Vous êtes sur la page 1sur 64

‫اجلمهورية اجلزائرية الدميقراطية الشعبية‬

République Algérienne Démocratique et Populaire


‫وزارة التعلـيم العايل والبحث العلمي‬
Ministère de l’Enseignement Supérieur et de la Recherche Scientifique
‫جامعـة حسيـبة بن بوعلي الشـلف‬
Université Hassiba Benbouali de Chlef

‫كلية علوم الطبيعة واحلياة‬


Faculté des Sciences de la Nature et de la Vie

‫قسم البيولوجيا‬
Département de Biologie

N° d’ordre : ……/2018

MÉMOIRE
En vue de l’obtention du diplôme de Master

Domaine : Sciences de la Nature et de la Vie


Filière : Biologie
Spécialité: Biologie Moléculaire des Microorganismes

THEME
Isolement et caractérisation du pathogène Clostridium
difficile

Présenté par :

 Boubekeur Hemici Walid


 Kirouani Ahlem

Soutenu publiquement le :

Devant le jury:

Driche E. MCB Université Hassiba Benbouali de Chlef Président


Djouad M. MAA Université Hassiba Benbouali de Chlef Examinateur
Sebaihia M. MCA Université Hassiba Benbouali de Chlef Encadreur
Boudjelel Y. Doctorant Université Hassiba Benbouali de Chlef Co-Encadreur

Année universitaire : 2017/2018


Remerciements
Avant tout nous remercions Dieu le tout puissant pour le courage et la volonté qu'il
nous accordé pour mener à bien ce modeste travail.
Nous tenons à exprimer nos sincères remerciements, nos haute considération et nos
profond respect à notre encadreur, Mr.SEBAIHIA M. Maître de Conférences A à
l’université de Chlef, qui nous a guidé et encouragé au cours de ce travail, également
pour sa gentillesse, sa disponibilité et sa patience.
Nos remerciements les plus respectueux à Mr. DRICHE E. Maître de Conférences B à
l’université de Chlef, de nous avoir fait l’honneur de présider le Jury.
Nos remerciements les plus respectueux à Mr DJOUAD M. Maître assistant A à
l’université de Chlef, pour l’honneur qu’il nous a fait en acceptant d'examiner ce
travail.
Nous vous voudrais remercier Mr BOUDJLEL Y. pour l’honneur qu’il nous a fait en
dirigeant ce travail, pour sa gentillesse, ses aides et ses précieux conseils, tout au
long de l’élaboration de ce modeste travail.
Nous remercions également Mlle DJEBBAR A. qui nous a transmis des conseils
d’études sur certaines de nos recherches.
Merci à Mlle NAAMOUN R. pour son aide.
Nos vifs remerciements s’adressent à tous nos enseignants qui ont participé à notre
formation.
Un grand merci à monsieur CHERBAL, médecin biologiste à l’établissement public
hospitalier de CHETTIA pour leur implication dans nos recherches.
Nous tenons également à remercier madame OSSIF, médecin biologiste à l’EPH
SOEURS BEDJ de Chlef pour leur implication dans nos recherches.
Nos remerciements à Mme ABDELKRIM le chef service du laboratoire de l’Hôpital
SOEURS BEDJ de Chlef pour l’accueil, leur aide et surtout pour leur gentillesse.
Enfin nos remerciements à toutes les personnes qui ont contribuées de près et de loin.
Dédicace

Je dédie cet humble travail :

A mes très chers parents, que Dieu me les gardent et protègent.

A mes frères

Mohammed, Fateh, Hamid, Zoheyr, Farouk, Abderrezak et Billel

A mes sœurs

Lamia, Leyla et Hamida

A mes chères amies.

Leyla, Imene, Samira, Nawel et Amina

A tous mes collègues de la promotion biologie moléculaire 2017/2018.

Je vous souhaite tous un avenir plein de succès, de bonheur et de santé.

AHLEM
Dédicace

Je dédie ce modeste travail de fin d’étude :

A mes très chers parents ma mère et mon père

Pour leur patience, leur amour, leur soutien et leurs

encouragements.

A mes chers frères et sœurs :

Pour leurs encouragements et soutien en vous souhaitant un avenir plein de


succès et de bonheur.

A toute ma grande famille.

A mes chers amis.

A tous mes collègues de la promotion biologie moléculaire 2017/2018.


Je
vous souhaite tous un avenir plein de succès, de bonheur et de santé.

Walid
Summary

Over the last two decades, Clostridium difficile infections (CDI) have increased globally and
have become a major public healthcare problem. The extent of CDI in health care facilities in Algeria
is unknown, and it is in this context that this study was undertaken.

The main objective of this study was to isolate C. difficile strains from patients admitted to
some hospitals in Chlef and Ain-Defla.

Faecal samples, collected from 39 hospitalized patients with antibiotic-associated diarrhea,


were analysed by microbiological and molecular tests to identify strains of C. difficile. The results of
these tests showed that 5 patients were infected with this pathogen.

Our results confirm the presence of C. difficile in Algerian healthcare facilities.

Although this study has its limitations, especially in terms of sample size and at the same time,
nevertheless the results obtained provide a platform for further studies to better understand the
prevalence of CDI in our healthcare facilities.

Key words: Clostridium difficile, antibiotic-associated diarrhea, CDI.

Résumé

Au cours des deux dernières décennies, on a assisté à une augmentation des infections à
Clostridium difficile (ICD) à l'échelle mondiale, et ont devenu un problème majeur de santé publique.
L’ampleur des ICD dans les établissements de soins en Algérie est méconnue, et c'est dans ce contexte
que cette étude a été entreprise.

L’objectif principal de cette étude était d'isoler des souches de C. difficile de patients admis
dans quelques hôpitaux de Chlef et Ain-Defla.

Des échantillons des selles diarrhéiques post-antibiothérapie, collectés à partir de 39 patients


hospitalisés, ont été analysés par des tests microbiologiques et moléculaires afin d’identifier les
souches de C. difficile. Les résultats de ces tests ont montré que 5 patients étaient infectés par ce
pathogène.

Nos résultats confirment la présence de C. difficile dans les établissements de soins algériens.

Bien que cette étude à ses limitations, particulièrement au niveau de la taille de


l’échantillonnage et dans le même temps, néanmoins les résultats obtenus fournissent une plate-forme
pour d'autres études afin de mieux comprendre la prévalence des ICD dans nos établissements de
santé.

Mots clés: C. difficile, diarrhées poste anti-biothérapique, ICD.


‫الملخص‬

‫على مدى العقدين الماضيين ‪ ،‬كانت هناك زيادة في االلتهابات المتعلقة ب ‪ Clostridium difficile‬في جميع أنحاء العالم‬
‫وأصبحت مشكلة صحية عامة كبيرة‪ .‬إن مدى اإلصابة ب ‪ C.difficile‬في مرافق الرعاية الصحية في الجزائر غير‬
‫معروف ‪ ،‬وفي هذا السياق تم إجراء هذه الدراسة‪.‬‬

‫الهدف الرئيسي من هذه الدراسة هو البحث عن ‪ C.difficile‬عند المرضى الذين تم إدخالهم في بعض مستشفيات الشلف‬
‫وعين الدفلى‪.‬‬

‫تم تحليل عينات من البراز اإلسهالي الناتج عن استعمال المضادات الحيوية و التي تم جمعها من ‪ 39‬مريضا في‬
‫المستشفى من خالل االختبارات الميكروبيولوجية والجزيئية لتحديد سالالت ‪.C.difficile‬‬

‫أظهرت هذه نتائج أن ‪ 5‬مرضى أصيبوا بهذا الممرض‪ ,‬نتائجنا تؤكد وجود ‪ C.difficile‬في مرافق الرعاية الصحية‬
‫الجزائرية‪.‬‬

‫على الرغم من أن هذه الدراسة لها حدودها ‪ ،‬خاصة فيما يتعلق بحجم العينات و كمية الوقت إال أن النتائج التي تم الحصول‬
‫عليها توفر منصة دراسات أخرى من أجل فهم أفضل النتشار االلتهابات المتعلقة ب ‪ C.difficile‬في مرافقنا الصحية ‪.‬‬

‫الكلمات المفتاحية ‪ :‬اإلسهال المرتبط بالمضادات الحيوية‪.‬‬


Table des matières

Liste des figures

Liste des tableaux

Liste des abréviations

Introduction générale………………………………………………………………………… 01

Chapitre I : Synthèse bibliographique


1. Bactériologie………………………………………………………………………………. 03
1.1. Caractéristiques microbiologiques de Clostridium difficile ………………………… 03
1.2. Facteurs de virulence………………………………………………………………… 04
1.2.1. Toxinogénie……………………………………………………………………........ 04
1.2.1.A. Toxine A /B…………………………………………………………..................... 04
1.2.1.B. Toxine binaire…………………………………………………………………….. 05
1 .2.2. Facteurs d’adhésion……………………………………………................................. 05
1.2.2.A. La capsule…………………………………………………………........................ 06
1.2.2.B. Chimiotactisme……………………………………………………………............ 06
1.2.3. Enzymes hydrolytiques……………………………………………………….......... 06
1.2.4. Spore………………………………………………………………………………... 06
2. Epidémiologie……………………………………………………………………............... 07
2.1. Habitat et réservoir…………………………………………………………………… 08
2.2. Transmission………………………………………………………………………..... 08
3. Facteurs de risque………………………………………………………………….............. 09
3.1. Facteurs liés au médicamentation…………………………………………………..... 09
3.1.1. Antibiothérapie……………………………………………………………………... 09
3.1.2. Chimiothérapie……………………………………………………………………... 10
3.1.3. Inhibiteurs de la pompe à proton…………………………………………………… 10
3.2. Facteurs liés à l’hôte………………………………………………………………..... 10
3.2.1. L’âge………………………………………………………………………………... 10
3.2.2. Déficit immunitaire………………………………………………………………… 11
3.3. Facteurs liés à l’environnement……………………………………………………… 11
3.3.1. L’hospitalisation prolongée………………………………………………………… 11
3.4. Autres facteurs……………………………………………………………………….. 12
4. Physiopathologie…………………………………………………………………………... 12
4.1. Mécanisme d’action des toxines……………………………………………………... 12
4.1.1. Toxine A et B……………………………………………………………………….. 12
4.1.2. Toxine binaire……………………………………………………………………….. 13
5. Infections liées aux C. difficile…………………………………………………….............. 14
5.1. Portage asymptomatique……………………………………………………………... 15
5.2. Portage symptomatique………………………………………………………………. 16
5.2.1. Diarrhée simple……………………………………………………………………... 16
5.2.2. Colite pseudomembraneuse et complications (CPM)………………………………. 16
5.2.3. Récidive……………………………………………………………………………... 17
6. Diagnostic et identification de C. difficile…………………………………………............. 18
6.1. Tableau clinique……………………………………………………………………… 18
6.2. Transport et conservation de selles…………………………………………………... 19
6.3. Tableau biologique…………………………………………………………………… 19
6.3.1. Identification microbiologique…………………………………………………….... 19
6.3.1.1. Culture…………………………………………………………………………...… 19
6.3.1.1.A. Aspect macroscopique et microscopique des colonies…………………............. 19
6.3.1.1.B. Caractères biochimiques………………………………………………………... 20
6.3.2. Méthodes immuno-enzymatiques………………………………………………….... 20
6.3.2.1. Mise en évidence de glutamate déshydrogénase (GDH)……………………......... 20
6.3.2.2. La sérologie………………………………………………………………………. 21
6.3.3. Tests de cytotoxicité des selles (CTA)…………………………………………….... 21
6.3.4. Identification moléculaires…………………………………………………………. 22
7. Traitement…………………………………………………………………………............. 22
7.1. Antibiothérapie……………………………………………………………………...... 22
7.2. Transplantation fécale (FMT)………………………………………………………... 24
7.3. Les proiotiques……………………………………………………………………...... 24
7.4. Anticorps monoclonaux anti-toxines A et B…………………………………………. 24
7.5. Vaccination…………………………………………………………………………... 25
8. Prévention………………………………………………………………………….............. 25
Chapitre II : Matériel et méthodes
1. Echantillonnage……………………………………………………………......................... 27
2. Traitement des échantillons………………………………………………………………... 28
3. Isolement et identification de C. difficile………………………………………………….. 28
3.1. Culture microbiologique……………………………………………………………... 28
4. Identification de C. difficile………………………………………………………………... 28
4.1. Examen macroscopique……………………………………………………................ 29
4.2. Examen microscopique……………………………………………………................. 29
5. Identification moléculaire…………………………………………………………………. 29
5.1. Extraction d’ADN…………………………………………………………................. 29
5.2. Réactions de PCR…………………………………………………………….............. 29
5.3. Migration sur gel d’agarose………………………………………………………….. 30
5.3.1. Préparation de gel……………………………………………………….................... 30
5.3.2. Migration……………………………………………………………………………. 30
Chapitre III : Résultat et discussion
1. Collection des échantillons…………………………………………………........................ 31
2. Isolement du pathogène C. difficile agent des diarrhées post-antibiotiques………………. 31

Conclusions et perspectives………………………………………………………………… 36

Références bibliographiques…………………………………………………………….…. 37

Annexes…………………………………………………………………………………….... 48
Liste des figures

Figure 1 : Coloration de Gram de C. difficile 3


Figure 2 : Culture de C. difficile sur gélose à base du sang 4
Figure 3 : Schéma du Locus de pathogénicité de C. difficile 5
Figure 4 : C. difficile formant une endospore colorée en rouge 7
Figure 5 : Epidémiologie de l’ICD en Europe (2008) 7
Figure 6 : Epidémiologie de la souche 027 aux Etats Unis 8
Figure 7 : Modèle d’acquisition d’infection liée à C. difficile 9
Figure 8 : Mode d’action du C. difficile toxinogène sur l’épithélium intestinal 13
Figure 9 : Infections aux C. difficile 15
Figure 10 : Pseudomembranes à l’examen endoscopique 17
Figure 11 : Schéma d’une infection à C. difficile 18
Figure 12 : Aspect de Clostridium difficile en gélose au sang 20
Figure 13 : Test de cytotoxicité sur cellules MRC-5 22
Figure 14 : Protocole de traitement des infections à C. difficile 24
Figure 15 : Boite d’anaérobiose incubée dans l’étuve à 37°C 28
Figure 16 : Gel d’électrophorèse avant migration 30
Figure 17 : Caractères morphologiques et culturaux de C.difficile 31
Figure 18 : Aspect de C. difficile au Gram 32
Figure 19 : Identification de C. difficile par PCR du gène gluD 32
Figure 20 : Distribution des souches de C, difficile isolés 33
Liste des tableaux

Tableau 1 Classification des antibiotiques selon le risque d’ICD 10


Tableau 2 Récapitulation des données relatives aux prélèvements 27
Tableau 3 Programme d’amplification du gène GluD 30
Tableau 4 Donné des patients porteurs de C.diffile 33
Liste des abréviations

ADN : Acide DésoxyriboNucléique


ATB : Antibiotique
BET : Bromure d'Éthidium
C. difficile : Clostridium Difficile
CCA : Cyclosérine Céfoxitine Agar
CCFA : Cyclosérine Céfoxitine Fructose Agar
CDT : C. difficile transférase
CPM : Colites Pseudo-Membraneuses
CRP: Protéine C-Réactive
CTA: Cytotoxicity Assay
Cwp : Cell wall protein
dNTP: désoxyribonucléotides triphosphate
ECCMID: European Society of Clinical Microbiology and Infectious Diseases
EIA: Tests Immuno-Enzymatiques
ELISA: Enzyme-Linked Immunosorbent Assay
FDA: Food Drug Administration
GDH: Glutamate déshydrogénase
ICD : Infections à Clostridum difficile
IgA : Immunoglobuline A
IgG : Immunoglobuline G
IgM : Immunoglobuline M
IPP : Inhibiteur de la Pompe à Protons
IV: Intra veineuse
Paloc : Pathogenenicity locus
PCR : Polymerase chain reaction
Rho: Ras homologue
SARM : Staphylococcus Aureus Résistante au Méthicilline
TAE : Tris Acétate EDTA
UV : Ultra-Violet
Introduction

La première description de Clostridium difficile a été réalisée par Hall et O’Toole en


1935 qui ont isole cette bactérie à partir des selles de nouveau-nés (Hall et O'Toole, 1935), et
l’ont nommé Bacillus difficilis en raison des difficultés présentées pour l’isoler.

Pendant les 40 années qui ont suivi, C. difficile a été considéré comme un commensal
de l’homme et ce n’est qu’à partir de 1978 qu’il a été reconnu responsable de colites pseudo-
membraneuses (CPM) associées à l’utilisation des antibiotiques (Bartlett et al., 1978), bien
que le premier cas de CPM ait été décrit en 1893 par John Finney chez une jeune femme suite
à une opération chirurgicale (Finney, 1893). Ce pathogène est responsable de plus de 95%
des cas de colite pseudomembraneuse et de 15 à 25% des diarrhées post-antibiotiques
(Larson et al., 1978).

Les infections à C. difficile (ICD) surviennent suite à une prise d’antibiotiques et plus
fréquemment lors d’une hospitalisation, et représentent la première cause de diarrhées
nosocomiales chez l’adulte. Cependant l’existence de formes communautaires d’infections à
C. difficile (ICD) a été aussi récemment démontrée. Une des particularités des ICD est la
tendance aux rechutes observées chez certains patients.

La grande majorité des ICD sont acquises au niveau des établissements de soins. La
transmission des spores se produit entre patients, ou à partir du personnel soignant, ou de
l’environnement hospitalier. Ce pathogène opportuniste tire avantage de la perturbation de la
microflore normale de l’intestin, suite à une prise d’antibiotiques, pour proliférer, coloniser et
nuire á l’hôte (Zar et al., 2007).

Les principaux facteurs de risque des ICD sont l’âge (supérieur à 65 ans),
l’administration d’antibiotiques et la durée d’hospitalisation.

Le début du millénaire a notamment été marqué par la description, d’abord au


Canada et aux Etats-Unis puis en Europe.

Des épidémies de formes sévères d’ICD, avec des taux de mortalité élevés, ont été
signalées au Canada, aux Etats-Unis puis en Europe durant les deux dernières décennies. Ces
épidémies sont liées à l’émergence d’un clone particulièrement virulent de C. difficile appelé
027. L'impact économique des ICD est très important à travers le monde, le coût associé au
traitement est estimé à plus de sept milliards de dollars par an (Cariou, 2013).

Dans ce manuscrit, nous allons tout d’abord présenter une revue bibliographique sur
C. difficile, ainsi que sur les aspects de la virulence, la physiopathologie et l’épidémiologie de
Introduction

ce pathogène. Nous développerons ensuite nos travaux expérimentaux qui ont consisté à la
mise en évidence de ce germe en Algérie, plus particulièrement au niveau de quelques
hôpitaux de la wilaya de Chlef et Ain Defla. Pour en tirer enfin quelques conclusions à partir
des principaux résultats de ce travail.
Chapitre I Synthèse bibliographique

1. Bactériologie

1.1. Caractéristiques microbiologique de Clostridium Difficile

Clostridium difficile (C. difficile) est un bacille à Gram positif (Figure 1), anaérobie
strict, sporulé retrouvé dans l’environnement ainsi que dans l’intestin de l’homme et de
l’animal (Eckert et al., 2011), il s’agit d’un bacille de 0,5 à 1,9 μm de diamètre sur 3 à 16,8
μm de longueur, non hémolytique caractérisé par la formation des colonies rhizoïdes sur
gélose au sang et ayant une odeur caractéristique de crottin de cheval. Il peut se regrouper en
chaînettes de 2 à 6 cellules, généralement mobiles grâce à une ciliature péritriche.

Figure 1 : Coloration de Gram de C. difficile (Buyse et al., 2005).

La température optimale de croissance est comprise entre 30 et 37 °C mais la culture


est également obtenue à 25 et à 45 °C, après 24 à 48 heures d'incubation, les colonies sont
circulaires ou à contour irrégulier, elles sont plates ou légèrement convexes, opaques,
blanchâtres ou grisâtres avec un aspect en verre brisé à la loupe binoculaire. Les colonies
obtenues sur gélose enrichie (hémine, vitamine K) présentent une fluorescence vert pâle sous
lumière ultraviolette (Figure 2) (Carroll et Bartlett, 2011).

La bactérie C. difficile est capable d'utiliser de nombreux sucres tels que le glucose, le
fructose et le maltose. Le lactose et l’amidon ne sont pas utilisés comme source de carbone
(Hafiz et al., 1976).

3
Chapitre I Synthèse bibliographique

Figure 2 : Culture de C. difficile sur gélose à base du sang (Doosti et Farsani, 2014).

1.2. Facteurs de virulence

C. difficile possède un certain nombre de facteurs de virulence, certains contribuent


directement au pouvoir pathogène de la bactérie tandis que d’autres permettent la colonisation
des cellules hôtes et la production in situ de ses facteurs pathogènes par la bactérie. Une étude
réalisée par Boriello en 1987 montre que toutes les souches de C. difficile n’ont pas la même
virulence, les plus virulentes produisant une quantité de toxines bien plus élevée (Vaishnavi,
2010).

1.2.1. Toxinogénie

La virulence de C. difficile est principalement associée aux toxines A et B (Kuehne et


al., 2010). Certaines souches de C. difficile produisent une troisième toxine dite toxine binaire
(Lyras et al., 2009).

1.2.1. A. Toxines A et B

La majorité des souches toxigéniques de C. difficile produisent deux toxines, la toxine


A (TcdA ou entérotoxine) et la toxine B (TcdB ou cytotoxine). Les toxines TcdA et TcdB
sont des protéines de 308 et 270 kDa, respectivement, avec 49% d'identité et 63% de
similarité, ils appartiennent à la famille des grandes toxines clostridiales les plus
léthales (Pruitt et Lacy, 2012).

Les gènes tcdA et tcdB codant respectivement pour la toxine A et la toxine B font
partie d’un locus de pathogénicité bien défini, le PaLoc (pathogenicity locus) (Figure 3), tous
deux possèdent leurs propres promoteurs, respectivement P1 et P2, ainsi que leurs propres

4
Chapitre I Synthèse bibliographique

sites de liaison ribosomale, mais peuvent être exprimés à partir d’un seul et même promoteur
commun. Chez les souches non toxinogènes, le PaLoc est remplacé par 127 bases d’ADN non
codant. L’élément entier du locus de pathogénicité représente 19,6 Kb constitué de 5 gènes
dont les deux gènes tcdA et tcdB codant les toxines TcdA et TcdB, les gènes tcdR et tcdC
codent pour des régulateurs positif et négatif, le gène tcdE, qui est organisé en opéron avec
tcdB, code une protéine de type holine impliquée dans la sécrétion des toxines (Kuehne et al.,
2011).

Figure 3: Schéma du Locus de pathogénicité de C. difficile (Geric et al., 2003).

1.2.1. B. Toxine binaire

La toxine binaire ou CDT (Clostridium difficile transférase), n’est produite que par
certaines souches de C. difficile. Ces souches étaient auparavant rarement trouvées comme
une cause de l'infection à C. difficile (CDI) dans les populations humaines, mais sont
devenues de plus en plus fréquentes au cours des 10 dernières années (Gerding et al., 2014).

La CDT appartient à la famille des toxines ADP-ribosylantes binaires, cette toxine est
constituée de deux sous-unités A et B, la première présente une activité ADP-
ribosyltransférase qui peuvent modifier l'actine, la seconde est responsable dans la liaison de
la toxine aux cellules hôtes et la translocation de la sous-unité A dans le cytosol (Gerding et
al., 2014).

1.2.2. Facteurs d’adhésion

Les protéines exprimées en surface ont plusieurs fonctions. Elles peuvent intervenir
dans la protection de la bactérie face aux agressions extérieures telles que les conditions
toxiques ou les défenses immunitaires de l’hôte, ces protéines vont aussi permettre

5
Chapitre I Synthèse bibliographique

l’utilisation des nutriments présents dans l’environnement. L’adhésion spécifique ainsi que les
interactions bactérie-bactérie sont aussi des mécanismes pour lesquels les protéines de surface
ont un rôle (Scott et Barnett, 2006).

Les facteurs d’adhésion et de colonisation sont impliqués dans la colonisation


intestinale et donc aussi dans l'infection, la colonisation est reconnue comme une étape
importante dans l’infection (Merrigan et al., 2013).

1.2.2. A. Capsule

La phagocytose d’une souche de C. difficile par les polynucléaires neutrophiles


humains est directement dépendante de l’opsonisation (Dailey et al., 1987). En 1998,
Borriello a montré que la capsule est composée de nombreux polysaccharides.

1.2.2. B. Chimiotactisme

La capacité d’une bactérie entérique à passer de la lumière à la muqueuse intestinale


augmente ses chances d’adhérer aux récepteurs intestinaux. Des études ont montré que les
mucus intestinaux humain et animales constituaient un facteur chimiotactique essentiel pour
la colonisation intestinale de C. difficile, ce mucus intestinal est thermostable et résistant à la
protéolyse. Une corrélation positive entre le degré de chimiotactisme d’une souche de C.
difficile et sa virulence relative a été démontrée (Borriello, 1998).

1.2.3. Enzymes hydrolytique

La plupart des souches de C. difficile possèdent une activité hyaluronidase, une


activité chondroitine-4-sulfatase, ainsi qu’une activité héparinase, cette dernière étant moins
prononcée que les deux premières ; de plus, ces activités enzymatiques sont beaucoup plus
importantes chez les souches hypervirulentes (Seddon 1990).

La protéine de surface Cwp 84, à une activité protéolytique (Eckert et al., 2010), cette
protéine appartient de la famille cystéine protéase qui joue un rôle dans la dégradation
tissulaire de la cellule hôte ainsi que dans la dissémination du pathogène (Borriello, 1998).

1.2.4. Spore

C. difficile se caractérise par sa capacité à produire des spores subterminales (Figure


4) (Slimings et al., 2014). Ces spores sont ubiquitaires, elles sont présentes dans l'eau, le sol
et les légumes crus (al Saif et al., 1996). Les endospores de C. difficile peuvent persister dans
des environnements hostiles sur de très longues périodes et peuvent germer lorsque les
conditions redeviennent favorables (Setlow, 2007), ces endospores sont résistantes à de

6
Chapitre I Synthèse bibliographique

nombreux stress environnementaux comme les désinfectants, l’alcool, la chaleur, le pH, les
antibiotiques et l’oxygène (Lawley et al., 2009).

Figure 4 : Clostridium difficile formant une endospore colorée en rouge

(Observée au microscope électronique à transmission) (Aslam et al., 2005).

2. Epidémiologie

Dans la dernière décennie, l’épidémiologie de ce pathogène a évolué rapidement ce


qui a poussé plusieurs pays à établir des systèmes de surveillance afin de suivre l’impact et le
taux des infections à C. difficile (Rupnik et al., 2009). Au cours des dernières années, de
graves épidémies des infections nosocomiales de C. difficile ont été signalées en Europe et en
Amérique du Nord (figure 5 et 6).

Figure 05 :Epidémiologie de l’ICD en Europe (2008) (Bauer et al.,2011).

7
Chapitre I Synthèse bibliographique

En 2003 et 2004 plus de 2000 personnes sont mortes au Québec, Canada à cause de ce
pathogène (Loo et al., 2005), cette recrudescence est liée à l'émergence de souches
épidémiques dites hyper virulentes dont en premier lieu la souche NAP1/BI/027 (North
American pulsotype 1, Restriction endonuclease analysis groupe BI, PCR ribotype 027). Les
premiers cas ont été recensés au Canada et dans la province du Québec, au début des années
2000, ensuite, l’épidémie s’est propagée aux Etats-Unis puis à l’Europe (Pepin et al., 2004).

Figure 06 : Epidémiologie de la souche 027 aux Etats Unis (Clement et al., 2010).

2.1. Habitat et réservoir

C. difficile est un germe ubiquitaire largement répandu dans la nature, il se trouve dans
l’eau et le sol (forme sporulée) ainsi que dans le tube digestif de l'homme et de nombreuses
espèces animales sous forme végétatif (Freeman et al., 2010). Le tractus intestinal des
animaux porteurs de C. difficile est une niche écologique pour la multiplication de la bactérie
et la dissémination des spores dans l’environnement (Rupnik, 2007), c’est retrouvé aussi dans
les matières fécales des nouveau-nés avec une fréquence pouvant aller jusqu’à 70 % (Gerding
et al., 1986).

2.2. Transmission

Le principal mode de transmission est le mode horizontale par la propagation de


pathogène de personne à personne ou à partir des spores de l’enivrement (eau, sol, surface)
par voie oro-fécale (Cerquetti, 1995).

8
Chapitre I Synthèse bibliographique

Les porteurs sains, qui sont asymptomatiques, peuvent aussi être une source de
dissémination et de contamination (Alasmari et al., 1981), par ailleurs en milieu hospitalier,
le contact avec les spores de C. difficile .est élevé compte tenu de la présence de patients
hospitalisés infectés par C. difficile facilitant les transmissions croisées, le taux de
contamination environnementale par C. difficile augmente en fonction du portage et/ou de la
présence de symptômes liés à l’ICD, moins de 8 % dans les chambres de patients avec une
culture négative, 8 à 30 % dans les chambres des patients colonisés asymptomatiques et 9 à 50
% des chambres des patients avec une ICD (Sethi et al., 2010; Barbut et al., 2009; Jernigan
et al., 1998). Le personnel de santé peut aussi être impliqué dans ces transmissions croisées
entre patients lors d'un mauvais suivi des règles d'hygiène (Figure 7) (Eyre et al., 2013).

Figure 7 : Modèle d’acquisition d’infection liée à C. difficile (Rupnik et al, 2009).

3. Facteurs de risque

3.1. Facteurs liés au médicamentation

3.1.1. Antibiothérapie

Le principal risque de développer une ICD dans plus de 95 % des cas, est la prise des
antibiotiques, en effet, ces derniers vont perturber le microbiote intestinal (Barbut et al.,
2004), ce qui favorise la multiplication et la colonisation de C. difficile, particulièrement les
souches résistantes aux antibiotiques administrés (Merrigan et al., 2003). Les antibiotiques
incriminés sont généralement des antibiotiques à large spectre tels que les céphalosporines de
deuxième et troisième générations, la clindamycine, l’amoxicilline additionné à l’acide
clavulanique, et les fluoroquinolones (Barbut et al., 2000).

9
Chapitre I Synthèse bibliographique

Selon Elliot (2007), presque tous les antibiotiques peuvent induire des ICD
(Tableau1), même la vancomycine et le métronidazole qui sont les antibiotiques de choix
pour le traitement des infections à C. difficile.

La durée du l’antibiothérapie, ainsi que l’association de différents antibiotiques,


semblent toutefois jouer un rôle important dans l’ICD (Gerding et al., 2004).

Tableau 1 : Classification des antibiotiques selon le risque d’ICD (Barbut et al., 2004).

3.1.2. Chimiothérapie

Les produits chimio-thérapeutiques tel que le fluorouracil, le méthotrexate peuvent


modifier la flore gastro-intestinale naturelle et favoriser l’émergence de C difficile (Fekety,
1997). Selon Cohen et al. (2010), le mécanisme est considéré comme un résultat de l'activité
antimicrobienne de l'agent chimio-thérapeutique et des altérations subséquentes du microbiote
intestinal.

3.1.3. Inhibiteurs de la pompe à proton

Un autre facteur de risque important pour le développement d’une ICD est l'utilisation
d'inhibiteurs de la pompe à protons (Gerding et al., 2004; Akhtar et Shaheen, 2007).
Cependant, le rôle des IPP dans le développement d’ICD est encore controversé (Novack et
al., 2014; Khanafer et al., 2017).

3.2. Facteurs liés à l’hôte

3.2.1. L’âge

L’âge avancé est l’un des principaux facteurs de risque d’ICD, une valeur d’incidence
élevés a été observés chez les personnes de plus de 65 ans (Pepin et al., 2004; McDonald et
al., 2006), les nourrissons et les enfants sont beaucoup plus susceptibles que les adultes d’être
porteurs asymptomatiques du C. difficile dans leur tube digestif (Viscidi et al., 1981). Le
risque de développer une ICD avec une colite pseudomembraneuse (CPM) est plus important
chez les personnes âgées hospitalisées (Khanna et al., 2012).

10
Chapitre I Synthèse bibliographique

Plusieurs hypothèses sont proposées comme une diminution de la réponse immunitaire


(Andrews et al., 2003) ; la répétition des hospitalisations (Barbut et al., 2004), des
pathologies sous-jacentes plus sévères ou une modification du microbiote intestinal du au
vieillissement (Khanna et al., 2012).

On estime que de 15 % à 63 % des nouveau-nés, de 3 % à 33 % des nourrissons et des


tout-petits de moins de deux ans et jusqu’à 8,3 % des enfants de plus de deux ans sont
porteurs asymptomatiques (Cerquetti et al.,1995), l’absence des symptômes est
probablement en raison de l’immaturité de leurs récepteurs de surface pour les toxines de c
.difficile et parce qu’ils sont protégés par les anticorps maternels acquis par voie
transplacentaire ou dans le lait maternel (Chen et al., 2002).

3.2.2. Déficit immunitaire

Le système immunitaire joue un rôle important dans la pathogenèse de l’ICD, le


développement d’une réponse immunitaire systémique à la toxine A du C. difficile protège
contre le développement de la diarrhée aiguë, en outre, Erik (2011) a démontré que les
patients qui ne pouvaient pas développer une augmentation des titres sériques d'IgG antitoxine
A en réponse à un premier épisode de l’ICD étaient beaucoup plus susceptibles de développer
une ICD récurrent par rapport à ceux qui ont monté une réponse immunitaire adéquate.

Des études ont montré que les patients avec un faible taux d’anticorps sériques
antitoxine A ont plus de risque de développer une ICD (Kyne et al., 2000). Aussi, une
réponse immunitaire insuffisante est associée à un risque de récidives (Kyne et al., 2001).

3.3. Facteurs liés à l’environnement

3.3.1. Hospitalisation prolongée

L'hospitalisation fréquente et la durée de séjour ont été identifiés comme des facteurs
de risque pour les ICD (Freeman et al., 2010), les établissements de santé représentant un
milieu d’infection particulièrement courant et problématique. Les spores sont surtout
transférées aux patients par les mains de membres du personnel soignant qui ont touché une
surface ou un objet contaminé (Viscidi et al., 1981).

Selon Clabots (1992), le taux d'acquisition de C. difficile pour les patients hospitalisés
pendant deux semaines ou moins, est d'environ 13%, et pour les patients hospitalisés plus de
quatre semaines, le taux d'acquisition est de 50%. Plus de 66 % des patients colonisés par C.
difficile au cours d’une hospitalisation restent asymptomatiques (Buyse et al., 2005).

11
Chapitre I Synthèse bibliographique

L’hospitalisation d’une personne est donc un facteur de risque non négligeable, surtout
pour les hospitalisations de longue durée qui vont accroitre le risque de colonisation par C.
difficile (Khanna et al., 2014).

3.4. Autres facteurs

La chirurgie gastro-intestinale et les manipulations du tractus gastro-intestinal, y


compris l’alimentation entérale, la coloscopie, l’endoscopie sont également des facteurs de
risque d’ICD (Cohen et al., 2010).

4. Physiopathologie

La contamination par C. difficile se fait par l’ingestion de spores qui résiste à l’acidité
gastrique, ces spores se transforment dans l’intestin en formes végétatives qui colonisent le
côlon, cette étape de colonisation est favorisée par une perturbation de la flore digestive
anaérobie de barrière souvent liée à un traitement antibiotique, qui va permettre à C. difficile
de s’implanter et de se multiplier (Eckert et al., 2015; Janoir et al., 2007), la seconde étape
repose sur la production, par la souche toxinogène, de deux toxines A (TcdA) et B (TcdB) qui
sont dotées à la fois de propriétés entérotoxiques et cytotoxiques et qui agissent en synergie
(Eckert et al., 2011; Lyras et al., 2009).

4.1. Mécanisme d’action des toxines

4.1.1. Toxine A et B

La majorité des souches du C. diffıcile produisent à la fois la toxine A et la toxine B;


La toxineA est endocytée par le colonocyte après fixation sur son récepteur membranaire. À
l’interieur de la cellule, la toxine A entraîné des importantes modifications du cytosquelette
(Hecht et al., 1988), et exerce également un effet délétère direct sur l’épithélium colique en
augmentant la perméabilité intestinale après destruction des jonctions serrées intercellulaires,
induisant alors la production de médiateurs pro-inflammatoires au sein de la lamina propria,
ceux-ci activent le système immunitaire épithélial et déclenchent une réponse à médiation
humorale, aussi appelée Th2, à l’origine de la production d’anticorps IgA puis IgG anti-
C.difficile (Just, 1998).

Les deux toxines sont capables d’inactiver les protéines de bas poids moléculaire de la
famille Rho liant le GTP en les glycosylant (Just et al., 1998), cette inactivation des GTPases
est un mécanisme original de cytotoxicité par perturbation de la signalisation intracellulaire,
ses effets délétères affectent le cytosquelette et s’exercent à travers la stimulation de signaux

12
Chapitre I Synthèse bibliographique

de mort cellulaire en activant la voie de signalisation nucléaire du NFkB) (Buyse et al.,


2005).

Figure 8 : Mode d’action du C. diffıcile toxinogène sur l’épithélium intestinal

(Voth et al., 2005).

4.1.2. Toxine binaire

Le mécanisme d’action de la toxine binaire a été très peu étudié, mais il serait
apparenté au mécanisme d’action des autres membres de la famille des ADP-
ribosyltransférases. L’élément CDTb serait activé par clivage, il formerait alors un heptamère
à la surface cellulaire et il se fixerait sur des récepteurs spécifiques. Tout récemment, une
équipe allemande a identifié le LSR (Lipolysis-stimulated lipoprotein Receptor) comme étant
le récepteur membranaire de la toxine binaire de C. difficile. Une fois CDTb fixé au récepteur,
CDTa se lie à CDTb et est internalisé par endocytose, puis CDTa est transloqué dans le
cytosol après acidification de l’endosome (Kaiser et al., 2011). D’après Gulke (2001). La
partie N-terminale de CDTa est responsable de l’interaction avec CDTb et la partie C-
terminale est responsable de l’activité enzymatique, CDTa agirait, par la suite, en ribosylant

13
Chapitre I Synthèse bibliographique

les monomères d’actine G de façon irréversible, cette ADP-ribosylation bloque la


polymérisation de l’actine G en micro filament d’actine F et rompt l’équilibre entre les deux
formes d’actine, ce qui provoque une ballonisation des cellules et puis la mort cellulaire
(Davies et al., 2011).

5. Infections liées au C.difficile

L’infection liée aux C. difficile est définie par la combinaison de signes cliniques et de
symptômes, confirmés par la preuve microbiologique de toxines de C. difficile et d’une
souche toxinogène dans les selles, en l’absence d’autre cause, ou par la présence d’une colite
pseudomembrane (Debast et al., 2014).

Une ICD nosocomiale est définit comme celle développant 48 h après le début de
l’hospitalisation ou dans les quatre semaines suivant la sortie de l'établissement de soins. En
revanche, dans le cas d’une ICD communautaire, les premiers symptômes apparaissent dans
la communauté en dehors de tout établissement de soins (Clabots et al., 1992).

En Europe, les ICD seraient responsables de 60 % des infections intestinales


bactériennes hospitalières et représenteraient 9 % des infections nosocomiales et seraient ainsi
plus fréquentes que les infections nosocomiales à staphylococcus aureus résistant à la
méthicilline (SARM) (Bauer et al., 2011).

Après colonisation du tractus intestinal par C. difficile, le sujet peut soit resté
asymptomatique et être porteur sain soit développer des signes cliniques d'ICD.

14
Chapitre I Synthèse bibliographique

Figure 09: infection aux C. difficile (Poutanen et al., 2004).

5.1. Portage asymptomatique

Le portage asymptomatique de C. difficile est de 1% à 3% chez l’adulte en bonne santé


(Gerding et al., 1986; Kelly et al., 1994), ce portage asymptomatique est plus important chez
les patients dans les établissements de santé, allant de 5 % à 11 %.

Le portage asymptomatique chez les enfants de plus de 2-3 ans est équivalent à celui
des adultes. En revanche, chez le nourrisson (moins de 2 ans), le portage est plus fréquent, il
est de 70 % dans la première année de vie (Rousseau et al., 2011), mais il diminue
rapidement après la première année de vie pour atteindre le pourcentage de 3 % vers l’âge de
2 à 3 ans (Hedge et al., 2008).

15
Chapitre I Synthèse bibliographique

5.2. Portage symptomatique

5.2.1. Diarrhée simple

Lors d’un cas d’ICD, le patient présente une diarrhée modérée le plus souvent sans
signes généraux d'infection, dans 25 % des cas, la guérison du patient est observée deux à
trois jours après l’arrêt du traitement antibiotique responsable (Barbut et al., 2004).Ce type
d’ICD est souvent rencontré chez l’adulte ne présentant pas de facteurs de risque de
complications. La diarrhée simple est la forme d'ICD la plus observée en communauté,
l'hospitalisation est requise dans les cas les plus graves (Khanna et al., 2012).

5.2.2. Colite pseudomembraneuse et complications (CPM)

Dans 10 % des cas d’ICD, le malade présente des signes cliniques de CPM, les signes
observés sont une diarrhée liquide et abondante non sanglante, avec fièvre dans 75 % des cas,
et des douleurs abdominales dans 70 % des cas (Barbut et al., 2004; Bartlett, 1996), il est
souvent observé chez les malades une anorexie, des nausées, une hyperleucocytose, un taux
de protéine réactive C élevé ainsi qu’un taux d'albumine bas (Hedge et al., 2008).

Le diagnostic d’une CPM se fait par un examen endoscopique qui révèle la présence
de lésions aphtoïdes jaunâtres caractéristiques au niveau de la muqueuse (Figure 10), ces
lésions peuvent être éparses ou confluentes selon le stade de la maladie, ces
pseudomembranes sont constituées de débris cellulaires, de mucus, de fibrine et de leucocytes
(Barbut et al., 2004).

Dans certains cas, une complication avec perforation colique ou mégacôlon toxique
peut se développer, ces deux complications sévères sont parfois fatales (Bauer et al., 2009).
Dans ces cas extrêmes, le taux de mortalité est de 4 %, mais il peut atteindre 35 à 50 % dans
les cas de CPM compliquées (Barbut et al., 2004). Dans de rares cas, il arrive que l’infection
à C. difficile ne se limite pas au côlon, en effet, des manifestations extra-coliques peuvent être
observées, comme une atteinte de l’intestin grêle avec la formation de pseudomembranes
(Jacobs et al., 2001).

D’autres pathologies provoquées par C. difficile ont été rapportées, telles que des
bactériémies, une arthrite réactionnelle, des abcès viscéraux (Ben Abdelghani et al., 2010).

16
Chapitre I Synthèse bibliographique

Figure 10 : Pseudomembranes à l’examen endoscopique (Barbut et al., 2011).

5.2.3. Récidives

Une des particularités de l’ICD est la récidive de la maladie. C’est la principale


inquiétude des cliniciens et des patients. Un patient ayant était traité efficacement pour une
ICD, c’est-à-dire disparition des symptômes, est susceptible de faire une récidive dans les
deux mois après l’arrêt du traitement (Barbut et al., 2004), Le taux de récidive est de 20 %
après une première infection. Il atteint 50 %, après une première récidive (Valiente et al.,
2014).

La continuité d’un traitement antibiotique à large spectre, l’âge du patient supérieur à


65 ans et/ou une hospitalisation de longue durée sont des facteurs qui augmentent le risque de
récidive (Aslam et al., 2005).

La souche mise en cause est, dans 50 % des cas, la souche à l’origine du premier
épisode d’ICD qui a persisté sous forme sporulée dans le côlon; il s'agit alors de rechute.
L’autre moitié des récidives implique une autre souche d'origine exogène, il s'agit alors de ré-
infection (Barbut et al., 2004).

Les récidives peuvent être multiples sur une échelle de temps pouvant s’étaler sur
plusieurs mois voire plusieurs années. Une étude a rapporté le cas d’un patient ayant subi 26
épisodes diarrhéiques (Bartlett, 1996).

17
Chapitre I Synthèse bibliographique

Figure 11 : Schéma d’une infection à C. difficile (Pantaléon, 2015).

6. Diagnostic et identification de C. difficile

6.1. Tableau clinique

Les ICD sont responsables de tableaux cliniques de gravité très variable, allant de la
diarrhée simple, aux formes sévères dominées par la CPM, rare mais potentiellement mortelle
(Debast et al., 2014).

Le tableau clinique de la diarrhée simple est une diarrhée fécale au moins 3 selles non
moulées par jour, sans glaire ni sang visible, nauséabonde, elle peut s’accompagner d’une
fièvre modérée, mais il n’y a pas d’altération marquée de l’état général (Aslam et al., 2005).
Selon les recommandations européennes de l’ESCMID, l’infection a C. difficile sera
considérée comme sévère, dont toute cas présentant au moins 1 signe de colite tels que la
fièvre ≥ 38,5 °C, frissons, instabilité hémodynamique y compris choc septique, défaillance
respiratoire, péritonite, d’iléus, hyperleucocytose (> 15x109/L), augmentation de la créatinine
(>50 % de la valeur de base), élévation du lactate sérique, hypo-albuminémie (<30 g/L),
pseudo-membranes (l’endoscopie), distension colique, diminution du mur colique, infiltration
de la graisse péri-colique, ascite, et les formes d’emblées compliquées (choc, passage en
réanimation, colectomie cas de mégacôlon toxique ou de perforation digestive) (Bauer et al.,
2011; Debast et al.,2014).

18
Chapitre I Synthèse bibliographique

6.2. Transport et conservation des selles

Pour garantir la bonne conservation d’un échantillon de selles pour la détection des
toxines et pour la culture, il est recommandé de le stocker à +4°C ou à -80°C (Lalande et al.,
2004).

6.3. Tableau biologique

6.3.1. Identification microbiologiques

6.3.1.1. Culture

Plusieurs milieux de culture permettant l’isolement de C. difficile. La gélose sélective


CCFA (Cyclosérine Céfoxitine Fructose Agar) contient de la,cyclosérine, de la céfoxitine, du
fructose, du jaune d’oeuf et du rouge neutre, l’ajout d’antibiotique à une base gélosée permet
l’isolement sélectif de 2000 organismes parmi un total de 6.1010 bactéries par gramme de
selles, les concentrations des agents sélectifs peuvent être réduites de 500 à 250 mg/L pour la
cyclosérine et de 16 à 8 mg/L pour la céfoxitine, mais certains auteurs préconisent la
concentration d’origine de cyclosérine c’est-à-dire 500 mg/L et une pré-incubation de 4
heures du milieu en atmosphère anaérobie (Lalande et al., 2004).

Le milieu CCEY (cefoxitin cycloserine egg yolk agar: Brazier’s medium) est très
utilisé pour l’isolement et la purification de C. difficile, il est commercialisé sous forme
déshydraté avec une supplémentassions des antibiotiques (Mullany, 2010).

6.3.1.1. A. Aspects macroscopique et microscopique des colonies

L’incubation des milieux sélectifs se déroule en atmosphère anaérobie c’est-à-dire


80% d’azote N2, 10% d’hydrogène H2, et 10% de dioxyde de carbone CO2 pendant une
durée de 48 heures à une température de 37°C, après l’incubation on observe des colonies de
5 à 10 millimètres de diamètre, plates, circulaires, à bords irréguliers, jaunes ou blanches à
grises, non hémolytiques, d’aspect caractéristique en tache de bougie (Figure 12). La
coloration de Gram met en évidence des bacilles à Gram positif sporulés présentant une spore
terminale ou subterminale peu déformante d’apparition rapide sur milieu solide (Mullany et
al., 2010).

L’identification présomptive repose sur cinq caractères :

• Métabolisme anaérobie strict ;

• Aspect morphologique des bactéries à la coloration de Gram ;

19
Chapitre I Synthèse bibliographique

• Aspect de verre brisé, frité des colonies à la loupe binoculaire ;

• Odeur caractéristique de crottin de cheval due à l’émission de crésol ;

• Fluorescence vert chartreuse en lumière UV à 360 nm.

Figure 12: Aspect de C. difficile en gélose au sang (Mullany, 2010).

6.3.1.1. B. Caractères biochimiques

L’analyse des caractères biochimiques permet l’identification définitive de C. difficile,


elle est réalisée grâce aux galeries pour bactéries anaérobies, galeries API20A (bioMérieux)
ou Rapid 32A (bioMérieux). Elles permettent après 4 heures d’incubation en aérobiose à 37°C
d’étudier l’équipement enzymatique de C. difficile (Mullany, 2010).

6.3.2. Méthodes Immuno-Enzymatiques

6.3.2.1. Mise en évidence du glutamate déshydrogénase (GDH)

Le glutamate déshydrogénase est une enzyme produite par les souches de C. difficile et
peut être détectée dans les selles soit par agglutination de particules de latex soit par méthode
immuno-enzymatique (IEA), ces tests IEA peuvent se présenter sous forme unitaire ou sous
forme de plaques de micro-titration; ils sont simples et rapides d’exécution (Lalande et al.,
2004).

Cette méthode a une sensibilité de l’ordre de 88 à 89 % par rapport à la culture


toxigénique. On observe une très bonne corrélation entre la détection de la GDH et la culture
sur milieux sélectifs (Eckert et al, 2011).

Malgré une bonne spécificité de ce test vis-à-vis de la bactérie, la GDH peut être
produite aussi bien par les souches toxinogènes que par les souches non-toxinogènes, ce qui

20
Chapitre I Synthèse bibliographique

en fait un excellent marqueur de la présence de souche de C. difficile dans les selles mais ne
permet en aucun cas de déterminer le caractère toxinogène ou non de la souche détectée
(Lalande et al., 2004).

6.3.2.2. La sérologie

La mise en évidence des anticorps sériques anti-toxines peut être réalisée par réaction
de neutralisation de l’effet cytopathogène ou par technique ELISA, mais aucun test permettant
le dosage de ces anticorps n’est actuellement disponible (Lalande et al., 2004).

L’interprétation d’une sérologie est difficile étant donné que les IgG anti-toxines A et
B sont détectées dans environ deux tiers de la population mondiale, de plus, lors d’une
infection symptomatique, on relève une augmentation du taux d’IgG anti-toxine A dans
seulement 11 à 68 % et une augmentation du taux d’IgG anti-toxine B dans 44 à 71 % des cas,
ce qui rend l’interprétation d’une sérologie pratiquement difficile (Freeman et al., 2003).

Une étude en 2011 par l’équipe de Eckert, démontre une réponse immunologique
systémique de type IgG et locale de type IgA plus faible Chez les patients présentant une
forme sévère ICD, Eckert observe que les patients présentant une bonne réponse
immunologique lors d’un premier épisode présentent un taux de rechute plus faible.

6.3.3. Test de cytotoxicité des selles (CTA)

Le CTA est considéré comme le gold standard historique choisi par la Food Drug
Administration (FDA), L’objectif est de détecter l’effet cytopathogène produit par la toxine B
(Figure 13), manifesté par la ballonisation des cellules (Eckert et al., 2011). Il s’agit
d’inoculer un filtrat stérile d’une suspension de selles sur une culture cellulaire. Plusieurs
lignées cellulaires peuvent être utilisées, Vero, MRC5, CHO, HeP2 (Lalande et al., 2004).

Figure 13: Test de cytotoxicité sur cellules MRC-5 (Lalande et al., 2004).

21
Chapitre I Synthèse bibliographique

La durée d’incubation est de 24 à 48 heures dans une atmosphère enrichie en CO2 et à


une température de 37°C, on observe la ballonisation des cellules qui s’arrondissent et se
détachent, la déglobulisation des cellules entraîne une augmentation de leur réfringence. La
toxine B, étant mille fois plus cytotoxique que la toxine A, est responsable de cet effet
cytopathogène (Lalande et al., 2004; Karasawa et al., 1997).

Cette méthode est sensible, avec un seuil de détection de l’ordre du picogramme, mais
la sensibilité de cette méthode peut varier suivant la lignée cellulaire utilisée (la plus sensible
étant la lignée Vero). La sévérité de l’ICD n’étant pas corrélée à la quantité de toxines, le
titrage de la toxine B ne présente aucun intérêt Les valeurs prédictives positives et négatives
de ce test sont respectivement de l’ordre de 80 à 100 % et de 95 à 100 % (Karasawa et al.,
1997).

Cette technique est peu coûteuse, simple et facile à réaliser, ce qui en fait la méthode
diagnostique de référence d’une infection à C. difficile (Lalande et al., 2004), mais elle
comporte néanmoins quelques inconvénients, parmi lesquels la longue durée d’incubation
allant de 24 à 48 heures (Eckert et al., 2013). De plus, afin de s’assurer de la spécificité de
l’effet cytopathogène, il est nécessaire de neutraliser l’effet cytopathogène obtenu à l’aide
d’un antisérum anti-C. difficile ou anti-Clostridium sordellii (Lalande et al., 2004).

6.3.4. Identification moléculaire

L’identification se fait par la recherche des gènes codant pour les toxines A et B par
amplification génique en utilisant la technique de chaine de réactions de polymérisation
(PCR). Cela permet d’avoir un diagnostic rapide (de 1 à 6 heures) avec une sensibilité
supérieure à 90% et une spécificité de 100% (Barbut et al., 2014).

7. Traitement

7.1. Antibiothérapie

La prise en charge d’un patient avec une ICD simple, ou avec des symptômes peu
sévères est relativement simple. En effet, un arrêt des antibiotiques incriminés ou un
changement d’antibiotique, ainsi qu’une bonne réhydratation et un rééquilibrage
électrolytique du patient, permettent le plus souvent d’arrêté l’infection, en cas de persistance
des symptômes, un traitement spécifique contre C .difficile doit être mis en place. Trois
antibiotiques, le métronidazole, la vancomycine, et récemment la fidaxomicine, sont
recommandés pour le traitement d’une ICD (Figure 14) (Ackermann et al., 2001).

22
Chapitre I Synthèse bibliographique

Le métronidazole est le plus souvent favorisé, en milieu hospitalier, à cause de son


faible coût et du fait de l’absence de risque de sélection d’entérocoques résistants à la
vancomycine. Selon Bartlett (2008), la vancomycine est le traitement le mieux adapté et le
plus efficace en cas d’ICD graves. Ces deux antibiotiques présentent, toutefois, deux
problèmes majeurs, l’absence de réponse en cas de complications cliniques (ileus ou
mégacôlon toxique) et le risque de rechutes après arrêt de l’antibiothérapie.

Ces dernières années, le taux d’échec des traitements par métronidazole est en
augmentation surtout avec l’émergence de la souche hyper-virulente NAP1/B1/027 (Sinh et
al., 2011).

D’autres antibiotiques (rifampicine, bacitracine, rifaximine, nitazoxanide et acide


fusidique) ont été testés pour le traitement des ICD et semblent avoir presque la même
efficacité que le métronidazole et la vancomycine (Nelson, 2007). La tigécycline et surtout la
fidaxomicine (également connu sous les noms OPT-80, ou PAR-101 ou tiacumicine B) ont
également donné des résultats prometteurs, surtout dans le traitement des ICD réfractaires
(Herpers et al., 2009 ; Louie et al., 2011). Les intérêts de la fidaxomicine sont sa spécificité
sur les bactéries à Gram positif tout en préservant l’activité barrière du microbiote intestinal,
sa forte concentration dans les selles après administration orale (non absorption) et son action
régulatrice négative sur la sporulation et la production des toxines (Bouillaut et al., 2011;
Gomez et al., 2011).

Figure 14: Protocole de traitement des infections à C. difficile (Bauer et al., 2009).

23
Chapitre I Synthèse bibliographique

7.2. La transplantation fécale (FMT)

Les rechutes des ICD peuvent être multiples, sévères et de plus en plus invalidantes
pour les patients, les deux paramètres, sévérité et chronicité, peuvent avoir des conséquences
pour le quotidien des patients. Pour ces patients, la transplantation fécale peut être envisagée
(Silverman et al., 2010).

Ce traitement consiste en une implantation (greffe) du microbiote fécal d'un ou


plusieurs donneurs sains, après lavement intestinal du patient, pour tenter d'éliminer son
propre microbiote, le lavement permet d’éliminer les matières fécales, les traces
d’antibiotiques et les spores de C. difficile présents dans l’intestin (Austin et al., 2014).
L’implantation se fait par sonde nasogastrique, coloscopie ou lavement. Ce traitement, utilisé
depuis plusieurs siècles dans la médecine chinoise, est très étudié actuellement (Yoon et al.,
2010).

Des précautions préalables doivent permettre d'éliminer des micro-organismes


potentiellement pathogènes de la selle du donneur, par ailleurs, d'autres risques associés à la
transplantation d'un microbiote exogène sont soulevés tels que transfert de substances
cancérigènes; de plus, le patient peut avoir du mal à accepter l’idée de recevoir des matières
fécales d'autrui (McCune et al., 2014). En revanche, hormis ces risques, en particulier le
risque de transmission d'un pathogène, ce traitement a un coût peu élevé et peu d'effets
secondaires décrits à ce jour (Van Nood et al., 2013).

La transplantation fécale, permet dans la majorité des cas de guérir les patients
(Gough et al., 2011), une étude par Aas en 2003 sur 317 patients traités par transplantation
fécale, démontre un pourcentage de guérison de 92 % jusqu’à la guérison totale.

7.3. Les probiotiques

Les probiotiques ont été utilisés afin de restaurer l’équilibre du microbiote (Hickson,
2011). Certaines espèces de micro-organismes comme Saccharomyces boulardii ou des
souches de Lactobacillus ont donné des résultats dans la prévention des récidives de
l’infection (Hickson et al., 2007; McFarland, 2006).

7.4. Anticorps monoclonaux anti-toxines A et B

Outre l’antibiothérapie et la transplantation fécale, les récidives des ICD peuvent aussi
être prévenues par une immunothérapie passive par des immunoglobulines en intraveineuse
(Surawicz et al., 2013). Des études ont montré un taux de récidives de 7% dans le cas de

24
Chapitre I Synthèse bibliographique

traitement par les anticorps monoclonaux, mais il restent à valider par d’autres études
(Abougergi et al., 2010; Koulaouzidis et al., 2008).

7.5. Vaccination

Plusieurs cibles vaccinales sont actuellement étudiées pour prévenir les récidives
d’ICD ainsi que pour empêcher la colonisation de C. difficile dans le tube digestif (Surawicz
et al., 2013).

8. Prévention

La prévention de l’acquisition du C. difficile peut être classée en 2 stratégies; la


prévention de la transmission horizontale afin de minimiser l’exposition, et la diminution des
facteurs de risque de développement d’ICD (Kallen et al., 2009).

La prévention de l’infection repose sur le bon usage des antibiotiques, une diminution
d’incidence d’ICD a été observée suite à la restriction d’usage de certaines classes associées à
un risque élevé d’ICD (Climo et al., 1998). La plupart de ces études prennent rarement en
compte une exposition au C. difficile lors de l’évaluation des résultats, ainsi, les efforts pour
démontrer les effets de la restriction des antibiotiques peuvent être gênés par les interventions
de contrôle de l’infection qui affectent le risque d’acquérir le C. difficile (Davey et al., 2013).

En milieu hospitalier, on peut identifier 3 sources d’exposition au C. difficile ; par


contact avec du personnel soignant qui porte une contamination transitoire au niveau des
mains, par contact avec l’environnement contaminé, ou par contact direct avec un patient
infecté (Rupnik et al., 2009; Guerrero et al., 2012).

Les principales mesures pour prévenir cette transmission croisée comprennent


l’isolement géographique du patient infecté, le lavage adéquat des mains, les précautions de
contact (port des gants, surblouse), la désinfection de l’environnement à l’aide de produits
sporicides ainsi que l’information des patients et l’éducation du personnel soignant (Eckert et
al., 2010). L’hygiène des mains est considérée comme l’une des pierres angulaires de la
prévention de la transmission nosocomiale du C. difficile (Arfons et al., 2005). Pour éliminer
les spores du C. difficile, seule l’action mécanique d’un lavage à l’eau et un savon
antiseptique est efficace contrairement aux solutions hydro alcooliques largement utilisées en
milieu hospitalier (Oughton et al., 2009). L’utilisation de gants associée avec une hygiène
des mains est efficace pour réduire la transmission manu portée (Johnson et al., 1990).

25
Chapitre I Synthèse bibliographique

Les désinfectants de surfaces habituellement utilisés ne sont pas efficaces sur les
formes sporulées de C. difficile, la désinfection de surfaces avec une solution à base
d’hypochlorite a été associée à une incidence réduite de l’ICD (Hacek et al., 2010; Fawley et
al., 2007; Wilcox et al., 2004). De nouveaux produits à base de peroxyde d’hydrogène se sont
montrés aussi efficaces mais des considérations pratiques, la nécessité de clore
hermétiquement les chambres et d’avoir accès à un équipement spécialisé, et financières
limitent son application (Barbut et al., 2009; Shapey et al., 2008; Doan et al., 2012).

26
Chapitre II Matériel et méthodes

1. Échantillonnage

Cette étude a été entretenue dans trois Hôpitaux à la wilaya de Chlef (hôpital de Hay
Bensouna, Chettia et Chorfa) et un hôpital à la wilaya d’Ain Deffla (Sidi Bouabida) à partir de
10 services différents durant la période allant du mois de Janvier jusqu'à mois de Mai; afin
d’isoler, identifier et caractériser le pathogène nosocomial anaérobie, C. difficile.

Ce travail a été réalisé au Laboratoire de Biologie Moléculaire de la Faculté des


Sciences de la Nature et de la vie, Département de Biologie à l’Université du Hassiba Ben
Bouali de Chlef.

Un total de 39 prélèvements a été effectué à partir des selles diarrhéiques des patients
hospitalisés sous traitement antibiotiques, et récoltés dans des pots de coproculture stériles.

Le tableau 2 récapitule le nombre et la source des prélèvements.

Tableau 2: Récapitulation des données relatives aux prélèvements.

Prélèvements Etablissement
Source Total
hospitalier

SERVICE Nº

Pédiatrie 7
Merouani Abed (Chettia)
Médecine interne 3 13
Isolement 3
Oncologie 1

Selles humaines Médecine interne 3


Sœur Bedj (Hay Bensouna) Chirurgie 1 11
Cardiologie 5
Réanimation 1
Pédiatrie 3
Frères Khellif (Chorfa) Urgence 1 4

Pédiatrie 8
Bouabida(Sidi Bouabida) 11
Medecine interne 3

27
Chapitre II Matériel et méthodes

2. Traitement des échantillons

Un volume de selles diarrhéiques est melangé avec le même volume d’éthanol absolu.
Le mélange est homogénéisé par vortex (VWR, W3S40); ensuite laissé pendant 1 heure (h) à
température ambiante. Le mélange est centrifugé (MSE Micro Centaur, sanyo, UK) à 13 000
tr/min pendant 10 minutes (min). Le surnageant est éliminé et le culot contenant les spores
est laissé sécher à température ambiante pendant 15 minutes, puis suspendue dans 0.5 ml
d’eau physiologique stérile. Ce traitement permet de sélectionner exclusivement les spores en
éliminant toutes les bactéries de la flore fécale (Borriello et Honour, 1981; Tenover, 2011).

3. Isolement et identification de C. difficile

3.1 Culture microbiologique

Une goutte de 50µl de la suspension de spores obtenues précédemment est


ensemencée sur gélose Columbia additionnée 05% de sang de cheval stérile. Les boites sont
ensuite incubées à 37°C pendant 72 h dans une boite contenant un sachet générateur
d’anaérobiose (GENbox anaer, ref : 96124, BioMérieux, France) (Figure 15).

Figure 15 : Boite d’anaérobiose incubée dans l’étuve à 37°C.

4. Identification de C. difficile

L’identification des souches purifiées est réalisée en suivant une procédure de


plusieurs étapes successives, basée sur la recherche et la détermination d’un certain nombre
de caractère morphologiques.

28
Chapitre II Matériel et méthodes

4.1 Examen macroscopique

Une observation macroscopique des colonies a été faite à l’œil nu et par une loupe
binoculaire, ce qui permet de décrire la taille, l’aspect, la couleur, l’odeur, la consistance, le
contour, l’opacité, et la forme des colonies (Denis et al., 2007).

4.2 Examen microscopique

Le test de Gram est utilisé pour classer les bactéries, selon la structure de leur paroi
cellulaire, en Gram positif ou négatif.

5. Identification moléculaire

5.1 Extraction d’ADN

L’extraction de l’ADN chromosomique des isolats suspects de C. difficile a été


réalisée par la méthode du choc thermique, 2 à 3 colonies pures sont déposées dans 500 µl de
l’eau distillée stérile et chauffées à 100°C pendant 15 min, puis transférées directement dans
la glace (-20°C) pendant 15 min, cette étape d’alternation (chaleur et froid) est répétée trois
fois jusqu’à la lyse des cellules bactériennes et la libération de l’ADN.

La suspension est ensuite centrifugée à 13 000 tr/min pendant 10 min; le surnageant


contenant l’ADN est retenu, puis conservé à - 20°C.

5.2. Réactions de PCR

Les souches de C. difficile isolées par culture ont été identifiées par PCR en utilisant
une paire d’amorce (908 CLD-gluDs : GTCTTGGATGGTTGATGAGTAC et 909 CLD-
gluDas : TTCCTAATTTAGCAGCAGCTTC) permettant d’amplifier le gène codant pour
l’enzyme glutamate déshydrogénase (GluD), uniquement présente chez C. difficile.
L’amplicon généré est de 158 pb (Paltansing et al., 2007).

La réaction d’amplification a été effectuée dans un mélange réactionnel d’un volume


total de 25μl contenant; 5μl d’ADN chromosomique, 2.5μl de chaque amorce (5pmol)
(908GluDs, 909 GluDas), 0.5μl de chaque nucléotide (10mM), 2.5 μl de tampon (10 X) et
0,25 μl de Taq polymérase. Le volume est complété à 25μl par l’ajout de 10.25 μl d’ H2O
ultra pure.

L’amplification a été réalisée dans un thermocylceur (TECHNE, TC-3000) selon le


programme d’amplification récapitulé dans le tableau 3.

29
Chapitre II Matériel et méthodes

Tableau 3 : Programme d’amplification du gène GluD.

Nombre de cycles Étape Température (°C) Durée


1 cycle Dénaturation initiale 95 3min
35 cycles Dénaturation 94 1min
Hybridation 58 30sec
Elongation 72 1min
1 cycle Elongation final 72 5min

5.3. Migration sur gel d’agarose

5.3.1. Préparation de gel

1g d’agarose est dissoudre dans 100 ml du tampon de (TAE) pour préparé un gel de
1%, puis placé au four à micro-onde jusqu'à dissolution total et obtention d’une phase
homogène (limpide). Après refroidissement ,10µl de BET est incorporé.

5.3.2 Migration

Un volume de 15 µl du produit de la PCR est mélangé avec le tampon de charge (5X)


et un marqueur de taille (100 pb) sont migrés sur un gel d’agarose de 1 % additionné au BET,
à un voltage de 100V pendant 15 min, puis 80V pendant 45mn, Les amplicons de la PCR
sont visualisés sous lampe UV à 365 nm (Figure 16).

Figure 16 : Gel d’électrophorèse avant migration.

30
Chapitre III Résultats et Discussion

1. Collection des échantillons

Durant la période entre Janvier et Mai 2018, 39 échantillons de selles diarrhéiques ont
été collectés à partir de patients admis aux hôpitaux de Chettia, Hay Bensouna, Chorfa et Sidi
Bouabida. Chaque prélèvement de selle est accompagné d’une fiche de renseignements
(annexe 1). L’ensemble de ces renseignements sont montrées dans le tableau (annexe 2).

2. Isolement du pathogène C. difficile agent des diarrhées post-antibiotiques

Cette étude a été menée dont l’objectif était d’estimer la prévalence des infections à C.
difficile au niveau de quelque hôpitaux à Chlef et Ain Defla. L’isolement de C. difficile a été
réalisé à partir de selles diarrhéiques de patients hospitalisés.

Pour rappeler, les patients étaient inclus dans cette étude s'ils présentaient une diarrhée
aqueuse, et ont reçus des antibiotiques, 48 heures après leur admission. L’identification de C.
difficile a été effectuée par des méthodes microbiologiques et moléculaires (PCR).

Parmi les 39 échantillons de selles prélevés, 26 colonies suspectes de C. difficile, sur la


base de caractéristiques culturaux; Les colonies de C. difficile possèdent une morphologie
typique, elles apparaissent blanches à grises, à contours irréguliers et non hémolytiques sur
gélose au sang, avec un aspect en verre vitré (figure 17), et une odeur caractéristique du
crottin de cheval (Brazier et Borriello, 2000).

Figure 17 : Aspect des colonies de C.difficile sur columbia au sang après 48h d’incubation en
anaérbiose.

31
Chapitre III Résultats et Discussion

La coloration de Gram mis en évidence des bacilles gram positif avec la présence des
spores ovales subterminales non déformantes (Figure18).

Figure 18 : Aspect de C. difficile au Gram.

Ces souches suspectes de C. difficile ont été soumises à une identification par PCR,
par l’amplification du gène codant pour le glutamate déshydrogénase (GluD).

Les résultats de la PCR (figure 19), montrent que 5 souches sont positives, suite à la
présence d’une bande d’un amplicon de 158 pb correspondant à la taille attendue de
l’amplification du gène gluD par la paire d’amorces utilisée.

Figure 19 : Identification de C. difficile par PCR du gène gluD.

32
Chapitre III Résultats et Discussion

M: Marquer de taille de 100 pb (promega); Puits 1 (B2), 2 (B4), 4 (B8), 5 (C5) et 8


(D4) : échantillons à gluD positive; Puits de 3 (B5), 6 (C12), 7 (D2), et 9 (C6) : échantillons
à gluD négative ; Puit 10 : Souche de référence.

Parmi les 39 prélèvements obtenus entre Janvier et Mai 2018 à partir de quatre
hôpitaux, cinq souches en total ont été isolées et identifiées par culture et PCR ; trois souches
(27,27%, 3/11) de l’hôpital de Hay Bensouna, une souche de l’hôpital de Chettia (7,69%,
1/13) et une de l’hôpital de Sidi Bouabida (9,09%, 1/11). Aucune souche n’a été isolée à
partir de l’hôpital de Chorfa (Figure 20).

Il est clair que la fréquence d’isolement la plus élevé s’est produite au niveau de
l’hôpital de Hay Bensouna ; ceci peut être expliqué par le fait que cet hôpital est le plus grand
de Chlef.

Figure 20: Distribution des souches de C, difficile isolés.

Notre résultat montre une présence des ICD en Algérie et précisément au niveau des
wilaya de Chlef et Ain Defla.

Les patients à partir desquels on a isolé C. difficile étaient hospitalisés, pendant 7 à 15


jours, à cause de différentes maladies, cancer, cardiopathie, syndrome néphrotique, infection
gastro-intestinale et amygdalite. Les renseignements des patients porteurs de C. difficile sont
résumés dans le tableau 4.

33
Chapitre III Résultats et Discussion

Tableau 4 : Donné des patients porteurs de C. difficile

Prélèvements Sexe Age Hôpital Service ATB administrés

B2 Féminin 70 ans Oncologie Chimiothérapie

Hay Bensouna
B4 Féminin 60 ans Cardiologie Claforan

B8 Féminin 69 ans Médecine interne Céfotaxime

C5 Féminin 32 ans Chettia Infectiologie Flagyl+claforan

D4 Masculin 3 mois Sidi Bouabida Pédiatrie Amoxypen

Les quatre patients B2, B4, B8 et C5, de sexe féminin, sont âgées de 70, 60, 69 et 32
ans respectivement. La première patiente (code d’échantillon B2), était sous chimiothérapie,
alors que les trois autres patientes (B4, B8 et C5) ont subi une antibiothérapie par
l’administration de claforan, céfotaxime (céphalosporine de 3ème génération), et flagyl
additioné au claforan respectivement.

Le cinquième patient D4 été un bébé de 3 mois traité par amoxypen (amoxicilline).

Barbut et al. (2004) ont reportés que le principal risque de développement d’une ICD
dans plus de 95 % des cas, est la prise des antibiotiques. Nos résultats confirment cette
information, car tous les patients porteurs de C. difficile ont subi une antibiothérapie lors de
leur période d’hospitalisation.

Dans notre étude, les quatre patients (B4.B8.C5.D4) ont été traités par claforan et
céfotaxime (céphalosporine de 3ème génération), amoxypen (amoxyciline) qui sont les
antibiotiques les plus incriminés dans les ICD (Barbut et al. 2004).

La patiente C5 a pris claforan additionné au flagyl (un antibiotique à base de


métronidazole). Selon Elliot (2007), même la vancomycine et le métronidazole qui sont les
antibiotiques de choix pour le traitement des infections à C. difficile peuvent induire des ICD.

Les produits chimio-thérapeutiques tels que le fluorouracil, le méthotrexate peuvent


favoriser l’émergence de C. difficile par modification de la flore gastro-intestinale naturelle à
cause des propriétés antimicrobiennes de ces agents.

34
Chapitre III Résultats et Discussion

Dans cette étude une patiente été admise pour un traitement chimio-thérapeutique
contre un cancer. Chez cette patiente une souche de C. difficile a été isolée. La présence de C.
difficile chez des patients cancéreux subissant des traitements chimio-thérapeutiques a été
rapportée de se produire avec une fréquence de 5 à 9 % (Kohn et al., 2015). La
chimiothérapie, par fluorouracil ou méthotrexate, a été démontrée comme une facteur qui
augmente le risque d’ICD, en causant la perturbation de la flore gastro-intestinale, et
l’affaiblissement du système immunitaire (Fekety, 1997; Nylund et al., 2011).

Il est bien établit que les infections liées à C. difficile acquises aux niveaux hospitaliers
est de l’ordre de (15-30%) (Mylonakis et al., 2001). Nos fréquences d’isolements
préliminaires (7-27%) sont proches de ces valeurs. Cependant, il se peut que ces fréquences
ne reflètent pas la réalité à cause de l’échantillonnage limitée dans le temps et l’espace de
notre étude.

35
Conclusion

Les infections nosocomiales à C. difficile sont relativement courantes dans les


établissements de soins à travers le monde. L’incidence et la sévérité de ces infections sont en
augmentation en Amérique et en Europe. En Algérie aucune information n’est disponible sur
les ICD, appart une seule étude effectuée récemment á Chlef (Djebbar et al. 2018). Ce projet
est une continuation de cette étude, et vise à isoler des souches de C. difficile à partir de
quelques hôpitaux de Chlef et Ain Defla.

Les fréquences d’isolement obtenues dans notre étude sont de l’ordre de 0%, 7,69%,
9,09%, 27,27% dans les hôpitaux de Chorfa, Chettia, Sidi Bouabida et Hay Bensouna,
respectivement.

A l’issue de ce projet, limité dans l’étendue de l’échantillonnage, il est clair que C.


difficile est prévalent au niveau de nos hôpitaux, confirmant les résultats de Djebbar et al.
(2018).

A la lumière de cette étude, il est important de sensibiliser les personnels soignants sur
les risques posés par C. difficile au niveau des hôpitaux.

En perspective, il est donc raisonnable, sur la base des résultats de notre étude,
d’envisager une enquête plus étendu dans le temps, l’espace et la taille de l’échantillon, afin
de mieux comprendre l’ampleur de la prévalence des ICD au niveau de nos hôpitaux ; et ceci
est primordial pour une meilleure prise en charge des patients.

Enfin, les résultats de telles études pourraient être utiles aux autorités de la santé
publique afin de mettre en œuvre des programmes de surveillance et de prévention contre
cette redoutable bactérie pathogène.

36
Références bibliographiques

 Aas J., C. E. Gessert., J. S. Bakken. 2003. Recurrent Clostridium difficile colitis: case
series involving 18 patients treated with donor stool administered via a nasogastric
tube. Clin Infect Dis 36:580-5.
 Abougergi MS., Kwon JH. 2010. Intravenous immunoglobulin for the treatment of
Clostridium difficile infection: a review. DigDisSci, 56(1):19-26.
 Ackermann G ., Y. J. Tang., R. Kueper., et al. 2001. Resistance to moxifloxacin in
toxigenic Clostridium difficile isolates is associated with mutations in gyrA.
AntimicrobAgents Chemother 45:2348-53.
 Akhtar A. J., Shaheen M. 2007. Increasing incidence of Clostridium difficile
associated diarrhea in African-American and Hispanic patients: association with the
use of proton pump inhibitor therapy. J. Natl. Med. Assoc. 99, 500–504.
 Al Saif N., Brazier JS. 1996. The distribution of Clostridium difficile in the
environment of South Wales. J Med Microbiol; 45(2):133‐7.
 Alasmari F., S. M. Seiler., T. Hink., et al. 2014. Prevalence and Risk Factors for
Asymptomatic Clostridium difficile Carriage. Clin Infect Dis.2014 Jul 15;59(2):216-
22.
 Andrews C. N., J. Raboud., B. O. Kassen., et al. 2003. Clostridium difficile associated
diarrhea: predictors of severity in patients presenting to the emergency department.
Can J Gastroenterol 17:369-73
 Arfons L., Ray AJ., Donskey CJ. 2005. Clostridium difficile infection among health
care workers receiving antibiotic therapy. Clin Infect Dis, 40(9):1384-1385. 328.
 Aslam S., R. J. Hamill., D. M. Musher. 2005. Treatment of Clostridium difficile-
associated disease: old therapies and new strategies. Lancet Infect Dis 5:549-57.
 Austin M., M. Mellow, W. M. Tierney. 2014. Fecal Microbiota Transplantation in the
Treatment of Clostridium difficile Infections. Am J Med.
 Barbut F., Menuet D., Verachten M., et al. 2009. Comparison of the efficacy of a
hydrogen peroxide dry-mist disinfection system and sodium hypochlorite solution for
eradication of Clostridium difficile spores. Infect Control HospEpidemiol, 30(6):507-
514.
 Barbut F., Guery B., Eckert., C et al. 2014. Comment traiter une infection digestive à
Clostridium difficile en 2014 .Réanimation 23:284-297.

37
Références bibliographiques

 Barbut F., Lalande V., Petit J.-C. 2004. Épidémiologie et prévention des infections
digestives à Clostridium difficile. Revue Française des Laboratoires.n°368, p. 27–34.
 Barbut F., Meynard J.-L., Eckert C. 2011. Traitement des infections digestives à
Clostridium difficile : anciennes et nouvelles approches. Journal des Antiinfectieux.
Vol. 13, n°2, p. 74-86.
 Barbut F., Petit J-C. 2000. Les diarrhées à Clostridium difficile : épidémiologie et
stratégies de prévention. Médcine thérapeutique. Hors série n°1 ,PP.51-58
 Bartlett JG. The case for vancomycin as the preferred drug for treatment of
Clostridium difficile infection.2008. Clin Infect Dis. 15;46(10):1489‐92.
 Bartlett J. G. 1996. Management of Clostridium difficile infection and other antibiotic-
associated diarrhoeas. Eur J GastroenterolHepatol 8:1054-61.
 Bartlett J.G., T. W. Chang., M. Gurwith., et al. 1978. Antibiotic-associated
pseudomembranous colitis due to toxin-producing clostridia. N. Engl. J. Med.
298:531-534.
 Bauer MP., Notermans DW., van Benthem BH., et al. 2011. ECDIS Study Group.
European Society of Clinical Microbiology and Infectious Diseases: Clostridium
difficile infection in Europe: a hospital-based survey. Lancet 2011;377:63-73.
 Bauer M. P., E. J. Kuijper., J. T. van Dissel. 2009. European Society of Clinical
Microbiology and Infectious Diseases (ESCMID): treatment guidance document for
Clostridium difficile infection (CDI). ClinMicrobiol Infect 15:1067-79.
 Ben Abdelghani K., D. Gerard-Dran., J. Morel., et al. 2010. Clostridium difficile
associated reactive arthritis. Rev Med Interne 31:e13-5.
 Borriello S. P. 1998. Pathogenesis of Clostridium difficile infection. Journal of
antimicrobial chemotherapy. Vol. 41, n°suppl 3, p. 13–19.
 Borriello S. P., Honour P., 1981. Simplified procedure for the routine isolation of
Clostridium difficile from faeces. Journal of ClinicalPathology; 34(10), 1124– 1127
 Bouillaut L., Sims C., Gomez A., et al. 2011. Fidaxomicin inhibits production of toxin
A and toxin B in Clostridium difficile. Poster in 7th International Conference on the
Molecular Biology and Pathogenesis of the Clostridia ‐ClostPath, Iowa‐USA.
 Brazier JS., Boriello SP. 2000. Microbiology, epidemiology and diagnosis of
Clostridium diffıcile infection. Curr Top MicrobiolImmunol. 250:1–33.
 Buyse E., Azoula F., Barbut B., et al. 2005. Infection à Clostridium difficile :
physiopathologie, diagnostic et traitement. Réanimation. Vol. 14, n°4,p. 255-263.

38
Références bibliographiques

 Cariou E. 2013. Rchutes d’infections à Clostridium difficile : Etude clinique sur 3 ans
au chu de limoges. Université de Limoge.
 Carroll KC., Bartlett JG. 2011. Biology of Clostridium difficile: implications for
epidemiology and diagnosis. Annu Rev Microbiol. 65:501-521.
 Cerquetti M., Luzzi I., Caprioli A., et al. 1995. Role of Clostridium difficile in
childhood diarrhea. Pediatr Infect Dis J. 14(7):598-603.)
 Chen ML., Pothoulakis C., LaMont JT. 2002. Protein kinase C singnaling regulates
ZO-1 translocation and increased paracellular flux of T84 colonocytes exposed to
Clostridium difficile toxin A.J Biol Chem.8;277(6):4547-54.
 Clabots CR., Johnson S., Olson, MM., et al. 1992. Acquisition of Clostridium difficile
by hospitalized patients: Evidence of colonized new admissions as the source of
infection. J Infect Dis.166(3): 561–567
 Clements AC., Soares Magalhaes RH., Tatem AJ., et al. 2010. Clostridium difficile
PCR ribotype 027: assessing the risks of further worldwide spread. Lancet.10:395-
404.
 Climo M W., Israel DS., Wong ES., et al. 1998. Hospital-wide restriction of
clindamycin: effect on the incidence of Clostridium difficile-associated diarrhea and
cost. Ann Intern Med 1998,128(12 Pt 1):989-995.
 Cohen SH., Gerding DN., Johnson S., et al. 2010. Clinical practice guidelines for
Clostridium difficile infection in adults: update by the society for healthcare
epidemiology ofAmerica (SHEA) and the infectious diseases society of America
(IDSA). Infect Control HospEpidemiol, 31(5):431-455.
 Dailey D. C., Kaiser A., Schloemer R. H. 1987. Factors influencing the phagocytosis
of Clostridium difficile by human polymorphonuclear leukocytes. Infection and
immunity. Vol. 55, n°7, p. 1541–1546.
 Davey P., Brown E., Charani E., et al. 2013. Interventions to improve antibiotic
prescribing practices for hospital inpatients. Cochrane Database Syst Rev,
4:CD003543.
 Davies AH., Roberts AK., Shone CC., et al. 2011. Super toxins from a super bug:
structure and function of Clostridium difficile toxins. Biochem J 15;436(3):517‐26.
 Debast SB., Bauer MP., Kuijper EJ. 2014. European Society of Clinical Microbiology
and Infectious Diseases. ClinMicrobiolInfect : update of the treatment guidance

39
Références bibliographiques

document for Clostridium difficile infection.;20 Suppl 2:1-26 (Recommandations de


l'ECCMID).
 Denis F., Ploy M-C., Martin C., et al. 2007. Bactériologie médicale. 2ème Edition.
Ellipses. Paris. 573 p.
 Dial S., Alrasadi K., Manoukian C., et al. 2004. Risk of Clostridium difficile diarrhea
among hospital inpatients prescribed proton pump inhibitors: cohort and case-control
studies. CMAJ 171, 33–38. doi: 10. 1503/cmaj.1040876.
 Djebbar A., Sebaihia M., Kuijper E., et al. 2018. First molecular characterisation and
PCR ribotyping of Clostridium difficile strains isolated in two Algerian Hospitals.J
Infect Dev Ctries; 12(1):015-021.
 Doan L., Forrest H., Fakis A., et al. 2012. Clinical and cost effectiveness of eight
disinfection methods for terminal disinfection of hospital isolation rooms
contaminated with Clostridium difficile 027. J Hosp Infect, 82(2):114-121.
 Doosti., Mokhtari-Farsani. 2014. Study of the frequency of Clostridium difficiletcdA,
tcdB, cdtA and cdtB genes in feces of Calves in south west of Iran. Annals of Clinical
Microbiology and Antimicrobials 13:21.
 Eckert C., Barbut F. 2010. Clostridium-difficile-associated infections. Med Sci (Paris),
26(2):153-158.
 Eckert C., Lalande V., Barbut F. 2015. Colites à Clostridium difficile. Rev Prat; 65 :
21 25.
 Eckert C., Barbut F. 2010. Infections à Clostridium difficile. Médecine/science. Vol.
26, n°2, p. 153-158.
 Eckert C., Lalande V., Barbut F. 2011. Diagnostic des infections à Clostridium
difficile. Journal des Anti-infectieux. Vol. 13, n°2, p. 67-73..2011.03.004.
 Elliott B., Chang BJ., Golledge CL. et al. 2007. Clostridium difficile‐associated
diarrhoea. Intern Med J ;37(8):561‐8.
 Erik R., Dubberke., Curtis J., et al. 2011. Ontemporary Diagnosis and Management of
Clostridium difficile Infection. 1er Ed: Handbooks in Health Care Co. Newtown,
Pennsylvania, USA, Inc. p 49.
 Eyre D. W., M. L. Cule., D. J. Wilson., et al. 2013. Diverse sources of C. difficile
infection identified on whole-genome sequencing. N EnglJ Med 369:1195-205.

40
Références bibliographiques

 Fawley W N., Underwood S., Freeman J., et al. 2007. Efficacy of hospital cleaning
agents and germicides against epidemic Clostridium difficile strains. Infect Control
HospEpidemiol , 28(8):920-925.
 Fekety R. 1997. Guidelines for the diagnosis and management of Clostridium difficile-
associated diarrhea and colitis. American College of Gastroenterology. Practice
Parameters Committee. Am J Gastroenterol. 92:739–50.
 Finney J M. 1893. Gastro-enterostomy for cicatrizing ulcer of the polyrus. John
Hopkins Medical Journal 4,53-5.
 Freeman J., Bauer MP., Baines SD., et al. 2010. The changing epidemiology of
Clostridium difficile infections. ClinMicrobiol Rev. 23:529–549. PubMed: 20610822.
 Gerding D N., Johnson S., Rupnik M., et al. 2014. Clostridium difficile binary toxin CDT
Mechanism, epidemiology, and potential clinical importance. 5(1): 15–27.
 Gerding D N., Olson M M., Peterson LR., et al. 1986. Clostridium difficile-associated
diarrhea and colitis in adults. A prospective case-controlled epidemiologic study. Arch
Intern Med , 146(1):95-100.
 Geric B., S. Johnson., D. N. Gerding., et al. 2003. Frequency of binary toxin genes
among Clostridium difficile strains that do not produce large clostridial toxins. J
ClinMicrobiol 41:5227-32.
 Gomez A. BL., Sonenshein A.L., Sears P., et al. 2011. Fidaxomicininhibits spore
production in Clostridium difficile. Poster in 7th International Conference on the
Molecular Biology and Pathogenesis of the Clostridia ‐ClostPath, Iowa‐USA.
 Gough E., H. Shaikh., A. R. Manges. 2011. Systematic review of intestinal microbiota
transplantation (fecal bacteriotherapy) for recurrent Clostridium difficile infection.
Clin Infect Dis 53:994-1002.
 Guerrero DM., Nerandzic MM., Jury LA., et al. 2012. Acquisition of spores on gloved
hands after contact with the skin of patients with Clostridium difficile infection and
with environmental surfaces in their rooms. Am J Infect Control, 40(6):556-558.
 Gulke I., Pfeifer G., Liese J., et al. 2001. Characterization of the enzymatic component
of the ADP‐ribosyltransferase toxin CDTa from Clostridium difficile. Infect
Immun;69(10):6004‐11.
 Hacek DM., Ogle AM., Fisher A., et al. 2010. Significant impact of terminal room
cleaning with bleach on reducing nosocomial Clostridium difficile. Am J Infect
Control 2010, 38(5):350-353.

41
Références bibliographiques

 Hafiz S., C. L. Oakley. 1976. Clostridium difficile: isolation and characteristics. J Med
Microbiol 9:129-36.
 Hall I., E. O'Toole. 1935. Intestinal flora in newborn infants with a description of a
new pathogenic anaerobe, Bacillus difficilis. Am. J. Dis. Child.49:390–402.
 Hecht G., Pothoulakis C., LaMont JT., et al. 1988. Clostridium diffıcile toxinA
perturbs cytoskeletal structure and tight junction permeability of cultured human
intestinal epithelial monolayers. J Clin Invest;82:1516–24.
 Hedge D. D., J. D. Strain., J. R. Heins., et al. 2008. New advances in the treatment of
Clostridium difficile infection (CDI). TherClin Risk Manag 4:949-64.
 Herpers B.L., Vlaminckx B., Burkhardt et al. 2009. Intravenous tigecycline as
adjunctive or alternative therapy for severe refractory Clostridium difficile infection.
Clin Infect Dis 15; 48(12):1732‐5.
 Hickson, M. 2011. Probiotics in the prevention of antibiotic-associated diarrhoea and
Clostridium difficile infection. TherapAdvGastroenterol 4:185-97.
 Hickson M., A. L. D'Souza., N. Muthu., et al. 2007. Use of probiotic Lactobacillus
preparation to prevent diarrhoea associated with antibiotics: randomised double blind
placebo controlled trial. BMJ 335:80.
 Jacobs A., K. Barnard., R. Fishel., et al. 2001. Extracolonic manifestations of
Clostridium difficile infections. Presentation of 2 cases and review of the literature.
Medicine (Baltimore) 80:88-101.
 Janoir C., Pechine S., Grosdidier C., et al. 2007. Cwp84, a surface-associated protein
of Clostridium difficile, is a cysteine protease with degrading activity on extracellular
matrix proteins. J Bacteriol; 189 : 7174-80.
 Jernigan JA., Siegman-Igra Y., Guerrant RC., et al. 1998. A randomized crossover
study of disposable thermometers for prevention of Clostridium difficile and other
nosocomial infections. Infect Control HospEpidemiol, 19(7):494-499.
 Johnson S., Gerding DN., Olson MM., et al. 1990. Prospective, controlled study of
vinyl glove use to interrupt Clostridium difficile nosocomial transmission. Am J Med,
88(2):137-140.
 Just I., Wilm M., Selzer J., et al. 1995. The enterotoxin from Clostridium diffıcile
monoglycosylates the Rho proteins. J BiolChem 1995;270:13932–6.

42
Références bibliographiques

 Just I. 1998. Costridium diffıcile. In: Rampal P, Boquet P, editors. Recent advances in
the pathogenesis of gastrointestinal bacterial infections. Paris: John LibbeyEurotext. p.
135–42.
 Kaiser E., Kroll C., Ernst K., et al. 2011. Membrane translocation of binary actin‐
ADP‐ribosylating toxins from Clostridium difficile and Clostridium perfringens is
facilitated by cyclophilin A and Hsp90. Infect Immun. 79(10):3913‐21.
 Kallen AJ., Thompson A., Ristaino P., et al. 2009. Complete restriction of
fluoroquinolone use to control an outbreak of Clostridium difficile infection at a
community hospital. InfectControl HospEpidemiol, 30(3):264-272.
 Kelly CP., Pothoulakis C., LaMont JT. 1994. Clostridium difficile colitis. N Engl J
Med, 330:257-262.
 Khanafer N., Vanhems P., Barbut F., et al. 2017. Factors associated with Clostridium
difficile infection: a nested case-control study in a three year prospective cohort.
Anaerobe 44, 117–123.
 Khanna S., D. S. Pardi. 2014. Infection: management strategies for a difficult disease.
TherapAdvGastroenterol 7:72-86.
 Khanna S., D. S. Pardi., S. L. Aronson., et al. 2012. Outcomes in community-acquired
Clostridium difficile infection. Aliment PharmacolTher 35:613-8.
 Khanna S., D. S. Pardi., S. L. Aronson., et al. 2012. The epidemiology of community-
acquired Clostridium difficile infection: a population-based study. Am J Gastroenterol
107:89-95.
 Kohn M., Robin C., Beckerich F., et al. 2015. Infections à Clostridium difficile et
hemopathies : que faut-il savoir ? Hematologie; 21 : 18-27.
 Koulaouzidis A., Tatham R., Moschos J., et al. 2008. Successful treatment of
Clostridium difficile colitis with intravenous immunoglobulin. J Gastrointestin Liver
Dis, 17(3):353-355.
 Kuehne S. A., Cartman S. T., Minton N. P. 2011. Both, toxin A and toxin B, are
important in Clostridium difficile infection. » Gut Microbes .Vol. 2, n°4, p. 252-255.
 Kuehne, S. A., Cartman, S. T., Heap, et al. 2010. The role of toxin A and toxin B in
Clostridium difficile infection. Nature467(7316), 711-713.
 Kuijper E. J., B. Coignard., P. Tull. 2006. Emergence of Clostridium difficile-
associated disease in North America and Europe. ClinMicrobiol Infect 12 Suppl 6:2-
18.

43
Références bibliographiques

 Kyne L., Warny M., Qamar A., et al. 2001. Association between antibody response to
toxin Aand protection against recurrent Clostridium difficile diarrhoea.
357(9251):189-193.
 Kyne L., Warny M., Qamar A., et al. 2000. Asymptomatic carriage of Clostridium
difficile and levels of IgG antibody against toxin A. N Engl J Med, 342(6):390-397.
 Lalande V., Barbut F., Petit J.C. 2004. Diagnostic bactériologique des infections liées
à Clostridium difficile. Revue Française des Laboratoires. n°368, p. 57–63.
 Larson H. E., A. B. Price., P. Honour., et al. 1978. Clostridium difficile and the
aetiology of pseudomembranous colitis. Lancet 1:1063-6.
 Lawley T. D., N. J. Croucher., L. Yu., et al. 2009. Proteomic and genomic
characterization of highly infectious Clostridium difficile 630 spores. J Bacteriol
191:5377-86.
 Loo V.G., Poirier L., Miller M.A., et al. 2005. A predominantly clonal
multiinstitutional outbreak of Clostridium difficile-associated diarrhoea with
highmorbidity and mortality. New England Journal of Medicine 353, 2442–2449.
 Louie TJ., Miller MA., Mullane KM., et al. 2011. Fidaxomicin versus vancomycin for
Clostridium difficile infection. N Engl J Med 2011 Feb 3;364(5):422‐31.
 Lyras D., O’Connor JR., Howarth PM., et al. 2009. Toxin B is essential for virulence
of Clostridium difficile. Nature; 458 : 1176-9.
 McCune V. L., J. K. Struthers., P. M. Hawkey. 2014. Faecal transplantation for the
treatment of Clostridium difficile infection: a review. Int J Antimicrob Agents 43:201-
6.
 McDonald LC., Owings M., Jernigan DB. 2006. Clostridium difficile infection in
patients discharged from US short-stay hospitals, 1996-2003. Emerg Infect Dis,
12(3):409-415.
 McFarland L. V. 2006. Meta-analysis of probiotics for the prevention of antibiotic
associated diarrhea and the treatment of Clostridium difficile disease. Am J
Gastroenterol 101:812-22.
 Merrigan M., Sambol S., Johnson S., et al. 2003. Susceptibility of hamsters to human
pathogenic Clostridium difficile strain B1 following clindamycin, ampicillin or
ceftriaxone administration. Anaerobe 9(2), 91–95.

44
Références bibliographiques

 Merrigan M. M., A. Venugopal., J. L. Roxas., et al. 2013. Surface-layer protein A


(SlpA) is a major contributor to host-cell adherence of Clostridium difficile. PLoS One
8:e78404.
 Mylonakis E., E. T. Ryan., et al. 2001. Clostridium difficile--Associated diarrhea:A
review. Arch Intern Med 161(4): 525-33.
 Nelson R. 2007. Antibiotic treatment for Clostridium difficile‐associated diarrhea in
adults. Cochrane Database Syst Rev (3):CD004610.
 Novack L., Kogan S., Gimpelevich, L., et al. 2014. Acid suppression therapy does not
predispose to Clostridium difficile infection: the case of the potential bias. PLoS One
9:e110790.
 Nylund CM., Goudie A., Garza JM., et al. 2011. Clostridium difficile infection in
hospitalized children in the United States. Arch PediatrAdolesc Med. 165(5):451–7.
 Oughton MT., Loo VG., Dendukuri N., et al. 2009. Hand hygiene with soap and water
is superior to alcohol rub and antiseptic wipes for removal of Clostridium difficile.
Infect Control HospEpidemiol, 30(10):939-944.
 Paltansing S., van den Berg RJ., Guseinova RA. 2007. Characteristics and incidence
of Clostridium difficile-associated disease in The Netherlands. ClinMicrobiol Infect
13: 1058-1064.
 Pantaléon V. 2015. Le biolfilm de Clostridium difficile : Rôle de proteines de surface.
 Pepin J., L. Valiquette., M. E. Alary., et al. 2004. Clostridium difficile-associated
diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of disease
severity. CMAJ 171:466-72.
 Poutanen S.M., Simor AE. 2004. Clostridium difficile-associated diarrhea in adults.
CMAJ, 171(1):51-58.
 Pruitt N.R., lacy .B.D. 2012. Toward a structural understanding of Clostridium
difficile toxins A and B.Frontiers in Cellular and Infection Microbiology,(2):00028
 Rousseau C., F. Levenez C., Fouqueray J., et al. 2011. Clostridium difficile
colonization in early infancy is accompanied by changes in intestinal microbiota
composition. J ClinMicrobiol 49:858-65.
 Rupnik M. 2007. Is Clostridium difficile-associated infection a potentially zoonotic
andfoodborne disease? ClinMicrobiol Infect 13:457-9.
 Rupnik M., Wilcox M. H., Gerding, D. N. 2009. Clostridium difficile infection: new
developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 7(7), 526- 536.

45
Références bibliographiques

 Scott J. R., T. C. Barnett. 2006. Surface proteins of gram-positive bacteria and how
they get there. Annu Rev Microbiol 60:397-423
 Seddon SV., Hemingway I., Borriello SP. 1990. Hydrolytic enzyme production by
Clostridium difficile and its relationship to toxin production and virulence in the
hamster model.J Med Microbiol 31(3):169-74.
 Sethi AK., Al-Nassir WN., Nerandzic MM., et al. 2010. Persistence of skin
contamination and environmental shedding of Clostridium difficile during and after
treatment of C. difficile infection. Infect Control HospEpidemiol, 31(1):21-27.
 Setlow P. 2007. I will survive: DNA protection in bacterial spores. Trends Microbiol
15:172-80.
 Shapey S., Machin K., Levi K., et al. 2008. Activity of a dry mist hydrogen peroxide
system against environmental Clostridium difficile contamination in elderly care
wards. J Hosp Infect, 70(2):136-141.
 Silverman M. S., I. Davis., D. R. Pillai. 2010. Success of self-administered home fecal
transplantation for chronic Clostridium difficile infection. ClinGastroenterolHepatol
8:471-3.
 Sinh P., Barrett TA., Yun L. 2011. Clostridium difficile Infection and Inflammatory
Bowel Disease: A Review. Gastroenterol Res Pract:136064.
 Slimings C., P. Armstrong., W. D. Beckingham., et al. 2014. Increasingincidence of
Clostridium difficile infection, Australia, 2011-2012. Med J Aust 200:272-6.
 Surawicz CM., Brandt LJ., Binion DG., et al. 2013. Guidelines for diagnosis,
treatment, and prevention of Clostridium difficile infections. Am J Gastroenterol,
108(4):478-498; quiz499.
 Tenover F.C., Baron E.J., Peterson L.R., et al. 2011. Laboratory diagnosis of
Clostridium difficile infection can molecular amplification methods move us out
ofuncertainty.Journal of Molecular Diagnostics;13(6),573-82.
 Vaishnavi C. 2010. Clinical spectrum & pathogenesis of Clostridium difficile
associated diseases. 131:487-99.
 Valiente E., M. D. Cairns., B. W. Wren. 2014. The Clostridium difficile PCR ribotype
027 lineage: a pathogen on the move. ClinMicrobiol Infect 20:396-404.
 Van Nood, E., A. Vrieze., M. Nieuwdorp., et al. 2013. Duodenal infusion of donor
feces for recurrent Clostridium difficile. N Engl J Med 368:407-15.

46
Références bibliographiques

 Viscidi R., Willey S., Bartlett JG. 1981. Isolation rates and toxigenic potential of
Clostridium difficile isolates from various patient populations. Gastroenterology.
Jul;81(1):5-9.
 Voth, D. E., and J. D. Ballard. 2005. Clostridium difficile toxins: mechanism of action
and role in disease. Clin. Microbiol. Rev. 18:247-263.
 Wilcox MH., Fawley WN., Wigglesworth N., et al. 2004. Detergent versus
hypochlorite cleaning and Clostridium difficile infection. J Hosp Infect, 56(4):331.
 Yoon S. S., and L. J. Brandt. 2010. Treatment of refractory/recurrent C. difficile-
associated disease by donated stool transplanted via colonoscopy: a case series of 12
patients. J ClinGastroenterol 44:562-6.
 Zar FA., Bakkanagari SR., Moorthi KM., et al. 2007. A camparaison of ancomycin
and metronidazole for the treatment of Clostridium difficile-associated
diarrhea,stratified by desease severity. Clin infection Dis 1:45(3):302-7.

47
Annexes
Annexe 1 : Fiche de renseignements

48
Annexes

Annexe 2 : Données des patients sources des prélèvements de selles pour C. difficile

B : Hay Bensouna, C : Chettia, D : Sidi Bouabida, F : Chorfa.

49