Vous êtes sur la page 1sur 86

PROGRAMA FORMATIVO

Preparación a las
Pruebas de Acceso a la Universidad
para personas mayores de 25 años

Materia de modalidad

Mª Dolores López Pastor


Fernando Tejerina de Fuentes
Florencio Torres Blanco
Victoria Venteo Martínez
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ÍNDICE

ORIENTACIONES GENERALES ..................................................................... 5

PRESENTACIÓN DE LA MATERIA ............................................................................. 7

TEMARIO OFICIAL ……………………………………………………………………….…. 7

OBJETIVOS GENERALES DEL CURSO ..................................................................... 7

CONTENIDOS MÍNIMOS Y REFERENCIAS BIBLIOGRÁFICAS .. .................................. 8

MATERIAL DIDÁCTICO .............................................................................................. 10

FUNCIONAMIENTO DE LAS TUTORÍAS .................................................................... 10

PROGRAMACIÓN DEL CURSO ................................................................................... 11

EVALUACIÓN .............................................................................................................. 12

BLOQUES ………………………………………………………………………. 15
BLOQUE 1.- COMPONENTES QUÍMICOS DE LA CÉLULA……………………….……… 17

BLOQUE 2.- GENÉTICA MOLECULAR ……….…………………………………………… 59

BLOQUE 3.- LA CÉLULA ……………………………………….………………………….. 89

BLOQUE 4.- EL METABOLISMO…………………….…………………………………….. 117

BLOQUE 5.- LA REPRODUCCIÓN CEULAR………………………….…………………… 165

DIRECCIONES WEB DE BIOLOGÍA………………………………………….. 165

PRUEBA DE ACCESO .......................................................................................... 167

INFORMACIÓN SOBRE EL EJERCICIO DE BIOLOGÍA ........................................ 169

EXÁMENES DE LAS UNIVERSIDADES DE VALENCIA ..................................... 171

3
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ORIENTACIONES
GENERALES

PRESENTACIÓN DE LA MATERIA
TEMARIO OFICIAL
OBJETIVOS GENERALES DEL CURSO
CONTENIDOS MÍNIMOS Y REFERENCIAS BIBLIOGRÁFICAS
MATERIAL DIDÁCTICO
FUNCIONAMIENTO DE LAS TUTORÍAS
PROGRAMACIÓN DEL CURSO
EVALUACIÓN

5
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

6
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

PRESENTACIÓN DE LA MATERIA

¿De qué va esta asignatura? La Biología te aporta una base avanzada para la
comprender la estructura y funcionamiento de los seres vivos, para entender, en
definitiva, cómo es la vida, cuáles son las bases de su organización y sus
mecanismos activos, su “lógica”.

Resulta indispensable para realizar estudios universitarios relacionados con la


Biología, Salud, Nutrición. Estudia las moléculas químicas que forman a los seres
vivos (proteínas, ADN,...), la estructura de la célula y su funcionamiento
(fotosíntesis, respiración celular, mitosis, etc.). Incluye también conocimientos
básicos sobre la manipulación genética.

TEMARIO OFICIAL

1.- Componentes Químicos de la Célula.

2.- Genética Molecular.

3.- La Célula. Membranas y Transporte. EL Núcleo

4.- Metabolismo. La Respiración. La Fotosíntesis.

5.- La División celular.

OBJETIVO GENERAL DEL CURSO

El objetivo principal de esta asignatura es contribuir a que el alumnado supere las pruebas
de acceso a la Universidad.

7
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

CONTENIDOS MÍNIMOS Y REFERENCIAS BIBLIOGRÁFICAS

Las referencias bibliográficas (en cursiva) indican los capítulos y apartados del
libro de consulta recomendado (Biología. Editorial Santillana. Segundo de
Bachillerato) donde podrás encontrar los contenidos de cada bloque temático, más
desarrollados que en la guía didáctica.

BLOQUE 1.- COMPONENTES QUÍMICOS DE LA CÉLULA


Contenidos
1.1. Bioelementos y oligoelementos: definición y función.
1.2. El agua y las sales minerales: propiedades y funciones biológicas.
1.3. Los glúcidos: definición, clasificación, estructura general y función biológica.
1.4. Los lípidos: definición, clasificación, estructura general y función biológica.
1.5. Las proteínas: definición, clasificación, estructura y función biológica.
Capítulos 1, 2, 3, 4 y 5.

1.6. Los enzimas como biocatalizadores. Las vitaminas


Capítulo 10 (apartados 2 y 3).

BLOQUE 2. GENÉTICA MOLECULAR


Contenidos
2.1. Los ácidos nucleicos: definición, clasificación, estructura general y función biológica.
Capítulo 6.

2.2. El ADN como portador de la información genética.


2.3. Duplicación (Replicación) del ADN
Capítulo 14 (apartados 1 a 4).

2.4. Concepto de gen


2.5. El código genético
2.6. Transcripción y traducción del mensaje genético.
Capítulo 14 (apartados 5 a 9).

2.7. Alteraciones de la información genética. Mutaciones. Tipos.


2.8. La Ingeniería Genética: sus técnicas y aplicaciones en medicina y en agricultura.
Capítulo 13 (apartados 3 a 4). Capítulo 15 (apartados 1 a 5).
Capítulo 20 (apartados 1 y 5).

(NOTA: Los dos últimos apartados, 2.7 y 2.8, se estudiarán al final del temario,
después del bloque 5).

8
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

BLOQUE 3.LA CÉLULA.


Contenidos
3.1 La célula como unidad de estructura y función. La Teoría Celular
3.2 Métodos de estudio de la célula
3.3 Características de la célula procariótica
3.4 Características de la célula eucariótica: comparación entre célula animal y vegetal
Capítulo 7 (apartados 1 a 3).

3.5. Estructura de la membrana plasmática.


3.6. Intercambios celulares: ósmosis, difusión y transporte activo.
3.7. Aparato de Golgi.
3.8. Retículo endoplásmico.
3.9. Transporte de macromoléculas y digestión celular.
3.10. Otras vesículas de membrana
Capítulo 8. Capítulo 9 (apartados 1 a 9).

3.11 .La mitocondria


3.12. El cloroplasto
3.13. Características del núcleo interfásico
Capítulo 7 (apartados 4 y 5). Capítulo 9 (apartados 10 y 11).

BLOQUE 4.- METABOLISMO. RESPIRACIÓN. FOTOSÍNTESIS.


Contenidos
4.1. Concepto de metabolismo. Catabolismo y anabolismo.
4.2. Organismos autótrofos y heterótrofos.
4.3. El ATP como intercambiador de energía.
4.4. Concepto de respiración celular.
4.5. Significado biológico de la respiración.
4.6. Diferencias entre las vías aerobia y anaerobia.
4.7. Localización intracelular de los procesos respiratorios.
Capítulo 10 (apartados 1 y 4 a 7).

4.8. Concepto de fotosíntesis.


4.9. La fase luminosa y la fase oscura.
4.10. Importancia del proceso fotosintético.
4.11. Localización intracelular de los procesos fotosintéticos.
Capítulo 11.

BLOQUE 5.- LA DIVISIÓN CELULAR


Contenidos
5.1. El ciclo celular. Sus fases
5.3. Características del núcleo en división: Los cromosomas
5.4. División del núcleo: Mitosis
5.5. División del citoplasma: Citocinesis en células animales y vegetales
5.6. La meiosis y su significado biológico
Capítulo 12.

9
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

MATERIAL DIDÁCTICO

Para el seguimiento de esta asignatura necesitarás BÁSICAMENTE esta guía


didáctica.

La guía didáctica. En ella, en cada unidad, encontrarás desarrollado el contenido


a estudiar, destacando los aspectos más importantes, te propondrá actividades y
ejercicios y te ofrecerá indicaciones para organizar temporalmente tu estudio. No
dudes en pedir aclaraciones u orientaciones a tu profesor/a.

El libro de texto. Es conveniente que tengas acceso a un libro de texto de biología


de 2º de Bachillerato (a veces algunas ilustraciones en color te pueden ayudar a
estudiar mejor y las explicaciones serán más extensas y detalladas).

Aunque cualquier libro que contenga el temario oficial de segundo de Bachillerato


puede ser de utilidad, te recomendamos (a nivel de consulta, sin que tengas que
comprarlo) el de la editorial Santillana (autores: Jimeno, Ballesteros, Ugedo y
Madrid). En la biblioteca del CEED encontrarás varios ejemplares de consulta (así
como de otras editoriales).

Además del material didáctico descrito en los apartados anteriores, para favorecer
el aprendizaje autónomo característico de la enseñanza a distancia, al final de la
guía didáctica figura un listado comentado de direcciones de páginas web, en las
que puedes consultar conceptos de Biología, con animaciones y ejercicios
interactivos que te permitirán autoevaluar tu propio aprendizaje.

FUNCIONAMIENTO DE LAS TUTORÍAS

En las Tutorías grupales se tratará la materia correspondiente a los contenidos


conceptuales de cada semana y se corregirán las actividades realizadas por el
alumnado, en especial, los cuestionarios básicos que figuran en el AULA VIRTUAL
de la asignatura.

Las Tutorías individuales se utilizarán también para clarificar las dudas, ayudaros
a los que, por no haber estudiado nunca la materia, presentéis mayor dificultad
para seguir el curso y para atender las consultas de los que no asistís a las tutorías
grupales.

Además, podrás efectuar consultas por teléfono (en el horario de Tutorías


Individuales del profesor) o por correo electrónico y participando en los foros de
dudas y discusión del Aula Virtual.

10
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

DISTRIBUCIÓN TEMPORAL DE LOS CONTENIDOS:

PROGRAMACIÓN DEL CURSO.

Los contenidos están distribuidos en dos evaluaciones, según se detalla a continuación.


Esta distribución es provisional y podrá sufrir cambios dependiendo del calendario oficial
del curso, festividades o imprevistos. En el Aula Virtual de la asignatura se publicará la
distribución definitiva. Conviene que revises con frecuencia el Aula Virtual, donde se
publicarán avisos, noticias e informaciones importantes al largo del curso.

PRIMER CUATRIMESTRE

UNIDADES CONTENIDOS

Composición química de la célula. Bioelementos y


Biomoléculas.
1
Agua y sales minerales.

2 Composición química de la célula. Glúcidos.

3 Composición química de la célula. Lípidos.

4 Composición química de la célula. Prótidos.

Composición química de la célula. Enzimas y Vitaminas.


5

6 Genética Molecular. Ácidos Nucleicos

7 Genética Molecular. Replicación del ADN.

Genética Molecular. Expresión del mensaje Genético.


8
Síntesis de proteínas.

EXAMEN

11
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

SEGUNDO CUATRIMESTRE

UNIDADES CONTENIDOS

La célula. Características generales. Organización celular.


10
Envueltas celulares. Citosol. Citoesqueleto.

11 La célula. Orgánulos celulares.

12 La célula. Orgánulos energéticos y Núcleo celular.

13 Metabolismo. Introducción general.

Metabolismo. Catabolismo (I).


14
Catabolismo (II).

Metabolismo. Anabolismo.
15
Fotosíntesis

La división celular. Ciclo celular.


16
Mitosis.

17 La división celular. La meiosis.

Genética Molecular. Nociones básicas de genética. La


9 variabilidad genética: mutaciones y recombinación.
Ingeniería genética

EXAMEN

EVALUACIÓN
En el curso se realizarán dos pruebas (simulacros de examen), una por
cada cuatrimestre, sin valor académico, pero que pueden servir para que el
alumnado valore sus progresos y sus dificultades frente a la prueba de acceso.

12
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

13
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

14
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

BLOQUES TEMÁTICOS
UNIDADES DIDÀCTICAS

1.- COMPONENTES QUÍMICOS DE LA CÉLULA


U.1. Biolementos y biomoléculas.
U. 2. Glúcidos.
U.3. Lípidos.
U. 4. Prótidos.
U.5. Biocatalizadores.

2.- GENÉTICA MOLECULAR


U. 6. Ácidos Nucleicos.
U.7. Replicación del ADN.
U. 8. Expresión del mensaje genético.
U. 9. Nociones de genética*.

3.- LA CÉLULA
U.10. Características generales.
U. 11. Orgánulos celulares.
U. 12. Orgánulos energéticos y Núcleo

4.- EL METABOLISMO
U.13. El Metabolismo.
U. 14. El Catabolismo.
U. 15. El Anabolismo. La Fotosíntesis.

5.- REPRODUCCIÓN CELULAR


U.16. El Ciclo celular. La Mitosis.
U. 17. La Meiosis.

* (NOTA: La unidad 9 se estudiará al final del temario,


después de la unidad 17.)

15
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

16
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

BLOQUE 1.- COMPONENTES QUÍMICOS


DE LA CÉLULA
UNIDAD 1. BIOELEMENTOS Y BIOMOLÉCULAS
1. Concepto de ser vivo
2 La diversidad de los seres vivos
3. La composición química de los seres vivos: Bioelementos
4. La composición química de los seres vivos: Biomoléculas
5. El agua en los seres vivos.
5.1 Estructura de la molécula de agua.
5.2 Funciones biológicas y propiedades
5.3 Disociación del agua y concepto de pH
6. Las sales minerales: propiedades y funciones

UNIDAD 2. LOS GLÚCIDOS


1. Concepto de glúcido
2. Clasificación y estructura
2.1. Monosacáridos
2.2. Disacáridos
2.3. Polisacáridos
3. Funciones biológicas

UNIDAD 3. LOS LÍPIDOS


1. Concepto de Lípido
2. Clasificación y estructura
2.1. Ácidos grasos
2.2. Acilglicéridos
2.3. Ceras
2.4. Fosfolípidos
2.5. Glucolípidos
2.6. Terpernos
2.7. Esteroides
2.8. Prostaglandinas
3. Funciones biológicas

UNIDAD 4. LOS PROTÍDOS


1. Concepto y propiedades
2. Los aminoácidos y los péptidos
3. Estructura de las proteínas
4. Clasificación
5. Funciones biológicas

UNIDAD 5. BIOCATALIZADORES: ENZIMAS y VITAMINAS


1.- Función de los enzimas
2.- Inhibición enzimática
3.- Clasificación de los enzimas
4.- Las Vitaminas

17
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 1. BIOELEMENTOS Y BIOMOLÉCULAS

1.- CONCEPTO DE SER VIVO

¿Qué diferencia a un ser vivo de la materia inerte? Todos los seres vivos tienen una
organización común que les permite realizar las funciones vitales: nutrición, relación y reproducción.
(Excepciones: virus, viroides y priones).

a) Organización y
Complejidad.

Los seres vivos muestran


un alto grado de organización y
complejidad. La vida se
estructura en niveles
jerárquicos de organización,
donde cada uno se basa en el
nivel previo y constituye el
fundamento del siguiente
nivel, por ejemplo: los
organismos multicelulares
están constituidos por tejidos,
los tejidos están formados por
células, las células integradas
por orgánulos, etc.

Aunque cada nivel está


integrado por elementos del nivel inferior, sus propiedades no son solo la suma de las propiedades de
los elementos del nivel inferior sino que aparecen características nuevas. Por ejemplo, una célula es
capaz de realizar unas funciones (nutrición, relación y reproducción) que no pueden realizar las
macromoléculas que la integran.

18
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

b) Funciones vitales:

 Nutrición
La función de nutrición incluye aquellos procesos que permiten a los seres vivos mantener su
elevado grado de complejidad y organización.
Los organismos necesitan tomar del exterior materiales y energía. Los materiales necesarios
los toman del aire, del agua, del suelo y de otros organismos.
El metabolismo es el conjunto de procesos químicos por los que los organismos utilizan la
materia que han incorporado y que permiten su crecimiento, conservación y reparación. Los desechos
producidos en el metabolismo se eliminan al exterior.
Las estructuras organizadas y complejas no se mantienen fácilmente, existe una tendencia
natural a la pérdida del orden denominada entropía. Para mantenerse vivos y funcionar
correctamente los organismos vivos deben mantener la constancia del medio interno de su cuerpo,
proceso denominado homeostasis (del griego "permanecer sin cambio"). Entre las condiciones que se
deben regular se encuentra: la temperatura corporal, el pH , el contenido de agua, la concentración
de electrolitos etc. Gran parte de la energía de un ser vivo se destina a mantener el medio interno
dentro de límites homeostáticos.

 Relación = Sensibilidad
Los seres vivos son capaces de detectar y responder a los estímulos, que son los cambios
físicos y químicos del medio ambiente, ya sea interno o externo. Los estímulos ambientales pueden
ser la luz, la presión, la temperatura o la composición química.

En organismos sencillos o unicelulares, todo el individuo responde al estímulo, en tanto que en


los organismos complejos pluricelulares existen células especializadas que se encargan de detectar
determinados estímulos.

 Reproducción y herencia
Los seres vivos no se originan de forma espontánea; solo pueden proceder de otros seres vivos
por un proceso de reproducción, ya sea asexual (con formación de individuos idénticos) o sexual (con
formación de individuos diferentes al combinarse la información genética de los dos progenitores).
El proceso de reproducción implica la transferencia de información genética (herencia) de una
generación a la siguiente. Los seres vivos poseen esa información en forma de ADN (excepciones
como los retrovirus poseen ARN).
La herencia del material genético permite mantener las características propias de cada
especie, pero también permite la variabilidad o aparición de individuos distintos (por mutaciones y
combinaciones nuevas) lo que es la base de la evolución biológica.
Estas variaciones han producido a lo largo de la historia de la vida (unos 3.500 millones de
años), una gran cantidad de formas de vida diferentes que se han ido sucediendo a lo largo del
tiempo.

Podemos resumir las características de la vida en dos conceptos: unidad y diversidad. Unidad
de estructura (molecular y celular) y de función de todos los seres vivos. Y diversidad de formas
diferentes.
Entendemos por biodiversidad a la diversidad genética que se produce tanto entre diferentes
especies como en individuos de una misma especie.

19
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2.- LA DIVERSIDAD DE LOS SERES VIVOS

Concepto de especie: conjunto de poblaciones que pueden cruzarse entre ellas dando lugar a
una descendencia fértil, y que están aisladas reproductivamente de otras poblaciones.

Si estudiamos la biodiversidad de seres vivos que habitan, o habitaron, el planeta podemos


hacer agrupaciones con especies que tienen características comunes.
En la actualidad todos los seres vivos se clasifican en cinco grandes grupos o Reinos:
 Reino MONERAS: Organismos procariotas (Bacterias y algas cianofíceas).
 Reino PROTOCTISTAS: Organismos eucariotas unicelulares o multicelulares sin tejidos
diferenciados. (Algas y protozoos).
 Reino METAFITAS (Vegetales): Organismos eucariotas pluricelulares (con tejidos
diferenciados). Nutrición autótrofa. (Plantas).
 Reino METAZOOS (Animales): Organismos eucariotas pluricelulares (con tejidos
diferenciados). Nutrición heterótrofa. (Animales).
 Reino HONGOS (Fungi): Organismos eucariotas unicelulares o multicelulares. Nutrición
heterótrofa (saprofitos). (Mohos, setas, líquenes, levaduras).

Ver en la Unidad 2 las diferencias entre la organización celular procariota y eucariota, y en la


Unidad 4 los conceptos de nutrición autótrofa y heterótrofa.

20
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

3.- LA COMPOSICIÓN QUÍMICA DE LOS SERES VIVOS: BIOELEMENTOS

Los átomos que forman parte de los seres vivos se llaman bioelementos.

Atendiendo a su abundancia se pueden clasificar en:

% en la
Bioelementos Átomos
materia viva
Primarios 96% C, H, O, N, P, S
Secundarios 3,9% Ca, Na, K, Cl, I, Mg, Fe
Oligoelementos 0,1% Cu, Zn, Mn, Co, Mo, Ni, Si...

a) Bioelementos primarios, que aparecen en una proporción media del 96% en los seres vivos, y
son carbono, oxigeno, hidrógeno, nitrógeno, fósforo y azufre. Son los elementos químicos que forman
las biomoléculas. Estos elementos reúnen una serie de propiedades que los hacen adecuados para la
vida.
La mayor parte de las moléculas que componen los seres vivos tienen átomos de carbono. Este
elemento presenta las siguientes propiedades:

1. Forma enlaces covalentes, que son estables y acumulan mucha energía.


2. Puede formar enlaces, hasta con cuatro elementos distintos.
3. Puede formar enlaces sencillos, dobles o triples.
4. Se puede unir a otros carbonos, formando largas cadenas.
5. Los compuestos, siendo estables, a la vez, pueden ser transformados por reacciones
químicas.

Estas características del


carbono, permiten formar un
número infinito de moléculas
distintas.

b) Bioelementos secundarios, aparecen en una proporción próxima al 3,3%. Son: calcio, sodio,
potasio, magnesio y cloro, desempeñando funciones de vital importancia en fisiología celular.

c) Oligoelementos, micro constituyentes, o elementos vestigiales, que aparecen en los seres


vivos en proporción inferior al 0,1% siendo también esenciales para la vida: hierro, manganeso, cobre,
zinc, flúor, yodo, boro, silicio, vanadio, cobalto, selenio, molibdeno y estaño. Aún participando en
pequeñas cantidades su carencia puede acarrear graves trastornos para los organismos.

(NOTA: En otros libros de texto los oligoelementos se consideran un grupo dentro de los
bioelementos secundarios. Los oligoelementos serían aquellos bioelementos secundarios que no se
presentan en todos los seres vivos, sino sólo en algunos).

21
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4.- LA COMPOSICIÓN QUÍMICA DE LOS SERES VIVOS: BIOMOLÉCULAS

Los bioelementos se unen unos con otros mediante enlaces químicos formando las biomoléculas
o principios inmediatos. Existen dos tipos principales de enlaces:

Enlace iónico. Se
establece por la
atracción de dos iones
de cargas opuestas: un
catión (+) y un anión (-).
Ej. Na+ Cl-.
Enlace covalente:
Los dos átomos que
intervienen en el enlace
comparten los
electrones, sin perderlos
ni ganarlos. Ej. CH4.

Las biomoléculas pueden


ser inorgánicas (agua y sales minerales) y orgánicas (glúcidos, lípidos, proteínas y ácidos
nucleicos).
En las moléculas orgánicas el carbono se combina con el mismo, y con los otros bioelementos
primarios mediante enlaces covalentes. Existen diferentes tipos de representación de las fórmulas
químicas de las moléculas orgánicas:

En las fórmulas anteriores el carbono aparece combinado con Hidrógeno. Los cuatro enlaces
posibles del carbono pueden estar sustituidos por otro carbono, por hidrógeno, oxígeno y nitrógeno.
Los principales grupos funcionales de las biomoléculas son los siguientes:

22
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

 Monómeros y polímeros. Moléculas y macromoléculas

Muchas biomoléculas, como los polisacáridos, las proteínas y los ácidos nucleicos son polímeros.
Se denomina polímero a toda macromolécula constituida por la unión de muchas moléculas pequeñas
similares, que reciben el nombre de monómeros. Cuando dos monómeros similares se unen forman un
dímero, si son tres un trímero, etc.

Monómeros
La formación de polímeros tiene la
ventaja de poder formar infinidad de
macromoléculas diferentes con solo unos pocos
monómeros, combinándolos de distinta forma.

Polimerización Hidrólisis
El proceso de unión de monómeros o
H2O H2O polimerización se realiza por deshidratación.
Todos los monómeros sueltos tienen átomos de
H y grupos oxidrilos (-OH). Al unirse se
desprende una molécula de agua por cada
enlace formado.
Polímero

El proceso inverso se denomina hidrólisis, hidro = agua, lisis =rotura.

Observa los siguientes ejemplos de reacciones de polimerización e hidrólisis. Las flechas


señalan los enlaces que se forman en la polimerización y que se rompen en la hidrólisis.

a) Formación de polisacáridos a partir de monosacáridos:

Polimerización

n Hidrólisis
glucosa
almidón

23
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

b) Formación de proteínas a partir de aminoácidos:

aminoácido

Polimerización Hidrólisis

Proproteín
proteína
ateína

c) Formación de ácidos nucleicos a partir de nucleótidos:

Polimerización

n Hidrólisis

Nucleótido

Ac. nucleico

24
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. ¿Qué propiedades tiene el nivel pluricelular que no tiene el nivel celular? ¿qué
propiedades tiene el nivel de poblaciones que no tiene el nivel pluricelular ni el celular?
2. Di algún ejemplo de detección de estímulos ambientales en los seres humanos, en un
árbol y en una bacteria.
3. Observa el árbol evolutivo de los seres vivos ¿porqué la representación tiene forma de
árbol? ¿qué organismos son los más antiguos? ¿qué tipo de organismos es el más próximo
evolutivamente a las aves?
4. ¿Qué monómeros forman las proteínas? ¿y el almidón? ¿qué polímeros se obtienen por la
unión de nucleótidos?
5. Escribe la fórmula molecular y reconoce los grupos funcionales de las siguientes
moléculas:

(A)

(B) (C)

(D)

25
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

5.- EL AGUA EN LOS SERES VIVOS

El agua es la molécula más abundante en los seres vivos. Por ejemplo, en las medusas (96%), en
caracoles (80%), en persona adulta (65 %). En un mismo organismo la cantidad de agua varía según el
órgano o tejido de que se trate; cuanto más activo es, más cantidad de agua contiene. Por ejemplo,
en el cerebro (85 %), en el tejido adiposo (15 %) y en los huesos (25%).

5.1. ESTRUCTURA DE LA MOLÉCULA DE AGUA


El que el agua sea la molécula más abundante en los seres vivos se debe a sus funciones
biológicas que derivan de sus propiedades físico-químicas.
Estas propiedades se deben a la estructura molecular del
agua. En una molécula de agua hay un átomo de oxígeno unido a
dos átomos de hidrógeno por enlaces covalentes. Como el oxígeno
es más electronegativo que el hidrógeno, atrae con más fuerza los
electrones compartidos. Esto hace que, aunque la carga neta sea
cero, la molécula de agua sea polar con una pequeña densidad de
carga negativa en el oxígeno y una densidad de carga positiva en
el hidrógeno, formando un dipolo permanente.
Este carácter polar del agua es responsable de la mayoría de
sus propiedades, y permite que se produzcan interacciones
electrostáticas, llamadas puentes o enlaces de hidrógeno, con otras
moléculas polares y con iones.

El átomo de oxígeno (σ ) puede ser atraído por átomos de


-

hidrógeno (σ ) de otras moléculas de agua para formar enlaces por


+

puentes de hidrógeno. Estos puentes de hidrógeno entre las


diferentes moléculas de agua son los que permiten que el agua sea
líquida en un intervalo de temperatura muy amplio (0° a 100° C). Cada
molécula de agua puede unirse por puentes de hidrógeno a otras 4
moléculas en disposición tetraédrica

5.2. FUNCIONES BIOLÓGICAS Y PROPIEDADES

1) Principal disolvente biológico.


Esta propiedad del agua hace que las sales y otros compuestos iónicos se disocien en sus
cationes y aniones. Asimismo, el agua disuelve con facilidad otros compuestos no iónicos, pero que
poseen grupos funcionales polares (alcoholes, aldehídos, cetonas, etc.) al establecer enlaces de H
entre ellos.
A su vez, esta capacidad es responsable de dos funciones del agua en los seres vivos:
a) es vehículo de transporte para la circulación de sustancias en el interior de los organismos
y en su intercambio con el exterior.
b) es el medio donde transcurren las reacciones bioquímicas, ya que la mayor parte de las
biomoléculas se encuentra disuelta en ella y necesita un medio acuoso para interaccionar.

26
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2) Regulador térmico
El agua puede absorber una gran cantidad de calor, mientras que su temperatura sólo asciende
ligeramente, ya que parte de esa energía habrá sido utilizada en romper los enlaces de H. Esta
propiedad hace del agua un buen amortiguador térmico que regula la temperatura interna de los
seres vivos a pesar de las variaciones externas.

3) Mayor densidad en estado líquido que sólido


Por ello el hielo flota sobre el agua, evitando la congelación de zonas profundas de mares y
lagos, y permitiendo el desarrollo de la vida bajo la superficie helada.

5.3. DISOCIACIÓN DEL AGUA Y CONCEPTO DE pH

En el agua líquida, además de las moléculas de agua (aisladas o agrupadas), existe una cierta
proporción de moléculas disociadas en sus iones:

H 2O H+ + OH-
Hay que advertir que en el agua no existen protones (H+) libres o aislados, sino hidratados, en
forma de iones hidronio (H3O+), aunque por conveniencia se utilice el símbolo H + para abreviar. Es
decir, sería más correcto escribir:

2 H 2O H3O+ + OH-
El pH es un indicador de los valores de acidez o basicidad de una disolución y viene
determinado por la concentración de H+ en la misma.
Se mide en una escala que va de 0 a 14:
pH = 7  neutralidad: [H+] = [OH-]
pH 7  basicidad: baja [H+]
pH 7  acidez: alta [H+]

6.- LAS SALES MINERALES

La función que desempeñan las sales en un organismo depende del estado físico en que se
encuentran. Según ello, hablamos de:

1. SALES PRECIPITADAS
Cristalizadas, insolubles en agua: Forman estructuras sólidas, que suelen tener función de
sostén o protectora, como el esqueleto interno de vertebrados, en el que encontramos: fosfatos,
cloruros y carbonatos de calcio; caparazones de carbonato cálcico de crustáceos y moluscos;
endurecimiento de células vegetales, como en gramíneas (impregnación con sílice); otolitos del oído
interno, formados por cristales de carbonato cálcico (equilibrio).

27
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2. SALES SOLUBLES EN AGUA.


Se encuentran disociadas en sus iones (cationes y aniones) que se encuentran en el medio
interno y externo de la célula.
Desempeñan funciones específicas (ej. El Ca+2 es necesario para la contracción muscular y la
coagulación sanguínea; el Na+, K+ y Cl- para la transmisión del impulso nervioso, etc.) y funciones
reguladoras.
a) aniones: Cl- , PO4-3 , CO3= , HCO3-
b) cationes: Na+, Ca+2, Mg+2, Fe+2

Se llama homeostasis al mantenimiento constante de las propiedades del medio interno. Las
sales disociadas son parcialmente responsables de este proceso, ya que controlan el pH y
contribuyen a regulan la presión osmótica de dicho medio, es decir, tienen una función homeostática.

a) Función tamponadora o amortiguadora del pH. Se lleva a cabo por los sistemas carbonato-
bicarbonato, y también por el monofosfato-bifosfato.
El pH debe mantenerse más o menos constante y próximo a la neutralidad (excepto en algunos
casos como la piel o el estómago que tienen un pH ácido), con el objetivo de preservar la estabilidad
de la materia viva y permitir la correcta actividad de las enzimas.
Sin embargo, en el metabolismo se producen continuamente sustancias que alteran ese pH y,
para neutralizar esas oscilaciones, los seres vivos han desarrollado a lo largo de la evolución los
llamados sistemas amortiguadores, cuya finalidad es mantener el pH constante mediante mecanismos
reguladores.
Estos sistemas, también llamados tampón, consisten en un par de sustancias, un ácido débil y
una sal de ese ácido, que actúan como dador y aceptor de H+ respectivamente.
Uno de los más importantes y conocidos sistemas tampón es el constituido por el H 2CO3 ácido
carbónico) y el HCO3- (bicarbonato).

Si, por ejemplo, en el medio se produce un incremento de la acidez (aumento de la [H +] ), los H+


excedentes son neutralizados por el ión bicarbonato HCO3- para formar H2CO3 que, eventualmente,
se disocia dando H2O y CO2 (sustancias que no modifican el pH).

b) Regulación osmótica. Intervienen en los procesos relacionados con la distribución de agua


entre el interior celular y el medio donde vive esa célula. Hay que tener en cuenta que la
concentración del medio intracelular está determinada, no sólo por las sales, sino también por las
macromoléculas orgánicas en disolución.
En las células vivas, las membranas se pueden comportar como semipermeables (dejan pasar el
agua, pero no el soluto), separando dos disoluciones o medios: el extracelular y el intracelular. Se
llama osmosis a la difusión pasiva del agua a través de la membrana celular desde el medio más
diluido hacia el más concentrado (Ver Unidad 11, apartado 2: Membranas y transporte).

28
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. Haz un dibujo de la estructura de la molécula de agua. ¿Cómo se forman los puentes


de hidrógeno?
2. Explica las funciones biológicas del agua derivadas de su carácter polar.
3. ¿Qué funciones realizan las sales minerales en estado sólido? Di algún ejemplo.
4. ¿Qué es la homeostasis?
5. Indica dos sustancias o dos disoluciones que tengan pH neutro, pH ácido y pH básico.
6. ¿Por qué tomamos bicarbonato cuando tenemos acidez de estómago?
7. ¿En qué consiste la regulación osmótica?

29
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 2. LOS GLÚCIDOS

1.- CONCEPTO DE GLÚCIDO

Los glúcidos son biomoléculas formadas por carbono (C), hidrógeno (H) y oxígeno (O) en una
proporción aproximada de CnH2nOn. Por lo que también se les llama carbohidratos o hidratos de
carbono. El nombre procede del griego glycos que significa dulce, por lo que también se les llamaba
azúcares,

2.- CLASIFICACIÓN Y ESTRUCTURA

La clasificación más sencilla establece tres grupos en función del número de unidades que lo
forman:
Monosacáridos: son los monómeros que integran los glúcidos. Los más sencillos. No son
hidrolizables.
Oligosacáridos: son glúcidos formados por la unión de unas pocas unidades de monosacáridos.
Los más comunes son los disacáridos. Son hidrolizables.
Polisacáridos: polímeros formados por la unión de muchos monosacáridos. Son hidrolizables.

2.1. MONOSACÁRIDOS

Son moléculas formadas por cadenas de 3 a 7 átomos de carbono (triosas, tetrosas, pentosas,
hexosas y heptosas.).
Son cristalizables, de color blanco, sabor dulce, solubles en agua, poco solubles en alcohol,
insolubles en los disolventes orgánicos y no hidrolizables. También tienen carácter reductor, es
decir, capacidad de oxidar su grupo funcional, reduciendo a otros compuestos.
En los glúcidos los átomos de carbono están unidos a grupos alcohólicos (-OH), llamados
también radicales hidroxilo y a radicales hidrógeno (-H). Son por tanto polialcoholes.
En todos los glúcidos siempre hay un grupo carbonilo, es decir, un carbono unido a un oxígeno
mediante un doble enlace (C=O). El grupo carbonilo puede ser un grupo aldehído(-CHO) situado en el
carbono 1, o un grupo cetónico (-CO-) situado en el carbono 2. Así pues, los glúcidos pueden definirse
como polihidroxialdehídos o polihidroxicetonas.

Ejemplos de monosacáridos:

Eritrosa

Las triosas son abundantes en el interior de la célula, ya que son metabolitos


intermediarios de la degradación de la glucosa.

30
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Las pentosas, son glúcidos de 5 carbonos y entre ellos se encuentran la ribosa y la


desoxirribosa, que forman parte de los ácidos nucleicos (ARN y ADN respectivamente) y la
ribulosa que desempeña un importante papel en la fotosíntesis.
Las hexosas son glúcidos con 6 átomos de carbono. Entre ellas tienen interés en biología,
la glucosa y galactosa entre las aldohexosas y la fructosa entre las cetohexosas.
La glucosa es el glúcido más abundante, llamado azúcar de uva; en la sangre se encuentra en
concentraciones de un gramo por litro. Al polimerizarse da lugar a polisacáridos con función
energética (almidón y glucógeno) o con función estructural, como la celulosa de las plantas.
Constituye la base del metabolismo energético, ya que todos los seres vivos son capaces de
metabolizar la glucosa. En nuestro organismo hay células (hematíes y neuronas), que obtienen energía
sólo de la glucosa.

En disolución acuosa, algunos monosacáridos se cierran formando unos anillos pentagonales


(cetohexosas y aldopentosas) o hexagonales (aldohexosas).

Estas fórmulas representan a la glucosa en su forma lineal y cíclica. En este caso el anillo
formado tiene 6 lados. Al cerrarse la molécula, el grupo -OH del carbono 1, puede ocupar dos
posiciones, respecto al grupo -CH2OH del C5. Son dos isómeros denominados alfa y beta.

Ribosa Ribosa
(forma abierta) (forma cerrada)

La ribosa y la desoxirribosa son dos pentosas que sólo se diferencian en el carbono dos: la
desoxirribosa tiene un H en el carbono 2 en lugar de un grupo OH. Al cerrarse forman anillos
pentagonales. Unidas a otras moléculas forman los nucleótidos, monómeros con los que se construyen
los ácidos nucleicos.

31
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2.2. DISACÁRIDOS

Se forman por la unión de dos monosacáridos.


La unión se realiza por un enlace O-glucosídico que se establece por reacción entre el grupo
hidroxilo de uno de los monosacáridos, con un radical hidroxilo del otro. Se forma una molécula de
agua.

Los disacáridos son hidrolizables dando lugar a monosacáridos. Son solubles en agua, tienen
sabor dulce y carácter reductor (excepto la sacarosa).
Los principales disacáridos son:

La lactosa está formada por una molécula de glucosa y una de galactosa. Se encuentra en la
leche de los mamíferos.

La celobiosa no se encuentra libre en la naturaleza. Se obtiene por hidrólisis de la celulosa.


Está formada por dos moléculas de glucosa.

La maltosa está formada por la unión de dos moléculas de glucosa. Se encuentra libre en la
malta de cebada. Se obtiene por la hidrólisis del almidón y el glucógeno.

La sacarosa se forma por la unión de glucosa y fructosa. Es el azúcar común. Se encuentra en


la caña de azúcar y en la remolacha.

32
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2.3. POLISACÁRIDOS

Los polisacáridos están formados por la unión de muchos monosacáridos (puede variar entre 11
y varios miles), mediante enlace O-glucosídico, con pérdida de una molécula de agua por cada enlace.

(Monosacáridos)n Polisacárido + n-1 (H20)

Son polímeros de elevado peso molecular, son insolubles en agua o forman dispersiones
coloidales; no poseen poder reductor y pueden desempeñar funciones de reserva energética o
función estructural. Los principales polisacáridos son:

ALMIDÓN. Es el polisacárido de reserva energética de los vegetales. Formado por la unión de


miles de moléculas de glucosa. Se acumula en forma de granos sobre todo en las semillas y en los
tubérculos. Constituye la fuente más importante de carbohidratos de los alimentos y se encuentra
en cereales, patatas, legumbres y otros vegetales. Su hidrólisis la realiza el enzima amilasa que se
encuentra en la saliva y en el jugo pancreático. Está formado por dos tipos de polímeros:

 Amilosa, (15-20%)
formada por alrededor
de 250 moléculas de
glucosa que forman
cadenas lineales y
helicoidales sin
ramificar.
 Amilopectina, (80-
85%) formada también
por largas cadenas con
ramificaciones.

GLUCÓGENO. Es el polisacárido de reserva energética de los animales. Se acumula en el hígado y


en las células musculares. Está formado por miles de moléculas de glucosa que forman cadenas
ramificadas similares a la amilopectina. El glucógeno acumulado en el hígado se hidroliza poco a poco
y la glucosa obtenida va pasando a la sangre para ser distribuida a todo el organismo.

CELULOSA. Es un
polisacárido vegetal con
función estructural, al ser el
constituyente principal de las
paredes celulares de las
células vegetales. Es un
polímero de glucosa (forma
beta). Esta ligera diferencia
hace que no podamos
hidrolizar la celulosa. Sólo lo
hacen algunos organismos que
poseen un enzima (celulasa),
como por ejemplo algunos
microorganismos que viven en simbiosis en el estómago de los rumiantes o en el de las termitas.

33
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Constituye cadenas lineales sin ramificar, que se disponen paralelas en un mismo plano,
uniéndose unas con otras mediante enlaces de H y originando un conjunto de fibras más o menos
gruesas muy resistentes. Probablemente es la molécula orgánica más abundante de la naturaleza.

QUITINA. Es un tipo de polisacárido de gran importancia estructural en los invertebrados. Se


puede encontrar en los exoesqueletos de los artrópodos. También forma las paredes celulares de los
hongos. Es un polímero de un derivado de la glucosa.

3.- FUNCIONES BIOLÓGICAS

1) ENERGÉTICA:
Son los principales combustibles que utilizan las células para obtener energía. Esta energía es
liberada tras los procesos metabólicos de oxidación (en la respiración celular) y es necesaria para
mantener las actividades vitales de las células.
Los Hidratos de Carbono (HC) representan en el organismo el combustible de uso inmediato. La
combustión de 1g de HC produce unas 4 Kcal. Los HC son compuestos con un grado de reducción
suficiente como para ser buenos combustibles, y además, la presencia de funciones oxigenadas
(carbonilos y alcoholes) permiten que interaccionen con el agua más fácilmente que otras moléculas
combustible como pueden ser las grasas. Por este motivo se utilizan las grasas como fuente
energética de uso diferido y los HC como combustibles de uso inmediato.

2) RESERVA ENERGÉTICA:
Los seres vivos necesitan tener reservas energéticas para no tener que estar alimentándose
continuamente. El almidón (en las plantas) y el glucógeno (en los animales) representan la forma de
almacenar la energía de la glucosa.

3) ESTRUCTURAL:
Hay glúcidos que intervienen en la conformación de determinadas estructuras celulares como
las membranas, o la pared celular de los vegetales, formada por celulosa. Otros son constituyentes
vitales de algunas moléculas esenciales (ácidos nucleicos).
También realizan otras funciones estructurales como por ejemplo el exoesqueleto de los
artrópodos que está formado por el polisacárido quitina o la matriz extracelular de los tejidos
animales de sostén (conjuntivo, óseo, cartilaginoso) está constituida por polisacáridos nitrogenados
entre otros componentes.

34
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. Escribe la fórmula empírica y desarrollada de una cetopentosa y una aldotriosa.


Indica en la fórmula los grupos funcionales.
2. ¿Cómo se forman los disacáridos y polisacáridos?
3. ¿Qué glúcidos son hidrolizables? ¿por qué? ¿qué se obtiene al hidrolizarlos?
4. El pan es un alimento rico en almidón ¿qué le ocurre al almidón cuando comemos pan?
5. Si no podemos utilizar la celulosa (fibra vegetal) como nutriente ¿Por qué es tan
importante a nivel dietético?
6. Completa la siguiente tabla:

Molécula Composición Estructura Función

Celulosa

Lactosa

Almidón

Desoxirribosa

Glucosa

Glucógeno

35
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 3. LOS LÍPIDOS

1. CONCEPTO DE LÍPIDO

Los lípidos son biomoléculas orgánicas formadas básicamente por carbono e hidrógeno y
generalmente también oxígeno; pero en porcentajes mucho más bajos. Además pueden contener
también fósforo, nitrógeno y azufre.
Se trata de un grupo de biomoléculas con estructuras muy diversas y funciones diferentes.
Todos los lípidos tienen en común la naturaleza hidrocarbonada de gran parte de su molécula, lo que
les hace insolubles en agua, pero solubles en disolventes orgánicos no polares (benceno, alcohol, éter,
cloroformo, etc.).

2. CLASIFICACIÓN Y ESTRUCTURA

Los lípidos se clasifican en dos grupos, atendiendo a que posean en su composición ácidos
grasos (Lípidos saponificables) o no lo posean (Lípidos insaponificables).

1. Lípidos saponificables
A. Simples
1. Acilglicéridos
2. Céridos
B. Complejos
1. Fosfolípidos
2. Glucolípidos
2. Lípidos insaponificables
A. Terpenos
B. Esteroides
C. Prostaglandinas

2.1. ÁCIDOS GRASOS


Los ácidos grasos son moléculas formadas por una larga cadena hidrocarbonada de tipo lineal, y
con un número par de átomos de carbono (de 12 a 22). Tienen en un extremo de la cadena un grupo
carboxilo (-COOH).
Apenas se encuentran libres, pero aparecen en grandes cantidades en las células como
componentes de los lípidos saponificables y se obtienen por hidrólisis de éstos.

Se conocen unos 70 ácidos grasos que se pueden clasificar en dos grupos:


Los ácidos grasos saturados sólo tienen enlaces simples entre los átomos de carbono. Son
ejemplos de este tipo de ácidos el palmítico de 16 carbonos (CH 3 - (CH2)14 – COOH) y el
esteárico de 18 carbonos (CH3 - (CH2)16 – COOH).

36
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Los ácidos grasos insaturados tienen uno o varios enlaces dobles en su cadena y sus
moléculas presentan codos, con cambios de dirección en los lugares dónde aparece un doble
enlace. Son ejemplos el oleico (CH3 - (CH2)7 – CH = CH- (CH2)7 - COOH) y el linoleico (18C y
dos dobles enlaces).

Propiedades de los ácidos grasos

 Carácter anfipático:

Los ácidos grasos poseen en su molécula dos zonas diferentes:


a) Zona polar: corresponde al grupo carboxilo, que puede formar enlaces de H con otras
moléculas polares, como el agua.
b) Zona apolar: corresponde a la cadena
hidrocarbonada, fuertemente hidrófoba.
El gran tamaño de la cadena alifática hidrófoba,
es responsable de la insolubilidad en agua de estas
moléculas que, en un medio acuoso, tienden a disponerse
en forma de lámina superficial o en micelas (mono o
bicapa), en las que las zonas polares (hidrófilas)
establecerán enlaces de H con moléculas de agua,
mientras que las zonas apolares (hidrófobas)
permanecerán alejadas de éstas.

37
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

 Punto de fusión:
Depende de la longitud de la cadena y del número de insaturación de ésta. Los ácidos grasos
saturados (más abundantes en los animales) presentan puntos de fusión más altos que los
insaturados (más abundantes en los vegetales), por lo que a temperatura ambiente los primeros son
sólidos y los segundos líquidos.

 Esterificación:
Los ácidos grasos pueden formar enlaces éster con grupos alcohol (-OH) de otras moléculas.

R-COOH + OH-R'  R-COO-R' + H2O

2.2. ACILGLICÉRIDOS
Son lípidos simples formados por la esterificación de una, dos o tres moléculas de ácidos
grasos con una molécula de glicerina. También reciben el nombre de glicéridos o grasas simples. Los
más comunes son los triglicéridos formados por la esterificación de tres moléculas de ácidos grasos.

Los triacilglicéridos son los lípidos más abundantes, y constituyen las principales reservas
energéticas ya que su rendimiento (9'4 kcal/gr.) es mucho mayor que el de los glúcidos (4'1 kcal/gr.).
Son más abundantes en los animales que en los vegetales.

Los triacilglicéridos que a temperatura ambiente son líquidos se conocen como aceites y se
encuentran sobre todo en vegetales; los que son sólidos se llaman grasas y son propios de la mayoría
de animales.

Por hidrólisis alcalina dan lugar a jabón (sal del ácido graso). Esta reacción se denomina
saponificación.

38
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2.3. CERAS
Son ésteres de ácidos grasos de cadena larga con monoalcoholes de elevado peso molecular.
Las dos zonas de la molécula son hidrófobas, por lo que su característica básica es la
insolubilidad en agua, y de ahí su principal función: actuar como impermeabilizantes.
Las ceras forman cubiertas protectoras de la piel, el pelo, las plumas en los animales, y de las
hojas y los frutos de los vegetales superiores.
Una de las ceras más conocidas es la que segregan las abejas para confeccionar su panal.

2.4. FOSFOLÍPIDOS
Son los principales constituyentes de las membranas biológicas. Están formados por la
esterificación de una molécula de glicerina, dos ácidos grasos y una molécula de ácido fosfórico al
que llevan unida otra molécula también polar. Esto hace que sean anfipáticos formados por:
- una parte lipídica, apolar (hidrófoba),
-·otra parte no lipídica (aminas, restos de fosfato, etc.), polar (hidrófila).
Este comportamiento anfipático es la causa de su disposición en un medio acuoso, similar a la
descrita en los ácidos grasos. Se orientan formando bicapas que son la base de las membranas
celulares.

2.5. GLUCOLÍPIDOS
Son lípidos complejos, con una estructura semejante a los fosfolípidos que se caracterizan por
poseer uno o varios monosacáridos unidos. Se encuentran formando parte de las bicapas lipídicas de
las membranas de todas las células, especialmente de las neuronas. Se sitúan en la cara externa de
la membrana celular, en donde realizan una función de relación celular, siendo receptores de
moléculas externas que darán lugar a respuestas celulares.

2.6. TERPENOS (ISOPRENOIDES)


Grupo de lípidos insaponificables muy heterogéneo formados por polimerización de una unidad
estructural que es el isopreno (2-metil-butadieno), que pueden tener estructura lineal (fitol) o
cíclica (caroteno). Abundantes en los vegetales.
Realizan funciones muy variadas como:
- Esencias vegetales como el mentol, el geraniol, limoneno, alcanfor, eucaliptol, vainillina.
- Vitaminas, como la vit.A, vit. E, vit.K.
- Pigmentos vegetales, como el caroteno y la xantofila.

39
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2.7. ESTEROIDES
Son lípidos insaponificables derivados del esterano.

El más importante es el colesterol, que


forma parte de las membranas plasmáticas de
células animales (más raramente de las vegetales
superiores), a las que confiere fluidez y
estabilidad; también forma parte de algunas
lipoproteínas del plasma sanguíneo.

En los animales, el colesterol es un precursor de otros esteroides, entre los que son
relevantes:
Ácidos biliares: Compuestos que contribuyen a emulsionar los lípidos intestinales, lo cual
facilita su digestión y absorción.
Vitamina D: Necesaria para el metabolismo y absorción del calcio.
Hormonas esteroídicas: Concretamente, la aldosterona y el cortisol, producidas por la
corteza suprarrenal, y las hormonas sexuales masculinas y femeninas (testosterona y
progesterona).

2.8. PROSTAGLANDINAS
Las prostaglandinas son lípidos cuya molécula básica está constituida por 20 átomos de
carbono que forman un anillo y dos cadenas alifáticas.

Todas realizan una función reguladora u hormonal local, aunque sus efectos (funciones) son
muy variados. Entre ellas destaca la producción de sustancias que regulan la coagulación de la sangre
y cierre de las heridas; la aparición de la fiebre como defensa de las infecciones; la reducción de la
secreción de jugos gástricos, disminución de la presión sanguínea, inflamación local frente a golpes y
constricción de la musculatura lisa.

3. FUNCIONES DE LOS LÍPIDOS

 Función de reserva. Son la principal reserva energética del organismo. Un gramo de grasa
(triacilglicérido) produce 9'4 kilocalorías en las reacciones metabólicas de oxidación,
mientras que proteínas y glúcidos sólo producen 4'1 kilocalorías/gr. Estas reservas se
acumulan en el tejido adiposo. En los vegetales se acumula en los tejidos de reserva y en
las semillas.
 Función estructural. Forman las bicapas lipídicas de las membranas. Protegen e
impermeabilizan como las ceras; aíslan térmicamente como el tejido adiposo, etc.
 Función reguladora. En este papel los lípidos favorecen o facilitan las reacciones químicas
que se producen en los seres vivos. Cumplen esta función las vitaminas lipídicas, las
hormonas esteroideas y las prostaglandinas.

40
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. Escribe la fórmula desarrollada del ácido linoleico de 18 átomos de carbono y con dos
insaturaciones C6=C7 y C9=C10. Indica la parte hidrófoba e hidrófila de la molécula.
2. ¿Qué tipo de lípido se acumula en el tejido adiposo? ¿Qué función realiza? ¿Por qué
animales como las focas tienen un tejido adiposo muy desarrollado?
3. ¿Cómo se produce la reacción de esterificación? ¿Cuál sería la reacción inversa?
4. ¿Cómo se produce la saponificación? ¿Qué lípidos son saponificables? ¿Qué tienen en
común en sus moléculas?
5. Completa la siguiente tabla:

Tipo Composición Función

Esteroide

Terpeno

Fosfolípido

Cera

Triglicérido

41
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4.- LOS PRÓTIDOS

1.- CONCEPTO Y PROPIEDADES

Son macromoléculas que forman más del 50% del peso seco de las células con funciones muy
diversas. Son moléculas específicas cuya síntesis está codificada genéticamente.
Las proteínas son biomoléculas formadas básicamente por carbono, hidrógeno, oxígeno y
nitrógeno. Pueden además contener azufre y en algunos tipos de proteínas, fósforo, hierro, magnesio
y cobre entre otros elementos.
Pueden considerarse polímeros de unas pequeñas moléculas que reciben el nombre de
aminoácidos y serían por tanto los monómeros unidad. Los aminoácidos están unidos mediante enlaces
peptídicos.

Propiedades de las proteínas:


 Especificidad. La especificidad se refiere a su función; cada una lleva a cabo una
determinada función que realiza porque posee una determinada estructura primaria y una
conformación espacial propia; por lo que un cambio en la estructura de la proteína puede
significar una pérdida de la función.
Además, no todas las proteínas son iguales en todos los organismos, cada individuo posee
proteínas específicas suyas que se ponen de manifiesto en los procesos de rechazo de
órganos transplantados.
 Solubilidad. Solo las proteínas globulares son solubles en agua, formando dispersiones
coloidales debido a su gran tamaño molecular. Las proteínas filamentosas son insolubles.
 Desnaturalización. Consiste en la pérdida de la forma nativa de la cual depende su función.
La desnaturalización se puede producir por cambios de temperatura, (ej. al cocer o freír un
huevo la albúmina presente en la clara se desnaturaliza dejando de ser soluble y precipitando
lo que produce la coagulación), o por variaciones del pH. En algunos casos, si las condiciones
se restablecen, una proteína desnaturalizada puede volver a su anterior plegamiento o
conformación, proceso que se denomina renaturalización.

2.- LOS AMINOÁCIDOS (A.A.) Y LOS PÉPTIDOS

Los aminoácidos son las moléculas sencillas con las que


se construyen las proteínas. Se caracterizan por poseer un
grupo carboxilo (-COOH) y un grupo amino (-NH2). Las
otras dos valencias del carbono se saturan con un átomo de
H y con un grupo variable denominado radical R. Según éste
se distinguen 20 tipos de aminoácidos.

En disolución acuosa, los aminoácidos muestran un comportamiento anfótero, es decir pueden


ionizarse, dependiendo del pH, como un ácido liberando protones y quedando (-COO'), o como base,
los grupos -NH2 captan protones, quedando como (-NH3+), o pueden aparecer como ácido y base a la
vez.

42
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Los aminoácidos (a.a.) se clasifican según la naturaleza del radical R:


a.a. con grupo R no polar (ej. alanina)
a.a. con grupo R polar sin carga (ej. treonina)
a.a. con grupo R polar con carga negativa (ej. ácido aspártico)
a.a. con grupo R polar con carga positiva (ej. histidina)

Tirosina
(Tyr)

43
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

La forma y el tamaño de estos radicales afectan al empaquetamiento de los a.a. en las


proteínas y el carácter polar (hidrófilo) o apolar (hidrófobo) determina las interacciones con el
medio acuoso y la forma de la proteína.
En la especie humana hay 10 a.a. esenciales (Met, Val, Leu, Ile, Phe, Trp, Thr, Lys, Arg e His)
que deben ser incorporados con la dieta. Sólo los vegetales y bacterias pueden sintetizarlos, aunque
todos los seres vivos los necesitan para fabricar sus proteínas.

Los a.a. se unen unos a otros por medio de enlaces peptídicos formando péptidos. Si la
molécula tiene más de 10 a.a. se llama polipéptido y si el nº es superior a 50 a.a. se habla ya de
proteína.
El enlace peptídico es un enlace covalente que se establece entre el grupo carboxilo de un a.a.
y el grupo amino del siguiente, dando lugar al desprendimiento de una molécula de agua.

44
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

3.- ESTRUCTURA DE LAS PROTEÍNAS

En la configuración espacial de las proteínas pueden describirse hasta cuatro niveles


estructurales distintos, cada uno de los cuales se constituye a partir del anterior. Es decir, estos
niveles podrían corresponder a los pasos mediante los cuales una proteína recién formada se pliega
hasta conseguir su configuración nativa o natural, o sea, hasta alcanzar la configuración
tridimensional en la que es estable y activa.

3.1. ESTRUCTURA PRIMARIA

La estructura primaria es la secuencia de


aminoácidos (a.a.) de la proteína (su número oscila
entre 50 y 5000). Nos indica qué a.a. componen la
cadena polipeptídica y el orden en que se
encuentran. La estructura primaria es específica
para cada proteína, está codificada
genéticamente y determina la forma
tridimensional de la proteína y su función.

3.2. ESTRUCTURA SECUNDARIA

A medida que las proteínas se sintetizan en los ribosomas, la cadena de a.a. va adquiriendo la
forma tridimensional más estable. Los a.a., a medida que van siendo enlazados durante la síntesis de
proteínas y gracias a la capacidad de giro de sus enlaces, adquieren una disposición espacial estable,
la estructura secundaria.
Esta estructura secundaria está condicionada por las interacciones entre las cadenas laterales
de los a.a. y por las posibilidades de formación de puentes de hidrógeno entre el -C=O de un
aminoácido y el -NH- de otro a.a. no consecutivo en la cadena.

Las proteínas pueden adoptar dos configuraciones secundarias:

a) Alfa-hélice:
Esta estructura se forma al enrollarse helicoidalmente sobre sí misma la estructura primaria.
Así se forma una hélice mantenida por puentes de hidrógeno entre el -C=O de un aminoácido y el -
NH- del cuarto a.a. siguiente en la cadena. Las cadenas laterales R de los a.a. quedan hacia el
exterior de la hélice.

45
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

b) Lámina beta:
Se produce cuando la cadena polipeptídica se dispone en
paralelo a modo de láminas zigzageantes, unidas
transversalmente por puentes de Hidrógeno. Los restos R de
los a.a. están por encima o por debajo de los planos en zig-
zag.
Las proteínas pueden presentar tramos de conexión de
las alfa-hélices y las beta-láminas, o estar formadas
exclusivamente por cada una de ellas por separado.

3.3. ESTRUCTURA TERCIARIA

La estructura terciaria
es la forma tridimensional en
que la proteína se dispone en
el espacio. Esta estructura se
mantiene por distintos tipos
de enlaces:
puentes de hidrógeno entre grupos polares;
atracciones electrostáticas entre grupos con cargas
opuestas;
puentes disulfuro (S-S) entre radicales de cisteínas; y
atracciones hidrofóbicas (fuerzas de Van der Waals)
entre los radicales apolares de los a.a. que
generalmente se sitúan en el interior de las proteínas,
para evitar el contacto con el agua

3.4. ESTRUCTURA CUATERNARIA

Esta estructura sólo aparece en las proteínas formadas


por subunidades. Se unen varias cadenas polipeptídicas
mediante los mismos tipos de enlaces que mantienen la
estructura terciaria.
Por ejemplo la hemoglobina de los glóbulos rojos
sanguíneos está formada por la unión de cuatro cadenas de
polipéptido.

46
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4.- CLASIFICACIÓN DE LAS PROTEÍNAS

Según la forma tridimensional de la proteína podemos diferenciar dos tipos principales:


fibrosas y globulares.
Las proteínas fibrosas tienen forma alargada.
Son muy resistentes e insolubles en agua y
suelen tener funciones de tipo estructural
(miosina, colágeno, queratina, elastinas).
Las proteínas globulares tienen formas redondeadas. Son solubles en agua. Realizan
muchas funciones diferentes.

Teniendo en cuanta su composición se clasifican en:

1. HOLOPROTEÍNAS: Formadas solamente por aminoácidos


2. HETEROPROTEÍNAS: Formadas por una fracción proteínica y por un grupo no proteínico,
que se denomina "grupo prostético. Según la naturaleza del grupo prostético se diferencian:
cromoproteínas (grupo prostético es un pigmento); glucoproteínas (si es un glúcido);
lipoproteínas (si es un lípido); nucleoproteínas (cuando es un ácido nucleico).

HOLOPROTEÍNAS

Prolaminas: Zeína (maíz), gliadina (trigo), hordeína (cebada)


Gluteninas: Glutenina (trigo), orizanina (arroz).
Globulares Albúminas: Seroalbúmina (sangre), ovoalbúmina (huevo), lactoalbúmina (leche)
Hormonas: Insulina, hormona del crecimiento, prolactina, tirotropina
Enzimas: Hidrolasas, Oxidasas, Ligasas, Liasas, Transferasas...etc.

Colágenos: en tejidos conjuntivos, cartilaginosos


Queratinas: En formaciones epidérmicas: pelos, uñas, plumas, cuernos.
Fibrosas
Elastinas: En tendones y vasos sanguíneos
Fibroínas: En hilos de seda, (arañas, insectos)

HETEROPROTEÍNAS

Ribonucleasa
Mucoproteínas
Glucoproteínas
Anticuerpos
Hormona luteinizante

Lipoproteínas De alta, baja y muy baja densidad, que transportan lípidos en la sangre.

Nucleosomas de la cromatina
Nucleoproteínas
Ribosomas

Hemoglobina, hemocianina, mioglobina, que transportan oxígeno


Cromoproteínas
Citocromos, que transportan electrones

47
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

5.- FUNCIONES DE LAS PROTEÍNAS

Como las glucoproteínas que forman parte de las membranas. Además de función
estructural también actúan de receptores y de transportadores.
Las histonas que junto al ADN forman los cromosomas.
El colágeno, del tejido conjuntivo fibroso.
Estructural
La elastina, del tejido conjuntivo elástico.
La queratina de la epidermis.
Muchas estructuras celulares están formadas por proteínas: El citoesqueleto, las
fibras del huso, los cilios y flagelos, los ribosomas.

Son las más numerosas y especializadas. Actúan como biocatalizadores de las


Enzimática
reacciones químicas del metabolismo celular. Ej. amilasa, ADN polimerasa, etc.

Insulina y glucagón
Hormona del crecimiento
Hormonal
Calcitonina
Hormona ACTH

Algunas proteínas regulan la expresión de ciertos genes y otras regulan la división


Reguladora
celular.

Inmunoglobulinas. Actúan como anticuerpos en el sistema inmunológico.


Trombina y fibrinógeno son proteínas que se encuentran en el plasma sanguíneo y
Defensiva contribuyen a la formación de coágulos para evitar hemorragias
Las mucinas (proteoglucanos) protegen a las mucosas (efecto bactericida)
Algunas toxinas bacterianas son proteínas fabricadas con misión defensiva.

Algunas proteínas mantienen el equilibrio osmótico y actúan junto con sistemas


Homeostática
amortiguadores en la regulación del pH.

La hemoglobina, hemocianina y mioglobina transportan oxígeno


Las lipoproteínas transportan lípidos por la sangre.
Transporte Las proteínas transportadoras de la membrana plasmática que controlan el paso de
sustancias a su través.
Los Citocromos son transportadores de electrones.

La actina y la miosina constituyen las fibrillas responsables de la contracción


Contráctil
muscular.

Ovoalbúmina, de la clara de huevo


Reserva Gliadina, del grano de trigo
Lactoalbúmina, de la leche

48
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. ¿Qué características y propiedades de las proteínas las diferencian de glúcidos y


lípidos?
2. Escribe la fórmula del a.a. serina. Indica en la fórmula los grupos funcionales y el
radical. Escribe a continuación el a.a. leucina y únelos mediante enlace peptídico. ¿Cómo
sería la reacción inversa?
3. ¿En qué consiste la estructura primaria de las proteínas? ¿por qué es tan
importante?
4. ¿En qué niveles estructurales de las proteínas se forman puentes de hidrógeno?
5. ¿Qué es necesario para que una proteína tenga estructura cuaternaria?
6. Nombra las funciones que realizan las proteínas indicando un ejemplo de cada una (di
si son fibrosas o globulares y si son holoproteínas o heteroproteínas.)

49
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

50
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 5. BIOCATALIZADORES: ENZIMAS Y VITAMINAS.


1.- FUNCIÓN DE LOS ENZIMAS

Las enzimas son biocatalizadores muy potentes y eficaces; químicamente son proteínas. Como
catalizadores, las enzimas actúan en pequeña cantidad y no se consumen en las reacciones. Gracias a
ellas, las células pueden llevar a cabo reacciones químicas a grandes velocidades y a temperaturas
relativamente bajas.

Un catalizador es una sustancia que acelera una reacción química, hasta hacerla instantánea o
casi instantánea. Un catalizador acelera la reacción al disminuir la energía de activación.

Para reaccionar, las moléculas deben


poseer suficiente energía, la energía de
activación (EA), a fin de chocar con
suficiente fuerza para superar su
repulsión mutua y debilitar los enlaces
químicos existentes.
Las enzimas actúan como
catalizadores disminuyendo la energía
de activación y aumentando
enormemente la velocidad a la que se
producen las reacciones químicas en las
células. La característica más
sobresaliente de los enzimas es su
elevada especificidad. Ésta es doble y
explica que no se formen subproductos:

1. Especificidad de sustrato. El sustrato (S) es la molécula sobre la que el enzima ejerce su


acción catalítica.

2. Especificidad de acción. Cada reacción está catalizada por un enzima específico.

La acción enzimática se caracteriza por la formación de un complejo que representa el estado


de transición.

E+S ES E+P

El sustrato se une al enzima a través de numerosas interacciones débiles como son: puentes de
hidrógeno, electrostáticas, hidrófobas, etc, en un lugar específico, el centro activo. Este centro es
una pequeña porción del enzima, constituido por una serie de aminoácidos que interaccionan con el
sustrato.

51
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Las enzimas son grandes moléculas de proteínas globulares cuyo modo de plegamiento asegura
que grupos particulares de aminoácidos formen un centro activo. Cuando las enzimas pierden su
estructura tridimensional característica, se dice que están desnaturalizadas. Las moléculas
reactivas, conocidas como sustrato se ajustan con precisión a este sitio activo (modelo de llave-
cerradura). Aunque la conformación de una enzima puede cambiar temporalmente en el curso de una
reacción, no se altera permanentemente.

Actualmente se
ha confirmado que los
centros activos de
algunas enzimas se
modifican al unirse al
sustrato (lo que se
conoce como ajuste
inducido), por lo que
sus formas sólo son
realmente
complementarias
después de la unión
(símil del “apretón de
manos”).

Algunas enzimas actúan con la ayuda de estructuras no proteicas. En función de su naturaleza


se denominan:

1. Cofactor. Cuando se trata de iones o moléculas inorgánicas.


2. Coenzima. Cuando es una molécula orgánica. Aquí se puede señalar, que muchas vitaminas
funcionan como coenzimas; y realmente las deficiencias producidas por la falta de vitaminas
responde más bien a que no se puede sintetizar un determinado enzima en el que la vitamina
es el coenzima. Otros coenzimas importantes son el sistema ATP-ADP que interviene en las
reacciones metabólicas que implican transferencia energética, y los coenzimas de oxido-
reducción (como el NAD - NAH + H, o el FAD – FADH2)

52
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Las enzimas presentan una cinética que responde al modelo propuesto por Michaelis-
Menten. Según tal modelo, si se mide la velocidad de una reacción catalizada a una temperatura
determinada y a una concentración constante de enzima, es decir, si se varía la concentración de
sustrato, se obtiene una gráfica como la siguiente:

Podemos observar cómo la velocidad de reacción es directamente proporcional a la


concentración de sustrato, hasta llegar a un cierto límite en el cual se alcanza un máximo y ya no
varía aunque se incremente la concentración de sustrato.

Se dice entonces que se ha alcanzado la saturación, o lo que es lo mismo: la velocidad es


máxima cuando la enzima está saturada o formando el complejo E-S. Es el momento que corresponde
al estado de transición, en el que se produce la total interacción del sustrato con el centro activo de
la enzima.
La Km de una enzima indica el grado de afinidad de ésta respecto del sustrato o, lo que es lo
mismo, la estabilidad del complejo E-S. Concretamente:
a) un valor alto de Km quiere expresar que para conseguir la semisaturación se requiere una
elevada concentración de sustrato y que, por lo tanto, la enzima no tiene gran afinidad por él.
b) valores bajos de Km indican que el complejo E-S se forma a bajas concentraciones de
sustrato, es decir, la enzima tiene gran afinidad por él.

Al tener naturaleza proteica, las enzimas se ven afectadas en su actividad, al menos, por todas
aquellas variaciones que modifican la estructura o actividad de las proteínas.

Todas las enzimas presentan una actividad máxima bajo unas condiciones ambientales óptimas
y, por tanto, esta actividad se verá alterada al cambiar cualquiera de esos factores ambientales.

Los factores que, básicamente, condicionan la actividad enzimática son:

1) La temperatura:
La gran mayoría de las enzimas se desnaturalizan e inactivan alrededor de los 50º C (a excepción
de las enzimas de bacterias termófilas y cianobacterias de aguas termales, que toleran los 100º
C).

53
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2) El factor pH:
Las variaciones de pH
del medio ocasionan
cambios en la actividad
enzimática puesto que
se modifican las cargas
superficiales y se
altera la configuración
espacial de la
estructura de estas
proteínas.
El pH óptimo de
actuación también es
diferente para las
distintas enzimas de un
organismo; para unas es
ácido (pepsina) y para
otras alcalino (lipasas).

2.- INHIBICIÓN ENZIMÁTICA

Es otro mecanismo de control de las reacciones enzimáticas. Los inhibidores enzimáticos son
sustancias que disminuyen o bloquean la actividad de las enzimas. La inhibición puede ser de dos
tipos:
1) Reversible:
Se trata de casos en los que se forma un complejo E-I, que puede disociarse y dejar activa a la
enzima. A su vez, puede ser:
a) Competitiva:
El inhibidor y el sustrato se parecen y compiten por unirse al centro activo de la enzima. Se
forma un complejo E-I reversible.
Su efecto se puede invertir aumentando la [S].
b) No competitiva:
En este caso el inhibidor y el sustrato pueden unirse simultáneamente a la enzima, aunque en
puntos distintos de su molécula, pero al unirse el inhibidor se produce un cambio en la
conformación del centro activo y la actividad enzimática queda bloqueada.
2) Irreversible (envenenamiento):
El inhibidor modifica la estructura de la enzima o se une tan fuertemente a ella que la inactiva
totalmente. Por ejemplo el cianuro inhibe uno de los enzimas de la respiración celular.

La velocidad de las distintas vías metabólicas debe estar regulada, de forma que ocurran sólo
aquellas vías necesarias para la actividad celular y se obtenga el máximo rendimiento. Esta
regulación se lleva a cabo, entre otros mecanismos, mediante inhibidores.

a) El producto final de la vía metabólica inhibe a uno de los primeros enzimas de esa vía,
regulando su propia formación.
b) Se trata de un mecanismo de retroinhibición en el que el inhibidor es el propio producto de
una reacción o de una vía metabólica. (regulación por retroalimentación o feed-back).
c) El producto (en este caso inhibidor) funciona a modo de 'señal' de que existe una
concentración adecuada del mismo y que ya no se necesita más, para que la reacción se detenga.
d) Ventaja: evita un gasto inútil de energía y también un gasto innecesario de enzimas.

54
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

3.- CLASIFICACIÓN DE ENZIMAS

1. Oxido-reductasas
( Reacciones de oxido-reducción).
Si una molécula se reduce, tiene que haber otra que se
oxide

2. Transferasas
(Transferencia de grupos funcionales)

3. Hidrolasas
(Reacciones de hidrólisis)
Transforman polímeros en monómeros.

4. Liasas
(Adición a los dobles enlaces)

5. Isomerasas
(Reacciones de isomerización)

6. Ligasas
(Formación de enlaces, con gasto de
ATP)

55
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4.- LAS VITAMINAS

Las vitaminas son sustancias orgánicas, de naturaleza y composición variada. Se necesitan en


pequeñas cantidades, aunque su presencia es imprescindible para el desarrollo normal del organismo.
Las necesidades vitamínicas varían según las especies, con la edad y con la actividad.
Los vegetales, hongos y microorganismos son capaces de elaborarlas por sí mismos. Los
animales, salvo algunas excepciones, carecen de esta capacidad, por lo que deben obtenerlas a partir
de los alimentos de la dieta. En algunos casos los animales obtienen algunas vitaminas a través de sus
paredes intestinales, cuya flora bacteriana simbionte las producen.
Ciertas vitaminas son ingeridas como provitaminas (inactivas) y posteriormente el metabolismo
animal las transforma en activas (en el intestino, en el hígado, en la piel, etc.), después de alguna
modificación en sus moléculas.
Son sustancias lábiles, ya que se alteran fácilmente por cambios de temperatura y pH, y
también por almacenamientos prolongados.

Los trastornos orgánicos en relación con las vitaminas se pueden referir a:


Avitaminosis.- si hay carencia total de una o varias vitaminas,
Hipovitaminosis.- si hay carencia parcial de vitaminas,
Hipervitaminosis.- si existe un exceso por acumulación de una o varias vitaminas, sobre
todo las que son poco solubles en agua y, por tanto, difíciles de eliminar por la orina.

Las vitaminas se designan utilizando letras mayúsculas, el nombre de la enfermedad que


ocasiona su carencia o bien el nombre de su constitución química.
Clásicamente se establecen 2 grupos según su capacidad de disolución en agua o en las grasas o
disolventes de éstas. Así, se habla de: vitaminas hidrosolubles (vitamina C y las vitaminas del grupo
B) y liposolubles (vitaminas A, D, E, K) respectivamente.

Algunas vitaminas son necesarias para la actuación de determinados enzimas, ya que funcionan
como coenzimas que intervienen en distintas rutas metabólicas y por ello, una deficiencia en una
vitamina puede originar importantes defectos metabólicos, como puede verse en la tabla adjunta.

56
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

57
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. ¿Es lo mismo enzima que proteína? ¿Es lo mismo catalizador que enzima?

2. Define: holoenzima, apoenzima, cofactor y coenzima.

3. ¿Qué es la energía de activación de una reacción? ¿Cómo consiguen los enzimas rebajarla?

4. ¿Qué propiedades tienen los enzimas? ¿En qué se basa la especificad enzimática?

5. Explica de cuántas formas se puede impedir la acción de un enzima.

6. Escribe la ecuación general de una reacción catalizada por un enzima. ¿Cómo se une el enzima
al sustrato de la reacción?

7. Las siguientes gráficas corresponden a dos enzimas distintas que actúan sobre el mismo
sustrato. ¿Cuál presenta mayor afinidad por el sustrato? Razona tu respuesta.

8. Interpreta las siguientes gráficas:

9.¿Cómo se produce la regulación por retroinhibición en una vía metabólica? ¿Qué tipo de enzimas
intervienen?

58
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

BLOQUE 2.- GENÉTICA MOLECULAR

UNIDAD 6. LOS ÁCIDOS NUCLEICOS

1. Composición química y clasificación


2. Estructura y función del ADN
3. Estructura y función de los ARN
4. Funciones biológicas

UNIDAD 7.- DUPLICACIÓN DEL ADN

1. El ADN como portador de la información genética. Concepto de gen.


2. Replicación semiconservativa.
3. Enzimas de la replicación

UNIDAD 8.- EXPRESIÓN DE LA INFORMACIÓN GENÉTICA

1. Transcripción del mensaje genético


2. Traducción del mensaje genético
3. El código genético.

UNIDAD 9.- NOCIONES DE GENÉTICA*

1. Alteraciones en la información genética.


1. Mutaciones génicas
2. Mutaciones cromosómicas
3. Mutaciones genómicas
2. Biotecnología e Ingeniería genética.
3. Técnica del ADN recombinante o clonación celular
4. Aplicaciones prácticas de la ingeniería genética
5. Biotecnología y bioética

* (NOTA: La unidad 9 se estudiará al final del temario, tras la unidad 17, en el segundo
cuadrimestre, por motivos de mejor adecuación didáctica).

59
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 6.- LOS ÁCIDOS NUCLEICOS.

1.- COMPOSICIÓN QUÍMICA Y CLASIFICACIÓN

Los ácidos nucleicos son las moléculas más importantes en Biología Molecular debido a su
implicación en la transmisión de los caracteres hereditarios y en la síntesis de proteínas ya que
contienen la información genética de los seres vivos. Existen dos tipos de ácidos nucleicos, ADN
(Ácido Desoxirribonucleico) y ARN (Ácido ribonucleico).
Son macromoléculas formadas por la repetición de una molécula unidad que es el nucleótido.
Son específicas para cada individuo y si se desnaturalizan pierden su estructura y su función.

Los nucleótidos constituyen la unidad monomérica de los ácidos nucleicos, y tienen tres
componentes básicos:
a) Una pentosa, que puede ser la
ribosa (ARN) o la desoxirribosa
(ADN).
b) Ácido fosfórico: una, dos o
tres moléculas, según se trata de
nucleótidos mono-P, di-P o tri-P.
c) Una base nitrogenada,
derivada de la purina: Adenina (A) o
Guanina (G) o de la pirimidina: Citosina (C), Timina (T) o Uracilo (U). Las tres primeras son comunes
al ADN y al ARN, la Timina solo se encuentra en el ADN y el Uracilo solo en el ARN.

60
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Para formar el nucleótido la base nitrogenada siempre se une al C1' de la pentosa para formar
un nucleósido.
La unión del grupo fosfato al nucleósido se produce en el C5' de la pentosa, y se forma el
nucleótido.

Los nucleótidos también se encuentran libres en las


células y cumplen distintas funciones. Por ejemplo:
Transportadores de energía: Fundamentalmente
el sistema ATP (Adenosin trifosfato)-ADP
(Adenosin difosfato).
Mensajeros intracelulares: Como es el caso del
AMPc (adenosín-mono-P cíclico), que se forma por
acción de enzimas específicas y desencadenan
distintas respuestas en cada tipo celular.
Coenzimas de oxido-reducción: Las más comunas
son el NAD, NADP, FAD, FMN y la CoA.

Los ácidos nucleicos están formados por unión de nucleótidos-mono-fosfato dando lugar a
cadenas de polinucleótidos. Pueden alcanzar tamaños gigantes, siendo las moléculas más grandes que
se conocen, constituidas por millones de nucleótidos.

Los nucleótidos se unen mediante enlaces fosfodiester entre el hidroxilo del C5' de un
nucleótido y el hidroxilo del C3' del siguiente, formándose una molécula de agua. La dirección de
síntesis es siempre de 5’ 3’.

61
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

En una cadena polinucleótida, por tanto, se distinguen:


un esqueleto covalente P-pentosa-P-pentosa-P..., con un extremo 5’ con el P y un
extremo 3’ hidroxilo.
las bases nitrogenadas que salen a modo de radicales, de los carbonos 1’ de la pentosa y
que van formando la secuencia de nucleótidos específica de cada molécula.
5’ TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT3’
ATTCCGGTACGGTGCCTAACCAGTACAATGATGATCAC

2.- ESTRUCTURA Y FUNCIÓN DEL ADN

La molécula de ADN contiene la información genética de todos los seres vivos (excepción:
retrovirus). Esta información genética se puede “expresar” en forma de proteínas y puede
transmitirse de la célula madre a las células hijas en la reproducción celular.
El conocimiento de la estructura del ADN data de mitad del siglo XX. El modelo de Watson y
Crick de la doble hélice del ADN abrió las puertas de la investigación genética moderna.
La molécula de ADN está constituida por dos largas cadenas de polinucleótido (la pentosa es
desoxirribosa) unidas entre sí, formando una doble hélice. Las dos cadenas que constituyen una
molécula de ADN, se mantienen unidas entre sí porque se forman enlaces entre las bases
nitrogenadas de ambas cadenas que quedan enfrentadas. Estas dos cadenas son antiparalelas.
La unión de las bases se realiza mediante puentes de hidrógeno, y este apareamiento está
condicionado químicamente de forma que la adenina (A) sólo se puede unir con la Timina (T) y la
Guanina (G) con la Citosina (C).
La estructura en doble hélice del ADN, con el apareamiento de bases limitado (A-T; G-C ),
implica que el orden o secuencia de bases de una de las cadenas delimita automáticamente el orden
de la otra, por eso se dice que las cadenas son complementarias. Una vez conocida la secuencia de las
bases de una cadena, se deduce inmediatamente la secuencia de bases de la complementaria.
Esta complementariedad de bases permite la duplicación de la molécula para formar otras dos
iguales de manera que la información genética pueda pasar de una generación a la siguiente.

62
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

La estructura de un determinado ADN está definida por la "secuencia" de las bases


nitrogenadas en la cadena de nucleótidos, residiendo precisamente en esta secuencia de bases la
información genética del ADN. El orden en el que aparecen las cuatro bases a lo largo de una cadena
en el ADN es, por tanto, crítico para la célula, ya que este orden es el que constituye las
instrucciones del programa genético de los organismos.
Conocer esta secuencia de bases, es decir, secuenciar un ADN equivale a descifrar su mensaje
genético.

Del estudio del ADN de diversas especies se deduce que:


a) La composición de bases varía de una especie a otra.
b) Las células de la misma especie tienen la misma composición de bases, y se mantiene a lo
largo de su vida.
c) Los ADN de especies muy emparentadas tienen composiciones de bases más similares que
los de especies poco relacionadas filogenéticamente.

En eucariotas, el ADN se encuentra en el núcleo y una pequeña cantidad en mitocondrias y


cloroplastos. El ADN del núcleo es lineal y el de las mitocondrias y los cloroplastos es circular. En
procariotas, la molécula de ADN es circular, y, además, estas células pueden tener otras moléculas
más pequeñas de ADN, llamadas plásmidos.

3.- ESTRUCTURA Y FUNCIÓN DE LOS ARN

Los ARN son polímeros de ribonucleótidos de A, G, C y U, en los que la pentosa es la ribosa.


Con la excepción de los virus que tienen ARN bicatenario y constituye su material genético, los
ARN son monocatenarios, aunque algunos pueden presentar regiones de apareamiento o
complementariedad intracatenarias.
Hay distintos tipos de ARN y sus funciones están relacionadas con la síntesis de proteínas
(expresión del mensaje genético).
Los ARN se forman por transcripción de una cadena de la doble hélice de ADN, mediante la
complementariedad de bases.

 ARNm (ARN mensajero)

Está formado por una sola cadena de nucleótidos de longitud variable.


Su función es transportar la información genética codificada desde el núcleo hasta los
ribosomas, para que tenga lugar la traducción de ese código (síntesis de proteínas).
Estas moléculas tienen una vida muy corta, ya que tras su elaboración (transcripción) y
cumplida su misión (traducción), son rápidamente degradadas (un minuto en bacterias).

 ARNr (ARN ribosómico)

Estas moléculas tienen entre 3.000 y 5.000 ribonucleótidos, representando el 80% del total
del ARN. Tienen el peso molecular más elevado de todos los ARN.
Junto a proteínas constituyen los ribosomas, que se encargan de sintetizar las proteínas,
según la secuencia de nucleótidos del ARNm.
Estas moléculas se elaboran en el nucleolo a partir de un único ARN nucleolar precursor, que
posteriormente se fragmenta para originar las subunidades ribosómicas.

63
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

 ARNt (ARN transferente)

Se trata de moléculas pequeñas (70-80


nucleótidos) y representa el 15% del total de
ARN, siendo su peso molecular el más bajo de
los ARN vistos.
Su estructura tridimensional presenta
bucles y zonas de doble hélice intracatenaria
mantenida por puentes de H; se conoce como
estructura de trébol.
Su función es transportar los aminoácidos
según el lugar que les corresponde en la
proteína de acuerdo con la información
codificada en el ADN.
De lo anterior se deduce que los ARNt son específicos, de forma que cada a.a. sólo se une a un
determinado ARNt o a un determinado grupo de ARNt.

6.4.- FUNCIÓN DE LOS ACIDOS NUCLEICOS

Es esquema anterior corresponde a lo que Watson denominó “dogma central de la genética”. El


ADN constituye el material genético de los seres vivos.
El ADN tiene capacidad de replicación para originar dos copias idénticas para que la
información genética pase de una célula madre a las células hijas en la reproducción celular.
La información genética contenida en la secuencia de nucleótidos del ADN se expresa
mediante proteínas. Para la formación de proteínas primero se copia la información del gen que
codifica la proteína formando una molécula de ARNm mediante el proceso de transcripción.
Posteriormente este “mensaje” es “leído” por los ribosomas y se forman las proteínas mediante el
proceso de traducción. Para formar las proteínas los ARNt llevan los a.a. específicos según la
secuencia de nucleótidos del ARNm.
La capacidad de mutación del ADN ha producido los cambios evolutivos que han ocurrido a lo
largo de la historia de la vida en la Tierra.

64
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Estos procesos se estudian con más detalle en la unidad 8 (Genética molecular).

65
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. Dibuja de forma simplificada un nucleótido indicando las moléculas que lo componen.


2. ¿Qué propiedades y características tienen en común los ácidos nucleicos y las
proteínas?
3. ¿Cómo se forma un polinucleótido? ¿Cómo se produciría la reacción inversa?
4. Explica el modelo de Watson y Crick de la doble hélice del ADN. Haz un dibujo
simplificado de la estructura indicando los componentes.
5. Completa la siguiente tabla:

ADN ARNm ARNt ARNr

Pentosa

Bases
nitrogenadas

Mono/
Bicatenario

Estructura

Localización
celular (eucariota)

Función

66
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 7. DUPLICACIÓN (REPLICACIÓN) DEL ADN.

1. EL ADN COMO PORTADOR DE LA INFORMACIÓN GENÉTICA.


CONCEPTO DE GEN

El ADN contiene la información para sintetizar las proteínas de la célula. Ya que muchas de
estas proteínas funcionan como enzimas en las reacciones químicas que tienen lugar en la célula,
todos los procesos celulares dependen, en última instancia, de la información codificada en el ADN.
Esta información genética es hereditaria.

BREVE HISTORIA:
En 1944, O.T. Avery demostró que el ADN constituye el material genético en las bacterias.
Poco después, en 1952 Alfred Hershey y Marta Chase demostraron que el ADN de los fagos es el
que dirige la multiplicación de los virus.
En la misma década de los 50, se llevaron a cabo diversos estudios y experimentos que
contribuyeron a establecer sin ninguna duda que el ADN era el material genético y a conocer su
estructura. Por ejemplo se demostró que cualquier célula somática de un mismo individuo contenía la
misma cantidad de ADN.
En 1950, Edwin Chargaff demostró que la composición de bases nitrogenadas en los ADN varía
según la especie considerada, y estableció la llamada ley de equivalencia entre las bases (A-T y C-
G).
En 1953, James Watson y Francis Crick tras recopilar toda la información que se tenía del
ADN establecieron la estructura de esta molécula que constituye el material genético. Se puede
decir, por tanto, que estos hechos constituyen el nacimiento de la Genética molecular.
Al mismo tiempo el concepto de gen ha ido modificándose. Según la genética clásica un gen es
la unidad de información que controla un determinado carácter, como por ejemplo el color de los
ojos. Actualmente según la genética molecular un gen se define (de forma simplificada) como un
fragmento de ADN que lleva información para sintetizar una proteína. Cada gen ocupa un lugar
específico en los cromosomas. A las diferentes variantes de un gen se les llama alelos, por ejemplo,
para el color de los ojos pueden existir diferentes alelos (marrón, azul, etc.)

DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR


La información genética se almacena en la doble hélice del ADN, cuya estructura es idónea
para mantener la integridad de dicha información. Cuando una célula se divide, transmite su
información genética a las células hijas; para ello, duplica previamente su ADN mediante el
mecanismo de la replicación.
En 1970, F. Crick enunció el llamado dogma central de la Biología molecular:
"la información genética contenida en el ADN es transcrita en forma de ARN y traducida a
proteínas"

67
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

El "dogma central" admite excepciones. Se descubrió una enzima, la transcriptasa inversa, que
es capaz de sintetizar ADN copiando la información contenida en un ARN. El papel biológico de esta
enzima es fundamental en los retrovirus, como el virus del SIDA, cuyo material genético es ARN en
vez de ADN.
La replicación del ADN permite que la información genética se transmita de una célula a las
células hijas.
La expresión génica comprende dos etapas: la transcripción y la traducción. Estas dos etapas
tienen lugar en distintas localizaciones de la célula eucariota. Como se observa en la figura la
transcripción, al igual que la duplicación del ADN, ocurre en el núcleo celular. La traducción que
implica la síntesis de una proteína se realiza en los ribosomas del citoplasma y del retículo
endoplasmático rugoso.

2.- REPLICACIÓN SEMICONSERVATIVA DEL ADN

El mecanismo es esencial para que se realice correctamente la división celular, en la que una
célula madre origina por división dos células hijas con idéntica información hereditaria.

Watson y Crick (1953), al proponer la estructura del ADN, ya sugerían uno de los tres modelos
o hipótesis de replicación:

1) Conservativa: La doble hélice original


permanece intacta, originándose una doble
hélice completamente nueva.

2) Semiconservativa: Cada nueva


molécula de ADN está formada por una
hebra original y por otra recién sintetizada.

3) Dispersiva: La molécula original se


rompe y las dos nuevas se construyen con
precursores originales y de nueva síntesis.

Messelson y Stahl (1958) demostraron que la hipótesis semiconservativa era la correcta.


El mecanismo de replicación consiste en la formación de dos moléculas de ADN idénticas a
partir de una original que actúa como molde o patrón.

68
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

La duplicación del ADN se produce de acuerdo con las


siguientes características:
1) Es semiconservativa.
2) Bidireccional: a partir de un punto dado del
cromosoma, la replicación progresa en dos
direcciones

3) En virus y bacterias hay un único punto de inicio de


la replicación, mientras que en eucariotas hay
varios.
4) La replicación avanza por adición de
desoxirribonucleótidos-monofosfato (dNMP) en el
sentido 5'3'.
5) Semidiscontinua: una hebra se replica de forma
continua y la complementaria de modo discontinuo
(fragmentos de Okazaki).

6) La iniciación de la síntesis de cada hebra y de cada


fragmento requiere de un cebador o primer
(ARN).

3.-ENZIMAS DE LA REPLICACIÓN

Las más importantes son las ADN polimerasas (ADN pol), que catalizan la formación de los
enlaces fosfodiéster entre nucleótidos y van añadiendo el nucleótido complementario al de la hebra
molde.

Para ello, utilizan desoxirribonucleótidos-trifosfato (dNTP) que, además, aportan la energía


necesaria para la reacción y desprenden restos de fosfato inorgánico (P):
Las ADN polimerasas requieren un ADN-molde y un fragmento polinucleótido que proporcione
el grupo 3' -OH libre al que ir añadiendo desoxirribonucleótidos. Este segmento es un ARN cebador
llamado también iniciador o primer.

69
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Otras enzimas importantes son:

1) Primasas: Sintetizan el ARN cebador usando como molde una hebra de ADN.
2) Girasas (topoisomerasas): Actúan desenrollando el ADN.
3) Helicasas: Separan las dos hebras del ADN, para que cada una actúe de molde.
4) Proteínas SSB (estabilizadoras): Mantienen las hebras separadas mientras tiene lugar la
replicación.
5) Ligasas: Unen los fragmentos mediante enlaces fosfodiéster.

El punto de la doble hélice de ADN donde se inicia el proceso se conoce como 'origen de
replicación'. A partir de él se forma una 'horquilla de replicación'. En la formación de la horquilla
intervienen: las girasas, las helicasas y las proteínas estabilizadoras.
A continuación y por medio de una primasa se sintetiza un ARN cebador para que pueda actuar
la ADN polimerasa, que continua la polimerización siguiendo el principio de complementariedad de
bases.
Posteriormente, la ADN polimerasa elimina el cebador y al mismo tiempo rellena el hueco con
nuevos nucleótidos de ADN y repara las roturas que pueden producirse. De esta manera continua se
elabora una nueva hebra de ADN, que se conoce como 'hebra conductora'. La hebra conductora es
la que se sintetiza en la misma dirección en que se abre la horquilla.
Paralelamente al proceso anterior, la otra cadena del ADN sirve de molde para la síntesis de su
complementaria, que va a llamarse 'hebra retardada' porque su elaboración es discontinua
(fragmentos de Okazaki). La hebra retardada es la que se sintetiza en dirección contraria a la de
apertura de la horquilla.
Al final, la ADN ligasa une los fragmentos independientes para construir una cadena sin
discontinuidades.
Existen mecanismos que contribuyen a asegurar una correcta replicación y reparan los posibles
errores en la copia de la molécula. La ADN polimerasa revisa la copia y corrige los errores.A pesar
de este sistema de 'corrección de pruebas', suele haber un nucleótido equivocado por cada 100
millones de nucleótidos añadidos.

70
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES

1. Identifica todos los componentes que aparecen en el dibujo: ¿Qué


proceso biológico está ocurriendo? ¿Qué importancia tiene?

3. Señala en el dibujo la hebra conductora y la hebra retardada.

4. Indica las etapas que se distinguen en el proceso de traducción en los


organismos eucariotas. ¿Qué diferencias se observan con los procariotas?

71
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 8.- EXPRESIÓN DE LA INFORMACIÓN GENÉTICA

1. TRANSCRIPCIÓN DEL MENSAJE GENÉTICO

El proceso de síntesis de ARN o


TRANSCRIPCIÓN, consiste en hacer una copia
complementaria de un fragmento de ADN. De forma
simplificada podemos decir que se copia la
información de un gen que codifica una proteína. El
ARN se diferencia estructuralmente del ADN en el
glúcido, que es la ribosa y en una base, el uracilo, que
reemplaza a la timina. Además el ARN es una cadena
sencilla.
En una primera etapa, una enzima, la ARN-
polimerasa (ARN pol) reconoce una región del ADN
denominada promotor como lugar de inicio. Las dos
cadenas del ADN se separan y una de las hebras de
ADN se utiliza como patrón. La ARN pol, se desplaza
por la hebra patrón, insertando nucleótidos de ARN,
siguiendo la complementariedad de bases.

Cuando se ha copiado toda la hebra la cadena de


ARN queda libre y el ADN se cierra de nuevo, por
apareamiento de sus cadenas complementarias.

El ADN, por tanto, es la "copia maestra" de la


información genética, que permanece en "reserva"
dentro del núcleo.

El ARN, en cambio, es la "copia de trabajo" de la


información genética. Este ARN que lleva las
instrucciones para la síntesis de proteínas se denomina
ARN mensajero (ARNm).

El proceso de transcripción es semejante en


procariotas y eucariotas. En los organismos eucariotas
los genes están formados por regiones de ADN
codificante (exones) intercaladas con regiones no
codificantes (intrones). Podemos diferenciar las
siguientes etapas:

1) Iniciación: La ARN pol reconoce la región concreta


del ADN que llamamos promotor.

72
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2) Elongación: El proceso de síntesis se ejecuta en sentido 5'->3', y al cabo de unos 300


nucleótidos transcritos se añade una 'caperuza’ al extremo 5'.
3) Finalización: La ARN pol concluye el proceso al encontrar otra secuencia específica.
Antes de concluir la síntesis se añade al extremo 3' la llamada 'cola de poli-A' (más o menos
unos 200 nucleótidos de adenina).
El resultado es la formación de una molécula de ARNm llamada transcrito primario.
El ARN recién sintetizado se desprende y el ADN recupera su estructura de doble hélice.
4) Maduración: Se produce en el núcleo, donde los intrones son eliminados y se unen los
exones.
Un determinado transcrito primario puede sufrir diferentes cortes y empalmes que originan
diversas moléculas de ARNm con información para diferentes proteínas.

2. TRADUCCIÓN DEL MENSAJE GENÉTICO

La TRADUCCIÓN o síntesis de proteínas consiste en la unión de los aminoácidos (a.a.)


mediante enlaces peptídicos, según una secuencia que corresponde a la de los nucleótidos (bases
nitrogenadas) en el ARNm.

73
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

La síntesis de proteínas tiene lugar en los ribosomas. Los aminoácidos son transportados por el
ARN transferente (ARNt), específico para cada uno de ellos, y son llevados hasta el ARNm, al lugar
marcado por el ribosoma, dónde se van uniendo siguiendo la secuencia marcada por el ARNm.

Una vez finalizada la síntesis de una proteína, el ARNm queda libre y puede ser leído de nuevo.
De hecho, es muy frecuente que antes de que finalice una proteína ya está comenzando otra, con lo
cual, una misma molécula de ARNm, está siendo leída por varios ribosomas simultáneamente.

En el mecanismo de la traducción se pueden diferenciar las siguientes etapas:

1) Iniciación: El ARNm se une a la subunidad menor del ribosoma, comenzando con su triplete AUG
(Metionina). El Met-ARNt se coloca en el lugar P del ribosoma complementando su anticodón con el
codón del ARNm y comenzando así la síntesis de una proteína. Después se une la subunidad mayor.

74
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2) Elongación: Se trata de una etapa cíclica en la que pueden distinguirse tres momentos
fundamentales:
1º/ Unión del a.a.2-ARNt específico al codón correspondiente, que se sitúa en el lugar A del
ribosoma.
2º/ Formación del enlace peptídico entre los dos aminoácidos quedando libre el primer ARNt
que deja el ribosoma (este ARNt vuelve al citoplasma, donde podrá aceptar otra vez su
aminoácido). Se forma un dipéptido unido al ARNt que ocupa el lugar A.
3º/ Translocación: el ribosoma se desplaza un triplete en el sentido de la lectura del ARNm, de
forma que el complejo dipéptido-ARNt del lugar A se traslada al lugar P. El lugar A queda
vacío y en condiciones de albergar otro a.a.3-ARNt, empezando así un nuevo ciclo.
3) Terminación: La finalización de la cadena polipeptídica se produce cuando el ribosoma alcanza un
codón de terminación ("stop"). Se separan las subunidades del ribosoma, y se obtiene la proteína.

3. EL CÓDIGO GENÉTICO
Gracias a los trabajos en los que intervino el premio Nobel Severo Ochoa se fue estableciendo
la correspondencia entre las bases del ARN mensajero (que es copia del DNA) y los aminoácidos de
las proteínas, correspondencia a la que se le dio el nombre de Código Genético.
La unidad de esta clave genética es el codón y está constituido por un triplete de nucleótidos
del ARNm al que corresponde un determinado a.a. de la proteína.

El código es universal, pues es el mismo en todos los seres vivos.


El código es degenerado, lo que significa que existen a.a. que son codificados por más
de un triplete.
Existen codones-stop que no codifican a.a. y actúan a modo de señales que indican el
final de la traducción. Asimismo, hay un codón (AUG, codificador de la metionina) que
actúa como señal de iniciación de la traducción del mensaje.

75
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES
1.- Observa el esquema siguiente:
2
ADN ARNm 4
Proteínas
3
1

a. ¿Cómo se denomina cada una de las etapas numeradas en el mismo?


b. Indica cuáles de estas etapas se producen normalmente en la célula eucariota y
dónde se produce cada una de ellas.

2.- Observa esta imagen:

3. Explica el siguiente dibujo e indica los componentes que aparecen:

4. Indica el ARNm transcrito y la secuencia de a.a. de la proteína (con la ayuda del


código genético) formada a partir de la siguiente cadena de ADN:

3’...TACCCGGTAACAGTACGTAGTATC...5’

76
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

5. ¿Por qué los codones no son sólo de dos nucleótidos?

6. ¿Por qué cada ARNt reconoce a su aminoácido específico?

7. ¿Qué pasaría si un ribosoma se equivocara y “leyese” una cadena de ARNm al


revés? ¿Cómo se evita esto?

77
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

UNIDAD 9. NOCIONES DE GENÉTICA:


MUTACIONES E INGENIERÍA GENÉTICA.

1.- ALTERACIONES EN LA INFORMACIÓN GENÉTICA

Una mutación es un cambio heredable en el material genético de una célula. Una mutación en
una célula somática puede provocar alteraciones en el organismo en el que se presente; pero
desaparece con el individuo en que se originó. Sin embargo, las mutaciones en las células sexuales,
óvulos y espermatozoides, pueden transmitirse como rasgos hereditarios diferenciadores a los
descendientes del organismo en los que tuvo lugar la mutación.
Las mutaciones pueden surgir de forma espontánea (mutaciones naturales) o ser inducidas de
manera artificial (mutaciones inducidas) mediante radiaciones y determinadas sustancias químicas a
las que llamamos agentes mutágenos. Estos agentes aumentan significativamente la frecuencia
normal de mutación. Los principales son:

1) Radiaciones, como los rayos ultravioleta (UV), los rayos X y los rayos gamma.
2) Sustancias químicas, como el HNO2, la hidroxilamina, el gas mostaza, etilo, etc. que
reaccionan con el ADN y que pueden provocar diversas alteraciones.

Se distinguen varios tipos de mutaciones en función de los cambios que sufre el material
genético:
Génicas: si afectan a la secuencia de nucleótidos de un gen.
Cromosómicas: si afectan a la estructura de uno o varios cromosomas, respecto al orden de
sus genes.

Genómicas: si afectan al genoma modificando el número de cromosomas o de juegos


cromosómicos.

4.1. MUTACIONES GÉNICAS

Son las verdaderas mutaciones, porque se produce un


cambio en la estructura del ADN. A pesar de todos los
sistemas destinados a prevenir y corregir los posibles
errores, de vez en cuando se produce alguno en la
réplica, bien por colocarse una Citosina (C) en lugar de
una Timina (T), o una Adenina (A) en lugar de una
Guanina (G); o bien porque el mecanismo de replicación
se salta algunas bases y aparece una "mella" en la
copia. O se unen dos bases de Timina, formando un
dímero. Aunque se trate de un cambio de un nucleótido
por otro, supondrá una alteración en la secuencia de un
gen, que se traduce posteriormente en una
modificación de la secuencia de aminoácidos de una
proteína.

Al transcribirse la mutación, al menos un triplete del ARNm, se encuentra modificado y su


traducción da lugar a que se incorpore un aminoácido distinto del normal en la cadena polipeptídica.
Es un cambio que aunque la mayoría de las veces va a ser perjudicial, en ocasiones puede provocar

78
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

que mejore un gen y gracias a esta característica se sintetice una proteína que tenga propiedades
distintas o participe en la formación de estructuras más eficaces.
En estos casos raros, pero esenciales para la evolución de las especies, los individuos
portadores de la mutación poseen ventajas adaptativas respecto a sus congéneres, por lo que el gen
mutado es posible que con el tiempo, y gracias a la selección natural, sustituya al gen original en la
mayoría de los individuos que componen la población.

4.2. MUTACIONES CROMOSÓMICAS


Son cambios en la disposición de los genes en los cromosomas,
unas veces con pérdida, otras con ganancia y otras sin variación en
la cantidad de ADN, pero sí en el orden de los loci. Este tipo de
mutaciones provoca cambios en la estructura de los cromosomas.
Se originan por rotura espontánea de los cromosomas, y hay
varias clases:
1) Delección:
Pérdida de material genético, que puede ser letal si afecta a los
alelos de dos homólogos.

2) Duplicación:
Consiste en la repetición de un segmento cromosómico.

3) Inversión:
Un segmento cromosómico cambia de sentido dentro del propio
cromosoma; ello supone una rotura del cromosoma por dos partes y
una rotación de 180º del segmento.

Según la región afectada se distinguen:

a) Inversiones pericéntricas: afectan a un segmento que tiene


el centrómero.
b) Inversiones paracéntricas: afectan a un segmento que no
contiene el centrómero.

4) Translocación:
Consiste en el cambio de situación de un segmento del
cromosoma.

Un tipo particular de transposición es la fusión


céntrica, por la cual dos cromosomas se fusionan dando
origen a uno solo.

Otro tipo de cambio es la fisión o disociación, por


la cual un cromosoma se divide dando lugar a dos.
(Algunos autores consideran estas mutaciones como
genómicas, porque aumentan o disminuyen el número de
cromosomas).

79
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4.3. MUTACIONES GENÓMICAS

Son las producidas por la alteración del número de cromosomas del cariotipo de una especie, y
pueden ser de dos tipos:

1) Euploidías:
Cuando el número de cromosomas resultante de la mutación es múltiplo del número haploide
originando individuos poliploides (3n, 4n, etc.).
Este tipo de mutación es rara en los animales, pero es frecuente en vegetales. Hoy en día
muchas variedades de plantas cultivadas son poliploides.

2) Aneuploidías:
Cuando el número de cromosomas resultante de la mutación afecta a una pareja de
cromosomas homólogos de la dotación diploide del organismo.
Las más comunes son la monosomía: falta de uno de los dos homólogos, y la trisomía: hay tres
homólogos.
Pueden producirse tanto en heterocromosomas como en autosomas.
La causa más frecuente de las aneuploidías es la no separación de los cromosomas en la
meiosis, ya sea en la primera o en la segunda división, originándose gametos con un exceso o un
defecto de cromosomas.

Ejemplos de aneuploidías en nuestra especie:

TIPO DE
SÍNDROME Características y síntomas de la mutación
MUTACIÓN

Síndrome de Retraso mental, ojos oblicuos, piel rugosa, crecimiento


Trisomía 21
Down retardado

Síndrome de Anomalías en la forma de la cabeza, boca pequeña,


Trisomía 18
Edwars mentón huido, lesiones cardiacas.

Síndrome de Trisomía 13 ó
Labio leporino, lesiones cardiacas, polidactilia.
Patau 15

Síndrome de 44 autosomas +
Escaso desarrollo de las gónadas, aspecto eunucoide.
Klinefelter XXY
Elevada estatura, personalidad infantil, bajo
Síndrome del 44 autosomas +
coeficiente intelectual, tendencia a la agresividad y al
duplo Y XYY
comportamiento antisocial.
Síndrome de 44 autosomas +
Aspecto hombruno, atrofia de ovarios, enanismo.
Turner X
Síndrome de 44 autosomas + Infantilismo y escaso desarrollo de las mamas y los
Triple X XXX genitales externos.

80
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

2. BIOTECNOLOGIA E INGENIERIA GENÉTICA.

La Biotecnología es una disciplina que engloba conocimientos de microbiología, bioquímica,


genética molecular, ingeniería industrial, inmunología, farmacología, ciencias medioambientales e
informática. Estos conocimientos se aplican para transformar una sustancia en un producto de
interés. Esta transformación se realiza por la acción de un ser vivo.

Aunque el término Biotecnología es moderno, desde tiempos inmemoriales se usan seres vivos
para lograr productos a partir de una materia prima. Un ejemplo de estos usos es la obtención de
cerveza a partir de cereales utilizando levaduras desde antes del año 6.000 a.C.

Con la aplicación de la Biotecnología no sólo se persigue la obtención de alimentos elaborados.


También se consiguen medicamentos, mejora de especies vegetales y animales, regeneración del
medio ambiente dañado e, incluso, proteínas humanas que ayudan a paliar enfermedades como la
anemia, el enanismo o la diabetes. La consecución de estos logros se está llevando a cabo gracias a la
aparición de las técnicas de ingeniería genética.

La Ingeniería Genética trata de la manipulación de los genes y de sus productos. Incluye un


conjunto de técnicas biotecnológicas, entre las que destacan:

La secuenciación del ADN: Técnica que permite saber el orden o secuencia de los
nucleótidos que forman parte de un gen. Con esta técnica se ha conseguido secuenciar el genoma
humano.

Obtención de organismos genéticamente modificados. Son organismos cuyo ADN ha sido


modificado de forma no natural (ni por reproducción, ni por mutación), mediante técnicas de
ingeniería genética. Se crean introduciendo uno o más genes, pertenecientes a otros seres, o
quitando uno o más genes, pertenecientes al organismo. Los organismos transgénicos están
genéticamente modificados, pero con genes pertenecientes a organismos de distinta especie.

Clonación. El proceso de clonación está encaminado a la obtención de un clon. Un clon es un


conjunto de elementos genéticamente iguales.

Todos los elementos del clon son iguales entre sí e iguales al elemento precursor. La palabra
clon también se utiliza para denominar a cada uno de los elementos genéticamente iguales. Cada uno
es un clon de los otros, es decir, son clónicos entre sí. Los elementos del clon pueden ser moléculas,
células u organismos completos.
Hay que entender que la clonación es un proceso natural, ya que, por ejemplo, las células
somáticas pertenecientes a un mismo tejido son células clónicas. Los hermanos gemelos univitelinos
son un clon.

El proceso de clonación es importante en Biotecnología, debido a la capacidad que ofrece para


multiplicar moléculas de ADN o ARN, células e, incluso, individuos completos. Así, podemos distinguir
distintos tipos de clonación, atendiendo a la finalidad perseguida:
Clonación de ADN o ARN mediante la técnica de clonación acelular (PCR), o la de clonación
celular. Se utiliza para aumentar el número de moléculas de ácido nucleico que se utilizan en una
investigación.

81
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

Clonación de células. No hay que confundirla con la clonación celular de ADN. En este proceso
se pueden clonar células aisladas o tejidos u órganos. Puede utilizarse para terapias génicas, por
ejemplo, en enfermos diabéticos.
Clonación de organismos completos, tanto plantas como animales. Se suele utilizar en
procesos de mejora genética de especies.

3. TÉCNICA DEL ADN RECOMBINANTE O CLONACIÓN CELULAR

La técnica consiste en introducir el gen


seleccionado en el interior de un vector y
éste, a su vez, dentro de una célula,
denominada célula anfitriona. Aprovechando la
maquinaria celular, el gen se expresa,
sintetizándose así la proteína codificada en el
gen. Además, al dividirse la célula, las nuevas
células formadas contienen ese gen que
también sintetizan esa proteína. Se genera un
grupo celular que contiene un genoma distinto.

Para utilizar está técnica primero se corta el ADN que queremos clonar con unas enzimas que
se aislaron en bacterias: las enzimas de restricción ("tijeras moleculares"). Cada enzima reconoce
una secuencia específica de nucleótidos y corta en ese punto cada una de las cadenas de ADN.

Los extremos libres que quedan se llaman extremos adherentes o pegajosos, porque por ellos
pueden unirse a otros fragmentos de ADN que hayan sido cortados por la misma enzima de
restricción, al ser complementarias las bases, obteniéndose un ADN recombinante.

Como vector se suelen utilizar


plásmidos, que se cortan con la misma
enzima de forma que queden extremos
adherentes complementarios. Se
obtiene así un ADN recombinante.

Posteriormente se introduce el
ADN recombinante en la bacteria
anfitriona. Todas las bacterias
descendientes tendrán el ADN
recombinante y por tanto el gen que se
quiere clonar.

82
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

4. APLICACIONES PRÁCTICAS DE LA INGENIERÍA GENÉTICA

Las aplicaciones son de gran interés e importancia, sobre todo, en tres ámbitos: en medicina,
en agricultura y en animales.
EN MEDICINA

Las aplicaciones se pueden concretar en cuatro aspectos:

1) La producción de sustancias con efectos terapéuticos. Solo se pueden obtener sustancias de


tipo proteico. Entre ellas podemos citar como ejemplo:

Somatostanina, hormona segregada por el hipotálamo que inhibe la síntesis de


somatotropina u hormona del crecimiento.
Insulina, hormona segregada por el páncreas, que regula la concentración de glucosa
en sangre.
Somatotropina, segregada por la hipófisis controla y regula el normal crecimiento
(evitando enanismo).
Interferones, que son proteínas elaboradas por células animales en respuesta a una
infección vírica.
Factor VIII antihemofílico (AHF), es una globulina que estimula a las plaquetas (para
la coagulación sanguínea).
Renina, es una enzima que cuaja la leche, necesaria para la elaboración de quesos (o
para algunos fármacos).
Celulasa, enzima hidrolítica de la celulosa, es utilizada en algunos preparados
digestivos.
Vacunas recombinantes, como la de la hepatitis B.

2) El diagnóstico de enfermedades hereditarias.


Para ello se utilizan técnicas como la amniocentesis, basadas en la extración de células
amnióticas del feto. Se pueden diagnosticar enfermedades como la hemofilia, la anemia falciforme,
la distrofia muscular y otras, que son debidas a mutaciones genéticas.

3) La identificación de genes humanos específicos.


Se trata de localizar e identificar el gen responsable de una enfermedad que se sabe que es
hereditaria.

4) La terapia génica.
A grandes rasgos, este tipo de terapia o curación de enfermedades consiste en reemplazar en
las células un gen defectuoso, causante de la enfermedad, por un gen normal.
Como realizar tal cambio en todas las células de una persona es imposible, los ensayos se
realizan introduciendo genes sanos en células seleccionadas. Por ejemplo, si la enfermedad es debida
al mal funcionamiento de las células madre de la sangre, en la médula ósea, es en esas células donde
se lleva a cabo la terapia.
Una de las primeras terapias génicas fue la realizada en los pacientes con deficiencia de ADA
(niños burbuja). Esta deficiencia provoca la acumulación de Adenosina, que produce la inviabilidad de
los linfocitos y degenera en una inmunodeficiencia completa. Para corregir esta deficiencia, en el

83
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

laboratorio se añade a las células madre de linfocito el gen y, posteriormente, se introducen en el


torrente sanguíneo del paciente. Se ha observado que después de la terapia génica el paciente es
capaz de formar linfocitos normales.

EN AGRICULTURA
En el ámbito de la agricultura siempre se ha pretendido obtener plantas cultivables, cuyos
rendimientos sean óptimos.
Desde hace muchos años se utilizan los conocimientos de la Genética, aunque muchas veces de
una forma inadvertida, y en este sentido deben entenderse los procesos de selección génica
realizados provocando cruces y originando poliploidías, para luego seleccionar aquellas plantas de
buenos resultados y multiplicarlas asexualmente, formando clones con ellas.

Con la aplicación de técnicas de Ingeniería Genética se están obteniendo plantas transgénicas,


es decir, plantas a las que se ha introducido ADN clonado (recombinante) y que lo han incorporado a
su genoma de forma estable.
Los principales caracteres conseguidos en las plantas transgénicas, son:
a) resistencia a herbicidas, a insectos y enfermedades microbianas.
b) incremento del rendimiento fotosintético.
c) mejora en la calidad de los productos agrícolas.

EN GANADERÍA

En animales, la aplicación de las técnicas de la Ingeniería Genética persiguen los objetivos


siguientes:
a) favorecer la investigación biomédica para estudiar la fisiología de los genes y la biología del
desarrollo.
b) mejorar la productividad o la resistencia a las enfermedades de animales útiles para la
humanidad.
c) producción de proteínas de valor farmacológico.

5. BIOTECNOLOGÍA Y BIOÉTICA

En 1971, V. R. Potter utilizó por primera vez la palabra bioética. A ella se refirió como el
diálogo entre la cultura científica y la humanística. En la bioética se unen los valores éticos de la
Sociedad y los hechos biológicos conseguidos por los científicos. Aunque la ciencia es imparable, en
1974 se acordó la interrupción de los trabajos realizados con ADN recombinante. Fue la primera
respuesta bioética. Con esta interrupción los científicos se plantearon hasta dónde podían o querían
llegar en el estudio con el ADN. En 1975 se convocó la Conferencia de Asilomar. En ella se pusieron
las bases para el trabajo de la manipulación genética.

Día a día, la Ciencia y la Tecnología avanzan y se adelantan a las normas jurídicas. Una vez
conseguido un avance científico, su aplicación es inmediata. La Sociedad, a través de los medios de
información, examina ese avance y lo critica, lo apoya o lo rechaza. Sin embargo, en Biotecnología,
¿se puede (o se debe) actuar así? Al crear un organismo transgénico se introduce un gen que no ha
coevolucionado con el resto del genoma y se desconocen las consecuencias que esto puede derivar.

En 1993, el Comité Internacional de Bioética de la UNESCO estableció unas normas para


evitar que la Biotecnología atente contra la dignidad humana.

84
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

En resumen, los criterios para evitar tales inconvenientes establecen una serie de limitaciones
por motivos ecológicos, sanitarios, sociales, políticos, morales, etc. Se trata, sobre todo, de:
a) salvaguardar la dignidad y los derechos de las personas.

b) imposibilitar la discriminación social e ideológica.


c) impedir desastres ecológicos.

d) evitar el desarrollo o aparición de enfermedades que pudieran ser incontrolables.

Frente a los posibles beneficios que puede ofrecer este campo, se encuentran diferentes
problemas que presenta la aplicación de la Ingeniería Genética:
Problemas sanitarios. Pueden aparecer nuevos microorganismos patógenos que provoquen
enfermedades desconocidas, o el uso de fármacos de diseño provoquen efectos secundarios no
deseados.
Problemas ecológicos. La liberación de nuevos organismos en el ambiente puede provocar la
desaparición de especies contra las cuales se lucha, con consecuencias aún desconocidas, ya que
cumplen una función en la cadena trófica de la naturaleza. Se puede pensar en posibles nuevas
contaminaciones debidas a un metabolismo incontrolado.

Problemas sociales y políticos. Las aplicaciones de la Biotecnología en el campo de la producción


industrial, agrícola y ganadera, pueden crear diferencias aún más grandes entre países ricos y
pobres. El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación
laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona.

Problemas éticos y morales. La experimentación en la especie humana puede atentar contra la


dignidad de la misma.

85
CEED Preparación a la Prueba de Acceso a la Universidad >25 BIOLOGÍA

ACTIVIDADES.

1. ¿En qué consiste la biotecnología? Propón algunos ejemplos.

2. ¿Qué es la ingeniería genética?

3. Indica algunas de las técnicas que se usan en la ingeniería genética.

4. ¿Qué es el ADN recombinante?

5. ¿Qué son las enzimas de restricción? ¿Para qué se usan?

6. ¿Para qué se usa la clonación bacteriana en la ingeniería genética?

7. ¿Qué son los organismos transgénicos u OGM?

8. ¿Qué aplicaciones generales tiene la ingeniería genética?

9. ¿Qué son los alimentos o cultivos transgénicos? ¿Para qué se emplean?

10. ¿Qué efectos negativos pueden tener los cultivos transgénicos? ¿ En qué
ámbitos?

11. ¿Crees que los OMG pueden ser un buen instrumento para combatir el hambre
en el mundo?

12. Explica en qué consiste la Bioética.

13. Indica qué tipo de reglas puede establecer la bioética, con qué fundamentos y
con qué legitimidad.

86