7.5); δ 7.37 (d, J = 8.0); δ 7.49 (d, J = 8.0); δ
7.80 (s); δ 5.80 (d, J = 8.5)
Formic acid δ 8.48 (s)
s singlet, d doublet, dd double doublet, t triplet, m multiplet
with reduced pressure. The liquid medium flows through the

Büchner flask can be subject for TIA analysis. Collect the liquid
medium in a microcentrifuge tube, centrifuge at 16,000 × g for
5 min, and inject 150 μL of the supernatant into HPLC [15].
Cells should be rinsed with distilled water or Milli-Q water to
remove sugar or chemicals in the liquid culture.
2. Harvested cells should be immediately quenched in liquid

nitrogen to stop metabolic activity. Lyophilize the cells in a
freeze dryer for at least 72 h to minimize water content of the
cells. It is estimated that about 90–95% of the mass of C. roseus
cell culture consists of water. Minimum water content is
crucial for NMR analysis.
3. The pooled extracts can be collected into a clean glass tube
and concentrated under reduced pressure using a SpeedVac.
4. Mobile phase solvents for HPLC need to be filtered using
membrane filter (e.g., cellulose acetate for aqueous solution
and PTFE for organic solvent) and subsequently degassed by
sonication for 20 min. Despite using HPLC Waters system,
Method 2 can also be applied in an Agilent HPLC system.
Injection volume is 50 μL but can be adjusted depending on
the concentration of the compounds in the sample. An HPLC
column Zorbax Eclipse XDB-C18 (250 mm × 4.6 mm col-
umn) (Agilent, USA) is used for both Method 1 and 2. Some
other types of C-18 columns have been tested but resulted in
different chromatograms, and compound separations were
not better than on a Zorbax Eclipse column. Different C18-
based stationary phases may give differences in selectivity.
5. BHT is added in chloroform or methanol as antioxidant.
Methanol, water, and chloroform are pre-cooled before use.
Incubate extracts/samples on ice (~4 °C) in the dark condi-
tion, e.g., put the tube’s samples on ice in a polystyrene icebox
to minimize isomerization or degradation of carotenoids upon
light and heat effects.
6. Carotenoids can be classified as oxygenated carotenoids called
xanthophylls and unoxygenated carotenoids known as caro-
tenes. As we did not have all the standard compounds of carot-
enoids, identification of the peaks was done by comparing the
retention time and the pattern of UV spectra at 436–450 nm
wavelength (12, 13). For quantification of the carotenoids, we
made calibration curves for two standard compounds, i.e.,
lutein and β-carotene, representing the groups of xanthophylls
and carotenes, respectively. Calculation of xanthophylls, e.g.,
lutein, violaxanthin, neoxanthin, and zeaxanthin, was based
on the calibration curve of lutein, where for β-carotene and
α-carotene, a calibration curve of β-carotene was used. If
possible, it is recommended to make calibration curves for all
individual compounds.
7. An internal standard 5α-cholestan-3β-ol is used in this study.
Concentration of internal standard and loading volume can be
adjusted depending on the preliminary result.
8. Prepare a fresh solution of 1 M KOH because after a few days,
the solution may turn to a yellow-orange color. In case of
spongy cells or the cells do not immerse in the solution, add
more of 1 M KOH, e.g., 3 mL. Alkaline hydrolysis of esterified

sterols to free sterols is achieved by adding 1 M KOH in etha-
nol. This method extracts free sterol and esterified sterol from
the samples. Acid hydrolysis method can be added prior to the
saponification, to hydrolyze sterol glycosides. In this case, the
sample is hydrolyzed with hydrochloric acid at 80–100 °C fol-
lowed by nonpolar extraction. The extract is evaporated to
dryness before proceeding to saponification.
9. Water bath can be used as other alternative of heating block.
10. BHT is added in n-hexane as an antioxidant.
11. Hexane layer contains among others carotenoids and phy-
tosterols, and water layer contains fatty acids. Water layer
can be kept for fatty acid analysis and that method is not
discussed here.
12. BondElut Silica SPE cartridge (1 mL) is used to pre-clean the
sample extract. This cartridge is commercially available.
Initially, the sample extract is washed with 5 mL n-hexane
(two times), and the flow through containing carotenoids is
discarded. Subsequently, wash with 5 mL n-hexane/ethyl ace-
tate (95:5, v/v) and collect the clear eluent containing
phytosterols.
13. Sample size of 25 mg (or 50 mg) freeze-dried cells is sufficient
for NMR analysis, considering that the sample is extracted in
2 mL microcentrifuge tube.
14. MeOD/phosphate buffer (80:20) is used to extract C. roseus
cells because it provides a better result than MeOD/phos-
phate buffer (50:50) [14], especially the area of aromatic signal
(6.0–8.5 ppm). This method is suitable for polar compounds
which covers both important primary and secondary metabo-
lites in C. roseus cells. It is not suitable for nonpolar metabo-
lites and lipid.
15. Sensitivity of NMR measurement can be increased by using a
higher magnetic field and/or increase the analysis time. In
addition, an NMR equipped with a cryoprobe increases the
signal-to-noise ratio per scan up to 16-fold.
16. Analysis of 1H-NMR is applied for all biological replicates.
The 1H-NMR data will be used for metabolomics analysis
using multivariate data analysis software.
17. Analysis of 2D-NMR is not applied to all samples. One or two
samples can be analyzed for identification of metabolites when
signals are overlapping in 1H-NMR spectra.
18. Processing the spectra by phasing, baseline correction, and
calibration to TSP at 0.0 ppm is crucial prior to bucketing and
multivariate data analysis. 1H-NMR signals in the range of
0.5–10.0 ppm are bucketed to 0.04 ppm width, which reduces
Fig. 7 1H-NMR spectra of jasmonate elicited (red) and control (blue) cell suspension cultures of Catharanthus
roseus at 72 h. 1, isoleucine; 2, leucine; 3, valine; 4, alanine; 5, acetic acid; 6, succinic acid; 7, malic acid; 8,
sucrose (fructose moiety, δ 4.14; glucose moiety, δ 5.41); 9, glucose (β-glucose, δ 4.53; α-glucose, δ 5.15);
10, strictosidine; 11, loganic acid; 12, fumaric acid; and 13, formic acid. Figure taken from reference [8]
the variables from about 30,000 to 200. The sum of intensities

of signals in each bin (bucket) is calculated by relative intensities
to the sum of total intensities, thus minimizing the effect of
variation between samples regarding the amount of tissue
extracted [14].
19. The regions of δ 4.75–4.90 and δ 3.30–3.35 were not included
in the analysis because of the remaining signals of D2O and
CD3OD, respectively.
20. Different chemometric methods can be applied depending
on the objectives of the study. Among multivariate data analy-
sis that is commonly used are PCA and PLS-DA. PCA is an
unsupervised clustering method, in which samples are separated

based on the signals in the spectra representing the metabo-
lomes. It is an unbiased method and requires no information
on the data. PLS-DA is a supervised method, in which the
groups are defined prior to analysis, such as the treated versus
control plant cells. To find the relation between factor A and
B, PLS can be applied. In addition, an orthogonal filter incor-
porated into the PLS algorithm (e.g., OPLS or OPLS-DA)
allows the removal of unrelated variables, thus highlighting
the important biomarkers. Chemical shifts of the discriminating
signals can be identified from the loading plots [14].
Acknowledgment
This work was funded by the IBOS-ACTS program as coordinated

by NWO, The Netherlands. Mohd Zuwairi Saiman was sponsored
by Ministry of Higher Education Malaysia and University of
Malaya, Kuala Lumpur, Malaysia.
References
1. Aslam J, Khan SH, Siddiqui ZH et al (2010) HPLC. Phytochem Rev 6:207–234. https://
Catharanthus roseus (L.) G. Don. An impor- doi.org/10.1007/s11101-006-9036-y
tant drug: it’s applications and production. Int 7. Saiman MZ, Mustafa NR, Pomahacova B et al
J Compr Pharm 1:1–16 (2014) Analysis of metabolites in the terpenoid
2. van der Heijden R, Jacobs DI, Snoeijer W et al pathway of Catharanthus roseus cell suspensions.
(2004) Catharanthus roseus alkaloids: pharma- Plant Cell Tiss Org 117:225–239. https://doi.
cognosy and biotechnology. Curr Med Chem org/10.1007/s11240-014-0435-2
11:1241–1253. https://doi. 8. Saiman MZ, Mustafa NR, Choi YH et al
org/10.2174/0929867043455846 (2015) Metabolic alterations and distribution of
3. Pan Q, Mustafa NR, Tang K et al (2016) five-carbon precursors in jasmonic acid-elicited
Monoterpenoid indole alkaloids biosynthesis Catharanthus roseus cell suspension cultures.
and its regulation in Catharanthus roseus: a lit- Plant Cell Tiss Org 122:351–362. https://
erature review from genes to metabolites. doi.org/10.1007/s11240-015-0773-8
Phytochem Rev 15:221–250. https://doi. 9. Moreno PRH, van der Heijden R, Verpoorte R
org/10.1007/s11101-015-9406-4 (1993) Effect of terpenoid precursor feeding
4. Salim V, De Luca V (2013) Towards complete and elicitation on formation of indole alkaloids
elucidation of monoterpene indole alkaloid in cell suspension cultures of Catharanthus
biosynthesis pathway: Catharanthus roseus as a roseus. Plant Cell Rep 12:702–705. https://
pioneer system. In: Giglioli-Guivarc’h N (ed) doi.org/10.1007/BF00233423
Advances of botanical research – new light on 10. Tikhomiroff C, Jolicoeur M (2002) Screening
alkaloid biosynthesis and future prospects. of Catharanthus roseus secondary metabolites
Academic Press, London, pp 1–37 by high-performance liquid chromatography.
5. Miettinen K, Dong L, Navrot N et al (2014) J Chromatogr A 955:87–93. https://doi.
The seco-iridoid pathway from Catharanthus org/10.1016/S0021-9673(02)00204-2
roseus. Nat Commun 5:3606. https://doi. 11. Bino RJ, de Vos RCH, Lieberman M et al
org/10.1038/ncomms4606 (2005) The light-hyperresponsive high pig-
6. Hisiger S, Jolicoeur M (2007) Analysis of ment-2dg mutation of tomato: alterations in
Catharanthus roseus alkaloids by the fruit metabolome. New Phytol 166:
427–438. https://doi.org/10.1111/j.1469- New York, pp 105–123. https://doi.

8137.2005.01362.x org/10.1007/978-1-4613-0849-2_6
12. Ben-Amotz A, Lers A, Avron M (1988) 14. Kim HK, Choi YH, Verpoorte R (2010) NMR-
Stereoisomers of β-carotene and phytoene in based metabolomic analysis of plants. Nat
the alga Dunaliella bardawil. Plant Physiol Protoc 5:536–549. https://doi.org/10.1038/
86:1286–1291. https://doi.org/10.1104/ nprot.2009.237
pp.86.4.1286 15. Whitmer S, van der Heijden R, Verpoorte R
13. Taylor RF, Farrow PE, Yelle LM et al (1990) (2002) Effect of precursor feeding on alkaloid
Advances in HPLC and HPLC-MS of carot- accumulation by a strictosidine synthase overex-
enoids and retinoids. In: Krinsky NI, Mathews- pressing transgenic cell line S1 of Catharanthus
Roth MM, Taylor RF (eds) Carotenoids: roseus. Plant Cell Tiss Org 69:85–93. https://
chemistry and biology. Plenum Press, doi.org/10.1023/A:1015090224398
Chapter 32
Transformed Root Culture: From Genetic Transformation

to NMR-Based Metabolomics
Andrey S. Marchev, Zhenya P. Yordanova, and Milen I. Georgiev
Abstract
Hairy root (HR) culture is considered as “green factory” for mass production of bioactive molecules with
pharmaceutical relevance. As such, HR culture has an immense potential as a valuable platform to elucidate
biosynthetic pathways and physiological processes, generate recombinant therapeutic proteins, assist
molecular breeding, and enhance phytoremediation efforts. However, some plant species appear recalci-
trant to the classical Agrobacterium rhizogenes transformation techniques. Sonication-assisted
Agrobacterium-mediated transformation (SAArT) is a highly effective method to deliver bacteria to target
plant tissues that includes exposure of the explants to short periods of ultrasound in the presence of the
bacteria.
Nuclear magnetic resonance (NMR)-based metabolomics is one of the most powerful and suitable
platforms for identifying and obtaining structural information on a wide range of compounds with a high
analytical precision. In terms of plant science, NMR metabolomics is used to determine the phytochemical
variations of medicinal plants or commercial cultivars in certain environments and conditions, including
biotic stress and plant biotic interaction, structural determination of natural products, quality control of
herbal drugs or dietary supplements, and comparison of metabolite differences between plants and their
respective in vitro cultures.
In this chapter, we attempt to summarize our knowledge and expertise in induction of hairy roots
from rare and recalcitrant plant species by SAArT technique and further methodology for extraction of
secondary metabolites of moderate to high polarity and their identification by using NMR-based
metabolomics.
Key words Agrobacterium rhizogenes, Hairy roots, PCR, NMR, SAArT, Secondary metabolites
1 Introduction
During the last three decades, HR cultures have been considered as

“green factories” for biotechnological production of valuable mole-
cules with therapeutic (e.g., anticancer, antimalarial, anti-
atherosclerosis, anti-inflammatory potential) and industrial
Andrey S. Marchev and Zhenya P. Yordanova are contributed equally to this work.
457
458 Andrey S. Marchev et al.
a pplication [1, 2]. The possibility of horizontal gene transfer through

naturally occurring genetic engineers Agrobacterium (Rhizobiaceae)
came into light after a thorough insight into the molecular mecha-
nisms of crown gall and hairy root diseases in plants. Owing to vari-
ous properties such as fast growth potential, ability to produce a
range of secondary metabolites, and genetic/biochemical stability,
the HRs are being exploited in plant biotechnology as a model sys-
tem to elucidate biosynthetic pathways and physiological processes
[3], generate recombinant therapeutic proteins, assist molecular
breeding, and enhance phytoremediation efforts [4–6].
Briefly, the protocol for HRs induction comprises cultivation
of wounded sterile explants that could be directly inoculated or
co-cultivated with Agrobacterium rhizogenes and then treated
with antibiotics for eliminating the bacteria. On hormone-free
media the neoplastic roots form a network of highly branched
roots, which subsequently are subjected to PCR (by using prim-
ers designed to amplify rol and VirG genes) to confirm that the
roots have been genetically transformed and the bacteria have
been successfully eliminated [7]. The molecular mechanism of
HRs induction includes independent transfer of two T-DNAs
(denoted as TL-DNA and TR-DNA) to the host plant genome.
However, only the TL-DNA is essential to induce HRs as
sequence analysis reveals 18 open reading frames (ORF), four of
which are essential for HR induction, namely, ORF10 (rolA),
ORF11 (rolB), ORF12 (rolC), and ORF15 (rolD) [8]. Significant
progress in Agrobacterium-mediated transformations has been
achieved in plant species (monocotyledonous plants but also cer-
tain dicotyledonous species) that are considered as difficult-to-
transform or even non-susceptible to Agrobacterium infections.
Sonication-assisted Agrobacterium rhizogenes-mediated transfor-
mation (SAArT) is a highly effective method to deliver bacteria
to target plant tissues that includes exposure of the explants to
short periods of ultrasound in the presence of Agrobacterium.
The ultrasound results in the formation of large numbers of
micro wounds across the tissue which permits the Agrobacterium
to penetrate deeper and more completely throughout the tissue
as compared to the natural infection obtained during co-cultiva-
tion [9–11], thus enhancing the bacterial colonization and infec-
tion of the plant explant. Observations by electron microscopy
revealed that ultrasound treatment produces small and uniform
fissures and channels throughout the plant epidermis, which
allows Agrobacterium access to internal plant tissue [12]. The
SAArT protocol has been successfully applied to transform a
number of recalcitrant plants such as Papaver somniferum,
Phtheirospermum japonicum, Verbascum xanthophoeniceum, and
V. nigrum [13–15] as well as to improve the transformation effi-
cacy in plants such as flax, loblolly pine, soybean, black locust,
citrus, and cowpea [16].
Hairy Roots Metabolomics 459
Metabolomics is a holistic approach applied for qualitative and

quantitative determination of both primary and secondary metab-
olite composition of a given biological system and its dynamic
metabolic responses toward various stimuli [17–19]. It is being
intensively used in environmental and nutritional science, biomed-
ical research, and precise medicine, as well as employed to investi-
gate the molecular aspects of pathogenesis, toxicity, stress effects,
and disease diagnosis and prognosis [20, 21].
The application of NMR spectroscopy in plant metabolomics
is very suitable since it allows the simultaneous detection and
obtaining structural information of diverse group of primary and
secondary metabolites with different polarity in complex plant
extracts [22–24]. NMR metabolomic analyses are rapid, unbiased,
and comprehensive [25, 26] and possess other important advan-
tages, such as high-throughput, nondestructive data acquisition,
minimal sample handling, and simple methods for metabolite
quantitation [27, 28]. Major limitations of NMR metabolomics
are its lower sensitivity and detection of less metabolites compared
to mass spectrometry (MS) and considerable signal overlapping
(particularly in the carbohydrate region), which hamper the signal
identification and accurate integration [29, 30]. However, this
overlapping might be solved by the application of the two-
dimensional NMR (2D NMR), which has better resolution than
the one-dimensional [29–32].
For example, the 2D heteronuclear single quantum coherence
(HSQC) correlates the chemical shift of 1H nuclei with the chemi-
cal shift of directly bonded 13C nuclei within a molecule by means
of one-bond coupling within them. For that reason the dispersion
of the carbon axis separates the overlapped peaks [32]. Despite the
low natural abundance of the heteronuclei, HSQC provided
important insights on the metabolic alternation between V. nigrum
mother plant and the relevant HR culture. The structure of the
amino acid glutamine, found in highest amounts in V. nigrum HRs
and missing in the mother plant, was unambiguously elucidated by
HSQC [33]. According to the corresponding HSQC, spectra were
identified as the marker compounds in wild-grown Rhodiola rosea
L. [34] and in commercial products, based on that plant [35].
Correlation spectroscopy (COSY) shows correlation of protons
that have multiple spin-spin couplings. This spectrum reflects the
conventional 1D NMR spectrum as well as the diagonal cross-peaks
at chemical shifts corresponding to the pairs of coupled nuclei. This
method is very suitable for identification of phenolic acids, since pro-
tons with three bonds are well correlated in COSY spectrum [32].
For example, the presence of 5-caffeoylquinic acid has been pro-
posed on the basis of 2D COSY and HSQC data [36]. The identifi-
cation of specific cross-peaks and signal assignments in the 1H and
13
C HSQC, as well as analyses of the 1H-1H COSY spectrum, was
essential in the identification of two new and rare tetraacetylated
iridoid glycosides from Sambucus ebulus L. leaves [37]. Correlation

approaches have attracted interest for their ability to reduce NMR
spectral complexity and identify peaks that belong to the same
metabolite [25]. Total correlation spectroscopy (TOCSY) shows
correlation of protons which have mutual spin-spin couplings. It
shows the correlations to spins that are not directly coupled, existing
in the same spin system. This technique is very suitable for clarifica-
tion of the crowded signals of carbohydrates and amino acids [32].
1
H-1H TOCSY was used to identify the phenylethanoids glycosides
verbascoside and martynoside occurring in highest amounts in V.
eriophorum HRs [38], as well as a novel diterpene glycoside with
nine glucose units from Stevia rebaudiana Bertoni [39].
In this chapter we summarize our knowledge and expertise in
induction of hairy roots from rare and recalcitrant plant species by
SAArT technique and further methodology for extraction of sec-
ondary metabolites of moderate to high polarity and their identifi-
cation applying NMR-based metabolomics (Fig. 1).
2 Materials
Prepare all solutions using ultrapure water (purity of 18.2 MΩ/

cm) and analytical grade reagents.
2.1 Sonication- Explants (leaves) from in situ (wild grown) or in vitro cultivated
Assisted plants could be subjected to SAArT transformation.
Agrobacterium
rhizogenes-Mediated 1. 70% (v/v) aqueous ethanol.
Transformation 2. 96% ethanol.
(SAArT) 3. Tween 80 (few drops).
2.1.1 Plant Material 4. Sterile filter paper.
5. Sterile scalpel.
Sterilization of Explants
and/or Seeds from In Situ
Plants
Induction of Plant In Vitro 1. Seed germination medium (half-strength MS medium): MS

Shoot Cultures medium 2.2025 g L−1 [40]; sucrose 15 g L−1. Dissolve the
components of the medium in water. Adjust pH to 5.6–5.7
with 10% NaOH and add 7 g L−1 agar. Autoclave at 121 °C for
30 min. Shake well both before and after autoclaving to avoid
nonuniform solidification which leads to difficulties when
remelting. After cooling to 40 °C, pour 5 mL medium into
sterile tubes for seed germination.
2. Medium for in vitro cultivation: MS medium 4.4052 g L−1;
sucrose 30 g L−1. Dissolve the components of the medium in
water. Adjust pH to 5.6–5.7 with 10% NaOH and add 7 g L−1
agar. Autoclave at 121 °C for 30 min. Shake well both before
Fig. 1 Experimental procedure of hairy roots induction through SAArT technique and further metabolites fin-
gerprinting by NMR-based metabolomics. Abbreviations: MS, Murashige and Skoog medium; NMR, nuclear
magnetic resonance; OD, optical density; PCR, polymerase chain reaction; rpm, revolutions per minute; YEB,
yeast extract broth
and after autoclaving. After cooling to 40 °C, pour 50 mL

medium into sterile containers for plant in vitro cultivation.
2.1.2 Growing of 1. YEB solid medium: 8 g L−1 beef extract, 1 g L−1 yeast extract,
A. rhizogenes Strain 0.5 g L−1 MgSO4, 1.0 g L−1 glucose. Dissolve the components
of the medium in water. Adjust pH to 7.0 and add 20 g L−1
A. rhizogenes
agar. Autoclave at 121 °C for 30 min. Shake well both before
Cultivation Media
and after autoclaving. After cooling to 40 °C, pour 25 mL
medium into sterile 90-mm Petri dishes.
2. YEB liquid medium for A. rhizogenes cultivation: 8 g L−1 beef
extract, 1 g L−1 yeast extract, 0.5 g L−1 MgSO4, 1.0 g L−1 glu-
cose. Dissolve the components of the medium in water. Adjust
pH to 7.0. Autoclave at 121 °C for 30 min. After cooling to
40 °C, pour 100 mL medium into 300 mL sterile flasks.
3. A. rhizogenes resuspending medium: MS medium 4.4052 g L−1,
sucrose 30 g L−1. Dissolve the components of the medium in
water. Adjust pH to 5.6–5.7 with NaOH. Autoclave at 121 °C
for 30 min. After cooling to 40 °C, add 100 μM sterile aceto-
syringone (final concentration; see Note 1). Pour 25 mL
medium into sterile Falcon tubes of 50 mL.
4. Sterile inoculating loops.
2.1.3 SAArT 1. Sterile in situ or in vitro cultivated plants as described in

Transformation Subheading 2.1.1.
Plant Material
1. A. rhizogenes resuspending medium as described in Subheading
A. rhizogenes Suspension “A. rhizogenes Cultivation Media”, step 2, containing 100 μM
sterile acetosyringone
2. Sterile filter paper
Cultivation Media for Plant 1. Inoculation medium: MS medium 4.4052 g L−1, sucrose

Explants During SAArT 30 g L−1. Dissolve the components of the medium in water.
Adjust pH to 5.6–5.7 with NaOH and add 5.5 g L−1 agar.
Autoclave at 121 °C for 30 min. Shake well both before and
after autoclaving. After cooling to 40 °C, add 50 μM sterile
acetosyringone (final concentration see Note 1). Pour 25 mL
medium into sterile 90-mm Petri dishes.
2. Selection medium: MS medium 4.4052 g L−1, sucrose 30 g L−1.
Dissolve the components of the medium in water. Adjust pH
to 5.6–5.7 with NaOH and add 5.5 g L−1 agar. Autoclave at
121 °C for 30 min. Shake well both before and after autoclav-
ing. After cooling to 40 °C, add 300 mg L−1 sterile ceftriaxone
sodium (final concentration). Pour 25 mL medium into sterile
90-mm Petri dishes.
2.1.4 Confirmation 1. For genomic DNA extraction from plant tissue and for purifi-
of Agrobacterium Genetic cation of plasmid DNA (pRi) from A. rhizogenes, any commer-
Transformation cially available extraction kit may be used (see Note 2).
DNA Extraction Reagents
1. To perform PCR reaction, Multiplex PCR Plus Kit (Qiagene)
Polymerase Chain Reaction may be used (see Note 3).
(PCR) Reagents
Primers 1. For PCR amplification the following primer pairs must be pre-
pared at 10 pmol μL−1:
5′-GCT CTT GCA GTG CTA GAT TT-3′ and 5′-GAA GGT
GCA AGC TAC CTC TC-3′ to amplify a 423 bp fragment of rolB
gene;
5′-CTC CTG ACA TCA AAC TCG TC-3′ and 5′-TGC TTC
GAG TTA TGG GTA CA-3′ to amplify a 626 bp fragment of rolC
gene;
5′-ACT GAA TAT CAG GCA ACG CC-3′ and 5′-GCG TCA
AAG AAA TAG CCA GC-3′ amplifying a fragment of 350 bp for
detecting the virG gene.
2. To prepare a working solution of each primer from stock solu-
tion with concentration 100 pmol μL−1: dilute an aliquot of
that stock further at 1:10 to get a 10 pmol μL−1 working solu-
tion. Use 0.5 μL of that working solution in a 25 μL PCR
reaction or accordingly 1 μL in a 50 μL reaction.
Electrophoresis Reagents 1. TAE buffer (10×): 48.4 g of Tris base [tris (hydroxymethyl)
and Solutions aminomethane]; 11.4 mL of glacial acetic acid; 20 mL of
0.5 M EDTA; deionized water.
2. TAE buffer (1×): dilute 100 mL of 10× TBE in 900 mL of
water.
3. Agarose gel (1.5%): weigh 1.5 g of agarose and dissolve in
100 mL of 1× TAE buffer. Boil until agarose is completely dis-
solved producing a clear solution (see Note 4) and fill the con-
tainer with the comb.
4. Ethidium bromide (EtBr), (10 mg mL−1) stock solution: weigh
50 mg of EtBr and dilute in 5 mL of water (see Note 5).
5. GeneRuler (Thermo Scientific, Cat. # SM0333), DNA Ladder
Mix, ready-to-use for both DNA sizing and approximate quan-
tification. The ladder is composed of 21 DNA fragments in a
range of 100–10,000 pb.
2.1.5 Cultivation 1. Regeneration medium: MS medium 4.4052 g L−1, sucrose

of Hairy Roots 20 g L−1. Dissolve the components of the medium in water.
Adjust pH to 5.6–5.7 with NaOH and add 7 g L−1 agar.
Autoclave at 121 °C for 30 min. Shake well both before and
after autoclaving. After cooling to 40 °C, pour 25 mL medium
into sterile 90-mm Petri dishes.
2. Liquid medium: MS medium 4.4052 g L−1, sucrose 20 g L−1.

Dissolve the components of the medium in water. Adjust pH
to 5.6–5.7 with NaOH. Autoclave at 121 °C for 30 min. After
cooling to 40 °C, pour into sterile 300 mL Erlenmeyer flasks
with 20% net volume of liquid MS medium.
2.2 Metabolite 1. Polypropylene Eppendorf type tubes (2 mL).

Extraction and Sample 2. Sufficient volumes of 1H NMR extraction solvents prepared in
Preparation for NMR advance, including deuterium oxide (D2O, 99.9% D), deuter-
Analyses ated methanol (CD3OD, 99.8% D), 3-(trimethylsilyl)
propionic-2,2,3,3-D4 acid sodium salt (TSP, 99% D), KH2PO4
(99%), and sodium deuteroxide (NaOD, 40% in D2O). For
reagent setup please follow Notes 6 and 7.
3. Liquid nitrogen.
4. Thin-wall clean 5 mm NMR tubes.
5. NMR 600.13 MHz spectrometer with 1H probe and autosam-
pler (Bruker, Karlsruhe, Germany).
6. MestReNova analytical software for processing NMR samples
(Mestrelab Research, Santiago de Compostela, Spain) or
equivalent software.
7. SIMCA-P multivariate statistical software (Umetrics, Umea,
Sweden) or comparable software for multivariate analysis.
3 Methods
3.1 Plant Material 1. Isolate carefully leaves and/or seeds from in situ plants (see
for SAArT Note 8).
Transformation 2. Wash the plant material (seeds and/or isolated leaves) thor-
oughly under running tap water.
3.1.1 Sterilization 3. Prepare a solution of 70% ethanol with a few drops of Tween
of Plant Material 80 to reduce surface tension and allow better surface contact.
4. Soak the plant material (seeds or isolated leaves) in this solu-
tion under aseptic conditions, shake/stir gently for 5 min, and
discard the solution.
5. Wash seeds with 96% ethanol for 10 s and place them on a
sterile filter paper to dry.
6. Transfer the isolated leaves in a 6% Ca(OCl)2 solution for
6 min.
7. Wash thoroughly three times with sterile distilled water.
8. Cut the isolated sterile leaves with scalpel to small fragments of
1 cm and subject them to SAArT transformation.
3.1.2 Induction of In Vitro 1. Inoculate sterilized seeds (see Subheading 3.1) on half-strength
Shoot Cultures from Seeds MS medium under aseptic conditions [see Subheading
“Induction of Plant In Vitro Shoot Cultures”, step 1].
2. After seed germination, transfer seedlings on MS medium sup-

plemented with 3% (w/v) sucrose and 0.7% agar [see
Subheading “Induction of Plant In Vitro Shoot Cultures”,
step 2] and cultivate them under controlled environmental
conditions (16 h light/8 h dark, 60 μmol m−2 s−1 photosyn-
thetic photon flux density, Philips TLD-33, at 25 °C with
60–70% air humidity).
3. After 30 days, cut with scalpel regenerated plants to small
explants containing mono-nodal segments and inoculate them
on fresh solid MS medium for in vitro multiplication.
4. Isolate fully expanded leaves from 1-month-old in vitro plants
and expose them to SAArT transformation.
3.2 Preparation of 1. Streak the A. rhizogenes (strain ATCC 15834) preserved at

A. rhizogenes −80 °C on solid YEB medium [see Subheading “A. rhizogenes
Suspension for SAArT Cultivation Media”, step 1] in the dark at 26 °C for 2–3 days
(these culture can be stored for up to a month at 4 °C (see
Note 9).
2. With sterile inoculating loop isolate and transfer colony in liq-
uid YEB medium [see Subheading “A. rhizogenes Cultivation
Media”, step 2].
3. Cultivate suspension overnight (16 h), on an orbital shaker
(110 rpm), at 26 °C in dark.
4. Centrifuge bacterial suspension at 5000 rpm (2800 × g) for

25 min and resuspend the pellet in MS medium, containing
100 μM acetosyringone [see Subheading “A. rhizogenes
Cultivation Media”, step 3] to OD600 nm between 0.6 and 0.8.
3.3 Genetic 1. Transfer 10 explants (~1 cm2 each) to sterile 50 mL Falcon

Transformation tubes filled out with 25 mL of properly diluted in MS medium
Through SAArT A. rhizogenes suspension (see Subheading 3.2).
2. Individually place the plastic tubes in a sonicator and subject to
ultrasound with frequency of 35 kHz.
3. Perform different treatment exposures to ultrasound for 0, 5,
10, 15, 30, 45, or 60 s (see Note 10).
4. After ultrasound treatment blot the explants on filter paper to
remove excess bacteria.
5. Transfer the explants on solid MS inoculation medium supple-
mented with 50 μM acetosyringone [see Subheading “Cultivation
Media for Plant Explants During SAArT”, step 1].
6. Perform transformation procedure at 26 °C in dark.
7. After 72 h of co-cultivation, transfer all explants on solid selec-
tion MS medium, supplemented with ceftriaxone sodium [see
Subheading “Cultivation Media for Plant Explants During
SAArT”, step 2], and cultivate them under controlled environ-

mental conditions (16 h light/8 h dark, 60 μmol m−2 s−1 pho-
tosynthetic photon flux density, Philips TLD-33, at 25 °C with
60–70% air humidity) until adventitious roots are developed.
8. Carefully cut the root tips (~1 cm long) from the mother plant
leaf explants and transfer them separately on MS regeneration
medium [see Subheading 2.1.5, step 1]. Each root tip repre-
sents a separate clone of root culture.
3.4 Confirmation The presence of stable genetic transformation can be determined

of Genetic using PCR analysis of DNA from HR clones with primer pairs for
Transformation the amplification of rolB and rolC.
3.4.1 Isolation of DNA For an efficient PCR amplification, the most critical requirement is
a high quality of DNA without presence of contaminant com-
pounds that could inhibit the enzymatic reaction catalyzed by the
Taq DNA polymerase.
1. For DNA extraction collect 100 mg of fresh roots from trans-
formed and untransformed (as negative control) lines.
2. Place the plant material in a mortar and add enough liquid
nitrogen to cover the tissue. Ground thoroughly tissue with a
pestle to a fine powder (see Note 11), and the manufacturer’s
instructions for the extraction kit are followed (see Note 2).
3. For isolation of plasmid, DNA pellet 1–5 mL bacterial over-
night culture by centrifugation at 8000 rpm (5900 × g) for
3 min at room temperature, and the manufacturer’s instruc-
tions for the extraction kit are followed (see Note 2).
4. Mix 5 μL of the DNA solution with 2 μL loading day to check
the integrity of the genomic DNA and perform electrophoresis
on a 1.0% agarose gel at 80 V for approximately 30 min. A
predominant and intense band is expected.
5. Checked DNA concentration and purity by spectrophotome-
ter (NanoDrop 1000 spectrophotometer) at 260 nm/280 nm.
3.4.2 PCR Amplification 1. For PCR reaction Multiplex PCR Plus Kit (Qiagene) may be
used (see Note 3).
2. Use specific oligonucleotide primer pairs for rolB, rolC, and
virG amplification (gene sequences are described in Subheading
“Primers”).
3. The reaction mixture (25 μL) contains 12.5 μL Multiplex PCR
Master Mix, 2.5 μL CoralLoad Dye, 20 ng plant genomic
DNA (or 10 ng pRi DNA), and 0.2 μM of each primer.
4. The thermocycler conditions include a denaturation step at
95 °C (5 min) followed by 35 cycles of amplification 95 °C
(30 s), 57 °C (90 s), and 72 °C (1 min) with final extension

step of 68 °C (10 min).
5. Analyze PCR products [423 bp (rolB), 626 bp (rolC), 350 bp
(virG)] by electrophoresis in 1.5% (w/v) agarose gels (see
Subheading “Electrophoresis Reagents and Solutions”) at
80 V for approximately 30 min.
3.5 Cultivation 1. After dense network of highly branched roots occurs on solid
of Hairy Root Clones medium, transfer fragments of 1 cm root tips to fresh MS
medium [see Subheading 2.1.5, step 1].
3.5.1 Maintenance
on Solid Media
2. Cultivate HR clones on solid MS medium between 3 and 4
months with regular period of subculture to get HRs with sta-
ble growth and morphological characteristics.
3.5.2 Submerged 1. Transfer root tips (~1–2 cm length) to liquid MS medium [see
Cultivation Subheading 2.1.5, step 2] in 250 mL Erlenmeyer flasks (20%
net volume of liquid MS medium) and cultivate in the dark at
26 °C, 110 rpm, for 14 days.
2. Further, inoculate flasks with ca. 1.5 g fresh weight of 2 weeks
old roots.
3. To monitor the growth of the HRs, determine accumulated
dry biomass (ADB) and growth index (based on dry weight;
GIDW). ADB = Final dry biomass – initial dry biomass (g L−1);
GIDW = (Final dry biomass − initial dry biomass)/initial dry
biomass [for details see 9, 38].
3.6 Metabolite 1. Grind the freeze-dried plant tissue in a pre-cooled pestle and
Extraction and Sample mortar under liquid nitrogen (see Note 12).
Preparation for NMR 2. Prepare each biological sample in six replicates (50 mg each) in
Analyses labeled 2.0 mL Eppendorf tubes.
3. Add 0.75 mL of CD3OD and 0.75 mL of KH2PO4 buffer in
D2O (pH 6.0), which contains 0.01% TSP in each tube.
4. Homogenize the samples by vortexing at room temperature
(20–25 °C) for 1 min (see Note 13).
5. Ultrasonicate the samples for 20 min at room temperature.
6. Centrifugate for 20 min at room temperature at 14,000 × g
(see Note 14).
7. Transfer more than 1 mL of the supernatant in 2 mL Eppendorf
tube (see Note 15).
8. Transfer 0.8 mL of the clear supernatant into a 5 mm thin-wall
NMR tube and cap ready for analysis (see Note 16).
3.7 NMR Data 1. Load the NMR tubes into the NMR spectrometer.
Acquisition 2. Set the NMR probe temperature to 289 K (25 °C) and leave
few minutes for temperature equilibration.
3. Enter the sample details into the automation program’s sample

list, taking into account the correct sample labeling.
4. Tune, match the NMR tube, and start the automation
sequence. The NMR software should automatically load each
sample into the NMR magnet.
5. Find and lock the spectrometer frequency to the deuterium
resonance arising from the CD3OD solvent signal (see Note
17).
6. Optimize the intensity of the signal via manual or automated
shimming procedure (see Note 18). At the end of the data col-
lection, the NMR automation routine automatically processes
the data before the next sample.
7. Determine the frequency of the D2O resonance and set the
center of the spectrum to this frequency (see Note 19).
8. After data collection and quality assessment (see Note 20), the
NMR samples are removed from the NMR tubes, transferred
to screw cap glass vials, and stored in a refrigerator if further
analyses are required.
9. Standard 1H NMR spectroscopy. Set up pulse sequence com-
prising (relaxation delay-60°-acquire), where the pulse power
is set to achieve a 60° flip angle, 10 kHz spectral width, and
water pre-sat applied during 4.0 s relaxation time. The applied
processing parameters include zero-fill to 64 k data points and
exponential line broadening of 0.3 Hz and perform Fourier
transformation (see Note 21).
10. 1H-1H COSY. A phase sensitive/magnitude mode standard
three pulse sequence with pre-sat during relaxation delay of 1 s
is used. A data matrix of 512 × 4096 points covering
6361 × 6361 Hz is recorded with 8 scans for each increment.
Zero-fill data to 4096 × 4096 points and apply a sine bell-
shaped window function by /2 in the F1 and /4 in F2 dimen-
sion before States-TPPI type two-dimensional Fourier
transformation.
3.8 Data Processing 1. The obtained spectra are first normalized to its total intensity.
and Spectral Afterward the noise is removed, and the files are reduced to
Bucketing ASCII files for further multivariate data analysis using AMIX
or equivalent software (see Note 22).
2. Manually perform phase correction by using MestReNova or
equivalent software. The NMR spectrum is phase corrected by
applying zero- and first-order phase corrections, taking care to
achieve good symmetry on all peaks.
3. Baseline correction is performed manually using multipoint

correction (see Note 23).
4. Align the spectra to the internal standard TSP at 0.00 ppm (see
Note 24).
5. Divide the spectra into segments (bins or buckets) with size of
0.04 ppm corresponding to the region of 0.12–10.0 ppm. The
spectrum bucketing is aiming to avoid the effect of signal fluc-
tuation due to pH concentration (see Note 25).
6. Incorporate the obtained buckets to Microsoft Excel.
7. Remove the signals of the solvents belonging to CD3OD and
D2O from the statistical analysis.
3.9 Multivariate Data 1. Create a new project in SIMCA-P and load one of the bucket
Analysis tables. The principal component analysis (PCA) according to
the guidelines of Umetrics homepage.
2. Analyze the PCA score plots. Plots of various components are
analyzed for different clustering patterns. Principal component
(PC) 1 versus PC2 should always be examined as these must
represent the largest variance in the data set.
3. For each scores plot, the two corresponding loadings plots (see
Note 26) should be generated to describe the metabolites
responsible for differences in clustering.
4. Identify the metabolites by comparison of the NMR signals
with authenticated reference compounds or by 2D NMR spec-
tra (see Note 27).
4 Notes
1. To prepare 100 mM stock solution of acetosyringone, weigh

0.020 g (MW = 196.20 g mol−1) of the substance and dissolve
it in 100 μL DMSO. Add 900 μL ultrapure water and sterilize
the stock solution through 0.2 μm syringe filter. To have final
concentration of 100 μM or 50 μM acetosyringone in 200 mL
culture medium, add 200 or 100 μL, respectively, from stock
solution to the medium.
2. For DNA extraction, kit such as DNeasy Plant Mini Kit
(Qiagene) and QIAprep Spin Miniprep Kit (Qiagene) for puri-
fication of Plasmid DNA (pRi) from A. rhizogenes may be
used. Alternatively you can extract or purify DNA with an
appropriate method [e.g., 41].
3. Multiplex PCR Plus Kit (Qiagene) is a convenient kit with
high specificity and sensitivity in multiplex PCR applications.
The Multiplex PCR Master Mix contains HotStarTaq Plus
DNA Polymerase and MgCl2, as well as dNTPs and an innova-
tive PCR buffer. The kit also includes Q-Solution that pro-
motes amplification of difficult-to-amplify targets and
CoralLoad Dye improving pipetting visibility and subsequent
gel loading and visualization of DNA migration.
4. It is possible to use a microwave oven. To avoid air bubbles,
turn off the microwave immediately after boiling the solution.
After cooling to 40–50 °C pour into the mold avoiding
bubbles.
5. Ethidium bromide intercalates double-stranded DNA and
RNA and acts as a mutagen. Utilize eye shields, face shields,
mask, and gloves. Designate a special area to work with the
materials containing EtBr. Check the risk and safety
statement.
6. Prepare phosphate buffer (90 mM, pH 6.0) by addition of
1.232 g of KH2PO4 and 10 mg of TSP (0.01%) to 100 mL of
D2O. After homogenization the pH of the solution is adjusted
to 6.0 with 1.0 M NaOD.
7. Add 1.0 mL of NaOD (40%, 10 M) to 9 mL of D2O and
homogenize well to obtain 1.0 M NaOD.
8. When working with in situ (wild grown) plants, isolate fully
expanded leaves from second or third position from top.
9. Agrobacteria strain can be cryopreserved and maintained at
−80 °C. Grow bacteria to the exponential phase (OD600 ~
0.4), spin, redissolve the pellet in 0.5 mL of sterile YEB with
15% glycerol in cryogenic vials, and flash-freeze in liquid nitro-
gen. The bacterial culture can be also store at −80 °C, but the
viability will be reduced. For short-term preservation up to a
few months, pick a colony and stab it in a tube with sterile solid
YEB medium. Keep this so-called stab culture in the fridge.
10. When working with explants isolated from in vitro plants, per-
form an ultrasound treatment no longer than 15 s. Higher
ultrasound exposures cause explant necrosis and compromise
the transformation process. In situ explants may be subjected
to higher ultrasound exposures due to better epidermis
development.
11. The tissue should not be thawed during the crushing process.
It is necessary to add liquid nitrogen several times.
12. The metabolites are highly dynamic, and all sampling should
be done at the same time of the photoperiodic cycle. The har-
vested tissue is kept in liquid nitrogen to arrest metabolism and
then should be stored at −80 °C prior to processing. The
lyophilized samples can be stored at room temperature for sev-
eral weeks before extraction. A desiccator can be used for the
storage of dried samples.
13. Any material not suspended in the solvent at this stage will lead
to a higher variability in the extraction process.
14. For lower-speed centrifugation more time is required to
achieve clear supernatant.

15.
If a clear supernatant is not obtained, repeat the
centrifugation.
16. The extract can be kept for few days at 0–4 °C before NMR
analysis. Nevertheless, it is recommended to place the samples
at room temperature at least half an hour before NMR mea-
surement to avoid bad shimming owing to the temperature
difference in samples.
17. As an internal lock could be used D2O as well, but the prefer-
able one is CD3OD.
18. The shimming approach should ensure the obtaining of spec-
trum with uniform line widths suitable for later bucketing and
multivariate data analysis (MVDA) steps.
19. The most widely used method for water suppression technique
is the weak radiofrequency irradiation [presaturation (pre-
sat)]. It is a preferred method for small molecule samples and
requires well shimmed environment. This will improve the
resolution of the NMR spectrum and is likely to result in an
intrinsic line width for the TSP reference signal, before line
broadening during processing, of ≤1.2 Hz.
20. The quality assessment of the NMR data is performed in three
ways. First, the line shape of TSP is automatically measured at
half height, and its width should be less than 1.2 Hz. If the
peak is broader, then the spectrum should be rerecorded.
Second, visual check one of the overlaid batches of spectra to
ensure that there are no gross abnormalities with any of the
spectra; there are no significant peak shifts and that the auto-
matic phasing has been carried out adequately. Third, analyti-
cal replicate spectra of the same sample should be overlaid to
ensure that there is good reproducibility.
21. The spectra are collected by applying a simple pre-sat pulse
sequence with a 60° flip angle and presaturation during the 4 s
relaxation delay. The relaxation delay should be long enough
to allow complete relaxation of the samples between scans.
The spectra are recorded with sample spinning at 10 Hz to
obtain reliable and narrow line widths (≤1.2 Hz). Each spec-
trum is automatically Fourier transformed after zero filling to
64 k data points and the application of an exponential window
function with a line broadening of 0.3 Hz.
22. The normalization refers to a mathematical operation which
attempts to account for the overall concentration of the sam-
ple. The aim of the normalization is to make the profiles com-
parable to each other by taking into account the metabolite

dilution. The removal of noise from NMR spectra has been
shown to improve the quality of PCA results, which leads to
reduction of the file size.
23. To use correctly this method and avoid baseline distortions, it
is important to choose points close to the signal of interest and
to have a uniform distribution of the points in the whole
spectrum.
24. This alignment aims the removal of global shifts from the data
set. In case it is not sufficient, a fine or local alignment could
be applied, such as interval correlated shifts, correlation opti-
mized warping, fuzzy warping, and hierarchical cluster-based
peak alignment. However, although the alignment is impor-
tant, several issues should be taken into consideration, such as
introduction of artifacts, which might affect the
quantification.
25. The segmentation of the spectra is usually done in bins with
size of 0.04 ppm. In spite of that, due to loss in resolution and
the potential for splitting, peaks between two bins than narrow
bins might be used (or even spectra at full resolution) or bins
of variable size (variable binning).
26. Loadings plots describe the differences in chemical shift inten-
sities responsible for the separation of clusters in the PCA
scores plots. The loadings plots can be represented as 2D scat-
ter plots or as line plots. The line plot format is useful to pres-
ent the 1H NMR. Peaks which are positive in the loadings plot
of a given component represent signals which are more intense
in those samples which have a high score for that component.
Negative peaks in the loadings plot of a given component rep-
resent signals which are more intense in those samples which
have a low score for that component.
27. The signals of most primary metabolites are detected in the δ
5.5–0.5 ppm region; amino acids appear around δ 2.0–0.5,
organic acids at δ 3.0–2.0, and sugars at δ 5.0–3.0. The aro-
matic region (δ 9.0–5.0) comprises many characteristic signals
of secondary metabolites.
Acknowledgment
This work has been supported by a grant from NSF of Bulgaria and
DAAD Germany (Contract Number DNTS/Germany 01/8).
References
1. Georgiev M, Agostini E, Ludwig-Müller J, Xu (Phaseolus vulgaris L.) with lea gene. Mol
J (2012) Genetically transformed roots: from Breed 16:189–197. https://doi.
plant disease to biotechnology. Trends org/10.1007/s11032-005-6616-2
Biotechnol 30:528–537. https://doi. 12. Beranová M, Rakouský S, Vávrová Z et al
org/10.1016/j.tibtech.2012.07.001 (2008) Sonication assisted Agrobacterium-
2. Yordanova Z, Georgiev M (2017) Cell facto- mediated transformation enhances the trans-
ries. In: Brian T, Murray BG, Murphy DJ (eds) formation efficiency in flax (Linum
Encyclopedia of applied plant sciences, vol II, usitatissimum L.). Plant Cell Tiss Org 94:253–
2nd edn. Academic Press, Amsterdam, 259. https://doi.org/10.1007/
pp 72–76. https://doi.org/10.1016/ s11240-007-9335-z
B978-0-12-394807-6.00158-1 13. Le Flem-Bonhomme V, Laurain-Mattar D,
3. Gao W, Sun H-X, Xiao H et al (2014) Fliniaux MA (2004) Hairy root induction of
Combining metabolomics and transcriptomics Papaver somniferum var. album, a difficult-to-
to characterize tanshinone biosynthesis in transform plant by A. rhizogenes LBA 9402.
Salvia miltiorrhiza. BMC Genomics 15:73. Planta 218:890–893. https://doi.
https://doi.org/10.1186/1471-2164-15-73 org/10.1007/s00425-003-1196-z
4. Huang Y, Su C-Y, Kuo H-J et al (2013) A 14. Ishida JK, Yoshida S, Ito M et al (2011)
comparison of strategies for multiple-gene co- Agrobacterium rhizogenes-mediated transfor-
transformation via hairy root induction. Appl mation of the parasitic plant Phtheirospermum
Microbiol Biotechnol 97:8637–8647. https:// japonicum. PLoS One 6:e25802. https://doi.
doi.org/10.1007/s00253-013-5034-3 org/10.1371/journal.pone.0025802
5. Ludwig-Müller J, Jahn L, Lippert A et al (2014) 15. Georgiev M, Ludwig-Müller J, Alipieva K et al
Improvement of hairy root cultures and plants by (2011) Sonication-assisted Agrobacterium rhi-
changing biosynthetic pathways leading to phar- zogenes-mediated transformation of Verbascum
maceutical metabolites: strategies and applica- xanthophoeniceum Griseb. For bioactive metab-
tions. Biotechnol Adv 32:1168–1179. https:// olite accumulation. Plant Cell Rep 30:859–
doi.org/10.1016/j.biotechadv.2014.03.007 866. https://doi.org/10.1007/
6. Ibañez S, Talano M, Ontañon O et al (2016) s00299-010-0981-y
Transgenic plants and hairy roots: exploiting 16. Oliveira MLP, Febres VJ, Costa MGC et al
the potential of plant species to remediate (2009) High-efficiency Agrobacterium-
contaminants. New Biotechnol 33:625–635. mediated transformation of citrus via sonica-
https://doi.org/10.1016/j.nbt.2015.11.008 tion and vacuum infiltration. Plant Cell Rep
7. Georgiev M, Ludwig-Muller J, Bley T (2010) 28:387–395. https://doi.org/10.1007/
Hairy root culture: copying nature in new bio- s00299-008-0646-2
processes. In: Arora R (ed) Medicinal plant 17. Dunn W, Broadhurst D, Edison A (2017)
biotechnology. CAB International, UK, Quality assurance and quality control pro-
pp 156–175. https://doi. cesses: summary of a metabolomics community
org/10.1079/9781845936785.0156 questionnaire. Metabolomics 13:50. https://
8. Nilsson O, Olsson O (1997) Getting to the doi.org/10.1007/s11306-017-1188-9
root: the role of the Agrobacterium rhizogenes 18. Kim H, Choi Y, Verpoorte R (2010) NMR-
rol-genes in the formation of hairy roots. based metabolomic analysis of plants. Nat
Physiol Plant 100:463–473. https://doi. Protoc 5:536–549. https://doi.org/10.1038/
org/10.1111/j.1399-3054.1997.tb03050.x nprot.2009.237
9. Trick HN, Finer JJ (1997) SAAT: sonicated- 19. Wu X, Li N, Li H et al (2014) An optimized
assisted Agrobacterium-mediated transforma- method for NMR-based plant seed metabolo-
tion. Transgenic Res 6:329–336. https://doi. mic analysis with maximized polar metabolite
org/10.1023/A:1018470930944 extraction efficiency, signal-to-noise ratio, and
10. Tang W, Sederoff R, Whetten R (2001) chemical shift consistency. Analyst 139:1769–
Regeneration of transgenic loblolly pine (Pinus 1778. https://doi.org/10.1039/
taeda L.) from zygotic embryos transformed C3AN02100A
with Agrobacterium tumefaciens. Planta 20. Brasili E, Filho V (2017) Metabolomics of can-
213:981–989. https://doi.org/10.1007/ cer cell cultures to assess the effects of dietary
s004250100566 phytochemicals. Crit Rev Food Sci Nutr
11. Liu Z, Park BJ, Kanno A, Kameya T (2005) 57:1328–1339. https://doi.org/10.1080/10
The novel use of a combination of sonication 408398.2014.964799
and vacuum infiltration in Agrobacterium- 21. Marshall D, Powers R (2017) Beyond the para-
mediated transformation of kidney bean digm: Combining mass spectrometry and nuclear
magnetic resonance for metabolomics. Prog Nucl plant metabolite profiling. In: Weckwerth W,
Magn Reson Spectrosc 100:1–16. https://doi. Kahl G (eds) The handbook of plant metabolo-
org/10.1016/j.pnmrs.2017.01.001 mics, 1st edn. Wiley-VCH Verlag GmbH &
22. Capitani D, Sobolev A, Delfini M (2014) NMR Co. KGaA, Weinheim, pp 57–76. https://doi.
methodologies in the analysis of blueberries. org/10.1002/9783527669882.ch3
Electrophoresis 35:1615–1626. https://doi. 33. Georgiev M, Radziszewska A, Neumann M
org/10.1002/elps.201300629 et al (2015) Metabolic alterations of Verbascum
23. de Albuquerque A, Ribeiro D, de Amorim M nigrum L. plants and SAArT transformed
(2016) Structural determination of complex roots as revealed by NMR-based metabolo-
natural products by quantum mechanical calcu- mics. Plant Cell Tiss Org 123:349–356.
lations of 13C NMR chemical shifts: develop- https://doi.org/10.1007/
ment of a parameterized protocol for terpenes. s11240-015-0840-1
J Mol Model 22:183. https://doi. 34. Marchev A, Dimitrova P, Koycheva I et al
org/10.1007/s00894-016-3045-6 (2017) Altered expression of TRAIL on mouse
24. Alipieva K, Orhan I, Cankaya I et al (2014) T cells via ERK phosphorylation by Rhodiola
Treasure from garden: chemical profiling, rosea L. and its marker compounds. Food
pharmacology and biotechnology of mulleins. Chem Toxicol 108:419. https://doi.
Phytochem Rev 13:417–444. https://doi. org/10.1016/j.fct.2017.02.009
org/10.1007/s11101-014-9361-5 35. Vasileva L, Getova D, Doncheva N et al (2016)
25. Gowda G, Raftery D (2015) Can NMR solve Beneficial effect of commercial Rhodiola extract
some significant challenges in metabolomics? in rats with scopolamine-induced memory
J Magn Reson 260:144–160. https://doi. impairment on active avoidance.
org/10.1016/j.jmr.2015.07.014 J Ethnopharmacol 193:586–591. https://doi.
26. Kruger N, Troncoso-Ponce M, Ratcliffe R org/10.1016/j.jep.2016.10.011
(2008) 1H NMR metabolite fingerprinting and 36. de Falco B, Incerti G, Bochicchio R et al (2017)
metabolomic analysis of perchloric acid extracts Metabolomic analysis of Salvia hispanica seeds
from plant tissues. Nat Protoc 3:1001–1012. using NMR spectroscopy and multivariate data
https://doi.org/10.1038/nprot.2008.64 analysis. Ind Crop Prod 99:86–96. https://doi.
27. Baker J, Ward J, Beale M (2012) Combined org/10.1016/j.indcrop.2017.01.019
NMR and flow injection ESI-MS for 37. Alipieva K, Simova S, Zahmanov G et al (2017)
Brassicaceae metabolomics. In: Hardy N, Hall New tetraacetylated iridoid glycosides from
R (eds) Plant metabolomics: methods and pro- Sambucus ebulus L. leaves. Phytochem Lett
tocols, Methods in molecular biology, vol 860. 20:429–432. https://doi.org/10.1016/j.
Springer, New York, pp 177–191. https://doi. phytol.2017.01.003
org/10.1007/978-1-61779-594-7_12 38. Marchev A, Yordanova Z, Alipieva K et al (2016)
28. Brennan L (2014) NMR-based metabolomics: Genetic transformation of rare Verbascum eri-
from sample preparation to applications in ophorum Godr. Plants and metabolic alterations
nutrition research. Prog Nucl Magn Reson revealed by NMR-based metabolomics.
Spectrosc 83:42–49. https://doi. Biotechnol Lett 38:1621–1629. https://doi.
org/10.1016/j.pnmrs.2014.09.001 org/10.1007/s10529-016-2138-8
29. Zahmanov G, Alipieva K, Denev P et al (2015) 39. Prakash I, Ma G, Bunders C et al (2017) A
Flavonoid glycosides profiling in dwarf elder novel diterpene glycoside with nine glucose
fruits (Sambucus ebulus L.) and evaluation of units from Stevia rebaudiana Bertoni.
their antioxidant and anti-herpes simplex activ- Molecules 7:10. https://doi.org/10.3390/
ities. Ind Crop Prod 63:58–64. https://doi. biom7010010
org/10.1016/j.indcrop.2014.10.053 40. Murashige T, Skoog F (1962) A revised medium
30. Zahmanov G, Alipieva K, Simova S et al (2015) for rapid growth and bioassays with tobacco tis-
Metabolic differentiations of dwarf elder by sue cultures. Physiol Plant 15:473–497. https://
NMR-based metabolomics. Phytochem Lett doi.org/10.1111/j.1399-3054.1962.
11:404–409. https://doi.org/10.1016/j. tb08052.x
phytol.2014.11.021 41. Berendzen K, Searle I, Ravenscroft D et al
31. Mansfield S, Kim H, Lu F et al (2012) Whole (2005) A rapid and versatile combined DNA/
plant cell wall characterization using solution- RNA extraction protocol and its application to
state 2D NMR. Nat Protoc 7:1579–1589. the analysis of a novel DNA marker set poly-
https://doi.org/10.1038/nprot.2012.064 morphic between Arabidopsis thaliana ecotypes
32. der Sar S, Kim H, Meissner A et al (2013) Col-0 and Landsberg erecta. Plant Methods 1:4.
Nuclear magnetic resonance spectroscopy for https://doi.org/10.1186/1746-4811-1-4
Chapter 33
Genetic Transformation of Pentalinon andrieuxii Tissue

Cultures
Yeseña Burgos-May, Elidé Avilés-Berzunza,
Luis Manuel Peña-Rodríguez, and Gregorio Godoy-Hernández
Abstract
Pentalinon andrieuxii is a species used in Mayan traditional medicine due to its biological properties.
Recent studies indicate that it produces a pentacyclic triterpene-denominated betulinic acid, which pres-
ents various biological activities: antibacterial, antifungal, antiplasmodial, anti-inflammatory, antimalarial,
anticancer, leishmanicidal, and antiviral, as well as steroids and sterols with leishmanicidal properties. A
recent study also reported the presence of urechitol A and B in the roots; these are secondary metabolites
whose biochemical function is as yet unknown. This plant therefore represents a natural source of metabo-
lites with potential application in the pharmaceutical industry. In this chapter, a protocol is described for
obtaining transgenic plants, at the reporter gene of the β-glucuronidase (GUS) via Agrobacterium tumefa-
ciens from hypocotyl and root explants. The protocol established herein could be employed for the
manipulation of the genes involved in the biosynthesis of isoprenoids or secondary metabolites of interest.
To our knowledge, this is the first report of stable transformation of Pentalinon andrieuxii via Agrobacterium
tumefaciens.
Key words Agrobacterium tumefaciens, Pentalinon andrieuxii, Stable genetic transformation,

β-glucuronidase gene
1 Introduction
Pentalinon andrieuxii (Müller Argoviensis) Hansen and Wunderlin

(synonym, Urechites andrieuxii) [1], 2n = 12 [2], is a woody or
semi-woody, climbing species of the family Apocynaceae, com-
monly known as “bejuco de la vibora” (snake vine), “bejuco
guaco,” and “contrayerba,” which can be found growing on trees
at heights of more than 6 meters, presenting oval, opposing leaves,
5–10 cm long and 2–6 cm wide, dark green on the upper side, and
light-grayish green on the underside. Inflorescences are scarce, yel-
low in color, up to 7 cm in length, and trumpet-shaped, while the
follicles (fruits) are 20–28 cm in length and up to 7 mm in diam-
eter, with an arch-shaped formation. The seeds are brown in color
475
476 Yeseña Burgos-May et al.
and numerous, approximately 7 mm in length and 1 mm wide,

with a narrow stem up to 10 mm in length ending in a light-brown
plume of hair up to 2.5 cm in length (Fig. 1) [3].
P. andrieuxii is used in Mayan traditional medicine to treat
snake bites; an extract obtained by chewing the root or fresh leaves
is applied directly to the affected part. The latex is used to alleviate
headaches and nervous disorders [4].
Biological studies have demonstrated that the extracts from
this plant have antidepressant, anti-inflammatory, and anti-
atherogenic activity [5]. One of the important applications of this
plant is in the treatment of the “chiclero ulcer,” a cutaneous
disease caused by a protozoan of the genus Leishmania sp. [6].
The biological activity of root extracts from P. andrieuxii has been
evaluated using a toxicity assay with the microcrustacean Artemia
salina, which showed greater activity in the ethanol extract
(CL50 = 165.95 μg mL−1) from the plant (CL50 = 1202.26 μg mL−1)
[7].
Extracts of the P. andrieuxii roots were evaluated to determine
their effect on the Leishmania mexicana protozoan. The results
indicated that the hexane extract is very efficient in delaying and
detaining survival of the parasite (10 mg mL−1 of the hexane extract
is effective in killing one million promastigotes of Leishmania mex-
icana cultivated in vitro) [5], confirming the importance of the
extracts from this plant for the treatment of the chiclero ulcer.
From the leaf extract of P. andrieuxii, it has been possible to
extract betulinic acid, which is a lupane-type pentacyclic triterpene,
reported as having antibacterial, antifungal, antiplasmodial, anti-
inflammatory, antimalarial, anticancer, and antiviral activity [8].
Betulinic acid, together with betulinic acid acetate, betulinic acid,
betulinic acid methyl ester, and betulin, was evaluated to deter-
mine their antiprotozoal activity. The results showed that modifi-
cation of the position C-3 increases leishmanicidal activity, while
modification of C-3 and C-28 reduces the activity [9].
In other investigations carried out with the root extract from
P. andrieuxii, it was possible to isolate the trinorsesquiterpenoids,
urechitol A and B. The structures were identified through the
interpretation of their spectroscopic data, and the stereochemistry
of the urechitol was confirmed by an X-ray crystallography study.
This is the first report on the isolation and identification of second-
ary metabolites with the skeleton of trinorsesquiterpenoids [10].
Existing phytochemical knowledge on the genus Pentalinon is
limited, with the existence of one reference on the isolation and
identification of cardenolides and pyrrolizidine alkaloids, which
have antitumor and hepatotoxic activity. The isolation of two preg-
nanes (steroids) from the root extract of P. andrieuxii has also
been reported. The structures of both metabolites were established
using spectroscopic methods and correlating chemical reactions
[11]. A recent report described the isolation of 2 pregnanes (pen-
talinonsterol and pentalinonside), 14 sterols, 3 coumarins, and 1
Transformation of Pentalinon andrieuxii 477
Fig. 1 Pentalinon andrieuxii (Müll. Arg.) Hansen & Wunderlin. (a) Inflorescence. (b) Follicles. (c) Seeds with their
plume. (d) Seeds
triterpene from the methanolic extract of P. andrieuxii roots.

Identification of the pregnane structure was achieved through the
interpretation of their spectroscopic data. All the products isolated
were evaluated in vitro in order to observe their antileishmanicidal
activity. The most effective metabolite against the promastigotes of
L. mexicana was the 6,7-dihydroneridienone. The analog of cho-
lesterol and pentalinonsterol, together with two sterols, the 24-me
thylcholest-4-24(28)-dien-3-one and the neridienone, also showed
a significant leishmanicidal activity. The compounds cholest-4-en-
3-one and cholest-5,20,24-trien-3β-ol exhibited a strong antileish-
manicidal activity against amastigotes of L. mexicana, but the
cholest-4-en-3-ona was found to be the most potent. All the com-
pounds isolated were evaluated to determine their cytotoxicity in
the uninfected derivatives of bone marrow-derived macrophages,
but none showed activity against this cell line [6].
Recently, a protocol for transient genetic transformation of P.
andrieuxii was published, which demonstrated that the species is
susceptible to transformation from leaf, hypocotyl, and root
explants, all of which presented the characteristic blue color due to
the activity of the β-glucuronidase enzyme (GUS reporter gene) of
the transformed tissue [12].
A protocol has been described on the regeneration of in vitro

plants of P. andrieuxii, beginning with the asepsis and germination
of seeds to obtain leaves, hypocotyl, and roots, which were used as
explants for the induction of shoot formation. In this work, it was
determined that the concentration of 6.25 μM of thidiazuron
(TDZ) is optimal for the induction of shoots in root explants (5.25
shoots/explant) and that the concentration of 13.75 μM of TDZ
is the most indicated for the explants of hypocotyl (0.71 shoots/
explant) and leaves (0.38 shoots/explant). The shoots generated
were rooted with 1 μM of indolebutyric acid (IBA), and the accli-
matization stage was carried out in a 1:1 soil-agrolite substrate,
without sterilization [13].
In this work, the protocol of transient transformation via
Agrobacterium tumefaciens::pcCAMBIA2301 (reporter gene of
β-glucuronidase (GUS) previously reported [12]) was used in con-
junction with the protocol of in vitro regeneration of Pentalinon
andrieuxii [13], in order to establish the protocol for stable trans-
formation of the species, using only the root and hypocotyl
explants, as these presented the highest number of shoots/explants.
2 Materials
2.1 Pentalinon The seeds of the species, extracted from follicles measuring between
andrieuxii Seeds 22 and 27 cm, each one containing between 45 and 70 seeds, were
collected from plants growing in the city of Mérida, Yucatán (N
21°00′09.6″; W 89°35′31.9″), from 2012 up to the present day.
2.2 Agrobacterium Agrobacterium tumefaciens strain LBA4404, which is the disarmed

tumefaciens LBA4404 derivative of Ach5 [14], known for its resistance to rifampicin [15],
was employed in all the transformation experiments.
2.3 pCAMBIA 2301 The pCAMBIA 2301 plasmid (Fig. 2) within the left and right
borders can be found in the ADN-T region, where the GUS gene
(UidA) is inserted and codifies for the β-glucuronidase enzyme.
The GUS gene possesses the intron of the catalase, which allows
the expression of the β-glucuronidase in eukaryotic cells; in this
way, once the GUS histochemical test has been conducted, one can
be sure there are no false positives and that an event of plant tissue
transformation is really being observed. The NPTll gene is also
found inserted in this region; this gene codes for the neomycin
phosphotransferase II enzyme, which confers resistance to
kanamycin in the plant. Both genes are under the control of the
promoter 35S of the Cauliflower mosaic virus. The gene of resis-
tance to kanamycin (R), for the selection in bacteria, can be found
outside the ADN-T region.
Fig. 2 pCAMBIA 2301 plasmid (www.org/daisy/cambia/2067.html)
2.4 Culture Media The macronutrients, micronutrients, and organic compounds of

medium PC-L2 [16] were the same as those employed for the
2.4.1 Medium PC-L2
cultivation of transformed plant tissues (Table 1). In the modalities
of semisolid medium and liquid medium, the media were placed in
glass containers covered with aluminum foil or in Erlenmeyer flasks
and autoclaved at 121 °C, 15–20 PSI for 20 min.
2.4.2 YEB Medium The YEB medium (yeast extract and beef) [17] (see Note 1).
2.5 Stock Solutions ●● TDZ 100 mM. Dissolve the quantity in a small volume of 1 M
of KOH, and add distilled water to the desired volume. Store
2.5.1 Plant Growth
the stock at −20 °C.
Regulators
●● IBA 50 mM. Dissolve the quantity in a small volume of 1 M of
KOH, and add distilled water to the desired volume. Store the
product at −20 °C [18].
2.5.2 Antibiotics ●● Streptomycin 10 mg mL−1. Stock in distilled water, and sterilize

by filtration. Store at −20 °C.
●● Rifampicin 10 mg mL−1. Stock in DMSO. Store at −20 °C.
●● Kanamycin 250 mg mL−1. Stock in distilled water, and sterilize
by filtration. Store at −20 °C.
●● Cefotaxime 250 mg mL−1. Stock in distilled water, and sterilize
by filtration. Store at −20 °C [18] (see Note 2).
Table 1
PC-L2 media composition
Compound mM mg L−1
Macronutrients
NH4NO3 12.5 1000
KNO3 20.8 2100
KH2PO4 2.4 325
NaH2PO4.H2O 0.6 85
MgSO4.7H2O 1.8 435
CaCl2.2H2O 4.1 600
Na2EDTA 100 37.3
FeSO4.7H2O 100 27.8
Micronutrients
KI 6 1
H3BO3 82 5
MnSO4.H2O 90 15
ZnSO4.7H2O 17.5 5
Na2MoO4.2H2O 1.7 0.4
CuSO4.5H2O 0.4 0.1
CoCl2.6H2O 0.4 0.1
Organic compounds
Thiamine.HCl 6 2
Pyridoxine.HCl 2.5 0.5
Myoinositol 1.4 250
Sucrose 73 25,000
pH 5.5
2.5.3 Other Stock ●● Acetosyringone 200 mM. Stock in sterile distilled water.

Solutions ●● Buffer for the β-glucuronidase test.
●● 100 mM buffer phosphate pH 7.0 (see Note 3).
●● 0.5 mM K3Fe(CN)6.
●● 0.5 mM K4Fe(CN)6.
●● 10 mM Na2EDTA.
●● 0.1% Triton X-100.
●● X-Gluc (5-bromo-4-chloro-3-indolylglucuronide) in DMSO.

Stock 40 mg mL−1. Store at −20 °C. Use 1 mg mL−1 (see Note
4). Adjust the final volume with distilled water [17].
3 Methods
3.1 Culture The protocol established for culture of the bacterial strain is based
and Preparation on the process reported previously for the transient transformation
of the Agrobacterium of P. andrieuxii [12], with slight modifications.
tumefaciens LBA4404 1. Using a sterile toothpick, pick a colony of the LBA4404 strain
Strain of A. tumefaciens, previously transformed with the vector
pCAMBIA 2301.
2. Inoculate a flask with 20 mL of YEB medium, containing
100 μg mL−1 of rifampicin and streptomycin, respectively, and
50 μg mL−1 of kanamycin.
3. Incubate the culture at 28 °C in total darkness and in agitation
at 200 rpm for 48 h.
4. Take an aliquot of 200 μL, and inoculate 10 mL of YEB
medium with the same concentrations of the three
antibiotics.
5. Incubate in total darkness and in agitation at 200 rpm and at
28 °C for 24 h; add the culture to 20 mL of YEB medium with
antibiotics and 100 μM (before 200 μM) of acetosyringone.
6. Incubate in total darkness and in agitation at 2000 rpm at
28 °C for 5 h, until reaching an OD600 of 0.6 (before DO600
of 0.1).
3.2 Asepsis The protocol of asepsis previously employed [13] is as follows:

and Germination 1. Weigh out 0.3 g of seeds (approximately 55), and wash with
of Pentalinon Extran at 5% for 5 min.
andrieuxii Seeds
2. Rinse them with distilled water to eliminate excess foam.
3. Wash them with ethanol at 70% for 5 min.
4. Rinse them with sterile distilled water three times, and place
them immediately in a solution of commercial sodium hypo-
chlorite at a concentration of 70% for 20 min.
5. The seeds are rinsed once with sterile distilled water and are
placed once more in a solution of commercial sodium hypo-
chlorite at 50% for 10 min.
6. Rinse the seeds three times with sterile distilled water or until
the water is colorless.
7. The seeds are soaked in sterile distilled water for 1 h. All the
above steps are carried out in a laminar flow hood.
8. For their germination, five seeds of P. andrieuxii are placed in

glass containers (10.5 cm long and 6 cm wide) containing
25 mL of semisolid PC-L2 medium [16] at a 50% salt concen-
tration and pH 5.5. The containers with the seeds are covered
with aluminum foil and incubated at 25 °C for 12 days in dark-
ness, after which they are transferred to continuous light at
25 °C (40–50 mmol m−2 seg−1).
3.3 Selection In order to guarantee the adequate selection of the transformed

of the Lethal shoots of the root and hypocotyl explants obtained from 45-day-
Concentration old plants, it is necessary to carry out a dosage curve response of
of Kanamycin kanamycin to select the lethal dosage. For this, 10 concentrations
(0, 2.5, 5, 7.5, 10, 12.5, 15, 20, 25, and 50 μg mL−1) of kanamy-
cin (antibiotic of choice) and a fixed concentration of 50 μg mL−1
of cefotaxime (antibiotic for the elimination of the A. tumefaciens)
are employed. The untransformed explants are placed in glass con-
tainers with medium PC-L2 at 100% of its salts, and the addition
of TDZ (6.25 μM for root and 13.75 μM for hypocotyl), and
finally they are covered with aluminum foil.
The lethal concentration of kanamycin selected was
12.5 μg mL−1 for hypocotyl (Fig. 3) and 7.5 μg mL−1 for root
explants, respectively (Fig. 4); this was incorporated to the culture
medium as selector during shoot induction from the explants, as
well as for their subsequent maintenance.
3.4 Histochemical The histochemical test of GUS is performed after washing the
Analysis of GUS explants of transformed root and hypocotyl callus or shoots main-
tained in PC-L2 medium, following the protocol previously
described [19].
Fig. 3 Response of hypocotyl explants of Pentalinon andrieuxii to variable concentrations of kanamycin on

PC-L2 medium with TDZ and cefotaxime. (S/A) Positive control (with TDZ and without cefotaxime)
Fig. 4 Response of Pentalinon andrieuxii roots to variable concentrations of kanamycin in PC-L2 medium with
TDZ, cefotaxime. (S/A) Positive control (with TDZ and without cefotaxime)
1. Employ 4 mL of phosphate buffer and the dissolved salts as

previously described (see Subheading 2.5.3 and Note 3).
2. Add 100 μL of the solution X-Gluc (5-bromo-4-chloro-3-
indol-β-D-glucuronide) at a concentration of 1 mg mL−1 in
DMSO.
3. The explants are placed in the final solution (buffer-X-Gluc),
15 min of vacuum are applied, and they are then incubated at
37 °C for 24 h in darkness, given that the X-Gluc is
photosensitive.
4. The staining solution is eliminated, and the explants are decol-
ored with a mixture of methanol and acetone (3:1), rinsing
repeatedly until all plant pigments have been eliminated.
5. Finally, the decoloration solution is eliminated from the
explants to allow their observation and to photograph them. If
not required, then the explants are soaked in glycerol at 50%
for their conservation at 4 °C.
3.5 Stable The protocol established here is based on the previously reported
Transformation protocol for the transient transformation of P. andrieuxii [12],
of Pentalinon with modifications.
andrieuxii
1. The root and hypocotyl explants, 1 cm in length, obtained
Through Infection from 45-day-old plants, are submerged in the bacterial culture
by Agrobacterium at a DO600 of 0.6 (before DO600 of 0.1) absorbance, and vac-
tumefaciens uum is applied for 20 min (15 lb. in−2).
2. Excess bacterial culture is eliminated from the explants by plac-

ing them on sterile filter paper.
3. The co-cultured explants (four for each tissue) are placed in
glass containers with 25 mL of the co-cultured medium [semi-
solid medium PC-L2 at 100% of its ionic strength, with the
addition of TDZ (6.25 μM for the root explants and 13.5 μM
for the hypocotyls explants, respectively) without antibiotics].
4. The containers with the co-cultured explants, covered with
aluminum foil, are incubated in the culture room for 5 days
(before 3 days) in darkness at 25 °C (before 28 °C).
5. Once the culture period is concluded, the explants are washed
with liquid PC-L2 medium with cefotaxime 100 μg mL−1 for
30 min, followed by another rinse without the antibiotic for
15 min. The histochemical GUS test on the hypocotyl and
root explants can be seen in Fig. 5, and the frequency of infec-
tion is shown in Table 2.
6. Finally, the co-cultured explants (4 for each tissue) are placed
in glass containers with 25 mL of the shoot induction medium
(PC-L2 medium at 100% of its ionic strength), with the addi-
tion of 6.25 μM of TDZ, 7.5 μg mL−1 of kanamycin, and
50 μg mL−1 of cefotaxime for the root explants, while for the
hypocotyl explants, 13.5 μM of TDZ, 12.5 μg mL−1 of kana-
mycin, and 50 μg mL−1 of cefotaxime are added. The explants
are then incubated at 25 °C in continuous light in order to
induce the formation of callus (see Note 5).
3.6 Induction 1. After 30 days, the root and hypocotyl explants incubated under
of Shoots continuous light for the induction of transformed callus are
from the Transformed subcultured for an additional period of 30 days in the same
Callus, Maintenance, conditions previously described, in order to induce the forma-
and Rooting tion of shoots. In this case, the distribution is two explants-
of Pentalinon callus/container. The histochemical GUS test on the hypocotyl
andrieuxii Plantlets and root callus can be seen in Fig. 6.
Transformed 2. After 60 days, the induced shoots with lengths greater than
with the GUS 1.5–2 cm are separated and placed individually in glass con-
Reporter Gene tainers with 25 mL of PC-L2 medium at 100% of its ionic
strength, without TDZ, to achieve elongation, but with the
addition of 6.25 μM of TDZ, 7.5 μg mL−1 of kanamycin, and
50 μg mL−1 of cefotaxime for the shoots obtained from root
and with the addition of 13.5 μM of TDZ, 12.5 μg mL−1 of
kanamycin, and 50 μg mL−1 of cefotaxime in the case of the
shoots obtained from hypocotyl explants (Fig. 7).
3. The callus-shoots will continue to proliferate, if they are sub-
cultured individually for a third time on the PC-L2 medium
for shoot induction with TDZ and the respective antibiotics.
The same operation for the separation of shoots is performed
when they reach a length of 1.5–2 cm.
Fig. 5 Histochemical GUS test on hypocotyls and roots of Pentalinon andrieuxii transiently transformed. (a)
Non-co-cultured hypocotyl explant. (b) Co-cultured hypocotyl explant. (c) Non-co-cultured root explant. (d)
Co-cultured root explant
Table 2
Infection frequency of the root and hypocotyl explants of Pentalinon
andrieuxii
# of GUS positive a
% infection
Explant # of explants explants frequency
Root 185 8 36.36
Hypocotyl 185 13 54.16
Infection frequency (%): # of explants (+) to the GUS test/# total of infected explants
a
per 100
4. When the potentially transformed shoots obtained from both

explants have achieved a length of 3 cm, they are transferred
onto individual containers with 25 mL of PC-L2 medium at
100% of its ionic strength; 50 μg mL−1 of cefotaxime, with the
addition of 12.5 μg mL−1 of kanamycin for the hypocotyl-
derived shoots; and 7.5 μg mL−1 of kanamycin for the root-
derived shoots, as well as 1 μM of IBA for root proliferation in
both cases. The histochemical GUS test of different tissues
from the rooted plantlets generated from the hypocotyl can be
Fig. 6 Histochemical GUS test in hypocotyl and root callus of Pentalinon andrieuxii. (a) Callus from non-co-
cultured hypocotyl explant. (b) Callus from co-cultured hypocotyl explant. (c) Callus from non-co-cultured root
explants. (d) Callus from co-cultured root explant
Fig. 7 Potentially transformed callus-shoots regenerated from hypocotyl explants

of Pentalinon andrieuxii
Fig. 8 Histochemical GUS test in rooted shoots regenerated from hypocotyl callus of Pentalinon andrieuxii. (a)
Non-transformed hypocotyl and leaves. (b) Transformed hypocotyl callus. (c) Transformed shoot. (d)
Transformed leaf. (e) Transformed hypocotyl. (f) Transformed root
seen in Fig. 8, as well as in the leaves of the different lines

obtained (Fig. 9). The transformation frequency was found to
be more favorable for the hypocotyl explants (33%), in com-
parison with that of the root segments (28%) (Table 3).
The infection frequency was found to be more favorable for

the hypocotyl explants (54%), in comparison with that of the roots
(36%) (Table 2).
3.7 Adaptation 1. The plantlets are removed from the containers, and the roots
of Plantlets Rooted are washed with tap water.
in Pots 2. The roots are soaked in a benlate solution prior to their trans-
fer to pots with non-sterile red soil and agrolite (1:1).
3. The pots are covered immediately with plastic bags, which are
subsequently punctured with a needle each day for a week, and
incubated in a culture room under continuous light at 25 °C.
4. The plastic bags are removed after a week, and the pots are
maintained 3 additional weeks under the same conditions
before their transfer to a shaded area, where a survival rate of
80% is usually attained (Fig. 10).
3.8 Molecular For the extraction of the genomic DNA, the methodology previ-
Analysis ously described [20] is used, with modifications.
3.8.1 Genomic DNA

1. Two hundred milligrams of fresh tissue (leaves) is weighed
Extraction
and ground in liquid nitrogen to obtain a fine powder.
Fig. 9 Plantlets transformed with the GUS reporter gene, regenerated from hypocotyl and root callus of
Pentalinon andrieuxii. (a) Wild plants regenerated from hypocotyl callus. (b, c) Plants regenerated from root
callus. (d, e) Plants regenerated from hypocotyl callus. (a’, b’, c’, d’, e’) Histochemical staining of leaf frag-
ments from the respective plants
Table 3
Transformation frequency of root and hypocotyl explants from Pentalinon andrieuxii
# of total # of total # of explant # of shoots (+) % transformation

explants shoots shoots to GUS frequencya
Hypocotyl 94 93 1.01 31 33.33
Root 102 157 1.53 45 28.66
Transformation frequency (%): # of shoots (+) to the GUS test/# of total shoots per 100
a
2. The fine powder is macerated in 1 mL of extraction buffer

(1 M Tris-HCl, 1 M EDTA, 1 M NaCl, PEG 8000, 0.5%
Na2S2O5).
3. One hundred microliters of SDS at 20% and 200 μL of PVP at
5% are added to the homogenate, which is then incubated at
65 °C for 20 min.
Fig. 10 Untransformed plantlets (control) and plantlets of Pentalinon andrieuxii transformed with the GUS
reporter gene in adaptation stages in pots
4. Five hundred microliters of 5 M potassium acetate is added to

the homogenate and then incubated in ice for 20 min.
5. The mixture is centrifuged at 13,792.766 × g for 25 min, and
the supernatant is collected.
6. Ten microliters of RNase is added to the supernatant, and it is
incubated at 37 °C for 60 min.
7. Five hundred μL of isopropyl alcohol is added, and the mix-
ture is incubated at −4 °C for 60 min.
8. The mixture is centrifuged at 11,752.416 × g for 20 min, the
supernatant is discarded, and the paste is left to dry at room
temperature.
9. The paste is washed with 700 μL of redissolving buffer (10 mM
Tris; 1 mM of EDTA, pH 8) and centrifuged at 12,752.1875 × g
for 10 min.
10. The supernatant is recovered, to which 75 μL of 3 M sodium
acetate and 500 μL of isopropyl alcohol are added and mixed.
11. The mixture is centrifuged at 13,000 rpm for 10 min, and the
paste is washed twice with ethanol at 70%.
12. Finally, the paste is allowed to dry at room temperature and
re-suspended in water for molecular biology analysis.
3.8.2 Amplification 1. Polymerase chain reaction (PCR) is a technique designed to

of the Genes of Interest synthesize a fragment of DNA. This is used to amplify a frag-
by Polymerase Chain ment of 600 pb of the neomycin phosphotransferase II gene
Reaction (PCR) (NPTII) according to the previously established conditions
[21]: 94 °C × 5 min for the denaturation, 30 cycles of 94 °C
per minute, 57 °C × 45 s and 72 °C × 70 s, and a final elonga-
tion of 72 °C × 5 min. The PCR reaction comprises the follow-

ing reactives: PCR buffer at 1×, 0.2 mM of dNTPs, 1.5 mM of
MgCl2, 0.5 μM of the oligonucleotides (forward and reverse),
and 2 units of Taq polymerase.
2. Oligonucleotides for NPTII:
(a) Forward 5′-TAT TCG GCA TTG ACT GGG CA-3′
(b) Reverse 5′-GCC AAC GCT ATG TCC TGA TA-3′
3. From the transformed lines obtained, three lines are taken at
random to perform the extraction of DNA and amplification of
the NPTII gene, in order to confirm the transformation events.
4. PCR analysis of the selected lines [E3 and H.2 (hypocotyl) and
F2 (root)] and the subsequent amplification of the NPTII
gene show the expected amplification of the 600 pb fragment,
confirming the transformation of the lines (Fig. 11).
4 Notes
1. Composition of the YEB medium: 5 g L−1 Beef extract, 5 g L−1

peptone, 5 g L−1 sucrose, 1 g L−1 yeast extract, and 0.5 g L−1
MgSO4.7H2O. Adjust pH to 5.6 prior to its sterilization in
autoclave.
2. Cefotaxime is thermolabile; therefore, it must be sterilized by
filtration. Moreover, given that it is also photosensitive, incu-
bation of the tissues in diffuse light or in darkness is recom-
mended in order to obtain a better effect. In media containing
cefotaxime and with explants subjected to continuous light,
the subcultures should be done every 20 days, maximum.
3. The phosphate pH 7 buffer can be prepared by adding 122 mL
of 200 mM of Na2HPO4 to 78 mL of NaH2PO4. If the pH is
not 7, it can be adjusted with a base or weak acid. It is sterilized
by filtration and stored at laboratory temperature, for use in a
laminar flow hood.
4. The X-Gluc can be prepared as a stock of 10 mM dissolved in
DMSO, to be mixed with the phosphate buffer prior to its use
in the co-cultured explants or in potentially transformed
shoots.
5. The PC-L2 culture medium, with TDZ, is autoclaved at
121 °C, 15–20 PSI for 20 min; it is allowed to cool, without
solidification, in order to add the antibiotics and subsequently
distributed in glass containers, which are then covered with
aluminum foil. This stage is essential because, if the medium is
very hot, it will degrade the antibiotics and affect the selection
of transformed shoots (kanamycin), as well as the elimination
of bacteria (cefotaxime).
Fig. 11 PCR to detect the nptII gene in the transformed Pentalinon andrieuxii
plants. (1) Positive control (plasmid pCAMBIA 2301). (2) Negative control (DNA
wild plant). (3) Hypocotyl line E3. (4) Root line F2. (5) Hypocotyl line H2; (6) 100 bp
DNA ladder
5 Conclusions
The protocol reported herein allows to regenerate P. andrieuxii

transgenic shoots expressing the GUS reporter gene from hypo-
cotyl and root explants, as well as its subsequent rooting and adap-
tation in pots. Although the transformation frequency obtained is
low in both cases (28% in roots and 33% in hypocotyls), the proto-
col can be applied to obtain transformed plants with key genes of
metabolic routes such as those of the cytoplasmic isoprenoids
[gene of the 3-hydroxy-3-methylglutaryl CoA reductase (HMGR)]
and the plastidic isoprenoids [gene of the 1-deoxy-D-xylulose-5-
phosphate synthase (DXS)] or of genes potentially involved in sec-
ondary metabolism.
Acknowledgment
The authors would like to express their gratitude to the Consejo

Nacional de Ciencia y Tecnología (CONACYT) of Mexico for the
financial support received for the projects 223404 and 257915.
Our thanks also for the Master’s scholarship (280663) awarded to
Yeseña Beatriz Burgos May.
References
1. Hansen BF, Wunderlin RP (1986) Pentalinon Pentalinon andrieuxii. Phytochem Lett 5:45–
Voigt, an earlier name for Urechites Müll. Arg. 48. https://doi.org/10.1016/j.phytol.2011.
(Apocynaceae). Taxon 35:166–168 09.004
2. Van den Laan, Arends JC (1985) Cytotaxonomy 12. Yam-Puc A, Elide A-B, Chan-Bacab M et al
of the Apocynaceae. Genetica 68:3–35. (2012) Agrobacterium-mediated transient
https://doi.org/10.1007/BF02424563 transformation of Pentalinon andrieuxii Müll.
3. Rzedowski J, Calderon G (1998) Flora del Arg. Adv Biosci Biotechnol 3:256–258.
bajío y regiones adyacentes. Fascículo https://doi.org/10.4236/abb.2012.33035
70:27–28 13. Martin-Acosta JC, Avilés-Berzunza E, Godoy-
4. Pulido MT, Serralta L (1993) Lista anotada de Hernández G (2012) In vitro plant regenera-
las plantas medicinales de uso actual en el tion from explants of Pentalinon andrieuxii
estado de Quintana Roo, México. Centro de (Müll. Arg). Hansen & Wunderlin.
Investigaciones de Quintana Roo, Chetumal, Unpublished
p 105 14. Hoekema A, Hirsch PR, Hooykaas PJJ,
5. Lezama-Dávila C, Isaac-Márquez AP, Zamora- Schilperoort RA (1983) A binary plant vector
Cresencio P et al (2007) Leishmanicidal activ- strategy based on separation of vir- and
ity of Pentalinon andrieuxii. Fitoterapia T-region of the Agrobacterium tumefaciens
78:255–257. https://doi.org/10.1016/j. Ti-plasmid. Nature 303:179–180. https://
fitote.2006.12.005 doi.org/10.1038/303179a0
6. Li P, Lezama-Dávila CM, Isaac-Márquez A 15. Lee LY, Gelvin SB (1988) T-DNA binary vec-
et al (2012) Sterols with antileishmanial activ- tors and systems. Plant Physiol 146:325–332.
ity isolated from the roots of Pentalinon https://doi.org/10.1104/pp.107.113001
andrieuxii. Phytochemistry 82:128–135. 16. Phillips G, Collins G (1979) In vitro tissue cul-
https://doi.org/10.1016/j. ture of selected legumes and plant regeneration
phytochem.2012.06.012 from callus culture of red clover. Crop Sci
7. Melchor-Macías P, Carballo-Perea JA, 19:59–64. https://doi.org/10.2135/cropsci
Hernández-Solís U (2005) Posible actividad 1979.0011183X001900010014x
biológica del extracto de la raíz de Pentalinon 17. Sambrook J, Fritsch EF, Maniatis T (1989)
andrieuxii. Universidad del Valle de México. Molecular cloning: a laboratory manual, 2nd
Dirección General Académica. Episteme No.3. edn. Cold Spring Harbor Laboratory Press,
Dirección Institucional de Investigación e Cold Spring Harbor, New York
Innovación Tecnológica. UVM - Campus 18. Ellis JR (1993) Plant tissue culture and genetic
Chapultepec transformation. In: Croy RRD (ed) Plant
8. Moghaddam M, Ahmad F, Samzadeh-Kermani molecular biology, LABFAX series. Blackwell
A (2012) Biological activity of betulinic acid: a Scientific Publications, Oxford
review. Pharmacol Phar 3:119–123 19. Jefferson RA, Kavanagh TA, Bevan MW
9. Domínguez-Carmona DB, Escalante-Erosa F, (1987) GUS fusions: β-glucuronidase as a sen-
Garcia-Sosa K et al (2009) Antiprotozoal activ- sitive and versatile gen fusion marker in higher
ity of betulinic acid derivatives. Phytomedicine plants. EMBO J 6:3901–3907
17:379–382. https://doi.org/10.1016/j. 20. Dellaporta S, Wood J Hicks J (1983) A plant
phymed.2009.08.002 minipreparation: version II. Plant Mol Biol
10. Yam-Puc A, Escalante-Erosa F, Pech-Lopez M Rep 1:19–20. https://doi.org/10.1007/
et al (2009) Trinorsesquiterpenoids from the BF02712670
root extracts of Pentalinon andrieuxii. J Nat 21. Vanegas PE, Valdez-Morales M, Valverde ME
Pro 72:745–748. https://doi.org/10.1021/ et al (2006) Particle bombardment, a method
np800554n for gene transfer in marigold. Plant Cell Tiss
11. Yam-Puc A, Chee-Gonzalez L, Escalante-Erosa Org 84:359–363. https://doi.org/10.1007/
F et al (2011) Steroids from the root extract of s11240-005-9030-x
Appendix A: The Components of the Culture Media
Randy Avilez-Montalvo and Víctor M. Loyola-Vargas
Abstract
The type of culture medium and its composition are fundamental when planning experiments in the field
of plant tissue culture. The balance of its macro, micro, and organic components, and in most of the cases
coupled with plant growth regulators, forms an amalgam that will allow us to succeed or to fail in the
establishment of plant tissue culture. A better understanding of the nutritional requirements of cultured
cells and tissues can help to choose the most appropriate culture medium for the explant used.
Key words Culture media
1 Introduction
A medium is defined as a formulation of inorganic salts and organic

compounds (apart from major carbohydrate sources, vitamins, and
plant growth regulators) used for the nutrition of plant cultures [1].
The success in the technology and application of plant tissue culture
is greatly influenced by the nature of the culture medium used. A
better understanding of the nutritional requirements of cultured
cells and tissues can help to choose the most appropriate culture
medium for the explant used. Similarly, certain factors, such as the
type of explant, the concentration, and combination of the
components of the medium, and the purpose of the experiment
should be considered. In summary, it is important to take into
consideration that each plant culture can have its requirements.
The composition of the media that we are currently using
originated from studies of plant nutrition carried out by plant

physiologists. During the last part of the nineteenth and beginning of
the twentieth centuries, several laboratories around the world found
each one of the necessary elements for the nutrition of plants. Most
of this knowledge comes from the solutions d eveloped for the hydro-
ponic culture of intact plants. The base of most of these first media
was the Knop’s medium [2] and the Uspeuski and Uspetiskaia’s
medium for algae [3]. These two media were the base of the White’s
medium [4]. Gautheret [5] used a combination of Knop’s medium
https://doi.org/10.1007/978-1-4939-8594-4, © Springer Science+Business Media, LLC, part of Springer Nature 2018
493
494 Culture Media
and a modified mineral solution from Berthelot medium to culture

carrot calli. Heller [6] began a large list of studies over the mineral
requirements of plant tissue culture, in particular carrot. His approach
was to subculture several times the cells in a mineral solution without
one of the components and then reintroducing the element at differ-
ent concentrations. During the following years, different research
groups, using the same and new approaches, reached the different
media that we are using today. However, the standard for the elabo-
ration of a medium was set by the laboratory of Folke Skoog at the
Department of Botany, University of Wisconsin [7].
The major changes made to the composition of the media since
the early days have been the introduction of ammonium as a nitrogen
source, together with a higher amount of nitrate and potassium, as
well as the use of organic additives mainly vitamins and amino acids.
Plant tissue culture provides major (macro) and minor
(micro) carbon source and trace amounts of certain organic
compounds, notably vitamins, amino acids, and plant growth
regulators (Table A1). In general, the tissue culture medium
must contain the 14 essential elements for plant growth, n itrogen,
potassium, calcium, phosphorus, magnesium, sulfur, iron, nickel,
chlorine, manganese, zinc, boron, copper, and molybdenum, in
addition to carbon, oxygen, and hydrogen [1, 8].
When a culture medium is not defined, it is common to use
variables of the same in compounds or concentration to obtain a
medium that is not only according to the objectives of the research
but also that it can be reproducible; however, this practice requires
considerable time to develop. In some cases, culture media can be
taken as a reference for the development of new culture media for
individual species and specific propagation methods [9].
For plant tissue culture, the most widely used media and their
differences in composition are presented in Table A1. The most
important difference among media may be the overall salt level.
There seem to be three different media types by this classification:
high salt (e.g., Murashige and Skoog medium), intermediate level
(e.g., Nitsch and Nitsch), and low salt media (e.g., White).
Researchers quickly found that the addition of “complexes” to
the basic medium frequently resulted in the successful growth of
tissues and organs. Some of these complexes have included green
tomato extract, coconut milk, orange juice, casein hydrolysate, and
yeast and malt extract [8, 10].
It is critical when a medium is chosen to take into account that
some of the components of the culture media are not only a nutrient;
some of them can have a profound influence not only on the growth
of the cultures but in the differentiation process [11, 12]; for exam-
ple, the addition of arginine significantly induces sugarcane somatic
embryogenesis (SE) [13], and during the induction of SE in Coffea
canephora, there is a substantial change in the levels of putrescine,
spermidine, and spermine, both free and bound, suggesting that a
close correlation exists between p olyamine biosynthesis and SE [14].
Table A1
The composition of media most frequently used
Components of the media

Components MS LS G PC W
Macroelements mg L−1 (mM) mg L−1 (mM) mg L−1 (mM) mg L−1 (mM) mg L−1 (mM)
(NH4)2SO4 134 (1.0)
NH4NO3 1650 (20.60) 1650 (20.60) 1000 (12.5)
KNO3 1900 (18.80) 1900 (18.80) 2528 (25.0) 2100 (20.8) 80 (0.79)
CaCl2·2H2O 440 (3.00) 440 (3.00) 150 (1.0) 600 (4.1) 440 (3.00)
KH2PO4 170 (1.25) 170 (1.25) 325 (2.4)
FeSO4·7H2O 27.80 (100) 27.80 (100) 27.80 (100) *25.0 (0.1)
*FeSO4·7H2O(EDTA)
Na2EDTA 37.30 (100) 37.30 (100) 37.30 (100)
MgSO4·7H2O 370 (1.50) 370 (1.50) 250 (1.0) 435 (1.8) 720 (2.92)
NaH2PO4·H2O 150 (1.1) 85 (0.6) 19 (0.13)
Ca(NO3)2·4H2O 300 (1.27)
KCl 65 (0.87)
Na2SO4 200 (1.40)
Fe2(SO4)3 2.5 (0.006)
−1 −1 −1 −1
Microelements mg L (μM) mg L (μM) mg L (μM) mg L (μM) mg L−1 (μM)
Na2MoO4·2H2O 0.25 (1.0) 0.25 (1.0) 0.25 (1.0) 0.4 (1.7)
H3BO3 6.20 (100.0) 6.20 (100.0) 3.0 (50.0) 5.0 (82.0) 1.5 (24.2)
Culture Media
MnSO4·7H2O *22.30 (100.0) *22.30 (100.0) **10.0 (60.0) **15.0 (90.0) *7.0 (31.3)
*MnSO4·4H2O
** MnSO4·H2O
495
CuSO4·5H2O 0.025 (0.1) 0.025 (0.1) 0.025 (0.1) 0.1 (0.4) 0.001 (0.004)
(continued)
Table A1
496
(continued)

ZnSO4·7H2O 8.60 (30.0) *8.60 (30.0) 2.0 (7.0) 5.0 (17.5) 3.0 (10.4)
*ZnSO4·4H2O
Culture Media
KI 0.83 (5.0) 0.83 (5.0) 0.75 (4.5) 1.0 (6.0) 0.75 (4.5)
CoCl2·6H2O 0.025 (0.1) 0.025 (0.1) 0.025 (0.1) 0.1 (0.4)
MoO3 0.0001 (0.004)
Organic components mg L−1 (μM) mg L−1 (μM) mg L−1 (μM) mg L−1 (μM) mg L−1 (μM)
Pyridoxine HCl 0.5 (2.43) 1 (4.86) 0.5 (2.43) 0.1 (0.5)
Nicotinic acid 0.5 (4.06) 1.0 (8.12) 0.5 (4.0)
Thiamine HCl 0.1 (0.30) 0.4 (1.20) 10.0 (30.0) 2 (6.0) 0.1 (0.3)
Myo-inositol 100.0 (555.10) 100.0 (555.10) 100.0 (555.10) 250.0 (1400.0)
Glycine 2.0 (26.60) 3.0 (40.0)
Sucrose 30,000 (87.64 mM) 30,000 (87.64 mM) 20,000 (58.42 mM) 25,000 (73.0 mM) 20,000 (58.42 mM)
pH* 5.7–5.8 5.6 5.5 5.8 5.5
Murashige and Skoog (MS) [7], Linsmaier and Skoog (LS) [30], Gamborg et al. (G) [31, 32], Phillips and Collins (PC) [33], White (W) [34, 35]
Components NN SH Y MY
Macroelements mg L−1 (mM) mg L−1 (mM) mg L−1 (mM) mg L−1 (mM)
NH4NO3 720 (9.0) 412.5 (5.156) 412 (5.15)
KNO3 950 (9.4) 2500 (24.72) 475 (4.7) 475 (4.7)
CaCl2·2H2O *166 (1.5) 200 (1.36) 110 (0.748) 110 (0.748)
*CaCl2
KH2PO4 68 (0.5) 85 (0.624) 85 (0.624)
Fe-Na-EDTA 21 (0.057)
FeSO4·7H2O 27.8 (0.1) 15 (0.054) 21 (75.53)
Na2EDTA 37.2 (0.1) 20 (0.053) 27.9 (74.95)
MgSO4.7H2O 185 (0.75) 400 (1.63) 92.5 (0.375) 92.5 (0.375)
NH4H2PO4 300 (2.60)
−1
Microelements mg L (μM) mg L−1 (μM) mg L−1 (μM) mg L−1 (μM)
Na2MoO4·2H2O 0.25 (1.0) 0.1 (0.41) 0.125 (0.5) 0.125 (0.5)
H3BO3 10 (161.7) 5.0 (80.86) 3.100 (50) 3.100 (50)
MnSO4·7H2O *25 (112.1) **10.0 (59.17) 11.2 (40.41) **6.83 (40)
*MnSO4·4H2O
**MnSO4·H2O
CuSO4·5H2O 0.025 (0.1) 0.2 (8.00) 0.05 (0.2) 0.05 (0.2)
ZnSO4·7H2O 10 (42.8) 1.0 (3.47) 4.3 (15) 4.3 (15)
KI 1.0 (6.02)
CoCl2·6H2O 0.1 (0.42)
−1
Organic components mg L (μM) mg L−1 (μM) mg L−1 (μM) mg L−1 (μM)
Pyridoxine HCl 0.5 (2.43) 0.5 (2.43) 1 (4.86) 1 (4.86)
Nicotinic acid 5.0 (40.6) 5.0 (40.6) 1 (8.12) 1 (8.12)
Thiamine HCl 0.5 (1.50) 5.0 (14.8) 10 (29.6) 10 (29.6)
Myo-inositol 100 (555.10) 1000 (5500.6) 100 (550) 100 (550)
Glycine 2.0 (26.60)
Folic acid 0.5 (1.1)
Culture Media
Biotin 0.05 (0.2)

Sucrose 20,000 (58.42 mM) 30,000 (87.64 mM) 30,000 (87.64) 30,000 (87.64)
497
pH 5.5 5.9 5.7 5.8

Nitsch and Nitsch (NN) [36], Schenk and Hildebrandt (SH) [37], Yasuda (Y) [38], Modified Yasuda (MY) [9]
498 Culture Media
The carbon source is another important component of the

c ulture medium. As the cells, tissues, and organ culture are not
fully autotrophic, they need an organic carbon source [15]. The
morphogenetic potential of plant tissues can significantly be
manipulated by the carbon sources. Also, the response to different
carbon sources depends on the species and genotypes. Sucrose is
the most frequently used carbon source in the studies of SE
induction [16–21]. It has been found that the carbon source plays
an important role during SE induction [22]. In Linum
usitatissimum, fructose produces higher embryonic cultures with
higher somatic embryo frequencies [23]. Also, it has been
suggested that the carbon source plays an important role in

regulating the gene expression during the histodifferentiation of
somatic embryos [24].
Another important fact is that vigorous colonies of callus tissue
require more nutrients than the slowly growing ones, while the
opposite situation can be observed for other nutrients. At the same
time, some nutrients are taken in “order” by the cells, e.g., different
nitrogen sources [25]. In the case of the media used to cultivate
cells for the production of secondary metabolites, special attention
must be done to some of the minor components. The successful
production of shikonin derivatives by suspension cultures of
Lithospermum erythrorhizon is due to a change in the composition
of the medium [26]. The presence of ammonium is inhibitory to
the production of the compounds, while nitrate as nitrogen source
lets the stable production of shikonin derivatives [26]. In addition
to nitrate, phosphate, copper, and sulfate have significant effects on
the production of shikonin derivatives [26].
It is also important to pay attention to some inaccuracies and
errors which have appeared in several widely used plant tissue
culture basal medium formulations [27, 28]. Even the primary
literature can have some mistakes [7], or the same name is used to
designate different media. There have been many different versions
presented in print either by White and his co-workers [28].
Minor variations in medium composition can determine the
success or failure of individual protocols. The excesses of a c helating
agent, although small, may be influencing micronutrient
availabilities. Investigators should sift through original papers and
compare them with commercial formulations when seeking details
on a given nutrient or medium.
In relation with the Kao and Michayluk medium (Table A2)
[29], the presence of vitamin-free casamino acid and the coconut
water is essential for the culture of protoplasts, but they are not
necessary for the culture of cells. This medium is one of the most
complex between all the media used in plant tissue culture. It is
used mainly for the growth of very low cell density cultures, as well
as protoplasts in liquid media [29].
Culture Media 499
Table A2
The composition of media of Kao and Michayluk [29]
Macroelements mg L−1 mM
NH4NO3 600 7.49
KNO3 1900 18.80
CaCl2·2H2O 600 4.08
MgSO4·7H2O 300 1.21
KH2PO4 170 1.25
SequestreneR 330Fe 28 —
Microelements mg L−1 μM
H3BO3 3.00 48.5
MnSO4·H2O 10.00 59.2
ZnSO4·7H2O 2.00 7.0
KI 0.75 4.5
Na2MoO4·2H2O 0.25 1.0
CuSO4·5H2O 0.025 0.1
CoCl2·6H2O 0.025 0.1
Vitamins mg L −1
μM
Myo-inositol 100.0 555.10
Nicotinamide 1.0 8.19
Pyridoxine HCl 1.0 4.86
Thiamine HCl 1.0 3.00
Calcium D-pantothenate 1.0 4.20
Folic acid 0.4 0.90
p-aminobenzoic acid 0.02 0.15
Biotin 0.01 0.04
Choline chloride 1.00 7.16
Riboflavin 0.20 0.53
Ascorbic acid 2.00 11.35
Vitamin A 0.01 0.03
Vitamin D3 0.01 0.02
Vitamin B12 0.02 0.01
(continued)
500 Culture Media
Table A2
(continued)
Macroelements mg L−1 mM
Organic acids mg L−1 μM
Sodium pyruvate 20.0 181.8
Citric acid 40.0 208.2
Other sugars and sugar alcohols mg L −1
mM
Fructose 250.0 1.38
Ribose 250.0 1.66
Xylose 250.0 1.66
Mannose 250.0 1.38
l-amino acids mg L −1
μM
All are used at a concentration of 0.1 mg L−1 except:
Glutamine 5.6 38.3
Alanine 0.6 6.7
Nucleic acid bases mg L−1 μM
Adenine 0.10 0.74
Guanine 0.03 0.20
Thymine 0.03 0.24
Uracil 0.03 0.27
Hypoxanthine 0.03 0.22
Xanthine 0.03 0.19
Other mg L −1
μM
Vitamin-free casamino acid 250.0 —
Coconut water a
20.0 mL L −1
—
Sucrose 20 g L −1
58.40 mM
Glucose 10 g L−1 55.49 mM
pH 5.6
From mature fruits; heated at 60 °C for 30 min
a
This medium is filter-sterilized
Acknowledgment

(CONACyT, 1515).
Culture Media 501
References
1. George EF, De Klerk G-J (2008) The 12. Gutierrez E, Gallego P, Alonso A et al (2010)
components of plant tissue culture media
Nitrogen compounds in embryogenic and
I: macro and micro nutrients. In: George non-embryogenic calluses of Medicago
EF, Hall MA, De Klerk GJ (eds) Plant arborea L. In Vitro Cell Dev Biol-Plant
propagation by tissue culture, Springer, 46:257–264. https://doi.org/10.1007/
Dordrecht, pp 65–102. doi: https://doi. s11627-009-9273-z
org/10.1007/978-1-4020-5005-3_3 13. Nieves N, Sagarra F, González R et al (2008)
2. Knop W (1865) Quantitative u ntersuchugen Effect of exogenous arginine on sugarcane
über die ernahrungsprozesse der pflanzen. (Saccharum sp.) somatic embryogenesis, free
Landwirtsch Vers Stn 7:93–107 polyamines and the contents of the soluble
3. Uspenski EE, Uspenskaja WJ (1925) proteins and proline. Plant Cell Tiss Org
Reinkultur und ungeschlechtliche 95:313–320. https://doi.org/10.1007/
Fortpflanzung des Volvox minor und Volvox s11240-008-9445-2
globator in einer synthetischen Nährlösung. 14. De-la-Peña C, Galaz-Ávalos RM, Loyola-
Zeitschr Bot 17:273–308 Vargas VM (2008) Possible role of light
4. White PR (1942) Plant tissue cultures. Annu and benzylaminopurine on biosynthesis of
Rev Biochem 11:615–628. https://doi. polyamines during the somatic embryogen-
org/10.1146/annurev.bi.11.070142.003151 esis of Coffea canephora. Mol Biotechnol
5. Gautheret RJ (1939) Sur la possibilité de 39:215–224. https://doi.org/10.1007/
réaliser la culture indefinie des tissus de s12033-008-9037-8
tubercules de carotte. CR Hebd Seances Acad 15. Yaseen M, Ahmad T, Sablok G et al (2013)
Sc 208:118–120 Review: role of carbon sources for in vitro
6. Heller R (1953) Recherches sur la n utrition plant growth and development. Mol Biol Rep
minerale des tissues vegetaux in vitro. Ann Sci 40:2837–2849. https://doi.org/10.1007/
Nat Bot Paris 14:1–10 s11033-012-2299-z
7. Murashige T, Skoog F (1962) A 16. Swedlund B, Locy RD (1993) Sorbitol as
revised medium for rapid growth and the primary carbon source for the growth of
bioassays with tobacco tissue cultures.
embryogenic callus of maize. Plant Physiol
Physiol Plant 15:473–497. https://doi. 103:1339–1346. https://doi.org/10.1104/
org/10.1111/j.1399-3054.1962.tb08052.x pp.103.4.1339
8. Conger BV (1980) Cloning agricultural plants 17.
Nadel BL, Altman A, Ziv M (1989)
via in vitro techniques. CRC Press, Boca Regulation of somatic embryogenesis in
Raton, FL celery cell suspensions. Plant Cell Tiss Org
18:181–189. https://doi.org/10.1007/
9. Quiroz-Figueroa FR, Monforte-González BF00047743
M, Galaz-Ávalos RM et al (2006) Direct
somatic embryogenesis in Coffea canephora. 18. Kochba J, Ben-Hayyim G, Spiegel-Roy P
In: Loyola-Vargas VM, Vázquez-Flota FA et al (1982) Selection of stable salt-tolerant
(eds) Plant Cell Culture Protocols. Humana callus cell lines and embryos in Citrus sinen-
Press, Totowa, NJ, pp 111–117. https://doi. sis and C. aurantium. Z Pflanzenphysiol
org/10.1385/1-59259-959-1:111 106:111–118. https://doi.org/10.1016/
S0044-328X(82)80073-1
10. George EF, Hall MA, De Klerk G-J (2008)
The components of plant tissue culture 19. Strickland SG, Nichol JW, McCall CM
media II: organic additions, osmotic and et al (1987) Effect of carbohydrate
pH effects, and support systems. In: George source on alfalfa somatic embryogen-
EF, Hall MA, De Klerk GJ (eds) Plant esis. Plant Sci 48:113–121. https://doi.
propagation by tissue culture, Springer, org/10.1016/0168-9452(87)90138-5
Dordrecht, pp 115–173. doi: https://doi. 20.
Quiroz-Figueroa FR, Méndez-Zeel M,
org/10.1007/978-1-4020-5005-3_4 Sánchez-Teyer F et al (2002) Differential
11. Fuentes-Cerda CFJ, Monforte-González M, gene expression in embryogenic and non-
Méndez-Zeel M et al (2001) Modification embryogenic clusters from cell suspension
of the embryogenic response of Coffea ara- cultures of Coffea arabica L. J Plant
bica by nitrogen source. Biotechnol Lett Physiol 159:1267–1270. https://doi.
23:1341–1343. https://doi.org/10.102 org/10.1078/0176-1617-00878
3/A:1010545818671
502 Culture Media
21. Quiroz-Figueroa FR, Fuentes-Cerda CFJ, 29. Kao KN, Michayluk R (1975) Nutritional
Rojas-Herrera R et al (2002) Histological requirements for growth of Vicia hajastana
studies on the developmental stages and cells and protoplasts at a very low population
differentiation of two different somatic
density in liquid media. Planta 126:105–110.
embryogenesis systems of Coffea arabica. https://doi.org/10.1007/BF00380613
Plant Cell Rep 20:1141–1149. https://doi. 30. Linsmaier EM, Skoog F (1965) Organic
org/10.1007/s00299-002-0464-x growth factor requirements of tobacco tissue
22. Wang HL, Lee PD, Liu LF et al (1999) Effect cultures. Physiol Plant 18:100–127. https://
of sorbitol induced osmotic stress on the d o i . o rg / 1 0 . 1 1 1 1 / j . 1 3 9 9 - 3 0 5 4 . 1 9 6 5 .
changes of carbohydrate and free amino acid tb06874.x
pools in sweet potato cell suspension cultures. 31. Gamborg OL, Miller RA, Ojima K
Bot Bull Acad Sin 40:219–225 (1968) Nutrient requirements of sus-
23. Cunha A, Fernandes-Ferreira M (1999) pension cultures of soybean root cells.
Influence of medium parameters on somatic Exp Cell Res 50:151–158. https://doi.
embryogenesis from hypocotyl explants of org/10.1016/0014-4827(68)90403-5
flax (Linum usitatissimum L.). J Plant Physiol 32. Gamborg OL, Murashige LH, Thorpe TA et al
155:591–597. https://doi.org/10.1016/ (1976) Plant tissue culture media. In Vitro
S0176-1617(99)80059-5 Cell Dev Biol-Plant 12:473–478. https://doi.
24. Lipavská H, Konrádová H (2004) Somatic org/10.1007/BF02796489
embryogenesis in conifers: the role of 33. Phillips GC, Collins GB (1979) In vitro tissue
carbohydrate metabolism. In Vitro Cell
culture of selected legumes and plant regen-
Dev Biol-Plant 40:23–30. https://doi. eration from callus cultures of red clover. Crop
org/10.1079/IVP2003482 Sci 19:59–64. https://doi.org/10.2135/cro
25. Moreno-Valenzuela O, Coello-Coello J, psci1979.0011183X001900010014x
Loyola-Vargas VM et al (1999) Nutrient 34. White PR (1943) A handbook of plant tissue
consumption and alkaloid accumulation in
culture. The Jaques Cattell Press, Lancaster,
a hairy root line of Catharanthus roseus. PA
Biotechnol Lett 21:1017–1021. https://doi. 35. White PR (1963) The cultivation of animal
org/10.1023/A:1005606818744 and plant cells. Ronald Press, New York
26. Fujita Y, Hara Y, Suga C et al (1981) Production 36. Nitsch JP, Nitsch C (1969) Haploid plants from
of shikonin derivatives by cell suspension pollen grains. Science 163:85–87. https://
cultures of Lithospermum erythrorhizon. II A doi.org/10.1126/science.163.3862.85
new medium for the production of shikonin
derivatives. Plant Cell Rep 1:61–63. https:// 37. Schenk RU, Hildebrandt AC (1972) Medium
doi.org/10.1007/BF00269273 and techniques for induction and growth of
monocotyledonous and dicotyledonous plant
27. Wallace RJ (1992) Rumen m icrobiology, cell cultures. Can J Bot 50:199–204. https://
biotechnology and ruminant nutrition: doi.org/10.1139/b72-026
the application of research findings to
a complex microbial ecosystem. FEMS 38. Yasuda T, Fujii Y, Yamaguchi T (1985)
Microbiol Lett 100:529–534. https://doi. Embryogenic callus induction from Coffea
org/10.1111/j.1574-6968.1992.tb14088.x arabica leaf explants by benzyladenine.
Plant Cell Physiol 26:595–597. https://doi.
28. Singh M, Krikorian AD (1981) White’s stan- org/10.1093/oxfordjournals.pcp.a076946
dard nutrient solution. Ann Bot 47:133–139
4th ed. 2018
Index
A Auxins�� 18, 49, 51, 72, 137, 162, 172, 179–187, 190,
196–198, 201, 207, 228, 229, 248, 334, 388–394, 397
Acclimatization��4, 19, 21, 24, 26, 28–30, 33, 35, 40, Azospirillum brasilense��72
166–168, 175–176, 220, 224, 239, 240, 248, 252,
254, 255, 386, 478 B
Acetocarmine/Evans blue staining�� 57, 58
Bacillus��72
Acidaminococcus sp.��135
Bacterial endophytes��69–82
Acinetobacter��72
Banana��21, 29, 104, 215, 216, 259, 320–322, 324–328
Aechmea bicolor��280
Beta vulgaris��352
Aeroponics��22
Betulin��476
Agave��5, 151–159, 171, 289–299, 371–382
Betulinic acid��476
Agave angustifolia�� 152, 157, 291, 299, 371–382
Bioaccumulation�� 335, 336
Agave applanata��152
Biobalistics�� 190, 196
Agave colimana�� 152, 299
Biofactory�� 32, 33
Agave fourcroydes A. sisalana��290
Biofarming��39
Agave inaequidens�� 152, 291
Bioinformatics��340, 342, 347–348
Agave maximiliana�� 152, 291
Bioreactors�� 20, 32, 33, 39, 40, 230, 237–239, 244
Agave salmiana��152
Bioremediation��136
Agave sisalana��290
Biotransformation��39
Agave tequilana�� 104, 152, 153, 291, 299
BIT® bioreactors��32
Agave victoria-reginae��152
Brachypodium distachyon�� 53, 54, 57
Aglaonema��81
Bradyrhizobium��72
Agrobacterium rhizogenes��39, 458, 460–465, 469
Brassica napus�� 135, 138–140
Agrobacterium tumefaciens��4, 7, 30, 196, 478, 481–484
Brassica oleracea��135
Ajmalicine��437, 439, 442, 443
Brassinosteroids�� 162, 180, 388
Alkaloids�� 437–454, 476
Bromeliaceae�� 279, 287
Allium cepa�� 37, 319, 362
Bromeliads�� 9, 279–287
Amplified fragment length polymorphism
(AFLP)��105, 109, 110, 112–120, 124–126, C
295–299
Amplified ribosomal rDNA restriction analysis Cacao�� 227–244, 385–394
(ARDRA)��77 Camelina sativa��135
Ananas comosus��31 Camptotheca acuminata��39
Androgenesis�� 301, 302 Camptothecin��39
Anther culture�� 6, 37, 301 Capsaicin (CAP)��431
Anthurium�� 21, 24, 31 Capsaicinoids (CPS)��430
Anthurium andraeanum�� 24, 31 Capsicum chinense��429–435
Arabidopsis thaliana��26, 114, 115, 123, 134, 138, Carica papaya��22
139, 180, 181, 387, 388, 393, 394 Carotenoids��437–454
Arachis hypogaea��202 Carrot��137, 191, 201, 228, 301–314, 494
Artemia salina��476 Cas endonuclease��132
Automation�� 18, 20, 23, 27, 352, 468 Catharanthine��437, 439, 442, 443
Autopolyploids��38 Catharanthus roseus�� 5, 437–454
https://doi.org/10.1007/978-1-4939-8594-4, © Springer Science+Business Media, LLC, part of Springer Nature 2018
503
504 Index

Cattleya��28 Endosperm culture��38
Cell suspensions�� 4, 6, 39, 58, 217, 218, 222, 320, Enterobacter��72
333–335, 430–434, 437–454 Epigenetics��6, 8, 24, 34, 107, 108, 131, 135, 168,
Centella asiatica��39 228, 248, 320, 371–382
Chili pepper��vi Erwinia��75
Chromatin immunoprecipitation (ChiP)��371–382 Eucalyptus��21, 25, 27, 31
Citrullus lanatus��38 Eucalyptus benthamii��31
Citrus clementina��36 Eucalyptus uro-grandis��27
Citrus paradisi�� 139, 140 Euphorbiaceae��207
Citrus sinensis�� 139, 140
Citrus spp.��22 F
Clonal propagation�� 5, 18, 21, 38, 47, 50, 216, 320 False horn plantain��215–225
Coconut�� 161–169, 494, 498, 500 Female buds��215–225
Cocos nucifera�� 388, 412 Female flowers�� 216–218, 221, 222, 224
Coffea arabica�� 23, 35 Flow cytometry��303, 309, 317–330
Coffea canephora��5, 179–187, 412, 494 Francisella novicida��135
Coffee�� 35, 137, 228
Common bean��189–203 G
Competent cells�� 49, 58, 201, 388, 390
Genetic engineering�� 7, 9, 131, 136, 216, 458
Confocal laser scanning microscopy��80
Genetic improvement�� 6, 7, 152, 290–291, 320
Cool cathode fluorescent lamp (CCFL)�� 25, 26, 28
Genetic transformation�� 4, 7–9, 30, 39, 48, 58, 136,
Cork oak��247–249
189, 190, 196, 290, 457–472, 475–491
CRISPR/Cas9 (Clustered Regularly Interspaced
Genome editing��7, 8, 10, 131–141
Short Palindromic Repeat)�� 8, 131–141
Ginsenosides��39
Cryopreservation�� 9, 19, 35, 75, 248, 258, 259,
β-glucuronidase (GUS)��90, 92, 180, 477, 478, 480,
269–276, 279–287
482–485, 487–489, 491
Cucumis sativus�� 139, 140
Glycine max�� 140, 319, 390
Culture media��4, 6, 17–20, 23–25, 30–32, 34, 38, 49,
Gracilaria edulis��39
73, 75, 76, 154, 163, 173–175, 191, 192, 209, 217,
Gynogenesis�� 36, 302
218, 230, 249, 250, 270, 293, 303, 334, 373–376,
398, 399, 430, 431, 479, 493 H
Cymbidium��26
Cytokinins�� 18, 49, 72, 137, 162, 172, 190–193, Hairy roots (HR)�� 39, 138, 140, 458, 460, 461, 463, 467
196, 201, 203, 207, 228, 334, 393 Haploids��4, 6, 10, 18, 19, 22, 35–37, 50, 301–314
Cytometry��303, 309, 317–330 Heavy metals�� 137, 190, 228, 333–337, 429
Hevea��137
D Histochemical analysis�� 55, 57, 58, 279, 482, 483
Histology��162
Datura
Histone��228, 371–382, 389
Daucus carota�� 58, 301, 388
Hordeum vulgare�� 138, 139
Dendrobium catenatum��74
Hyperhydricity�� 23, 24, 32
Dendrobium nobile��74
Hypericum perforatum��39
Digital photography��89–100
Dionaea muscipula��81 I
Dioscorea sp.��81
Doritaenopsis��28 Ilex paraguariensis��81
Doubled haploid (DH)��6, 10, 18, 22, 35–37, 301–314 Image manipulation�� 99, 100
Droplet vitrification technique��269–276 Image processing��90, 91, 96, 98
Image storage�� 90, 98
E Immobilized placenta cultures�� 430, 433
Immunocytochemistry��179
Embryogenesis�� 8, 22, 48, 137, 162, 172, 190, 207,
In Casa pollination�� 158, 289–299
216, 227, 248, 290, 328, 386, 397, 411, 494
In situ hybridization�� 58–62, 71, 80
Embryo rescue��6, 10, 35, 36, 158, 289–299
Internal transcribed spacer (ITS)��78
Endophytes��69–82
Ipomoea�� 9, 140
Endophytic bacteria�� 70–76, 81, 82
Ipomoea batatas��9
505
Index

J Morphology�� 72, 176, 228, 280, 386
Murashige and skoog medium (MS)��93, 173, 219,
Jatropha curcas��207–213 234, 412, 413, 461, 494
Musa acuminata�� 320, 321, 328
K
Musa balbisiana��215
Klebsiella spp.��75 Musa spp.��216
L N
Lachnospiraceae bacterium��135 Next generation sequencing (NGS)�� 78, 79, 108, 418, 420
Lactuca sativa�� 138, 139 Nicotiana�� 17, 137, 138
Leishmania mexicana�� 476, 477 Nicotiana attenuata�� 138, 139
Lepidoptera��172 Nicotiana benthamiana�� 138, 139
Light-emitting diode (LED)�� 25, 26, 28, 40, 91, 93 Nicotiana tabacum�� 138, 139
Linum usitatissimum��498 NMR-based metabolomic analysis��437, 443–446,
Liquid chromatography-electrospray ionization tandem 448–450, 453, 457–472
mass spectrometry (LC-ESI-MS/MS)��352 Nuclear magnetic resonance (NMR)��437, 443–446,
Lithospermum erythrorhizon��498 448–450, 453, 457–472
Littaea�� 152, 290
Long-term conservation��19 O
Lugol’s reagent��56 Oncidium��28
Orchids�� 18, 20, 21, 26, 28, 29
M
Organogenesis�� 8, 18, 24, 26, 38, 48, 49, 52, 54, 57,
Maize��9, 22, 36, 72, 104, 108, 113, 135, 397–409 63, 137, 172, 189, 190, 193, 216, 290, 387, 401
MALDI mass spectrometry��351–369 Oryza sativa�� 134, 138, 139, 181, 319, 365, 388
Malus�� 37, 73, 138, 259, 265 Ovule�� 36, 38, 50, 136, 301–314
Malus domestica��37 Ovule culture�� 38, 136, 302
Malus pumila��138–140 Ovule excision��301–314
Mammillaria gracilis��352
Manihot esculenta�� 138, 139 P
Marchantia polymorpha��135 Panax quinquefolium��39
Mass spectrometry (MS)��339–342, 345–347, 351–369 Pantoea��70
Melia azedarach��81 Papaver somniferum��458
Meristem�� 4, 22, 48–50, 53, 54, 57–59, 70, Papaya�� 22, 26, 28
71, 80, 95, 97, 136, 138, 157, 158, 162, 163, 172, Parthenogenesis��36, 37, 301–314
174, 186, 189, 193–195, 201, 216, 258, 271, 290, Passiflora edulis�� 52, 53, 59
318, 389–393, 400 Pentalinon andrieuxii��475–491
Metabolome�� 8, 438, 454 Periodic Acid-Schiff ’s (PAS) Reaction�� 56, 57
Metabolomics��8, 437–454, 457–472 Petunia hybrida��136, 138–140, 319
Metagenomic DNA��78 Phalaenopsis�� 20, 21, 23, 26, 28, 74
Methyl jasmonate (MeJA)��39, 430, 431, 433 Phaseolus acutifolius��190
Methylobacterium��70, 72, 74, 80 Phaseolus aureus��190
Methylobacterium extorquens�� 70, 74 Phaseolus coccineus�� 190, 196, 202
Microbacterium�� 72, 74 Phaseolus vulgaris��189–203
Microbacterium testaceum��74 Phaseolus wrightii��190
Microbiome�� 78, 80 Photoautotrophy��27
Microcuttings��22 Photographic techniques��90
Micropropagation�� 5, 6, 9, 17–41, 104, 141, 151–159, Photomacrography�� 90, 95
171–176, 291, 294, 320, 386, 411 Photomicrography��90, 283, 284, 287
MicroRNA�� 135, 397–409 Photomixotrophic��26
Microspore culture�� 6, 36, 301 Photosynthetic photon flux density
Molecular markers��6, 103–126, 362 (PPFD)��27, 28, 167, 237, 465, 466
Morel and wetmore medium (MW)��217, 218, 220, 469 Phtheirospermum japonicum��458
Morphogenesis��4, 49, 50, 55, 137, 339–348 Phytosterols��437–454
Morpho-histological tools��64 Picea��137
506 Index

Pineapple��9, 21, 29, 31, 269–276, 279–287 Somatic embryogenesis (SE)��5, 22, 23, 34, 40, 48–53,
Pinus�� 74, 137 57–59, 63, 137, 140, 162, 163, 168, 172, 189–203,
Pinus sylvestris��74 207–213, 215–225, 227–244, 247–255, 290, 294,
Plant germplasm��9 295, 328, 385–394, 397–409, 411–424, 494
Plant regeneration (PR)�� 8, 10, 47–64, 163, 189, Somatic embryos�6, 35, 48, 49, 51, 52, 54, 57, 59, 95, 97, 136,
190, 197, 199, 200, 222, 232, 240, 258, 261, 290, 164, 166–168, 186, 190, 193, 196, 197, 199, 201,
398, 401, 402, 407 202, 207, 212, 213, 221–223, 225, 228, 229, 233,
Plumule explants��161–169 236–241, 243, 248, 251–255, 386–389, 391–394,
Pluripotency�� 49, 54, 59 397, 411, 412, 414, 498
Pollen grains��36, 279–287, 293, 294 Somatic hybridization��7, 10, 22, 35
Populus tomentosa��135 Somatic hybrids�� 4, 7, 38
Prodoxidae��172 Sorghum bicolor��78
Proembryogenic masses (PEM)��193, 195–198, 202 Spathiphyllum��27
Proteome��8, 248, 352, 353, 422, 423 Staphylococcus aureus��135
Proteomics��8, 339–348, 351–369 Starch�� 54–57, 313
Protoplasts�� 4, 5, 7, 22, 35, 38, 50, 51, 131, 136–139, Stereomicroscopic photography��95
216, 318, 391, 498 Stevia rebaudiana��460
Prunus avium�� 73, 74, 76, 77, 79 Streptococcus pyogenes��132
Pseudogamy��36 Strictosidine�� 438, 439, 441–442, 450, 453
Pseudomonas�� 72, 75 Sweet potato�� 9, 257, 259
Q T
Quercus suber��247–255 Tabersonine�� 439, 442, 443
Taxus canadensis��39
R Taxus cuspidata��39
Rhizobium��70–72 Terminal restriction fragment length polymorphism
Rhizobium leguminosarum��70 (T-RFLP)��77
Rhodiola rosea��459 Terpenoid indole alkaloids (TIA)��437–454
Rhodiola sachalinensis��39 Theobroma cacao�� 227–244, 385–394
Rhodococcus��72 Totipotency�� 3, 4, 17, 49, 54, 137, 190, 248, 386, 387, 389
Rhodopseudomonas palustris��74 Transcription activator-like effector nucleases (TALENs)��
RITA® bioreactors��33 132
RNA-seq�� 106, 109, 418, 420–422 Transcription factors��40, 201, 385–394, 397
Root cultures�� 5, 457–472 Transcriptome�� 8, 10, 108, 109, 411–424
Rosmarinic acid��39 Transcriptomics�� 8, 423
Rosmarinus officinalis��39 Triticum aestivum��72, 138–141, 388
S U
Salicylic acid (SA)��39, 72, 229, 430, 431, 433, 434 Ultrastructural analysis��50, 51, 53, 54
Sambucus ebulus��460 Urechitol��476
Secologanin��438, 439, 442, 444
V
Secondary metabolites��8, 10, 34, 38–40, 131, 140,
318, 452, 458–460, 476, 498 Vanda��28
Sempervivum tectorum��352 Verbascum nigrum�� 458, 459
Serratia��75 Verbascum xanthophoeniceum��458
Single nucleotide polymorphisms (SNPs)103–106, 108–122, Verticalization��30
124 Vinblastine��437
Solanum lycopersicum�� 135, 138, 139, 181, 319 Vincristine�� 439, 442, 443
Solanum tuberosum�� 9, 29, 74, 135, 388 Vindoline��437, 439, 442, 443
Somaclonal variants�� 6, 26 Vitis sp.��38
Somaclonal variation��6, 10, 34, 103–126, 172, 229, Vitis vinifera�� 138, 139, 388
320, 388 Vitron��27
507
Index

W Yucca filamentosa�� 171, 175
Yucca periculosa�� 172, 175
Withania somnifera��39
Z
X
Zantedeschia��26
Xanthomonas citri��140 Zea mays��36, 134, 138, 139, 319, 391,
Xylidine Ponceau (XP)�� 56, 57 397, 399, 412
Zinc finger nucleases (ZFNs)��132
Y
Zygotic embryos (ZE)�� 4, 18, 36, 48, 50, 51, 55, 152,
Y3 medium��163–165 154, 157, 159, 162, 163, 166, 190, 193, 194, 201,
Yucca��171–176 202, 210, 212, 216, 247–255, 295, 298, 389,
Yucca coahuilensis�� 171, 175 392–394, 411

2018 Book PlantCellCultureProtocols

Transféré par

Informations du document

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

2018 Book PlantCellCultureProtocols

Transféré par

Droits d'auteur :

Formats disponibles

Methods in

Molecular Biology 1815

For further volumes:

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Library of Congress Control Number: 2018945533

© Springer Science+Business Media, LLC, part of Springer Nature 2018

Printed on acid-free paper

Mérida, Yucatán, Mexico Víctor M. Loyola-Vargas

1 An Introduction to Plant Tissue Culture: Advances and Perspectives ����������������� 3

Part II Cell Culture the Fundaments

2 Micropropagation in the Twenty-First Century������������������������������������������������� 17

8 Micropropagation of Agave Species������������������������������������������������������������������� 151

11 Auxin Immunolocalization in Coffea canephora Tissues ������������������������������������� 179

23 Procedure for Estimating the Tolerance and Accumulation

Appendix A: The Components of the Culture Media ����������������������������������������������� 493

Adela Adamus • Faculty of Biotechnology and Horticulture, Institute of Plant Biology and

Francisco Cruz-Sosa • Departamento de Biotecnología, Universidad Autónoma

Ángela Ku-González • Unidad de Bioquímica y Biología Molecular de Plantas, Centro

Petra Peharec Štefanić • Faculty of Science, Division of Molecular Biology, Department

Ricardo Souza Reis • Laboratório de Biotecnologia, Centro de Biociências e Biotecnologia

An Introduction to Plant Tissue Culture: Advances

conditions to initially achieve the growth of organs [2] or tissues

2 Basic Principles of Cell, Tissue, and Organ Culture

Anyone who wishes to start plant tissue cultures should have in

Undoubtedly, micropropagation or in vitro clonal propagation is

applied for the micropropagation of almost any plant species, it is

4 Plant Breeding and Genetic Improvement

Plant tissue techniques can be certainly powerful auxiliary tools for

but the endosperm not necessarily accompanies the whole process of

Plant genetic engineering is possible thanks to the use of plant tissue

In the last decade, different genome editing techniques based on

c­reating specific desirable mutations [35, 36]. Genome editing

7 Omics and Plant Tissue Culture

Genomics (the study of gene structure, function and regulation,

8 Epigenetics in Plant Tissue Culture

Epigenetic changes (heritable changes in gene function that do not

9 Preservation and Conservation of Plant Germplasm

10 Future Perspectives

drought tolerance in a flowering plant. Proc Nat Biotechnol 32:947–951. https://doi.

Cell Culture the Fundaments

Micropropagation in the Twenty-First Century

One of the first reports on plant tissue culture was by Gottlieb

i­mportance of relationship among auxins and cytokinins during

duction of solid mutants or transgenic plants rather than chimeras;

2 Cost Reduction of Micropropagated Plantlets

The high costs of micropropagated plants are related to the use

Given these factors, large variations in the cost of micropropa-

the loss of plants during different phases of micropropagation,

other bacterial and fungal diseases after several generations of

Thus, cost reduction of micropropagated plants could be a

for groups of gerbera cultivars. If a new cultivar shows low rates of

to study in vitro organogenesis of horticultural and ornamental

2.2 Photoautotrophic The control of environmental conditions, especially temperature

regeneration, multiplication, rooting, or other in vitro devel-

costs attributable to electrical energy, and because more light

during acclimatization when cultured under greenhouse conditions

temperature control, as fogs or pad fan systems which reduce

2.3 Chemical The chemical sterilization of the culture media is an alternative to

that a concentration ranging between 0.0003 and 0.0005% of

2.4 Bioreactor The major obstacle to the micropropagation of conventional plants

contact with the explant for a predetermined period after which

The use of temporary immersion bioreactors is a semiauto-

3 Increasing the Efficiency of Micropropagation for Other Applications

Micropropagation has great importance in improving techniques

Mérida, Yucatán, Mexico Víctor M. Loyola-Vargas

1 An Introduction to Plant Tissue Culture: Advances and Perspectives �� 3

Part II Cell Culture the Fundaments

2 Micropropagation in the Twenty-First Century�� 17

8 Micropropagation of Agave Species�� 151

11 Auxin Immunolocalization in Coffea canephora Tissues �� 179

Appendix A: The Components of the Culture Media �� 493

creating specific desirable mutations [35, 36]. Genome editing

importance of relationship among auxins and cytokinins during

jasmonate-responsive transcription factors would allow for the

2.1 Culture- It is common understanding that only a small percentage of bacte-

2.1.2 Culture- For the culture-independent detection of bacteria, the DNA is

The named techniques are more and more replaced by high-