Agriculture Issues and Policies Series

CORN CROP PRODUCTION: GROWTH,

FERTILIZATION AND YIELD
No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or
by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no
expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of information
contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in
rendering legal, medical or any other professional services.
Agriculture Issues and Policies Series

Agriculture Issues & Policies, Volume I

Alexander Berk (Editor)
2001. ISBN 1-56072-947-3

Agricultural Conservation
Anthony G. Hargis (Editor)
2009. ISBN 978-1-60692-273-6

Hired Farmworkers: Profile and Labor Issues

Rea S. Berube (Editor)
2009. ISBN 978-1-60741-232-8

Environmental Services and Agriculture

Karl T. Poston (Editor)
2009 ISBN: 978-1-60741-053-9

Weeds: Management, Economic Impacts and Biology

Rudolph V. Kingely (Editor)
2009 ISBN 978-1-60741-010-2

Effects of Liberalizing World Agricultural Trade

Henrik J. Ehrstrom (Editor)
2009 ISBN: 978-1-60741-198-7

Economic Impacts of Foreign-Source Animal Disease

Jace R. Corder (Editor)
2009 ISBN: 978-1-60741-601-2

Agricultural Wastes
Geoffrey S. Ashworth and Pablo Azevedo (Editors)
2009 ISBN: 978-1-60741-305-9

Soybean and Wheat Crops: Growth, Fertilization, and Yield

Samuel Davies and George Evans
2009 ISBN: 978-1-60741-173-4

Corn Crop Production: Growth, Fertilization and Yield

Arn T. Danforth (Editor)
2009 ISBN: 978-1-60741-955-6
CORN CROP PRODUCTION: GROWTH,
FERTILIZATION AND YIELD

ARN T. DANFORTH
EDITOR

Nova Science Publishers, Inc.

New York
Copyright © 2009 by Nova Science Publishers, Inc.

All rights reserved. No part of this book may be reproduced, stored in a retrieval system or
transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical
photocopying, recording or otherwise without the written permission of the Publisher.

For permission to use material from this book please contact us:
Telephone 631-231-7269; Fax 631-231-8175
Web Site: http://www.novapublishers.com

NOTICE TO THE READER

The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or
implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of
information contained in this book. The Publisher shall not be liable for any special,
consequential, or exemplary damages resulting, in whole or in part, from the readers’ use of, or
reliance upon, this material. Any parts of this book based on government reports are so indicated
and copyright is claimed for those parts to the extent applicable to compilations of such works.

Independent verification should be sought for any data, advice or recommendations contained in
this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage
to persons or property arising from any methods, products, instructions, ideas or otherwise
contained in this publication.

This publication is designed to provide accurate and authoritative information with regard to the
subject matter covered herein. It is sold with the clear understanding that the Publisher is not
engaged in rendering legal or any other professional services. If legal or any other expert
assistance is required, the services of a competent person should be sought. FROM A
DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE
AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS.

LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA

Danforth, Arn T.
Corn crop production growth, fertilization and yield / Arn T. Danforth.
p. cm.
Includes index.
ISBN 978-1-60876-860-8 (E-Book)
1. Corn--Growth. 2. Corn--Fertilizers. 3. Corn--Yields. I. Title.
SB191.M2D27 2009
633.1'5--dc22
2009021729

Published by Nova Science Publishers, Inc. Ô New York

 CONTENTS

Preface vii
Chapter 1 Corn Crop Production: Growth, Fertilization and Yield 1
K. D. Subedi and B. L. Ma
Chapter 2 Responses of Agronomically Important Crops to Inoculation
With Plant-Associated Beneficial Bacteria in Crop-Farming
Systems – A Review 85
M. Madhaiyan, S. Poonguzhali, M. Senthilkumar and P.
Santhanakrishnan
Chapter 3 Effect of Abiotic Stresses on Growth, Metabolic Alterations
and Tolerance Mechanisms in Rice Crop 111
Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey
Chapter 4 Domestication and Conservation Genetics of the Lima Bean
(Phaseolus Lunatus L.) in Its Mesoamerican Diversity Center 187
Jaime Martínez-Castillo, Patricia Colunga-GarcíaMarín, Daniel
Zizumbo-Villarreal, Filogonio May-Pat and Julián Coello-Coello
Chapter 5 Potential Impact of Biological Nitrogen Fixation
and Organic Fertilization on Corn Growth and Yield in Low
External Input Systems 227
Márcia do Vale Barreto Figueiredo, Mario de Andrade Lira Junior,
Arminda Saconi Messias and Rômulo Simões Cezar Menezes
Chapter 6 Distribution and Risk Assessment of PAHs in Soils and Corns
Around Zhongyuan Oil Field, China 257
Shaoping Kuang and Hong Chen
Chapter 7 Low Temperature Effects on the Early Development
of Corn Seedlings 291
Ricardo Aroca
vi Contents

Chapter 8 Soil Water Balance and Yield of Dryland Maize Using

the CropSyst Model 307
M. G. Abraha and M. J. Savage
Chapter 9 Wrongful Exploitation and Terminator Technology 319
Keith Bustos
Chapter 10 Maize Doubled Haploids Via Anther and Microspore Culture 333
Bohuš Obert, Ľubica Uváčková and Anna Preťová
Chapter 11 Modelling of Maize Production and the Impact of Climate Change
on Maize Yields in Croatia 345
Višnja Vučetić
Index 353
 PREFACE

Corn or maize is a crop that originated in Mexico and has spread all over the world as a
major food crop. Sustainable production of a corn field crop as grain corn for feed, food and
biofuels, as well as sweet corn for fresh market or processing, and as silage for high energy
sources, requires scientific management of nutrients along with several other crop
management practices such as proper plant population density, timely seeding and harvesting,
soil water, weeds and pests control. Corn has become the major item in the diet of many
tropical peoples, the main grain used for animal feed in temperate regions, as well as new
stocks for many other purposes including recently used as feedstock for biofuels. Rapid
expansion of grain based ethanol production in North America, has already caused concern
about future food and feed supplies. This important book gathers the latest research from
around the world in this dynamic field.
Chapter 1 - Sustainable production of a corn (Zea mays L.) crop as grain corn for feed,
food and biofuels, as sweet corn for fresh market or processing, and as silage of high energy
source, requires scientific management of nutrients along with several other crop management
practices such as proper plant population density (PPD), timely seeding and harvesting, soil
water, weeds and pests management. This chapter reviews the recent advances on corn
nutrients management in relation to crop development, yield formation, economic
consideration and environmental sustainability of corn production. Corn types, physiological
basis of corn yield, nutrients uptake and partitioning by different types of corn will be briefly
reviewed. Critical timing of nutrients requirements by a corn plant, factors affecting nutrients
uptake, removal and utilization efficiencies are discussed under different crop rotations,
cropping systems, and growing environments. Recent approaches of determining/predicting
corn nutrients requirements such as crop-based indicators, site-specific nutrients management
and variable rates application for the sustainable nutrients management are discussed along
with the conventional soil test and plant tissue test approaches. Impacts of manures and
fertilizers and methods, timing, and rates of their applications on the crop yield and
environment such as nitrate (NO3--N) leaching, ammonia (NH3) volatilization and greenhouse
gas emissions such as nitrous oxide (N2O) from corn fields are also outlined. The concept,
importance and practical approaches of integrated plant nutrients management (IPNM) for
corn production are also discussed. Finally, the importance of corn residue for biofuel
(ethanol) production is discussed in relation to its impact on soil fertility.
Chapter 2 - Root colonizing bacteria (rhizobacteria) that exert beneficial effects on plant
development via direct or indirect mechanisms have been defined as plant growth promoting
viii Arn T. Danforth

rhizobacteria (PGPR). The search for PGPR and investigation of their modes of action are
increasing at a rapid pace as efforts are made to exploit them commercially as biofertilizers.
This review focuses on different kinds of PGPR, their mode of action as biofertilizers and
also development of microbial consortia is mentioned. These mode of action include fixing
N2, increasing the availability of nutrients in the rhizosphere, positively influencing root
growth and morphology. Although significant control of plant pathogens or direct
enhancement of plant development has been demonstrated by PGPR in the laboratory and in
the greenhouse, results in the field have been less consistent. Because of these and other
challenges in screening, formulation, and application, PGPR have yet to fulfill their promise
and potential as commercial inoculants. Recent progress in our understanding of their
diversity, colonization ability, mechanism of action, formulation, and application should
facilitate their development as reliable components in the management of sustainable
agricultural systems. Obtaining maximum benefits on farms from plant growth promoting
biofertilizers will require a systematic strategy designed to fully utilize all these beneficial
factors, allowing crop yields to be maintained or even increased with reduced fertilizer
applications.
Chapter 3 - Rice is a staple food crop for the majority of world population. Abiotic
stressful conditions of the environment such as salinity, drought, heat, chilling, anaerobiosis,
metal toxicity impose limitations on productivity of rice in the regions which are prone to
such constraints. The manifestations of these stresses include non-expression of full genetic
potential, differential transcription of many genes, induction of stress responsive genes
leading to cellular metabolic changes, alteration in activity behaviours of many enzymes,
overproduction of several compatible metabolites like amino acids, sugars, polyamines,
phytochelatins, organic acids, increased synthesis of many enzymes and stress specific
proteins. Salinity and drought are prime stressful conditions for rice crop in arid and semi arid
regions of the world. Changes in temperature rhythm impose heat or chilling injury. Soil
flooding or submergence causes oxygen deprivation leading to anaerobic stress. Metal ions
such as Pb, Cd, Hg, As, Ni are key pollutants of the soil, whereas Al toxicity is a problem in
acid upland soils. Most of the abiotic stresses cause overproduction of reactive oxygen
species (ROS) within the cell which cause oxidative damage to membranes and biomolecules.
Increased accumulation of compatible solutes, overproduction of antioxidative enzymes,
overexpression of transcription factors have been shown to confer tolerance in rice plants to a
wide range of stresses like salinity, drought and low temperature. Stress induced gene
products those involved in stress tolerance and those involved in signal transduction or as
transcription regulators have served as basis to engineer stress tolerant plants. To contribute to
food security and sustainability in rice production, it is essential to produce stress tolerant rice
plants suitable for cultivation in stress prone areas. This needs a detail understanding of
physiological and molecular mechanisms associated with stress tolerance more specially gene
products involved in stress tolerance and signal transduction. Transcriptome profiling of rice
seedlings has helped in great way in understanding how rice plants respond to abiotic stresses.
Successful attempts have been made to produce transgenic rice plants tolerant to different
abiotic stresses. However, with the rapid progress in the areas of functional genomics,
proteomics and metabolomics a more improved understanding of novel stress responsive
genes and their expression under various stresses is anticipated which will provide the basis
of new strategies to produce genetically engineered rice plants tolerant to a single or multiple
of abiotic stresses.
 Preface ix

Chapter 4 - The lima bean (Phaseolus lunatus L.) is the second major cultivated species
of the genus Phaseolus. It possesses high levels of genetic diversity and its primary gene pool
includes both wild and domesticated forms grouped into two main gene pools: Mesoamerican
and Andean. In the Yucatan peninsula, it is integrated into the traditional agricultural system
focused on corn cultivation, known as milpa, where it is planted as an associated crop. This
region possesses the largest diversity of domesticated forms in Mexico, a diversity that is
possibly being generated and maintained, in part, by their sympatric growth with wild
populations. However, the repercussions of human population growth and socio-economic
changes occurring in this region during the last 50 years have resulted in major modifications
to the milpa. One of the most evident consequences of these changes has been a decreased
planting of the crops associated with corn and a loss of the vegetational areas next to the
milpa where wild relatives grow. This review chapter shows the results of eight years of
research on the conservation genetics of P. lunatus in the Yucatan peninsula, México, using
ethnobotanical, ecological and genetic evidence. The results indicate that: 1) the genetic
diversity of P. lunatus from the Yucatan peninsula is higher in comparison to other
Mesoamerican regions; 2) wild populations show higher values of diversity than the
domesticated ones, probably due to a founder effect or recent processes of genetic erosion in
the domesticated forms; 3) the three most abundant landraces (70% of the planted area) had
the lowest values of genetic diversity—in contrast, 12 landraces with high levels of genetic
diversity were planted only by few farmers, a situation that shows the high risk of genetic
erosion in the domesticated gene pool; 4) wild and domesticated gene pools show a strong
genetic differentiation due to distance isolation and low levels of gene flow; 5) the wild-
domesticated gene flow is low, but it is three times higher than the domesticated to the wild
populations than in the opposite direction. This situation may lead to genetic assimilation of
the wild lima bean by its domesticated counterpart and may lead to the possible escape of
transgenes in this center of diversity. In situ programs urgently need to be established in this
important Mesoamerican region to conserve the milpa system, including the lima bean
landraces and its wild populations.
Chapter 5 - Maize productivity in tropical low external input systems is usually limited
by low soil fertility because crop uptake leads to a gradual depletion of soil nutrient stocks.
Since the use of chemical fertilizers is infeasible or undesired, the management of the fertility
of these soils depends primarily on low-cost processes based on nutrient recycling. The main
processes that may contribute to this are 1) biological nitrogen fixation (BNF), 2) nutrient
recycling through organic fertilization using plant residues or animal manures, and 3) where
feasible, the use of industrial and/or urban waste. BNF may contribute to maize growth and
yield by direct fixation in corn, or through the use of legume plants either as green manure or
as crops in rotation or intercropped with corn. Either way, BNF can usually be considered
sustainable long term, and usually would be one of the preferred nitrogen sources for low
external input corn production systems. Since almost all soil nitrogen is derived from the
atmosphere, in the absence of substantial use of nitrogen fertilizer most of the remaining
nitrogen pool is a product of BNF, either recent or past. The main difference between on-field
BNF and use of plant residues and animal manures is that nitrogen is previously fixed or
obtained from the soil pool on another field and later taken to the corn field. At the same time,
nutrient recycling through organic fertilization is usually limited due to the low amounts of
organic matter available for this use, especially considering the concurrent demands for this
material. Therefore, the efficient use of the different types of organic matter used as fertilizer
x Arn T. Danforth

requires knowledge about its quality and patterns of decomposition in order to guarantee
synchronization between nutrient supply and crop demand. Finally, the third approach in
these systems centers on the use of urban waste, most usually compost or sewage sludge, or
industrial by-products. Some of these may be quite rich in several nutrients at the same time,
but usually require careful investigation into possible negative effects of items such as heavy
metals and pathogens. Information is reviewed regarding BNF directly on corn, in green
manure or crop rotations involving this culture; strategies to improve the amount and quality
of organic fertilizers produced in low input systems; and some possible alternatives of urban
or industrial by-products, describing the current rationale to supply nutrients to maize crops at
a low cost using the resources available within the agroecosystems.
Chapter 6 - The purpose of this study was to determine the degree of contamination with
polycyclic aromatic hydrocarbons (PAHs) in samples of soils in both winter and summer,
corn roots and corn leaves around three different oily sludges in Zhongyuan Oil Field. The
contents of PAHs in samples were determined with HPLC. According to these data and the
ratio of Fla/Pyr, PAHs in oily sludge samples were mainly from petrogenic sources, and the
soil samples in both winter and summer were divided into petrogenic soil samples and both
petrogenic and pyrogenic soil samples by the source of PAHs. The PAHs contents of soil
samples in both winter and summer around three different oily sludges from high to low
present that the Third Wenming Plant of the oily sludge (3W)>the Third Mazhai plant of the
oily sludge (3M)>the Fourth Wener Plant of the oily sludge (4W), and the contents of PAHs
in soil samples in summer were lower than those in winter, and 2-4 rings were major
pollutants of PAHs in oily sludge. The contents of PAHs in soil samples around oily sludges
varied widely from 434.5 to 408.8 ng·g-1. Naphthalene, acenaphthene, fluorine, phenanthrene
and pyrene were major pollutants of PAHs in petrogenic soil samples, and the two
predominant PAHs in both petrogenic and pyrogenic soil samples were naphthalene and
phenanthrene. The PAHs contents of corn root samples from soils around three different oily
sludges from high to low were 3W > 3M> 4W, which was consistent with the order of the
contents of PAHs of soil samples in three plants. And 2-4 rings PAHs were still the most
predominant components of PAHs in corn root samples. The PAHs contents of corn leaf
samples from soils around three different oily sludges from high to low were 3W> 4W > 3M,
which was not consistent with the order of the contents of PAHs of soil samples and corn root
samples in three plants. And 5-6 rings PAHs were the most predominant components of
PAHs in corn leaf samples. Based on Nemero index P, the result of classification evaluation
showed soils around oily sludge were heavily polluted, and also present that the PAHs
pollution level in soil samples in winter was much higher than that in summer. According to
the pollution characters of PAHs in soil samples in winter and summer, and the contents
characters of PAHs in corn samples in summer, this article also determined the health risk
assessment and ecological risk assessment in soils around oily sludge in Zhongyuan Oil Field,
and the security of the corn as a crop.
Chapter 7 - Corn farming is extended all around the world, from temperate regions to
tropical ones. Moreover, corn crop represents an essential component of the global food
security. In temperate regions, corn growth is reduced by low temperatures at the early stage
of development (from germination to fourth leaf fully developed stage). At these stages, corn
seedlings are very sensitive to low temperatures as can be determined by several
physiological processes. These physiological processes include among others water transport,
respiration, photosynthesis and oxygen metabolism. On the other hand, there is a degree on
 Preface xi

the sensitivity to low temperature among corn genotypes cultivated worldwide. Corn
seedlings suffer a decrease in their leaf water content upon exposure to low temperatures.
This water deficit is caused by the lack of stomatal response and the diminution of the root
water uptake. Together with this water deficit, corn seedlings diminish their respiration and
their CO2 fixation. However, although CO2 fixation decreases, the amount of light that the
leaf receives remains constant. The excess of light non used to fix CO2 causes an excess of
energy in the photosystems, that ultimately is captured by the oxygen molecules, forming the
so called reactive oxygen species (ROS). These ROS are highly harmful when they exceed
the capacity of the leaves to remove them. Thus the differences on low temperature sensitivity
among corn genotypes is partially linked to better water status maintenance, keeping higher
rates of photosynthesis, and having more effective ROS removing mechanisms. Here, we will
review all these physiological aspects involved on corn seedlings tolerance to low
temperatures.
Chapter 8 - Crop growth models are increasingly being used as decision support tools to
help optimize crop and soil management strategies. Crop growth models need to be calibrated
and validated for the site and crop variety of interest. This study is undertaken to evaluate the
ability of CropSyst, a cropping systems simulation model, to simulate the yield and soil water
balance of dryland maize (Zea mays L. cv. PAN 6568) at Cedara, KwaZulu-Natal, South
Africa. Soil, plant, weather and management data were used as inputs for calibration and
validation of the CropSyst model. Model crop parameters were calibrated using past
experiments or obtained from model documentation, with slight modification to account for
varietal differences. Validation of crop parameters was carried out using an independent
dataset not previously used for calibration. The model-predicted phenology and grain yield of
maize with reasonable accuracy, but consistently under-estimated the soil water content of the
deeper depths with more pronounced under-estimation about 80 days after start of simulation.
The CropSyst model appears to be an adequately suitable tool for crop management
applications, climate change studies and research applications. For more accurate and reliable
results, the CropSyst model should be validated for the site and crop under study with more
observed data.
Chapter 9 - In an effort to restrict seed piracy, Monsanto intends to implement some
variation of genetic use restriction technology (GURT). Regarding such intentions, many
activist groups throughout the world (mainly in the US, Canada, and the UK) adamantly
contend that Monsanto and possibly other multinational agrochemical corporations (MACs)
will be acting immorally if GURTs, such as Terminator Technology (TT), are implemented in
the global agricultural industry. These activists argue that the potential implementation of TT
is immoral because it will grant Monsanto the power to wrongfully exploit resource-poor
farmers (RPFs) by reducing RPFs to mere means of production.
I contend that Monsanto will not necessarily be wrongfully exploiting RPFs through the
implementation of TT. More specifically, as long as Monsanto allows these RPFs to make an
autonomous choice to use terminator seeds and sponsors public plant breeding initiatives
(PPBIs), then Monsanto cannot be accurately considered to be wrongfully exploiting these
farmers.
There are three main parts to this essay. In the first part, I explain what exploitation is and
the conditions that must obtain for it to be immoral from a Kantian perspective. In the second
part, I briefly describe a few of the major objections that some activist groups have made
regarding the potential implementation of TT. In the third part of this essay, I apply the
xii Arn T. Danforth

conception of wrongful exploitation developed below to the current debate concerning the
potential implementation of TT in the global agricultural industry.
Chapter 10 - Within the past years, great progress has been made in development of
technologies for improvement of cereal crops of economic importance including maize.
Induction of embryogenesis from gametic and somatic cells and tissue culture are the main
techniques necessary for practical application of advanced biotechnological tools for targeted
improvement of plant. There is a requirement for haploid and doubled haploid material and
homozygous lines for cell culture studies and breeding in maize. Anther culture is currently
the most successful method producing doubled haploid lines in maize, but microspore culture
was also described as a good source of doubled haploids.
This review focuses on tissue and plant regeneration using anther culture, and cultivation
of isolated microspores. The effect of genotype, physiological status of donor plants, donor
material pre-treatment, cultivation conditions for maize anthers and microspores as well as
ploidy level of regenerated tissue and plants, and use of colchicine during early stages of
androgenesis induction for chromosome doubling are discussed here. Processes connected
with developmental switch towards embryogenic development of microspores and process of
plant regeneration from anther- and microspore-derived calli are also in the focus of this
chapter.
Chapter 11 - The effect of climate change on maize growth and productivity in the central
part of Croatia has been researched using the crop CERES-Maize model. The Zagreb
Maksimir meteorological data during the period 1949–2004 and pedological, physiological
and genetic data obtained in the field maize experiment in Zagreb 1999 have been used. In
order to estimate the intensity of the regional impact of climate change on maize production, a
synthetic meteorological series was created by the stochastic weather generator MetandRoll
for different climate change scenarios. The CERES-Maize model was run with
meteorological series representing the present climate and synthetic meteorological series
representing the changed climate. All climate change scenarios during the 21st century,
including only the climate change effect, projected a shorter growing season of 34-44 days
and a reduction in maize yields of 8-15%.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 1

CORN CROP PRODUCTION: GROWTH,

FERTILIZATION AND YIELD

K. D. Subedi and B. L. Ma1

Eastern Cereal and Oilseed Research Centre (ECORC), Agriculture and Agri-Food
Canada (AAFC), Central Experimental Farm, 960 Carling Avenue,
Ottawa, ON, K1A, 0C6, Canada

ABSTRACT
Sustainable production of a corn (Zea mays L.) crop as grain corn for feed, food and
biofuels, as sweet corn for fresh market or processing, and as silage of high energy source,
requires scientific management of nutrients along with several other crop management
practices such as proper plant population density (PPD), timely seeding and harvesting,
soil water, weeds and pests management. This chapter reviews the recent advances on corn
nutrients management in relation to crop development, yield formation, economic
consideration and environmental sustainability of corn production. Corn types,
physiological basis of corn yield, nutrients uptake and partitioning by different types of
corn will be briefly reviewed. Critical timing of nutrients requirements by a corn plant,
factors affecting nutrients uptake, removal and utilization efficiencies are discussed under
different crop rotations, cropping systems, and growing environments. Recent approaches
of determining/predicting corn nutrients requirements such as crop-based indicators, site-
specific nutrients management and variable rates application for the sustainable nutrients
management are discussed along with the conventional soil test and plant tissue test
approaches. Impacts of manures and fertilizers and methods, timing, and rates of their
applications on the crop yield and environment such as nitrate (NO3--N) leaching,
ammonia (NH3) volatilization and greenhouse gas emissions such as nitrous oxide (N2O)
from corn fields are also outlined. The concept, importance and practical approaches of
integrated plant nutrients management (IPNM) for corn production are also discussed.
Finally, the importance of corn residue for biofuel (ethanol) production is discussed in
relation to its impact on soil fertility.

1
Baoluo.Ma@agr.gc.ca or mab@agr.gc.ca. AAFC-ECORC Contribution No. 08-953.
2 K. D. Subedi and B. L. Ma

ABBREVIATIONS
BMP best management practice;
CHU Crop Heat Unit;
DM dry matter;
GDD growing degree days
HI harvest index;
IPNM integrated plant nutrient management;
LAI leaf area index;
LRS leafy reduced-stature;
NDVI normalized difference vegetation index;
NLRS non-leafy reduced stature;
NUE nitrogen use efficiency;
OM organic matter;
PAR photosynthetically active radiation;
PPD plant population density;
PM physiological maturity;
PPNT pre-plant nitrate test
PSNT pre-sidedress nitrate test;
SOC soil organic matter;
SSNP site specific nutrients management;
VRA variable rate application.

1. INTRODUCTION
Corn or maize (Zea mays L.), a crop originated in Mexico from where, it spreads to all
over the world as a major food crop. In the late 15th and the early 16th centuries when the
Europeans came to North and South America, they brought corn back home and spread it
throughout the world during the rest of their conquer (www.Maize.net). Corn is now one of the
most widely grown crops, and it is cultivated from the equator to the approximately 50 ° north
and south, and altitude from sea level to 3000 m above sea level (Morris, 2002). Although corn
is cosmopolitan in nature, it is the major staple food of several countries of Latin America,
Eastern Africa, Central America and South-east Asia including China. In the North America,
corn is grown as a food, feed and industrial crop. In the USA, corn production uses over 25%
of the nations’ cropland and more than 40% of the commercial fertilizer applied (Christensen,
2002). Unlike the other major cereal crops, corn is a C4 grass, efficient in utilizing water,
nutrients and CO2 to produce carbohydrates which are stored in the leaves and stalks and
harvested as grain starch. It is one of the most efficient field crops in producing superior
amount of dry matter (DM) per unit area (Oktem, 2005). Consequently, corn becomes the
major item in the diet of many tropical people, the main grain used for animal feed in
temperate region, as well as new stocks for many other purposes including recently used as
feedstock for biofuels. Rapid expansion of grain based ethanol production in North America
has already caused concern about future food and feed supplies. Crop improvement strategies
 Corn Crop Production: Growth, Fertilization and Yield 3

for increased biomass and yield and site-specific nutrient best management practices (BMPs)
should be developed to adapt to the changes and meet the new demands.
Nutrients management is a vast topic which involves cropping systems management, corn
types, BMPs suitable for improved nutrients use efficiency, maintain soil fertility levels for
sustainable production while protecting the environment. Maintenance of soil fertility to a
desired level is the most important production challenge for corn worldwide. Continuous corn
cultivation and declining soil organic matter (SOM) levels are the limiting factors for corn
production, especially in the smallholders in the tropical and subtropical corn production areas.
Efforts have been made to collect information on best management technologies of soil,
manure and fertilizers management on corn crops. In this chapter, acquisition and roles of
essential nutrients on corn development, nutrients requirements, and yield are discussed. Major
corn-based cropping systems, essential nutrients and their deficiencies, diagnostic tools for
nutrients deficiencies, integrated nutrients management approaches, and environmental
impacts of corn nutrients management are discussed.
Since corn is cultivated in a vast area, diverse cropping systems and agro-ecologies from
tropics to cool temperate environments, and from small-holding subsistence farmings to highly
mechanized and precision farmings such as of North America and Europe, it is not possible to
give detailed accounts of specific system in a single chapter. Therefore, attempts have been
made to provide a general overview of nutrients management for sustainable corn production.
This chapter describes the current understanding and advances on nutrients management for
corn production. Corn production practices in relation to its nutrients management are
discussed based on the peer-reviewed journal publications and non-reviewed sources globally.
Efforts have been made to give a global perspective of corn nutrients management, whereas
majority of the published literature are available from the North America. Although, this
chapter deals mainly on the nutrients management aspects of corn production, some of the
terminology and background information such as corn types, growth stages, corn-production
systems, are also briefly discussed.

2. CORN: TYPES, USAGES AND CLASSIFICATIONS

Botanically, corn is a monoceious species, with a male flower (tassel) located at the top of
the stem and female inflorescence (ear) located in the middle of the stem nodes of the same
plant. The spatial arrangement of the flowers facilitates both selfing and crossing (Morris,
2002). At flowering (anthesis), numerous pollens shed from the tassels, which are then trapped
by the receptive stigmas (i.e. the silks). The male inflorescence (tassel) of corn can produce
considerably more pollen grains than are required for pollination of a single plant (Schoper et
al., 1987). Goss (1968) estimated that as many as 2 to 5 million pollen grains are produced by
a typical corn plant. Pollen shed can begin before tassels have completely emerged from the
whorl and can continue over a week or longer (Ritchie et al., 1993).
There are many forms or types of corn, and they are classified based on botanical
description, utilization, growing environments, maturity types and so on. Some of the common
classifications of corn are briefly described below:
4 K. D. Subedi and B. L. Ma

2.1. Classification Based on Plant Taxonomy

• Flour corn — Zea mays var. amylacea

• Popcorn — Zea mays var. everta
• Dent corn — Zea mays var. indentata
• Flint corn — Zea mays var. indurata
• Sweet corn — Zea mays var. saccharata and Zea mays var. rugosa
• Waxy corn — Zea mays var. ceratina

2.2. Classification Based on Growing Environments or Adaptation

Although no universally accepted system exists for classifying corn production

environments, the International Maize and Wheat Research Center (CIMMYT), recognizes the
following four Mega Environments for corn production:

• Low land tropical

• Sub-tropical and mid-altitude transition
• Tropical highlands, and
• Temperate

Tropical and sub-tropical corn varieties are adapted to the more tropical environments.
They are characterized by tall plants, large tassels and have substantial capacity to store
photosynthates as simple sugars in the stem at crop maturity (Hay and Gilbert, 2001).
Tropical highlands and temperate varieties are developed such that they have reduced
tassel size with shorter plant height and retain less sugar in the stem at crop maturity.
Temperate varieties are the ones that are adapted to cooler, temperate regions of the world
such as North America and Europe.

2.3. Classification Based on Plant Stature or Leaf Types

Leafy corn: The Leafy corns are those with extra number of leaves above the ear node
(Shaver, 1983). For most temperate corn hybrids (varieties), the mature plant has about 5
leaves above the primary ear node. The gene Lfy causes the plant to have extra number of
leaves above the ear (> 6 and up to 11) compared to normal hybrids of the same maturity.
Leafy hybrids have recently gained popularity as silage corn (Roth, 2003), probably due to
potential longer window for silage harvest and greater silage dry matter (Ma et al., 2006b).
These hybrids have greater total number of leaves and leaf area than their conventional
counterparts (Shaver, 1983; Subedi and Ma, 2005a, 2005b). Because of the heavy foliage and
higher biomass (Andrews et al., 2000; Subedi and Ma, 2004), N nutrition requirement of Leafy
hybrids may be greater than the conventional hybrids.
Erect-leaf corn: Certain phenotypes of corn are developed with more erect leaf orientation
than the conventional corn types. Erect types are believed to be more efficient in canopy light
interception.
 Corn Crop Production: Growth, Fertilization and Yield 5

Brown mid-rib (BMR) corn: Brown midrib (bmr) plants are characterized by a brown or
reddish-brown pigmentation in the leaf midrib, rind and pith. Such corn contains a gene (bm3)
that results in lower lignin content being produced during the plant development. As a
consequence, BMR silage corn contains fibre that is more digestible than conventional silage
corn (Gehman et al., 2008).
Stay-green (SG) corn: Expression of the stay green (SG) trait has been reported in corn
(Tollenaar and Daynard, 1978; Ma and Dwyer, 1998; Rajcan and Tollenaar, 1999a, 199b).
Such phenotypes exhibit delayed senescence and have higher water and chlorophyll content in
the leaves at maturity than the conventional corn phenotypes. There is a limited understanding
of the physiological processes underlying this trait. Rajcan and Tollenaar (1999b) proposed
that leaf senescence in a recent corn hybrid was delayed because of an improvement in the
ratio of assimilate supply (i.e. source) to assimilate demand (i.e. sink) during kernel filling
period. They also found that total N uptake in aboveground portions were 10 and 18% greater
in the SG hybrid than an older hybrid under low and high soil N conditions, respectively.
Reduced stature (rht) corn: Reduced stature (Rht) corns are genetically modified for
reduced plant height. The total stalk height substantially reduced through reduced internode’s
length. These types may be with leafy or normal leaf numbers.

2.4. Classification Based on Uses

Grain corn: grain corns refer to flour, dent and flint corns that are mainly used for human
consumption, animal feed and industrial uses such as corn flour, starch, ethanol and others.
Pop corn: pop corns have ears with small kernells that pop while roasting. Pop corns are
used as one of the most common snacks.
Sweet corn: sweet corns are planted for fresh market or processing (e.g., canning) uses.
Sweet corn grains contain higher concentration of sugars than other corns. Some varieties of
sweet corn are more sugary which are also called se (sugary enhanced) and supersweet types
depending on the types of genes on them. Sweet corn consumption has increased considerably
worldwide. Fresh consumption of sweet corn is more beneficial compared to other derivatives
of corn due to its soft kernels, thin shells, high concentration of sugar and tastefulness. Dough
made from dry kernels of sweet corn is used for baby food, chips, dough products, pasta and
cakes. Sweet corn can be an excellent source of some minerals.
Baby corn: cobs harvested early, while the ears are very small and immature from the
specialized corn plants. Baby corn ears are usually processed and preserved prior to the
market.
Silage corn: corns that are harvested for fodder or silage before the plant reaches
physiological maturity. Corn silage production is an integral component of many dairy and
beef operations. In Canada, silage hybrids make up approximately 20% of corn acreage with
concentrated production in Ontario and Quebec, supporting the dairy industry (Dwyer et al.,
1998). Principally, any types of corn can be used as silage corn, but certain varieties have more
desirable qualities than others such as Leafy and the brown-midrib (BRM) types are more
silage specific hybrids. Traditionally, grain corn hybrids have been used dual-purposely for
silage production. However, selection criteria such as hard, high density kernels, strong stalks
and rapid kernel dry-down, which favour grain production, may be undesirable for silage
harvest, fermentation and digestibility (Ma et al., 2006b). Silage varieties should have the
6 K. D. Subedi and B. L. Ma

characteristics of slow maturing, softer starch kernels, and slow dry-down of stalks and lower
neutral detergent fibre (NDF) with high NDF digestibility (Dwyer et al., 1998).

2.5. Classification Based on Growing Duration (Maturity Classes)

• Early maturing varieties (<110 d)

• Intermediate (medium) duration varieties (110-120 d)
• Late maturing varieties (>120 d).

The rate of development of corn from planting to maturity is dependent mainly on

temperature (accumulated heat), although other factors such as photoperiod (day length),
altitude, and agronomic management practices such as water and nutrition management also
influence maturity to some extent. Therefore, air temperature is used to quantify response to
corn growth. The more realistic estimation of crop maturity would be based on the amount of
heat accumulated by a variety or hybrid. Rating of hybrid corn maturity and zonation of
production areas in North America employ several systems, including Growing Degree Days
(GDD; Wang, 1960), Crop Heat Unit (CHU; Brown and Bootsma, 1993), and Minnesota
Relative Maturity Rating (MRMR; Peterson and Hicks, 1973). The accumulated heat is
calculated according to the following formulae:

(i) Growing Degree Days (GDD; Wang, 1960; Dwyer et al., 1999a):

GDD = ∑ (TA – TB)∆t (1)

where TA is the average of daily maximum (Tmax) and minimum (Tmin) air temperatures, TB is a
base temperature below which development is assumed to cease and is usually set at 10 oC for
corn, and ∆t is a time step in days (Dwyer et al., 1999a). In addition, temperatures below 10 oC
and above 30 oC are assumed to be ineffective for development and Tmax values > 30 oC are set
to 30 oC and Tmin values < 10 oC are set to 10 oC.
(ii) Minnesota Relative Maturity Rating (MRMR) provides the relative ranking of the
number of days corn hybrid requires to reach maturity in relation to the time require
by previously ranked hybrid (Peterson and Hicks, 1979).
(iii) Crop Heat Unit (CHU; Brown and Bootsma, 1993) is similar to GDD, but it considers
that response of development to temperature differs between the day and the night,
therefore, is more commonly used in northern states of USA and Canada. The
maximum or daytime relationship uses 10°C (50°F) as the base temperature and 30°C
(86°F) as the optimum because warm-season crops do not develop at all when daytime
temperatures fall below 10°C, and develop fastest at about 30°C. The minimum or
night time relationship uses 4.4°C (40°F). The CHU is calculated according to eq. [2].

CHU = (Ymin + Ymax)/2 (2)

where,
 Corn Crop Production: Growth, Fertilization and Yield 7

Ymin = 9/5 (Tmin - 4.4) (3)

and Ymax = 3.33 (Tmax - 10.0) - 0.084(Tmax - 10.0)² (4)

Recently, another index, named General Thermal Index (GTI) was developed (Dwyer et
al., 1999). This system takes into consideration of the temperature functions separately for
vegetative and reproductive phases of corn (Stewart et al., 1998) as

FT(veg) = 0.0432 TA² - 0.000894TA3 (5)

FT(fill) = 5.358 + 0.01128TA² (6)

and GTI is expressed as

(7)

where, FT is the Temperature Response Function fitted to the vegetative (veg; before silking)
or grain filling period (fill; after silking) phase, n is the number of days in a period and ∆t is
time step in days.

3. CORN-BASED CROPPING SYSTEMS

Cropping system refers the sequence of crops in a piece of land or farm unit, grown in a
fixed period of time. There are diverse corn-based cropping systems in practice throughout the
world. Describing all systems is beyond the scope of this chapter. Only brief account of the
key corn-based cropping systems are discussed.

3.1. Monoculture

Monoculture refers growing a single crop over growing seasons in the same field. In the
temperate corn production systems such as Northern Corn-Belts of USA and Canada, and
some European Union countries, historically growing sole corn crop is a common practice.
However, corn and soybean (Glycine max L.) in biannual rotation is gaining more popularity.
8 K. D. Subedi and B. L. Ma

3.2. Intercropping

In the more tropical or sub-tropical environments, corn is grown in a subsistence label by

the small holders, and mostly under non-irrigated (rainfed) conditions. Corn-based mixed
cropping, such as in the subsistence farming of the Latin America, Asia and Africa where
usually legumes are intercropped (mixed, row or relay intercropping) with corn. Legumes such
as soybean, cowpea (Vigna unguiculata L.), field bean (Phaseolus vulgaris L.), mungbean (V.
radiate L.), groundnut (Arachis hypogeae), velvet bean (Mucuna pruriens L.) and others are
intercropped. There are also some cropping systems where corn is intercropped with cereal
crops such as finger millet (Elecusine corocana L.) (Subedi, 2002) or upland rice (Oryza
sativa L.) (Subedi et. al., 1993) or cotton (Gossypium hirsutum L.).

3.3. Corn Based Crop-Rotations

Different crop species can be rotated in the same piece of land one after another in the
same year or in different years. The common corn-based rotations in different parts of the
world are as follows:

• Corn followed by a legume crop (e.g. corn-soybean, corn-alfalfa (Mdicago sativa L.).
This is the dominant corn-based cropping rotation in US Corn Belt and Canada.
Christensen (2002) estimated that corn-legume rotation was used on almost 60% of
US corn acreage in 1996.
• Corn-small grain cereal-legume (e.g. corn-wheat (Triticum aestivum L.)-soybean,
corn-oat (Avena stiva L.)-soybean, corn-rice-lentils (Lens culinaris), etc.
• Corn- small grain cereal- small grain cereal or corn- small grain cereal (annual
system): In the tropical and sub-tropical regions such as parts of India and China,
Nepal and other countries, corn is rotated with other cereals such as wheat and rice in
a rice-wheat-corn or rice-fallow-corn cropping system.

3.4. Based on Water Availability

• Unirrigated or rainfed (most of tropical and sub-tropical) corn production: Where crop
production is totally dependent on the seasonal precipitation.
• Irrigated corn: Where corn production is supplemented with irrigation water. This
system is dominant in the plains states of USA, most of Australia, and in certain areas
of tropical and sub-tropical Asia such as India, China and Thailand.

3.5. Based on Tillage Practices

Tillage systems have a profound effect on soil fertility and nutrients management in corn.
Therefore, a brief account of various tillage systems in corn cultivation is introduced here.
Nutrients management in relation to tillage systems is discussed in the respective sections.
 Corn Crop Production: Growth, Fertilization and Yield 9

3.5.1. Conventional Tillage

In a conventional tillage system, corn is planted with mouldboard plough or any
conventional land preparation practices including ploughing, harrowing, planking, etc. This
practice was historically dominated in the US Corn Belt, and continues to follow in the
majority of small-holders, subsistence farmers of the tropics and sub-tropics. This system is
labour and/or machinery intensive and prone to extensive soil loss due to erosion. Almost all
of the crop residues are removed from the soil. Even in the highly mechanized crop production
system of USA, still about 30% of the corn acreage is under this system (Christensen, 2002).

3.5.2. Reduced-Tillage
This is a system in which soil disturbance is minimal and leaves at least 15-30% of the soil
surface covered by crop residue at planting. This system excludes the use of mouldboard
plough, and the intensity of tillage is reduced. Weed control is accomplished with herbicides
and/or cultivation. The reduced tillage practices were used on about 30% of corn cultivation in
1996 in USA (Christensen, 2002).

3.5.3. Conservation Tillage

Conservation tillage (CT) refers to any system that uses some tillage, but less than the
conventional techniques of seedbed preparation. Any tillage system that maintains at least 30%
of the soil surface covered by crop residue after planting is considered as conservation tillage.
Conservation cultivation is considered as one of the most successful agricultural inventions in
terms of soil management. In the USA, conservation tillage practices were estimated to be in
32% of the land in corn production in 1996, and there is a higher percentage of no-till/ridge-
till conservation tillage with the irrigated corn production system (Christensen, 2002).
Generally, the advantages of CT system are to conserve soil and moisture, reduce the costs
of fuel, machinery, and labour (Halvorson et al., 2006). No-till seedbed conditions pose
challenges for nutrient retention, fertilizer amendments, application methods and timing of
operations. There are also some disadvantages of NT system. In some situations, mulches
(crop residues) under the conservation tillage system acts as an insulating layer over the soil
surface, which can contribute to lower soil temperatures in the upper soil profile (Wolfe and
Eckert, 1999; Niehues et al., 2004) and shelter for insects. The decreased soil temperature
thereby lowers early season soil NO3--N released from organic matter mineralization (Andraski
and Bundy, 2008), may lead to the increased N-immobilization and denitrification (Fox and
Bandel, 1986). Reduced plant population densities, slow early growth and delayed tasselling
(Halvorson et al., 2006), and reduced grain yield (Dwyer et al., 1995b) has also been reported
as a result of cooler spring soil temperatures in the NT systems. The following two CT are
more common in practice:
No-till (NT) is defined as planting crops in unprepared soil with at least 30% mulch cover
(Triplett and Dick, 2008). In most no-till systems, no land preparation or cultivation is done
during production. The soil is left undisturbed so as to minimize the disturbance and to
maximize retention of crop residue on the surface. Seeds are planted in narrow seedbeds by
coulters or disk opener or row chisels. Normally, fertilizer or granular soil insecticides are
applied at the time of planting. Knockdown herbicides are generally applied before planting.
With better planters, herbicides and accumulated experiences, NT has gradually become a
more adopted practice in USA, Canada, and Australia since 1980. Basic idea of no-till planting
10 K. D. Subedi and B. L. Ma

is that the crop residue will provide benefits, including (1) conserving moisture; (2) reducing
runoff and erosion; (3) increased sequestration of soil organic carbon (SOC), and (4) reducing
weeds pressure through shading out. Higher level of SOC and soil organic N can be attained
by increasing cropping intensity under no-till management (Ortega et al., 2002).
Ridge-tillage is where soil is undisturbed from harvest to planting except for nutrients and
seeds injection. Seeds are planted on seedbeds prepared on ridges with sweeps, disc openers or
row cleaners.
Tillage systems have a significant effect on SOM. For example, after 8 years of no-till,
chisel plough and mouldboard plough, the chisel plough and mouldboard ploughs had less
total organic C than no-till plots in the 0-5 cm depth (Hussain et al., 1999). In the fine-textured
clay soils, no-till system often resulted in 15% or more reduction in dry matter and grain yields
of corn than the conventional mouldboard plough system in the cool and humid northeastern
Canada (Dwyer et al., 1995b).

4. CORN GROWTH AND PHYSIOLOGICAL BASIS OF YIELD

4.1. Growth Stages of Corn

Corn plant undergoes different distinct developmental stages to complete its life cycle.
Although various scales of growth measurement are used, the most practical and commonly
used scale is the one developed by Ritchie et al. (1993). It describes corn growth in two
distinct growth phases, i.e. “Vegetative” and “Reproductive”. Within each phase, different
growth stages are designated with different scales (Table 1).

Table 1. Vegetative and reproductive stages of a corn plant (Ritchie et al., 1993)

Growth stage Morphological characterization

Vegetative Stages
VE Seedling emergence
V1 First leaf unfolded and fully expanded
V2 Second leaf unfolded and fully expanded
V3 Third leaf eaf unfolded and fully expanded
V(n) nth leaf eaf unfolded and fully expanded
VT Tasseling
Reproductive Stages
R1 Silking
R2 Blister
R3 Milk
R4 Dough
R5 Dent
R6 Physiological maturity
 Corn Crop Production: Growth, Fertilization and Yield 11

4.2. Yield Components and Yield Determinants

Yield of any crop refers to the total amount of the part of a crop harvested on a given area
of land for economic uses. In corn, yield may refer to grain yield (grain corn), fodder yield
(forage or silage crop), marketable cob yield (sweet corn) and cobs weight (baby corn) and so
on. Yield components are the portions, each of which affects the yield as a whole. Yield
components in corn can be as follows:

a) Grain corn:

Grain yield (Mg ha-1) = Plants or ears ha-1 x grains ear-1 x mean grain weight (8)
Grain yield is usually expressed on a 155 g kg-1 water basis.

b) Silage corn:

Silage yield (Mg dry matter ha-1) = Plants ha-1 x weight of individual plant (9)

Silage corn is usually harvested when the whole plant moisture is within the range of 62 to
70%. Silage yield is often reported on a 650 g kg-1 water basis.

c) Sweet corn yield is usually reported as the number or weight of marketable ears per
ha, which is the product of number of plants per unit area by the number of marketable
ears per plant. Marketable ears refer to those ears with over 80% filled kernels and a
minimum length of 12 cm (Ma et al., 2007).

Clearly, plant population density (PPD; the number of plants per unit area) is the key
determinant of yield for all types of corn. Plant population density ultimately affects yield
through altering all the yield components. At high PPD, ear and kernel abortion occur because
of interplant competition for assimilates during the flowering period (Tollenaar, 1977), which
reduces the size of ear and ultimately the number of grains per ear and the size of individual
kernels. Andrade et al. (1999) suggested that PPD has also an important effect on partitioning
of dry matter (DM) between vegetative and reproductive sinks, and kernel set responded to the
amounts of resources available for each individual plant. Grain yield per unit area increases
with PPD until the increase in yield attributable to plants is not greater than the decline in
mean yield per plant (Tollenaar and Wu, 1999). At supra-optimal PPD, the number of grains
per ear, mean grain weight and cob-length were reduced (Bavec and Bavec, 2002). High PPD
coupled with low N supply often leads to high rates of kernel abortions and results in more
barren plants (Subedi et al., 2006). On the other hand, lower than optimum PPD delays the
time of canopy closure and thus reduces the interception of seasonal incident solar radiation
(Westgate et al., 1997), leading to larger number of grains per plant, but lower grain yield per
unit area (Andrade et al., 1999; Subedi and Ma, 2009). The PPD affects the post-flowering
source-sink ratio through its effects on plant leaf area, the amount of light intercepted per plant
and kernel number per plant (Borrás et al., 2003). Generally, higher PPD would enable the
crop to capture more PAR initially, but crowding increases after canopy closure.
The number of grains (or often refer to kernels) per ear is another important component for
grain corn. In corn, grain yield is correlated with kernel number, but uncertainty exists about
12 K. D. Subedi and B. L. Ma

the extension of the critical period of kernel set (Otegui and Bonhommer, 1998). Kernel
number is closely related to intercept photosynthetically active radiation (IPAR) during the
critical period. Pre-silking environment appears to define the potential number of kernels that
will be set as well as sub apical fertility, but the effectively fixed kernel number is dependent
upon post-silking conditions and hybrid characteristics. Pearson and Jacob (1987) observed no
evidence that shoot size per se controlled grain number or rate of grain growth; rather fertilizer
management during spikelet differentiation had most effect on yield. Number of kernels per
unit area is the most critical determinant of corn grain yield (Ritchie et al., 1988). Stresses that
enlarge anthesis-silking-interval beyond 5 d reduced grain yield per ear drastically (Ellings et
al., 1998). Monneveux et al. (2005) also observed that in tropical corn, grain yield was
negatively correlated with kernel abortion rate under low N stress.
Plant nutrition has also a significant effect on yield components. Grain yield was affected
by both N supplied before and after anthesis. For example, soil and foliar applied N around
silking can increase grain yield and nitrogen use efficiency by up to 15% (Ma et al., 2004).
The concentration of grain N remained declined rapidly during the first 20 d of grain filling
and remained constant thereafter (Ma et al., 2001). Subedi et al. (2006) observed that under
high PPD (90, 000 plants ha-1), as high as 15% of the plants were barren (plants without fully
developed ears), especially when the supply of N was limited. The effect of N stress on kernel
number occurs through its indirect effect on photosynthesis, silking dates and anthesis-silking-
interval (Singh and Wilkens, 2002).

4.3. Dry Matter Production and Partitioning

Corn is a C4 grass, which means, during the process of CO2 assimilation, the first stable
product of carbon reduction is a 4-C molecule. On a leaf surface and per unit time basis, C4
plants are more efficient in utilizing water, nutrients and CO2 to produce photoassimilates than
C3 plants such as wheat, barley (Hordeum vulgare L.) and rice (Oryza sativa L.). Unlike the
most small grain cereals, in which grain yield improvement during the past 60 years was
associated with the better partitioning of photoassimilates into the grains, resulting in the
significant improvement in harvest index (HI), corn yield improvement is attributable to its
general improvement in tolerance to abiotic (crowding, lodging, extreme temperatures, water,
nutrients, etc.) and biotic (insects, diseases, weeds) stresses (Tollenaar and Wu, 1999).
Partitioning of total biomass to the harvestable grains in tropical (Hay and Gilbert, 2001) and
temperate (Tollenaar and Wu, 1999) corn hybrids (varieties) has largely unchanged.
Harvest index refers to the proportion a crop that is of economic use. The HI in grain corn
is calculated as:

Grain yield
HI = x 100 (10)
Total biomass ( grain + stover )

Harvest Index is used as an indicator of the efficacy with which assimilates are partitioned
into the economically useful component of the crop. Generally, HI for corn without severe
stress ranges from 0.48 to 0.52, i.e. at maturity, around 50% of plant dry matter is partitioned
into kernels.
 Corn Crop Production: Growth, Fertilization and Yield 13

5. CORN NUTRITION
5.1. Essential Plant Nutrients

Higher plants require at least 17 nutrient elements for their growth and completion of life
cycle. These elements are also called essential nutrients. Arnon and Stout (1939) first proposed
the term. For an element to be considered as an essential, it must meet the following three
criteria:

(i) The plant cannot complete its life cycle in the absence of this element,
(ii) The function of an essential element cannot be replaced or compensated by another
element, and
(iii) The element is directly involved in the plants’ growth and reproduction.

5.2. Classification of Essential Plant Nutrients

The essential nutrients of higher plants, their sources and typical concentrations in plant
tissues are summarized in Table 2. Carbon (C), hydrogen (H) and oxygen (O) are considered
as non-mineral elements and are derived from air and water (Jones and Jacobson, 2005a). The
remaining 13 nutrients are classified either as macronutrients and micronutrients based on
their relative amounts of requirements by the plants. Within the macronutrients, nitrogen (N),
phosphorus (P) and potassium (K) are considered as “Primary Nutrients” while calcium (Ca),
magnesium (Mg) and sulphur (S) are called as “Secondary Nutrients”. The micronutrients
include boron (B), chlorine (Cl), copper (Cu), iron (Fe), manganese (Mn), molybdenum (MO),
and zinc (Zn). Nickel (Ni) is recently included among the micronutrients.

Table 2. Essential plant nutrients, their source, roles in the plant,

and typical concentrations in plant tissues

Element Origin Ionic forms absorbed by Role in plant Typical concentration

plants on dry tissue
Backbone of all organic matter;
Carbon (C) Air
necessary for photosynthesis
Important for osmotic balance,
Hydrogen (H) Water biochemical reactions and
constituent of carbohydrate
Constitution of carbohydrate,
Oxygen (O) Air/ Water
necessary for respiration
NO3- Constituent of proteins, chlorophyll 1.0-5.0%
Nitrogen (N) Air /soil
NH4+ and nucleic acids
Constituent of coenzymes, nucleic 0.1-0.5%
acids (DNA) and metabolic
substrates; storage of energy (ATP)
H2PO4-
Phosphorus (P) Soil and important in energy transfer;
HPO4-2
transportation of nutrients across
the cell wall and synthesis of
nucleic acid and proteins
14 K. D. Subedi and B. L. Ma

Table 2. (Continued)

Element Origin Ionic forms absorbed by Role in plant Typical concentration

plants on dry tissue
Involved with photosynthesis, 0.5-0.8%
+ carbohydrate translocation, protein
Potassium (K) Soil K
synthesis, disease resistance and
drought tolerance
A component of cell walls; plays a 0.2-1.0%
Calcium (Ca) Soil Ca+2 role in the structure and
permeability of membranes
Component of chlorophyll 0.1-0.4%
Magnesium +2 molecule, acts as an enzyme
Soil Mg
(Mg) activator, involves in carbohydrate
metabolism
Important component of plant 0.1-0.4%
Sulphur (S) Soil SO4-2 proteins (amino acid synthesis) and
chlorophyll
Important in sugar translocation, 6-60 mg kg-1
H3BO3
Boron (B) Soil carbohydrate metabolism, N and P
H2BO3-
metabolism, pollination
Cl- Involves with oxygen production in 0.1-1.0%
Chlorine (Cl) Soil photosynthesis, water use, disease
control
A catalyst for respiration; a 2-20 mg kg-1
component of various enzymes,
Copper (Cu) Soil Cu+2
protein synthesis and chlorophyll
formation, N metabolism
Involves with chlorophyll synthesis 50-250 mg kg-1
+2 +3
Iron (Fe) Soil Fe , Fe and in enzymes for electron
transfer
Controls several oxidation- 20-200 mg kg-1
+2 reduction systems, essential for
Manganese (Mn) Soil Mn
chlorophyll manufacturing and thus
photosynthesis
Molybdenum MoO4-2 Involves with N fixation, protein 0.05-0.2 mg kg-1
Soil
(Mo) synthesis, N metabolism
Involves with enzyme systems that 25-150 mg kg-1
regulate various metabolic
Zinc (Zn) Soil Zn+2
activities, including protein
synthesis and root development
Adapted from Dr. C.E. Swift (1993). Colorado State University, Extension, Tri River Area Agent
(Horticulture); W.F. Bennett (editor). Nutrient Deficiencies and Toxicities in Crop Plants, APS
Press, St. Paul, Minnesota.

All essential nutrients move from roots to the other parts of the plant, but they differ in
their pattern such that some nutrients move or are translocated from the older leaves to the
newer leaves when the supply of these nutrients to the growth point is limited. This
phenomenon is also referred as “mobility” of nutrients. Based on the mobility of nutrient
elements within the plant, plant nutrients are classified as mobile and immobile as presented in
Table 3.
 Corn Crop Production: Growth, Fertilization and Yield 15

Table 3. Mobility of essential plant nutrients within the plant

Mobile Nutrients Immobile Nutrients

Nitrogen Boron
Phosphorus Calcium
Potassium Copper
Magnesium Iron
Molybdenum Sulphur
Chlorine Zinc
Manganese

Within the mobile category, nutrients also vary greatly. For example, nitrate (NO3-) is
more mobile than phosphate (HPO4). The general rule is that deficiency symptoms are first
shown in the lower (older) leaves for the mobile nutrients whereas shortage of immobile
nutrients shows first symptom in the new leaves or terminal growth. In the soil system,
nutrients are also mobile such as NO3- is highly mobile while NH4+ is less mobile. Mobile
nutrient forms in the soil are easier to be taken up by the plant than non-mobile forms.

5.3. Deficiency Symptoms of the Essential Plant Nutrients

All essential nutrients have their specific and unique roles in plant growth. Although the
deficiency symptoms of some of the nutrients are identical in certain ways, they can be
distinguished each other. The typical deficiency symptoms on plant and soil-water system that
favors the deficiency are summarized in Table 4.

Table 4. Typical deficiency symptoms of various plant nutrients and favourable

conditions that enhance deficiency of different plant nutrients in corn

Nutrient Deficiency symptoms Favourable conditions

V-shaped yellow coloration from the margins in Low supply of N fertilizers
new leaves. Yellowing progresses from the Low mineralization in soil
Nitrogen (N) lower to the upper leaves and plants appear pale Water logging
green to yellow. Leaching of NO3--N and
N loss in gaseous forms (NH3 or N2O)

Purple margins or entire leaves especially Low test-P containing soils

during the seedling stage.
Phosphorus (P)
Yellowing to brown (necrosis) of the outer leaf
margins. These symptoms begin at the leaf tip
and progress down the margin toward the leaf
Potassium (K)
base. Plants become weak and may lodge.
Failure of the leaf tips to separate from the
Calcium (Ca) whorl. This is often called "laddering".
Low fertilizer-P applied
Cooler and wetter weather during planting which
reduces the mobility of P and its uptake by the
plant
Low soil pH
Low test- K containing soils
Under applied fertilizer K
Cooler and wetter environments may induce K-
deficiency
Soil compaction
Excess N supply can also lower K availability
Low Ca-containing soils
Calcium is often limited in acidic soils that
receive abundant rainfall to leach Ca
16 K. D. Subedi and B. L. Ma
Table 4. (Continued)
Nutrient Deficiency symptoms
Leaves have light green to yellow strips that run
Magnesium parallel with the blade. Chlorotic leaves
(Mg) generally turn reddish and develop spotted
necrotic areas.
Yellowing of the younger leaves of the corn
plant. Sulphur deficiency symptoms show up as
interveinal chlorosis of the leaves emerging
Sulphur (S) from the whorl. As the plant ages and the
deficiency become more pronounced, the entire
leaf turns yellow with slightly greener veins.
Generally S-deficient plants are stunted.
Severe B deficiency results in small, misshapen
cobs or do not produce ears or ears with
Boron (B) missing kernels (barren cobs). Under extreme B
deficiency, the leaves also may have small
white dead spots and be curled and brittle.
Wilting and restricted, highly branched root
Chlorine (Cl) systems are the main chloride-deficiency
symptoms.
Yellowing of leaves, stunted growth and pale
green leaves that wither easily.
Copper (Cu)
Leaf yellowing first appears on the younger
upper leaves in interveinal tissues due to low
levels of chlorophyll. Severe Fe deficiencies
cause leaves to turn completely yellow or
Iron (Fe) almost white interveinal chlorosis and then
brown as leaves die.
Inter-veinal chlorosis with white/grey spots of
the upper, new leaves of corn, resulting in
Manganese
premature leaf drop. Delayed maturity is
(Mn)
another deficiency symptom and is also a sign
of manganese deficiency.
Pale - green to yellow leaves and marginal
Molybdenum
chlorosis along side and tip of blade and thick
(Mo)
cupped leaves.
Zinc deficiency is the most widely occurring
among the micronutrients. Zinc deficiency
symptoms begin at the leaf base of the upper
leaves and expand toward the leaf tip as
Zinc (Zn)
interveinal chlorosis or a band of chlorotic
tissue between the leaf edge and the midrib.
Zinc deficient plants also exhibit delayed
maturity.
Sources: Jones and Jacobson (2005a)
http://www.ipm.iastate.edu/ipm/icm/2000/6-26-2000/kdef.html
Http://plantsci.sdstate.edu/woodardha/soilfert/Nutrient_Deficiency_Pages/CornD.html
http://agri.atu.edu/people/Hodgson/FieldCrops/Mirror/Nutrient%20Def.htm
http://www.ecochem.com/t_micronutrients.html
Favourable conditions
More common in acidic and sandy soils that are
prone to leaching
Mock or organic soils
Cool, wet soils
Sulphur is a mobile nutrient and is water soluble,
high rainfall during corn planting can cause more
S leaching.
Poor root development of corn
Low soil OM or reduced mineralization of
organic-S in the no-till systems.
Sandy soil, leached soils and calcareous soils are
deficient in B
Soils low in OM are deficient in B
Chlorine deficiencies can occur on sandy soils in
high rainfall areas or those derived from low-
chloride parent materials.
Copper deficiencies are mainly reported on peat
(muck) soils, sandy soils which are low in OM.
Copper uptake decreases as soil pH increases.
Increased P and Fe availability in soils decreases
copper uptake by plants.
Iron deficiencies are found mainly on high pH
soils, sandy soils low in OM.
Cool, wet weather enhances iron deficiencies,
especially on soils with marginal levels of
available Fe.
Poorly aerated or compacted soils also reduce iron
uptake by plants.
Uptake of Fe is also adversely affected by high
levels of available P, Mn and Zn in soils.
Manganese deficiencies mainly occur on organic
soils, high-pH soils, sandy soils low in OM, and
on over-limed soils. Soil Mn may be less available
in dry, well-aerated soils.
Mo deficiency occurs under acidic conditions,
sandy soils and soils low in OM.
Soils deficient in Zn
Calcareous soils with pH >7.5
 Corn Crop Production: Growth, Fertilization and Yield 17

5.4. Nutrients Composition in Corn Plants

Generally, typical values of nutrient composition are given based on repeated observations
and from unstressed plants. The typical nutrient concentrations in different parts of a matured
corn plant are presented in Table 5. Composition of essential nutrients in any plant depends on
growing conditions such as amount of nutrients supplied in the growing medium/soil, growing
environments (unstressed crop), crop type, variety, growth stage and several other factors.
Therefore, typical concentration is a vague definition and cautions should always be taken to
interpret such data. For example, chemical constituent of corn plant was dependent on amount
of nutrients supplied and frequency of irrigation (Ibrahim and Kandil, 2007).

Table 5. Dry matter and nutrient composition by corn plant part at maturity
(after Hanway, 1962)

Component Dry Matter Nitrogen Phosphorus Potassium

% of total %N % P2O5 % K2O
Grain 48 1.44 0.69 0.50
Stalks 22 0.43 0.14 0.90
Leaves 10.6 1.80 0.69 2.05
Sheaths 5.3 0.64 0.37 1.74
Husks 4.3 0.36 0.21 1.32
Shanks 1.5 0.50 0.18 1.68
Cobs 7.5 0.33 0.11 0.62
Tassels 0.5 0.97 0.50 1.70
Lower ears 0.5 2.04 0.87 3.00
Silks 0.2 3.50 0.87 2.57
Total 100 - - -

The concentrations reported above are not universal. The tissue nutrients composition
varies with the supply of nutrients (soil plus applied nutrients), genotypic ability to take up and
partition nutrients to different components, growing environment of the crop (water supply,
stress-free growing period, etc.) and stage of the crop at harvest. For example, tropical corn
varieties are reported to contain 1.46% N, 0.33% P, and 0.39% K in the grain (Feil et al.,
2005).

5.5. Sources of Essential Plant Nutrients

Plant nutrients that are to be supplemented for plant growth (i.e. in addition to from soil
and water systems) are available in many forms and through different sources. Broadly, the
nutrients for corn are supplied through two major sources:
18 K. D. Subedi and B. L. Ma

(i) Organic form: Organic sources are those originated from living organisms after their
decomposition. These include crop residues, green manures, biologically fixed N,
farm yard manures (FYM), liquid or solid compost or uncomposted animal manures,
processing waste, municipal waste, etc.
(ii) Inorganic form: Plant nutrients (macro and micro) and soil amendments (e.g. dolomite
lime) are supplied in artificially manufactured chemical medium called fertilizers and
supplements.

The typical nutrient concentrations in various organic sources are presented in Tables 6, 7
and 8, and macronutrient fertilizers and micronutrient supplements are summarized in Tables 9
and 10.

Table 6. Nutrient content of organic materials

Percentage by Weight
Organic Material
N P2O5 K2O Ca Mg S Cl
Blood (dried) 12 to 15 3.0 — 0.3 — — 0.6
Bone meal (raw) 3.5 22.0 — 22.0 0.6 0.2 0.2
Bone meal (steamed) 2.0 28.0 0.2 23.0 0.3 0.1 —
Cotton waste from factory 1.3 0.4 0.4 — — — —
Cottonseed meal 6 to 7 2.5 1.5 0.4 0.9 0.2 —
Cowpea forage (green manure) 0.4 0.1 0.4
Hay
Legume 3.0 1.0 2.4 1.2 0.2 0.3 —
Grass 1.5 0.5 1.9 0.8 0.2 0.2 —
Peanut hull meal 1.2 0.5 0.8 — — — —
Peanut meal 7.2 1.5 1.2 0.4 0.3 0.6 0.1
Peat/muck 2.7 — — 0.7 0.3 1.0 0.1
Pine needles 0.5 0.1 — — — — —
Poultry processing: DAF sludge 8.0 1.8 0.3 — — — —
Sawdust 0.2 — 0.2 — — — —
Seaweed (dried) 0.7 0.8 5.0 — — — —
Sewage sludge (municipal) 2.6 3.7 0.2 1.3 0.2 — —
Soybean meal 7.0 1.2 1.5 0.4 0.3 0.2 —
Adapted from Zublena et al. (1991).
 Table 7 Average nutrient contents of livestock manures. Data from manure samples collected between 1992 and 2004
and analyzed by different Ontario Labs

Manure Type Dry Total N NH4+-N P K (%) Ca Mg Zn (mg kg-1) Cu (mg kg-1) Mn (mg kg-1)
(number of samples) Matter (%) (mg kg-1) (%) (%) (%)
(%)
Dairy liquid (860) 8.5 0.36 1,527 0.09 0.24 0.49 0.14 48 17 40
solid (150) 24.2 0.61 1,278 0.17 0.50 1.54 0.36 95 29 107
Swine liquid (924) 3.8 0.40 2,648 0.13 0.17 0.12 0.06 85 30 22
solid (54) 29.8 0.90 2,582 0.47 0.56 -- --- 172 103 --
Poultry liquid (137) 10.6 0.83 5,581 0.3 0.3 1.6 0.08 70 11 64
solid (623) 52.6 2.37 5,495 1.11 1.17 4.6 0.28 238 33 204
Beef liquid (81) 7.95 0.52 1,794 0.13 0.43 0.7 0.3 57 14 61
solid (176) 28.6 0.73 1,011 0.23 0.57 1.5 0.41 129 36 112
Sheep solid (54) 31.3 0.76 1,862 0.27 0.70 1.5 0.38 170 20 140
Horse solid (32) 33.41 0.42 684 0.13 0.36 1.7 0.56 73 23 113
Source (Brown, 2005).
20 K. D. Subedi and B. L. Ma

These concentrations are typical nutrient ranges found in the highly nutritive animal
feeding systems. The nutrient concentration depends on protein content in the feed stuff, types
of animal, age of animal, manure management system (liquid versus stock piled, open versus
shaded piles and liquid versus solid and so on). This table gives a general guideline, but more
accurate data are required from determinations by chemical analysis locally and frequently.
The actual concentrations of nutrients in the small-scale subsistence farming vary greatly. For
example, Lupwayi et al. (2000) reported in highland Ethiopia, that manure samples taken from
experimental stations contain more N, P, K, Mg, Cu and Zn than those from smallholder
farms, probably due to differences in feed availability and quality. Stored manures usually
contain slightly higher N concentration than the same of fresh manures, probably because of
loss of some carbon.

Table 8. Nutrients concentration (g kg-1 dry weight basis) of cattle manure collected
from small-scale farms and experimental stations in Ethiopian highlands

Nutrient Range Mean± SD

Nitrogen (N) 11.7-27.4 18.3±4.6
Phosphorus (P) 2.2-7.0 4.5±1.5
Potassium (K) 10.6-54.4 21.3±11.2
Calcium (Ca) 10.1-24.6 16.4±3.9
Magnesium (Mg) 3.2-12.4 5.6±2.3
Iron (Fe) 3.7-22.4 10.8±0.5
Manganese (Mn) 0.27-1.90 0.78±0.39
Copper (Cu) 0.008-0.086 0.024±0.015
Zinc (Zn) 0.049-0.0217 0.092±0.036
Adapted from Lupwayi et al. (2000).

Table 9. Common chemical fertilizers and their nutrients composition

Nutrients concentration (% by weight)

Material Chemical formula
N P2 0 5 K20 Ca Mg S

Ammonium nitrate NH4NO3 30-33 0 0 0 0 0

Ammonium nitrate sulphate NH4NO3+(NH4)2SO4 26 0 0 0 0 15
(NH4)2SO4
Ammonium sulphate 21 0 0 0.3 0 24
Ammonium thiosulfate (NH4)2S2O3 12 0 0 0 0 26
NH3
Anhydrous ammonia 82 0 0 0 0 0
Aqua ammonia NH4OH 16 -25 0 0 0 0 0
.
Ca(NO3)2 4H2O
Calcium nitrate 15 0 0 19 1.5 —

Calcium nitrate/urea Ca(NO3)2+4CO(NH2)2

34 0 0 10 0 0

Potassium nitrate KNO3

13 0 44 0.6 0.4 0.2

Urea CO(NH2)2
46 0 0 0 0 0
 Corn Crop Production: Growth, Fertilization and Yield 21

Nutrients concentration (% by weight)

Material Chemical formula
N P2 0 5 K20 Ca Mg S
Urea (sulphur coated) CO(NH2)2+S
36 -38 0 0 0 0 13-16
Urea sulphate CO(NH2)2.H2SO4 17 — — — — 20
(NH4)2HPO4
Diammonium phosphate (DAP) 18 46 0 0 0 0

Monoammonium phosphate (MAP) NH4H2PO4

11 48 0.2 1 0.3 2.2
.
Ammonium phosphate nitrate NH4H2PO4 NH4NO3
27 15 0 0 0 0

Ammonium phosphate sulphate 4NH4H2PO4+(NH4)2SO4

13-16 20-39 0.2 0.3 0.1 15

Ammonium polyphosphate (APP) (NH4)3HP2O7

10 34 0 0 0 0
. .
Basic slag 5CaO P2O5 SiO2 0 2-17 0 3 -3 3 —
.
Concentrated superphosphate Ca(H2PO4)2 H2O
0 42-50 0.4 14 0.3 1.4
Ordinary superphosphate Ca(H2PO4)2.H2O+CaSO4 0 18-20 0.2 20 0.2 12

Nitric phosphate
14-22 10-22 0 8-10 0.1 0.3

Phosphate rock 0 2-35 0 — — 0

Urea ammonium phosphate (UAP) CO(NH2)2.NH4H2PO4

25 35 0 0 0 0
Potassium chloride KCI
(Muriate of potash) 0 0 60-62 0.1 0.1 0

Potassium nitrate KNO3

13 0 44 0.6 0.4 0.2

Potassium sulphate K2SO4

0 0 50 0.7 1 18

Calcium chloride CaCl2

0 0 0 36 0 0

Calcitic limestone CaCO3

0 0 0.3 32 3 0.1

Dolomitic limeston CaCO3+MgCO3

0 0 0 21-30 6-12 0.3
.
Gypsum CaSO4 2H2O
0 0 0.5 22 0.4 17

Hydrated lime (Slaked lime) Ca(OH)2

0 0 0 50 0 0

Magnesium oxide (Magnesia) MgO

0 0 0 0 45 0
.
Magnesium sulfate MgSO4 7H2O
0 0 0 2 10 14

Ammonium sulphate (NH4)2SO4

21 0 0 0.3 0 24

Elemental sulphur/ Wettable S S

0 0 0 0 0 90-100

Elemental sulphur (S): Flowable S S

0 0 0 0 0 52-70
Compiled from Zublena et al. (1991).
22 K. D. Subedi and B. L. Ma

Table 10 . Types and the approximate nutrient concentrations of different micronutrients

Nutrient Material Chemical Formula Concentration (%)

Boron (B) Borax (sodium tetraborate 11

decahydrate) Na2B4O7.10H2O

Boric acid 17
H3BO3
Clorine (Cl) Ammonium chloride 66
NH4Cl

Calcium chloride 74
CaCl2

Magnesium chloride 65
MgCl2

Potassium chloride 47
KCl

Sodium chloride 60
NaCl
Copper (Cu) Copper chelates 13
(Cu EDTA)
Copper sulfate CuSO4.H2O 35

Cupric ammonium phosphate Cu(NH4)PO4.H2O 32

Iron (Fe) Ferric sulphate 20

Fe2(SO4)3.9H2O

Ferrous ammonium phosphate 29

Fe(NH4)PO4.H2O

Ferrous ammonium sulphate 14

(NH4)2SO4.FeSO4.6H2O

Ferrous oxalate 30
FeC2O4.2H2O

Ferrous sulphate 20
FeSO4.7H2O
Iron chelates (Fe EDTA) 9 to 12
Manganese Manganese ammonium phosphate 28
Mn(NH4)PO4.6H2O
(Mn)
Manganese chelate 12
Mn EDTA

Manganese sulphate 24
MnSO4.3H2O

Manganous oxide 41 to 68
MnO
Molybdenum Sodium molybdate 38 to 46
Na2MoO4.2H2O
(Mo)
Ammonium molybdat (NH4)6Mo7O24.4H2O up to 54
Zinc (Zn) Zinc chelate Na2Zn EDTA 9 to 14

Zinc oxide 78 to 80
ZnO

Zinc sulphate ZnSO4.H2O 22 to 36

Compiled from Zublena et al. (1991).

5.6. NUTRIENTS UPTAKE AND PARTITIONING BY CORN PLANT

Nutrient uptake by a crop refers to the total amount of the nutrient as a fraction of the plant
DM at harvest. The amount of nutrients removed by a corn plant at harvest depends on the
 Corn Crop Production: Growth, Fertilization and Yield 23

availability of the nutrients in the soil, soil moisture, corn hybrids, and growing conditions that
determine the crop growth rate. Table 11 shows the typical nutrient concentrations found in a
corn crop producing 18.7 Mg ha-1 DM. These values give a general idea but the actual
concentrations vary considerably with different growing conditions, varieties and nutrients
supplying capacity of the soils.

Table 11. Typical concentrations of 13 essential plant nutrients in a corn crop yielding
18.7 Mg ha-1 dry matter yield

Primary Nutrients Content Micro-nutrient Content

kg ha-1 kg ha-1
Nitrogen (N) 240 Chlorine (Cl) 110
Phosphorus (P) 44 Iron (Fe) 3
Potassium (K) 200 Manganese (Mn) 0.6
Secondary Nutrients Zinc (Zn) 0.6
Sulphur (S) 34 Copper (Cu) 0.2
Calcium (Ca) 45 Boron (B) 0.1
Magnesium (Mg) 56 Molybdenum (Mo) >0.1
Adapted from Johnston and Dowbenko (2004).

One should not be confused with the “nutrients uptake” with “nutrients removal”. The
nutrient removal is the amount of nutrients that are removed in the harvested portions of the
crop such as grain, silage or forage (Ma et al., 2006a). In the case of corn, generally grain
(about 50% DM and 60 to 70% N) is harvested while 50% DM and about 30% N in the residue
DM (leaves, stalk, cobs etc.) are left on the same field if only grains are harvested. Therefore,
at least 1/3 of the total N and other nutrients in much higher proportions are remained and
recycled in the same field. In the small holder subsistence farming systems, corn residues are
often considered value for livestock feed, or as materials for heating, fencing and staking etc.,
corn stovers are partially or entirely removed from the corn-fields, leading to the land
vulnerable to erosion and much less nutrients available for the following crops. In such
systems, replenishment of plant nutrients is difficult to achieve and there is always a negative
balance of SOM and nutrients unless large amounts of manure and fertilizers are added each
year.
To determine if a nutrient element is critical for plant development and yield formation,
the concept of critical nutrient concentration is often referred. For example, the concept of
critical N concentration (Ncrit) assumes at any time a minimum shoot N concentration
necessary for maximum biomass production (Herrmann and Taube, 2005). A quadratic-plateau
model is used to derive Ncrit values. The relationship of Ncrit (g N kg-1 DM) and biomass
production is described by a mononomial function: W (Mg DM ha-1): Ncrit=34.12 x W-0.391.
Uptake rates of N, P and K nutrients can often be expressed as a linear relationship between
nutrients uptake rate and transpiration rate of corn canopy (Novak and Vidovic, 2003).

6. DETERMINATION OF NUTRIENTS REQUIREMENT BY CORN

Nutrients required by a corn crop can be determined in a variety of ways. Some of the
methods are quantitative while others give subjective judgement of whether the crop is
24 K. D. Subedi and B. L. Ma

deficient in particular nutrient(s). The common methods in practice to determine or assess the
nutrients requirement of corn crops are as follows:

6.1. Visual Observation

Corn plants deficient on a particular nutrient can be detected visually based on the
symptom they develop (See Table 2). This is a simple and inexpensive method but needs skills
of detection and knowledge of crop growth environment. Sometimes symptoms of more than
one nutrient can be confusion. For example, the deficiency symptoms of N and Mg are similar
unless they are carefully diagnosed. Colour pictures of deficiency symptoms are helpful for
such detections. The disadvantage of this approach is that (i) normally it will be already too
late to follow corrective actions, and (ii) this approach does not quantify how much nutrients
are to be added if application is needed for correction.

6.2. Soil –Based Indicators

Soil analysis to determine the nutrient availability in the soil is one of the most common
methods for determining nutrients requirement in any crop. This is a traditional method;
although newer methods and approaches are being developed for the determination of nutrient
status and for recommendations of the optimum fertilizer rates. Soil tests both pre-season and
pre-sidedress can help farmers to predict optimum fertilizer rates (Binford and Peterson, 1998;
Ma and Wu, 2008). Soil test methods require considerable time, efforts and cost for sampling,
processing and analysis (Bausch and Duke, 1996).

6.2.1. Pre-Plant Soil Test (PPNT)

This test quantifies the amount of soil residual NO3-- and NH4+-N concentrations (PPNT
soil test) and other nutrients such as P and K present in the crop rooting zone so that farmers
can adjust their fertilizer rates accordingly. Soil samples are collected before planting in
spring, generally from a soil depth of up to 60 cm and concentrations of available N (NO3--
and NH4+-N), P, K and any other nutrients of interest are determined in a chemical laboratory.
Fertilizers are recommended based on the concentrations of soil available nutrients. In the
humid environments, such as northeastern USA and Canada, response of corn grain yields to N
amendments is often poorly correlated with soil mineral N at pre-plant or pre-sidedress,
because they do not address the spatial and temporal variability of soil N (Ma and Dwyer,
1999). Similarly, Stevens et al. (2005) concluded that the PPNT performed less than
satisfactorily in many cases when compared with actual N responses from 75 site-year data.
Khan et al. (2001) proposed an approach of predicting soil organic N contributions to the
plant-available N supply through the analysis of NH4+ and hydrolysable amino sugar. This test
is known as Illinois Soil Nitrogen Test (ISNT). Osterhaus et al. (2008) evaluated this test and
concluded that ISNT and the soil organic fractions studied are not reliable predictions of corn
N response. The limitation with the PPNT is that soil samples are taken before corn planting
which does not account for growing season mineralization and denitrification, which
determine the amount of NO3--N available for corn.
 Corn Crop Production: Growth, Fertilization and Yield 25

6.2.2. Pre-Sidedress Nitrate Test (PSNT)

Magdoff et al. (1984) proposed the pre-sidedress soil nitrate test (PSNT), in which
recommendations of N fertilizer sidedress rates are based on the soil test prior to the time of
application, usually in late June or early July, during the crop growing season. This is also
called as late-spring soil nitrate test. This approach involves (i) time (when corn is 20-30 cm
tall) and (ii) soil depth (top 30 cm) of sampling. This test quantifies the amount of soil NO3--N
present in the crop rooting zone so that farmers can adjust the fertilizer rates accordingly (Ma
and Wu, 2008). A critical value of PSNT was defined to be 20 to 30 µg NO3--N g-1 soils
(Magdoff et al., 1984).
Unlike PPNT, PSNT is partially accountable for soil mineralization and preplant
application of N fertilizers and manures. Recommendations based on PSNT can trim down the
extra amount of fertilizer N used by farmers to guard against N-deficient corn (Magdoff, 1991;
Heckman et al., 1995). This approach has the greatest potential for soils with high
mineralization potentials (e.g. soils with high OM, or with manure history). Therefore, the
PSNT has shown promise as a means of quantifying and improving N management for corn
production (Magdoff et al., 1984; Binford et al., 1992). Andraski and Bundy (2002) concluded
that adjusting N application rates for corn using PSNT is more profitable than not making such
adjustment. Andraski and Bundy (2002) also reported that the accuracy of PSNT was highest
for sites with above-average May-June air temperatures and high yield potentials. Use of
PSNT has also been successfully extended to sweet corn and other vegetables (Heckman et al.,
2002). In Ontario, working with sweet corn, Ma et al. (2007) observed that the PSNT NO3--N
increased linearly with the fertilizer N rates, and there were significant positive correlations
between PSNT at V4 to V6 growth stages and the number of marketable ears. The drawback of
this test is that (i) it can be costly as it involves several samples per ha to be taken and
analysed, (ii) laboratory analysis of soil samples requires more time before critical stage of
corn N requirement elapses, and (iii) PSNT may not precisely address the spatial variability of
soil N.

6.2.3. Post-Harvest Nitrate Test (PHNT)

The post harvest nitrate test (PHNT) is an approach in which soil samples are collected
after the corn is harvested and analyzed for the residual soil NO3--N and other nutrients of
interest such as P and K. This test is not as common as PSNT or PPNT. However, PHNT
appears to be valuable to identify N sufficient and deficient sites (Schröder et al., 2000), and
justify environment assessment (Ma et al., 2006a). This test also indicates the potential for
ground water pollution since it measures the NO3--N not used by the crop (Sullivan and
Cogger, 2004). Elevated post-harvest soil NO3--N is an indicator of excess amount of N
fertilizer application in the previous crop (Gehl et al., 2006). Slight differences in site
characteristics (e.g. textural boundaries), can greatly influence conclusions derived post-
harvest soil sampling regarding the risk of NO3--N leaching (Gehl et al., 2006). The weather
patterns such as precipitation and temperatures affect the interpretation as they influence
mineralization of SOM and also leaching. This approach can help to decide on the preplant
fertilizer recommendations where PPNT is not possible. However, this is not a tool for in-
season N corrections.
26 K. D. Subedi and B. L. Ma

6.3. Plant Tissue Analysis (Destructive Method)

Destructive plant sampling is one of the commonly used indicators to assess crop N status
during the crop growing season. Plant analysis has proven useful in confirming nutrient
deficiencies, toxicities or imbalances, identifying “hidden hunger”, evaluating fertilizer
programs, determining the availability of elements not tested for by other methods, and
studying interactions among nutrients (Schulte and Kelling, 1999). Therefore, plant analysis is
considered as a tool for troubleshooting crop problems.
There are some disadvantages of tissue analysis other than labour and cost, such as (i)
contamination of plant samples with soil particles or pesticides residue can lead to erroneously
high results for iron, Al, Mn or Cu, (ii) decomposition of plant samples before it reaches to the
laboratory can result in a loss of carbon through respiration thereby increases the concentration
of other nutrients, (iii) measurement of N uptake by plants does not necessarily indicate the N
requirement of the plant as several studies have indicated that N concentration in shoot can be
greater than the minimum plant requirements for maximum growth (Dharmakeerthi et al.,
2006), (iv) As N supply decreases, N uptake, translocation and remobilization are also
affected. Therefore, it might not give a true picture of the N status.
Nevertheless, tissue tests give an overall picture of the nutrient level within the plant at the
time of sample taken. Generally, good relationships can be developed between soil nutrient
supplies, nutrient levels in the plant, and crop yield for a given location in a year. However,
differences in locations, variety, time and management often cause variations in these
relationships and make them difficult to interpret (Schulte and Kelling, 1999). For most
diagnostic purpose, plant analysis is interpreted on the basis of “critical levels” for each
nutrient. The critical level has been defined as the concentration that below which yields
decrease or deficiency symptoms appear (Schulte and Kelling, 1999). The nutrient
concentration of the crop changes as the plant matures and with the portion of plant sampled;
therefore, the critical levels are defined for a specific plant part at a specific stage of growth.
Tissue test can be whole plant analysis or a particular plant part such as individual leaf, plant
sap content or shoots. The commonly used tissue tests that are used in corn are as follows:

6.3.1. Whole Plant Tissue Test

Generally, corn seedlings (V6-V8 stage) are sampled and analysed for the nutrients
concentration, especially for total or NO3--N. This test is employed to diagnose the nutrients
status at specific stage and make recommendation for corrections. Iversen et al. (1985) found
that stalk N concentration at approximately 30 d after emergence appeared to be correlated
with relative grain yield and N uptake. Binford et al. (1992), however, suggested that tissue
test based on the concentrations of N in young plants would not be reliable indicators of N
availability in corn fields. Although, the relationships between plant N concentration and grain
yield were established, results varied with season, soil types and stages of measurement.
Similarly, Schröder et al. (2000) concluded that tissue tests are less value for the support of
decisions on N supplementation than indicators that are directly related to the soil or to the
measurement of leaf and canopy greenness. Tissue tests are unable to quantify excessive
availability of N at early crop stages as opposed to soil related indicators. Driskell and Richer
(1952) observed a strong correlation between tissue N concentration and visual deficiency
symptoms, however, no correlation was found between tissue test and potential nitrification.
Strong correlation was observed between tissue tests of P and K with deficiency symptoms.
 Corn Crop Production: Growth, Fertilization and Yield 27

In general, the greatest risk of high nitrate levels has been in drought-stunted fields that
have received excessive manure or N fertilizer. The risk of high nitrate levels is highest
immediately following a drought-ending rain. Nitrates accumulate in the lower portion of the
plant, so harvesting higher position of the plant under these conditions can help avoid high
nitrate concentrations. Plant analysis requires considerable efforts for sample collection and
processing. Repeated sampling throughout the growing season can be very laborious, time
consuming and costly.

6.3.2. Leaf Tissue Test

Concentration of earleaf at silking (R1) has been used as a tool for evaluating the N status
of crop by comparing the observed concentration of earleaf N with published critical values.
For corn, the earleaf from tasselling to silking is commonly used for analysis (Schulte and
Kelling, 1999). The typical concentration of nutrients in corn earleaf at silking stage is
presented in Table 12. Cerrato and Blackmer (1991) assessed the reliability of leaf N
concentration as an indicator of the N status of corn. They found that leaf N concentration
tended to increase with increase in rates of N application and with increase in grain yields.
Critical N concentration in the earleaf between tasselling and silking ranged from 2.6 to 3.6%
on DM basis (Roberts and Rhee, 1993). Cerrato and Blackmer (1991) concluded that for grain
yield, the critical N concentration in the leaf opposite or below the ear is not a sensitive
indicator of N status. More importantly, in most cases, this is too late to correct the deficiency
through in-season nutrients application.

Table 12. Typical Composition of Plant Nutrients in the Corn Leaf (Mid-Third of the
Earleaf Opposite The Ear) At Silking Stage

Nutrient Units Critical concentration1 Maximum normal concentration2

Nitrogen % 2.50 3.50
Phosphorus % 0.28 0.50
Potassium % 1.20 2.50
Calcium % 1.50
Magnesium % 0.10
Sulphur % 0.14 0.60
Boron ppm 2.0 25.0
Copper ppm 2.0 20.0
Manganese ppm 15.0 150.0
Zinc ppm 20.0 70.0
1 Maximum yield loss due to nutrients deficiency is expected with nutrient concentrations at or below
the "critical" concentration.
2 Maximum normal concentrations are more than adequate but do not necessarily cause toxicities.
Adapted from OMAFRA (2002).

6.3.3. Post-Harvest (End-of–Season) Stalk Nitrate Test

The end-of-season NO3--N test or post-harvest stalk nitrate test was proposed by Binford
et al. (1990), as a post-mortem to determine if excessive or insufficient N was available to the
corn crop during the later part of the development. This indicator gives valuable hints on N
fertilizer requirements for the subsequent corn crops. The 20 cm portion of corn stalk, 15-35
cm above the ground are analysed for NO3- concentration immediately after grain harvest. A
concentration of between 700 to 2000 mg NO3- kg-1 indicates adequate N supplied and over
28 K. D. Subedi and B. L. Ma

2000 mg kg-1 indicates that excess N was supplied or present in the soil during the growing
season (Binford et al., 1992). This test helps in N management in the coming season but not
for in-season correction for N - deficiency. Wilhelm et al. (2004) observed that NO3-
concentration of the individual sample varied greatly from <100 to >8000 mg NO3--N kg-1
DM, and increased downwards the stalk from ear level to the aboveground level. Moreover,
the range of NO3--N concentration for grain corn will not be applicable for sweet corn or silage
corn because these crops are harvested earlier than the grain crop. Therefore, stalk N
concentration will be higher prior to maturity. Similarly, N-dynamics in the soil such as
mineralization, denitrification and leaching are not taken into account. Thus stalk NO3--N
concentrations are also soil and climate dependent.

6.4. Crop-Based Indicators (Non-Destructive Methods)

Because soil and plant analysis require considerable efforts, time and cost to collect and
analyse samples, alternative technologies that reflect plant nutrients status can be useful. In the
recent past, many types of instantaneous diagnostic techniques have been developed to monitor
the crop nutrients status. These are called remote sensing or crop sensing devices.
Chlorophylls, xanthophylls and carotenes absorb solar radiation in the visible part of the
spectrum and thus reflect a small portion in these ranges. Reflectance in the visible range (λ =
550-675 nm) has been used to estimate leaf chlorophyll (Benedict and Swilder, 1961; Slafer
and Andrade, 1991), and carotenoid (Filella et al., 1995; Thomas and Gausman, 1977) levels,
and by extension the photosynthetic capacity of the crop (Ma et al., 1995). In the near infrared
(NIR) range, green vegetation strongly reflects incident radiation. The magnitude of the NIR
reflectance is governed by the scattering of light by plant tissues at different levels in the
canopy (Knipling, 1970) and is proportional to the vegetation biomass (Gutierrez-Rodriguez et
al., 2004). This distinct contrast in spectral behaviour between visible absorbance and NIR
reflectance formed the background and principle of terrestrial remote sensing for the past three
decades (Gitelson, 2004). Many remote sensing devices operate in the green, red and NIR
regions of the electromagnetic spectrum, which discriminate radiation absorption and
reflection from the surface of green vegetation. Such devices are used not only to detect crop
nutrient deficiencies but also crop stresses induced moisture deficiency (drought), disease, and
pests. The stresses are indicated generally by decrease in NIR reflectance.

6.4.1. Leaf Chlorophyll Meter (SPAD)

The leaf chlorophyll meter, which is commonly known as SPAD (Soil Plant Analysis
Development; SPAD–502 Minolta Camera Co. Ltd. Japan), is an easy to use device which
measures the intensity of light transmitted through the leaf at the 650 and 940 nm wavelengths.
The obtained SPAD values are linearly correlated with leaf chlorophyll content determined
with destructive measurements (e.g. Marquard and Tipton, 1987; Schaper and Chacko, 1991).
Wood et al. (1992) evaluated its field performance and found to be good predictor of grain
yield. Blackmer and Schepers (1995), Bausch and Duke (1996), and Waskom et al. (1996) also
found that chlorophyll meter is a useful method for rapid monitoring of in-season crop N status
and grain yield potential. The ability of the SPAD to accurately identify N deficiencies is
improved when normalizing the chlorophyll meter reading to an adequate or non-N limiting
 Corn Crop Production: Growth, Fertilization and Yield 29

reference plot within the same field (Schepers et al., 1992; Bausch and Duke, 1996; Ruiz Diaz
et al., 2008).
It is well established that chlorophyll meter readings are highly correlated with N
concentration in corn leaf tissue (Schepers et al., 1992; Wood et al., 1992). However, at the V6
stage, there is a narrow range of leaf chlorophyll, which made difficult to separate N-deficient
from N-sufficient field (Dwyer et al., 1991) and a large number of observations are required
(Costa et al., 2001). Although Schröder et al. (2000) concluded that leaf greenness and tissue
tests both are unable to quantify excessive availability of N at early stages as opposed to soil
related indicators, Ruiz Diaz et al. (2008) stated that sensing of crop to determine in-season N
addition seems to be a cost effective strategy with the reduced sidedress N rate.
The chlorophyll meter is a quick, easy to use, and results are instantaneous for in-season N
application decisions. However, there are some drawbacks of the SPAD system such that (i) N
sufficiency is not represented by a unique value as the SPAD value of sufficient N increases
with crop age (Blackmer and Schepers, 1995), (ii) corn hybrids differ substantially in
chlorophyll meter readings within a given N rates (Subedi and Ma, 2005a; Subedi et al., 2006),
(iii) position of leaf, and the readings taken at the early stage (before V6 growth stage) are less
effective, and the later season diagnosis of N deficiency (i.e. after V8 growth stage) is
generally too late to correct the deficiency, and (iv) the initial investment is high for small
scale farmers.

6.4.2. Canopy Reflectance Measurements

The use of remote sensing techniques such as canopy light reflectance could help
eliminate the need for extensive field samplings (Gilabert et al., 1996; Ma et al., 1996).
Canopy reflectance is defined as the ratio of the amount of radiation reflected by an individual
leaf or canopy to the amount of incident radiation (Schröder et al., 2000). Leaves absorb
mainly blue (450 nm) and red (660 nm) wavelengths and reflect mainly green (550 nm)
wavelengths. Reflectance measurements at these wavelengths therefore, give a good indication
of leaf greenness (Schröder et al., 2000). Several researchers have used the multi-spectral
canopy reflectance to indicate plant N status and predict yield potential in many crops,
including corn (Ma et al., 1996, 2005; Bausch and Duke, 1996; Osborne et al., 2002b), rice
(Casanova et. al., 1998), soybean (Ma et al., 2001), cotton (Gossypium hersutum L.) (Bronson
et al., 2003) and wheat (Aparicio et al., 2000; Flowers et al., 2003). Similarly, Osborne et al.
(2002a) used the spectral radiance to detect the P-deficiency in corn. On-the-go sensing
devices based on canopy reflectance have now been developed and tested for variable rate
application of N fertilizer according to site-specific field conditions (Raun et al., 2002).
A hand-held multi-spectral radiometer (Crop Scan, CropScan Inc., Rochester, MN), which
records percent light reflectance in 11 wavelength bands (460, 507, 559, 613, 661, 706, 850,
900 and 950 nm), approximately at 50 nm intervals is used for measuring nutrient status, weed
infestation and foliar disease intensity in corn. The data are processed through a minicomputer
connected to the sensor. The sensor readings are used to derive different vegetation indices.
The normalized difference vegetation index (NDVI) is one of the common indices (Ma et al.,
2005), and is derived as follows:

( R813 − R613)
NDVI= (13)
( R813 + R613)
30 K. D. Subedi and B. L. Ma

Ma et al. (2005 and 2007) evaluated NDVI data in comparison with soil tests (PSNT),
tissue test and chlorophyll meter readings all taken simultaneously at the V6 to V8 growth
stages of corn. They observed that PSNT, tissue N concentration at V6, SPAD and NDVI all
differentiated corn N response similarly (Figure 1), and these measurements were highly
correlated with one another. However, they concluded that none of the indicators tested at the
V6 to V8 growth stage was able to predict corn yield at harvest sufficiently, indicating that
environmental factors after N sidedress may have played dominant roles in their studies.
Recently, another ground-based commercial canopy device, GreenSeeker (NTech
Industries Inc., Ukiah, CA) optical sensor, is developed to measure canopy reflectance using
an active light source. The unit emits red (656 nm) and NIR (774 nm) light and measures how
much is reflected back to the sensor from the canopy. An NDVI is calculated with the same
assumptions as the Crop Scan. This technology has been extensively tested in recent years on
corn as a tool for variable rate application of N fertilizers. Teal et al. (2006) reported a poor
exponential relationship between NDVI of early season measurement (V6-V7) and grain yield.
But, they found a strong relationship (R² = 0.77) by V8 growth stage. In their study, the sensor
failed to distinguish variations in green biomass among fertilizer levels at the later stages (V8-
V9), likely due to canopy closure. They concluded that yield potentials in corn could be
accurately predicted in season with NDVI measured with GreenSeeker.
Such crop-based indicators are quicker (on-the-go) and require less labour, and can be
used as alternatives in predicting N requirement for corn production. For the N reflectance
index to be a practical, usable technique, it must represent plant N status as early as the V6
growth stage (Busch and Duke, 1996). It appears that, however, the N-stress sensing is more
accurate and successful later in the growing season (Ma et al., 2005, 2007; Ruiz Doaz et al.,
2008). Another drawback of canopy reflectance sensors is that soil background interferes with
the NDVI data before the corn canopy closure. The general consensus is that crop sensors are
useful tools in determining the N status of corn plants, it is important to take measurements at
the appropriate stage because NDVI values change with growth stages, the relationship
between chlorophyll concentration and soil N status is not linear – there is a maximum
concentration of chlorophyll that a plant can pack into a leaf, and results in the NDVI
saturation, the technology is not yet plug-and-play, and more work is needed to improve the
algorithms used for on-the-go application to adjust fertilizer rates based on NDVI in corn.
However, variable-rate fertilizer application based on crop sensors “seeing” and responding to
plants requirements will become reality in the near future.

7. NUTRIENTS MANAGEMENT FOR SUSTAINABLE CORN PRODUCTION

Sustainable nutrients management refers to the use of various available sources of plant
nutrients and agronomic management practices that optimizes the crop yield while maintaining
soil health and environment in a longer run. Although sustainable agriculture is an often
discussed subject, the application of its principles in practices is insufficient. In this section,
best management practices (BMP) in nutrients management for sustainable corn production are
discussed.
 Corn Crop Production: Growth, Fertilization and Yield 31

Figure 1. Leaf chlorophyll content (SPAD), canopy reflectance (NDVI), plant N uptake (kg ha-1) and soil
NO3- - N as affected by preplant N application. All measurements were taken at the V6 stage of grain
corn. The bars followed by different letters indicate significant differences (P < 0.05). Derived from Ma
et al. (2005).

7.1. Nitrogen

Nitrogen is one of the most important plant nutrients as it is required for the production of
proteins and chlorophyll, maintenance of photosynthetic efficiency, leaf area development, and
ultimately DM production (Muchow, 1998). It is also the most important yield limiting
nutrients all over the world. Limitation of N is more severe in tropical and sub-tropical farming
systems where cropping systems are intensive and degradation of soil fertility is alarming. In
Sub-Saharan Africa, for example, low soil fertility especially low N is among the major abiotic
stress limiting corn yield (Worku et al., 2007).
The component of soil N include SOM, residual organic and inorganic N from previous N
application, atmospheric N fixed by legumes and free-living bacteria and atmospheric
deposition (Legg and Meisinger, 1982). The availability of soil mineral N (SMN; i.e. NH4+ and
NO3-) affects the rate of leaf initiation and expansion, final leaf size and foliar senescence rate
(Schröder et al., 2000). In agricultural soils, SMN usually accounts for < 2% of the total N
(Keeney and Nelson, 1982). The SMN concentration does not necessarily reflect the crop’s N
32 K. D. Subedi and B. L. Ma

status but a positive relationship can be found between SMN and the NO3- concentration in
plants (Schröder et al., 2000).
Nitrogen management is one of the most extensively researched topics in agriculture
(Subedi et al., 2006). The use of N fertilizer has been identified as the most energy-consuming
component of corn production (Ma and Dwyer, 1998; Ruiz Diaz et al., 2008). Nitrogen use is
an issue of great concern in corn production because higher N rates are used by corn growers
as “insurance” which may have an adverse effect on the environment (Schröder et al., 2000).
Efficient use of N fertilization is becoming increasingly important in modern corn production
due to raising cost of N fertilizer and growing concerns about NO3- contamination in ground
and surface waters (Stevens et al., 2005), and gaseous N emissions to the atmosphere as a
major source of GHGs and air pollutions. Nitrogen uptake and partitioning, critical timing of N
requirement by corn plant, genotypic differences in N requirement, NUE and considerations
for N fertilizer recommendation will be discussed in this section.

7.1.1. Nitrogen Uptake and Partitioning in Corn

Soon after corn seedling emergence, the roots start to take up N from the soil solution. As
plant growth progresses, the rate of N uptake increases linearly (Ma and Dwyer, 1998). How
long a corn plant keeps on taking N from the soil is not very clear. In general, the rate of N
uptake by corn is relatively slow before entering the period of rapid growth at about the V6
growth stage, and great N accumulation occurs during the mid to late vegetative growth stages
(Ritchie et al., 1993). By silking, up to 70% or more (depending on hybrids, yield potentials
and weather conditions after silking) of the total plant N has been taken. After silking, rate of
N uptake becomes slow and eventually ceases prior to physiological maturity. Ziadi et al.
(2008) defined the minimum N concentration required to achieve the maximum growth as the
critical N concentration (NCrit). During the first three to six weeks after emergence, corn plants
take up soil mineral N at a rate of < 0.5 kg ha-1 d-1; during which period, soil net mineralization
rate can vary from 0.25 to 1.5 kg N ha-1 d-1 (Ziadi et al., 2008; Wu et al., 2008). Subedi and Ma
(2005a) observed that restriction of N supply until V8, and from V8 to physiological maturity
caused irreversible effects on grain yield and N-uptake in three contrasting corn hybrids. They
concluded that the timing of N application and level of N-deficiency in plant significantly
influenced N uptake, remobilization and N-dynamics in corn.
Partitioning of total N taken up by a corn plant at maturity may be dependent on the
hybrids, growing duration, level of stresses suffered by the crop and adequacy of soil N supply
during the growing season. Subedi and Ma (2005b) observed that the more severe the plants
were deficient in N, the greater was the recovery of applied 15N fertilizer. Under an adequate N
supplied situation, according to Subedi and Ma (2007), about 47% of the applied 15N was
recovered at harvest, of which 74% was partitioned in the kernels, followed by 14% in the
leaves, 10% in the stalk and only 3% in the roots (Figure 2). During grain filling period, there
are two sources of N for kernel development: (i) absorbed N from the soil, and (ii) re-
mobilized N from vegetative tissues (Ta and Weiland, 1992). With later application, 15N-
labeled N fertilizer was predominately partitioned to the ear, and stalk played an important role
in providing N to the grain during grain filling period. Subedi and Ma (2005b) observed that
the demand for N by grains from leaves and stalk was small when plants received adequate N
supply from current uptake. If the absorbed N from the soil is not adequate, great proportions
of N stored in the leaves and stalks are remobilized for kernel development. On the contrary,
when there is adequate N supply, corn plants continue to take up N from the soil until later
 Corn Crop Production: Growth, Fertilization and Yield 33

grain filling period. For example, Subedi and Ma (2005a) reported that corn plant continued to
take up N beyond 3 wk after silking, and the later N was applied, the higher proportion of it
was partitioned to the grain.
The sources of N for uptake are (i) residual soil mineral N, (ii) current-season mineralized
N, and (iii) N applied through fertilizers. Fertilizer N accounted for an increasing proportion of
crop N uptake as the N rate was increased, but N uptake from the soil source was always more
extensive, accounting for 54-83% of total plant N uptake (Ma et al., 1999a; Stevensen et al.,
2005).

Figure 2. Distribution (%) of dry matter, N content, 15N content, and N use efficiency (NUE) among
roots, stalks, leaves and kernels of a corn plant labelled with 5%15N2-NH4NO3, averaged over two
growing seasons. Adapted from Subedi and Ma (2007).

7.1.2. Critical Timing of Nitrogen Requirement by Corn

The critical time here refers to the stage of corn plant at which lack of N supply can cause
adverse effect on its growth and yield. As a general rule, any stage of corn development should
not experience an N-stress, although the demand of N varies considerably over the growing
period. The generalized trend of N uptake and response of crop yield to N supply is presented
in Figure 3 derived from Brown (1970). This figure shows that at very low soil N levels, there
is a clear evidence of N deficiency, and grain yield of corn increases rapidly with N fertilizer.
At very high soil N levels, grain yield declines, while plant N concentration continues to
increase. There is a window when plant tissue N concentration is low, and the crop suffers
from “hidden hunger”. It is important to know when N nutrition increases to a certain level,
although plant tissue N concentration continues to increase, grain yield does not respond to
increased soil N supply or yield stags. Further increases of soil N supply, grain yield may
suffer due to imbalanced source-sink ratios (Rajcan and Tollenaar, 1999a, 1999b).
Nitrogen supplied before anthesis has two main effects on yield as (i) plant size, and (ii)
grain number. High N from the onset of floral initiation directly increased the number of grains
34 K. D. Subedi and B. L. Ma

per plant or per unit area, presumably by increasing the rate of differentiation of spikelets
(Pearson and Jacob, 1987). Knowledge of both soil factors and crop N requirement is a pre-
requisite to the development of management strategies to maximize the yield response to
fertiliser N (Muchow, 1998). The critical timing of N requirement is important to know
because N amendment decisions can be made so that irreversible yield loss can be avoided.
There are, however, inconsistent reports about the critical timing of N requirement and N
uptake by a corn plant. In the US Corn Belt, it was observed (Scharf et al., 2002) that there was
no significant yield loss when N application was delayed until V11 to V16 growth stages;
although full yield was not achieved when N applications were postponed until silking, corn
was still responsive to N supply at the silking stage. In a controlled greenhouse study, Subedi
and Ma (2005a) reported that withholding N supply fromV8 to maturity reduced kernel yield
by 22% and N uptake by 53%. In the same experiment, when N supply was restricted until V8
stage, there was an irreversible effect on the size of ear and kernel number although overall
size of the plant (leaf number and shoot DM) was unaffected. They concluded that N supply
was more critical prior to silking than after silking as limiting N supply reduced ear size,
kernel yield and N uptake. Rendig and Crawford Jr. (1985) reported that post-anthesis N
nutrition affected the composition of the vegetative growth, but had no effect on yields or N
accumulation in the grain. Under low N conditions, however, Worku et al. (2007) observed
that post flowering N-uptake and utilization contributed to the improved performance in a set
of tropical corn varieties whereas N uptake before anthesis was of little relevance.

Figure 3. Relationship between nutrient supply, corn yield and nutrient concentrations in earleaf tissue.
Adapted from Brown (1970).

The uptake of N can be described by a linear relationship between the specific ion uptake
velocity from the soil and the rate of respiration (Novak and Vidovic, 2003). Therefore, for an
efficient uptake of N, the transpiration rate should be unaffected. For this, water supply plays
an important role. Maho et al. (2007) suggested that the amount of retained soil NO3- - N was
positively correlated with transpiration by corn (r = 0.943, P < 0.01, n = 12). Therefore, NO3-
leaching from a granitic regosol during the rainy season could be reduced by the increasing of
 Corn Crop Production: Growth, Fertilization and Yield 35

planting density due to the increase of N uptake by the plants and the increase of retained N in
soil derived from the increasing of plant transpiration.

7.1.3. Genotypic Differences in Nitrogen Uptake and Requirements

Nutrient requirements, uptake and utilization by different corn types (e.g. grain corn,
silage corn, sweet corn, leafy corn, conventional, and transgenic corn) may vary considerably.
Genotypic variation on N uptake and partitioning has been widely reported in conventional
corn hybrids (Beauchamp et al., 1976; Chevalier and Scharder, 1977; Moll et al., 1982;
Weiland and Ta, 1992; McCullough et al., 1994; Ma and Dwyer, 1998; Bertin and Gallais,
2000). For example, previous field studies show that the SG types taken up greater amounts of
N than the conventional hybrids (Ma and Dwyer, 1998; Rajcan and Tollenaar, 1999b; Borrell
et al., 2001). Costa et al. (2002) found no difference in different types of leafy, non-leafy,
reduced or not reduced stature corn hybrids. Similarly, Subedi and Ma (2005a, 2005b), in
greenhouse studies, reported there was no difference in total N acquisition, partitioning of 15N
and NUE among three contrasting (i.e. Leafy, stay-green and conventional) corn hybrids
(Table 13; adapted from Subedi and Ma, 2005a). Although Bruns and Abel (2003) reported an
increased N concentration and σ-endotoxin with increased supply of N in the whole plant of a
Bt corn hybrid at the V5 growth stage, Subedi and Ma (2007) found no such difference in Bt
and non-Bt conventional hybrids when compared the N uptake and partitioning patterns until
crop maturity.

Table 13. Total dry matter (DM, g plant-1), N concentration (NC, %) and N content (g
plant-1) in different plant parts or in the whole plant of conventional (Pioneer 3905), stay
green (Pioneer 39F06 Bt) and Leafy (Maizex LF 850 RR) corn hybrids, averaged over
five N treatments

Plant Parts Parameters Hybrid

Pioneer 3905 Pioneer 39F06 Bt Maizex LF850 RR
Root DM (g) 33.5b† 37.9b 54.3a
NC % 0.68ab 0.71a 0.59b
N content (g) 0.23b 0.25ab 0.29a

Stalk DM (g) 55.7b 60.0b 70.3a

NC (%) 0.47a 0.51a 0.44a
N content (g) 0.26a 0.30a 0.30a

Leaves DM (g) 35.3b 36.0b 45.9a

NC (%) 1.10a 0.98ab 0.85b
N content (g) 0.39a 0.35a 0.39a

Kernel DM (g) 100.4a 101.9a 102.9a

NC (%) 1.76a 1.59b 1.74ab
N content (g) 1.76a 1.61a 1.79a

Entire Plant DM (g) 224.9b 235.9b 273.2a

NC (%) 1.17a 1.06a 1.01a
N content (g) 2.64a 2.51a 2.77a
† Values followed by the same letter within each row are not statistically significant at P ≤ 0.05.
(After Subedi and Ma, 2005a).
36 K. D. Subedi and B. L. Ma

Subedi et al. (2006) observed that the Leafy corn was more sensitive to high PPD, especially
under low N supply conditions than a conventional corn hybrid, although the hybrids did not
differ in N acquisition and partitioning. In silage corn, Sheaffer et al. (2006) reported that
brown midrib and Leafy hybrids did not differ in N response.

7.1.4. Nitrogen Use Efficiency (NUE) in Corn Production

There are several definitations of NUE in the scientific literature. In general, soil scientists
and agronomists define NUE as the N uptake by a crop expressed as a fraction (or percent) of
total N fertilizer applied. Crop physiologists refer NUE as the dry matter produced per unit of
N taken up (i.e. g DM g-1 N) or the ratio of net photosynthetic rate to leaf N content. In order
to evaluate hybrid differences in plant N uptake and N utilization efficiencies, crop
physiologists also use the following formulae to calculate NUE and its components, N uptake
efficiency (NUptE) and N utilization efficiency (NUtiE) according to Moll et al. (1982) on a
kg ha-1 basis (Ma et al., 2003).

NUE = GDM / SN (14)

NuptE = PTN / SN (15)

UtiE = GDM / PTN (16)

where GDM refers to total grain dry matter (kg ha-1), PTN is plant total N at final harvest (kg ha-
1
) excluding roots, and SN is soil available N at planting (kg ha-1).
In this review, we use the terminology accepted by both soil and crop scientists: the plant
total N uptake as a percentage of applied N fertilizer. Using this method, the worldwide
estimated NUE of cereals including corn is approximately 33% (Raun and Johnson, 1999).
Clearly, improving NUE for cereal crops including corn production becomes more and more
important, both for economic benefit to producers and environment to the general public. The
use of best agronomic practices that help ensure the development of vigorous healthy crop will
increase the efficiency of applied N fertilizers. Of course, there are hybrids and varieties that
are more efficient in N utilization than others. Nitrogen use efficiency is measured using
various methods including the difference method and 15N-labeling techniques. The following
equation (Liang and Mackenzie, 1994) is commonly used to calculate NUE:

∑ [W × N (
i =1
i i
15
)]
N i1 −15 N i 0 × 100
NUE (%) = (17)
f ( a − b)

where Wi and Ni are the ith component of plant dry weight (g plant-1 or kg ha-1) and total N
concentration (fraction), respectively, 15Ni1 and 15Ni0 are the 15N% a.e. in the ith component of
the 15N-labelled and non-labelled plants, f is the total amount of N applied (g pot-1 or kg ha-1)
through the labelled source, and a and b are the 15N% a.e. in the fertilizer and background,
respectively.
The NUE is an important criterion to assess crop management systems. Nitrogen use
efficiency varies from one situation to another due to variability in several factors such as crop
 Corn Crop Production: Growth, Fertilization and Yield 37

health (plant stress), weather factors influencing soil temperature and moisture availability
(Westerman et al., 1999), PPD (Al-Kaisi and Yin, 2003), soil types (texture and SOM), years
and locations (Lory and Scharf, 2003), application timing, method of application/incorporation
of the fertilizer in the soil, and the nutrient responses of the cultivated variety (Nagy, 1997;
Nielsen, 2006). Improving NUE is therefore, an art of addressing the factors appropriately in
corn production. Similarly, methods of application, crop rotation and tillage practices also
affect NUE.
Selecting appropriate source of fertilizer or method and timing of application certainly
influences NUE. In order to increase fertilizer NUE and reduce N loading to the environment,
reliable methods that quantify crop N requirements must be developed and N fertilizers should
be applied precisely and timely. Matching supply of N from soil with the crop demand for the
nutrients is one of the nutrients management challenges of crop production (Heckman, 2002).
Precision agricultural practices attempt to allow timely and precise application of N fertilizer
to meet plant needs as they vary across the landscape (Raun and Johnson, 1999). For example,
sidedress can reduce NH3 volatilization, denitrification and NO3- leaching losses and increase
the availability of mineral N to the crop. Studies have shown that sidedress N applied during
early growth stages (i.e. close to the time of the crop’s greatest need) are used more efficiently
than preplant application (Magdoff et al., 1984; Magdoff, 1991; Ma et al., 2005). There is less
time for leaching or denitrification losses when N is applied after plant emergence (Vetsch and
Randall, 2004). Sainz Rozas et al. (2004) stated that higher NUE with economically
competitive grain yields can be obtained when N is applied at the V6 stage because gaseous N
losses are low and NO3--N leaching would be reduced. Split application of N fertilizers is
generally found to be beneficial than a single application. Corn plants can be responsive to
applied N until silking stage and later (Subedi and Ma., 2005a). The use of a sidedress
application strategy remains one of the easiest and least expensive ways to maximize NUE.
Other application methods and timings need to be matched wisely with N fertilizer source to
minimize the risk of N loss prior to plant uptake.
Applying N fertilizers without information about N-supplying capacity of the soil can
contribute to NO3- leaching and polluting ground and surface waters or not supplying enough
for economic yield (Heckman et al., 1995). Soil N supply is expected to vary among year and
location. Residual soil nitrogen (RSN) is the amount of inorganic N that remains in the soil at
the end of growing season after crops have been harvested. Adjustment of N rates to the
amounts of RSN present shortly before planting can contribute to efficient N-use (Schroder et
al., 2000). Soil RSN is estimated as the difference between all N-inputs (fertilizer N, manure-
N, biological fixed-N and atmospheric N deposition) and all N-output (N removed in crop
harvest, N losses through NH3 volatilization and denitrification), assuming that mineralization
and immobilization are generally balanced (Durby et al., 2005). A history of excessive N
application may decrease response of subsequent crops to fertilizer N due to greater release
from non-available N forms, most likely as a result of increased mineralization of crop
residues and recently formed SOM (Stevens et al., 2005).
Cropping systems, tillage practices and water availability all affect the timing and amount
of N fertilization for greater NUE. In the irrigated corn production systems, for example,
irrigation inputs needs to be optimized to prevent nutrients leaching from root zone, especially
on sandy soils (Raun and Johnson, 1999). Similarly, N application timing and rates should be
different for no-till or conservation tillage system than for conventional tillage system.
38 K. D. Subedi and B. L. Ma

Sources of N also affect NUE. For example, NH4+-containing fertilizers are less subject to
leaching or denitrification loss than fertilizers containing NO3--N. Ma et al. (1999a) observed a
greater NUE when manure was applied at the lower rate presumably because the slow release
of N from manure and increased uptake of N during exponential phase of plant growth. There
was a difference in timing of availability of manure N from fertilizer and manure treatment.
Mechanisms, such as leaching, volatilization, and denitrification significantly affect N
losses (Webster et al., 1992). Therefore, heavy N fertilization should be avoided and the most
effective N-fertilizer recommendation should be determined. Placing N where it can easily be
absorbed by the plant and using site-specific or variable rate of application techniques
improves NUE. Similarly, selecting an appropriate N fertilizer source is important for corn.
Selection of fertilizer depends on availability in the market, relative cost, soil pH, and
application equipments, etc. For example, Bacon and Thompson (1984) reported that urea was
superior to aqua ammonia because it minimized mineral N retention near the soil surface and it
was not susceptible to volatilization losses. Techniques that provide rapid assessment of soil
and plant N status on a frequent basis will be useful for the in-season N amendment (Bausch
and Duke, 1996).
Appropriate fertilizer N rate for corn crops is important in order to meet the crop critical N
demands during the rapid growing period, to minimize the wasteful application and to increase
NUE and economic benefit to the producers. Recommendation of N fertilization should
primarily focus on application (i) rates, (ii) timing, (iii) method, and (iv) choice of manure and
fertilizers. The economically optimum N rate (EONR) required for corn may vary spatially due
to variations in soil characteristics and temporally due to the interactions of environmental
factors (Schmitt and Randall, 1994; Miao et al., 2006; Mamo et al., 2003; Katsvario et al.,
2003; Scharf et al., 2005). Generally, the total amount of N utilized by a corn crop will
increase with yield level. However, recommendations of fertilizer rates based on yield goals
are often poorly correlated with actual EONR (Doerge, 2002). The variation in corn N
response has been attributed to differences in soil N supply, corn N needs for a given yield
level, and hybrid’s NUE potential. For example, EORN should be reduced in soils containing
high organic N concentration at the start of growing season. Therefore, corn N
recommendation typically includes a system of N credits from conditions that increase the
quantity of soil N available to the crop (Lory and Scharf, 2003). As a general rule, synchrony
of nutrients supply with crop demand is essential in order to ensure optimum crop yield, high
NUE, while reducing negative environmental effects (Ma et al., 2005).

7.2. Phosphorus

Although P is not present as large quantities as N in the plant tissues, it is involved in

many crucial metabolic functions that occur in plant cell (Johnston and Dowbenko, 2004). Soil
P is generally less mobile and is often not in shortage or excess for crop growth in most soils
of fine texture or with manure history. From production point of view, management of P is,
therefore, not as urgent and critical as N. However, there is a growing response of grain yield
of corn to P fertilizer, especially at high yield potentials. On the other hand, P leaching to the
water bodies has become one of the serious environmental problems.
Phosphorus deficiency usually appears when corn plants are young, when solution P
concentrations are either inadequate to meet the high P requirement of the faster growing
 Corn Crop Production: Growth, Fertilization and Yield 39

shoots, or the juvenile corn plants have difficulty absorbing sufficient amount of P, especially
in the cold spring conditions (Johnston and Dowbenko, 2004; Bittman et al., 2004).
Soil test P level is an important factor for understanding corn grain yield responses to
various P placements and tillage practices (Randall et al., 2001). Soil test before planting is the
best way to detect P requirement for corn, based on which recommendation of fertilizer P can
be made. The total soil P is usually much higher than the available P index because it includes
both the mineral and organic P pools. Soil P availability is usually evaluated with soil test
Bray-P concentrations, the amount of P that is likely available for uptake by the plant.
Phosphorus fixes easily with many compounds in the soil, and in a fixed form, it is less easily
available for the plants. When soil has a low pH, free Fe and Al ions bind with P, thereby
making P less available for plant roots. In the calcarious soils (high pH), P availability also
reduces as it binds with Ca to form an insoluble compound. Available soil P was correlated
positively with grain P content, and there was a considerable variability in grain P content for
any given soil test level (Lithourgidis et al., 2007).
The sources of P fertilizer can be organic (manures and supplements) and inorganic such
as rock phosphate and P containing chemical fertilizers. The inorganic sources of P fertilizer
are applied either broadcast before seeding or as a starter banded with corn planting. The use
of a starter fertilizer at planting is certainly one option for conditions where available P is low
in the soil or temperature is low during the early growth stage of corn. There is a growing
interest of "pop-up" fertilization (placement of small amounts of fertilizer in direct contact
with corn seed) in recent years. There are certain advantages of each of broadcast and banding
application, and suitability of each method varies with soil type, climate, crop rotation, tillage
systems and equipment availability and so on. The banded P can be placed either directly
below the seed or to the side of and below the seed. The most common method of supplying P
fertilizer is to apply a band about 5 cm depth to the side of the seed furrow (Bittman et al.,
2004). Banded application has been found to be more effective in the ridge-till and no-till
systems. The negative effect of fertilizer placed too close to the seed on germination is a
concern. However, the early research of Garg and Welch (1967) showed that percent seed
emergence did not differ among the placement methods. Yields of forage, percent P, and yield
of P were greater when P was placed in contact with seeds than when it was either mixed or
banded. Sanchez et al. (1991) compared the broadcast P as surface applied and disked into the
soil before planting with banded P as applied about 3 cm below the corn seeds. Band
placement reduced the amount of P required for specified sweet corn yield and also appeared
to result in higher total yield. The relative efficacy of banded to broadcast P depended on soil
test P level. They concluded that banded P was a reliable strategy of P used for sweet corn
production in Histosols. Placement is less of a consideration when soil tests are high. However,
when soil tests are low, substantial yield increases may be seen when P is applied either
broadcast or banded (Randall et al., 2001).
The relative efficacy of broadcast P was dependent on soil test-P. Yost et al. (1979) found
that broadcast treatments gave greater yields than banded treatments at the same rates for the
first crop, at the end of four crops. However, total yields of P uptake were very similar for
broadcast and banded treatment in which the same total amount of P had been applied. Borges
and Mallarino (2001) reported that there was a similar response of corn yield to P application
as broadcast or deep band (15-20 cm). Heckman et al. (2006) conducted a study in 12 northern
States of USA at 51 experimental sites, of which 17-47% of the sites testing below the critical
40 K. D. Subedi and B. L. Ma

level of soil P exhibited a yield increase to broadcast P. Marked residual effects were observed
with the higher rates of broadcast P.
In conservation tillage systems, surface application of P fertilizers and annual return of
corn residue to the soil surface can result in the P and K stratification (Mackay et al., 1987).
Phosphorus stratification occurs under long-term no-till conditions. This means that a build-up
of P occurs on or near the soil surface over time when the soil is managed in a no-till system.
This stratification is caused by normal crop demands on the nutrients deeper in the soil profile,
and the absence of incorporation of the surface applied P. However, unless an excessive
amount of P is applied, the build-up of P is always low. Vertical stratification due to deep-band
fertilization of P was evident for all treatments, but was more with band application, and
especially so on no-till cultivation (Mallarino and Borges, 2006).

7.3. Potassium

Potassium is required for photosynthesis, carbohydrate translocation, protein synthesis,

and for disease resistance and drought tolerance in plants. Optimum K fertilization is also
believed to increase N concentration in the grain as well as enhanced N-use by the crop. Not
all of the measured K is available to plants because the positive (+ve) cations are attracted by
the negatively charged ions in the soil humus and clay particles; also known as the cation
exchange capacity (CEC) of the soil. Only a small fraction of total K (<2%) is available in soil
solution as “soluble K”, which is the form available for plant uptake. Exchangeable soil K is
highly correlated with tissue test and deficiency symptoms (Driskell and Richer, 1952). In a
region or a corn field, the amount of K needed is site-specific and its application is therefore
dependent on three principal factors (i) soil test K, (ii) yield goal, and (iii) soil CEC. Potassium
uptake by plants can be affected by high salinity and N concentrations in the soil solution.
Heckman et al. (2003) reported that concentrations of K in the grains of corn were
positively associated with yield levels. Although K-deficiency is not always visually evident
and can be masked by other crop stress symptoms (Johnston and Dowbenko, 2004), K must be
available to corn plant from early growth stage for optimum corn development since over 70%
of the total K requirement is taken up by silking (Johnston and Dowbenko, 2004). Application
of K fertilizer is based on soil test recommendations. When soil test indicated shortage of
available K, up to 13% reduction in corn yield occurred in a humid temperate environment of
Canada (Subedi and Ma, 2009).
Tissue test and soil test (exchangeable K) are used to determine the requirement of K by a
corn crop. In northern climates, due to cold soils and slow plant growth rates early in the
growing season, responses of plant vigor and grain yield to starter fertilizers are often
anticipated. Heckman and Kamprath (1992) reported that corn yield increased linearly with
application of K up to 112 kg K ha-1. Similarly, Bundy and Andraski (1999) reported that it is
more likely for a positive response of corn yield to starter fertilizers on soils with soil test K
levels below 140 mg kg-1. Starter K fertilizer appears to be particularly important in reduced
tillage, since responses to applied K can occur even at high soil test levels.
Unlike N fertilizer, many farmers in the US Corn Belt apply a single dose of broadcast K
fertilizer before corn planting. In practice, responses of corn yields to preplant K fertilizer vary
considerably over locations, cropping systems and growing seasons. In conventional tillage
systems, the preferred method of K application is through land preparation and K is
 Corn Crop Production: Growth, Fertilization and Yield 41

broadcasted and incorporated into the soil. While in no-till systems, K fertilizers can be either
broadcasted on the surface or preferably banded. Bardoli and Mallarino (1998) observed that
no-till corn responded to deep banded K at some sites with high soil K levels. Vyn and
Janocicek (2001) showed that corn yield responses to starter K were larger with no-till than
tillage. Maximized corn yields are often obtained in the no-till system with high rate of starter
K, when no K fertilizer was applied in the previous fall. In furrow cultivation, starter K
fertilization for corn is, however, not an effective practice. Borges and Mallarino (2001)
observed a deep placement (15-20 cm) of K fertilizer superior to broadcast application. They
also observed that broadcast K fertilization leads to stratification of K in the ridge-till system,
which may reduce fertilizer use efficiency. To overcome K stratification, it is suggested that at
least some of the K fertilizer should be applied in a band with or near the seed row.

7.4. Calcium

Although considerable amount of Ca is required in plants as an integral part of plant

structure (i.e. cell wall), deficiency in Ca is not that common in agricultural soils. While most
neutral and alkaline soils contain adequate Ca, deficiency in Ca is sometime observed in acidic
soils. Correction for low soil pH with lime usually brings the soil Ca to the adequate levels for
corn crops. Similarly, maintenance of proper SOM through application of farm manures and
crop residues to the soil helps maintain Ca and other nutrient levels.

7.5. Magnesium

Magnesium is the constituent of chlorophyll molecule, it acts as an enzyme activator and

involves in carbohydrate metabolism. Deficiency in Mg is generally greater than Ca, but Mg is
often not a major yield limiting nutrient in most soils. Driskell and Richer (1952) reported
significant correlations between exchangeable soil Mg and visual deficiency symptoms of Mg
or tissue test in corn. Dolomite limestone contains large amount of Mg. Soils originated from
parent materials containing dolomitic limestone will not require Mg fertilization. Similarly, if
soil amendment is made with dolomitic limestone, there will be no additional requirement of
Mg fertilizers. If Mg deficiency is detected by visual symptoms or tissue or soil test, corrective
measures can be taken by soil or foliar application of Mg containing fertilizers such as
Chelated Mg or Magnesium oxide.

7.6. Sulphur

Sulphur is a secondary element, whose role on plant is vital as it is the component of plant
amino acids (precursor of proteins) and involved in chlorophyll formation. Sulphur plays the
key role in balanced nutrient application for top yields and superior quality produce. Both
organic and inorganic forms of S exist, with organic S as the predominant form in most soils
(Kowalenko, 2004). Organic S is unavailable to plants unless it is mineralized to inorganic
oxidized sulphate (SO4-). Rainfall and animal manure amendment supply soils with significant
amounts of S. Sulphur is attaining importance in all regions of the world because of frequent
42 K. D. Subedi and B. L. Ma

S-deficiencies in time and space (Khan et al., 2006). However, excess soluble S in the soil will
enhance the uptake of toxic Cd element and harm the normal growth of corn (Cui and Wang,
2006).
Several factors contribute to S deficiencies, including the increased use of S-free high
analysis fertilizers, intensive cropping, removal of crop residues and soil erosion. S-deficiency
symptoms are more often observed in crops at early growth stages since S can be easily
leached by precipitation and often accumulate in subsoil layers (Hitsuda et al., 2005). Critical
shoot S concentration of corn at early stages is reported at 0.8 g kg-1 (Hitsuda et al., 2005).
Reports of significant yield improvement with S fertilization are available, although responses
varied considerably over locations. Application of S up to 30 kg ha-1 enhanced average grain
yield of corn by 22% over unapplied control treatments (Dwivedi et al., 2002). Niehues et al.
(2004) showed enhanced early season DM production, and increased grain yield and nutrient
uptake when 11 kg S ha-1 was applied as a subsurface starter fertilizer. Khan et al. (2006)
reported that application of 60 kg S ha-1 significantly increased corn yield components and
grain yield, tissue S concentration as well as residual S in the soil after crop harvest in
Pakistan.

7.7. Micronutrients

Deficiencies in micronutrients have been frequently observed due to intensive cropping

practices and adoption of high yielding cultivars. Micronutrient deficiencies are particularly
problematic on sandy coastal plain soils due to low CEC, and organic soils due to low mineral
contents. Deficiencies of micronutrients are also widespread in many Asian countries due to
calcareous nature of soils, high soil pH, low SOM, soil salinity, continuous drought, high
bicarbonate content in irrigation water, and imbalanced application of fertilizers (Malakouti,
2008). Micronutrients are also often deficient in volcanic soils (Lisuma et al., 2006).
The availability of most micronutrients is influenced by soil pH. In general, the higher the
soil pH, the worst the problem becomes for many of the micronutrients. For example, alkaline
soils depress the availability of soil Fe, Mn, Zn, and increased the ratios of Na/Zn and P/Zn in
plant tissues (Mehrotra et al., 1986). Excessive application of N and P fertilizers can induce
Cu-deficiency.
Among the micronutrients, Zn followed by B is the element, which occurs most often in
deficiencies for corn production worldwide. Zinc deficiency is a very important nutrient
problem in the world’s soil as available Zn in most soils is in deficient level (Adiloglu and
Adiloglu, 2006). It was observed reduction in corn DM yield with B application, and B
accumulation and toxicity in plant roots especially in Zn-deficient soils (Adiloglu and
Adiloglu, 2006). Zinc deficiency is greatly correlated with band or broadcast application of Zn.
Application of small amount of Zn with seed could be used as a procedure for correcting Zn-
deficient corn. Pumbhrey et al. (1963) reported that ZnSO4 broadcast application followed by
incorporation before planting increased early growth and grain yield of corn. Higher
application rate increased Zn concentration in young and nearly mature corn plants. They also
showed that small amount of N banded with ZnSO4 enhanced the effectiveness of Zn fertilizer.
Dwivedi et al. (2002) reported that application of Zn up to 5 kg ha-1 increased corn yield by
19% over the control. The optimum dose of Zn was estimated to be 7.1 kg ha-1. Tariq et al.
(2002) in Pakistan reported that grain yield, yield components and uptake of Zn by corn
 Corn Crop Production: Growth, Fertilization and Yield 43

responded to Zn application up to 20 kg Zn ha-1. Hosseini et al. (2007) reported a significant B

× Zn interaction on plant growth and tissue nutrient concentration which were rate dependent.
In general, the effect of B × Zn interaction was antagonistic on nutrient concentration and
synergistic on growth. It is recommended that adequate Zn should be supplied when corn is
grown in high B soils, especially when availability of Zn is low. Serchan et al. (2004) in an
acid soil in Nepal found that corn yield decreased in the absence of B while Zn in the corn leaf
was deficient. Hensler et al. (1970) found that concentrations of Ca, Mg, P, S, Fe and Mo in
the plant tissue were usually higher from the limed soils than not limed soils but reverse was
true with Zn and Mn.
Boron deficiencies are mainly found in sandy soils, calcarious soils, soils with low SOM,
and in the regions with high rainfall or under irrigation, since borate ions are mobile in soils
and leach out quickly. Responses of crop yields to micronutrients have been evident in small
farms of developing countries. Kayode and Agboola (1983) reported a significant yield
increase of corn when N, P, and K fertilizers were applied in combination with Fe, Cu and Zn.
In tropical corn, application of N fertilizer reduced the concentration of Zn and Ca and
increased the concentration of Mn in grains (Feil et al., 2005). Lamond and Leikam (2002)
reported a positive response of applied Cl in corn, and application based on soil tests and plant
analyses has proven useful in identifying potential deficiencies of chloride.

8. INTEGRATED NUTRIENTS MANAGEMENT

FOR CORN PRODUCTION

8.1. The Concept of Integrated Plant Nutrients Management

Nutrients depletion through harvested crop components and residue removal or by

leaching, surface runoff and soil erosion accentuates the often very low inherent fertility of
many soils in the tropics (Syers, 1997). Sustainability of cropping systems requires that
nutrients removed from the soil be balanced by nutrients replacement so that soil fertilities are
maintained or improved (Ma et al., 2006a). Chemical fertilizer alone cannot sustain long-term
productivity on many soils and organic materials inputs are required to restore SOM levels and
crop productivity (Syers, 1997). Enhancing sustainable food production will therefore require
integrated strategies for the use of various sources of plant nutrients in conjunction with
improved soil, water and crop management practices (Keerthisinghe et al., 2003). For corn
production, farmers’ nutrient management decisions influence the amount and form of
nutrients used, the timing and method of fertilizer application, which in turn influences on how
much of a nutrient is used by the corn crop, how much is stored as a residual in the soil, and
how much becomes available as a potential water and air pollutant (Christensen, 2002).
Integrated plant nutrient management (IPNM) refers to the approach of integrating
available sources of plant nutrients to meet the crop’s nutrients requirement to achieve an
optimum yield while maintaining desired soil fertility (FAO, 1998). The IPNM attempts to
integrate all available means of soil and crop management so as to achieve locally optimum
land productivity under sustainable soil and fertility management (Subedi and Sapkota, 2002).
All sources of plant nutrients should be considered to optimize crop yield and quality, while
minimizing the impact of these nutrient sources on environment. Therefore, the main aim of
44 K. D. Subedi and B. L. Ma

IPNM is to increase and sustain soil fertility to provide a sound basis for flexible food
production systems that within the constraints of soil and climate can grow a wide range of
crops to meet changing needs (FAO, 1998). The role of IPNM seems to be very important in
the subsistence farming systems because there is always a limited nutrients supply, and soil
degradation is a major production and environmental threat. The following key steps are to be
considered while designing and implementing location-specific nutrient management for a
given domain or cropping system:

(i) Assessment of soil status: Information on soil parameters such as SOM, pH, nutrients
availability, texture, extent of nutrient leaching and erosion are to be gathered through
site visit and laboratory analysis.
(ii) Setting of yield target: based on the availability of farm resources, expected yield
levels for the crop under a particular production system are set.
(iii) Calculation of nutrient balance: based on the two estimates above, a nutrient balance
(i.e. input-output) can be calculated which indicates how much and which nutrients
are to be added. Emphasis is to be given for the balance of SOM.
(iv) Listing available nutrient sources: all available internal (farm level) and external
(purchased) nutrients sources are to be considered.
(v) Integrating all possible nutrient sources, and
(vi) Determine the amount, timing and methods of manure and fertilizers application for a
given crop, cropping system and land type.
(vii) Follow-up and monitoring: once manure and fertilizers are applied based on the
above assessments, periodic monitoring of corn fields is important in order to address
the in-season deficiencies if any induced by climatic variability such as excess rainfall
or drought and trouble shooting for such deficiencies.

In the IPNM system, soil, crop and nutrients are judiciously managed based on the
existing decision environments such as cropping systems, soil properties, labour availability,
market forces and social equity (Subedi and Sapkota, 2002). Several factors influence crop
yield and nutrients requirement by a corn crop. Therefore, soil properties (e.g. texture, SOM,
residual nutrients), climatic factors (e.g. precipitation, temperatures), cropping systems (e.g.
previous crops, tillage systems), crop variety grown (yield potential), and economic and
market considerations (e.g. prices of grain and fertilizers) should be taken into account when
making recommendations for manure and fertilizer application.
While deciding the amounts of chemical fertilizers, organic, inorganic and other sources of
plant nutrients are integrated along with soil and crop management options. It is a strategy that
incorporates both organic and inorganic plant nutrients to attain higher crop productivity,
prevent soil degradation, and thereby help meet future food supply needs. Therefore, IPNM
relies on a number of factors, including appropriate nutrient application and conservation and
the transfer of knowledge (Gruhn et al., 2000). This approach emphasizes applying nutrients as
and when needed. Similar to any other crop or cropping system, the key components of IPNM
for corn production are as follows:
 Corn Crop Production: Growth, Fertilization and Yield 45

8.2. Legumes in Rotations

Integration of various food, forage or vegetable legumes either in the crop rotations or as
intercropping with corn crop is a common practice everywhere, although the frequency of
rotations varies across locations and cropping systems. The advantages of legume
incorporation in a cropping system is well understood even in the subsistence farming systems
in terms of improved soil fertility (biologically fixed N), diversity in food values, nutrition and
farm income. Most of the legume species have a symbiotic relationship with certain bacteria
and fix N from the atmosphere. Corn crop can also benefit from the residual N from legumes
as well as the in-season N fixed by the companion legumes when grown in the intercropping
system. Numerous rotation studies have shown the benefit of extended rotations with legumes,
including interrupted insect populations (Cook, 1988), improved soil physical properties
(Raimbault and Vyn, 1991), a better balance of plant nutritional factors, increased root activity
(Copeland et al., 1993), a shift in soil mycorrhizal populations (Johnson et al., 1992; Jawson et
al., 1993), reduced disease severity (Reid et al., 2001), and enhanced seasonal N mineralization
(Vanotti and Bundy, 1995; Ding et al., 1998), reduced N inputs and increased corn yield (Ma
et al., 2003b). For example, corn in annual rotation with legume crops could increase corn
yields by as much as 20% and reduce the amount of chemical fertilizer N by as much as 180
kg N ha-1 (Ma et al., 2003b). The average increase of corn yield following soybean ranges
from 10 to 15% in the Midwestern USA (Griffith et al., 1988). Wolfe and Eckert (1999)
observed that in a no-till system, corn following soybean produced greater yield than corn
following corn system, indicating greater contribution of previous legume crop in the rotation
than the amount of crop residue on soil. Lawrence et al. (2008) found that following legume
forage turn over, only a small quantity of starter N was sufficient for optimum of silage corn
yield. In the subsistence farming systems, inclusion of legumes will play an important role in
diversifying crops and ensuring improved household food security.

8.3. Green Manures and Cover Crops

Green manures are the plants grown for the purpose of incorporation into the soil while
they are green. Green manuring involves the soil incorporation of any field or forage crop
while green or soon after flowering, for the purpose of soil improvement (Sullivan, 2003).
Literarily any plant species can be used as a green manure crop, however; species vary
considerably in their adaptation, green manure values and nutrients composition. Generally
leguminous species, plants with succulent tissues, fast growing and plant parts not suitable for
other uses (e.g. forage) are the desirable traits for green manure crops. Green manure crops can
be used as in-situ green manure (i.e. grown in the same field and incorporated in-situ) or green
leaf manure (i.e. lopping from plants or trees from the same field or from outside and then
incorporating them into the soil). Several species of plants, preferably legumes such as
Sesbania, sunhemp (Crotalaria juncea), Pillipesara sp., rice bean (Vigna umbellate L.), velvet
bean (Mucana deeringina), jackbean (Canavalia ensiformis), lablab bean (Dolichos lablab),
red clover (Trifolium pratense), cowpea (Vigna unguiculata) and other leguminous species are
considered good for green manuring, although certain non-legume species as Adhatoda vasica,
Artemisia vulgaris have also superior green manuring properties (Subedi, 1997). All green
manures have a positive effect on soil biological properties, plant nutrition and crop yield
46 K. D. Subedi and B. L. Ma

parameters (Tejada et al., 2008). In addition, the other benefits of green manures are reported
to be weed suppression, moisture conservation, and protection of soil from erosion (Fischler
and Wortmann, 1999). It is estimated that the portion of the N available to a following crop is
usually about 40 to 60% the total amount contained in the legume (Sullivan, 2003).
Cherr et al. (2006) used sun hemp green manures as supplement N sources for sweet corn
in a reduced tillage system. Sun hemp residue and living winter legumes together contained
120 to 125 kg N ha-1. Shehu et al. (1997) reported that a corn crop grown with the green
manure of pigeon pea (Cajanus cajan) produced yield equivalent to application of chemical
fertilizers at 120 kg N ha-1, 30 kg P ha-1 and 30 kg K ha-1. Similarly, Fischler and Wortmann
(1999) observed that grain yield of corn following a one-season fallow with velvet bean and
lablab bean that were 60 and 50% higher, respectively than corn following corn. These studies
demonstrated that green manures have the potential of substituting most of the N requirements
of succeeding corn crop.
Cover crops refer the growing of any plant species for the purpose of covering soil surface
to protect the soil from erosion and to trap nutrients losses without affecting the main crop.
Similar to green manures, cover crops can be annual, biennial, or perennial herbaceous plants
grown in a pure or mixed stand during all or part of the year (Sullivan, 2003). Cover crop can
be grown during the off-season (i.e. when there is no crop in the field) or underneath the crop.
When cover crops are planted to reduce nutrient leaching following a main crop, they are often
termed as "catch crops" (Sullivan, 2003). Cover crops can be legumes such as hairy vetch
(Vicia villosa Roth.), alfalfa, crimson clover (Trifolium incaratum L.); peas (Pisum sativum L.)
and others, and non-legume plant species such as wheat, oat, rye (Secale cereale) and barley.
Cover crops are incorporated into the soil as green or killed with herbicides.
The key benefits of cover crops are (i) soil conservation by reduced runoff, (ii) trapping of
soil NO3--N that is prone to leaching, (iii) weeds suppression, (iv) soil moisture conservation,
(v) contribution to nutrients pool thereby reduces the amount of fertilizer N requirement, and
(vi) addition of valuable SOM (Decker et al., 1994; Vaughan and Evanylo, 1998; Griffin et al.,
2000; Kuo and Jellum, 2002; Bittman et al., 2004; Snapp et al., 2005; Andraski and Bundy,
2005). For example, cover crop amendments increased soil aggregate stability and the
percentage of water stable 2-6 mm aggregates (Liu et al., 2005). Oyer and Touchton (1990)
reported that reseeding of crimson clover in combination with soybean-corn rotation,
constantly produced the highest yields of the system studied and provided an equivalent of 68
to 159 kg N ha-1 to corn. Griffin et al. (2000) reported that legume cover crops of alfalfa and
hairy vetch were able to replace all or nearly all of the N fertilizer required by a subsequent
sweet corn crop with a fertilizer replacement value of 58 to 156 kg N ha-1. Nevertheless, a
cover crop of cereal rye recovered more fertilizer N (48 kg ha-1) applied in the preceding corn
crop than by legume crops such as vetch and crimson clover (8 kg ha-1). Roy and Ball-Coelho
(2004) also reported that in southern Ontario, winter cereal such as rye appeared to be the best
cover crop for capturing residual N after corn harvest. Rye establishes and grows vigorously in
the fall taking up significant amounts of soil N. Relay crop of cover crops (i.e. planting or
establishing cover crops before corn harvest) can also be practised so as to capture maximum
amount of residual soil N and provide ground cover against erosion and runoff (Bittman et al.,
2004). Relay planting of different crops such as soybean, cowpeas, velvet beans and finger
millet (Eleusine coracana) under corn crop are traditional practices in the subsistence farmings
of tropical and sub-tropical regions, which also help conserve soil and trap N loss.
 Corn Crop Production: Growth, Fertilization and Yield 47

8.4. Organic Manures

Organic manures are the natural renewable sources of soil organic matter, containing all
the essential plant nutrient elements. Literarily, when any living things die and decay, the
resultant product is organic manure. Until the artificially synthesized chemical fertilizers were
developed, manures and organic supplements were the major sources of plant nutrients and
SOM. There are different types of organic manures. Farm yard manure (FYM), both solid and
liquid, represents the major source of organic manure, although poultry manure, hog manure
and other animal faeces, compost prepared from crop residues and other farm wastes,
vermicompost, oil cakes, and biological wastes such as - animal bones, slaughter house refuse,
etc. all represent organic manure. Most farmers in the developing countries with low input for
corn production are dependent upon organic sources of plant nutrients. Even in the developed
countries, organic manures constitute significant sources of nutrients for corn crop. For
example, in the poultry and dairy production states of USA, almost 40% of the acreage use
manures as nutrient sources for corn production (Christensen, 2002).
Decomposition and mineralization are the means by which plant nutriments held in SOM
are released into the soil as inorganic forms (Jarvis et al., 1996). Mineralization is the process
of transformation of OM into NH4+ - and NO3- - forms of inorganic N and several other
elements by soil microorganisms. Manure from livestock is an important source of N for crop
production in many areas, but efficient management of manure is critical to improve the
economics of manure use and to minimize the impact on water quality (Jokela, 2004). Most of
the readily available N in solid manure from pigs and cattle is in NH3 form while that in
poultry manure is in uric acid form (Misselbrook, 2004). The proportions of readily available
N as NH3 after applications on the soil are typically greater for solid manure than for slurries.
For solid manures, the only practical measure to reduce the ammonia losses after spreading is
to incorporate the manure into the soil (Misselbrook, 2004; Jokela, 2004). The amount of N
that will be available to a crop after manuring depends on the time and method of application.
For the fall (autumn) applications, the majority of available N will be lost through NH3
volatilization soon after application and by NO3- leaching over the winter and spring
(Misselbrook, 2004). It is important to apply manure as later as possible in the fall to minimize
mineralization before soil frozen (Ma et al., 1999b).
Compost is the organic material derived from aerobic decomposition of recycled plant
waste, manures, crop residues, biosolids, and animal shed waste such as left-over fodder.
Nutrients in the compost must be released by soil microorganisms through a decomposition
process called mineralization. This biological process is affected by variations in moisture,
temperature, and the microbial species and populations present in the soil. Composting manure
is a useful method of producing stabilized product that can be stored or spread with little odour
or fly-breeding potential (Fronning et al., 2008).
Organic manures have several advantages such as (i) they serve as the carrier of plant
nutrient and provide several of the essential nutrients, (ii) increase soil OM, (iii) enable soil to
hold more water and also help improve the drainage in clay soils, (iv) they provide organic
acids that help dissolve soil nutrients and make them available for the plants, (v) nutrients from
the organic manures release slowly in soil and supply nutrients over seasons, and (vi) they
enhance the physical, chemical and biological properties of soils.
Nutrients concentrations in the organic manure vary greatly depending on animal species,
the size and age of the animal, type of ration fed to the animals, bedding materials, storage,
48 K. D. Subedi and B. L. Ma

processing, and the season of the year. For example, manures from dairy cattle contain higher
N than from beef cattle, broiler chicken litter contain higher N than layer hens and so on.
Rieck-Hinz et al. (1996) reported that nutrient values of dairy feedlot manure were higher in
summer and fall than in spring and winter. The approximate nutrient composition of various
solid manures, including some composted manures, is presented previously (Tables 6 and 7).
While these tables provide a general guide of manure or compost’s nutrient concentrations, it
is strongly recommended that routine sampling and analysis needs to be carried out for the
determination of more precise application rates because as stated earlier, nutrients
concentrations vary greatly over time, location and sources.
There have been some systematic studies on the advantages of FYM and composted
manure applications on soil properties, environment and crop nutrient values. In eastern
Ontario, Ma et al. (1999a) reported greater increase in corn yield by the application of either
uncomposted or partially composted manure, in comparison with inorganic fertilizer N.
Manure application also enhanced soil N release from seasonal mineralization (Ma et al.,
1999b). Eghball and Power (1999a) found there was no effect of tillage practice, and manure
and compost applied plots resulted in similar corn grain yields. They noted that the first year N
availability was approximately 8% for manure and 20% for compost in both no-till and tillage
systems. Apparent NUE was 17% for manure and 12% for compost as compared to 45% in the
chemical fertilizer. In another study (Eghball and Power, 1999b), P-based manure and compost
application resulted in similar grain yield to those N-based treatments, but had significantly
less soil available P level after 4-yr of application. There was no yield difference between the
biannual and annual manure and compost application. They concluded that when application
rate is based on correct N or P availability, manure and compost can produce corn grain yields
that are equal to or greater than that for fertilizer application. Annual P-based manure or
compost application is the most effective method of using these resources when soil P build-up
is a concern. Similarly, when studied N-mineralization from beef-cattle feedlot manure and
compost, Eghball (2000) reported about 11% of the composted manure and 21% of the non-
composted manure released through mineralization during the succeeding growing season.
Eghball et al. (2004) also observed that residual effects of manure and compost applications on
corn grain yield and N uptake lasted for at least over growing seasons while effects on soil
properties lasted longer. Eghball et al. (2005) recommended that in P-deficient soils, a P
availability of 70% should be used. There is a serious lacking of studies on the residual effects
of manure and compost on soil and environment in the developing countries.
The rate of manure or compost applied to fields depends on the crop being grown, soil test
levels and nutrient composition of the manure or compost. There are some studies that
evaluated the efficacy of manure and composts on corn yield in comparison with chemical
fertilizers. Xie and MacKenzie (1986) reported that hog manure resulted in more NO3--N
compared with fresh and composted cow manures. Annual P-based manure or compost
application is the most effective method using these resources when soil P buildup is a concern
(Eghball et al., 2005). One to 5 kg manure-N was found to be equivalent to 1 kg of urea-N in
terms of increasing soil NO3--N levels at the end of growing season. Laboski and Lamb (2003)
reported that P from liquid swine manure was more available than fertilizer P. It is postulated
that decomposition of manure resulted in concentrations of organic acids that effectively
reduced P sorption to the soil and increased P availability.
 Corn Crop Production: Growth, Fertilization and Yield 49

In a corn-soybean-corn rotation study conducted in Michigan, USA, Fronning et al. (2008)

found that total SOM increased in the 2 to 25 cm soil profile by 41 and 25% for the compost
and manure treatments, respectively and decreased by 3% in the untreated control plots.
Nitrogen uptake increased with increases in N application rates and was higher with hog
manure than with cow manures.
With an expected yield of 9.4 Mg ha-1, Dormaar and Chang (1995) reported that corn
yields of annual or biennial beef cattle manure or compost application based on N or P
requirements of the crop were similar to those for fertilizer application. Ginting et al. (2003)
reported that effects of compost and manure resulted in 20 to 40% higher soil microbial
biomass C, 42 to 74% higher potentially mineralizable N, and 0.5 unit higher pH, as compared
with the fertilizer treatment. For silage corn production, Butler et al. (2008) reported that three
years after compost application, soil P and K concentrations were greater in plots receiving 70
and 150 Mg DM ha-1 manure. Soil OM increased in all treatments receiving >35 Mg DM ha-1
after first season application.
In the smallholder farmers in the tropics and sub-tropical regions, organic manures are the
main sources of plant nutrients for corn. Both quality and quantity of the manures are the
concerns and the environmental effects of manures are less perceived. For example, in a
subsistence farming system of Kenya, Jama et al. (1997) reported that application of 10 kg P
ha-1 as organic, inorganc and organic + inorganic sources significantly increased corn yield.
Sensitivity ananlysis suggested that organic materials was most suitable for use as P source
and low in cost of production. In a similar study conducted in Zimbabwe, supplement manure
with varying levels of mineral fertilizers resulted in corn yields that were still below the
potentials due to inadequate amounts, poor quality of organic materials and inefficient
combinations (Murwira and Palm, 1998).
Nutrients losses from the barn, storage and field are a big concern over manure
management. Burger and Venterea (2008) reported that estimates of first-season available N
from manure would be improved by measuring manure NH4+. In contrast, in soil amended with
solid manure, which had the lowest initial NH4+ content, 22% of organic N was mineralized.
Gaseous N losses were <1% of the added N in all treatments. Oenema et al. (2007) studied the
magnitude of nutrient losses in manure management systems in 27 European Union member
states, and found about 65% of the N excreted in barns was collected in barn and stored for
some time prior to application to agricultural land. Almost 30% of the N excreted in barns was
lost during storage; approximately 19% via NH3 volatilization, 7% via emission of NO, N2O
and N2, and 4% via leaching and run-off. Low-protein animal feeding is an effective measure
to reduce gaseous emissions of NH3, NO and N2, and NO3-- leaching from animal manure. Al-
Kaisi and Kwaw-Mensah (2008) reported that tillage and N rates beyond 85 kg ha-1 had no
effect on corn yield regardless of whether supplied from fertilizer or manure source. Tillage
and N rate had a significant effect on plant N and P uptake. Recovery of percentage of applied
N across all tillage systems and N rates was 40% and 27% from manure and fertilizer sources,
respectively at V12 of corn.
The challenges with use of organic manures are (i) large volume of materials which needs
more application cost, (ii) conservation of nutrients from organic manure, (iii) environmental
issues such as ground and surface water contaminations (Eghball and Power, 1999b), (iv)
odours, and (iv) buildup of P with continuous application and others. If organic materials are
over applied, it may lead to contamination of surface and/or groundwater by excess nutrients
such as NO3--N. Manure application in excess of crop needs can cause a significant buildup of
50 K. D. Subedi and B. L. Ma

soil P, N and other ions and salts (Dormaar and Chang, 1995; Eghball and Power, 1999b). The
environmental concerns of manure and compost application are discussed in detail in Section
9.

8.5. Mulching

Mulching is a practice of covering soil surface with some organic (e.g. organic reasidues
or live mulch) or inorganic materials. Living mulches grow for a long time with the main crops
and legumes used as mulches also provide N fixation thereby reducing the need for fertilizer.
This is a traditional practice in the subsistence farming systems of tropical and sub-tropical
regions and it has also gained popularity recently in the conservation agriculture. The key
benefits of using mulch are to (i) conserve soil moisture, (ii) prevent weeds growth, (iii)
protect soil from erosion, (iv) lower soil temperature, and (iv) add OM and nutrients into the
soil.
The value of mulching is very important in sloppy lands and with conventional tillage
practices where soil erosion is a major challenge. Atreya et al. (2008) in the mountains of
Nepal, estimated that up to 60 to 90% of annual nutrients losses occurred during the pre-
monsoon period (May). They reported that mulching reduced annual SOM loss by 52%,
annual total N loss by 46%, annual available P2O5 by 32%, and annual exchangeable K2O by
53% in a corn – mustard (Brassica campestris L.) cropping system. Similarly, intercropping
corn with soybean reduced the annual loss of these nutrients by 58, 49, 26 and 60%,
respectively.

8.6. Hedge Rows

Hedge row intercropping is a system of growing mainly leguminous hedges between the
crop rows and incorporation of pruned biomass on the soil. This system has gained some
attention in subsistence farming systems of tropics, e.g. Africa and Latin America, especially
in the sloppy lands. The benefits of hedge-row system are to (i) conserve soil from runoff, (ii)
add SOM and plant nutrients, and (iii) lift nutrients from deep soil to the surface. Swınkels and
Franzel (1997) evaluated the hedge row intercropping in western Kenya. Although about half
the farmers claimed that hedges improved crop yields, after three years of experimentation
only about one-fifth planted additional hedges and only 14% did so to improve soil fertility.
Agus et al. (1998) reported that Gliricidia in a contour hedgerow increases food crop yield on
strongly acid Oxisols by recycling nutrients and partially supplementing the N demand by the
food crops. It appeared that the potential for its adoption as a soil fertility practice is low,
mainly because of high labour requirements.

8.7. Chemical Fertilizers

Chemical fertilizers are the artificially manufactured sources of plant nutrients. The role of
chemical fertilizers in the modern day’s agriculture are paramount. The agricultural production
 Corn Crop Production: Growth, Fertilization and Yield 51

in the absence of fertilizers would not have met the growing food demand by the alarmingly
increasing population. Since the 1960s, additional nutrients applied through fertilizers have
been responsible for 55% of the yield increase in developing countries (FAO, 1998). There
should not be an argument whether fertilizers are needed, and corn production in the absence
of chemical fertilizer would not be possible only with rest of other sources. Therefore fertilizer
is one of the key components of IPNM. In an ideal situation, in addition to the nutrients
supplied by the components discussed above, remaining nutrients should be complemented
with chemical fertilizers. Consequently, a judicious use of chemical fertilizer to complement
the nutrients supplied through various other sources is a component of IPNM. The concept of
IPNM therefore, emphasizes the balanced amount of fertilizers to complement the nutrients
insufficient from other sources. However, excessive and unwarranted use of chemical
fertilizers has huge negative impacts on production efficiency, producers’ net returns, regional
and global environment, human health, and cost of production.
Changing practices from conventional to conservation tillage makes chemical fertilizer
management more crucial importance and challenge. Adequate fertility must be maintained
when producers switched to no-till corn production. It is because, for the no-till system, proper
fertilization is imperative to optimize production and maintain SOM (Campbell et al., 1998).
Fertilizer N addition, legume incorporation and tillage systems had significant positive effects
on N-uptake (Dharmakreethi and Beauchamp, 2006). Total N required for producing 1 Mg
grain yield of corn was slightly greater (20 kg Mg-1 grain) in the NT than conventional tillage
(19 kg Mg-1 grain). Thus, Halvorson et al. (2006) stated that current N fertilization
recommendations for conventional tillage corn may need to be modified for NT to account for
the lower yield potential and slightly higher N requirements.
Use of fertilizers is limited in the subsistence farmings of the developing countries because
of (i) unavailability in required time, (ii) lack of money to purchase by the resource poor
farmers, and (iii) lack of technical know-how of the judicious use of fertilizers.

8.7.1. Basis of Fertilizers Recommendation

As stated earlier in the concept of IPNM, the amount of chemical fertilizers required for a
corn crop depends on several factors such as target yield, available nutrients in soil,
mineralization potential of SOM, and nutrients supply from other sources such as FYM or
compost, green manures and others, tillage practices (e.g. no-till or conventional tillage), and
soil water availability (irrigated or non-irrigated). This is a decision making process and needs
some sort of exercise of nutrients budgeting. Current N management practices based on yield
goals have been found to be poorly correlated with optimum N rates (Vonotti and Bundy,
1994). Proper crediting of N from animal manures, legumes in rotation and SOM
mineralization has to be made although it is difficult to estimate the exact value of inputs from
these sources. The nutrients from chemical fertilizers can be supplied through one or more than
one fertilizers (e.g. N, P, K, and micronutrients sources). A decision of which fertilizers to be
applied depends on (i) availability of fertilizers, (ii) relative cost of fertilizers, (iii) soil texture,
(iv) soil pH, and (iv) type and availability of equipments, etc.
Management of N is one of the most important aspects of IPNM. The rate of fertilizer N to
corn depends on several crop management aspects such as hybrid/variety types, purpose of
crop production (grain or silage or sweet corn), yield goal, residual SMN, soil texture, SOM
content, manure history, preceding crops (e.g. legumes or cereals), PPD, and economic
considerations (costs of fertilizer, fuel and produce, etc.), and amount of other sources for N
52 K. D. Subedi and B. L. Ma

such as organic manure available. Therefore, determination of a precise N fertilizer rate has
been a complicated topic. It is because the best rate of N for corn crops varies greatly by
complex interactions of soil, climatic, biological, management practices and location
(Blackmer et.al., 1997; Winhold and Halvorson, 1999; Doerge, 2002). Even if SMN is known,
in the humid environments such as eastern Canada, corn yield response to N amendments was
poorly correlated with soil mineral N content prior to planting because of greater spatial and
temporal variability (Ma and Dwyer, 1999). The cumulative effects of past N management
practices, crops in rotations, tillage systems, and excessive use of manure and chemical
fertilizers makes the recommendation further complicated. Therefore, no single rate or a
blanket recommendation is desirable for diverse production systems. Any recommendation
should take into consideration of these variabilities. Recommendation of other nutrients such
as P, K, S and micronutrients should be based on the soil tests, and consideration should be
made for the P and K buildup in soil and micronutrients toxicities due to over-application or
improper application practices.

8.7.2. Timing of Fertilizer Application in Corn

Once the amount of nutrient element required is calculated and the type of fertilizer is
decided, next step is to determine the timing of fertilizer application. Fertilizers can be applied
as (i) before corn planting (preplant), (ii) at planting (starter), or (iii) after seedling emergence
(sidedress or topdress) depending on various circumstances. The key factors that determine the
apropriate timing of fertilizer application to corn could be (i) soil residual nutrients, (ii)
previous crop in the rotation, (iii) amount of manure and fertilizers applied on the previous
crops, (iv) soil texture and (v) other factors such as availability of fertilizer, labour, credit, etc.
For example, if the soil contains adequate P and K, it would unlikely need to add these
nutrients. On the other hand, if the soil test shows lack of these nutrients and other sources are
inadequate, these nutrients should be supplied based on the soil-test recommendations during
land preparation.
Timing of N fertilizer application is critical, especially for corn production. Nitrogenous
fertilisers are generally applied to corn as preplant, starter (at planting), and as sidedress at the
V6 to V8 growth stage (in-season). One approach to better matching N application with crop
need is a split application, focussing the split component at mid-to-late vegetative stages (Ruiz
Diaz et al., 2008). The goal is to make sure the crop not experience any shortage of N during
the critical periods of requirement. If organic manure such as FMY is to be applied, they
should be incorporated well before corn planting.
The rate of N uptake by corn is relatively slow before entering the period of rapid growth
at about the V6 growth stage. The highest rate of N mineralization tends to occur before the
highest rates of N uptake by corn (Wu et al., 2008) at which, soil NO3--N that accumulates
during the early part of the growing season, usually still presents in the root zone during the
peak demand period (Magdoff, 1991). Tillage system has a role on the timing of N
requirement. Schepers et al. (1995) reported that 50 to 80% of the N fertilizer use in corn is
applied prior to planting; however this varies with location. Less than 20% of the total N
uptake by corn occurs prior to sidedress (Schepers et al., 1995). Soil temperature rather than N
immobilization by residue and/or N supplied from residue, were primary factors affecting net
N mineralization in high surface residue corn systems (Andraski and Bundy, 2008).
Starter fertilizer is an efficient way of stimulating early growth and improving yield of
corn (Niehues et al., 2004). Starter fertilizers, regardless of placement, often increased early
 Corn Crop Production: Growth, Fertilization and Yield 53

season dry matter (DM) production and significantly increase grain yields (Vetsch and
Randall, 2002; Niehues et al., 2004). Restriction of starter N supply until V8 stage (Ritchie et
al., 1993) caused an irreversible effect on grain yield of corn even though adequate N was
supplied thereafter (Subedi and Ma, 2005a). Plant competition between the vegetative stage
and anthesis had a large effect on grain yield reduction, which ranged from 8 to 21% (Hashemi
et al., 2005). Subedi and Ma (2009) reported that while lack of preplant N application (100 kg
ha-1) reduced yield by up to 10 to 22%, there was no yield increment due to additional
sidedress of 50 kg N ha-1 in a medium textured loamy soil. The disadvantage of a single
preplant application is that excess N applied early can be lost on coarse-textured sandy soils or
with irrigated corn due to leaching, and on fine-textured soils due to runoff. While starter
fertilizers accelerate early plant growth under these conditions, yield increases do not always
occur. Bullock et al. (1993) reported that starter fertilizers on soils of high testing mineral N
increased plant growth and development rates, but the increase in early growth often did not
result in a yield increase. In general, use of starter fertilizers for corn may be more important in
no-till or reduced tillage systems than in conventional tillage because it may help overcome the
effects of slow early growth and soil compaction. In Wisconsin, a comparison of starter
fertilizer in no-till and conventional tillage showed that planting date had a major influence on
the role of starter fertilizer with the largest yield response in the no-till system when corn was
planted late (Bundy and Widen, 1991). No-till soils are often cooler and less aerated than tilled
soils. These conditions decrease N mineralization so that less N is available to the crop early in
the season. Failing to apply sufficient N fertilizer at planting time when the remainder of N
fertilizer is to be sidedress may limit yield of no-till corn. In the no-till or mulch covered fields,
incorporating or knifing-in the UAN improves efficiency slightly over dribble applications.
Delaying of some or all N fertilizer until after seedling emergence may allow for precise
diagnosis of N needs by either in-season soil testing, tissue tests, sensing crop colour or
estimating weather effect on soil N availability (Magdoff et al., 1984; Blackmer et al., 1989;
Scharf et al., 2002). Post-emergence applications are practised so as to avoid frequent wet
seasons and to minimise the in-season N loss in wet years (Scharf et al., 2002). However,
delaying N application may lead to irreversible yield loss (Subedi and Ma, 2005a). Binder et
al. (2000) reported a nearly 12% reduction in maximum grain yield when delaying in N
application until V6 growth stage. Scharf et al. (2002) found that yield was still responsive to
N application until silking, but full yield was not achieved when applications were delayed till
then. Corn responded more to sidedress N for total N uptake than for preplant application, and
it is very likely that grain yield is affected to a larger extent by the conditions after sidedress
(Ma et al., 2005). Split application of N can help reduce the N loss and also meet the high
demand of corn during its peak uptake stage. Split-application also provides farmers with the
opportunity for fine-tuning of N application. Russell et al. (1998) indicated that N recovery by
corn may be greater when part of the N is applied as a delayed split rather than a single
application at planting.
Studies have shown that N applied as sidedress during the early growth stage (i.e. close to
the time of rapid uptake of N by the crop) has been used more efficiently (Magdoff et al.,
1984; Magdoff, 1991; Ma et al., 2005). There is less time for leaching or denitrification loss
when N is applied after plant emergence (Vetch and Randall, 2004). This is especially critical
on soils with a high potential for leaching or denitrification. Although corn plants can be
responsive to applied N until later stages and it is easy to detect N-deficiency at the later
stages, application after V8 growth stages has a practical problem of the crop being damaged.
54 K. D. Subedi and B. L. Ma

Broadcasting fertilizers such as urea on corn plants can cause leaf injury; therefore this is not a
feasible practice for corn.
In the humid temperate regions of USA and Canada, where there is usually a single crop in
a year, fertilizer N can also be applied either during the fall (after crop harvest) or during the
spring (prior to corn planting). Smicklas and Moore (2008) compared fall and spring
applications in terms of grain yield of corn and NO3--N recovered in the drainage water.
Application of full dose of anhydrous ammonia in the spring produced equivalent yields to that
of fall-applied N treatments and it decreased NO3--N release into the drainage water.

8.7.3. Methods of Fertilizer Application

Chemical fertilizers can be applied to corn as surface broadcast or banded with planting or
injected in furrows at sidedress. Appropriate application method also depends on fertilizer
type, tillage system or land preparation, and stage of crop at the time of fertilizer application.
For instance, N fertilizer is often applied in no-till systems using surface broadcast of granular
urea or N solutions containing urea (UAN). If it is anhydrous ammonia, it has to be soil
incorporated (knifed) to 15 to 20 cm deep. Fertilizers such as ammonium nitrate, ammonium
sulfate, and the ammoniated phosphates are less prone to volatilization losses, therefore can be
surface-applied to soils with neutral or low pH, while application of urea as surface broadcast
would lead to significant losses.

8.7.3.1. Surface Broadcast Application

Generally, fertilizers and manures are applied as broadcast on the soil surface mainly in
the non-mechanized farmings. Even in the mechanized farming, fertilizer or manure is spread
over the soil surface such as solid manure or preplant application of fertilizer. There are some
possible adverse effects of the surface applied manure or fertilizers on soil and environment
such as surface-applied fertilizers and manures are prone to runoff and, surface-applied or
shallow banding of P and K could lead to stratification of these nutrients. Incorporation of
surface applied manure or fertilizer into the soil immediately after application is the
recommended best nutrient management practice.

8.7.3.2. Banding
Banding of fertilizers along the seed row allows combining the seeder with the fertilizer
distributor in one operation and saves timing and fuel cost in field operation. The consensus to
date is that P and K applications via strip tillage in the fall may be too deep to provide starter
fertilizer benefits to the following corn crop. Fall banding operations need to be particularly
concerned with depth of placement and perhaps with the orientation of previous bands as well.

8.7.3.3. Foliar Application

Foliar application of nutrients to corn has not been very effective although micronutrients
can be foliar-applied. Foliar application can sometimes cause foliar injury (phytotoxicity) of
the crop if proper sprayer calibrations are not carried out or if sprayers are not properly cleaned
after herbicide application. Foliar application is more useful for micronutrients that require
very small concentration. However, for the macronutrients such as N, the amount of total
requirements by high yield crops cannot be applied at once; split applications with foliar
supplement may useful to avoid plant toxicities.
 Corn Crop Production: Growth, Fertilization and Yield 55

8.7.4. Variable Rate-Application (VRA)/Site-Specific Nutrient Management (SSNM)

Yield variation in a corn field may be caused by many factors, including spatial variability
in landscape position, soil structure and texture, crop production and field operation history,
soil physical and chemical properties and nutrients availability (Wibawa et al., 1993; Penny et
al., 1996). Site-specific nutrients management (SSNM) is a concept developed in Asia for rice
(IRRI, 2007). It emphasizes on ‘feeding’ nutrients as and when the crop needed. The SSNM
strives to enable farmers to dynamically adjust fertilizer use to optimally and timely fill the
deficit between the nutrient needs of a high-yielding crop and the nutrient supply from
naturally occurring indigenous sources such as soil, organic amendments, crop residues,
manures, and irrigation water (IRRI, 2007). Site-specific N management based on an in-season
assessment of crop N status may offer producers with increased grain yield, profitability, and
NUE. To address the spatial variability of nutrients in corn fields, precision agriculture
practices such as SSNM will benefit growers by increasing the efficiency of fertilizers, reduce
the total amount of N application, improving the productivity and thereby reducing
environmental impacts. In Kenya, Tabu et al. (2006) reported that SSNM was found to be
important in the small holder farmer fields. A survey of the fertilizer use, however, shows that
farmers use sub-optimal levels probably because of the poor resources level and non-specific
recommendations that aim at optimizing crop yield but not necessarily NUE.
Variable rate application (VRA) is a similar concept as SSNM but it is based on more
precision agricultural practices than in the SSNM system. The strategies used in the VRA are
assessing site characteristics that affect soil nutrients dynamics. Fertilizer rates, application
timing and methods are determined based on extensive soil tests to determine pre- and post
season NO3--N and other nutrients of interest using intensive grid soil sampling or according to
crop need-based indicators (Ma et al., 2005). Crop-based indicators (e.g. remote sensing,
SPAD), and real-time site specific yield monitors are gaining popularity in recent years.
Variable responses to the amount of N fertiliser application in the same region or field have
been more common than other nutrients in corn (Magdoff et al., 1984; Scharf et al., 2002;
Andraski and Bundy, 2002). The first step in site-specific N management is to examine the
field history, in particular its effect on N mineralization, and to take account of anticipated
effects of texture, drainage and precipitation (Schröder et al., 2000). Site-specific N
management requires indicators of the N status of the soil-crop system. Various indicators
have been developed and evaluated during the last decade (Schröder et al., 2000). An ideal
indicator has a reproducible relationship with the N status of the soil-crop system and must be
able to detect or predict both deficiency and excess of N.
Heiniger (1998) reported that VRA increased yields only in the strips testing low in P and
K, but an increased economic profit of VRA where variability existed in the fields. Ferguson et
al. (2002) realised no significant difference between the uniform application and VRA while
VRA reduced soil residual NO3--N. Schmidt et al. (2002) stated that VRA based only on SOM
are too simplistic to reflect variability in soil N availability within a field. Other workers have
shown the potential of VRA to improve fertilizer use efficiency (Raun et al., 2002), increase
yield (Wang et al., 2003), economic returns (Wang et al, 2003; Yang et al., 2001; Koch et al.,
2004), and reduced environmental impacts (Raun et al., 2002; Roberts et al., 2002). Wittry and
Mallarino (2004) reported that VRA resulted in better P fertilizer management because it
applied 12 to 14% less fertilizer and reduced soil test P variability compared with the
traditional uniform fertilization method. Inman et al. (2005) used site specific management
zones (SSMZ) for N management and such zones were found to be less spatially variable than
56 K. D. Subedi and B. L. Ma

the whole field. The SSMZs accurately characterized variability in N uptake as well as grain
yield response to applied N. They concluded that variation in N uptake and grain yield can
potentially be managed using SSMZs. Nevertheless, adoption of this practice by corn
producers in the North America is rather low because of the recommended N fertilizers based
on yield goal are often poorly correlated with actual economically optimum N rates (Doerge,
2002). The challenges are that N response patterns are often field- and season-specific and can
vary within the same fields (Doerge, 2002). The availability of N to crop plant is affected by
complex set of interacting soil, biological, climatic and management factors (Blackmer et al.,
1992; Degree, 2002; Ma and Dwyer, 1999). Economically optimum rate of N (EORN) was
very different between fields and was also highly variable within fields (Scharf et al., 2005).
Scharf et al. (2005) concluded that the average level of within field variability in EORN is high
enough than the potential of VRA to produce economic and environmental benefits. The total
amount of N utilized by corn crop will increase with yield level. However, the predicted,
potential, average or actual yields are poorly correlated with EORN (Blackmer et al., 1992;
Doerge, 2002). As EORN was poorly correlated with grain yield, Lory and Scharf (2003)
suggested that the Delta Yield (i.e. the grain yield at optimum N rate minus grain yield at
control) may be a better predictor of EORN, and farmers should be encouraged to monitor
Delta Yield as a more effective indicator of EORN than the actual yield.
There are no consistent advantages for variable or uniform rate of N applications, whole-
field N rates were similar for both strategies and post-season soil NO3--N levels were not
appreciably reduced when using VRA (Wu and Ma, 2008). Doerge (2002) reviewed the
prospect of VRA and concluded that there is a need for new diagnostic tools that provide a
better prediction of EORN in sub-regions of a field. Adoption of this technology has been
hampered due to the difficulty of classifying fields into management units, the high cost of
sampling soils on a grid basis, and the variability of soil and plant properties in the landscape.
Moreover, intensive grid soil sampling approaches involving analysis of soils is also another
drawback for VRA to be a viable technology. Further research on tools that detect the nutrients
variability will make this technology more economical and practical for adoption by growers.

9. ENVIRONMENTAL ISSUES WITH CORN

NUTRIENTS MANAGEMENT
Corn production consumes probably the largest amounts of fertilizers worldwide. Even
with the most efficient ways of nutrient management practices, the efficacy of applied
nutrients is always low (< 50%). The low efficiency of applied nutrients especially N leads to
significant economic and environmental consequences. Therefore, excessive and improper
application of manure and fertilizers on corn production has raised public concern about
surface and ground water contamination, and gaseous N emissions to pollute the environment
(Christensen, 2002; Jarvis et al., 1996). While there are various pathways of N loss from corn
fields, the major routes of N losses occur through NH3 volatilization, NO3- leaching, and N2O
emissions (especially due to denitrification). Plant N losses as NH3 could be up to 52 to 73%
of labeled 15N fertilizer in a corn field (Francis et al., 1993). In a tillage study, gaseous N
losses due to denitrification from applied N fertilizer are up to 10% for conventionally-tilled
and 22% for no-till corn (Hilton et al., 1994). The leaching loss of NO3--N is dependent on the
 Corn Crop Production: Growth, Fertilization and Yield 57

amount of residual NO3- in the soil, applied manures and N fertilizers, rate of SOM
mineralization which is dependent on soil temperatures and seasonal rainfall and/or irrigation
water. Nitrate leaching is the most serious problem on well drained and sandy soils, but it also
can occur on well-drained upland limestone and shale soils. In Ontario, Drury et al. (1996)
estimated that up to 26 kg ha-1 yr-1 of NO3--N is lost through tile drainage. Denitrification is
most serious on soils rated as somewhat poorly drained but it also can occur on any soil that is
saturated with water. In Germany, Herrmann et al. (2005) concluded that forage corn
production is characterised by a significant excess of N supply, and there leaves ample
opportunity for reduction in N use without risk of yield loss. Therefore, manures and fertilizers
must be used judiciously to maximize profits, optimize crop quality, save energy, and protect
the environment (Schröder et al., 2000). In this section, the different ways of nutrients loss
from corn fields are discussed in relation to their impacts on environment.

9.1. Issues with the Use of Manure and Biosolids

Composted or liquid manure from farm animals is one of the major sources of plant
nutrients. Crop production in the small-holder farms is more dependent on manures as a source
of plant nutrients. Odour, runoff and leaching of nutrients such as NO3--N are some of the
important key environmental problems associated with manure and biosolids use in corn field.
Over-application of fertilizer or manure P can negatively impact water quality. Nitrate leaching
occurs most commonly after the corn harvest and in the following spring, and the risk of NO3--
N movement in groundwater is lower in loamy than in sandy soil (Ball-Coehlo and Roy,
2004). There has been substantial research conducted on this topic in Europe and North
America, but there is a lack of information in the developing countries, where manure is the
major source of nutrients for crop production.
In general, animal manure contains more P than needed by the crop when the amount of
manure application is based on its N content. Therefore, continuous manure application to
meet crop N requirements will result in higher soil test P, water soluble P and higher potential
runoff P (Zhang et al., 2007). Proper management of P sources and P transport over the
landscape can reduce negative impacts of P on water quality. Where P buildup in soil is a
concern, Zvomuya et al. (2006) suggest that accurate prediction of P availability and plant P
recovery may help tailor manure and compost applications to plant needs and minimize the
buildup of bioavailable P, which can contribute to eutrophication of sensitive aquatic systems.
Accumulation and redistribution of NO3--N within the soil varies due to management
practices, soil characteristics and growing season precipitation. Hensler et al. (1970) concluded
that for soils near the neutral points, nutrients in the manure, even at the very high rates of
application can be utilized in crop production and soil improvement with relatively little
danger of plant toxicity. Lithuurgidis et al. (2006) reported that concentrations of NO3--N in
the soil profile of manure-plots were higher than control but similar to inorganic fertilizer
treatments. They concluded that soil applied liquid cattle manure at a rate equivalent to the
recommended inorganic fertilization can produce corn yield and maintain soil fertility at
desired level.
When raw or treated liquid swine manure (LSM) was used on corn as sidedress followed
by immediate incorporation, Chantigny et al. (2008) found that the raw and treated LSM have
fertilizer value of N uptake and corn yields similar to fertilizer N; the risk of post-harvest NO3-
58 K. D. Subedi and B. L. Ma

accumulation with the raw and treated LSM was similar to mineral fertilizer on the loam soil
and lower on clay soils. Application of organic manures affects the rate of mineralization. Net
mineralization in the historically amended soil was twice that in the historically non-amended
soil, mostly due to difference in soil total N stock (Mallory and Griffin, 2007).
Research has shown that 40% of the total N in beef feedlot manure and 15% in composted
beef feedlot manure is available to the crop plant in the first year it is applied and incorporated
(Eghball et al., 1999a). Apparent NUE was 17% for manure, 12% for compost, and 45% for
the fertilizer treatment across 4 years. When beef feedlot manure is applied and not
incorporated in a no-till system, research has shown first-year availability of 38% of total N for
manure and 20% for compost (Eghball et al., 1999b). In their study, surface application did not
show significant N loss because the N in both manure and compost were in very stable forms.
A significant portion of the N can be lost from manure before it is applied to the land.
Much of this is caused by the gaseous loss of ammonia (NH3). This process occurs in the
feedlot pens and during storage. Ammonia loss will also continue after manure is applied to
crop land. Research has shown that incorporation of manure into the soil within the first 48 h
of application minimizes the gaseous loss of ammonia to about 15%. Delaying incorporation
will cause greater losses. Injection of liquid manure can also greatly reduce gaseous loss and
retain more N for crop use. Equipment should be calibrated based on the application method so
the correct amount is used.

9.2. Nitrous Oxide (N2O) Emission

Nitrous oxide (N2O) is one of the main greenhouse gases (GHG) generated from
agricultural sources. It has a global warming potential of 298 times greater than that of carbon
dioxide (CO2) and 25 times than that of methane (CH4) over a 100-year time horizon (IPCC,
2007). It accounts for approximately 5% of atmospheric GHG effect globally (Hutchinson et
al., 2007). The dramatic increase of atmospheric N2O is due to the human alterations of the
global N cycle, with 24% of annual emissions produced by agricultural soils and the
application of N fertilizer (Bouwman, 1996; Mosier et al., 1996; Mosier, 2001; Bouwman and
Boumans, 2002; IPCC, 2007). In groundwater under agricultural fields receiving N
applications, or in riparian zones receiving groundwater or runoff water, excessive NO3- may
be transformed to N2O through the process of denitrification (Mosier et al., 1998). Nitrous
oxide emissions account for almost 60% of on-farm GHG emissions in Canada (Desjardins et
al., 2005). Hutchinson et al. (2007) estimated that the direct N2O from manured corn field
ranged from 12.9 to 17.3 Tg with an average of 15.1 Tg equivalents during 1981-2001. The
greatest source of emissions estimated was from N fertilizer followed by crop residue (4.24
Tg). During a corn growing season (mid-May to mid-September), N2O emission from an
irrigated corn field was totaled only 2.5 kg N ha-1and about 30% of the N2O lost from the corn
field was emitted during the 2 wk following fertilization (Mosier and Hutchinson, 1981). The
amount of N2O produced is determined by the rate of nitrification and denitrification in
agricultural systems, and soil moisture plays an important role. The flux of N2O was not
significantly correlated with soil NO3--N concentration but was strongly correlated with soil
water content and N2O concnetration in the soil atmosphere (Mosier and Hutchinson, 1981).
Similarly, Lessard et al. (1996) observed that fluxes of N2O occurred in episodes and the high
fluxes coincided with periods when NO3--N levels and water content were relatively high.
 Corn Crop Production: Growth, Fertilization and Yield 59

Under a simulated rainfall condition, Whalen (2000) observed pulsed N2O emission from
denitrification of accumulated NO3--N, indicating that further emissions will occur with an
increase in soil moisture. Agricultural activities influence N2O emissions primarily by
changing the magnitude and pattern of N-cycle in the soil-plant system (Hutchinson et al.,
2007). However, Ginting et al. (2003) concluded that residual effects of manure and compost
on CO2, N2O, and CH4 emissions were minimal. Kim et al. (2009) also concluded that the flux
of dissolved N2O from the cropped field was negligible in comparison to soil N2O emission in
the crop fields. Fronning et al. (2008) observed that compost and manure amendments resulted
in a net global warming potential (GWP) of equivalent to 1811 and 1160 g CO2 m-2 yr-1,
respectively, compared to 12 g CO2 m-2 yr-1 for unapplied control treatment.

9.3. Nitrate (NO3--N) Leaching and Water Quality

Excessive rates and inappropriate method of application or inefficient use of N fertilizer

may have adverse effects on ground water through leaching of soil NO3--N. High NO3- levels
in ground water can cause adverse health concerns, especially for infants, and it also cause
excess plant and bacterial growth, which upon death and decay can deplete much oxygen in
river and lake water. The primary inorganic N component in the soil profile was NO3--N, and
the zone of maximum accumulation was between 2 and 2.5 m. Excessive levels of NO3--N in
subsurface drainage from row crops, especially corn are well documented (Owens, 2008).
Such accumulation is subjected to loss during winter and spring periods through leaching
and/or denitrification, especially in the humid environments (Drury et al., 2007).
A considerable amount of research has been conducted on NO3--N leaching and
redistribution in soil. Timmons and Dylla (1981) estimated that annual average NO3--N
leaching loss ranged from about 29 (non-fertilized, non-irrigated) to 112 kg ha-1 (high N with
irrigation), the combination of variable rainfall, soil NO3--N content and low soil water holding
capacity cause great variation within and among years. De Jong et al. (2007) estimated that N
loss via leaching and concentration of NO3--N in the leached water in Canada ranged from 5.1
kg N ha-1 in 1991 to 6.4 kg ha-1 in 2001. The actual concentration of NO3--N in the ground
water is affected by the amount of fertilizers applied in the previous crops, soil texture,
seasonal rainfall (percolation), tillage operations, crop rotations and so on. Elevated post-
harvest soil NO3--N usually provides evidence that N was applied in excess for corn uptake
(Ferguson et al., 1991; Andraski et al., 2003). Nitrate remaining in the post-harvest soil profile
representing a potential risk for leaching during the fallow period has been shown to be closely
related to N fertilization rate, seasonal precipitation and soil texture (Gehl et al., 2006). Year-
to-year variations in loads of NO3--N occur as a result of variations in weather and crop yields.
There are different ways which can minimize the NO3- leaching in the ground water. As N
is lost from cropping systems in a number of pathways, a single solution of N management is
unlikely (Binder et al., 2000). Precise matching of application rates with crop needs could
reduce residual soil NO3--N available for leaching (Bausch and Duke, 1996; Vyn et al., 1999;
Andraski and Bundy, 2002). For this, in-season, site-specific or variable-rate N management
based on remote sensing tools may reduce N losses to groundwater while maintaining or
increasing yield and NUE. Similarly, periodic application of liquid N through the irrigation
system may reduce average annual NO3--N leaching by about 12 kg ha-1 at the 5 cm irrigation
level. When N application rate was higher than the optimum, little fertilizer derived N leached
60 K. D. Subedi and B. L. Ma

from the profile during the first growing season, but losses did occur during the off-season and
subsequent growing season (Stevens et al., 2005). Yang et al. (2007) found that improved N
fertilization practices reduced residual soil nitrate (RSN) by 13%. In China, Fang et al. (2008)
estimated that there was a potential of saving more than 30% of the current N application rates
per crop from 300 to 200 kg N ha-1, which could reduce about 60% of the N leaching without
compromising yields. Timing of N fertilizer can have a major effect on NO3- leaching.
Smiciklas and Moore (2008) observed that spring applied fertilizer produced equivalent corn
yield with decreased NO3--N in the drainage water, in comparison with that of fall-applied N
treatments. Similarly, maintaining healthy and dense corn plants may help to reduce NO3-
leaching. Herron et al. (1971) proposed that use of a nitrification inhibitor with an NH carrier
can help in preserving mineral N in irrigated fine-textured soils. Maho et al. (2007) suggested
that NO3--N leaching from a granitic regosol during the rainy season could be reduced by the
increasing of planting density of corn due to the increase of N uptake by the plants.
The amount of NO3- leaching also depends on the soil type, water management practice
and cropping system. For example, no-till crop production increases the amount of soil
macropores and allows for greater water infiltration, which could lead to more NO3- leaching
in groundwater (Izaurralde et al., 1995). However, more recent studies (Halvorson, et al.,
2001; Gupta et al., 2004) showed no difference in N leaching between tillage types. Soil type,
rainfall, crop rotation and other external factors will influence the amount and rate of the
macropore flow. Therefore, proper N fertilization management is important to prevent
producers from applying too much crop-usable N and increasing the risk of N leaching in
macropore flow. Weather events can lead to substantial leaching, runoff, or denitrification of
residual N. As a general rule, the lower end of the recommended N rate range is more
appropriate under conditions when residual N is expected. Planting of cover crops and
avoiding of late season sidedress can minimize the post harvest NO3--N concentration in soil,
which is liable for leaching.

9.4. Phosphate in Surface Water

Transport of P from field is influenced by rainfall, soil erosion, surface runoff, and wind
(Lemunyon, 1993). The rate, timing, form, and method of application, along with the site
location on the landscape affect the likelihood of P movement and environmental impact
(Lemunyon, 1993). The transport of manure nutrients off-site in runoff is a major source of
surface water contamination. Phosphorus and N in surface runoff are the major contributors to
the impairment of lakes and ponds through the process of eutrophication. Eutrophication is the
result of excessive bacteria and algae growth in surface waters due to nutrient enrichment,
usually of N and phosphates. Applying poultry manure according to the N needs of corn
typically applies more P than is recommended for two crop-years in a corn-soybean rotation,
which increases the risk for P losses to surface waters (Mallarino et al., 2002; Kaiser et al.,
2009).
Phosphorus from liquid swine manure was more available than fertilizer P. It was
postulated that the decomposition of manure resulted in concentrations of organic acids that
effectively reduced P sorption to the soil and increased P availability. Incorporating swine
manure when the probability of immediate rainfall is high reduces the risk of P loss in surface
runoff; however, this benefit sharply decreases with time (Allen and Mallarino, 2008). Grande
 Corn Crop Production: Growth, Fertilization and Yield 61

et al. (2005a, 2005b) observed that high residue levels combined with spring-applied manure
led to enrichment in the clay-sized fraction of runoff sediment. After 4-yr of last application of
manure and compost in a corn field, P leaching to a soil depth of 45 to 60 cm was observed
with N-based manure application (Eghball et al., 2004).
Recently applied manure and higher residue levels achieved by high-cutting silage can
substantially lower sediment losses in spring runoff when soil is most susceptible to erosion.
Kleinman et al. (2005) reported that water-extractable P (WEP) ranged widely (0.2 -16.8 g ha-
1
), with swine manure having the highest average concentrations (9.2 g ha-1), followed by
turkey (6.3 g ha-1), layer chickens (4.9 g ha-1), dairy cattle (4.0 g ha-1), broiler chickens (3.2 g
ha-1), and beef cattle manure (2.3 g ha-1). Phosphorus leaching from manure applications on
loamy sand soils does not pose environmental concerns as long as soil P levels remain below
the saturation level (van Es et al., 2004). Phosphorus leaching can be extreme and represents a
great concern in many coarse-textured soils with low P-sorption capacities (Alleoni et al.,
2008). In a simulated rainfall study in Alberta, Canada, runoff of total P, soil test P and
dissolved reactive P concentrations increased with manure rate for both fresh and residual
manure (Volf et al., 2007). Band placement of P fertilizer can be considered an environmental
best management practice because the fertilizer banded below the soil surface is much less
susceptible to loss via surface runoff (Jokela, 2004). Recent manure additions were most
influential in enriching transported sediments with P (Grande et al., 2005b).
There was no relationship between soil test P levels and runoff P concentrations or loads in
no-till systems. Long-term manure P applications in excess of P removal by corn in
conventional tillage systems ultimately increased the potential for greater dissolved and
bioavailable P losses in runoff by increasing soil P levels (Andraski et al., 2003). They suggest
that maintaining high surface residue cover such as those found in long-term NT corn
production systems can mitigate this risk in addition to reducing sediment and particulate P
losses.

10. CORN RESIDUES, BIO-FUEL, AND IMPACTS

ON SOIL FERTILITY

Residues are necessary to protect soil from erosion and to contribute SOM levels. Crop
residues protect the soil from wind and water erosion, provide inputs to form soil organic
matter (a critical component determining soil quality) and play a key role in nutrient cycling
(Johnson et al., 2003). In the developing countries, corn stover is removed mainly for animal
feed, while in the mechanized and developed countries such as in the USA, corn residue
(stover) has been increasingly considered as a source of cellulosic biomass for biofuel
production to supplement fossil fuel. Ethanol derived from corn is considered as a clean source
of energy that is in use to power transportation vehicles. Use of corn residue for production of
biofuel has the advantage of reducing dependence on the imported fossil fuel and developing
renewal energy source (Wilhelm et al., 2004). Because of the growing demand of corn based
ethanol, corn growers in the USA are getting good profits from corn crops. Its use is increasing
and there is a growing demand of biofuel although this technology is generally still in its
infancy. Under conservation tillage systems, the corn residues are left over after the grain
harvest, which can be a major source of nutrients cycling and SOM. Removing corn stover as a
62 K. D. Subedi and B. L. Ma

feed stock for biofuel production may decrease the amount of carbon stored in soil, and lead to
an adverse impact on overall soil fertility.
There are no consistent conclusions on the impacts of residue removal on soil
characteristics and crop yield. In a short-term test, stover removal resulted in increased soil
crust strength and reduced soil water content (Blanco-Canquia et al., 2006). Over a three-year
period, where crop residues were completely removed after harvest, yield of corn was reduced
by 22% than where residues were not removed (Dorna et al., 1984). Yield reduction of corn
was primarily from decreased soil water storage and excessive surface soil temperatures where
residue was completely removed. There is a potential of reduction in grain yields as well as
greater potential for nutrients removal (Dorna et al., 1984). Blanco-Canqui and Lal (2008)
reported that removal of stover at rates ≥ 50% reduced sub-critical water repellence by 2 to 10
times in all soils and concluded that stover removal adversely affects both macro- and micro-
scale soil properties. In the contrary, Wilhelm et al. (2004) stated that within limits, corn stover
can be harvested for biofuel production. Johnson et al. (2003) concluded that the range of crop
and soil responses to crop residue removal was attributed to interactions with climate,
management and soil type. Crop residues also impact radiation balance and energy fluxes and
reduce evaporation. The impact of crop residue removal on soil quality and crop productivity
must be assessed before prudent decision and policy can be developed (Wilhelm et al., 2004).
Other potential problems with using corn stover for bio-energy include competition with
livestock feed, competition in land for other food grains production, and more importantly, the
negative impact on soil fertility and quality due to increasing continuous corn monoculture.
The removal of corn stover will significantly reduce the amount of OM returned in the soil,
which in time will reduce the SOM and plant nutrients. Alternative practices such as green
maturing, cover cropping and using animal manures should be practices for the lands where
corn stovers are removed for biofuel production. Similarly, height of cutting of stover will
minimize the total OM removal from the soil. In general, the benefits of using crop residues as
fuel, which removes crop residues from the field, must be balanced against negative
environmental impacts (e.g. soil erosion), maintaining SOM levels, and preserving or
enhancing productivity.

11. CONCLUDING REMARKS AND FUTURE RESEARCH NEEDS

This chapter covered a wide prospectus of sustainable nutrients management in corn crops.
Corn types, corn-based cropping systems, corn growth stages and maturity group, essential
nutrients and their classification, nutrients-deficiencies and sources of nutrients for corn crops
are the introductory sections. Methods of detecting nutrients requirements, and integrated
management of different sources of nutrients as well as strategies to achieve optimum corn
yield without causing adverse effects on soil health and environment have been the other
aspects of this chapter. Emphasis has been given on the nutrients use efficiencies especially for
N and impacts of different nutrients management practices on environment, such as on soil
NO3--N leaching to ground water, P in surface runoff and gaseous N emissions. The effects of
using organic manures and biosolids on corn fields and removal of corn stover for bioenergy
production are also briefly discussed. The information provided is based on the advances in
contemporary research outcomes suitable to the topic. Although we have tried to provide a
 Corn Crop Production: Growth, Fertilization and Yield 63

global perspective of the topic, it is obvious that majority of the research works that have been
reviewed are from the North Americas.
Low efficiency of applied manures and fertilizers, especially N fertilizer has been found to
be one of the most important nutrients management challenges in corn production.
Consequently, the impacts of chemical fertilizers and animal manures on soil, water and
eventually on the environment are significant. Tillage practices such as conservation tillage has
positive impacts on nutrients use efficiency, and soil conservation, and environment although
it demands more nutrients initially. Nutrients application timing (such as preplant or
sidedress), rate and methods have also been influenced by the tillage systems. The IPNM,
which is a nutrients management approach of integrating soil, crop and nutrients sources for
sustainable crop production seems to be the key nutrients management approach for all corn
production systems. Components of IPNM have been discussed in relation with the
environmental protection and sustainability of the corn production systems.
Nutrients management on corn is one of the most researched areas, while nutrients losses
from the corn fields are noteworthy. Still there are several areas of research that needed to be
concentrating for the sustainable nutrients management in corn crops in order to maximize the
nutrients use efficiencies while reducing the impacts on environment. Based on the review of
published literatures on this topic, information gaps in corn nutrients management seem to be
in the following key areas:

• There are several researches on an individual component of the overall nutrients

management for corn, such as N, P or micronutrients management. However, research
on a complete package is lacking. For example, integrating soil, crop and nutrients
management on a holistic system basis would provide more useful results on a system
perspective. Therefore, research projects focus on IPNM approach of nutrients
management, i.e. integrating nutrients, soils, crop and environment would be desirable
for the sustainable corn production.
• It has been observed that the use of N fertilizer on corn production is far more than
what is actually required. There is always a lower NUE, usually < 40% and excessive
N are beyond recovery in the soil and water systems. Therefore, efforts towards
reducing the use of unwarranted N fertilizers or manure in corn fields are important.
Large-scale on-farm research and demonstration projects with the participation of corn
producers will be useful and perhaps the best technology transfer avenues to raise
producers awareness and acceptance of any new innovative technologies.
• There is lack of suitable and agronomic and economically feasible controlled-release
fertilizers that would provide the crop with timely nutrient supply while minimizing or
eliminating NO3- and gaseous N emission losses. Integrating experts in the areas of
soil, plant, and engineering, including nanotechnology to develop intelligent smart
fertilizers and matched nutrient management systems will certainly improve the
system efficiency.
• There is a serious lack of research on crop site-specific nutrients management,
especially in the developing countries. Generalizing the research results from
geographically distinct regions is not appropriate. Therefore, more research based on
the local cropping systems, soil and environment should be encouraged. Nutrients
recommendations without complete set of research information can be misleading in
64 K. D. Subedi and B. L. Ma

terms of environmental and human health issues while increase the cost of manure or
fertilizers.
• Manures from animals are the natural sources of plant nutrients and undoubtedly they
have several benefits to soil and crops. However, improper storage, application and
uses can have severe impacts on environment and human health. There is limited
research on the use of organic manures, especially in the developed countries, while
research in the developing countries is negligible. This component of plant nutrients
management should be given much attention.
• The conservation tillage system has been proven to be beneficial for soil, water and
nutrients conservation and reducing energy and cost of production. The nutrients
management practices for conservation agriculture systems may be different than the
conventional systems. Therefore, more research on appropriate nutrient management
for the conservation agriculture system will be required for the wide-scale promotion
of this system.
• Cover crops have been shown importance in preserving soil NO3- after corn harvest,
providing nutrients to the following crops and preventing wind and water erosions.
Research on suitable crops and their cultivation and technologies for the
implementation of cover crops are urgently needed.
• Although, site-specific nutrient management is considered to be a potential approach
of reducing nutrients waste thereby protecting environment and providing
economically profitable system, there are limitations on the adaptation of this
approach. There has been considerable interest in the development of crop need-based
indicators using remote sensing technology. Up-to-date research on field level remote
sensing has shown that i) optical sensing at certain wavelength bands or spectral
indices is able to detect crop reaction to biotic (diseases) and abiotic (nutrient, water)
stresses; (ii) at early stages of crop development, measuring leaf chlorophyll or
canopy reflectance can predict biomass and yield potential in certain crops and at
specific growth stages/conditions; (iii) the ability of optical sensing to detect crop
health status varies with environmental and cultural conditions; (iv) under best
scenarios in research plots (shortage of plant available nutrients in the soil, e.g. N,
weed-free, no severe drought after fertilizer sidedress, low N supplying power fields –
sandy loam soil, no manure or legume preceding crop), optical sensor guided N
application can increase yield and NUE; (v) algorithms for converting optical sensor
signals into fertilizer N rates may vary across environments; (vi) optical sensor
readings will be saturated when available N above certain levels and/or crop reaches
advanced stages. Clearly, more focused research on the development of on-the-go
uniform or variable rate application of N to corn is of paramount importance to
improve nutrient and water use efficiencies and reducing N and agrochemical loading
of the environment for efficient food and biomass production.
 Corn Crop Production: Growth, Fertilization and Yield 65

REFERENCES
Adiloglu, A. and Adiloglu, S. (2006). The effect of boron (B) application on the growth and
nutrient contents of maize in zinc (Zn) deficiency. Research Journal of Agriculture and
Biological Sciences, 2(1), 1-4.
Agus, F.; Garrity, D.P.; Cassel, D.K. and Mercado, A. (1998). Grain crop response to contour
hedgerow systems on sloping Oxisols. Agroforestry Systems, 42, 107-120.
Al-Kaisi, M. and Kwaw-Mensah, D. (2007). Effect of tillage and nitrogen rate on corn yield
and nitrogen and phosphorus uptake in a corn-soybean rotation. Agronomy Journal,
99, 1548-1558.
Al-Kaisi, M.M. and Yin, X. (2003). Effect of nitrogen rate, irrigation rate and plant population
on corn yield and water use efficiency. Agronomy Journal, 95, 1475-1482.
Allen, B.L. and Mallarino, A.P. (2008). Effect of liquid swine manure rate, incorporation, and
timing of rainfall on phosphorus loss with surface runoff. Journal of Environmental
Quality, 37, 125-137.
Alleoni, L.R.F.; Brinton, S.R. and O’Connor, G.A. (2008). Runoff and leachate losses of
phosphorus in a sandy spodosol amended with biosolids. Journal of Environmental
Qualilty, 37, 259-265.
Andrade, F.H.; Vega, C.; Uhart, S.; Cirilo, A.; Cantarero, M. and Valentinuz, O. (1999).
Kernel number determination in maize. Crop Science, 39, 453-459.
Andraski, T.W. and Bundy, L.G. (2002). Using the pre-sidedress soil nitrate test and organic
nitrogen crediting to improve corn nitrogen recommendations. Agronomy Journal, 94,
1411-1418.
Andraski, T.W. and Bundy, L.G. (2005). Cover crop effects on corn yield response to nitrogen
on an irrigated sandy soil. Agronomy Journal, 97, 1239-1244.
Andraski, T.W. and Bundy, L.G. (2008). Corn residue and nitrogen sources effects on nitrogen
availability in no-till corn. Agronomy Journal, 100, 1274-1279.
Andraski, T.W.; Bundy, L.G and Kilian, K.C. (2003). Manure history and long-term tillage
effects on soil properties and phosphorus losses in runoff. Journal of Environmental
Quality, 32, 1782-1789.
Andrews, C. J.; Dwyer, L.M.; Stewart, D.W.; Dugas, J.A. and Bonn, P. (2000). Distribution of
carbohydrate during grain fill in Leafy and normal maize hybrids. Canadian Journal of
Plant Science, 80, 87-95.
Aparicio, N.; Villegas, D.; Casadesus, J.; Araus, J.L. and Royo, C. (2000). Spectral vegetation
indices as non-destructive tools for detecting durum wheat yield. Agronomy Journal, 92,
83-91.
Arnon, D.I. and Stout, P.R. (1939). The essentiality of certain elements in minute quantity for
plants with special reference to copper. Plant Physology, 14, 371-375.
Atreya, K.; Sharma, S.; Bajracharya, R.M. and Rajbhandari, N.P. (2008). Developing a
sustainable agro-system for central Nepal using reduced tillage and straw mulching.
Journal of Environmental Management, 88, 547-555.
Bacon, P.E. and Thompson, J.A. (1984). Effects of method and timing of nitrogen fertilizer on
irrigatated maize growth and nutrient distribution in soil. Austrilian Journal of
Experimental Agriculture and Animal Husbandry, 24, 606-611.
66 K. D. Subedi and B. L. Ma

Ball-Coelho, B.R. and Roy, R.C. 1999. Enhanced ammonium sources to reduce nitrate
leaching. Nutrient Cycling in Agroecosystems, 54, 73-80.
Bardoli, J.M. and Mallarino, A.P. (1998). Deep and shallow banding of phosphorus and
potassium as alternatives to broadcast fertilization for no-till corn. Agronomy Journal, 90,
27-33.
Bausch, W.C. and Duke, H.R. (1996). Remote sensing of plant nitrogen status in corn.
American Society of Agricultural Engineers, 39, 1869-1875.
Bavec, F. and Bavec, M. (2002). Effect of plant population on leaf area index, cob
characteristics and grain yield of early maturing maize cultivar (FAO-100-400). European
Journal of Agronomy, 16, 151-159.
Beauchamp, E.G.; Kannenberg, L.W. and Hunter, R. B. (1976). Nitrogen accumulation and
translocation in maize genotypes following silking. Agronomy Journal, 68, 418-422.
Benedict, H.M. and Swidler, R. (1961). Nondestructive method for estimating chlorophyll
content of leaves. Science, 133, 2015-2016.
Bertin, P. and Gallais, A. (2000). Genetic variation for nitrogen use efficiency in a set of
recombinant maize inbred lines 1. Agrophysiological results. Maydica, 45, 53-66.
Binder, D.L.; Sander, D.H. and Walters, D.T. (2000). Corn response to time of nitrogen
application as affected by level of nitrogen deficiency. Agronomy Journal, 92, 1228-1236.
Binford, G.D.; Blackmer, A.M. and El-Hout, N.M. (1990). Tissue test for excess nitrogen
during corn production: Agronomy Journal, 82, 124-129.
Binford, G.D.; Blackmer, A.M. and Cerrato, M.E. (1992). Nitrogen concentration of young
corn plants as an indicator of nitrogen availability. Agronomy Journal, 84, 219-223.
Bittman, S.; Hunt, D.E. and Kowalenko, C.G. (2004). Cover crops and relay crops. Pp. 89-94.
In: S. Bittman and C.G. Kowalenko (eds.) Advances in Silage Corn Management. Pacific
Field Corn Association, Agassiz, BC, Canada.
Blackmer, T.M. and Schepers, J.S. (1995). Use of a chlorophyll meter to monitor nitrogen
status and schedule of fertigation for corn. Journal of Production Agriculture, 8, 56-60.
Blackmer, T.M.; Pottker, D.; Cerrato, M.E. and Webb, J. (1989). Correlations between soil
nitrate concentrations in late spring and corn yield in Iowa. Journal of Production
Agriculture, 2, 103-109.
Blackmer, A.M.; Voss, R.D. and Mallarino, A.P. (1997). Nitrogen fertilizer recommendations
for corn in Iowa. Publication Pm-1714. Iowa State University Extension, Ames, IA.
Blanco-Canquia, H. and Lal, R. (2008). Corn stover removal impacts on micro-scale soil
physical properties. Geoderma, 145, 335-346.
Blanco-Canquia, H.; Lala, R.; Postb, W.M.; Izaurraldec R.C. and Owensd, L.B. (2006). Corn
stover impacts on near-surface soil properties of no-till corn in Ohio. Soil Science Society
of America Journal, 70, 266-278.
Borges, R. and Mallarino, A.P. (2001). Deep banding phosphorus and potassium fertilizers for
corn managed with ridge tillage. Soil Science Society of America Journal, 63, 376-384.
Borŕas, L.; Maddonni, G.A. and Otegui, M.E. (2003). Leaf senescence in maize hybrid: plant
population, row spacing and kernel set effects. Field Crops Research, 82, 13-26.
Borrell, A.K.; Hammer, G.L. and Oosterom, E.V. (2001). Stay-green: a consequence of the
balance between supply and demand for nitrogen during kernel filling. Annals of Applied
Biology, 138, 91-95.
Bouwman, A.F. (1996). Direct emission of nitrous oxide from agricultural soils. Nutrient
Cycling in Agroecosystems, 46, 53-70.
 Corn Crop Production: Growth, Fertilization and Yield 67

Bouwman, A.F. and Boumans, L.J.M. (2002). Emissions of N2O and NO from fertilized fields:
Summary of available measurement data. Global Biogeochemical Cycles, 16, 1-13.
Bronson, K.F.; Chua, T.T.; Booker, J.D.; Keeling, J.W. and Lascano, R.J. (2003). In-season
nitrogen status sensing in irrigated cotton: II leaf nitrogen and biomass. Soil Science
Society of America Journal, 67, 1439-1448.
Brown (1970). Plant Analysis. Missouri Agrcultural Experimental Station Bulletin. SB881.
Brown, C. (2005). Available nutrients from manures from various livestock types. November
2005. Ontario Minisitry of Agriculture Food and Rural Affairs. Available online at
http://www.omafra.gov.on.ca/english/crops/field/news/croptalk/2005/ct_1105a6.htm
Brown D.M. and Bootsma, A. (1993). Crop heat units for corn and other warm season crops in
Ontario. Ministry of Agric. and Food Factsheet Agdex 111/31. Ontario Ministry of
Agriculture and Food. Ontario, Canada.
Bruns, H.A. and Abel, C.A. (2003). Nitrogen fertility effects on Bt δ-endotoxin and nitrogen
concentrations of maize during early growth. Agronomy Journal, 95, 207-211.
Bullock, D.G.; Simmons, F.W.; Chung, I.M. and Johnson, G.I. (1993). Growth analysis of
corn grown with or without starter fertilizer. Crop Science, 33, 112-117.
Bundy, L.G. and Andraski, T.W. (1999). Site-specific factors affecting corn response to-starter
fertilizer. Journal of Production Agriculture, 12, 664-670.
Bundy, L.G. and Widen, P.C. (1991). Corn response to starter fertilizer: Planting date and
tillage effects. Better Crops, 76, 20–23. Potash and Phosphate Institute (ed.).
Burger, M. and Venterea, R.T. (2008). Nitrogen immobilization and mineralization kinetics of
cattle, hog, and turkey manure applied to soil. Soil Science Society of America Journal, 72,
1570-1579.
Busch, W.C. and Duke H.R. (1996). Remote sensing of plant nitrogen status in corn.
Transations of the American Society of Agricultural Engineering, 39, 1869-1875.
Butler, T.J.; Han, K.J.; Muir, J.P.; Weindorf, D.C. and Lastly, L. (2008). Dairy manure
compost effects on corn silage production and soil properties. Agronomy Journal, 100,
1541-1545.
Campbell, C.A.; Zentner, R.P.; Selles, F.; McConkey, B.G. and Dyck, F.B. (1993). Nitrogen
management for spring wheat grown annually on zero-tillage: Yields and nitrogen use
efficiency. Agronomy Journal, 85, 107-114.
Casanova, D.; Epema, G.F. and Goudriaan, J. (1998). Monitoring rice reflectance at field level
for estimating biomass and LAI. Field Crops Research, 55, 83-92.
Chantigny, M.H., Angers, D.A., Belanger, G., Rochette, P., Eriksen-Hamel, N., Bittman, S.,
Buckley, K., Masse, D. and Gasser, M.O., 2008, Yield and nutrient export of grain corn
fertilized with raw and treated liquid swine manure. Agronomy Journal, 100, 1303-1309.
Cherr, C.M.; Scholberg, J.M.S. and McSorley, R. (2006). Green manure as nitrogen source for
sweet corn in a warm–temperate environment. Agronomy Journal, 98, 1173-1180.
Cerrato, M.E and Blackmer, A.M. (1991). Relationships between leaf nitrogen concentrations
and the nitrogen status of corn. Journal of Production Agriculture, 4, 525-531.
Chevalier, P. and Scharder, L.E. (1977). Genotypic differences in nitrate absorption and
partitioning of N among plant parts in maize. Crop Science, 17, 897-901.
Christensen, L.A. (2002). Soil, nutrient and water management systems used in US corn
production. Agriculture Information Bulletin No. 774, United States Department of
Agriculture (USAID), USA.
68 K. D. Subedi and B. L. Ma

Cook, R.J. 1988. Biological control and holistic plant-healthcare in agriculture. Alternative
Agriculture, 3, 51-62.
Copeland, P.J.; Allmaras, R.R.; Crookston, R.K. and Nelson, W.W. (1993). Corn-soybean
rotation effects on soil water depletion. Agronomy Journal, 85, 203-210.
Costa, C.; Dywer, L.M.; Stewart, D.W.; Ma, B.L. and Smith, D.L. (2001). Interrelationships of
applied nitrogen and yield of leafy and non-leafy maize genotypes. Journal of Plant
Nutrition, 24, 1173-1194.
Costa, C.; Dywer, L.M.; Stewart, D.W.; and D.L. Smith. (2002). Nitrogen effect on kernel
yield and yield components of Leafy and non-Leafy maize genotypes. Crop Science, 42,
1556-1563.
Cui, Y. and Wang, Q. (2006). Physiological responses of maize to elemental sulphur and
cadmium stress. Plant, Soil and Environment, 52, 523-529.
Decker, A.M.; Clark, A.J.; Meisinger, J.J.; Mulford, F.R. and McIntosh, M.S. (1994). Legume
cover crop contributions to no-tillage corn production. Agronomy Journal, 86, 126-135.
De Jong, R.; Yang, J.Y.; Drury, C.F.; Huffman, E.C.; Kirkwood, V. and Yang, X.M. (2007).
The indicator of risk of water contamination by nitrate-nitrogen. Canadian Journal of Soil
Science, 187, 179-188.
Desjardins, C.A.; Verge, R.L.; Hutchinson, X.; Smith, J.; Grant, W.; McConkey, B. and
Worth, D. (2005). Greenhouse gases. Pp. 142-149 In: A. Lefebvre, W. Eilers and B.
Chunn, Eds. Environmental Sustainability of Canadian Agriculture: Agri-Environmental
Indicator Report Series- Report # 2, Agriculture and Agri-Food Canada, Ottawa, ON.
Dharmakeerthi, R.S.; Kay, B.D. and Beauchamp, E.G. (2006). Spatial variability of in-season
nitrogen uptake by corn across a variable landscape as affected by management.
Agronomy Journal, 98, 255-264.
Ding, W.; Hume, D.J.; Vyn, T.J. and Beauchamp, E.G. (1998). N credit for soybean to a
following maize crop in central Ontario. Canadian Journal of Plant Science, 78, 29-33.
Doerge, T.A. (2002). Variable-rate nitrogen management creates opportunities and challenges
for corn producers. Plant Management Network, 5 Sept., 2002.
Dormaar, J.F. and Chang, C. (1995). Effect of 20 annual application of excess feedlot manure
on labile soil phosphorous. Canadian Journal of Soil Science, 75, 507-515.
Dorna, J.W.; Wilhelm, W.W. and Power, J.F. (1084). Crop residue removal and soil
productivity with no-till corn, sorghum, and soybean. Soil Science Society of America
Journal, 48, 640-645.
Driskell, B.N. and Richer, A.C. (1952). Correlation of plant tissue tests of corn, deficiency
symptoms, and soil analyses on Jordan fertility. Soil Science Society of America Journal,
16, 270.
Drury, C.F.; Tan, C.S.; Gaynor, J.D.; Oloya, T.O. and Welacky, T.W. (1996). Influence of
controlled drainage-subirrigation on surface and tile drainage nitrate loss. Jorunal of
Environmental Quality, 25, 317-324.
Drury, C.F.; Yang, J.Y.; De Jong, R.; Yang, M.X.; Huffman, E.C.; Kirkwood, V. and Reid, K.
(2007). Residual soil nitrogen indicator for agricultural land in Canada. Canadian Journal
of Soil Science, 87, 167-177.
Dwivedi, S.K.; Singh, R.S. and Dwivedi, K.N. (2002). Effect of sulphur and zinc nutrition on
yield and quality of maize in Typic ustochrept soil of Kanpur. Journal of Indian Society of
Soil Science, 50, 70-74.
 Corn Crop Production: Growth, Fertilization and Yield 69

Dwyer, L.M.; Andrews, C.J.; Stewart, D.W.; Ma, B.L.; and Dugas. J.A. (1995a). Carbohydrate
levels in field-grown leafy and normal maize genotypes. Crop Science, 35, 1020-1027.
Dwyer, L.M.; Stewart, D.W. and Glenn, F. (1998). Silage yields of Leafy and normal hybrids.
Proc. 53rd Ann. Corn and Sorghum Research Conference 1998. pp. 193-216. In Amer.
Seed. Trade Assoc., Inc. (ed.), Washington, D.C., USA.
Dwyer, L.M.; Ma, B.L.; Hayhoe, H.N. and Culley, J.L.B. 1995b. Tillage effects on soil
temperature, shoot dry matter accumulation and corn grain yield. Journal of Sustainable
Agriculture, 5, 85-99.
Dwyer, L.M.; Stewart, D.W.; Carrigan, B.L.; Ma, B.L.; and Neave, A.P. 1999a. Guidelines for
comparisons among different corn maturity rating systems. Agronomy Journal, 91, 946-
949.
Dwyer, L.M.; Stewart, D.W.; Ma, B.L.; Carrigan, B.L.; Neave, A.P. and Balchin, D. 1999b.A
general thermal index for maize. Agronomy Journal, 91, 940-946.
Dwyer, L.M.; Tollenaar, M. and Houwing. L. (1991). A non-destructive method to monitor
leaf greenness in corn. Canadian Journal of Plant Science, 71, 505-509.
Eghball, B. (2000). Nitrogen mineralization from field-applied beef cattle feedlot manure or
compost. Soil Science Society of America Journal, 64, 2024-2030.
Eghball, B. and Power, J.F. (1999a). Composted and noncomposted manure application to
conventional and no-tillage systems. Agronomy Journal, 91, 819-825.
Eghball, B. and Power, J. F. (1999b). Phosphorus and nitrogen-based manure and compost
applications: corn production and soil phosphorus. Soil Science Society of America
Journal, 63, 895-901.
Eghball, B.; Ginting, D. and Gilley, J.E. (2004). Residual effects of manure and compost
applications in corn production and soil properties. Agronomy Journal, 96, 442-447.
Eghball, B.; Wienhold, B.J.; Woodbury, B.L. and Eigenberg, R.A. (2005). Plant availability of
phosphorus in swine slurry and cattle feedlot manure. Agronomy Journal, 97, 542-548.
Ellings, A.; White, J. and Edmeades, G.O. (1998). Modelling tropical maize under drought and
low N. Agronomy Abstracts, 1996 Annual Meeting. Pp. 109. Madison, Wisconsin, USA:
American Society of Agronomy.
FAO. (1998). Guide to Efficient Plant Nutrition Management. Pp. 18. Food and Agriculture
Organization (FAO), Rome, Italy.
Fang, Q.; Ma, L.; Yu, Q.; Malone, R.W.; Saseendran, S. A. and Ahuja L.R. (2008). Modeling
nitrogen and water management effects in a wheat-maize double-cropping system. Journal
of Environmental Quality, 7, 2232-2242.
Farmer, A.A and Farmer, A.M. (2000). Concentrations of cadmium, lead and zinc in livestock
feed and organs around a metal production centre in eastern Kazakhstan. Science Total
Environment, 257(1), 53-60.
Fearing, P.L.; Brown, D.; Vlachos, D.; Meghji, M. and Privalle L. (1997). Quantitative
analysis of Cry1A(b) expression in Bt maize plants, tissue, tissue and silage stability of
expression over successive generation. Molecular Breeding, 3, 169-176.
Feil, B.; Moser, S.B.; Jampaton, S. and Stamp, P. (2005). Mineral composition of the grains of
tropical maize varieties as affected by pre-anthesis drought and rate of nitrogen
fertilization. Crop Science, 45, 516-523.
Ferguson, R.B.; Hergert, G.W.; Schepers, J.S.; Gotway, C.A.; Cahoon, J.E. and Peterson, T.A.
(2002). Site-specific nitrogen management of irrigated maize: Yield and soil residual
nitrate effects. Soil Science Society of America Journal, 66, 544-553.
70 K. D. Subedi and B. L. Ma

Ferguson, R.B.; Shapiro, C.A.; Hergert, G.W.; Kranz, W.L.; Klocke, N.L. and Krull, D.H.
(1991). Nitrogen and irrigation management practices to minimize nitrate leaching from
irrigated corn. Journal of Production Agriculture, 4, 186-192.
Filella, I.; Serrano, L.; Serra, J. and Peñuelas, J. (1995). Evaluating wheat nitrogen status with
canopy reflectance indices and discriminant analysis. Crop Science, 35, 1400-1405.
Fischler, M. and Wortmann, C.S. (1999). Green manures for maize-bean systems in eastern
Uganda: Agronomic performance and farmers’ perceptions. Agro-forestry Systems, 47,
123-138.
Fleming, K.L.; Westfall, D.G., and Bausch, W.C. (2000). Evaluating management zone
technology and grid soil sampling for variable-rate nitrogen application.Pp. 12-22. In:
Proc. of the 5th International Conf. on Precision Agric. ASA-CSSASSSA, Madison, WI.
Flowers, M..; Weisz, R.; Heiniger, R.; Tarleton, B. and Meijer, A. (2003). Field validation of a
remote sensing technique for early nitrogen application decision in wheat. Agronomy
Journal, 95, 167-176.
Fox, R.H. and Bandel, V.A. (1986). Nitrogen utilization with no-tillage. Pp. 117-148. In:
Sprague, M.A.Triplett, G.B. (eds.). No-tillage and surface-tillage agriculture: The tillage
revolution. Wiley, New York (USA).
Francis, D.D.; Schepers, J.S., andVigil, M.F. (1993). Post anthesis nitrogen loss from corn.
Agronomy Journal, 85:659-663.
Fronning, B.E.; Thelen, K.D. and Min, D.H. (2008). Use of manure, compost, and cover crops
to supplement crop residue carbon in corn stover removed cropping systems. Agronomy
Journal, 100, 1703-1710.
Garg, K.P. and Welch, L.F. (1967). Growth and phosphorus uptake by corn as influenced by
phosphorus placement. Agronomy Journal, 59, 152-154.
Gehl, R.J.; Schmidt, J.P.; Godsey, C.B.; Maddux, L.D. and Gordon, W.B. (2006). Post-harvest
soil nitrate in irrigated corn: Variability among eight field sites and multiple nitrogen rates.
Soil Science Society of America Journal, 70, 1922-1931.
Gehman, A.M.; Kononoff, P.J.; Mullins, C.R. and Janicek, B.N. (2008). Evaluation of nitrogen
utilization and the effects of monensin in dairy cows fed brown mid rib corn silage.
Journal of Dairy Science, 91, 288-300.
Gilabert, M.A.; Gandia, S. and Melia, J. (1996). Analyses of spectral-biophysical relationships
for corn canopy. Remote Sensing of Environment, 55, 11-20.
Ginting, D.; Kessavalou, A.; Eghball, B. and Dorna, J.W. (2003). Greenhouse gas emission
and soil indicators four years after manure and composts applications. Journal of
Environmental Quality, 32, 23-32.
Gitelson, A.A. (2004). Wide dynamic range vegetation index for remote quantification of
biophysical characteristics of vegetation. Journal of Plant Physiology, 161, 165-173.
Goss, J.A. (1968). Development, physiology and biochemistry of corn and wheat pollen.
Botanical Review, 34, 333-358.
Grande, J.D., Karthikeyan, K.G., Miller, P.S. and Powell, J.M. (2005a). Residue levels and
manure application timing effects on runoff and sediment losses. Journal of
Environmental Quality, 34, 1337-1346.
Grande, J.D., Karthikeyan, K.G., Miller, P.S. and Powell, J.M. (2005b). Corn residue level and
manure application timing effects on phosphorus losses in runoff. Journal of
Environmental Quality, 34, 1620-1631.
 Corn Crop Production: Growth, Fertilization and Yield 71

Griffith, D.R., Kladivko, E.J., Mannering, J.V., West, R.D. and Parsons, S.D. (1988). Long-
term tillage and rotation effect on corn growth and yield on high and low organic matter,
poorly drained soils. Agronomy Journal, 80, 599-605.
Griffin, T.; Liebman, M. and Jemison, Jr. J. (2000). Cover crops for sweet corn production in a
short-season environment. Agronomy Journal, 92, 144-151.
Gruhn, P.; Goletti, F. and Yudelman, M. (2000). Integrated nutrient management, soil fertility,
and sustainable agriculture: Current issues and future challenges. Food, Agriculture, and
the Environment Discussion Paper 32. International Food Policy Research Institute,
Washington, D.C. 20006 U.S.A.
Gupta, S.; Munyankusi, E.; Moncrief, J.; Zvomuya, F. and Hanewall, M. (2004). Tillage and
Manure Application Effects on Mineral Nitrogen Leaching from Seasonally Frozen Soils.
Journal of Environmental Quality, 33, 1238-1246.
Gutierrez-Rodriguez, M.; Reynolds, M.P.; Escalante-Estrada, J.A. and Rodriguez-Gonzalez,
M.T. (2004). Association between canopy reflectance indices and yield and physiological
traits in bread wheat under drought and well-irrigated conditions. Australian Journal of
Agricultural Research, 55, 1139-1147.
Halvorson, A.D.; Moiser, A.R.; Reule, C.A. and Bausch, W.C. (2006). Nitrogen and tillage
effects on irrigated continuous corn yields. Agronomy Journal, 98, 63-71.
Hanway, J.J. (1962). Corn growth and composition in relation to soil fertility: III. Percentages
of N, P and K in different plant parts in relation to stage of growth. Agronomy Journal, 54,
222-229.
Hashemi, A.M.; Herbert, S.J. and Putnam, D.H. (2005). Yield response of corn to crowding
stress. Agronomy Journal, 97, 839-846.
Hay, R.K.M. and Gilbert, R.A. (2001). Variation in the harvest index of tropical maize:
evaluation of recent evidence from Mexico and Malawi. Annals of Applied Biology, 138,
103-109.
Heckman, J.R. 2002. In-season soil nitrogen testing as a guide to nitrogen management for
annual crops. HortTechnology, 12, 706-710.
Heckman, J.R. and Kamprath, E.J. (1992). Potassium accumulation and corn yield related to
potassium fertilizer rate and placement. Soil Science Society of America, J. 56, 141-148.
Heckman, J.R.; Hlubik, W.T.; Prostak, D.J. and Paterson, J.W. (1995). Pre-sidedress soil
nitrate test for sweet corn. HortScience, 30, 1033-1036.
Heckman, J.R.; Samulis, R. and Nitzsche, P. (2002). Sweet corn crop nitrogen status
evaluation by stalk testing. HortScience, 37, 783-786.
Heckman, J.R.; Sims, J.T.; Beegle, D.B.; Coale, F.J.; Herbert, S.J.; Bruulsema, T.W. and
Bamka, W.J. (2003). Nutrients removal by corn grain harvest. Agronomy Journal, 95, 587-
591.
Heckman, J.R.; Jokela, W.; Morris, T.; Beegle, D.B.; Sims, J.T.; Coale, F.J.; Herbert, S.;
Griffin, T.; Hoskins, B.; Jemison, J.; Sullivan, W.M.; Bhumbla, D.; Estes, G. and Reid,
W.S. (2006). Soil test calibration of predicting corn response to phosphorus in the
Northwest USA. Agronomy Journal, 98, 280-288.
Heinrichs, E.A. (1988). Global production and plant stress. pp. 1-34. In: E.A. Heinrichs (ed.)
Plant Stress-Insect Interactions. John Wiley and Sons, New York.
Hensler, R.F.; Olsen, R.J. and Attoe, O.J. (1970). Effect of soil pH and application rate of
dairy cattle manure on yield and recovery of twelve plant nutrients by corn. Agronomy
Journal, 62, 828-830.
72 K. D. Subedi and B. L. Ma

Herrmann, A. and Taube, F. (2005). Nitrogen concentration at maturity - an indicator of

nitrogen status in forage maize. Agronomy Journal, 97, 201-210.
Herrmann, A.; Kersebaum, K.C. and Taube, F. (2005). Nitrogen fluxes in silage maize
production: Relationship between nitrogen content at silage maturity and nitrate
concentration in soil leachate. Nutrient Cycling in Agroecosystems, 73, 59-74.
Herron, G.M.; Dreier, A.F.; Flowerday, A.D.; Colville, W.L. and R.A. Olson. (1971). Residual
mineral N accumulation in soil and its utilization by irrigated corn (Zea mays L.).
Agronomy Journal, 63, 322-327.
Hilton, B.R.; Fixen, P.E. and Woodward, H.J. (1994). Effects of tillage, nitrogen placement,
and wheel compaction on denitrification rates in corn cycle of corn-oats rotations. Journal
of Plant Nutrition, 17, 1341-1757.
Hitsuda, K.; Yamada, M. and Klepker, D. (2005). Sulfur requirement of eight crops at early
stages of growth. Agronomy Journal, 97, 155-159.
Hosseini, S.M.; Maftoun, M.; Karimian, N.; Ronaghi, A. and Emam, Y. (2007). Effect of zinc
x boron interaction on plant growth and tissue nutrient concentration of corn. Journal of
Plant Nutrition, 30, 773-781.
Hussain, I.; Olson, K.R. and Ebelhar, S.A. (1999). Long-term tillage effects on soil chemical
properties and organic matter fractions. Soil Science Society of America Journal, 63, 1335-
1341.
Hutchinson, J.J.; Grant, B.B.; Smith, W.N.; Desjardins, R.L.; Campbell, C.A.; Worth, D.E. and
Verge, X.P. (2007). Estimates of direct nitrous oxide emissions from Canadian agro-
ecosystems and their uncertainties. Canadian Journal of Soil Science, 87, 141-152.
Ibrahim, S.A. and Kandil, H. (2007). Growth, yield and chemical constituents of corn (Zea
mays L.) as affected by nitrogen and phosphorus fertilization under different irrigation
intervals. Journal of Applied Science Research, 3, 1112-1120.
IPCC - Intergovernmental Panel on Climate Change. (2007). Climate Change 2007: Synthesis
Report. An Assessment of the Intergovernmental Panel on Climate Change, IPCC
Secretariat, Geneva, 52 pp.
Inman, D.; Khosla, R.; Westfall, D.G. and Reich, R. (2005). Nitrogen uptake across site
specific management zones in irrigated corn production systems. Agronomy Journal, 97,
169-176.
IRRI - International Rice Research Institute. (2007). Available online at
http://www.irri.org/irrc/SSNM/SSNM/aboutssnm.asp
Iversen, K.V.; Fox, R.H. and Piekielek, W.P. (1985). The relationship of nitrate concentrations
in young corn stalks to soil nitrogen availability and grain yield. Agronomy Journal, 77,
927-932.
Izaurralde R.C.; Feng, Y.; Robertson, J.A.; McGill, W.B.; Juna N.G and Olson, B.M. (1995).
Long-term influence of cropping systems, tillage methods, and N sources on nitrate
leaching. Canadian Journal of Soil Sicence, 75, 497-505.
Jarvis, S.C.; Stockdale, E.A.; Shepherd, M.A.; Powlson, D.S. and Donald, L.S. (1996).
Nitrogen mineralization in temperate agricultural soils: Processes and measurement.
Advances in Agronomy, 57, 187-235.
Jawson, M.D.; Franzluebbers, A.J.; Galusha, D.K. and Aiken, R.M. (1993). Soil fumigation
within monoculture and rotations: Responses of corn and mycorrhizae. Agronomy Journal,
85, 1174-1180.
 Corn Crop Production: Growth, Fertilization and Yield 73

Jama, B.; Swinkels, R.A. and Buresh, R.J. (1997). Agronomic and economic evaluation of
organic and inorganic sources of phosphorus in western Kenya. Agronomy Journal, 89,
597-604.
Johnson, N.C.; Copeland, P.J.; Crookston, R.K. and Pfleger, F.L. (1992). Mycorrhizae:
Possible explanation for yield decline with continuous corn and soybean. Agronomy
Journal, 84, 387-390.
Johnston, A.M. and Dowbenko, R. (2004). Essential elements in corn. Pp.23-27. In: S. Bittman
and C.G. Kowalenko (eds.) Advances in Silage Corn Management. Pacific Field Corn
Association, Agassiz, BC, Canada.
Johnson, J. M.; Wilhelm, W.W.; Hatfield, J.L.; Voorhees, W.B. and Linden, D. 2003. Impact
of crop residue removal on crop and soil productivity. American Geophysical Union, Fall
Meeting 2003, abstract #B51B-03.
Jokela, W.E. (2004a). Applying starter fertilizer. Pp. 49-51. In: S. Bittman and C.G.
Kowalenko (eds.) Advances in Silage Corn Management. Pacific Field Corn Association,
Agassiz, BC, Canada.
Jokela, W.E. (2004b). Using solid manure: Vermont experience. Pp. 59. In: S. Bittman and
C.G. Kowalenko (eds.) Advances in Silage Corn Management. Pacific Field Corn
Association, Agassiz, BC, Canada.
Jones, C. and Jacobson, J. 2005. Plant Nutrition and Soil Fertility. Nutrient Management
Module No. 2. Montana State University Extension Services. 4449-2.
Kaiser, D.E.; Mallarino, A.P.; Haq, M.U. and Allen, B.L. (2009). Runoff phosphorus loss
immediately after poultry manure application as influenced by the application rate and
tillage. Journal of Environmental Quality, 38, 299-308.
Katsvario, T.W.; Cox, W.J.; Van Es, H.M. and Glos, M. (2003). Spatial yield response of two
corn hybrids at two nitrogen levels. Agronomy Journal, 95, 1012-1022.
Kayode, G.O. and Agboola, A.A. (1983). Investigation on the use of macro-and micro-
nutrients to improve maize yield in South Western Nigeria. Fertility Research, 4, 211-221.
Keeney, D.R. and Nelson, D.W. (1982). Nitrogen-inorganic forms. Pp. 643-698. In: A.L. Page,
R.H. Miller, and D.R. Keeney (eds). Methods of soil analysis. Part 2. Chemical and
microbiological properties. Agronomy – A series of Monographs. No. 9. 2nd ed.
ASA/CSSA/SSSA, Madison, WI, USA.
Keerthisinghe, G.; Zapata, F. and Chalk, P. (2003). Plant Nutrition: Challenges and Task
Ahead. Paper Presented in the IAF-FAO Agricultural Conference. Rome Italy, 26-28
March, 2003.
Khan, M.J.; Khan, M.H.; Khattak, R.A. and Jan, M.T. (2006). Response of maize to different
levels of sulphur. Communications in Soil Science and Plant Analysis, 37, 41-51.
Khan, S.A.; Mulvaney, R.L. and Hoeft, R.G. (2001). A simple soil test for detecting sites that
are nonresponsive to nitrogen fertilization. Soil Science Society of America Journal, 65,
1751-1760.
Kim, D.G.; Isenhart, T.M.; Parkin, T.B.; Schultz, R.C. and Loynachan, T.E. (2009). Nitrate
dissolved nitrous oxide in ground water within cropped fields and riparian buffers.
Biogeoscience Discovery, 6, 651-685.
Kleinman, P.J.A.; Wolf, A.M.; Sharpley, A.N.; Beegle, D.B. and Saporito, L.S. (2005). Survey
of water-extractable phosphorus in livestock manures. Soil Science Society of America
Journal, 69, 701-708.
74 K. D. Subedi and B. L. Ma

Knipling, E.B. (1970). Physical and physiological basis for the reflectance of visible and near-
infrared radiation from vegetation. Remote Sensing of Environment, 1, 155-159.
Koch, B.; Khosla, R.; Frasierb, W.M.; Westfall, D.G. and Inman, B. (2004). Economic
feasibility of variable-rate nitrogen application utilizing site-specific management zones.
Agronomy Journal, 96, 1572-1580.
Kowalenko, C.G. (2004). Determining nutrients available in soil. Pp. 27-33. In: S. Bittman and
C.G. Kowalenko (eds.) Advances in Silage Corn Management. Pacific Field Corn
Association, Agassiz, BC, Canada.
Kuo, S. and Jellum, E.J. (2002). Influence of winter cover crop and residue management on
soil nitrogen availability and corn. Agronomy Journal, 94, 501-508.
Kusa, K.; Hu, R.; Sawamoto, T. and Hatano, R. (2006). Three years of nitrous oxide and nitric
oxide emissions from silandic andosols cultivated with maize in Hokkaido, Japanese Soil
Science and Plant Nutrition, 52, 103-113.
Laboski, C.A.M. and Lamb, J.A. (2003). Changes in soil test phosphorus concentration after
application of manure or fertilizer. Soil Science Society America Journal, 67, 544-554.
Lamond, R.E. and Leikam, D.F. (2002). Chloride in Kansas: Plant, soil, and fertilizer
considerations. MF-2570. Kansas State Univ., Manhattan. Lemunyon, Kansas, USA.
Lawrence, J.R.; Ketterings, Q.M. and Cherney, J.H. (2008). Effect of nitrogen application on
yield and quality of silage corn after forage legume-grass. Agronomy Journal, 100, 73-79.
Legg, J.O. and Meisinger, J.J. (1982). Soil nitrogen budget. Pp. 503-566. In: F.J. Stevenson
(ed.) Nitrogen in agricultural soils. Agronomy – A series of Monographs. No. 22.
ASA/CSSA/SSSA, Madison, WI, USA.
Lemunyon, J.L. and Gilbert, R.G. (1993). The concept and need for a phosphorus assessment
tool. Journal of Production Agriculture, 6, 449-486.
Lessard, R.; Rochette, P.; Gregorich, E.G.; Pattey, E. and Desjardins, R.L. (1996). Nitrous
oxide fluxes from manure-amended soil under maize. Journal of Environmental Quality,
25, 1371-1377.
Li, C.F.; Cao, C.G.; Wang, J.P.; Zhan, M.; Yuan, W.L. and Shahrear, A. (2008). Nitrogen
losses from integrated rice–duck and rice–fish ecosystems in southern China. Plant and
Soil, 307, 207-217.
Liang, B.C. and MacKenzie, A.F. (1994). Corn yield, nitrogen uptake and nitrogen use
efficiency as influenced by nitrogen fertilization. Canadian Journal of Plant Science, 74,
235-240.
Lindsay, W.L. and Norwell., W.A. (1969). Development of a DTPA micronutrient soil test.
Soil Science of Amercan Proceeding, 35, 600-602. Research and Training Center. 21-24
September, 1998. İzmir, Turkey.
Lisuma, J.B.; Semoka, J.M.R. and Semu, E. (2006). Maize yield response and nutrient uptake
after micronutrient application on a volcanic soil. Agronomy Journal, 98, 402-406.
Lithourgidis, A.S.; Matsi, T.; Barbayiannis, N. and Dordas, C.A. (2007), Effect of liquid cattle
manure on corn yield, composition, and soil properties. Agronomy Journal, 99, 1041-
1047.
Lory, J.A. and Scharf, P.C. (2003). Yield goal versus delta yield for predicting fertilizer
nitrogen need in corn. Agronomy Journal, 95, 994-999.
Lupwayi, N.Z.; Girma, M. and Haque, I. (2000). Plant nutrient contents of cattle manures from
small farms in experimental stations in the Ethiopian highlands. Agriculture, Ecosystem
and Environment. 78, 57-63.
 Corn Crop Production: Growth, Fertilization and Yield 75

Ma, B.L. and Dwyer, L.M. (1998). Nitrogen uptake and use of two contrasting corn hybrids
differing in leaf senescence. Plant and Soil, 199, 283-291.
Ma, B.L. and Dwyer, L.M. (1999). Within plot variability in available soil mineral N in
relation to leaf greenness and yield. Communications in Soil Science and Plant Analysis,
30, 1919-1928.
Ma, B.L. and Dwyer, L.M. (2001). Maize kernel moisture, carbon and nitrogen concentrations
from silking to physiological maturity. Canadian Journal of Plant Science, 81, 225-232.
Ma, B.L, Dwyer, L.M.; Costa, C.; Cober, E.R. and Morrison, M.J. (2001). Early prediction of
soybean yields from canopy reflectance measurement. Agronomy Journal, 93, 1227-1234.
Ma, B.L.; Dwyer, L.M. and Costa, C. (2003). Row spacing and fertilizer nitrogen effects on
plant growth and grain yield of maize. Canadian Journal of Plant Science, 83, 241-247.
Ma, B.L.; Dwyer, L.M. and Gregorich, E.G. (1999a). Soil nitrogen amendment effects on
nitrogen uptake and grain yield of maize. Agronomy Journal, 91, 650-656.
Ma, B.L., Dwyer, L.M. and Gregorich, E.G. (1999b). Soil N amendment, effects on seasonal N
mineralization and N cycling in maize production. Agronomy Journal, 91, 1003-1009.
Ma, B.L.; Li, M.; Dwyer, L.M. and Stewart, G. (2004). Effect of in-season application
methods of fertilizer nitrogen on grain yield and nitrogen use efficiency in maize.
Canadian Journal of Soil Science, 84, 169-176.
Ma, B.L.; Morrison, M.J. and Voldeng, H.D. (1995). Leaf greenness and photosynthetic rate in
soybean. Crop Science, 35, 1411-1414.
Ma, B.L.; Morrison, M.J. and Dwyer, L.M. (1996). Canopy light reflectance and field
greenness to assess nitrogen fertilisation and yield of maize. Agronomy Journal, 88, 915-
920.
Ma, B.L. and Subedi, K.D. (2005). Yield, grain moisture and nitrogen use of Bt corn hybrids
and their conventional near-isolines. Field Crops Research, 93, 199-211.
Ma, B.L.; Subedi, K.D. and Costa, C. (2005). Comparison of crop-based indicators with soil
nitrate test for corn nitrogen requirement. Agronomy Journal, 97, 462-471.
Ma, B.L.; Subedi, K.D. and Liu, A. (2006a). Variation in grain N removal associated with
management practices in maize production. Nutrient Cycling in Agroecosystems, 76, 67-
80.
Ma, B.L.; Subedi, K.D.; Stewart, D.W. and Dwyer, L.M. (2006b). Dry matter accumulation
and silage moisture changes after silking in Leafy and dual-purpose corn hybrids.
Agronomy Journal, 98, 922-929.
Ma, B.L.; Subedi, K.D. and Zhang, T.Q. (2007). Pre-sidedress nitrate test and other crop-based
indicators for fresh market and processing sweet corn. Agronomy Journal, 99, 174-183.
Ma, B.L. and Wu, T.Y. (2008). Plant available N in the soil: Relationships between preplant
and presidedress nitrate tests for corn production. Journal of Plant Nutrition and Soil
Science, 171, 458-465.
Ma, B.L.; Ying, J.; Dwyer, L.D.; Gregorich, E.G. and Morrison, M.J. (2003). Crop rotation
and soil nitrogen amendment effects on maize production in Eastern Canada. Canadian
Journal of Soil Science, 83, 483-495.
Mackey, A.D.; Kladivko, E.J.; Barber, S.A. and Griffith, D.R. (1987). Phosphorous and
potassium uptake by corn in conservation tillage systems. Soil Science Society of America
Journal, 51, 970-974.
Magdoff, F.R. (1991). Understanding the Magdoff pre-sidedress nitrate test for corn. Journal
of production Agriculture, 4, 297-305.
76 K. D. Subedi and B. L. Ma

Magdoff, F.R.; Ross, D. and Amandon, J. (1984). A soil test for nitrogen availability to corn.
Soil Science Society of America Journal, 48, 1301-1304.
Mahalakshmi, V. and Bidinger, F.R. (2002). Evaluation of stay green sorghum germplasm
lines at ICRISAT. Crop Science, 42, 965-974.
Maho, H.; Yoshinori, H.; Toshinori, N. and Kenji, K. (2007). Nitrate leaching in granitic
regosol as affected by N uptake and transpiration by corn. The Journal of Plant Nutrition
and Soil Science, 53, 300-309.
Malakouti, M. J. (2008). The effects of micronutrients in ensuring efficient use of
micronutrients. Turkish Journal of Agriculture and Forestry, 32, 215-220.
Mallarino, A.P. and Borges, R. (2006). Phosphorus and potsssium distribution in soil
following long-term deep-band fertilization in different tillage systems. Soil Science
Society of America Journal, 70, 702-707.
Mallarino, A.P.; Stewart, B.M.; Baker, J.L.; Downing, J.D. and Sawyer, J.E. (2002).
Phosphorus indexing for cropland: Overview and basic concepts of the Iowa phosphorus
index. Journal of Soil and Water Conservation, 57, 440–447
Mallory, E.B. and Griffin, T.S. (2007). Impacts of soil amendment history on nitrogen
availability from manure and fertilizer. Soil Science Society of American Journal, 71, 964-
973.
Mamo, M.; Malzer, G.L.; Mulla, D.J.; Huggins, D.R. and Strock, J. (2003). Spatial and
temporal variation in economically optimum nitrogen rate for corn. Agronomy Journal,
95, 958-964.
Marquard, R.D. and Tipton, J.L. (1987). Relationship between extractable chlorophyll and an
in situ method to estimate leaf greenness. Horticulture Science, 22, 1327.
McCullough, D.E.; Aguilera, A. and Tollennar, M. (1994). N uptake, N partitioning, and
photosynthetic N-use efficiency of an old and a new maize hybrid. Candian Journl of
Plant Science, 74, 749-484.
Mehrotra, N.K.; Khanna, V.K. and Agarwala, S.C. (1986). Soil-sodicity-induced zinc
deficiency in maize. Plant and Soil, 92, 63-71.
Miao, Y.; Mulla, D.J.; Robert, P.C. and Hernandez, J.A. (2006). Within-field variation in corn
yield and grain quality responses to nitrogen fertilization and hybrid selection. Agronomy
Journal, 98, 129-140.
Monneveux, P.; Sánchez, C.; Beck D. and Edmeades, G.O. (2005). Drought tolerance
improvement in tropical maize source populations. Crop Science, 46, 180-191.
Misselbrook. (2004). Using solid manures. Pp. 57-58. In: S. Bittman and C.G. Kowalenko
(eds.) Advances in Silage Corn Management. Pacific Field Corn Association, Agassiz,
BC, Canada.
Moll, R.H.; Kamprath, E.J. and Jackson, W.A. (1982). Analysis and interpretation of factors
which contribute to efficiency of nitrogen utilization. Agronomy Journal, 74:562-564.
Monneveux, P.; Sanchez, C.; Beck, D. and Edmeades, G.O. (2005). Drought Tolerance
improvement in tropical maize source populations: evidence of progress. Crop Science,
46, 180-191.
Morris, M. L. (2002). Impacts of International Maize Breeding Research in Developing
Countries, 1966-1998. Mexico, D.F.:CIMMYT.
Mosier, A.R. (2001). Exchange of gaseous nitrogen compounds between agricultural systems
and the atmosphere. Plant and Soil, 228, 17-27.
 Corn Crop Production: Growth, Fertilization and Yield 77

Mosier, A.R.; Duxbury, J.M.; Freney, J.R.; Heinemeyer, O. and Minami, K. (1996). Nitrous
oxide emission from agricultural fields: Assessment, measurement and mitigation. Plant
and Soil, 181, 95-108.
Mosier, A.R. and Hutchinson, G.L. (1981). Nitrous oxide emissions from cropped fields.
Journal of Environmental Quality, 10, 169-173.
Mosier, A.; Kroeze, C.; Nevison, C.; Oenema, O.; Seitzinger, S. and van Cleemput, O. (1998).
Closing the global N2O budget: Nitrous oxide emissions through the agricultural nitrogen
cycle. Nutrient Cycling in Agroecosystems, 52, 225–248.
Muchow, R.C. (1998). Nitrogen utilization efficiency in corn and sorghum. Field Crops
Research, 56, 209-216.
Murwira, H.K. and Palm, C.A. (1998) Developing multiple fertilizer use strategies for
smallholder farmers in Southern Africa in CIMMYT and EARO (Ethiopian Agricultural
Research Organisation). Pp. 205-209. In: Proceedings of the Sixth Eastern and Southern
Africa Regional Maize Conference, 21-25 September, 1998. Maize Production
Technology for the Future: Challenges and Opportunities, Addis Ababa, Ethiopia.
Nagy, J. (1997). The effect of fertilization on the yield of maize (Zea mays L.) with and
without irrigation. Cereal Research Communications, 25, 69-76.
Nan, Z.; Li, J.; Zhang, J. and Cheng, G. (2002). Cadmium and zinc interactions and their
transfer in soil-crop system under actual field conditions. Science of the Total
Environment, 285, 187-195.
Niehues, B. J.; Lamond, R.E.; Godsey, C.B. and Olsen C.J. (2004). Starter nitrogen fertilizer
management for continuous no-till corn production. Agronomy Journal, 96, 1412-1418.
Nielson, R.L. (2006). N loss mechanisms and nitrogen use efficiency. 2006 Purdue University
Nitrogen Management Workshop. Purdue University, USA.
Novak, V. and Vidovic, J. (2003). Transpiration and nutrients uptake dynamics in maize (Zea
mays L.). Ecological Modelling, 166, 99-107.
Oenema, O.; Oudendag, D. and Velthof, G.L. (2007). Nutrients losses from manure
management in the European Union. Livestock Science, 112, 261-272.
Oktem, A. (2005). Response of sweet corn (Zea mays saccharata Sturt) to nitrogen and intra
row spaces in semi-arid region. Pakistan Journal of Biological Science, 8,160-1463.
OMAFRA. (2002) Corn: Plant analysis. Agromomy Buide for Field Crops (chapter 3). Ontario
Ministry of Aggiculture, Food and Rural Affairs. Toronto, ON. Available online at
http://www.omafra.gov.on.ca/english/crops/pub811/3planal.htm.
Ortega, R.A.; Peterson, G.A. and Westfall, D.G. (2002). Residue accumulation and changes in
soil organic matter as affected by cropping intensity in no-till dryland agroecosystems.
Agronomy Journal, 94, 944-954.
Osborne, S.L.; Schepers, J.S.; Francis, D.D. and Schlemmer, M.R. 2002a. Use of spectral
reflectance to estimate in-season biomass and grain yield in nitrogen and water–stressed
corn. Crop Science, 42, 165-171.
Osborne, S.L.; Schepers, J.S.; Francis, D.D. and Schlemmer, M.R. 2002b. Detection of
phosphorus and nitrogen deficiencies in corn using spectral radiance measurements.
Agronomy Journal, 94, 1215-1221.
Osterhaus, J.T.; Bundy, L.G. and Andraski, T.W. (2008). Evaluation of the Illinons soil nitrate
test for predicting corn nitrogen needs. Soil Science Society of America Journal, 72, 143-
150.
78 K. D. Subedi and B. L. Ma

Otegui, M.E. and Bonhommer, R. (1998). Grain yield component in maize. I- Ear growth and
kernel set. Field Crops Research, 56, 247-256.
Owens, L.B. (2008). Groundwater: Pollution from nitrogen fertilizers. Pp 459-463. in Trimble,
S.W.; Stewart, B.A. and Howell, T.A. (eds.) Encyclopodia of Water Science. Taylor and
Francis, New York, NY, USA.
Oyer, L.J. and Touchton, J.T. (1990). Utilizing legume cropping systems to reduce nitrogen
fertilizer requirements for conservation-tilled corn. Agronomy Journal, 82, 1123-1127.
Pearson, C.J. and Jacobs, B.C. (1987). Yield components and nitrogen partitioning in maize in
response to nitrogen before and after anthesis. Austrilian Journal of Agricultural
Research, 38, 1001-1009.
Penny, D.C.; Nolan, S.C.; McKenzie, R.C.; Goddard, T.W. and Kryzanowski, L. (1996). Yield
and nutrient mapping for site-specific fertilizer management. Communications in Soil
Science and Plant Analysis, 27, 522-527.
Peterson, R.H. and Hicks, D.R. (1973). Minnesota relative maturity rating of corn hybrids.
Agron. No. 27. University of Minnisoda, Agriculture Extension Service, St. Paul, MN,
USA.
Pumphrey, F.V.; Koehler, F.E.; Allmaras, R.R. and Roberts, S. (1963). Method and rate of
applying zinc sulphate for corn on zinc-deficient soil in western Nebraska. Agronomy
Journal, 55, 235-238.
Raimbault, B.A. and Vyn, T.J. (1991). Crop rotation and tillage effects on maize growth and
soil structural stability. Agronomy Journal, 83, 979-985.
Rajcan, I. and Tollenaar, M. 1999a. Source: sink ratio and leaf senescence in maize. I. Dry
matter accumulation and partitioning during kernel filling. Field Crops Research, 60, 245-
253.
Rajcan, I. and Tollenaar, M. 1999b. Source: sink ratio and leaf senescence in maize. II.
Nitrogen metabolism during kernel filling. Field Crops Research, 60, 255-265.
Randall, G.W.; Vetech, J.A. and Murrell, T.S. (2001). Corn response to phosphorus placement
under various tillage practices. Better Crops, 85, 12-15.
Raun, W.R. and Johnson, G.V. (1999). Improving nitrogen use efficiency for cereal
production. Agronomy Journal, 91, 357-363.
Raun, W.R.; Solie, J.B.; Johnson, G.V.; Stone, M.L.; Mullen, R.W.; Freeman, K.W.;
Thomason, W.E. and Lukina, E.V. (2002). Improving nitrogen use efficiency in cereal
grain production with optical sensing and variable rate application. Agronomy Journal, 94,
1815-1820.
Reid, L.M.; Zhu, X. and Ma, B.L. (2001). Crop rotation and nitrogen effects on maize
susceptibility to gibberella (Fusarium graminearum) ear rot. Plant and Soil, 237, 1-14.
Rendig, V.V. and Crawford, Jr., T.W. (1984). Partitioning into maize grain N fractions of N
absorbed through the roots before and after pollination. Journal of Food and Agriculture,
36, 645-650.
Rieck-Hinz, A.M.; Miller, G.A. and Schafer, J. (1996). Nutrient content of dairy manure from
three handling systems. Journal of Production Agriculture, 9, 82-86.
Ritchie S.W.; Hanway, J.J. and Benon, G.O. (1993). How a maize plant develops. Sp. Rpt. No.
48. Iowa State University of Science and Technology. Co-operative Extension Services.
Ames. IA.
Roberts, R.K; Mahajanashetti, S.B.; English, B.C.; Larson, J.A. and Tyler, D.D. (2002).
Variable rate nitrogen application on corn fields: the role of spatial variability and
 Corn Crop Production: Growth, Fertilization and Yield 79

weather. Journal of Agriculture and Applied Econ Economics, April, 2002. Available
online at http://purl.umn.edu/15512
Roberts, S. and Rhee, J.K. (1993). Critical nutrients concentrations and DRIS analysis of leaf
and grain from high yield-yielding corn. Communications in Soil Science and Plant
Analysis, 24, 2679-2687.
Roth, G.W. (2003). Experience with Leafy hybrids in Pennsylvania for silage production.
Pp.49-54. Proceedings of the Northeast Corn Improvement Conference. Agriculture and
Agri-Food Canada, Ottawa, Ontario, Canada.
Roy, R.C. and Ball-Coelho, B. (2004). Cover cropping to manage residual nitrogen. Pp. 85-89.
In: Bittman, S. and Kowalenko, C.G. (eds.) Advances in Silage Corn Management. Pacific
Field Corn Association, Agassiz, BC, Canada.
Rozas H.S.; Echeverria, H.E.; Studdert, G.A. and Dominguez, G. (2000). Evaluation of the
pre-sidedress soil nitrogen test for no-tillage maize fertilized at planting. Agronomy
Journal, 92, 1176-1183.
Ruiz Diaz, D.A.; Hawkins, J.A.; Sawyer, J.E. and Lundvall, J.P. (2008). Evaluation of in-
season nitrogen management strategies for corn production. Agronomy Journal, 100,
1711-1719.
Sainz Rozas, H.R.; Echeverria, H.E. and Barberi, P.A. (2004). Nitrogen balance as affected by
application time and nitrogen feretilizer rate in irrigated no-tillage maize. Agronomy
Journal, 96, 1622-1631.
Sanchez, C.A.; Porter, P.S. and Ulloa, M.F. (1991). Relative efficiency of broadcast and
banded phosphorus for sweet corn produced on histosols. Soil Science Society of America
Journal, 55, 871-875.
Schaper, H. and Chacko, E.K. (1991). Relation between extractable chlorophyll and portable
chlorophyll meter readings in leaves of eight tropical and subtropical fruit-tree species.
Journal of Plant Physiology, 138, 674-677.
Scharf, P.C.; Kitchen, N.R.; Sudduth, K.A.; Darvis, J.G.; Hubbard, V.C. and Lory, J.A. (2005).
Field-scale variability in optimum nitrogen fertilization rates for corn. Agronomy Journal,
97, 452-461.
Schepers, J.S.; Francis, D.D.; Vigil, M. and Below, F.E. (1992). Comparison of corn leaf
nitrogen concentration and chlorophyll meter readings. Communications in Soil Science
and Plant Analysis, 23, 2173-2187.
Schepers, J.S.; Varvel, G.E.; and Watts, D.G. (1995). Nitrogen and water management
strategies to reduce nitrate leaching under irrigated maize. Journal of Contaminant
Hydrology, 20(3-4), 227-239.
Scharf, P.C.; Wiebold, W.J. and Lory, J.A. (2002). Corn yield response to nitrogen fertilizer
timing and deficiency level. Agronomy Journal, 94, 435-441.
Schmitt, M.A. and Randall, G.W. (1994). Developing a soil nitrogen test for improved
recommendations for corn. Journal of Production Agriculture, 7, 328-334.
Schmidt, J.P.; DeJoia, A.J.; Ferguson, R.B.; Taylor, R.K.; Young, R.K. and Havlin, J.L.
(2002). Corn yield response to nitrogen at multiple in-field locations. Agronomy Journal,
94, 798-806.
Schoper, J.B.; Lambert, R.J. and Vasilas, B.L. (1987). Pollen viability, pollen shedding, and
combining ability for tassel heat tolerance in maize. Crop Science, 27, 27-31.
80 K. D. Subedi and B. L. Ma

Schröder, J.J.; Neeteson, J.J. Oenema, O. and Struik, P.C. (2000). Does the crop or the soil
indicate how to save nitrogen in corn production? Reviewing the state of the art. Field
Crops Research, 66, 151-161.
Schulte, E.E. and Kelling, K.A. (1999). Plant Analysis: a Diagnostic Tool. In NCH-46, Crop
Fertilization. Cooperative Extension Service, Purdue University, West Lafayette, IN
47907. Available online at http://www.ces.purdue.edu/extmedia/NCH/NCH-46.html
Serchan, D.P.; Upreti, R. and Maskey, S.L. (2004). Effects of micronutrients on production of
maize (Zea mays L.) in the acid soils of Chitwan Valley. In: Proceedings of an
International Workshop on Micro-Nutrients in South and South East Asia held in
Kathmandu, Nepal, 8-11 September, 2004.
Shaver, D.L. (1983). Genetics and breeding of maize with extra leaves above the ear.
Proceedings of the 38th Annual Corn and Sorghum Research Conference, American Seed
Trade Association, Washington D.C.
Sheaffer, C.C.; Halgerson, J.L. and Jung, J.H. (2006). Hybrid and N fertilization affect corn
silage yield and quality. Journal of Agronomy and Crop Science, 192, 278-283.
Shehu, Y. Alhassan, W.S.; Mensah, C.W.K.; Aliyu, A. and Phillips, C.J. C. (1997). The effect
of green manuring and chemical fertilizer application on maize yield, quality and soil
composition. Tropical Grasslands, 32, 139-142.
Serchan, D.P.; Upreti, R. and Maskey, S.L. (2004). Effects of micronutrients on production of
maize (Zea mays L.) in the acid soils of Chitwan Valley. In: Proceedings of an
International Workshop on Micro-Nutrients in South and South East Asia held in
Kathmandu, Nepal, 8-11 September, 2004.
Singh, U. and Wilkens, P.W. (2001). Simulating water and nutrient stress effect physiological
developments in maize. CIMMYT, D.F.: Mexico. Also available online at
http://www.cimmyt.org/research/NRG/map/research_results/gis_series/modeling00_01
Slafer, G.A. and Andrade, F.H. (1991). Changes in physiological attributes of the dry matter
economy of bread wheat (Triticum aestivum L.) through genetic improvement of grain
yield potential at different regions of world. A review. Euphytica, 58, 37-49.
Smiciklas, K.D. and Moore, A.S. (2008). The drainage nitrate concentrations in response to
fertilizer nitrogen application. Journal of Agronomy, 7, 163-169. ISSN 1812-5379.
Snapp, S.S.; Swinton, S.M.; Labarta, R.; Mutch, D.; Black, J.R.; Leep, R.; Nyiraneza, J. and
O’Neil, K. (2005). Evaluating cover crops for benefits, costs and performance within
cropping systems niches. Agronomy Journal, 97, 322-332.
Stanger, T.F. and J.G. Lauer. (2006). Optimum plant population of Bt and non-Bt corn in
Wisconsin. Agronomy Journal, 98, 914-921.
Stevens, W.B.; Hoeft, R.G. and Mulvaney, R.L. (2005). Fate of nitrogen-15 in a long-term
nitrogen rate study: I. Interactions with soil nitrogen. Agronomy Journal, 97, 1030-1045.
Stewart, D.W.; Dwyer L.M. and Carrigan, L. (1998). Phenological temperature response of
maize. Agronomy Journal, 90, 73-79.
Subedi, K.D. (1997). Indigenous green manures in Nepal: Farmers’ local knowledge agrees
with formal experimental results. ILEIA, 13 (3), 16-17.
Subedi, K.D. (2002). Maize and finger millet relay intercropping system in the hills of Nepal:
issues for sustainability. Pp. 170-174. In: N. R. Rajbhandary, J.K. Ransom, K. Adhikari
and A. F. E. Palmer (eds.) Sustainable Maize Production Systems for Nepal. Proceedings
of a Maize Symposium held December 3-5, 2001, Kathmandu, Nepal.
 Corn Crop Production: Growth, Fertilization and Yield 81

Subedi, K.D.; Sthapit, B.R.; Joshi, K.D.; Floyd, C.N.; Pandey, R.R. and Rana, R.B. (1993).
Indigenous upland rice culture in the western hills of Nepal: Contribution of farmers'
knowledge in rainfed farming. Preceedings of the Third International Symposium on
Sustainable Agriculture, CEICAPAR, Mexico, December 1-4, 1993.
Subedi, K.D. and Ma, B.L. 2005a. Nitrogen uptake and partitioning in stay-green and leafy
maize hybrids. Crop Science, 45, 740-747.
Subedi, K.D. and Ma, B.L. 2005b. Effect of N-deficiency and timing of N supply on the
recovery and distribution of labelled 15N in contrasting maize hybrids. Plant and Soil, 273,
189-202.
Subedi, K.D. and Ma, B.L. (2007). Dry matter and nitrogen partitioning patterns in Bt and
non-Bt near isoline maize hybrids. Crop Science, 47, 1186-1192.
Subedi, K.D. and Ma, B.L. (2009). Assessment of some major yield-limiting factors on maize
production in a humid temperate environment. Field Crops Research, 110, 21-26.
Subedi, K.D. and Sapkota, G.P. (2002). Integrated plant nutrient management (IPNM) in
maize: Pilot testing of IPNM with farmers in Sindhupalanchowk. Pp.163-169. In: N.P.
Rajbhandari, K.K. Ransom, K. Adhikari and A.F.P. Palmer (eds.) Sustainable maize
production systems for Nepal. Proceedings of a Maize Symposium held December 3-5,
2001, Kathmandu, Nepal.
Subedi, K.D.; Ma, B.L. and Smith, D.L. (2006). Response of leafy and non-leafy maize hybrid
to plant population densities and fertilizer nitrogen levels. Crop Science, 46, 1860-1869.
Sulivan, D.M. and Cogger, C.G. (2004). Post-harvest nitrate test. Pp. 37-38. In: S. Bittman and
C.G. Kowalenko (eds.) Advances in Silage Corn Management. Pacific Field Corn
Association, Agassiz, BC, Canada.
Sullivan, P. (2003). Overview of cover crops and green manures. Appropriate Technology
Transfer for Rural Areas (ATTRA). Available online at www.attra.ncat.org.
Swinkels, R. and Franzel, S. (1997). Adoption potential of hedgerow intercropping in maize-
based cropping systems in the highlands of western Kenya 2. Economic and farmers'
evaluation. Experimental Agriculture, 33, 211-223.
Syers, J.K. (1997). Manging soil for long-term productivity. Philosophical Transactions of the
Royal Society of London (B) 352, 1011-1021.
Ta, C.T. and Weiland, R.T. (1992). Nitrogen partitioning in maize during ear development.
Crop Science, 32, 443-451.
Tabu, I.M, Obure, R.K.; Bationa, A. and Mumera, L. (2006). Effect of soil fertility
management and nitrogen fertilizer rate on maize yield in small holder farmers fields.
Journal of Agronomy, 5, 191-1495.
Tariq, M.; Khan, M.A. and Parveen, S. (2002). Response of maize to applied soil zinc. Asian
Journal of Plant Science, 1, 476-477.
Teal, R.K.; Tubana, B.; Girma, K.; Freeman, K.W.; Arnall, D.B.; Walsh, O. and Raun, W.R.
(2006). In-season prediction of corn grain yield potential using normalized difference
vegetation index. Agronomy Journal, 98, 1488-1494.
Tejada, M.; Gonzalez, J.L.; Garcia-Martinez, A.M.; and Parrado, J. (2008). Effect of different
green manures on soil biological properties and maize yield. Bioresource Technology, 99,
1758-1767.
Thomas, J.R. and Gausman, H.W. (1977). Leaf reflectance vs. leaf chlorophyll and carotenoid
concentrations for eight crops. Agronomy Journal, 69, 799-802.
82 K. D. Subedi and B. L. Ma

Timmons, D.R. and Dylla, A.S. (1981). Nitrogen leaching as influenced by nitrogen
management and supplemental irrigation level. Journal of Environmental Quality, 10,
421-426.
Tollenaar, M. (1977). Sink source relationships during reproductive development in maize: A
review. Maydica, 22, 49-75.
Tollenaar, M. and Wu, J. (1999). Yield improvement in temperate maize is attributable to
greater stress tolerance. Crop Science, 39, 1597-1604.
Triplett, Jr. G.B. and Dick, W.A. (2008). No-tillage crop production: A revolution in
agriculture. Agronomy Journal, 100, 153-165.
Tollenaar, M. and Daynard, T.B. (1978). Leaf senescence in short season maize hybrids.
Canadian Journal of Plant Science, 58, 869-874.
van Es, H.M.; Schindelbeck, R.R. and Jokela, W.E. (2004). Effect of manure application
timing, crop, and soil type on phosphorus leaching. Journal of Environmental Quality, 33,
1070-1080.
Vanotti, M.B. and Bundy, L.G. (1994). Corn nitrogen recommendations based on yield
response data. Journal of Production Agriculture, 7, 249-256
Vanotti, M.B. and Bundy, L.G. (1995). Soybean effects on soil nitrogen availability in crop
rotation. Agronomy Journal, 87, 676-680.
Vaughan, J.D. and Evanylo, G.K. (1998). Corn response to cover crop species, spring
desiccation time, and residue management. Agronomy Journal, 90, 536-544.
Vetsch, J.A. and Randall, G.W. (2002). Corn production as affected by tillage system and
starter fertilizer. Agronomy Journal, 94, 532-540.
Vetsch, J.A. and Randall G.W. (2004). Corn production as affected by nitrogen application
timing and tillage. Agronomy Journal, 96, 502-509.
Volf, C.A.; Ontkean, G.R.; Bennett, D.R.; Chanasyk, D.S. and Miller, J.M. (2007). Phosphorus
losses in simulated rainfall runoff from manured soil of Alberta. Journal of Environmental
Quality, 36, 730-741.
Vyn, T.J. and Janovicek, K.J. (2001). Potassium placement and tillage system effects on corn
response following long-term no till. Agronomy Journal, 93, 487-495.
Vyn, T.J.; Janovicek, K.J.; Miller, M.H. and Beauchamp, E.G. (1999). Soil nitrate and crop
response to proceeding small grain fertilization and cover crops. Agronomy Journal, 91,
17-24.
Vyn, T.J. and Tollenaar, M. (1998). Physical and chemical parameters of corn grain associated
with three decades of maize yield improvement. Field Crops Research, 59, 135-140.
Wang, J.Y. (1960). A critique of the heat unit approach to plant response studies. Ecology, 4,
785-790.
Wang, D.; Prato, T.; Qiu, Z.; Kitchen, N.R. and Sudduth, K.A. (2003). Economics and
encvironmental evaluation of variable rate nitrogen and lime application for claypan soil
fields. Precision Agriculture, 4, 35-52.
Waskom, R.M.; Westfall, D.G.; Spellman, D.E. and Soltanpur, P.N. (1996). Monitoring
nitrogen status of corn with a portable chlorophyll meter. Communications in Soil Science
and Plant Analysis, 27, 545-560.
Webster, C.P.; Goulding, K.W.T.; Shepherd, M.A. and Lord, E. (1992). Methods for
measuring nitrate leaching from sandy soils. Aspects of Appied Biology, 30, 77-80.
 Corn Crop Production: Growth, Fertilization and Yield 83

Weiland, R.T. and Ta, C.T. (1992). Allocation and retranslocation of 15N by maize (Zea mays
L.) hybrids under field conditions of low and high N fertility. Austrilian Journal of Plant
Physiology, 19, 77-88.
Weiss, W.P.; Conrad, H.R. and St. Pierre, N.R. (1992). A theoretically-based model for
predicting total digestable nutrient values of forages and concentrates. Animal Feed
Science and Technology, 39, 95.
Westerman, R.L.; Raun, W.L. and Johnson, G.V. (1999). Nutrient and water use efficiency.
Pp.175-189. In: M.E. Sommers (ed.) Handbook of Soil Science. CRC Press, Boca Raton,
FL.
Westgate, M.E.; Forcella, F.; Reicosky, D.C. and Somsen, J. (1997). Rapid canopy closure for
maize production in the northern US Corn Belt: Radiation use efficiency and grain yield.
Field Crops Research, 49, 249-258.
Whalen, S.C. (2000). Nitrous oxide emission from an agricultural soil fertilized with liquid
swine waste or constituents. Soil Science Society of America Journal, 64, 781-789.
Wibawa, W.D.; Dludlu, D.L.; Swenson, D.G.; Hopkins, D.G. and Danke, W.C. (1993).
Variable fertilizer application based on yield goal, soil fertility, and soil map unit. Journal
of Production Agriculture, 6, 225-261.
Wienhold, B.J. and Halvorson, A.D. (1999). Nitrogen mineralization responses to cropping,
tillage, and nitrogen rate in the northern great plains. Soil Science Society of America
Journal, 63, 192-196.
Wilhelm, W.W.; Johnson, J.M.F.; Hatfield, J.L.; Voorhees, W.B. and Linden, D.R. (2004).
Crop and soil productivity response to corn residue removal: A literature review.
Agronomy Journal, 96, 1-17.
Wittry, D.J. and Mallarino, A.P. (2004). Comparison of uniform and variable-rate phosphorus
fertilizer for corn-soybean rotations. Agronomy Journal, 96, 26-33.
Wolfe, A.M. and Eckert, D.J. (1999). Crop sequence and surface residue effects on the
performance of no-till corn grown in a poorly drained soil. Agronomy Journal, 91, 363-
367.
Wood, C.W.; Reeves, D.W.; Duffield, R.R. and Edmisten, K.L. (1992). Field chlorophyll
measurements for evaluation of corn nitrogen status. Journal of Plant Nutrition, 15, 487-
500.n
Worku, M.; Banziger, M.; Erley, G. S.; Friesen, D.; Diallo, A.O. and Horst, W.J. (2007).
Nitrogen uptake and utilization in contrasting nitrogen efficient tropical maize hybrids.
Crop Science, 47, 519-528.
Wu, T.Y. and Ma, B.L. 2008. Variable vs. uniform rate of nitrogen: Spatial variation in soil
mineral N, canopy reflectance and grain yield of corn. Proceedings of Northeast and
Northcentral Corn Improvement Conference. Linthicum, MD.
Wu, T.Y.; Ma, B.L. and Liang, B.C. (2008). Quantification of seasonal soil nitrogen
mineralization for corn production in eastern Canada. Nutrient Cycling in Agroecosystems,
81, 279–290.
Xie, R. and MacKenzie, A.F. (1986). Urea and manure effects on soil nitrogen and corn dry
matter yields. Soil Science Society of America Journal, 50, 1504-1509.
Yang, C.; Everitt, J.H. and Bradford, J.M. (2001). Comparison of uniform and variable rate of
nitrogen and phosphorus fertilizer applications for grain sorghum. Transactions of
American Society of Agricultural Engineers, 44, 201-209.
84 K. D. Subedi and B. L. Ma

Yost, R.S.; Kamparth, E.J.; Lobato, E. and Naderman, G. (1979). Phosphorus response of corn
on an oxisol as influenced by rates and placement. Soil Science Society of America
Journal, 43, 338-343.
Ziadi, N.; Brassard, M.; Belanger, G.; Cambouris, A.N.; Tremblay, N.; Nolin, M.C.;
Claessens, A. and Parent L.E. (2008). Critical nitrogen curve and nitrogen nutrition index
for corn in eastern Canada. Agronomy Journal, 100, 271-276.
Zhang, H.; Johnson, G. and Fram, M. (2007). Managing Phosphorus from Animal Manure.
Oklahoma Cooperative Extension Fact Sheets, Publication PSS-2249. Available online at
http://osufacts.okstate.edu.
Zublena, J.P.; Baird, J.V. and Lilly, J.P. (1991). Nutrient content of fertilizer and organic
materials. North Carolina Cooperative Extension Service. Publication AG-439-18.
Zvomuya, F.; Helgasonb, B.L.; Larney, F.J.; Janzen, H. H.; Akinremi, O.O. and Olson, B.M.
(2006). Predicting phosphorus availability from soil-applied composted and non-
composted cattle feedlot manure. Journal of Environmental Quality, 35, 928-937.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 2

RESPONSES OF AGRONOMICALLY IMPORTANT CROPS

TO INOCULATION WITH PLANT-ASSOCIATED
BENEFICIAL BACTERIA IN CROP-FARMING
SYSTEMS – A REVIEW

M. Madhaiyana,c, S. Poonguzhalia,c, M. Senthilkumarb

and P. Santhanakrishnanc
a
Department of Agricultural Chemistry, Chungbuk National University,
Cheongju 361-763, Republic of Korea
b
Department of Agricultural Microbiology, Horticultural College and Research Institute,
TamilNadu Agricultural University, Periyakulam 625 604, TamilNadu, India
c
Department of Agricultural Microbiology, Tamilnadu Agricultural University,
Coimbatore 641 003, Tamilnadu, India

ABSTRACT
Root colonizing bacteria (rhizobacteria) that exert beneficial effects on plant
development via direct or indirect mechanisms have been defined as plant growth
promoting rhizobacteria (PGPR). The search for PGPR and investigation of their modes of
action are increasing at a rapid pace as efforts are made to exploit them commercially as
biofertilizers. This review focuses on different kinds of PGPR, their mode of action as
biofertilizers and also development of microbial consortia is mentioned. These mode of
action include fixing N2, increasing the availability of nutrients in the rhizosphere,
positively influencing root growth and morphology. Although significant control of plant
pathogens or direct enhancement of plant development has been demonstrated by PGPR in
the laboratory and in the greenhouse, results in the field have been less consistent. Because
of these and other challenges in screening, formulation, and application, PGPR have yet to
fulfill their promise and potential as commercial inoculants. Recent progress in our
understanding of their diversity, colonization ability, mechanism of action, formulation,
and application should facilitate their development as reliable components in the
management of sustainable agricultural systems. Obtaining maximum benefits on farms
from plant growth promoting biofertilizers will require a systematic strategy designed to
86 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

fully utilize all these beneficial factors, allowing crop yields to be maintained or even
increased with reduced fertilizer applications.

Keywords: PGPR, rhizosphere, growth-promotion, biocontrol, root morphology

INTRODUCTION
World’s population has been growing faster than cereal production since the early 1980s
with decrease in global per-capita cereal yield and output. The strong implication is that this
decline is caused by increasing various environmental production constraints. In addition to
these problems, between now and the year 2025, the human population is expected to rise from
about 6 billion to 8 billion (Tim Dyson, 1999). Can the world’s farmers produce 3 billion tons
for 8 billion people in 2025? Probably yes, but at an accelerated impact on sustainability and
environmental quality (Trewavas, 2001). As defined by Golley et al. (1992), sustainable
agriculture is that which is managed towards greater resource efficiency and conservation
while maintaining an environment favorable for the evolution of all species. More simply,
sustainability is meeting today’s needs without compromising the needs of the future. By
either of these definitions, crop production is compromising the global future use of fertilizers
and chemicals sustainability. It is only relatively recently that microbial ecologists have begun
to recognize the importance of those complex interactions between plants and the microbial
components in soil that sustain them. While the physical and biological benefits of manures
and composts have been quantified (Brady, 1974; Hoitink and Boehm, 1999), the microbial
mechanisms that underpin their effectiveness are still little understood. Though it is often
considered that soil microbes play a key role in soil quality and health (Vessey, 2003), a
general dearth of information exists when it comes to categorizing the assembly of species that
assure soil fertility, the critical forces that govern their community structure and function. It is
now clearly indicates that root zone microflora and plants interaction involves a continuum of
colonization events that are initiated at seed germination and traverse from rhizosphere to the
rhizoplane, to the endoroot via the root epidermis and apoplast, directly to the shoots (Petersen
et al., 1981; Kloepper et al.,1992a; Van Bruggen et al., 2002). Consequently, phyto-microbial
relationships can become extremely intimate, extending over the life-cycle and growth habit of
the plant, and involving both exo- and endo plant environments (Wardle, 2002).

PGPR DEFINITION
Functionally there are three broad interacting components were recognized in the
rhizosphere namely - rhizosphere (soil), the rhizoplane, and the root itself. The rhizosphere is
the zone of soil influenced by roots through the release of substrates that affect microbial
activity. The rhizoplane is the root surface, including the strongly adhering soil particles. The
root itself is a part of the system, because certain microorganisms, the endophytes, are able to
colonize root tissues (Kennedy, 1998 and Bowen and Rovira, 1999). Microbial colonization of
the rhizoplane and/or root tissues is known as root colonization, whereas the colonization of
the adjacent volume of soil under the influence of the root is known as rhizosphere
 Responses of Agronomically Important Crops to Inoculation… 87

colonization (Kloepper et al., 1991; Kloepper, 1994). The use of molecular techniques to
identify microorganisms (O’Gara et al., 1994) is currently a key tool to study rhizosphere
ecology (Puhler et al., 2004).
Bacterial inoculants which help in plant growth are generally considered to be of two
types a) symbiotic and b) free-living (Kloepper et al., 1988). One group of microorganisms
which are beneficial to crops is bacteria that colonize roots or rhizosphere soil of crop plants.
These bacteria are referred to as plant growth promoting rhizobacteria (PGPR). Beneficial
free-living bacteria referred to as PGPR are found in the rhizosphere of the roots of many
different plants (Kloepper et al., 1989). PGPR are free-living, soil-borne bacteria, isolated from
the rhizosphere, which, when applied to seeds or crops, enhance the growth of the plant or
reduce the damage from soil-borne plant pathogens (Kloepper et al., 1980a). Breakthrough
research in the field of PGPR occurred in the mid 1970s with studies demonstrating the ability
of Pseudomonas strains capable of controlling soil-borne pathogens to indirectly enhance plant
growth and increase the yield of potato and radish plants (Kloepper and Schroth, 1981a; Howie
and Echandi, 1983). The rhizosphere is the soil found around the root and under the influence
of the root. It is a site with complex interactions between the root and associated
microorganisms. PGPR enhance plant growth either by direct or indirect mechanisms (Glick,
1995). The direct growth promoting mechanisms includes nitrogen fixation, phosphorus
solubilization and mobilization, siderophores production, production of phytohormones such
as auxins, cytokinins, gibberellins and lowering of ethylene concentration (Kloepper et al.,
1989; Glick, 1995; Glick et al., 1999). The indirect mechanisms of plant growth promotion by
PGPR include antibiotic production, depletion of iron from the rhizosphere, synthesis of
antifungal metabolites, production of fungal cell wall lysing enzymes, competition for sites on
roots and induced systemic resistance (Kloepper et al., 1988; Liu et al., 1995; Glick et al.,
1999). The thin layer of soil (about 1 to 2mm thick) surrounding crop roots and the volume of
soil occupied by roots are known as the rhizosphere. Hiltner (1904) introduced the term
rhizosphere, which is derived from the Greek word ‘rhiza’, meaning root, and ‘sphere’,
meaning field of influence. He defined the rhizosphere as the zone of soil immediately
adjacent to legume roots that supports high levels of bacterial activity. Now the term has been
broadened to include both the volume of soil influenced by the root and the root tissues
colonized by microorganisms (reviewed in Pinton et al., 2001). The shear extent of crop roots
in soil dictates that a significant portion of soil is actually within the rhizosphere (about 5 to
40% of soil in the rooting zone depending upon crop root architecture). This zone is where the
majority of soil microorganism (bacteria and fungi) reside. They reside in the rhizosphere to
utilize compounds and materials released from crop roots providing microorganisms with
energy. Rhizobacteria that establish inside plant roots, forming more intimate associations, are
endophytes. These include a wide range of soil bacteria forming less formal associations than
the rhizobia–legume symbiosis; endophytes may stimulate plant growth, directly or indirectly
(Kobayashi et al., 1995) and include the rhizobia. Given the semantic overlap, the following
definition for endophytic bacteria has been proposed: “those bacteria that can be isolated from
surface-disinfected plant tissue or extracted from within the plant, and that do not visibly harm
the plant” (Hallmann et al., 1997). In general, a greater proportion of endophytes are PGPR
than in the case for bacteria inhabiting the rhizoplane or rhizosphere (Nowak, 1998).
Nodulating (rhizobia) and other N2-fixing rhizobacteria are also endophytes (Lodewyckx et al.,
2002), living in specially developed root organs; given their ability to promote plant growth
through N fixation.
88 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

PLANT-GROWTH PROMOTING BACTERIA

Beneficial, root colonizing, rhizosphere bacteria, the PGPR, are defined by three intrinsic
characteristics: (i) they must be able to colonize the root, (ii) they must survive and multiply in
microhabitats associated with the root surface, in competition with other microbiota, at least
for the time needed to express their plant promotion/protection activities, and (iii) they must
promote plant growth (Barea et al., 2005). The PGPR are known to participate in many
important ecosystem processes, such as the biological control of plant pathogens, nutrient
cycling, and/or seedling growth (Persello-Cartieaux et al., 2003; Barea et al., 2004; Zahir et al.,
2003). The rhizosphere supports diverse bacteria that can stimulate growth of plants. As
rhizosphere processes result from the activities of diverse groups of microorganisms (Table 1),
determining the significance of changes to community structure presents a major challenge for
the future. As the effect of PGPR on plants was demonstrated, the concept of PGPR began to
gain importance and a large number of bacterial strains have been isolated, screened and
evaluated for plant growth promotion.

Table 1. Examples of plant-growth promoting bacteria

Bacterial species Reference

Azotobacter chroococcum Kennedy and Tchan (1992)
Clostridium spp. Kennedy and Tchan (1992)
Azospirillum spp. Reinhold and Hurek (1988)
Azoarcus sp. Hurek et al. (1994)
Burkholderia vietnamiensis Baldani et al. (1997)
H. seropedicae Baldani et al. (1986)
Rhizobium leguminosarum bv. trifolii Yanni et al. (1997)
Rhizobium etli bv. phaseoli Gutiérrez-Zamora and Martı´nez-Romero (2001)
Azorhizobium caulinodans Matthews et al. (2001)
Acetobacter (Gluconacetobacter) diazotrophicus Baldani et al. (1997)
Actinobacter sp., Enterobacter agglomerans,
Tanii et al. (1990)
Flavobacterium spp
Aeromonas caviae Inbar and Chet (1991)
Agrobacterium radiobacter Ryder and Jones (1990)
Alcaligenes sp. Yuen et al. (1985)
Bacillus cereus Handelsman et al. (1990); Ryder et al. (1999)
Bacillus circulans Berge et al. (1990)
Bacillus firmus, Bacillus licheniformis Chen et al. (1996)
Bacillus subtilis Turner and Blackman (1991)
Enterobacter cloacae, Erwinia herbicola Nelson (1998)
Phyllobacterium sp. Lambert et al. (1990)
Pseudomonas aureofaciens Kluepfel and McInnis (1991)
Pseudomonas cepacia, Pseudomonas putida De Freitas and Germida (1991)
Pseudomonas fluorescens Voisard et al. (1989)
Serratia fonticola Chanway et al. (1991)
Serratia liquefaciens Zhang and Smith (1996)
Serratia macescens Ordentlich et al. (1988)
Serratia proteamaculans Chanway et al. (1991) and Bai et al. (2002a)
Bacillus thuringiensis Bai et al. (2002b)
 Responses of Agronomically Important Crops to Inoculation… 89

BELOWGROUND PROCESSES
The soil is a living environment that supports extremely diverse communities of micro and
macro organisms and is often considered a ‘black box’. The plant absorb all the minerals from
the soil by the solubilization action of the microbes in the rhizosphere region which indicates a
series of generalized and specific plant – microbe associations exists to perform this function.
The release of carbon compounds from plants into the soil results in greater microbial
populations in the rhizosphere relative to the bulk soil, and increased microbial biomass and
activity (Bending, 2003). When considering the rhizosphere effect in general, the
rhizosphere/bulk soil (r/s) ratios for bacteria, actinomycetes, and fungi are usually in the ranges
2–20, 5–10, and 10–20, respectively. In young plant roots it is thought that the rhizosphere
bacterial communities are dominated by r-strategists, which are species with fast growth rates
and capacities to utilize simple substrates (Andrews and Harris, 1986). As the roots mature,
there is a shift in dominance to bacterial communities with relatively slow growth rates and the
capacity to degrade more complex substrates (k-strategists). As a rule, although a general
increase in microorganisms in the rhizosphere is always noted, the community structure and
functional consequences of this increase are less well understood.
The rhizosphere environment is relatively rich in nutrients released by the roots and its
microbial communities differ from those outside the influence of the roots. Since roots act as a
source of organic carbon, the population density of microorganisms, especially bacteria, is
considerably higher in the rhizosphere than in the bulk soil. Root colonization is the initial
mechanism by which PGPR survive when inoculated onto seeds or into the soil and proliferate
in response to seed or root exudates rich in carbohydrates and amino acids (Kloepper et al.,
1985). In the root zone the rhizobacteria are efficient microbial competitors, can displace
native root colonizing microorganisms (Kloepper and Schroth, 1981b). The bacteria are
distributed in the rhizosphere in a log normal pattern with a sharp increase as the root surface
is approached (Loper et al., 1984) and are sporadically located along roots (Bahme and
Schroth, 1987).
Colonization of the roots is a complex phenomenon in which one of the first steps is the
migration of microorganisms towards the roots. The microorganisms present in the rhizosphere
colonize the host plant through chemotaxis movement with root exudates act as an important
source of nutrients. Chemotactic response towards amino acids, sugars, or organic acids is
fundamental for bacterial behavior both in vitro and in situ (Bashan and Holguin, 1994) and
represents, very probably, the first step in root colonization (Zheng and Sinclair, 1996). Once
bacteria are in the vicinity of the root, attachment to target cells on the plant surface can be
inoculation of wheat seedlings with A. brasilense increased the number and length of lateral
roots. Both grain and straw yields of wheat infected with R. leguminosarium bv. trifolii are
greater than uninfected controls. Yields of wheat plants are even higher when commercial
fertilizer is applied (Biswas et al., 2000). Inoculation with Azotobacter replaced up to 50% of
the urea-N for wheat in greenhouse trials under aseptic (gnotobiotic) conditions (Soliman et
al., 1995). Inoculation with A. brasilense can increase wheat grain yield by up to 30% and
other yield components significantly in field conditions (Okon and Labandera-Gonzalez,
1994), but only at lower rates of fertiliser-N (50–60 kg N ha-1). Beneficial effects of
inoculation with Azospirillum on wheat yields in both greenhouse and field conditions have
been reported (Ganguly et al., 1999). Azorhizobium caulinodans increased the dry weight and
90 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

N content of wheat plants in a greenhouse experiment (Matthews et al., 2001). Its inoculation
saved up to 50% of the recommended rate of urea N in greenhouse trials under gnotobiotic (or
sterile) conditions (Saleh et al., 2001).

MAIZE
Common diazotrophs found in the rhizosphere of maize are Enterobacter spp., Rahnella
aquatilis, Paenibacillus azotofixans, Azospirillum spp., H. seropedicae, Bacillus circulans and
Klebsiella sp. (Chelius and Triplett, 2000). Corn (Zea mays L.) plants under water stress
during flowering (Casanovas et al., 2003) exhibited better growth, enhanced grain yield and
quality. A. lipoferum (N7), A. brasilense (N8), and P. putida CQ179 strains isolated from corn
rhizosphere and isolates G. azotocaptans DS1 from corn rhizosphere,G. diazotrophicus Wt
from sugarcane when inoclulated into corn plant under green house condition in sterile and
unsterilie condition significantly increased the root and shoot growth (Mehnaz and Lazarovits,
2006). Javed et al., (1998) selected 11 isolates of plant growth promoting rhizobacteria and
reported that four of these improved the growth of maize and could be used as biofertilizers.
However, results of these bacteria used as biofertilizers are variable in the field. Fallik and
Okon, (1989) showed that when maize seedlings were inoculated with 107 cfu of A. brasilense,
root surface area was significantly increased two weeks after sowing compared to that of the
control. The increase in root surface area was attributed to the synthesis of IAA, identified in
culture medium using GLC and GC-MS. The ability of Pseudomonas fluorescens M.3.1 to
produce auxins in the presence of maize root exudates in the culture medium indicated that the
strain can convert exudates into secondary metabolites which can play an important role in
plant development and yield (Benizri et al., 1998). Dobbelaere et al. (2001) found A.
brasilense increased grain yield of maize by 0.7–1.0 t ha-1 (50–95% increase) depending on
soil conditions when N was applied at low to medium (18–46 kg ha-1) rates. Other species of
Azospirillum capable of increasing the yield of maize are A. lipoferum and A. indigens, and
Azorhizobium caulinodans was also capable of giving such beneficial effects (Riggs et al.,
2001). In addition, they concluded from the results of extensive greenhouse and field
experiments using non sterilised soils that there were beneficial effects of maize seed
inoculation H. seropedicae, with increased yield in greenhouse conditions by 49–82% with
applied fertilizer N compared to an increase of only 16% without fertilizer N. In field
experiments, the increases in yields due to H. seropedicae inoculation were up to 19.5%.
Rhizobium etli bv. phaseoli can colonize maize roots, and increase plant dry weight
(Gutie´rrez-Zamora and Martı´nez- Romero, 2001). Riggs et al., (2001) had shown that
inoculation of R. leguminosarum bv. trifolii increased maize yields by 34 and 11% in the
greenhouse and field conditions, respectively. Sinorhizobium sp. can increase maize yields by
35–43% depending on the maize genotype (Riggs et al., 2001). Burkholderia spp. application
in the field trials was able to increase maize yield by 5.9–6.3% (Riggs et al., 2001).
Application of Bacillus sp. has been found to substantially control seedling blight, root
rots and stalk rots of maize caused by Fusarium graminearum, when used as seed inoculant
(Kommedahl and Chang, 1975). Trichoderma viride and Pseudomonas species were also
capable of controlling stalk rots of maize (Chen et al., 1999). Application of root-associated
Pseudomonas cepacea as seed coating biocontrol agent could reduce the Fusarium
 Responses of Agronomically Important Crops to Inoculation… 91

moniliforme-induced infection of maize root by 23–80%. Pseudomonas cepacea was also

found to inhibit a range of soil-borne fungal pathogens including Fusarium graminearum,
Fusarium moniliforme and Macrophomina phaseolina (Hebbar et al., 1992). Burkholderia
cepacea was also found potent in controlling Fusarium moniliforme besides plant growth
promotion of maize (Bevivino et al., 1998). Raju et al., (1999) reported the reduction of
Fusarium moniliforme-induced diseases of maize by application of Trichoderma harzianum,
Pseudomonas fluorescens and Chaetomium globosum.

SUGARCANE
The diazotrophs commonly present in sugarcane plants are Acetobactor diazotrophicus,
Azospirillum brasilense, A. lipoferum, A. amazonense, B. brasilensis, B. tropicalis, H.
seropedicae and H. rubrisubalbicans (Reis et al., 2000). Asymbiotic nitrogen fixing bacteria
replaced 60% of the nitrogen requirements of sugarcane amounting to 200 kg N/ha (Urquiaga
et al., 1992). Gluconacetobacter diazotrophicus, a species found in high numbers in roots and
stems of sugarcane in Brazil and Australia (Stephan et al., 1991), was the only known
nitrogen-fixing species of this genus until Jimenez-Salgado et al., (1997) isolated two other
acetic-acid-producing, nitrogen-fixing bacteria (Gluconacetobacter azotocaptans and
Gluconacetobacter johannae) from the rhizosphere of coffee plants (Fuentes-Ramirez et al.,
2001). G. diazotrophicus has numerous properties associated with enhanced plant growth
including nitrogen fixation at low pH (5 or less), which is only partially inhibited by ammonia,
production of growth hormones, phosphate solubilization, and antagonistic potential against
plant pathogens (Muthukumarasamy et al., 2002). In sugarcane, inoculation with a mixture of
diazotrophic bacteria and mycorrhizal fungi was shown to be equivalent to half the dose of
recommended fertilisers. Muthukumarasamy et al., (1999) claimed that combination of G.
diazotrophicus, Herbaspirillum spp. and Azospirillum lipoferum with AM fungi helps in
reducing the input of nitrogen fertilizers. Also, investigations on the co-inoculation of G.
diazotrophicus with other diazotrophs resulted in improved growth of Brazilian sugarcanes
(Oliveira et al., 2002). Soil applications of Azospirillum can significantly increase cane yield in
both plant and ratoon crops in the field (Shankariah and Hunsigi, 2001). They reported that the
mean cane yield increases were 9 and 5 t ha-1 in plant and ratoon crops, respectively.

VEGETABLE AND FRUIT CROPS

Strains of Pseudomonas putida and Pseudomonas fluorescens were particularly effective
in increasing root and shoot elongation in canola, lettuce, and tomato and yield of potato,
radish, sugar beet, tomato, lettuce, apple, citrus, bean and ornamental plants (Rodriguez and
Fraga, 1999). Methylobacterium strains also contributed to the flavor of strawberries and have
been localized as endo symbionts within cells of Scotch pine buds (Zabetakis, 1997). Increase
in potato growth occurs following infection with Pseudomonas (Kloepper et al., 1980b),
increasing total plant weight up to 100% when compared to the control. Microbial inoculation
of tissue culture plants showed enhanced growth characters like pseudo stem height and girth
in nursery stage. Similarly, improved plant growth after microbial inoculation was reported
92 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

earlier in fruit crops like apple (Utkhede and Smith, 1992), strawberry (Kokalis-Burelle, 2003)
and Prunus spp. (Bonaterra et al., 2003). Similar influence of growth and development of fruit
crops were observed by Mello et al., (2000) and Jaizme- Vega et al., (2004) in pineapple and
banana respectively. The use of PGPR in the management of viral diseases in the field
condition is of very recent trend as reported from Tomato mottle virus in tomato (Murphy et
al., 2000), Cucumber mosaic virus in cucumber (Zehnder et al., 2000), Tomato spotted wilt
virus in tomato (Kandan et al., 2005). Pseudomonas strains 84 and 4B when introduced to
banana roots of tissue-cultured plants at de-flasking stage significantly improved plant growth
and reduced infection of Fusarium oxysporum f. sp. cubense in the rhizome under green house
conditions (Smith et al., 2003). Recently, Jaizme-Vega et al., (2004) found that bacterization of
micro propagated banana plants cv. Grand Nain and ITC-1297 with Bacillus spp. significantly
improved plant growth and foliar mineral contents. Similarly, strawberry cv. Camarosa
transplant plugs amended with PGPR strain LS 213 showed enhanced growth and yield under
field conditions (Kokalis-Burelle, 2003).

CO-INOCULATION OF PLANT GROWTH PROMOTING BACTERIA

AND THEIR EFFECTS ON GROWTH RESPONSE

The majority of interactions considered so far concern with single PGPR strains either as a
growth promoter or as a biocontrol agent in the rhizosphere. However, one way of improving
the efficiency of PGPR in the rhizosphere may be to add mixtures or combinations of bacterial
genera, particularly if they exhibit different or complementary modes of action or abilities to
colonize root microsites. Such multiple interactions are the normal situation in the rhizosphere.
However the major obstacle to the successful application of PGPR strains in soil has been the
lack of stable effectiveness of the inoculant. This was always due to ineffective colonization of
the plant as well as poor survival and/or low activity of the introduced population.
Coinoculation of plant growth promoting rhizobacteria PGPR with B. japonicum has been
shown to increase soybean nodulation, nitrogen fixation, growth and physiological activity at
suboptimal root zone temperatures. Coinoculation of PGPR and B. japonicum increases
soybean root and shoot weight, grain yield, plant vigour, nodulation and nitrogen fixation (Li
and Alexander, 1988) and yield. Azospirillum brasilense strain Az39 and Brayrhizobium
japonicum strain E109 when inoculated singly or in combination, showed the capacity to
promote seed germination, nodule formation, and early development of corn and soybean
seedlings (Cassan et al., 2008).
Compared to the use of individual PGPR strains, mixtures of several strains may result in
a more stable rhizosphere community, provide several mechanisms of biological control, and
may suppress a broader range of pathogens. Compatible mixtures of certain biocontrol strains
with antagonism as the main mechanism of action have provided greater disease suppression
than that used individually. The seed application of a combination of three PGPR, Bacillus
pumilus Meyer & Gotheil, Bacillus subtilis (Ehrenberg) Cohn and Curtobacterium
flaccumfaciens (Hedges) Collins & Jones provided greater control of several pathogens on
cucumber (Cucumis sativa L.) than when any were inoculated singly (Raupach and Kloepper,
1998), combinations of Paenibacillus sp. and a Streptomyces sp. suppressed Fusarium wilt of
cucumber better than when either was used alone (Singh et al., 1999) and a combination of
 Responses of Agronomically Important Crops to Inoculation… 93

Pseudomonas fluorescens and Stenotrophomonas maltophila improved protection of sugar beet

against Pythium-mediated damping-off in comparison with either applied individually (Dunne
et al., 1998). Jetiyanon and Kloepper, (2002) suggest that mixtures of PGPR and individual
strains of PGPR can elicit induced systemic resistance to fungal, bacterial, and viral diseases in
tomato, pepper, cucumber and green kuang futsoi tested. It has been reported that mixtures of
PGPR strains either in a two-way or three-way combination gave a greater protection,
compared to single-strain treatments, of cucumber angular leaf spot disease caused by
Pseudomonas syringae pv. lachrymans under field conditions (Raupach and Kloepper, 2000).

CONCLUSIONS
Plants growing in field soil cannot be viewed as single organisms. The science of PGPR is
thus relatively young in comparison to nitrogen fixing bacteria and momentarily applications
to crop production are limited. The possible role of PGPR signals in plant growth stimulation
presents exciting possibilities and research opportunities. As already outlined, PGPR increase
plant growth and the mechanisms underlying this are poorly understood. However, where they
are understood they could be exploited to increase plant growth. Agronomically, PGPR effects
are of particular interest and play roles in crop production (reviewed in Broughton et al.,
2003). The research required to fully understand them will require work at all levels, from
ecology to proteomics and metabolomics. What is needed for the future is a clear definition of
what bacterial traits are useful and necessary for different environmental conditions and plants,
so that optimal bacterial strains can either be selected or constructed. Also, it would be very
useful to have a better understanding of how different bacterial strains work together for the
synergistic promotion of plant growth (Lucy et al., 2004). Additional studies need to be
conducted on the effectiveness of different and novel inoculant delivery systems such as
alginate encapsulation. In addition, a better understanding of the factors that facilitate the
environmental persistence of the PGPR strains would be very useful. Finally inoculant strains
should be labelled e.g., with lux or gfp genes, so they can be readily detected in the
environment after their release. In this regard, finding new ways of establishing stable
associations between plants and beneficial organisms and understanding the molecular and
biochemical mechanisms of signal recognition and transduction that occur in plant–microbial
interactions under different environments are most challenging study elements.

REFERENCES
Andrews, J.H., & Harris, R.F. (1986). r-selection and k-selection and microbial ecology. Adv.
Microbial. Ecol. 9: 99–147.
Arora, D., & Gaur, C. (1979). Microbial solubilization of different inorganic phosphates.
Indian J. Exp. Biol.17: 1258–61.
Arshad, M., & Frankenberger, W.T. Jr. (1993). Microbial production of plant growth
regulators. In: F.B. Metting Jr., (Ed.), Soil microbial ecology. Applications in agricultural
and environmental management. pp. 307-343 Marcel Dekker, Inc., New York.
94 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Atzorn, R., Crozier, A., Wheeler, C., & Sandberg, G .(1988). Production of gibberellins and
Indole 3-acetic acid by Rhizobium phaseoli in relation to nodulation of Phaseolus vulgaris
roots. Planta 175:532–538
Bahme, J. B., & Schroth, M. N. (1987). Spatial temporal colonization patterns of a
rhizobacterium on under ground organs of potato. Phytopathol. 77: 1093-1100
Bai, Y., Souleimanov, A., & Smith, D.L. (2002a). An inducible activator produced by Serratia
proteamaculans strain and its soybean growth promoting activity under greenhouse
conditions. J. Exp. Bot. 53: 1495–1502.
Bai, Y., D’Aoust, F., Smith, D.L., & Driscoll, B.T. (2002b). Isolation of plant growth-
promoting Bacillus strains from soybean root nodules. Can. J. Microbiol. 48: 230–238.
Baldani, V.L.D., Alvarez, M.A., Baldani, J.I., & Dobereiner, J., (1986). Establishment of
inoculated Azospirillum spp. in the rhizosphere and roots of field grown wheat and
sorghum. Plant Soil 90: 35–46.
Baldani, J.I., Caruso, L., Baldani, V.L.D., Goi, S.R., & Dobereiner, J. (1997). Recent advances
in BNF with non-legume plants. Soil Biol. Biochem. 29: 911–922.
Banik S., & Dey, B.K. (1982). Available phosphate content of an alluvial soil is influenced by
inoculation of some isolated phosphate-solubilizing microorganisms. Plant Soil 69:353–
64.
Barbieri, P., Zanelli, T., Galli, E., & Zanetti, G. (1986). Wheat inoculation with Azospirillum
brasilense Sp6 and some mutants altered in nitrogen fixation and indole-3-acetic acid
production. FEMS Microbiol. Lett. 36: 87-90.
Barea, J.M., Azco´n, R., & Azcón-Aguilar, C. (2002). Mycorrhizosphere interactions to
improve plant fitness and soil quality. Antonie van Leeuwenhoek Int. J.Gen. Mol.
Microbiol. 81: 343–351.
Barea, J.M., Azcón, R., & Azcón-Aguilar, C. (2004). Mycorrhizal fungi and plant growth
promoting rhizobacteria. In: A. Varma, L. Abbott, D. Werner, and R. Hampp (Eds.), Plant
surface microbiology. pp. 351–371. Springer-Verlag, Heidelberg, Germany,
Barea, J.M., Navarro, E., & Montoya, E. (1976). Production of plant growth regulators by
rhizosphere phosphate-solubilizing bacteria. J. Appl. Bacteriol. 40: 129-134.
Barea. J.M., Pozo, M. J., Azcon, R., & Azco´n-Aguilar, C. (2005). Microbial cooperation in
the rhizosphere. J. Exp. Bot. 56:1761–1778.
Bashan, Y., & Holguin, G. (1994). Root-to-root travel of the beneficial bacterium Azospirillum
brasilense. Appl. Environ. Microbiol. 60: 2120–2131.
Bashan, Y., & Holguin, G. (1996). A proposal for the divsion of "plant growth promoting
rhizobacteria" into two classifications: biocontrol-PGPB and PGPB. Soil Biol. Biochem.
30:1225-1228
Bashan, Y., & Levanony, H. (1990). Current status of Azospirillum technology. Azospirillum
as a challenge for agriculture. Can. J. Microbiol. 36:591-608.
Bastián. F., Cohen, A., Piccoli, P., Luna, V., Baraldi, R., & Bottini, R. (1998). Production of
indole-3-acetic acid and gibberellins A1 and A3 by Acetobacter diazotrophicus and
Herbaspirillum seropedicae in chemically-defined culture media. Plant Growth Regul.
24:7–11
Belimov, A.A., Safronova, V.I., Sergeyeva, T.A., Egorova, T.N., Matveyeva, V.A., Tsyganov,
V.E., Borisov, A.Y., Tikhonovich, I.A., Kluge, C., Preisfeld, A., Dietz, K.J., & Stepanok,
V.V. (2001). Characterization of plant growth promoting rhizobacteria isolated from
 Responses of Agronomically Important Crops to Inoculation… 95

polluted soils and containing 1-aminocyclopropane-1-carboxylate deaminase. Can. J.

Microbiol. 47:242–252
Bending, G.D. (2003). The rhizosphere and its microorganisms. In: B.Thomas, D.J. Murphy,
and B.G. Murray, (Eds.), Encyclopaedia of applied plant sciences. pp1123–1129.
Academic Press, London
Benhamou, N, Bélanger, R.R., & Paulitz, T.C. (1996a). Pre-inoculation of Ri T-DNA-
transformed pea roots with Pseudomonas fluorescens inhibits colonization by Pythium
ultimum Trow: an ultrastructural and cytochemical study. Planta 199: 105–117.
Benhamou, N., Bélanger, R.R., & Paulitz, T.C. (1996b). Induction of differential host
responses by Pseudomonas fluorescens in Ri T-DNA-transformed pea roots after
challenge with Fusarium oxysporum f. sp. pisi and Pythium ultimum. Phytopathol. 86:
1174–1185.
Benizri, E., Baudoin, E., & Guckert, A. (2001). Root colonization by inoculated plant growth-
promoting rhizobacteria. Biocon. Sci. Technol. 11: 557-574.
Benizri, E., Courtade, A., Picard, C., & Guckert, A. (1998). Role of maize root exudates in the
production of auxins by Pseudomonas fluorescens M.3.1. Soil Biol. Biochem. 30: 1481-
1484.
Bensalim, S., Nowak, J., & Asiedu, S. (1998). A plant growth promoting rhizobacterium and
temperature effects on performance of 18 clones of potato. Am. Pot. J. 75: 145–152
Berge, O., Fages, J., Mulard, D., & Balandreau, J., (1990). Effects of inoculation with Bacillus
circulans and Azospirillum lipoferum on crop-yield in field grown maize. Symbiosis. 9:
259–266.
Berge, O., Heulin, T., Achouak, W., Richard, C., Bally, R., & Balandreau, J. (1991). Rahnella
aquatitis-nitrogen fixing enteric bacterium associated with the rhizosphere of wheat and
maize. Can. J. Microbiol. 37:195-203.
Bevivino, A., Sarrocco, S., Dalmastri, C., Tabacchioni, S., Cantale, C. & Chiarini, L. (1998).
Characterisation of a free living maize-rhizosphere population of Burkholderia cepacia:
effect of seed treatment on disease suppression and growth promotion of maize. FEMS
Microbiol. Ecol. 27: 225–237.
Biswas, J.C., Ladha, J.K., Dazzo, F.B., Yanni, Y.G., & Rolfe, B.G. (2000). Rhizobial
inoculation influences seedling vigor and yield of rice. Agron. J. 92: 880–886.
Blaha, D., Combaret, C.P., Mirza, M.S., & Loccoz, Y.M. (2006). Phylogeny of the 1-
aminocyclopropane-1-carboxylic acid deaminase-encoding gene acdS in phytobeneficial
and pathogenic Proteobacteria and relation with strain biogeography. FEMS Microbiol.
Ecol. 56:455–470
Bolton, H.J., Fredrickson, J.K., & Elliott, L.F. (1993). Microbial ecology of the rhizosphere.
In: F.B.J. Metting (Ed), Soil Microbial Ecology. pp. 27-63. Marcel Dekker, New York,
Bonaterra, A., Ruz, L., Badosa, E., Pinochet, J., & Montesinos, E. (2003). Growth promotion
of Prunus rootstocks by root treatment with specific bacterial strains. Plant Soil 255: 555–
569.
Bowen, G.D., & Rovira, A.D. (1999). The rhizosphere and its management to improve plant
growth. Adv. Agron. 66: 1–102.
Brady, N. C. (1974). Animal manures and green manures. In: N. C. Brady, (Ed.), The Nature
and Property of Soils, 8th ed., pp. 534–550. MacMillan, New York.
Bressan, W.. & Borges, M.T. (2004). Delivery methods for introducing endophytic bacteria
into maize. BioControl. 49: 315-322.
96 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Broughton, W.J., Zhang, F., Perret, X., & Staehelin, C. (2003). Signals exchanged between
legumes and Rhizobium: agricultural uses and perspectives. Plant Soil 252: 129–137.
Burdman, S, Jurkevitch, E., & Okon, Y. (2000). Recent advances in the use of Plant Growth
Promoting Rhizobacteria (PGPR) in Agriculture. In: N. Subba Rao, and Y. R.
Dommergues.(Eds.), Microbial Interactions in Agriculture and Forestry, Vol II. Chapter
10, pp. 29–250. Science Publishers Inc., Plymouth, U.K
Cartieaux, F.P., Nussaume, L., & Robaglia, C. (2003). Tales from the underground: molecular
plant-rhizobacteria interactions. Plant Cell Environ. 26: 189- 199.
Casanovas, E.M., Barassi, C.A., Andrade, F.H., & Sueldo, R.J. (2003). Azospirillum-
inoculated maize plant responses to irrigation restraints imposed during flowering, Cereal
Res. Commun. 31: 395–402.
Cassán, F., Bottini, R., Schneider, G., & Piccoli, P. (2001a). Azospirillum brasilense and
Azospirillum lipoferum hydrolyze conjugates of GA20 and metabolize the resultant
aglycones to GA1 in seedlings of rice dwarf mutants. Plant Physiol. 125:2053–2058
Cassán, F., Lucangeli, C., Bottini, R., & Piccoli, P. (2001b). Azospirillum spp. metabolize
[17,17-2H2]Gibberellin A20 to [17,17-2H2] Gibberellin A1 in vivo in dry rice mutant
seedlings. Plant Cell Physiol. 42:763–767
Cassan, F., Perrig, D., Sgroy, V., Masciarelli, O., Penna, C., & Luna, V. (2008). Azospirillum
brasilense Az39 and Bradyrhizobium japonicum E109, inoculated singly or in
combination, promote seed germination and early seedling growth in corn (Zea mays L.)
and soybean (Glycine max L.). Eur. J. Soil Biol. (doi:10.1016/j.ejsobi.2008.08.005) (In
press)
Cassán, F.D., Piccoli, P., & Bottini, R. (2003). Promoción del crecimiento vegetal por
Azospirillum sp. a través de la producción de giberelinas. Un modelo alternativo para
incrementar la producción agrícola. In: A. Albanesi, C. Kunst, A. Anriquez, S.Luna, and
R.Ledesma (Eds.), Microbiología Agrícola. Un aporte de la investigación en Argentina
para la sociedad pp 1–16. Universidad Nacional de Santiago del Estero, Santiago,
Cavalcante, V. A., & Dobereiner, J. (1988). A new acid tolerant nitrogen fixing bacterium
associated with sugarcane. Plant Soil. 108:23-31.
Chanway, C.P., Radley, R.A., & Holl, F.B. (1991). Inoculation of conifer seed with plant
growth promoting Bacillus strains causes increased seedling emergence and biomass. Soil
Biol. Biochem. 23: 575–580.
Chao, W.L., Li, R. K., & Chang, W.T. (1988). Effect of root agglutinin on microbial activities
in the rhizosphere. Appl. Environ. Microbiol. 54: 1838–1841.
Chelius, M.K., & Triplett, E.W. (2000). Diazotrophic endophytes associated with maize. In:
E.W.Triplett, (Ed.), Prokaryotic Nitrogen Fixation: A Model System for the Analysis of a
Biological Process. pp. 779–791. Horizon Scientific Press, Wymondham,
Chen, C, Bélanger, R.R., Benhamou, N., & Paulitz, T.C. (2000). Defense enzymes induced in
cucumber roots by treatment with plant growth-promoting rhizobacteria (PGPR) and
Pythium aphanidermatum. Physiol. Mol. Plant Pathol. 56: 13–23.
Chen, J., Gao, H. M., Lin, R. M., Ji, M. S., & Gao, Z. G. (1999). Infection mechanism and
biocontrol of major corn fungal diseases in North China. Res. Prog. Plant Protect. Plant
Nutr. 78–84.
Chen, Y.X., Mei, R.H., Lu, S., Liu, L., & Kloepper, J.W. (1996). The use of yield increasing
bacteria (YIB) as plant growth-promoting rhizobacteria in Chinese agriculture, In: R.S.
 Responses of Agronomically Important Crops to Inoculation… 97

Utkehede, and V.K. Gupta, (Eds.), Management of Soil-Borne Disease. pp. 165–184.
Kalyani, New Delhi, India.
Chet, I., & Inbar, J. (1994). Biological control of fungal pathogens. Appl. Biochem. Biotechnol.
48: 37-43.
Chin-A-Woeng, T.F.C., Bloemberg, G.V., & Lugtenberg, B.J.J. (2003). Phenazines and their
role in biocontrol by Pseudomonas bacteria. New Phytol. 157: 503–523.
Cocking. E.C. (2003).Endophytic colonization of plant roots by nitrogen-fixing bacteria. Plant
Soil 252: 169–175
Compant, S., Reiter, B., Sessitsch, A., Nowak, J., Clement, C., & Barka, E.A. (2005).
Endophytic colonization of Vitis vinifera L. by plant growth-promoting bacterium
Burkholderia sp. strain PsJN. Appl. Environ. Microbiol. 71: 1685-1693.
Creus, C.M., Sueldo, R.J., & Barassi, C.A. (2004). Water relations and yield in Azospirillum-
inoculated wheat exposed to drought in the field, Can. J. Bot. 82: 273–281.
Davison, J. (1988). Plant beneficial bacteria. Biotechnol. 6: 282- 286.
De Freitas, J.R., & Germida, J.J. (1991). Pseudomonas cepacia and Pseudomonas putida as
winter wheat inoculants for biocontrol of Rhizoctonia solani. Can. J. Microbiol. 37: 780–
789.
De Weger, L A., van der Vlugt, C. Y. M., Wijfjes, A. H. M., Bakker, P. A. H. M., Schippers,
B., & Lugtenberg, B. (1987). Flagella of a plant growth-stimulating Pseudomonas
fluorescens strain are required for colonization of potato roots. J. Bacteriol. 169, 2769–
2773.
Dobbelaere, S., Croonenborghs, A., Thys, A., Ptacek, D., Vanderleyden, J., Dutto, P.,
Labandera-Gonzalez, C., Caballero-Mellado, J., Aguirre, J.F., Kapulnik, Y., Brener, S.,
Burdman, S., Kadouri, D., Sarig, S., & Okon, Y. (2001). Responses of agronomically
important crops to inoculation with Azospirillum. Aust. J. Plant Physiol. 28: 871–879.
Dobbelaere, S., Vanderleyden, J., & Okon, Y. (2003). Plant growth-promoting effects of
diazotrophs in the rhizosphere. Crit. Rev. Plant Sci. 22: 107–149.
Döbereiner, J., Reis, V.M., Paula, M.A., & Olivares, F. (1993). Endophytic diazotrophs in
sugarcane, cereals and tuber plants. In: R. Palacios, J. Mora, and W.E. Newton, (Eds.),
New horizons in nitrogen fixation, pp. 671-676. Kluwer Academic Publishers, Dordrecht,
The Netherlands,
Dong, Z., McCully, M., & Canny, M. (1997). Does Acetobacter diazotrophicus live and move
in the xylem of sugarcane stems? Anatomical and physiological data. Ann. Bot. 80: 147-
158.
Dong, Y., Iniguez, A.L., & Triplett, E.W. (2003). Quantitative assessments of the host range
and strain specificity of endophytic colonization by Klebsiella pneumoniae 342. Plant
Soil. 257: 49-59
Dowling, D.N., &. Gara, F. O. (1994). Metabolites of Pseudomonas involved in the biocontrol
of plant disease. Trends Biotechnol. 12: 133- 141.
Duff, R.B., & Webley, D.M. (1959). 2-Ketogluconic acid as a natural chelator produced by
soil bacteria. Chem Ind. 13: 76–77.
Dunne, C., Crowley, J.J., Moënne-Loccoz, Y., Dowling, D.N., de Bruijn, F.J., & O'Gara, F.
(1998). Biological control of Pythium ultimum by Stenotrophomonas maltophilia W81 is
mediated by an extracellular proteolytic activity. Microbiol. 143: 3921–3931.
98 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Edge, T.A., & Wyndham, R.C. (2002). Predicting survival of a genetically engineered
microorganism, Pseudomonas chlororaphis 3732RNL11, in soil and wheat rhizosphere
across Canada with linear multiple regression models. Can. J. Microbiol. 48: 717-727.
Elbeltagy, A., Nishioka, K., Sato, T., Suzuki, H., Ye, B., Hamada, T., Isawa, T., Mitsui, H., &
Minamisawa, K. (2001). Endophytic colonization and in planta nitrogen fixation by a
Herbaspirillum sp. isolated from wild rice species. Appl. Environ. Microbiol. 67: 5285-
5293.
Esashi, Y. (1991). Ethylene and seed germination. In: A.K. Matoo, and J. C.Suttle, (Eds.), The
Plant Hormone Ethylene. pp:133-157.CRC Press, Boca Raton, FL.
Fallik, E., & Okon, Y. (1989). Identification and quantification of IAA and IBA in
Azospirillum brasilense inoculated maize roots. Soil Biol. Biochem. 21: 147-153.
Feng, Y., Shen, D., & Song, W. (2006). Rice endophyte Pantoea agglomerans YS19 promotes
host plant growth and affects allocations of host photosynthates. J. Appl. Microbiol. 100:
938-945.
Frankenberger, W.T.Jr., & Arshad, M. (1995). Phytohormones in soils: Microbial production
and function. Marcel Dekker, Inc. NewYork, NY, p 503.
Fuentes-Ramirez, L.E., Bustillos-Cristales, R., Tapia-Hernandez, A., Jimenez-Salgado, T.,
Wang, E.T., Martinez-Romero, E., & Caballero- Mellado, J. (2001). Novel nitrogen fixing
acetic acid bacteria, Gluconacetobacter johannae sp. nov. and Gluconacetobacter
azotocaptans sp. nov., associated with coffee plants. Int. J. Syst. Evol. Microbiol. 51:
1305–1314
Fujii, T., Huang, Y.D., Higashitani, A., Nishimura, Y., Iyama, S., Hirota, Y., Yoneyama, T., &
Dixon, R.A. (1987). Effect of inoculation with Klebsiella oxytoca and Enterobacter
cloacae on dinitrogen fixation by rice-bacteria associations. Plant Soil. 103: 221-226.
Ganguly, T.K., Jana, A.K., & Moitra, D.N. (1999). An evaluation of agronomic potential of
Azospirillum brasilense and Bacillus megaterium in fibre–legume–cereal system in an
Aeric haplaquept. Indian J. Agri. Res. 33: 35–39.
Ghosh, S, Penterman, J.N., Little, R.D., Chavez, R., & Glick, B.R. (2003). Three newly
isolated plant growth-promoting bacilli facilitate the seedling growth of canola, Brassica
campestris. Plant Physiol. Biochem. 41:277–281
Glick, B.R. (1995). The enhancement of plant growth by free-living bacteria. Can. J.
Microbiol. 41: 109-117.
Glick, B.R. (2005). Modulation of plant ethylene levels by the bacterial enzyme ACC
deaminase. FEMS Microbiol. Lett .251:1–7
Glick, B.R., Patten, C.L., Holguin, G. & Penrose, D.M. (1999). Biochemical and genetic
mechanisms used by plant growth promoting bacteria. Imperial College Press, London,
United Kingdom, p 267.
Goldstein, A.H.(1986). Bacterial solubilization of mineral phosphates: historical perspective
and future prospects. Am. J. Altern. Agri.1:51–57.
Goldstein, A.H., Rogers, R.D., & Mead, G. (1993). Mining by microbe. Biotechnol.11:1250–
1254.
Golley, F., Baudry, J., Berry, R.J., Bornkamm, R., Dahlberg, K., Jansson, A.M., King, J., Lee,
J., Lenz, R., & Sharitz, R. (1992). What is the road to sustainability? INTECOL Bull. 20:
15–20
 Responses of Agronomically Important Crops to Inoculation… 99

Gügi, B., Orange, N., Hellio, F., Burini, J.F., Guillou, C., Leriche, F., & Guespin-Michel, J.F.
(1991). Effect of growth temperature on several exported enzyme activities in the
psychrotropic bacterium Pseudomonas fluorescens. J. Bacteriol.173:3814–20.
Gutie´rrez-Zamora, M.L., & Martı´nez-Romero, E. (2001). Natural endophytic association
between Rhizobium etli and maize (Zea mays L.). J. Biotechnol. 91: 117–126.
Gutiérrez-Mañero, F., Ramos-Solano, B., Probanza, A., Mehouachi, J.,Tadeo, F.R., & Talon,
M. (2001). The plant-growth-promoting rhizobacteria Bacillus pumilus and Bacillus
licheniformis produce high amounts of physiologically active gibberellins. Physiol. Plant
111:206–211
Gyaneshwar, P., James, E.K., Mathan, N., Reddy, P.M., Reinhold-Hurek, B., & Ladha, J.K.
(2001). Endophytic colonization of rice by a diazotrophic strain of Serratia marcescens. J.
Bacteriol. 183: 2634-2645.
Gyaneshwar, P., James, E.K., Reddy, P.M. & Ladha, J.K. (2002). Herbaspirillum colonization
increases growth and nitrogen accumulation in aluminum-tolerant rice varieties. New
Phytol. 154: 131–145.
Halder, A.K., & Chakrabartty, P.K. (1993). Solubilization of inorganic phosphate by
Rhizobium. Folia Microbiol. 38:325–30.
Halder, A.K., Mishra, A.K., Bhattacharyya, P., & Chakrabartty, P.K. (1990). Solubilization of
rock phosphate by Rhizobium and Bradyrhizobium. J. Gen. Appl. Microbiol. 36:81–92.
Hallmann, J., Quadt-Hallmann, A., Mahaffee, W.F., & Kloepper, W., (1997). Bacterial
endophytes in agricultural crops. Can. J. Microbiol. 43: 895–914.
Handelsman, J., Raffel, S., Mester, E.H., Wunderlich, L., & Crau, C.R. (1990). Biological
control of damping-off of alfalfa seedlings with Bacillus cereus UW85. Appl. Environ.
Microbiol. 56: 713–718.
Hartmann, A. (1988). Ecophysiological aspects of growth and nitrogen fixation in
Azospirillum spp. Plant Soil. 110: 225- 238.
Hebbar, K. P., Atkinson, D., Tucker, W., & Dart, P. J. (1992). Suppression of Fusarium
moniliforme by maize root-associated Pseudomonas cepacia. Soil Biol. Biochem. 24:
1009–1020.
Hiltner. L. (1904). Uber neue erfahrungen und probleme auf dem gebiete der
bodenbakteriologie. Arbeiten der Deutschen Landwirtschaft Gesellschaft 98: 59–78.
Hoitink, H. A. J., & Boehm, M. J. (1999). Biocontrol within the context of soil microbial
communities: a substrate-dependent phenomenon. Annu. Rev. Phytopathol. 37: 427–446.
Holguin, G., Patten, C.L., & Glick, B.R. (1999). Genetics and molecular biology of
Azospirillum. Biol. Fert. Soils 29: 10-23.
Honma, M., & Shimomura, T. (1978). Metabolism of 1-amino-cyclopropane-1-carboxylic
acid. Agric. Biol. Chem. 42:1825–1831
Howie, W.J., & Echandi, E. (1983). Rhizobacteria: Influence of cultivar and soil type on plant
growth and yield of potato. Soil Biol. Biochem. 15: 127-132.
Hurek, T., Reinhold-Hurek, B., Van Montagu, M., & Kellenberger, E., (1994). Root
colonization and systemic spreading of Azoarcus sp. strain BH72 in grasses. J. Bacteriol.
176: 1913–1923.
Illmer, P., & Schinner, F. (1992). Solubilization of inorganic phosphates by microorganisms
isolated from forest soil. Soil Biol. Biochem. 24:389–95.
100 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Inbar, J., & Chet, I., (1991). Evidence that chitinase produced by Aeromonas caviae is
involved in the biological control of soil-borne plant pathogens by bacterium. Soil Biol.
Biochem. 23: 974–978.
Jacobson, M. B. (1991). Ethylene in root growth and development. In: A. K. Matoo, and J. C.
Suttle (Eds.), The Plant Hormone Ethylene. pp:159-181.CRC Press, Boca Raton, FL.
Jaizme-Vega, M.D.C., Romero, A.S.R., & Guerra, M.S.P. (2004). Potential use of
rhizobacteria from the Bacillus genus to stimulate the plant growth of micropropagated
bananas. Fruits 59: 83–90.
James, E.K., & Olivares, F.L. (1997). Infection of sugarcane and other graminaceous plants by
endophytic diazotrophs. Crit. Rev. Plant Sci. 17: 77-119.
James, E.K., Gyaneshwar, P., Barraquio, W.L., Mathan, N., & Ladha, J.K. (2000). Endophytic
diazotrophs associated with rice, In: P.M. Reddy (Ed.), The quest for nitrogen fixation in
rice. pp. 119-140. International Rice Research Institute, Makati City, Philippines.
James, E.K., Gyaneshwar, P., Mathan, N., Barraquio, W.L., Reddy, P.M., Iannetta, P.P.M.,
Olivares, F.L., & Ladha, J.K. ( 2002). Infection and colonization of rice seedlings by the
plant growth-promoting bacterium Herbaspirillum seropedicae Z67. Mol. Plant Microbe
Interact. 15: 894-906.
Javed, M., Arshad, M., & Ali, K. (1998). Evaluation of rhizobacteria for their growth
promoting activity in maize. Pak. J. Soil Sci. 14: 36-42.
Jetiyanon, K., & Kloepper, J.W. (2002). Mixtures of plant growth-promoting rhizobacteria for
induction of systemic resistance against multiple plant diseases. Biol.Con. 24: 285–291
Jetiyanon, K., Tuzun, S., & Kloepper, J.W. (1997). Lignification, peroxidase and superoxidase
dismutases as early plant defense reactions associated with PGPR-mediated induced
systemic resistance. In: A. Ogoshi, K. Kobayashi, Y. Homma, F. Kodama, N.Kondo, and
S. Akino, (Eds.), Plant growth-promoting rhizobacteria: present status and future
prospects. pp 265–268. Sapporo, Japan.
Jimenez-Salgado, T., Fuentes-Ramirez, L.E., Tapia-Hernandez, A., Mascarua-Esparza, M.A.,
Martinez-Romero, E., & Caballero-Mellado, J. (1997). Coffea arabica L., a new host plant
for Acetobacter diazotrophicus, and isolation of other nitrogen fixing acetobacteria. Appl.
Environ. Microbiol. 63: 3676 –3683
Kandan, A., Ramiah, M., Vasanthi, V.J., Radjacommare, R., Nandakumar, R., Ramanathan,
A., & Samiyappan, R. (2005). Use of Pseudomonas fluorescens-based formulations for
management of tomato spotted wilt virus (TSWV) and enhanced yield in tomato. Biocon.
Sci. Technol. 15: 553–569.
Kang, Y., Carlson, R., Tharpe, W., & Schell, M.A. (1998).Characterization of genes involved
in biosynthesis of a novel antibiotic from Burkholderia cepacia BC11 and their role in
biological control of Rhizotconia solani. Appl. Environ. Microbiol. 64: 3939-3947
Katznelson, H., Peterson, E.A., & Rovatt, J.W. (1962). Phosphate dissolving microorganisms
on seed and in the root zone of plants. Can. J. Bot. 40:1181–1186.
Kennedy, A.C. (1998). The rhizosphere and spermosphere. In: D.M.Sylvia, J.J. Fuhrmann,
P.G. Hartel, and D.A. Zuberer, (Eds.), Principles and applications of soil microbiology.
pp.389–407. Prentice Hall, Upper Saddle River, New Jersey.
Kennedy, I. R., & Tchan, Y. T. (1992). Biological nitrogen fixation in non leguminous field
crops. Recent Advances. Plant Soil. 141:93-118.
 Responses of Agronomically Important Crops to Inoculation… 101

Kessmann, H., Staub, T., Hofmann, C., Maetzke, T., Herzog, J., Ward, E., Uknes, S., & Ryals,
J. (1994). Induction of systemic acquired disease resistance in plants by chemicals. Annu.
Rev. Phytopathol. 32: 439-459.
Khalid, A., Arshad, M., & Zahir, Z.A. (2004). Screening plant growth-promoting rhizobacteria
for improving growth and yield of wheat. J. Appl. Microbiol. 96: 473–480
Kim, B.S., Moon, S.S., & Hwang, B.K. (1999).Isolation, identification and antifungal activity
of a macrolides antibiotics Oligomycin A produced by Sterptomyces libani. Can. J.
Bot.77: 850 – 858.
Kirchhof, G., Reis, V.M., Baldani, J.I., Eckert, B., Döbereiner, J., & Hartmann, A. (1997).
Occurrence, physiological and molecular analysis of endophytic diazotrophic bacteria in
gramineous energy plants. Plant Soil 194: 45-55.
Kloepper, J.W. (1994). Plant growth-promoting rhizobacteria (other systems). In: Y. Okon,
(Ed.), Azospirillum / plant associations. pp111–118. CRC Press, Boca Raton, FL, USA.
Kloepper, J.W., Hume, D.J., Scher, F.M., Singleton, C., Tipping, B., Laliberté, M., Frauley,
K., Kutchaw, T., Simonson, C., Lifshitz, R., Zaleska, I. & Lee, L. (1988). Plant growth-
promoting rhizobacteria on canola (rapeseed). Plant Dis. 72: 42- 45.
Kloepper, J.W., Leong, J., Teintze, M., & Schroth, M.N. (1980a). Enhanced plant growth by
siderophores produced by plant growth promoting rhizobacteria. Nature 286: 885-886.
Kloepper, J.W., Schroth, M.N., & Miller, W. (1980b). Effects of rhizosphere colonization by
plant growth-promoting rhizobacteria on potato plant development and yield. Ecol.
Epidemiol. 70: 1078–1082.
Kloepper, J.W., Lifshitz, R., & Zablotowicz, R.M. (1989). Free living bacterial inocula for
enhancing crop productivity. Trends Biotechnol. 7: 39-44.
Kloepper, J.W., Scher, F.M., Laliberte, M., & Zaleska, I. (1985). Measuring the spermosphere
colonizing capacity (spermosphere competence) of bacterial inoc ulants. Can. J.
Microbiol. 31: 926-929.
Kloepper, J. W., Schippers, B., & Bakker, P. A. H. M. (1992a). Proposed elimination of the
term endorhizosphere. Phytopathol. 82: 726–727.
Kloepper, J, Tuzun, S, & Kuc, J. (1992b). Proposed definitions related to induced disease
resistance. Biocon. Sci. Technol. 2: 347–349.
Kloepper, J.W., & Schroth, M.N. (1981a). Plant growth-promoting rhizobacteria under
gnotobiotic conditions. Phytopathol. 71: 642-644.
Kloepper, J.W. & Schroth, M.N. (1981b). Relationship of in vitro antibiosis of plant growth
promoting rhizobacteria on potato plant development and yield. Phytopathol. 71: 1020-
1024
Kloepper, J.W., Zablotowick, R.M., Tipping, E.M., & Lifshitz, R. (1991). Plant growth
promotion mediated by bacterial rhizosphere colonizers. In: D.L. Keister, and P.B.
Cregan, (Eds.), The rhizosphere and plant growth. pp. 315–326. Kluwer Academic
Publishers, Dordrecht, The Netherlands.
Kluepfel, D.A., & McInnis, T.M. (1991). Biological control of ring nematodes by
Pseudomonas aureofaciens. Phytopathol. 81: 1178–1186.
Kobayashi, M., Suzuki, T., Fujita, T., Masuda, M., & Shimizu, S. (1995). Occurrence of
enzymes involved in biosynthesis of indole-3-acetic acid from indole-3-acetonitrile in
plant-associated bacteria, Agrobacterium and Rhizobium. PNAS 92: 714–718.
Kokalis-Burelle, N. (2003). Effects of transplant type, plant growth promoting rhizobacteria,
and soil treatment on growth and yield of strawberry in Florida. Plant Soil 256: 273–280.
102 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Kommendahl, T., & Chang, I. P. (1975). Biocontrol of corn root infection in the field by seed
treatment with antagonists. Phytopathol. 65: 296–300.
Kucey, R.M.N. (1988). Plant growth-altering effects of Azospirillum brasilense and Bacillus
C-11-25 on two wheat cultivars. J Appl. Bacteriol. 64:187–196
Kucey, R.M.N., Janzen, H.H., & Leggett, M.E. (1989). Microbially mediated increases in
plant-available phosphorus. Adv. Agron. 42:199–228.
Landa, B.B., Mavrodi, D.M., Thomashow, L.S., & Weller, D.M. (2003). Interactions between
strains of 2,4-diacetylphloroglucinol producing Pseudomonas fluorescens in the
rhizosphere of wheat. Phytopathol. 93: 982–994.
Lambert, B., & Joos, H. (1989). Fundamental aspects pf rhizobacterial plant growth promotion
research. Trends Biotechnol. 7:215-219.
Lambert, B., Joos, H., Dierick, S., Vantomme, R., Swings, J., Kerters, K., & Van Montagu, M.
(1990). Identification and plant interaction of Phyllobacterium sp., a predominant
rhizobacterium of young sugar beat. Appl. Environ. Microbiol. 56: 1093–1102.
Lee, H.S., Madhaiyan, M., Kim, C.W., Choi, S.J., Chung, K.Y., & Sa, T.M. (2006).
Physiological enhancement of early growth of rice seedlings (Oryza sativa L.) by
phytohormone producing of N2-fixing methylotrophic isolates. Biol. Fert. Soils 42: 402–
408.
Leeman, M., van Pelt, J.A., den Ouden, F.M., Heinsbroek, M., Bakker, P.A.H.M., &
Schippers, B. (1995). Induction of systemic resistance against Fusarium wilt of radish by
lipopolysaccharides of Pseudomonas fluorescens. Phytopathol. 85: 1021–1027.
Leeman, M., den Ouden, F.M., van Pelt, J.A., Dirkx, F.P.M., Steijl, H., Bakker, P.A.H.M., &
Schippers, B. (1996). Iron availability affects induction of systemic resistance to Fusarium
wilt of radish by Pseudomonas fluorescens. Phytopathol. 86: 149–155.
Li, D. M., & Alexander, A. (1988). Coinoculation with antibiotic producing bacteria to
increase colonization and nodulation by rhizobia. Plant Soil.108:211-219.
Liu, L., Kloepper, J.W., & Tuzun, S. (1995). Induction of systemic resistance in cucumber
against bacterial angular leaf spot by plant growth-promoting rhizobacteria. Phytopathol.
85: 843-847.
Liu, T.S., Lee, L.Y., Tai, C.Y., Hung, C.H., Chang, Y.S., Wolfram, J.H., Rogers, R., &
Goldstein, A.H. (1992).Cloning of an Erwinia herbicola gene necessary for gluconic acid
production and enhanced mineral phosphate solubilization in Escherichia coli HB101:
Nucleotide sequence and probable involvement in biosynthesis of the coenzyme
pyrroloquinoline quinone. J Bacteriol.174:5814–5819.
Lodewyckx, C., Vangronsveld, J., Porteous, F., Moore, E.R.B., Taghavi, S., Mezgeay, M., &
Van der Lelie, D. (2002). Endophytic bacteria and their potential applications. Crit. Rev.
Plant Sci. 21: 583–606.
Loper, J. E., Suslow, T. V., & Schroth, M. N. (1984). Lognormal distribution of bacterial sub
populations in the rhizosphere. Phytopathol.74: 1454-1460.
Lucy, M., Reed, E., & Glick, B.R. (2004). Applications of free living plant growth-promoting
rhizobacteria. Antonie van Leeuwenhoek 86: 1–25,
Lugtenberg, B.J.J., Dekkers, L., & Bloemberg, G.V. (2001). Molecular determinants of
rhizosphere colonization by Pseudomonas. Ann. Rev. Phytopathol. 39: 461-490.
Lynch, J. M., & Whipps, J. M. (1990). Substrate flow in the rhizosphere. Plant Soil. 129: 1–10.
 Responses of Agronomically Important Crops to Inoculation… 103

Ma, W., Sebestianova, S.B., Sebestian, J., Burd, G.I., Guinel, F.C., & Glick, B.R. (2003).
Prevalence of 1-aminocyclopropane-1-carboxylate deaminase in Rhizobium spp. Antonie
van Leeuwenhoek 83:285–291
Madhaiyan, M, Poonguzhali, S., Ryu, J., & Sa, T.M. (2006). Regulation of ethylene levels in
canola (Brassica campestris) by 1-aminocyclopropane-1-carboxylate deaminase-
containing Methylobacterium fujisawaense. Planta 224: 268–278
Malik, K.A., Bilal, R., Mehnaz, S., Rasul, G., Mirza, M.S., & Ali, S. (1997). Association of
nitrogen-fixing, plant growth-promoting rhizobacteria (PGPR) with kallar grass and rice.
Plant Soil. 194: 37-44.
Mathews, S.S., Sparkes, D.L., & Bullard, M.J. (2001). The response of wheat to inoculation
with the diazotroph Azorhizobium caulinodans. Aspects Appl. Biol. 63: 35–42.
Mehnaz, S., & Lazarovits, G. (2006). Inoculation Effects of Pseudomonas putida,
Gluconacetobacter azotocaptans, and Azospirillum lipoferum on corn plant growth under
greenhouse conditions. Microbial Ecol. 51: 326–335
Mello, M.R.F., Assis, S.M.P., Mariano, R.L.R., Camara, T.R., & Menezes, M. (2000).
Screening of bacteria and bacterization methods for growth promotion of micropropagated
pineapple plantlets. http://www.ag.auburn.edu/argentina/pdfmanuscripts/mello.pdf.
Milner, J.L., Silo-Suh, L., Lee, J.C., He, H., Clardy, J., & Handlesmann, J. (1996). Production
of kanosamine by Bacillus cerus UW85. Appl. Environ. Microbiol. 62: 3061 - 3065
Mirza, M.S., Rasul, G., Mehnaz, S., Ladha, J.K., So, R.B., Ali, S., & Malik, K.A., (2000).
Beneficial effects of inoculated nitrogen-fixing bacteria on rice. In: J.K. Ladha, and
P.M.Reddy, (Eds.), The Quest for Nitrogen Fixation in Rice. pp. 191–204. International
Rice Research Institute, Los Banos.
Murphy, J.F., Zehnder, G.W., Schuster, D.J., Sikora, E.J., Polston, J.E., & Kloepper, J.W.
(2000). Plant growth-promoting rhizobacterial mediated protection in tomato against
Tomato mottle virus. Plant Dis. 84: 779–784.
Muthukumarasamy, R., Revathi, G., & Lakshminarasimhan, C. (1999). Influence of N
fertilization on the isolation of Acetobacter diazotrophicus and Herbaspirillum spp. from
Indian sugarcane varieties. Biol. Fertil. Soils 29: 157–164
Muthukumarasamy, R., Revathi, G., Seshadri, S., & Lakshminarasimhan, C. (2002).
Gluconacetobacter diazotrophicus (syn. Acetobacter diazotrophicus), a promising
diazotrophic endophyte in tropics. Curr. Sci. 83: 137–145
Nakayama, T., Homma, Y., Hashidoko, Y., Mizutani, J., & Tahara, S. (1999). Possible role of
xanthobaccins produced by Stenotrophomonas sp. strain SB-k88 in suppression of sugar
beet damping off disease. Appl. Environ. Microbiol.65: 4334-4339.
Neilands, J. B., & Leong, S. A. (1986). Siderophores in relation to plant growth and disease.
Ann. Rev. Plant. Physiol. 37: 187-208.
Nielson, E.B., (1998). Biological control of pythium seed rot and preemergence damping-off
of cotton with Enterobacter cloacae and Ervinis herbicola applied as seed treatments.
Plant Dis. 72: 140–142.
Njoloma, J.P., Tanaka, K., Shimizu, T., Nishiguchi, T., Zakria, M., Akashi, R., Oota, M., &
Akao, S. (2006). Infection and colonization of aseptically micropropagated sugarcane
seedlings by nitrogen-fixing endophytic bacterium, Herbaspirillum sp. B501gfp1. Biol.
Fertil. Soils. 43: 137-143.
Nowak, J., (1998). Benefits of in vitro ‘biotization’ of plant tissue cultures with microbial
inoculants. In Vitro Cell. Dev. Biol. Plant 34: 122–130.
104 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Nowak, J., Asiedu, S.K., Lazarovits, G., Pillay, V., Stewart, A., Smith, C., & Liu, Z. (1995).
Enhancement of in vitro growth and transplant stress tolerance of potato and vegetables
plantlets co-cultured with a plant growth promoting rhizobacterium., In: P. Chagvardieff
(Ed.). Proceedings of the International Symposium on Ecophysiology and Photosynthetic
In Vitro cultures. pp. 173-180. CEA, Aix-en-Provence, France.
Nowak, J., Asiedu, K., Bensalim, S., Richards, J., Stewart, A., Smith, C., Stevens, D., & Sturz,
A.V. (1997). From laboratory to application: challenges and progress with vitro dual
cultures of potato and beneficial bacteria. In: A.C. Cassells (Ed.), Pathogen and Microbial
Contamination Management in Micropropagation. pp. 321-330, Kluwer. Dordrecht
O’Gara, F., Dowling, D.N., & Boesten, B. (1994). Molecular ecology of rhizosphere
microorganisms. Weinheim, Germany: VCH, 173.
Ohtake, H., Wu, H., Imazu, K., Ambe, Y., Kato, J., & Kuroda, A. (1996). Bacterial
phosphonate degradation, phosphite oxidation and polyphosphate accumulation. A Res.
Conserv. Recycl.18:125–34.
Okon, Y., & Labandera-Gonzalez, C.A., (1994). Agronomic applications of Azospirillum: an
evaluation of 20 years world-wide field inoculation. Soil Biol. Biochem. 26, 1591–1601.
Olivares, F.L., Baldani, V.L.D., Reis, V.M., Baldani, J.I., & Döbereiner, J. (1996). Occurrence
of the endophytic diazotrophs Herbaspirillum spp. in root, stems, and leaves,
predominantly of Gramineae. Biol. Fertil. Soils. 21: 197–200.
Olivares, F.L., James, E.K., Baldani, J.I., & Döbereiner, J. (1997). Infection of mottled stripe
disease susceptible and resistant sugar cane varieties by the endophytic diazotroph
Herbaspirillum. New Phytol. 135: 723-737.
Oliveira, A. L. M., Urquiaga, S., Dobereiner, J., & Baldani, J. I. (2002). The effect of
inoculating endophytic N2-fixing bacteria on micro propagated sugarcane plants. Plant
Soil 242: 205–215.
Ordentlich, A., Elad, Y., & Chet, I., (1988). The role of chitinase of Serratia marcescens for
control of Sclerotium rolfsii. Soil Boil. Biochem. 19: 747–751.
O’Sullivan, D. J., & O’Gara, F. (1992). Traits of fluorescent Pseudomonas spp. involved in
suppression of plant root pathogen. Microbiol. Rev. 56: 662-676
Patten, C., & Glick, B.R. (1996). Bacterial biosynthesis of indole-3-acetic acid. Can. J.
Microbiol. 42: 207-220.
Penrose, D. M., Moffatt, B.A., & Glick, B.R. (2001a). Determination of 1-aminocyclopropane-
1-carboxylic acid (ACC) to assess the effects of ACC deaminase-containing bacteria on
roots of canola seedlings. Can. J. Microbiol. 47: 77-80.
Penrose, D.M., & Glick, B.R. (2001b). Levels of 1-aminocyclopropane-1-carboxylic acid
(ACC) in exudates and extracts of canola seeds treated with plant growth-promoting
bacteria. Can. J. Microbiol. 47:368–372
Pereira, J.A., & Baldani, J.I. (1995). Selection of Azospirillum spp. and Herbaspirillum
seropedicae strains to inoculate rice and maize plants. In: International Symposium on
Sustainable Agriculture for the Tropics – the Role of Biological Nitrogen Fixation. pp.
220–221. Brazilian Academy of Sciences, Angra dos Reis, EMBRAPA-CNPAB, UFRRJ.
Persello-Cartieaux, F., Nussaume, L., & Robaglia, C. (2003). Tales from the underground:
molecular plant–rhizobacteria interactions. Plant, Cell and Environment 26: 189–199.
Petersen, C. A., Emanuel, M. E., & Humphreys, G. B. (1981). Pathway of movement of
apoplastic fluorescent dye tracers through the endodermis at the site of secondary root
formation in corn (Zea mays) and broad bean (Vicia faba). Can. J. Bot. 59: 618–625.
 Responses of Agronomically Important Crops to Inoculation… 105

Piccoli, P., Lucangeli, D., Schneider, G., & Bottini, R. (1997). Hydrolysis of [17,17-
2
H2]Gibberellin A20-Glucoside and [17,17-2H2]Gibberellin A20-glucosyl ester by
Azospirillum lipoferum cultured in a nitrogen-free biotin-based chemically-defined
medium. Plant Growth Regul. 23:179–182
Piccoli, P., Masciarelli, O., & Bottini, R. (1999). Gibberellin Production by Azospirillum
lipoferum cultured in chemically-defined medium as affected by oxygen availability and
water status. Symbiosis. 27:135–146
Pinton, R., Varanini, Z., & Nannipieri, P. (eds) (2001). The rhizosphere: biochemistry and
organic substances at the soil-plant interface. New York: Marcel Dekker.
Puhler, A., Arlat, M., Becker, A., Gottfert, M., Morrissey, J.P., & O’Gara, F. (2004). What can
bacterial genome research teach us about bacteria–plant interactions? Curr. Opin. Plant
Biol. 2, 137–147.
Puente, M., Montecchia, M.S., & Perticari, A. (2005). Evaluation of Azospirillum inoculant
strains in wheat. In: B.A. Mardel Plata, (Ed.), 7th International Wheat Congress,
Argentina, SAGPyA-INTA, Argentina.
Raghu, K., & MacRae, I.C. (1966). Occurrence of phosphate-dissolving microorganisms in the
rhizosphere of rice plants and in submerged soils. J. Appl. Bacteriol. 29:582–586
Raju, N. S., Niranjana, S. R., Janardhana, G. R., Prakash, H. S., Shetty, H. S., & Mathur, S. B.
(1999). Improvement of seed quality and field emergence of Fusarium moniliforme
infected sorghum seeds using biocontrol agents. J. Sci. Food Agric. 79: 206–212.
Rashid, A., Aslam, M., Sajjad, M. R., Siddique, G., Jami, A. R., Gill, M. A., Cheema, M. S.,
Sindhu, M. S., Asghar M., & Nayyar, M. M. (1997). Response of wheat to diazotroph
bacteria and nitrogen at different locations of Pakistan Punjab area. Proc. Symp. Plant
Nutrition Management for Sustainable Agricultural Growth. pp:139-146. NFDC,
Islamabad.
Raupach, G.S., & Kloepper, J.W. (1998). Mixtures of plant growth-promoting rhizobacteria
enhance biological control of multiple cucumber pathogens. Phytopathol. 88: 1158–1164
Raupach, G.S., & Kloepper, J.W. (2000). Biocontrol of cucumber diseases in the field by plant
growth-promoting rhizobacteria with and without methyl bromide fumigation. Plant Dis.
84: 1073–1075.
Reinhold, B., & Hurek, T. (1988). Localization of diazotrophs in the root interior with special
attention to the kallar grass association. Plant Soil 110: 259–268.
Reinhold, B., Hurek, T., Niemann, E.G., & Fendrik, I. (1986). Close association of
Azospirillum and diazotrophic rods with different root zones of Kallar grass. Appl.
Environ.Microbiol. 52: 520-526.
Reis, V.M., Baldani, J.I., Baldani, V.L.D., & Dobereiner, J. (2000). Biological dinitrogen
fixation in gramineae and palm trees. Crit. Rev. Plant Sci.19: 227–247.
Richardson, AE. (2001). Prospects for using soil microorganisms to improve the acquisition of
phosphorus by plants. Australian J. Plant Physiol. 28: 897–906.
Richardson, A.E., & Hadobas, P.A. (1997). Soil isolates of Pseudomonas spp. that utilize
inositol phosphates. Can. J. Microbiol. 43:509–516.
Riggs, P.J., Chelius, M.K., Iniguez, A.L., Kaeppler, S.M., & Triplett, E.W. (2001). Enhanced
maize productivity by inoculation with diazotrophic bacteria. Australian J. Plant Physiol.
28: 829–836.
Rodriguez, H., & Fraga, R. (1999). Phosphate solubilizing bacteria and their role in plant
growth promotion. Biotech. Adv. 17: 319–339
106 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Rodríguez, H., Goire, I., & Rodríguez, M. (1996).Caracterización de cepas de Pseudomonas

solubilizadoras defósforo. Rev. ICIDCA 30:47–54.
Rojas, J.M., & Mellado, J.C. (2003). Population dynamics of Gluconacetobacter
diazotrophicus in sugarcane cultivars and its effect on plant growth. Microb. Ecol. 46:
454-464.
Roncato-Maccari, L.D.B., Ramos, H.J.O., Pedrosa, F.O., Alquini, Y., Chubatsu, L.S., Yates,
M.G., Rigo, L.U., Steffens, M.B.R., & Souza, E.M. (2003). Endophytic Herbaspirillum
seropedicae expresses nif genes in gramineous plants. FEMS Microbiol. Ecol. 45: 39-47.
Ryder, M.H., & Jones, D.A. (1990). Biological control of crown gall.n: D. Hornby, R.J. Cook,
and Y. Henis, (Eds.), Biological Control of Soil- Borne Plant Pathogens. pp. 45–63. CAB
International, Oxford, UK,
Ryder, M.H., Yan, Z., Terrace, T.E., Rovira, A.D., Tang, W., & Correll, R.L. (1999). Use of
strains of Bacillus isolated in China to suppress take-all and rhizoctonia root rot, and
promote seedling growth of glasshousegrown wheat in Australian soils. Soil Biol.
Biochem. 31: 19–29.
Safronova, V.I., Stepanok, V.V., Engqvist, G..L., Alekseyev, Y.V., & Belimov, A.A. (2006).
Root-associated bacteria containing 1-aminocyclopropane-1-carboxylate deaminase
improve growth and nutrient uptake by pea genotypes cultivated in cadmium
supplemented soil. Biol. Fert. Soils 42:267–272
Sala, C., Echarte M., Bulos, M., Vrdoljak, G., & Paulucci, P. (2004). Tendencias en el
mejoramiento del cultivo (Crop breeding trends). In: Proceedings of ‘‘A Todo Trigo’’
Congress, Mar del Plata (BA, Argentina), Federacio´n de Centros y Entidades Gremiales
de Acopiadores de Cereales, pp. 25–27.
Saleh, S.A., Mekhemar, G.A.A., El-Soud, A.A.A., Ragab, A.A., & Mikhaeel, F.T. (2001).
Survival of Azorhizobium and Azospirillum in different carrier materials: inoculation of
wheat and Sesbania rostrata. Bulletin of Faculty of Agriculture, Cairo University 52: 319–
338.
Scher, F.M., Kloepper, J.W., & Singleton, C.A. (1985). Chemotaxis of fluorescent
Pseudomonas spp. to soybean seed exudates in vitro and in soil. Can. J. Microbiol. 31:
570-574.
Schippers, B., Bakker, A .W., & Bakker, P. A. M .H. (1987). Interaction of deleterious and
benefical rhizosphere microorganisms and the effect of cropping practices. Annu. Rev.
Phytopathol. 25: 339– 358.
Senthilkumar, M., Madhaiyan, M., Sundaram, S. P., Sangeetha, H., & Kannaiyan, S. (2008).
Induction of endophytic colonization in rice (Oryza sativa L.) tissue culture plants by
Azorhizobium caulinodans. Biotechnol. Lett. 30:1477-1487.
Sessitsch, A., Coenye, T., Sturz, A.V., Vandamme, P., Barka, E., Wang-Pruski, G., Faure, D.,
Reiter, B., Glick, B.R., & Nowak, J. (2005). Burkholderia phytofirmins sp. Nov., a novel
plant-associated bacterium with plant beneficial properties. Int. J. Syst. Evol. Microbiol.
55:1187–1192
Sevilla, M., & Kennedy, C. (2000). Colonisation of rice and other cereals by Acetobacter
diazotrophicus an endophyte of sugarcane. In: J.K.Ladha, and P.M. Reddy, .(Eds.), The
Quest for Nitrogen Fixation in Rice. pp. 151–165. Manila: IRRI press.
Sevilla, M., Burris, R.H., Gunapala, N., & Kennedy, C. (2001). Comparison of benefit to
15
sugarcane plant growth and N incorporation following inoculation of sterile plants with
2
 Responses of Agronomically Important Crops to Inoculation… 107

Acetobacter diazotrophicus wild-type and Nif- mutants strains. Mol. Plant Microbe
Interact. 14: 358-366.
Shaharoona, B., Arshad, M., & Zahir, Z.A. (2006). Performance of Pseudomonas spp.
containing ACC-deaminase for improving growth and yield of maize (Zea mays L.) in the
presence of nitrogenous fertilizer. Soil Biol. Biochem. 38:2971–2975
Shane, M.W., McCully, M.E., & Canny, M.J. (2000). Architecture of branch-root junctions in
maize: structure of connecting xylem and porosity of pit membranes. Ann. Bot. 85: 613-
624.
Shankariah, C., & Hunsigi, G., (2001). Field responses of sugarcane to associative N2 fixers
and P solubilisers. In: D.M. Hogarth, (Ed.), Proceedings of the 24th International Society
of Sugarcane Technologists Congress, 17–21 September 2001. The Australian Society of
Sugarcane Technologists, Brisbane, pp. 40–45.
Sharma, V.K., & Nowak, J. (1998). Enhancement of Verticillium wilt resistance in tomato
transplants by in vitro co-culture of seedlings with a plant growth promoting
rhizobacterium (Pseudomonas sp. strain. PsJN). Can. J. Microbiol. 44: 528– 536
Singh, P.P.S., Shin, Y.C., Park, C.S., & Chung, Y.R. (1999). Biological control of Fusarium
wilt of cucumber by chitinolytic bacteria. Phytopathol. 89: 92–99.
Skrary, F.A., & Cameron, D.C. (1998). Purification and characterization of a Bacillus
licheniformis phosphatase specific for D-alpha-glycerphosphate. Arch. Biochem. Biophys.
349:27–35.
Smith, L., Keefe, D.O., Smith, M., & Hamill, S. (2003). The benefits of applying rhizobacteria
to tissue cultured bananas. Banana Topics Newsletter 33: 1–4.
Soliman, S., Seeda, M.A., Aly, S.S.M., & Gadalla, A.M., (1995). Nitrogen fixation by wheat
plants as affected by nitrogen fertilizer levels and nonsymbiotic bacteria. Egyptian J. Soil
Sci. 35: 401–413.
Sperberg, J.I. (1958).The incidence of apatite-solubilizing organisms in the rhizosphere and
soil. Aust J. Agric. Res. 9:778.
Steijl, H., Niemann, G.J., & Boon, J.J. (1999). Changes in chemical composition related to
fungal infection and induced resistance in carnation and radish investigated by pyrolysis
mass spectrometry. Physiol. Mol. Plant Pathol. 55: 297–311.
Stein, T., Hayen-Schneg, N., & Fendrik, I. (1997). Contribution of BNF by Azoarcus sp. BH72
in Sorghum vulgare. Soil Biol. Biochem. 29: 969-971.
Stephan, M.P., Oliveira, M., Teixeira, K.R.S., Martinez-Drets, G., & Dobereiner, J. (1991).
Physiology and dinitrogen fixation of Acetobacter diazotrophicus. FEMS Microbiol Lett
77: 67–72
Sundara Rao, W.V.B., & Sinha, M.K. (1963). Phosphate dissolving microorganisms in the soil
and rhizosphere. Indian J. Agric. Sci. 33:272–8.
Tanii, A., Takeuchi, T., & Horita, H. (1990). Biological control of scab, black scruff and soft
rot of potato by seed bacterization.. In: D.Hornby, R.J.Cook, and Y. Henis (Eds.),
Biological Control of Soil-Borne Plant Pathogens. pp. 143–146, CAB International,
Oxford, UK,
Thaller, M.C., Berlutti, F., Schippa, S., Iori, P., Passariello, C., & Rossolini, G.M. (1995).
Heterogeneous patterns of acid phosphatases containing low-molecular-mass polipeptides
in members of the family Enterobacteriaceae. Int. J. Syst. Bacteriol. 4:255–261.
108 M. Madhaiyan, S. Poonguzhali, M. Senthilkumar et al.

Thrane, C., Olsson, S., Nielsen, T.H., & Sorensen, J. (1999). Vital fluorescent strains for
detection of stress in Pythium ultimum and Rhizoctonia solani challenged with
viscosinamide from Pseudomonas fluorescence DR54. FEMS Microbial. Ecol. 30: 11-23
Tim Dyson. (1999). World food trends and prospects to 2025. Proc. Natl. Acad. Sci. USA
96: 5929–5936
Timmusk, S., & Wagner, E.G.H. (1999). The plant-growth-promoting rhizobacterium
Paenibacillus polymyxa induces changes in Arabidopsis thaliana gene expression: a
possible connection between biotic and abiotic stress responses. Mol. Plant Microbe
Interact. 12: 951–959.
Tran Van, V., Berge, O., Ngo, K.S., Balandreau, J., & Heulin, T. (2000). Reproducible
beneficial effects of rice inoculation with a strain of Burkholderia vietnamiensis on early
and late yield components in low fertility sulphate acid soils of Vietnam. Plant Soil 218:
273–284.
Trewavas, A.J. (2001). The population/biodiversity paradox: agricultural efficiency to save
wilderness. Plant Physiol. 125: 174–179
Turner, J.T., & Blackman, P.A. (1991). Factors related to peanut yield increases following
Bacillus subtilis seed treatment. Plant Dis. 75: 347–353.
Urquiaga, S., Cruz, K.H.S., & Boddey, R.M. (1992). Contribution of nitrogen fixation to sugar
cane: nitrogen-15 and nitrogen-balance estimates. Proc. Soil Sci. Soc. Am. 56: 105–114
Utkhede, R.S., & Smith, E.M. (1992). Promotion of apple tree growth and fruit production by
the EBW-4 strain of Bacillus subtilis in apple replant disease soil. Can. J. Microbiol. 38:
1270–1273.
Van Bruggen, A. H. C., Semenov, A. M., & Zelenev, V. V. (2002).Wavelike distributions of
infections by an introduced and naturally occurring root pathogen along wheat roots.
Microbial. Ecol. 44: 30–38.
Vande Broek, A., & Vanderleyden. J. (1995). The role of bacterial motility, chemotaxis, and
attachment in bacteria-plant interactions. Mol. Plant-Microbe Interact. 8: 800–810.
van Loon, L.C. (1997). Induced resistance in plants and the role of pathogenesis-related
proteins. European J. Plant Pathol. 103: 753–765.
van Peer, R., Niemann, G.J., & Schippers, B. (1991). Induced resistance and phytoalexin
accumulation in biological control of Fusarium wilt of carnation by Pseudomonas sp.
WCS417r. Phytopathol. 81: 728–734.
Vázquez, P. (1996). Bacterias solubilizadoras de fosfatos inorgánicos asociadas a la rhizosfera
de los mangles: Avicennia germinans (L.) L y Laguncularia racemosa (L.) Gerth. Tesis
para el título de Biologo Marino. Univ. Autónoma de Baja California Sur. La Paz, B.C.S.
México.
Vessey, J. K. (2003). Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:
571–586.
Verma, S.C., Ladha, J.K., & Tripathi, A.K. (2001). Evaluation of plant growth promoting and
colonization ability of endophytic diazotrophs from deep water rice. J. Biotechnol. 91:
127-141.
Vlassak, K., Van Holm, L., Duchateau, L., Vanderleyden, J., & De Mot, R. (1992). Isolation
and characterization of fluorescent Pseudomonas associated with the roots of rice and
banana grown Sri Lanka. Plant Soil 145: 51–63.
 Responses of Agronomically Important Crops to Inoculation… 109

Voisard, C., Keel, C., Haas, D., & Defago, G. (1989). Cyanide production by Pseudomonas
fluorescens helps suppress Black Root Rot of tobacco under gnotobiotic conditions.
EMBO J. 8: 351–358.
Wang, C.K.E., Glick, B.R., & Defago, G. (2000). Effect of transferring 1-aminocyclopropane-
1-carboxylic acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHA0 and
its gacA derivative CHA96 on their growth-promoting and disease-suppressive capacities.
Can. J. Microbiol. 46:898–907
Wardle, D. A. (2002). Communities and Ecosystems; Linking the Aboveground and
Belowground Components. Princeton Univ. Press, Princeton, NJ.
Welbaum, G.E., Sturz, A.V., Dong, Z., & Nowak, J. (2004). Managing soil microorganisms to
improve productivity of agro-ecosystems. Crit. Rev. Plant Sci. 23: 175–193.
Whipps, J.M. (1997). Development in the biological control of soil borne plant pathogens.
Adv. Bot. Res. 26: 1-134
Yanni, Y.G., & El-Fattah, F.K.A. (1999). Towards integrated biofertilization management with
free living and associative dinitrogen fixers for enhancing rice performance in the Nile
delta. Symbiosis 27: 319–331.
Yanni, Y.G., Rizk, R.Y., Corich, V., Squartini, A., Ninke, K., Philip-Hollingsworth, S.,
Orgambide, G., de Bruijn, F., Stoltzfus, J., Buckley, D., Schmidt, T.M., Mateos, P.F.,
Ladha, J.K., & Dazzo, F.B. (1997). Natural endophytic association between Rhizobium
leguminosarum bv. trifolii and rice and assessment of its potential to promote rice growth.
Plant Soil 194: 99–114.
Yuen, G.Y., Schroth, M.N., & McCain, A.H. (1985). Reduction of Fusarium wilt of carnation
with suppressive soils and antagonistic bacteria. Plant Dis. 69: 1071–1075.
Zabetakis, I. (1997). Enhancement of flavour biosynthesis from strawberry (Fragraria
ananassa) callus cultures by Methylobacterium species. Plant Cell Tissue Organ Cult. 50:
179-183.
Zahir, Z.A., Arshad, M., & Frankenberger, W.T. (2003). Plant growth promoting
rhizobacteria: applications and perspectives in agriculture. Adv. Agron. 81: 97–168.
Zakria, M., Njoloma, J., Saeki, Y., & Akao, S. (2007). Colonization and nitrogen-fixing ability
of Herbaspirillum sp. strain B501 gfp1 and assessment of its growth-promoting ability in
cultivated rice. Microbes Environ. 22: 197-206.
Zhang, F., & Smith, D.L., (1996). Genistein accumulation in soybean (Glycine max (L.) Merr.)
root systems under suboptimal root zone temperatures. J. Exp. Bot. 47: 785–792.
Zheng, X. Y., & Sinclair, J .B. (1996). Chemotactic response of Bacillus megaterium strain
B153-2-2 to soybean root and seed exudates. Physiol. Mol. Plant Pathol. 48: 21–35.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 3

EFFECT OF ABIOTIC STRESSES ON GROWTH,

METABOLIC ALTERATIONS AND TOLERANCE
MECHANISMS IN RICE CROP

a
Pallavi Sharma, bAmbuj Bhushan Jha and R. S. Dubey1
Department of Biochemistry, Faculty of Science
Banaras Hindu University
Varanasi-221005, India

1. ABSTRACT
Rice is a staple food crop for the majority of world population. Abiotic stressful
conditions of the environment such as salinity, drought, heat, chilling, anaerobiosis, metal
toxicity impose limitations on productivity of rice in the regions which are prone to such
constraints. The manifestations of these stresses include non-expression of full genetic
potential, differential transcription of many genes, induction of stress responsive genes
leading to cellular metabolic changes, alteration in activity behaviours of many enzymes,
overproduction of several compatible metabolites like amino acids, sugars, polyamines,
phytochelatins, organic acids, increased synthesis of many enzymes and stress specific
proteins. Salinity and drought are prime stressful conditions for rice crop in arid and semi
arid regions of the world. Changes in temperature rhythm impose heat or chilling injury.
Soil flooding or submergence causes oxygen deprivation leading to anaerobic stress. Metal
ions such as Pb, Cd, Hg, As, Ni are key pollutants of the soil, whereas Al toxicity is a
problem in acid upland soils. Most of the abiotic stresses cause overproduction of reactive
oxygen species (ROS) within the cell which cause oxidative damage to membranes and
biomolecules. Increased accumulation of compatible solutes, overproduction of
antioxidative enzymes, overexpression of transcription factors have been shown to confer

1 Corresponding author: Dr. R. S. Dubey, Department of Biochemistry, Faculty of Science, Banaras Hindu
University, Varanasi-221005, India, E-mail: rsdbhu@rediffmail.com, Tel.: +91-542-2317190; Fax: +91-542-
2368174
aPresent Address: Department of Plant Sciences, College of Agriculture and Bioresources, University of
Saskatchewan, 51 Campus Drive, Saskatoon, SK S7N 5A8, Canada
bPresent Address: Department of Food and Bioproduct Sciences, College of Agriculture and Bioresources, University of
Saskatchewan, 51 Campus Drive, Saskatoon, SK S7N 5A8, Canada
112 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

tolerance in rice plants to a wide range of stresses like salinity, drought and low
temperature. Stress induced gene products those involved in stress tolerance and those
involved in signal transduction or as transcription regulators have served as basis to
engineer stress tolerant plants. To contribute to food security and sustainability in rice
production, it is essential to produce stress tolerant rice plants suitable for cultivation in
stress prone areas. This needs a detail understanding of physiological and molecular
mechanisms associated with stress tolerance more specially gene products involved in
stress tolerance and signal transduction. Transcriptome profiling of rice seedlings has
helped in great way in understanding how rice plants respond to abiotic stresses.
Successful attempts have been made to produce transgenic rice plants tolerant to different
abiotic stresses. However, with the rapid progress in the areas of functional genomics,
proteomics and metabolomics a more improved understanding of novel stress responsive
genes and their expression under various stresses is anticipated which will provide the
basis of new strategies to produce genetically engineered rice plants tolerant to a single or
multiple of abiotic stresses.

2. INTRODUCTION
Rice, a staple crop for over half of the world population, is sensitive to a variety of abiotic
stresses (Lafitte et al., 2004a; Gao et al., 2007). Rice-growing areas span over the tropics,
subtropics, semi-arid tropics, and temperate regions of the world (Gorantla et al., 2007). These
areas are often threatened by severe abiotic stresses, including drought, salinity, extremes of
temperature, anaerobiosis, excessive levels of heavy metals, gaseous pollutants, irradiation,
etc. (Figure 1). Abiotic stresses (singly or in combination) cause both general and specific
detrimental effects on plant growth and development, and finally lead to reduced crop yield. At
the whole plant level, the effect of stress is usually perceived as a decline in photosynthesis
and growth associated with alteration in carbon and nitrogen metabolism (Dubey and Singh,
1999; Kumar et al., 2000; Feng et al., 2003; Chen et al., 2004; Jha and Dubey, 2004a, b;
Sharma and Dubey, 2005a; Moradi and Ismail, 2007; Mishra and Dubey, 2008a). One
characteristic cellular feature evident under abiotic stresses is the high production of reactive
oxygen species (ROS) in the chloroplasts, mitochondria and peroxisomes, which cause
irreversible cellular and tissue damages. Rice plants respond and adapt to variable
environmental conditions with a wide range of cellular and metabolic alterations that are
triggered by signaling and regulatory pathways (Shah and Dubey, 1998a; Shah et al., 2001;
Sharma and Dubey, 2004, 2005a, b, 2007; Rohila and Yang, 2007; Cho et al., 2008; Kumar et
al., 2008). Plants perceive the signals from environment and transmit them in a specific
manner to the genetic machinery in the nucleus to regulate the response to abiotic stresses.
Post-translational modifications of proteins play a key role in different signaling cascades. The
phosphorylation/dephosphorylation of proteins by specific protein kinases/phosphatases
modulate the activities of specific signaling molecules, resulting in signal amplification (Luan,
2003; Mishra et al., 2006; Kumar et al., 2008). Signal transduction cascade regulate gene
expression in a temporal and spatial pattern, leading to changes at the metabolic, physiological
and biochemical levels. These changes lead to adaption of rice plants to these stresses, thus
enabling the plants to survive.
 Effect of Abiotic Stresses on Growth… 113

Figure 1. Aboitic stresses such as drought, salinity, heat, chilling, metal toxicity, gaseous pollutants, UV-
B radiation are major constraints to rice production. Rice cultivars that are tolerant to aboitic stresses
tolerate abiotic stresses whereas sensitive rice cultivars suffer from productivity loss.

Significant number of genes, gene products, and pathways associated with abiotic
response and adaptation have been identified in rice using a variety of experimental
approaches (Shah and Dubey, 1998a; Sharma and Dubey, 2004, 2007; Kumar et al., 2008;
Kawakami et al., 2008; Wang et al., 2009).
Most common responses to abiotic stresses in rice plants include induction of stress-
responsive gene expression (Gorantla et al., 2007), anatomical and morphological changes
(Caldwell et al. 1998; Matsui and Omasa, 2002; Feng et al., 2003), cellular metabolic changes
(Shah et al., 1995, 1997a, 1998a; Shah et al., 2001; Jha and Dubey, 2004a, b, c, 2005; Sharma
and Dubey, 2005a, b, 2007), overproduction of several compatible organic solutes termed
osmoprotectants or osmolytes and synthesis of stress-specific proteins (Dubey and Rani, 1989;
Shah and Dubey, 1998a, b, d; Sharma et al., 2005a; Lee et al., 2007; Kawakami et al., 2008;
Wang et al., 2009). Figure 2 shows the most common responses to abiotic stress in rice plants.
In our quest to achieve sustainable food production, abiotic stresses seem to present major
challenge. Generally plants respond to low and moderate levels of abiotic stresses, but when
the intensity of stress increases, physiological mechanisms imparting tolerance to plants start
breaking down which ultimately may result into plant death (Tayal et al., 2004). Development
of crop plants tolerant to environmental stresses appears to be a promising approach to help
satisfy growing food demands of the developing and under-developed nations where abiotic
stresses are severe constraints to crop productivity. Decades of breeding and selection have
resulted in limited improvements of stress tolerance in rice and other crops largely due to the
physiological and genetic complexities involved (Zhang et al., 2006). The advances in
physiology, genetics, and molecular biology have greatly improved our understanding of the
mechanisms of responses to abiotic stresses in rice.
114 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Figure 2. Some of the common responses of rice plants to abiotic stresses.

Though considerable progress has been made in the improvement of transgenic rice for
abiotic stress tolerance yet the achievements are not promising. Progress is now anticipated
through comparative genomics studies of an evolutionarily diverse set of model organisms,
and through the use of techniques such as high-throughput analysis of expressed sequence
tags, large scale parallel analysis of gene expression, targeted or random mutagenesis, and
gain-of-function or mutant complementation. The identification of novel genes in rice,
determination of their expression patterns in response to the stresses, and an improved
understanding of their functions in stress adaptation (obtained by the use of functional
genomics) will provide us the basis of effective engineering strategies to generate rice plants
with enhanced tolerance to a single or multiple abiotic stresses in order to enhance the yield of
this crop (Rabbani et al., 2003).
The present review focuses on our current status of knowledge related to the effect of
various abiotic stresses on growth and metabolism of rice plants and components associated
with abiotic stress tolerance. Further the strategies adopted for improving stress tolerance in
rice plants have also been discussed.

3. ABIOTIC STRESSES AND THEIR IMPACT ON GROWTH

AND METABOLISM IN RICE PLANTS

Abiotic stresses such as drought, salinity, heat, chilling, excess levels of heavy metals,
gaseous pollutants, frequently limit growth and productivity of rice crop (Saini and Westgate,
2000; Yan et al., 2006; Yang et al., 2008). These conditions can delay growth and
development, reduce yield and, in extreme cases, can inflict lethal injuries to the rice plants.
Adverse effects of environmental stresses have been noted both during vegetative and
reproductive growth stages in rice plants (Sarvestani et al., 2008). Process leading to seedling
emergence, growth of the seedling, flower development and quality of seeds are critically
affected by these stresses. The cellular organelles like plasma membrane, mitochondria and
endoplasmic reticulum are known to be severely affected in response to adverse environmental
conditions (Pareek et al., 1997). The major events of plant response to abiotic stresses are
perception and transduction of the stress signals through signaling components resulting in the
 Effect of Abiotic Stresses on Growth… 115

activation of a large number of stress related genes and synthesis of diverse functional proteins
that finally lead to various physiological and metabolic responses. The responses to a specific
stress may vary with the genotype; nevertheless, some general reactions occur in all genotypes.
Some of the most common responses which are triggered in rice plants subjected to different
abiotic stresses include alteration in gene expression, anatomical and morphological changes,
decreased efficiency of photosynthesis, reduced N assimilation capacity, alterations in plasma
membrane characteristics, cellular metabolic changes, overproduction of several metabolites,
altered activities of several key enzymes, increased synthesis of stress induced novel proteins,
etc. In the following sections common abiotic stresses and their effects on growth and
metabolism in rice plants has been described.

a) Drought

Drought is an imminent threat to food security. Water deficit occurs when land plants
absorb less water from their roots compared to that transpired (evaporated) from their leaves
resulting in reduction of relative water content, cell volume and cell turgor (Lawlor and
Cornic, 2002). The frequency of such phenomena is likely to increase in the future even
outside today’s arid/semi-arid regions (Chaves et al., 2002). Water deficit adversely affects a
range of key metabolic processes in plants like normal synthesis of proteins and nucleic acids,
photosynthesis, respiration, nitrogen assimilation, etc. which may ultimately result in poor
growth of plants and reduction in yield (Dubey, 1994). Plant responses to water deficit are
complex, involving deleterious and/or adaptive changes, and under field conditions these
responses can be synergistically or antagonistically modified by the superimposition of other
stresses (Chaves et al., 2002).
Rice productivity is severely affected due to recurrent droughts in almost all
agroecological zones of the world (Gorantla et al., 2007). Growth and development of rice
plants can be detrimentally impaired by water deficit at anytime during its life cycle. However,
the damage from water deficit is particularly exacerbated if the stress occurs during the
meiosis stage of male gametophyte development in the anthers (Saini and Westgate, 2000).
The effects of water deficit on pollen formation and related events in rice anthers were
investigated by Giao and coworkers (2007). A reduction of grain set and decline in
concentration of the adenosine-5'-triphosphate (ATP) pool in rice anthers in water stressed rice
plants compared to the controls was recorded. Decline in the concentration of the ATP pool
could possibly cause programmed cell-death (PCD) and adverse effects on ATP dependent
processes in the cells which could be the physiological causes for the loss of viable pollens.
Water stress detrimentally affects flower induction, pollen production and subsequently leads
to failure of fertilization and hence grain set (Sheoran and Saini, 1996). Water stress at
vegetative stage of rice plants was found to significantly reduce plant height due to decrease in
photosynthesis rate and dry matter accumulation (Sarvestani et al., 2008) whereas at flowering
stage imposition of greater water stress caused a reduction in grain yield due to reduction in
fertile panicle and filled grain percentage. Total biomass, harvest index, plant height, filled
grain, unfilled grain and 1000 grain weight were reduced under water stress in all rice cultivars
studied (Sarvestani et al., 2008). Plant root is the most important organ for uptake of water,
therefore it plays important role in tolerance to osmotic and drought stresses (Zombori et al.,
2008). Rice reacted to drought stress with changes in root dry matter and rooting depth. Rice
116 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

roots grew deeper under drought stress (Asch et al., 2005). Under drought, aerobic genotypes
were more tolerant than the irrigated lowland genotypes due to their higher ability to maintain
nodal root production, elongation, and branching, thus, less reduction in dry matter production.
Aerenchyma was also formed in droughted roots regardless of genotypes. The inability of
roots to acclimate to drought stress results in reduced growth and function thereby reduced dry
matter production (Suralta and Yamauchi, 2008).
Plants act in response to drought stresses through perception and transduction of the stress
signals through signaling components, leading to activation of a large number of stress related
genes and synthesis of diverse functional proteins that finally lead to various physiological and
metabolic responses (Shinozaki et al., 2003; Seki et al., 2003). Osmotic stress activates several
protein kinases including mitogen-activated kinases, which may mediate osmotic homeostasis
and/or detoxification responses. A number of phospholipid systems are activated by osmotic
stress, generating a diverse array of messenger molecules, some of which may function
upstream of the osmotic stress–activated protein kinases (Zhu, 2002). Abscisic acid (ABA) is
thought to be involved in the signal transduction. Evidence exists demonstrating the presence
of both ABA-independent and ABA-dependent regulatory systems governing drought-
inducible gene expression (Yamaguchi-Shinozaki and Shinozaki, 2005). Rice roots are known
to produce signals in response to progressive drought, which regulate leaf stomatal
conductance (Gs) and transpiration (Tr) and shoot growth (Siopongco et al., 2008). The
increase in leaf ABA concentration under field drought, and its strong association with soil
moisture tension and Gs, suggested its involvement in mediating stomatal responses during
early drought in rice (Siopongco et al., 2008). Water stress leads to following sequence of
responses of the rice leaves (i) rise in ABA content, (ii) closure of stomata, (iii) initiation of
leaf rolling (Henson, 1982). Leaf diffusive resistance and degree of leaf rolling were found to
be linearly related to leaf water potential. Stomatal resistance was found to increase more on
the abaxial than the adaxial leaf surface in rice cultivars. At the grain filling stage of early rice,
the Gs, Tr and Gs/Tr ratio fluctuated insignificantly under mild and moderate water stress,
while photosynthetic rate and leaf water use efficiency increased significantly, with an increase
in grain yield under mild water stress (Chen et al., 2005). Cabuslay and coworkers (2002)
demonstrated the greater sensitivity of leaf enlargement to water stress than dry matter
accumulation. Rice cultivars tolerant to mild water stress were found to have relatively high
rate of transpiration, low initial leaf area, high carbon isotope discrimination in the leaf, and
low specific leaf weight. These factors enabled tolerant cultivars to maintain high moisture in
the leaf and to have high values of leaf area, shoot dry matter and sugar as well as starch in the
tissues of stressed plants relative to the controls. Mild water deficit increased water use
efficiency in stressed plants and caused more degradation of starch than sugar in the leaf blade,
and resulted in more accumulation of these carbohydrates in the leaf sheath (Cabuslay et al.,
2002).
Activities of photosynthetic O2 evolution, Hill reaction, photophosphorylation and Ca2+-
ATPase and ATP content were significantly reduced in chloroplasts from flag leaves of rice
plants subjected to water stress (Chen et al., 2004). The membrane lipid content especially
sulfoquinovosyl-diacylglycerol and phosphatidylglycerol also declined. The changes in the
ultrastructure of chloroplasts included mainly a decrease in number of grana and increase in
number of osmiophilic granules. Yamane and coworkers (2004) found that the ultrastructural
changes of chloroplasts in bundle sheath cells were more prominent than those in mesophyll
cells of rice plants under drought stress treatments. Contents of ribulose-1,5-bisphosphate
 Effect of Abiotic Stresses on Growth… 117

carboxylase (RUBISCO) reduced more dramatically in bundle sheath chloroplasts than in

mesophyll chloroplasts under drought stress. Thylakoids were less affected by drought stress
than chloroplast envelope (Yamane et al., 2004). Impairment of enzymes of sugar metabolism
and starch synthesis were suggested to be among the potential causes of pollen sterility and
inhibition of starch accumulation in water-stressed rice plants (Sheoran and Saini, 1996). Fast
hydrolysis of starch and increased carbon remobilization observed in rice under water stress
was attributed to the enhanced α-amylase activity and the high activation state of sucrose
phosphate synthase (SPS) (Yang et al., 2001).
The rate of dark respiration in rice plants increased in a normal light and dark cycle with
mild water stress whereas overall conversion efficiency (the ratio of grain dry-matter against
the gross carbohydrate input to the construction and maintenance processes) decreased. With
increasing water stress a decrease in respiration rate was observed (Kobata and Takami et al.,
1986). Photorespiration is associated with metabolism through the glycolate pathway (Tolbert,
1971). It was observed that increasing the duration of water-deficit-stress produced a
proportional decrease in relative reduced glycolate content and catalase (CAT) activity, but
increased glycolate oxidase activity, hydrogen peroxide (H2O2) and glyoxylate contents in the
leaves of rice plants (Goyal, 1986). Rice seedlings subjected to severe water stress showed
adverse effects on nitrogen assimilation. A marked decline in the levels of both NRact (Nitrate
reductase activity in the presence of Mg2+ representing the non-phosphorylated NR state) and
NRmax (Nitrate reductase activity in the presence of EDTA representing maximum NR
activity) and almost unaltered NR activation were observed by Sharma and Dubey (2005a) in
water stress seedlings. The accumulation of ammonium in detached rice leaves under water
stress has been observed which is attributed to a decrease in glutamine synthetase (GS)
activity. Ammonium accumulation in detached rice leaves, induced by water stress, was
accompanied by an increase in tissue sensitivity to ethylene which, in turn, accelerated leaf
senescence (Lin and Kao, 2000).
Amplified fragment length polymorphism (AFLP) analysis of cDNA identified 103
transcript-derived fragments corresponding to differentially induced genes in a tolerant rice
variety upon water-deficit stress. Most of the transcripts identified genes were related to
metabolism, energy, protein biosynthesis, cell defense, signal transduction and transport
(Rodriguez et al., 2006). Gorantla and coworkers (2007) identified genes associated with
water-stress response in rice using expressed sequence tags (ESTs) generated from a
normalized cDNA library, constructed from drought-stressed leaf tissue of an indica cultivar
Nagina 22. Comparison of leaf stress responsive genes (SRGs) to expression profiles for a
drought-stressed rice panicle library identified some common sequences. A total of 125 genes
were found to be expressed under drought stress in both tissues. The functional classification
of these 125 genes showed that the majority of them were associated with cellular metabolism,
signal transduction and transcriptional regulation (Gorantla et al., 2007). With the advent of
molecular and genomic technologies, emphasis is now being placed on understanding the
mechanisms of genetic control of the drought-stress response. To elucidate genome-level
responses to drought in rice, a 70 mer oligomer microarray covering 36,926 unique genes or
gene models was used to profile genome expression changes in rice shoot, flag leaf and panicle
under drought conditions. Drought stress appears to alter the expression patterns of a
significant number of genes involved in transcription and cell signaling in a largely organ-
specific manner. The promoter regions of genes induced by drought stress possess relative
118 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

enrichment of two cis-elements (ABRE core and DRE core) known to be associated with water
stress (Zhou et al., 2007).
An experiment was conducted to compare the mRNA expression difference in rice leaves
and roots under drought stress and normal conditions using fluorescent differential display
method. NADPH oxidoreductase gene expression level was found to be higher under drought
stress than that under normal conditions in rice leaves and roots (Chen et al., 2006a). Rice
seedlings subjected to drought showed increased concentration of superoxide anion (O2·−),
increased level of lipid peroxidation showing oxidative stress, chlorophyll bleaching, loss of
antioxidants [ascorbate (AsA), glutathione (GSH), α-tocopherol and carotenoids], total soluble
protein and thiols (Boo and Jung, 1999; Sharma and Dubey, 2005b; Bai et al., 2006). Various
studies related to the identification of components of water stress tolerance in rice suggest that
tolerance to water stress is associated with a co-ordination of physiological and biochemical
alterations at the cellular and molecular level such as the accumulation of various osmolytes,
polyamines and induced synthesis of stress specific proteins specially late embryogenesis
abundant proteins (LEAs) coupled with an efficient antioxidative defense system.

b) Salinity

Salinity is a widespread soil problem limiting productivity of cereal crops worldwide. The
United Nations Environment Program estimates that approximately 20% of agricultural land in
the world is salt-stressed (Flowers and Yeo, 1995). In saline soils predominant salts include
chlorides and sulphates of sodium, magnesium and calcium. NaCl is the more prevalent salt in
saline soils due to its exceptionally high solubility in water. High salinity causes hyperosmotic
stress and ion disequilibrium that produce secondary effects (Hasegawa et al., 2000; Zhu,
2001). The chemical potential of the saline solution initially establishes a water potential
imbalance between the apoplast and symplast that leads to turgor decrease, which if severe
enough can cause growth reduction (Bohnert et al., 1995). Processes such as seed germination,
seedling growth and vigour, vegetative growth, flowering and fruit set are adversely affected
by high salt concentration, ultimately causing diminished economic yield and also quality of
produce. In general, electrical conductivity of saturated soil extract (ECe) of 4.0 deciSiemens
per meter (dS-1m) is considered as a lower limit to define saline soils. Rice and most grain
crops are glycophytes that show stress symptoms and reduced yield even when the ECe is
lower than 4.0 dS-1m (~40 mmol/L NaCl). The salinity threshold for rice is 3.0 dS-1 m with a
12% reduction in yield per dS-1 m beyond this threshold (Maas, 1990). Sensitivity of rice to
salinity stress varies with the growth stage. Rice is considered to be relatively more salt
tolerant at germination (Heenan et al., 1988; Khan et al., 1997). Seed germination is not
significantly affected up to salinity level of 16.3 dS m-1 (Heenan et al., 1988). Rice is
particularly sensitive to salinity during the seedling stage, with consequent poor crop
establishment, as well as during reproduction stage, where salinity can severely disrupt grain
formation and yield (Moradi and Ismail, 2007). From an agronomic point of view, tiller
number determined at vegetative stage and numbers of spikelets per panicle determined at
panicle initiation stage have been regarded as the most salinity-sensitive yield components in
rice genotypes (Zeng and Shannon, 2000). Salinity imposes both ionic and osmotic stresses on
plants (Munns et al., 2006). Yamane and coworkers (2003) suggested that in salt-treated rice
plants, the ionic effects induced swelling of thylakoids and the osmotic effects caused the
 Effect of Abiotic Stresses on Growth… 119

destruction of chloroplast envelope. According to these workers salt-induced injury in

chloroplasts is dependent on light and that increased production of H2O2 and ·OH are
responsible for the deleterious effects of salt stress on chlorophyll content and chloroplast
ultrastructure.
Pareek and coworkers (1997) analyzed short-term salt stress-induced subcellular
alterations in undifferentiated leaf cells of rice seedlings. The subcellular changes evoked by
salinity stresses after 4 h were plasmolysis, lysis of the cytoplasm, accumulation of electron-
dense granules in the cytoplasm, distension in the endoplasmic reticulum membranes,
enhanced association of ribosomes with the endoplasmic reticulum, reduction in the number of
mitochondrial cristae, increased cytoplasmic vesiculation as well as disorganization of cell wall
fibrillar material (Pareek et al., 1997). Salt can induce programmed cell death (PCD) in rice
root tip cells (Li et al., 2006). NaCl treatment could lead to specific features of PCD in root
tips, such as DNA ladder formation nuclear condensation and deformation and transferase
mediated dUTP nick end labeling positive reaction, which were initiated at 4 h of treatment
and progressed thereafter. Cytochrome c release from mitochondria into cytoplasm was also
observed, which occurred at 2 h and was prior to the above nuclear events. In very early phase
of PCD, an immediate burst in H2O2 and O2·− production rate was accompanied by two-phase
changes of superoxide dismutases (SOD) and ascorbate peroxidase (APX) activities. A short
period of increase in the activity was followed by prolonged impairment (Li et al., 2006).
Salinity leads to decreased efficiency of photosynthesis. Net photosynthesis was inversely
correlated with the sodium concentration in the rice leaf tissues. There was no evidence of a
threshold effect; net photosynthesis declined linearly with increasing leaf sodium concentration
(Yeo et al., 1985). Dionisio-Sese and Tobita (2000) suggested that the decline in net
photosynthetic rate, measured in terms of CO2 assimilation of the youngest fully expanded leaf
of four rice varieties, might be due to a direct effect of salt on stomatal resistance via a
reduction in guard cell turgor. The relationship between transpiration rate and leaf sodium
concentration paralleled closely that for photosynthesis. Photosynthesis was reduced by half at
a sodium concentration in the leaf which did not reduce the concentration of chlorophyll.
Moradi and Ismail (2007) observed decreased photosynthetic CO2 fixation, Gs and
transpiration rate in rice plants due to salt stress, with greater reduction in the sensitive cultivar
IR29 than in the tolerant lines IR651 and IR632. The tolerant lines IR651 and IR632 had more
responsive stomata that tended to close faster during the first few hours of stress, followed by
partial recovery after a brief period of acclimation. However, in the sensitive line, Gs continued
to decrease for longer duration and with no recovery afterwards. Chlorophyll fluorescence
measurements revealed that non-photochemical quenching increased, whereas the electron
transport rate decreased under salt stress (Moradi and Ismail, 2007). The sucrose metabolizing
enzymes SPS and acid invertase show varying behaviours in activity in crop cultivars differing
in salt tolerance when raised in saline medium (Dubey and Singh, 1999). Nitrate assimilation
is reduced in plants growing in saline medium, however salt tolerant plants tend to maintain
higher N assimilation efficiency than the sensitive plants. Among the enzymes of nitrate and
ammonia assimilation NR and GS are more prone to inhibition under salinity, more inhibitory
effect is observed in salt sensitive cultivars than in tolerant ones when raised under similar
salinity levels (Katiyar and Dubey, 1992; Richharia et al., 1997; Kumar and Dubey, 1999).
Increased rate of proteolysis in salt-stressed rice seedlings and an association of salt-tolerance
ability with higher protease and aminopeptidase activities and lower carboxypeptidase activity
under salinisation were suggested by Dubey and Rani (1990). Varying behaviour of the
120 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

dehydrogenases malate dehydrogenase (MDH) and glutamate dehydrogenase (GDH) is

observed when two sets of rice cultivars differing in salt tolerance are raised in saline medium
(Kumar et al., 2000). Inhibition in the activities of dehydrogenases, NR and GS as well as
reduced photosynthetic activity in salt sensitive rice cultivars due to salinity appear to be key
contributory factors for the decreased growth of plants under saline conditions (Katiyar and
Dubey, 1992; Dubey and Singh, 1999; Kumar et al., 2000).
In lamina of rice 32 proteins were observed to be significantly regulated by salinity and so
far 11 of these proteins were identified by tandem mass spectrometry. An increase in the level
of eight proteins, including RUBISCO activase and ferritin, occurred by 24 h of exposure to
NaCl (50 mM) and it continued to increase during the following 6 d. Only one protein, a
putative phosphoglycerate kinase, was found to increase in expression within 24 h and it did
not increase over a longer period of exposure to salt. There were also proteins that showed no
change after 24 h exposure to salt. In such cases an increased SOD or decreased S-adenosyl-L-
methionine synthetase was observed after 7 d salt treatment (Parker et al., 2006). As rice is
most sensitive to salinity during the reproductive stage, proteomic approach was employed to
further investigate the mechanism of plant responses to salinity at an early reproductive stage.
The expression pattern of 13 proteins significantly changed in all panicle sizes in response to
stress. These proteins were involved in several salt responsive mechanisms which may
increase plant adaptation to salt stress including higher constitutive expression level and up-
regulation of antioxidants, up-regulation of proteins involved in translation, transcription,
signal transduction, and ATP generation (Dooki et al., 2006). The signaling processes in plants
that initiate cellular responses to biotic and abiotic factors are believed to be located in the
plasma membrane (PM). A better understanding of the PM proteome response to
environmental stresses might lead to new strategies for improving stress-tolerant crops.
Comparative two-dimensional electrophoresis revealed that 24 proteins were differentially
expressed in response to salt stress. These include protein related to regulation of PM pumps
and channels, membrane structure, oxidative stress defense, signal transduction, protein
folding, etc. (Sahar et al., 2007). Studies have suggested a critical role of protein
phosphorylation in salt stress response in plants. However, the phosphoproteome in rice,
particularly under salinity stress, has not been well studied. Chitteti and Peng (2007) studied
rice phosphoproteome differential expression under salt stress. Seventeen differentially
upregulated and 11 differentially downregulated putative phosphoproteins were identified.
Further analyses indicated that 10 of the 17 upregulated proteins are probably upregulated at
post-translational level instead of the protein concentration. While eight of them are known
salt stress responsive proteins, many of them have not been reported earlier in the literature
(Chitteti and Peng, 2007).
Results suggest that in response to high salinity stress in rice, various genes get
upregulated, the products of which are involved either directly or indirectly in plant protection.
Some of the genes encoding enzymes of antioxidant defense system, osmolytes, polyamines,
ion channels and receptors are able to confer salinity-tolerance phenotypes when transferred to
sensitive plants. Overall, the sensitivity or tolerance to high salinity in plants is a coordinated
action of multiple stress responsive genes, which also cross talk with other components of
stress signal transduction pathways. High salinity exerts its negative impact mainly by
disrupting the ionic and osmotic equilibrium of the cell. Mechanisms of salinity tolerance
involve sequestration of Na+ and Cl− in vacuoles of the cells, blocking of Na+ entry into the
cell, Na+ exclusion from the transpiration stream, and some other mechanisms that help in
 Effect of Abiotic Stresses on Growth… 121

salinity tolerance. Understanding these mechanisms of stress tolerance, along with a plethora
of genes involved in the stress signaling network, is important to improve high salinity stress
tolerance in crops plants (Tuteja, 2007).

c) Chilling

Chilling and freezing temperatures are major constraint that limits the productivity and the
geographical distribution of many important crops species including rice (Yan et al., 2006).
Poor seedling vigor and fertility, and consequent reductions in yield have been major problems
provoked by cold conditions. In rice, chilling sensitivity is one of the main features of the
genotypic diversity among varieties, and is one of the major factors limiting its production at
high altitude and in temperate or subtropical regions. Rice can perceive chilling stress signals
by putative sensors and can transmit them to the cellular machinery by signal transduction to
regulate gene expression. Through regulation of transcription, RNA processing, translation,
and protein processing, changes in the abundance and activities of functional proteins involved
in redox homeostasis, photosynthesis, photorespiration, and metabolisms of carbon, nitrogen,
sulfur and energy occur in rice plants. Redox homeostasis can also act as signals. These
processes might work cooperatively to establish a new cellular homeostasis under chilling
stress (Yan et al., 2006). Cold tolerance during germination is important for ensuring fast and
uniform establishment of rice crop early in the season (da Cruz et al., 2006). For rice,
temperatures lower than 20°C decrease both the speed and percentage of germination
(Yoshida, 1981) and result in lower crop stands and higher production costs. The first visible
symptom of rice seedling damage caused by chilling is wilting, and prolonged low
temperatures result in complete dehydration of the leaves. It is thought that transpiration
exceeds the rate of water absorption through the root system under low temperature conditions,
causing a loss of turgor in leaf tissues (Kabaki and Tajima, 1981; Kawakami et al., 2008).
Chilling during male gametophyte development in rice inhibits development of microspores,
causing male sterility. Changes in cellular ultrastructure observed under mild chilling include
microspores with poor pollen wall formation, abnormal vacuolation and hypertrophy of the
tapetum and unusual starch accumulation in the plastids of the endothecium in post-meiotic
anthers. Anthers observed during tetrad release also show callose (1,3-β-glucan) wall
abnormalities as shown by immunocytochemical labelling. Expression of rice anther specific
monosaccharide transporter (OsMST8) is greatly affected by chilling treatment (Mamun et al.,
2006).
Rolling of leaves, increased relative electrolyte leakage and decreased net photosynthetic
rate are observed in rice plants subjected to chilling treatment (Yan et al., 2006). Chilling
induced higher electrolyte leakage in rice leaves was also reported by Bertin and coworkers
(1996). Chilling temperatures resulted in light-dependent loss of photosynthetic electron
transport in chilling-sensitive rice varieties. Analysis of in vivo chlorophyll fluorescence in
chilling-sensitive rice suggests that low temperatures cause an increased reduction of the
plastoquinone pool that could result in photoinhibitory damage to the photosystem II reaction
centers. Chilling temperature inhibited protein phosphorylation in rice (Moll et al., 1987).
Jeong and coworkers (2002) observed that when rice leaves were exposed to various low
temperatures with illumination (150 μmol m-2 s-1) for 6 h, the leaf photosynthesis of chilling
122 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

sensititve rice cultivar decreased faster than that of chilling tolerant rice cultivar. The light-
chilling induced differential photoinhibition of photosynthesis between the two cultivars was
suggested to be caused by the photon-activation of PSII but not of PSI, since the potential
quantum yield of PSII followed a similar trend to the changes in photosynthetic rates. Among
various genes associated with sucrose metabolism the transcript levels of SPS significantly
decreased in sensitive rice cultivar by light-chilling stress compared to tolerant cultivar. Based
on these results, Jeong and coworkers (2002) proposed that PSII, not PSI, is the sensitive site
for light-chilling stress in chilling-sensitive rice. Several proteins show enhanced degradation
during chilling stress. The large subunit of photosynthetic enzyme protein RUBISCO showed
19 fragments due to chilling stress (Yan et al., 2006).
Low temperatures affect protein and RNA metabolism in leaves of rice seedlings. Hahn
and Walbot (1989) found that while de novo accumulation of several abundant proteins was
suppressed, some polypeptides were consistently found to be cold-induced. Synthesis of
RUBISCO was drastically reduced after 7 days of cold treatment. Using immunoprecipitation
of RUBISCO, evidence was obtained that the suppression was greater for the small subunit
(over 90%) than for the large subunit (80%), indicating a partial loss of coordination in their
synthesis. Cold-sensitive rice cultivars responded with drastic changes in the protein synthesis
pattern when compared to cold-tolerant varieties under cold stress. Chloroplast functions are
disturbed during cold stress. The levels of chloroplast-encoded mRNAs, especially
photosystem I reaction center polypeptide (psaB), and of the nuclear encoded chlorophyll a/b
binding protein decreased drastically in the cold. One nuclear gene known to be induced by
water stress and ABA (Rab21) was also found to be induced by cold treatment (Hahn and
Walbolt, 1989). Rice plants exposed to low temperatures showed a decrease in CO2
assimilation rate without photoinhibition, and increases in the fraction of thermal dissipation in
PSII and in the electron flux through the water-water cycle (WWC). Hirotsu and coworkers
(2004) concluded that although low temperature led to a decrease in CO2 assimilation, rice
potentially could cope up with the excess light energy by increasing the thermal dissipation
and the electron flux of WWC under low temperature irrespective of leaf development and
genotypes (Hirotsu et al., 2004).
To investigate the responses of rice to cold stress, changes in protein expression were
analyzed using a proteomic approach. Slight changes in stress responsive proteins were clearly
displayed, and four proteins were newly detected after cold stress. From identified proteins, it
was concluded that proteins related to energy metabolism were up-regulated and defense-
related proteins were down-regulated in leaf blades by cold stress (Hashimoto and Komatsu,
2007). A few days of cold treatment (< 20°C) at the young microspore stage induced severe
pollen sterility and large grain yield reductions. In an experiment using cold-sensitive cultivar
Doongara and relatively cold-tolerant cultivar HSC55 it was observed that the abundance of 37
anther proteins changed more than 2-fold after 1, 2, and 4 days of cold treatment in cv.
Doongara. Among these, one protein was newly induced, 32 protein spots were up-regulated,
and four protein spots were down-regulated. Of these 37 protein spots, two were identified as
anther-specific proteins (putative lipid transfer protein and Osg6B) and a calreticulin that were
down-regulated and a cystine synthase, a β-6 subunit of the 20 S proteasome, an H protein of
the glycine cleavage system, cytochrome c oxidase subunit VB, an osmotin protein
homologue, a putative 6-phosphogluconolactonase, a putative adenylate kinase, a putative
cysteine proteinase inhibitor, ribosomal protein S12E, a caffeoyl-CoA O-methyltransferase and
a monodehydroascorbate reductase (MDHAR) that were up-regulated (Imin et al., 2006).
 Effect of Abiotic Stresses on Growth… 123

Rice is more chilling sensitive at the onset of microspore release. Chilling treatment at this
stage causes male sterility. The gene expression profile during the microspore development
process under chilling stress revealed that as many as 160 cDNAs were up- or down-regulated
due to chilling during the microspore release stage. RT-PCR analysis of 5 genes OPDAR (12-
oxo-phytodienoic acid reductase), SAMDS (s-adenosyl methionone decarboxylase), Radc (rice
anther down-regulated by chilling), OsSalT (salt tolerant protein) and Act1 (Rice actin 1)
confirmed the microarray results (Yamaguchi et al., 2004). Roots are regarded as highly
sensitive organs to abiotic stresses in plants. To gain a better knowledge of the chilling stress
responses of plants, it is imperative to analyze the tissue-specific proteome patterns under
chilling stress. Proteomic analysis of the rice roots is an important step towards
characterization of differentially expressed proteins and elucidation of the mechanisms
underlying the stress effects (Hashimoto and Komatsu, 2007). Lee and coworkers (2009)
identified a number of chilling stress-responsive proteins such as aconitate hydratase, glycine
dehydrogenase, heat shock protein (HSP-70), calreticulin precursor, oxalyl-co-A
decarboxylase, ubiquitin conjugation enzyme, enolase, cysteine synthase, and cytoplasmic
MDH, which had also been previously identified in the proteomic analysis of rice or other
plant species in response to cold stress. A group of novel proteins were also identified
including acetyl transferase, phosphogluconate dehydrogenase, NADP-specific isocitrate
dehydrogenase, fructokinase, putative α-soluble N-ethylmaleimide-sensitive factor (NSF)
attachment protein, and glyoxalase. These proteins are involved in several cellular processes,
including energy production and metabolism, vesicular trafficking and detoxification etc. (Lee
et al., 2009).
Plants respond to low temperature through an intricately coordinated transcriptional
network. C-repeat binding factors (CBFs) also known as dehydration-responsive element
binding proteins (DREB) are transcription factors in plants involved in response to low
temperature. The CBF/DREB-regulated network of genes has been shown to play a prominent
role in freezing tolerance through the process of cold acclimation (CA). DREB1/CBF cold-
responsive pathway is conserved in rice and the DREB1-type genes are quite useful for
improvement of stress tolerance to low temperature in transgenic rice plants (Ito et al., 2006).
Cheng and coworkers (2007) used rice cultivars with wide contrast in chilling sensitivity
between indica and japonica rice as model to identify other regulatory clusters by integrative
analysis of promoter architecture (ab initio) and gene expression profiles. A hypothetical
model of an ROS-mediated regulon (ROS-bZIP-as1/ocs) triggered by chilling stress was
assembled in rice. Based on these results, it appears that this regulon is independent of ABA
and CBF/DREB, and that its activation has an important contribution in configuring the rapid
responses of rice seedlings to chilling stress.
Various genes encoding osmolytes, polyamine, regulatory proteins, including mitogen-
activated protein kinases, calcium-dependent protein kinases, and 14-3-3 proteins have been
shown to be up-regulated in response to low temperature. In addition, families of transcription
factors, the CBF/DREB1 proteins, have been identified in rice that control the expression of a
regulon of cold-induced genes that increase plant freezing tolerance.
124 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

d) Heat

As sessile organisms, plants are constantly exposed to changes in temperature rhythm.

Temperatures high and hot enough for sufficient time cause irreversible
damage to plant function and development and lead to extensive agricultural
losses (Mittler, 2006). With the predicted increase in global air temperature induced by the
greenhouse effect, plant responses to increasing temperatures have become a major area of
concern (Gunderson et al., 2000; Rustad et al., 2001). Heat stress disturbs cellular homeostasis
and can lead to severe retardation in growth and development and even death. The heat stress
response is characterized by inhibition of normal transcription and translation, higher
expression of heat shock proteins (HSPs) and induction of thermotolerance. If stress is too
severe, signaling pathways leading to apoptotic cell death are also activated (Krishna, 2003).
Many physiological factors could be involved in heat stress injury. For example, heat stress
inhibits photosynthesis, limits partitioning of carbohydrates and can damage cell membranes
leading to cell death (Abernethy et al., 1989; Liu and Huang, 2000; Tang et al., 2007).
High temperature stress adversely affects growth and development of rice plants. Izumi
and coworkers (2007) observed decline in rice yield when mean air-temperature exceeded
28°C (Izumi et al., 2007). A variable degree of increase in germination percentage, seedling
growth in terms of root and shoot lengths, water uptake, respiration and activities of hydrolytic
enzymes viz. α-amylase, adenosine triphosphatase (ATPase) and phytase and a positive
correlation between seedling vigour and hydrolase activities were observed in rice seedlings
treated for 30 min at 50°C compared to control. The treatment for 30 min at 60°C, on the other
hand, elicited a retarding influence on these characters. As regards the enzyme activities, the
damaging effect of 60°C could, however, be visualized only after 72 h of germination which
was preceded by an enhancement during the early hours (Mukherjee et al., 1971). The
subcellular changes in rice plant provoked by heat stress after 4 h of treatment were lysis of the
cytoplasm, accumulation of electron-dense granules in the cytoplasm, distension in the ER
membranes, enhanced association of ribosomes with the endoplasmic reticulum, reduction in
the number of mitochondrial cristae, as well as disorganization of cell wall fibrillar material.
Discontinuity in the plasma membrane with close association of the osmiophilic granules were
observed in response to high temperature (Pareek et al., 1997). Flowering (anthesis and
fertilization) and to a lesser extent booting (microsporogenesis) are more sensitive stages in the
life cycle of rice plants to high temperatures (Farrell et al., 2006). Rice is grown mainly in
tropical and subtropical zones and a high temperature at flowering can induce floret sterility
and limit grain yield (Matsushima et al., 1982). The effect of high temperature at anthesis on
spikelet fertility was studied on IR64 (lowland indica) and Azucena (upland japonica) rice
varieties at different tissue temperatures. In IR64, high temperature increased the number of
spikelets reaching anthesis, whereas in Azucena numbers were reduced. In both genotypes ≤ 1
h exposure to ≥ 33.7°C at anthesis caused sterility (Jagadish et al., 2007). Percentage fertility is
negatively correlated with the number of cell layers that separated the anther locule from the
lacuna that formed between the septum and the stomium. Anther dehiscence requires the
rupture of the cell layers. Matsui and Omasa (2002) concluded that the tight closure of the
locules by the cell layers delayed locule opening and decreased fertility at high temperatures in
rice (Matsui and Omasa, 2002). Tang and coworkers (2008) observed a marked decrease in
pollen activity, pollen germination and floret fertility in rice due to high temperature treatment,
however, the high temperature tolerant rice cv. Shanyou 63 showed a much slower rate of
 Effect of Abiotic Stresses on Growth… 125

decrease than the high temperature sensitive cv. Teyou 559. A possible correlation between
pollen viability/floret sterility and high temperature-caused changes in indole-3-acetic acid
(IAA), gibberellic acids (GAs), ABA, free proline and soluble protein contents was observed
by Tang and coworkers (2008). High temperature during the grain-filling stage causes
deleterious effects on the yield and quality of crop products (Peng et al., 2004). Temperature
above certain growth-optimal temperatures impairs dry matter production, generally
decreasing grain size in all major cereal crops, such as rice. Such small grains result in not only
decreased yield but also low milling quality. For japonica cultivars of rice, temperatures higher
than 26°C render chalky grain appearance as well as reduction of grain weight (Yamakawa et
al., 2007). To elucidate the effect of high temperature on grain-filling metabolism, Yamakawa
and coworkers (2007) exposed developing rice caryopses to high temperature (33°C/28°C) or
control temperature (25°C/20°C) during the milky stage. Comprehensive gene screening
revealed that several starch synthesis-related genes, such as granule-bound starch synthase I
(GBSSI) and branching enzymes, especially BEIIb, and a cytosolic pyruvate orthophosphate
dikinase gene were down-regulated by high temperature, whereas those for starch-consuming
α-amylases and HSPs were up-regulated. Biochemical analyses of starch showed that the high
temperature-ripened grains contained decreased levels of amylose and long chain-enriched
amylopectin, which might be attributed to the repressed expression of GBSSI and BEIIb,
respectively. SDS-PAGE and immunoblot analysis of storage proteins revealed decreased
accumulation of 13-kD prolamin, which is consistent with the diminished expression of
prolamin genes under elevated temperature (Yamakawa et al., 2007).
Stomatal diffusive conductances of 35°C treated rice plants were found to be significantly
higher than 25°C treated plants (Yang and Heilman, 1991). Relationship between
photosynthetic responses to high temperature at the whole-plant level and sensitivity of light
reactions, the most labile systems, to brief heat treatment was determined by Al-Khatib and
Paulsen (1999). Photosynthetic rates of protoplasts and chloroplasts from all rice species
decreased after being treated in vitro with high temperature. Photosystem II (PSII) activity
declined steadily in protoplasts, chloroplasts, and thylakoids of rice when treated from 22 to
42°C. The results suggest that differences in photosynthetic responses to high temperature are
associated with light reactions. Several components of the photosynthetic apparatus and
associated metabolic processes are heat labile. At a temperature of 40°C, specific activity of
RUBISCO and the titre of RUBISCO holoenzyme are increased or remained unaffected, while
at 45°C, the specific activity and holoenzyme level were more stable in the tolerant cultivar
than in the sensitive one. In both cultivars, a decline in activity and holoenzyme level with
time was pronounced at 50°C (Bose and Ghosh, 1995). Photosystem PSI and PSII mediated
photoreactions of thylakoids isolated from the seedlings exposed to high temperature did not
differ significantly from the thylakoids isolated from control seedlings (25°C). The high
irradiance induced loss in PSII activity and increased lipid peroxidation measured in terms of
malondialdehyde production was more rapid in thylakoids isolated from stressed seedlings as
compared to that of control seedlings. Thus the thylakoids isolated from the stressed seedlings
were more prone to photodamage than those from the controls (Vani et al., 1996).
Effects of high temperature on amylose concentration and amylopectin fine structure in
endosperm were found to depend on the genotypes of rice studied. High temperature caused a
reduction in amylose concentration and an increase in the short chain (CL< 22) proportion of
amylopectin for cv. Jia 935 (showing low amylose concentration); while opposite was true for
cv. Jia 353 (showing high amylose concentration). Accumulation rate of amylose was
126 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

significantly and positively correlated with glycine betaine accumulation for Jia 935, but not
for Jia 353. Amylose accumulation was also significantly and positively correlated with the
activities of starch-debranching enzyme (SDBE), starch branching enzyme (SBE), ADP-
glucose pyrophosphorylase and sucrose synthase (SS) for both varieties. Rice grain quality is
also affected with the environmental temperature it experiences. At higher temperature the
decreased activity of starch branching enzyme reduces the branching frequency of the
branches of amylopectin, which results in the increased amount of long chains of amylopectin
of endosperm in rice grain at high temperature (Jiang et al., 2003).
Proteins are essential to rice caryopsis development and quality formation. High
temperature is an important environmental factor, which may decrease grain quality. Rice
caryopsis proteins profiled by two-dimensional polyacrylamide gel electrophoresis showed 70
proteins that were differentially expressed. Total of 54 proteins were identified with known
functions. Of these, 21 were involved with carbohydrate metabolism, 14 with protein synthesis
and sorting, and 9 with stress responses. High temperature decreased the expression of waxy
(Wx) proteins, allergen-like proteins, and elongation factor 1β, but increased the expression of
small heat shock proteins (sHSPs), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and
prolamin. sHSPs formation was positively correlated with the appearance of chalky kernels.
During development, glutelins were phosphorylated and glycosylated, indicating that these
molecules were post-translationally modified (Lin et al., 2005). Rice leaf proteome in response
to heat stress was investigated by Lee et al. (2007). Increased relative ion leakage and lipid
peroxidation was observed which suggested that oxidative stress was frequently generated in
rice leaves exposed to high temperature. Among 73 differentially regulated proteins under heat
treatment, total of 48 proteins were identified. These proteins were categorized into classes
related to HSPs, energy and metabolism, redox homeostasis, and regulatory proteins. A group
of low molecular weight HSPs was newly induced by heat stress (Lee et al., 2007). Four of the
differentially accumulated proteins that corresponded to antioxidant enzymes were analyzed at
the mRNA level and it was confirmed that increased gene expression occurred for these
proteins. Expression of a group of proteins called heat shock proteins HSPs is increased when
the plants are exposed to elevated temperatures. These HSPs have diverse range of molecular
weights ranging from 20-30 kDa to high 120 kDa.
In order to cope up with heat stress, plants tend to develop various mechanisms, such as
maintenance of membrane stability, scavenging of ROS, production of antioxidants,
accumulation of compatible solutes, induction of mitogen-activated protein kinase (MAPK)
and calcium-dependent protein kinase (CDPK) cascades, as well as most importantly
chaperone signaling and transcriptional activation. All these mechanisms, which are regulated
at the molecular level, enable plants to thrive under heat stress (Wahid et al., 2007). Enhanced
production and accumulation of free and conjugated polyamines as well as increased activities
of their biosynthetic enzymes in rice plants have been associated with heat stress (Roy and
Ghosh, 1996).

e) Metal Toxicity

Metal contamination is a major global environmental problem, threatening the health of

wildlife, humans and plants (Salt et al., 1998; Taiz and Zeiger, 1998; Shah and Dubey, 1998a;
Sharma and Dubey, 2007). Metal concentrations in soil range from less than 1 mg/kg (ppm) to
 Effect of Abiotic Stresses on Growth… 127

as high as 100,000 mg/kg (Blaylock and Huang, 2000). Rice plants exposed to high levels of
metals in the soil environment typically accumulate these metals in their tissues (both in roots
and shoots), often to toxic levels that decrease growth and alter metabolic functions (Shah and
Dubey, 1995, 1998b; Verma and Dubey, 2003; Jha and Dubey, 2004a; Liu et al., 2007;
Maheshwari and Dubey, 2007; Sharma and Dubey, 2007). Absorbed metal has been shown to
be distributed in an organ specific manner with its localization greater in roots than in shoots
indicating that the roots are the primary sites of metal accumulation and only small quantities
of metals are transported or accumulated in the shoots (Shah and Dubey, 1995, 1998b; Verma
and Dubey, 2003; Jha and Dubey, 2004a; Maheshwari and Dubey, 2007; Sharma and Dubey,
2007). Metals like Cd, Cu, Pb, As, Al and Ni have been reported to decrease the germination
percentage of rice seeds and reduce the length of root as well as shoot of rice seedlings (Shah
and Dubey, 1995, 1998b; Verma and Dubey, 2003; Jha and Dubey, 2004a; Ahsan et al., 2007;
Maheshwari and Dubey, 2007; Sharma and Dubey, 2007). Muramoto (1989) suggested the
order of metal toxicity to rice plants is CdO>ZnO>PbO. Concentration of 10,000 ppm Cd in
the form of CdO is the critical one towards rice plant. By contrast, such damage was not
observed at even higher levels of ZnO and PbO and hence these metals were considered to
have low toxicity toward rice plant (Muramoto, 1989).
A wide array of metabolic alterations is seen in metal stressed plants. Rice plants grown in
nutrient medium containing metals show a significant decrease in water content as a
consequence of the stress (Ahsan et al., 2007; Llamas et al., 2008). The plasma membrane of
root cells constitutes the first barrier between cytoplasm and metal in the soil and therefore
plasma membrane gets rapidly affected by metals. Addition of Ni2+ to the solution bathing the
roots induced a concentration-dependent PM depolarization but the activity of the PM-H+-
ATPase was not inhibited by the presence of Ni2+. In the long term (days) a drastic loss of K+
was observed in roots and shoots, which could be responsible for the changes in the water
content measured, since stomatal conductance and the transpiration rate remained unaffected
by Ni2+ treatment. The effects induced by Ni2+ were not permanent and could be reverted, at
least in part, by transferring the plants to a medium without Ni2+ (Llamas et al., 2008). Rice
plants grown in presence of Cd, Pb, Al show increased generation of ROS and oxidative stress
marked by increased lipid peroxidation and protein oxidation (Shah et al., 2001; Verma and
Dubey, 2003; Sharma and Dubey, 2007; Ahsan et al., 2008).
Metals perturb carbohydrate metabolism and impair their partitioning in growing rice
plants. The effect of increasing concentrations of Cd, As and Al in situ on the content of
starch, sugars and activity behaviour of enzymes related to their metabolism were studied in
rice seedlings (Verma and Dubey, 2001; Jha and Dubey, 2004b; Mishra and Dubey, 2008a).
All three metals in the growth medium caused an increase in the contents of starch, total sugars
as well as reducing sugars in roots as well as shoots of the rice seedlings. The activities of the
enzymes of starch hydrolysis α-amylase, β-amylase declined, whereas the activities of sucrose
hydrolyzing enzymes sucrose synthase (SS) and acid invertase increased in the rice seedlings
due to these metals. The enzyme of sucrose synthesis, SPS showed decreased activity in Cd,
As as well as Al treated seedlings compared to controls. Enhanced activity of starch
phosphorylase enzyme was observed in As stressed rice seedlings (Jha and Dubey, 2004b).
Results indicated that these metals in rice seedlings caused perturbations in carbohydrate
metabolism leading to the accumulation of soluble sugars by altering enzyme activities in the
rice seedlings. Under metal toxicity sucrose synthase possibly appears to play a positive role in
synthesis of sucrose (Jha and Dubey, 2004b). A marked decline in nitrogen assimilation due to
128 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

inhibition in the activities of the nitrate assimilatory enzymes nitrate reductase (NR), nitrite
reductase (NiR) and glutamine synthethase (GS) is observed in rice seedlings subjected to As
toxicity, whereas an increase in the transamination reactions marked by elevated activities of
alanine and aspartate aminotransferases is observed under such conditions (Jha and Dubey,
2004a). Inhibition in the activities of N assimilatory enzymes accompanied with decreased
affinity of the enzymes towards their substrates is suggested to eventually lead to a marked
suppression of N assimilation and impaired growth of rice seedlings in As polluted
environment (Jha and Dubey, 2004a). Shah and Dubey (1995) observed increase in RNase
activity in rice seedlings due to moderate Cd treatment level of 100 μM, whereas higher Cd
level of 500 μM was inhibitory to the enzyme. Maheshwari and Dubey (2007) suggested that
nickel toxicity in rice seedlings suppresses the hydrolysis of RNA and proteins by inhibiting
the activity of ribonuclease (RNase) and protease, respectively. Suppression of proteolytic
activity marked by decreased activities of protease and peptidase was observed due to Cd
treatments in germinating rice seeds leading to altered levels of protein and amino acids (Shah
and Dubey, 1998b). An increase in the level of RNA, proteins and proline accompanied with a
decline in the level of free amino acid pool was observed in rice seedlings under As
supplementation compared to controls (Mishra and Dubey, 2006). Arsenic caused marked
decline in activities of RNase, protease and leucine aminopeptidase (LAP) whereas the activity
level of carboxypeptidase was enhanced (Mishra and Dubey, 2006). Cd impairs phosphorus
metabolism in plants (Shah and Dubey, 1998c). The increased concentration of As led to the
decrease in phosphate content in plant organs (Milivojevic et al., 2003; Mishra and Dubey,
2008b). Mishra and Dubey (2008b) suggested that exposure of rice plants to arsenite leads to
lowering of the phosphate pool and alteration in the activities of key phosphohydrolytic
enzymes which might contribute to metabolic perturbations and decreased growth of rice
plants in an As (III) polluted environment. Tissue specific inhibition of the activities of
phosphatases both under in situ and in vitro conditions has been observed due to Cd in
growing plants (Shah and Dubey, 1998c). Decrease in activity as well as synthesis of acid
phosphatase isoforms in embryoaxes of Cd-treated germinating rice seeds limit the energy
need of germinating seeds thereby decreasing the vigour of establishing seedlings (Shah and
Dubey, 1997b). A decline in the level of total phosphate pool along with inhibition in the
activities of phosphorolytic enzymes acid phosphatase, alkaline phosphatase and inorganic
pyrophosphatase appear to be one of the key reasons for decreased metabolic activity and
inhibited growth of rice plants grown under high Cd levels (Shah and Dubey, 1998c).
Drastic changes in high-resolution two-dimensional electrophoresis protein patterns of rice
leaf after treatment with Cu, Cd and Hg over control were found, including changes in the
morphology of the leaf segments. Changes in the major leaf photosynthetic protein, RUBISCO
(both suppression and fragmentation), and induction of synthesis of some of the proteins are
reported under metal toxicity. Most of the proteins showed homology to RUBISCO protein,
and some to defense/stress-related proteins, like the pathogenesis related class 5 protein
(OsPR5), the probenazole-inducible protein (referred to as the OsPR10), SOD, and the oxygen
evolving protein. Results indicated a highly specific action of some of these metals in
disturbing the photosynthetic machinery, as evidenced by prominent reductions/fragmentation
of the major photosynthetic protein RUBISCO (Hajduch et al., 2001).
Seed germination is a complex physiological process in plants that can be affected
severely by excessive level of metals. Protein profile alternations during the germination stage
following exposure to Cd has been studied. Seeds exposed to wide range of Cd concentration
 Effect of Abiotic Stresses on Growth… 129

revealed increased Cd accumulation in seeds and increased lipid peroxide content, whereas
germination rate, shoot elongation, biomass and water content decreased significantly. When
temporal changes of the total proteins were investigated by two-dimensional electrophoresis,
21 proteins including proteins involved in defense and detoxification, antioxidant, protein
biosynthesis and germination processes were found to be upregulated at least 1.5-fold in
response to Cd stress (Ahsan et al., 2007). Very little information is available regarding As
stress-elicited changes in plants at the proteome level. Arsenic treatment to rice plants resulted
in increases of As accumulation, lipid peroxidation, and in vivo H2O2 contents in roots. A total
of 23 As-regulated proteins including predicted and novel ones were identified. Results
suggested that S-adenosylmethionine synthetase (SAMS), cysteine synthase (CS), glutathione
S transferases (GSTs) and glutathione reductase (GR) presumably work synchronously
wherein GSH plays a central role in protecting cells against As stress (Ahsan et al., 2008).
Gene expression in response to Cu stress in rice leaves was quantified using DNA microarray
and real-time PCR technology. Microarray analysis flagged 305 Cu-responsive genes, and
their expression profile showed that a large proportion of general and defense related genes
were up-regulated under excess Cu conditions, whereas photosynthesis and transport-related
genes were down-regulated. Results indicated that defense-related genes involved in
phytoalexin and lignin biosynthesis were the most sensitive to Cu and that plant management
of abiotic and pathogen stresses has overlapping components, possibly including signal
transduction (Sudo et al., 2008). Rice plants possess a range of potential cellular mechanisms
that may be involved in the detoxification of heavy metals and thus tolerance to metal stress.
These include constitutively high levels or increased synthesis of antioxidant enzymes to cope
up with the oxidative stress caused due to excessive level of metals, release of extracellular
exudates reduced uptake or efflux pumping of metals at the plasma membrane; synthesis of
peptides such as phytochelatins or metallotheionin for chelation of metals in the cytosol, repair
of stress-damaged proteins compartmentation of metals in the vacuole by tonoplast-located
transporters, etc.

f) Gaseous Pollutants

Plants react to changes in the composition of the atmosphere. It is estimated that the levels
of several gaseous components like SO2, NO2, ozone (O3) will increase within the biosphere in
the near future. Plants are much more susceptible for gaseous air pollutants than humans and
animals. Air pollutants penetrate in plants mainly through skin pores. Through the skin pores
gases can penetrate cell walls and get absorbed by the cell fluids. Some of the gaseous air
pollutants directly damage plant leaves when they penetrate into plant cells. This can cause the
leaves of plants and trees to lose their colour, or even leaves die off. It can also cause plant
growth to stagnate. The leaves and stems may slack and curl up. Ozone is one of the major
gaseous pollutants detrimental to crop growth and metabolism (Yang et al., 2008). Ozone
enrichment causes visible injury symptoms and affects photosynthesis, water relationship,
phenology, dry matter production and allocation, leaf membrane protective system and grain
yield as well as its components in rice seedlings (Yang et al., 2008). When adverse effects of
phytotoxic levels of ambient ozone on growth and yield of two rice cultivars were studied a
clear difference in the sensitivity of the two cultivars was found. A yield reduction of 6.3%
was observed in a cultivar MR 185 (p< 0.01) which was largely due to an increase in grain
130 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

sterility, whilst the yield reduction in cultivar MR 84 was not statistically significant (Ishii et
al., 2004). Ozone leads to decrease in dry matter of rice plants. Changes in dry matter can be
accounted due to a decrease or increase in the relative growth rate (RGR). The changes in the
RGR caused by ozone could be mainly attributed to the effect of ozone on the net assimilation
rate. Root/shoot ratio of rice plants was lowered by ozone treatment throughout the exposure
period. Time-course changes in NH4-N root uptake rate were similar to that of the root/shoot
ratio on ozone exposure (Nouchi et al., 1991).
Effects of ozone on rice growth processes were addressed in terms of light use of plants
exposed to ozone in field exposure chambers (Kobayashi and Okada, 1995). While no effects
of ozone on light absorption were found, the light use efficiency was decreased due to ozone
exposure. The effect of ozone on light use efficiency was much greater in the reproductive
than in the vegetative stage (Kobayashi and Okada, 1995). Integrated transcriptomics,
proteomics and metabolomics approaches were applied to investigate the molecular responses
of ozone in the leaves of 2 week old rice seedlings. A total of 1535 nonredundant genes
showed altered expression of more than 5-fold over the control, representing 8 main functional
categories. Genes involved in information storage and processing (10%) and cellular
processing and signaling categories (24%) were highly represented within 1 h of ozone
treatment (Cho et al., 2008). Proteomics analyses identified 23 differentially expressed protein
spots (21 nonredundant proteins) in rice leaves exposed to ozone for 24 h compared to
respective control. Identified proteins were found to be involved in cellular processing and
signaling (32%), photosynthesis (19%), and defense (14%). Metabolomic profiling revealed
accumulation of amino acids, gamma-aminobutyric acid, and GSH in ozone exposed leaves
until 24 h over control. This systematic survey showed that ozone triggers a chain reaction of
altered gene, protein and metabolite expressions involved in multiple cellular processes in rice
plants (Cho et al., 2008). Ozone induced synthesis of defense/stress-related proteins in the
leaves of two-week-old rice seedlings, as evidenced by high-resolution two-dimensional
electrophoresis. These inductions by ozone were preceded by very early (within minutes) and
specific changes in the phosphorylation status of proteins, including the appearance of new
phosphoproteins, over the unchanged filtered pollution free air control. Furthermore, a protein
of approximately 66-kDa in leaf extracts showed strong and specific cross-reaction with an
anti-MAPKinase (ERK1) antibody, and whose levels increased within 5 min of ozone
exposure, over its decrease in control, which suggests possible involvement of ERK-type
MAPKs in the ozone-elicited self-defense response pathways in rice (Agrawal, 2002).
Moreover, in-gel kinase assay revealed rapid activation of a 48-kDa myelin basic protein-
phosphorylating activity by ozone in seedling leaves over control. It is concluded that the
activation of kinase-signaling cascades downstream of ozone perception in rice seedlings
might be involved in as self defense responses (Agrawal, 2002).
Exposure of rice plants to low concentrations of O3 and SO2 singly and in combination
showed foliar injury of different levels. The maximum leaf injury was noted in case of O3+SO2
treated plants and the minimum in O3 treated ones. Also the reductions in chlorophyll a,b and
total chlorophyll and carotenoid contents in leaves exposed to O3+SO2 mixtures were higher
than the reduction noted in case of each individual pollutant. Thus the results suggest existence
of a synergism between O3 and SO2 related to plant injury, especially with respect to
chlorophyll and carotenoid contents of rice (Agrawal et al., 1982). Highly damaging effect of
air pollutant SO2 and SO2 triggered multiple events linked with defense/stress response in the
leaves of rice seedlings (Rakwal et al., 2003). Distinctive reddish-brown necrotic spots and
 Effect of Abiotic Stresses on Growth… 131

interveinal browning were observed on the leaf surface after exposure to SO2, over control,
partly reminiscent of the hypersensitive reaction lesions. Sodium dodecyl sulfate-
polyacrylamide gel electrophoresis and immunoblotting analysis revealed strong induction of
ascorbate peroxidase (APX) and changes in cysteine proteinase inhibitors (‘phytocystatins’)-
like proteins. Employing classical two-dimensional electrophoresis followed by amino acid
sequencing, induced accumulation of a pathogenesis-related (PR) class 5 (OsPR5) protein,
three PR 10 class proteins (OsPR10s), a novel ATP-dependent CLP protease and an unknown
protein was observed. Subsequent northern analysis showed accumulation of OsPR5 and
OsPR10 transcripts in leaves. Finally, mass spectrometry analysis revealed a strong production
of phytoalexins, sakuranetin and momilactone A in SO2 stressed leaves (Rakwal et al., 2003).
Various mechanisms of tolerance to ozone have been suggested. Stomatal regulation is
important in controlling gas influx into the leaf mesophyll and can help to exclude ozone from
entering the leaves (Fiscus et al., 2005). Moreover, several ROS defense systems exist in
plants, which can counteract oxidative damage caused by ozone. Among these defense systems
are the ROS scavenging enzymes SOD, CAT and peroxidases, as well as a network of low
molecular mass antioxidant compounds, such as AsA, GSH, phenolic compounds, and
tocopherols (Blokhina et al., 2003). Activities of the enzymes SOD, APX, GR and POD were
significantly higher in a sensitive rice cultivar TN 1 than in the tolerant cultivar TNG 67
subjected to ozone treatment (Lin et al., 2001). It is suggested that the genotypic variation for
these tolerance mechanisms can be exploited for breeding ozone tolerant crop varieties (Frei et
al., 2008).

g) Anaerobiosis

Plants depend on the supply of molecular oxygen from their environment in order to
support respiration and various other life-sustaining oxidations reactions (Vartapetian and
Jackson, 1997). Exposure to oxygen deficits is more widespread in biological systems than it is
commonly believed. Since excessively wet soils are common in large areas of the world, poor
soil aeration is an important practical problem facing both agriculture and forestry. Soil
flooding, or more complete submergence, is the most common environmental cause of oxygen
deprivation for vascular plants. Flooding is a recurrent phenomenon in several lowland rice-
growing areas in India and elsewhere. Rice is the only major crop plant that can grow well in
flooded conditions. However, rice plants are severely injured when submerged totally in water
for several days (Ram et al., 2002; Jackson and Ram, 2003). Nearly 25% of the world’s rice
(i.e. 38 million hectares) is cultivated in the rainfed lowland ecosystem. However, the produce
from rainfed lowland ecosystem accounts for only 17% of the global rice supplies (Mohanty et
al., 2000). Growth and survival during submergence of rice is affected by partial (hypoxia) or
complete loss (anoxia) of O2. Reduced supply of O2 and CO2 as well as reduced C2H4 diffusion
limit respiratory activities, photosynthesis and have a negative impact on elongation and
growth of rice plants. Submergence of plants inhibits aerobic respiration and photosynthesis
and stimulates a variety of responses that can enhance survival, such as a switch from aerobic
to anaerobic respiration. Rice seeds can germinate in the complete absence of oxygen. Under
anoxia, the rice coleoptile elongates, reaching a length greater than that of the aerobic one.
Two cultivars (‘FR13A’ and ‘Kurkaruppan’) already known to tolerate submergence, differed
little from submergence-intolerant ‘IR42’ in their relative growth rate and soluble carbohydrate
132 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

concentration during submergence (Jackson et al., 1987). Complete submergence almost

stopped the accumulation of dry matter, depressed soluble carbohydrate concentration by over
75% and promoted chlorosis in fully expanded leaves. Increase in fresh weight by the shoots
was not impaired. Extension by the youngest visible leaf was stimulated but extension by the
next leaf to appear was retarded by submergence. However, underwater leaf extension of
cultivar ‘FR13A’ and ‘Kurkaruppan’ was less than in ‘IR42’. Greater leaf extension and
chlorosis of submerged plants could be attributable to accumulated ethylene (Jackson et al.,
1987).
Compared with coleoptiles from air-grown seedlings, anaerobically grown coleoptiles had
depressed cytochrome oxidase activity and a much lower capacity for respiratory oxygen
uptake. Since a high crista density develops in rice coleoptile mitochondria with a very much
depressed cytochrome oxidase activity, there is no obligate correlation between crista density
and cytochrome oxidase activity in this tissue (Opik, 1973). Mitochondrial structures appear to
proliferate in rice seedlings even when plants are grown under anoxic conditions from dry
seed. Fox and Kennedy (1990) found that the activities of the tricarboxylic acid cycle enzymes
succinyl-CoA synthase and citrate synthase were similar in aerobically and anaerobically
grown seedlings, whereas the activities of 2-oxoglutarate dehydrogenase complex, aconitase,
isocitrate dehydrogenase, and fumarase were reduced in anaerobic seedlings. The rate of
succinate oxidation and succinate dehydrogenase activity have been reported to be lower in
mitochondria from rice seedlings grown submerged but increased during adaptation to air.
When in rice seedlings the function of mitochondria under 6 days of anoxia following 1 day of
air adaptation were compared with mitochondria isolated from 7-day aerobically grown
seedlings, it was observed that the mitochondria isolated from anoxia grown seedlings respired
very slowly compared to air-adapted and air-grown seedlings. Activity analysis showed that
respiratory oxidases markedly increased in activity during the air adaptation of seedlings. The
abundance of cytochrome c1 oxidase complex, assembled b/c complex, total heme content,
cytochrome absorbance spectra, and the electron carrier cytochrome c increased markedly on
air adaptation. These results likely reflect limited heme synthesis for cytochrome assembly in
the absence of oxygen and represent a discrete and reversible blockage of full mitochondrial
biogenesis in the anoxia-tolerant rice species (Millar et al., 2004).
Irrespective of tolerance class, decreased soluble protein concentrations was observed
under submergence condition at all sampling times. Pyruvate decarboxylase (PDC) activity
was slightly higher in submergence intolerant lines, compared with tolerant lines, under both
dark submergence and anoxia. Such differences in PDC activity between the two groups of rice
lines were not observed when they were submerged under the natural diurnal cycle. Increased
PDC activity in roots at night demonstrated a probable incidence of tissue hypoxia or anoxia
during submergence during each dark period (Mohanty and Ong, 2003). Although most cereal
roots cannot elongate under anoxic conditions, primary roots of three-day-old rice seedlings
are able to elongate during anoxia. Kato-Noguchi (2004) showed that rice roots are able to
utilize the set of enzymes (SS, glucokinase, fructokinase, PDC, alcohol dehydrogenase)
involved in the metabolism of soluble sugars under anoxia. The ability to maintain an active
fermentative metabolism for production of ATP by fueling the glycolytic pathway with
fermentable carbohydrate is probably greater in hypoxic-pretreated (H-PT) than in non-
pretreated (N-PT) roots (Kato-Noguchi, 2004). Results indicate that sucrose synthase is a
typical anaerobic protein in rice (Ricard et al., 1991). Sucrose synthase activity increased in 2
day old rice seedlings subjected to anaerobic stress. Significantly higher steady-state levels of
 Effect of Abiotic Stresses on Growth… 133

SS mRNA, as determined by northern blots and the ability of total RNA to direct in vitro
synthesis of SS, were induced by anaerobic treatment. Analysis of run-on transcripts showed
increased transcription of SS genes as early as 60 minutes after initiation of anaerobic stress.
Anaerobic condition prevents aerobic respiration so that plant survival becomes dependent
on fermentative glycolysis which replaces the Krebs cycle as the main source of energy
(Crawford and Braendle, 1996; Vartapetian and Jackson, 1997). Fermentative glycolysis is
accompanied by the accumulation of a number of metabolites. The major fermentative
metabolites are ethanol, lactate and alanine, all derived from pyruvate, the end-product of
glycolysis (Ricard et al., 1994; Drew, 1997; Tadege et al., 1998). Although there is still much
to learn about the biochemical and molecular basis of anaerobic rice germination, the ability of
rice to maintain an active fermentative metabolism (i.e. by fuelling the glycolytic pathway with
readily fermentable carbohydrates) is certainly crucial (Magneschi and Perata, 2009). Relative
importance of ethanolic, lactate and alanine fermentation pathways was determined in
coleoptiles of rice seedlings subjected to anoxic stress by Kato-Noguchi (2006). The in vitro
activities of alcohol dehydrogenase, pyruvate decarboxylase and alanine aminotransferase in
the coleoptiles increased due to anoxia, whereas no significant increase was observed in lactate
dehydrogenase activity. Kato-Noguchi (2006) suggested that potential carbon flux from
pyruvate to ethanol may be much greater than the potential flux from pyruvate to lactate and
alanine in rice coleoptiles during anoxia (Kato-Noguchi, 2006). The ethanol concentration in
the coleoptiles was correlated with anoxia tolerance with respect to the ATP concentration and
coleoptile elongation. These results suggest that the ability to increase ethanolic fermentation
may be one of the determinants in anoxia tolerance of rice coleoptiles (Kato-Noguchi and
Morokuma, 2007).
Effects of anoxia on the levels of free-amino acids were investigated in the coleoptiles of
rice seedlings. Rice coleoptiles are able to grow in extremely low oxygen conditions. Anoxic
stress increased the concentration of total free-amino acids in the coleoptiles (Kato-Noguchi
and Ohasi, 2006). Alanine (Ala) and γ-aminobutyric acid (GABA) were the main amino acids
which accumulated. Since Ala and GABA are bio-compatible solutes and their accumulation is
known to stabilize osmotic potential and/or cytoplasmic pH in plant cells, these stress-induced
amino acids may allow rice coleoptiles to make biochemical adjustment that enable them to
cope with the stress conditions. Therefore, the ability to increase the concentrations of Ala and
GABA may be important for anoxic and submergence stress tolerance of rice seedlings (Kato-
Noguchi and Ohashi, 2006).
When seven day old rice seedlings were subjected to anaerobic stress, only minor changes
in the pattern of proteins were observed in the shoots, whereas disappearance of many protein
bands was observed in the roots. Three anaerobic stress proteins (ANPs; 36-, 40- and 87-kD
protein) were selectively induced in both roots and shoots of the seedlings, and 36-kD ANP
was identified as the glycolytic enzyme, GAPDH by limited N-terminal amino acid
sequencing. Activities of GAPDH in the shoots and roots increased due to stress of over 24 h
and were 3.4- and 6.2-fold greater than those in non-stressed seedlings at 24 h. These results
suggest that anaerobiosis induces the production of ANPs including GAPDH in the seedlings,
which may allow the seedlings to survive under stress condition (Kato-Noguchi, 2000).
Sugars appear to play a signaling role under anoxia, with several genes indirectly up-
regulated by anoxia-driven sugar starvation. Analysis of the effects of anoxia on the expansin
gene families revealed that EXPA7 and EXPB12 are likely to be involved in rice coleoptile
elongation under anoxia. Genes coding for ethylene response factors and HSPs are among the
134 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

genes modulated by anoxia in rice. Genes coding for some enzymes requiring oxygen for their
activity were dramatically down-regulated under anoxia, suggesting the existence of an energy
saving strategy in the regulation of gene expression (Lasanthi-Kudahettige et al., 2007). Gene
expression profiles of submergence tolerant rice cv. FR13A and sensitive IR39595-503-2-1-2,
when compared after submergence stress using differential display reverse transcriptase-
polymerase chain reaction (DDRT-PCR), 42 differential display bands were revealed from the
submergence tolerant variety, four of them showed high homology with genes related to a
water stress response: genes encoding ATP-binding protein, isocitrate dehydrogenase, NADH
dehydrogenase and terminal acetyltransferase, respectively. The remaining three fragments
were novel cDNA fragments (Chen et al., 2007).
Deep-water rice cultivars can diminish flooding stress by rapid elongation of their
submerged tissues to keep up with the rising waters. Aerenchyma and aerenchymatous
adventitious roots are formed that facilitate oxygen diffusion to prevent anaerobic conditions in
the submerged tissues. Aerobic as well as irrigated lowland rice genotypes grown under well-
watered (control) and waterlogged soil conditions for 30 days were found to be tolerant to
waterlogging because of their comparable abilities to enhance aerenchyma that effectively
facilitated O2 diffusion to the roots for maintaining root growth and dry matter production
(Suralta and Yamauchi, 2008). The ability of roots to resist waterlogging stresses might have
strong implications for the adaptation of rice growing in environments with fluctuating soil
water regimes (Suralta and Yamauchi, 2008). Two important factors influencing rice plant
survival during submergence are limitations to gas diffusion under water, and reduced
irradiance that impair photosynthesis and efficient utilization of carbohydrates. Thus, survival
during submergence may largely depend on accumulation of high carbohydrate concentrations
prior to submergence and a capacity for maintaining energy production through rapid alcoholic
fermentation under oxygen shortage. During flash flooding, a third factor thought to affect
survival is the aerobic shock during the post-submergence period when floodwaters recede.
Changes in the level of antioxidants and enzymes such as SOD suggest that tolerant rice
cultivars develop protective systems to air after exposure to hypoxic or anoxic environments.
In rice the two main strategies are to elongate and escape, or not to elongate and conserve
resources. For rainfed lowland rice exposed to flash flooding, elongation growth during
complete submergence has major adverse effects on survival, since this competes with
maintenance processes which require carbohydrates and energy (Ram et al., 2002).

h) UV-B Radiation

Ultraviolet-B (UV-B, 280-320 nm) radiation on plants is a major concern to plant

biologists due to its threat to productivity in global agriculture. The depletion in stratospheric
ozone has prompted renewed efforts in assessing the potential damage to plant and animal life
due to enhanced levels of solar UV-B radiation (Caldwell, 1998; Casati and Walbot, 2004;
Yannarelli et al., 2006). The enhanced UV-B radiation is detrimental to growth, development,
yield and quality of some crop plants including rice (Teramura and Ziska, 1996; Vass, 1997).
Enhanced UV-B radiation can affect sensitive species or cultivars by inhibition of
photosynthesis, DNA damage, decrease of pollen germination and tube growth, changes in
morphology, phenology, and biomass accumulation and partitioning (Caldwell et al., 1998;
Feng et al., 2003).
 Effect of Abiotic Stresses on Growth… 135

Plant height, leaf area, dry weight, net assimilation rate (NAR), and relative growth rate
(RGR) are significantly affected due to UV-B treatment in rice cultivars. Changes in plant
height and leaf area induced by UV-B can alter the rice plant canopy structure (Dai et al.,
1992). Tiller number, dry mass, panicle number, grain yield and grain size of rice was found to
decrease significantly under elevated UV-B radiation. Among grain storage proteins, glutelin
content significantly increased but albumin-globulin and prolamin contents did not. It was thus
evident that not only grain size but also grain storage protein of rice was markedly influenced
due to elevated UV-B radiation (Hidema et al., 2005). Rice plants exposed to UV-B exhibited
significantly reduced dry matter production (total plant and shoot), shoot height, leaf blade
length and total leaf area, increased number of tillers, and greater weight fractions in leaf
blades and roots. For most cultivars, the relative effects of UV-B on shoot morphology were
greater than the effects on biomass production (Barnes et al., 1993).
Supplementation of visible radiation with UV-B radiation resulted in reduced amounts of
total leaf nitrogen, chlorophyll, soluble protein and RUBISCO in rice leaves (Hidema et al.,
1996). It has been shown that under realistic UV-B conditions, reduction in the levels of
RUBISCO and other enzymes of the Calvin cycle as well as photoinhibition are the primary
cause for the decline in photosynthetic rate in higher plants as well as in aquatic photosynthetic
organisms (Baker et al., 1997; Sinha and Häder, 2002; Abdullaev et al., 2005). Compared with
control plants, the content of soluble protein and RUBISCO protein decreased significantly
after the UV-B treatment in rice leaves (He et al., 1993). UV-B radiation inactivates
photosystem II (PS II) (Biswal et al., 2006), oxygen evolving complex (OEC) (Hideg et al.,
1993), quinone component (Melis et al., 1992) and D1-D2 reaction centre protein complex
(Friso et al., 1994a, b). Marked decrease occurred in the ratios of variable to maximum
chlorophyll fluorescence yield and in the quantum yield of photosynthetic oxygen evolution in
rice leaves (He et al., 1993).When the effects of supplementary UV-B radiation on the changes
in synthesis and degradation of RUBISCO and light-harvesting chlorophyll a/b binding protein
of PSII (LHCII) as well as mRNA levels for small and large subunits of RUBISCO (rbcS and
rbcL, respectively) and LHCII (cab) were examined with leaf age in UV-sensitive (Norin 1)
and UV-resistant rice (Sasanishiki) varieties, synthesis of RUBISCO but not LHCII was
significantly suppressed by UV-B in Norin 1 (Takeuchi et al., 2002). The degradation of
RUBISCO was enhanced by UV-B around the time of leaf maturation in both the rice
cultivars. The levels of rbcS and rbcL were reduced by UV-B at the early stages after leaf
emergence in both cultivars. Cab transcripts were first present at high levels in the two
cultivars, but drastically decreased due to UV-B treatment immediately after leaf emergence in
Norin 1. RUBISCO synthesis was significantly suppressed by supplementary UV-B radiation
at the transcription step during the early leaf stages. It is suggested that the difference in UV-B
sensitivity in RUBISCO synthesis between the two rice cultivars is due to specific suppression
both transcriptionally and post-transcriptionally (Takeuchi et al., 2002).
Free radicals with a long lifetime were observed in the leaves of two rice cultivars
Sasanishiki (UV-B resistant) and Norin-1 (UV-B sensitive), by electron spin resonance (ESR)
spectroscopy. The leaves of both cultivars grown with visible light showed very similar ESR
spectra composed of radical 1 (R1) and radical 2 (R2), which could be attributed to the
formation of P700 cation radicals in the reaction center of photosystem I and tyrosine cation
radicals in the reaction center of photosystem II, respectively. The ESR spectrum composed of
R1 and R2 radicals in the leaves of Sasanishiki grown under visible light with supplemental
UV-B was similar to that in the plant grown without supplemental UV-B. On the other hand,
136 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

the amount of R2 radicals in the leaves of Norin-1 grown under visible light with supplemental
UV-B was significantly smaller than that in the plant grown without supplemental UV-B. It is
suggested that the loss of R2 radicals in Norin-1 upon UVB irradiation is related to the
instability of the plant (Kumagai et al., 1999). Effect of UV-B radiation on stomatal density
and opening was determined to test whether the stomatal response to UV-B was associated
with different sensitivity of growth to UV-B in four cultivars. Ten-day-old seedlings of IR 45
and IR 74 (UV-B sensitive), and IR 64 and IR 30 (UV-B less sensitive), were subjected to UV-
B radiation. Under 4-week UV-B exposure, leaf area and plant dry mass of IR 45 and IR 74
were significantly reduced. Stomatal density decreased in all cultivars, except in IR 64. Greater
reduction of stomata on the adaxial surface than on the abaxial surface under 3 and 4 weeks of
UV-B exposure suggested a direct effect of UV-B radiation on stomata. Difference in plant dry
mass between UV-B treated and control plants could be significantly correlated with the
reductions in stomatal opening and density on adaxial surface under UV-B treatment (Dai et
al., 1995).
The impact of elevated UV-B radiation on membrane systems and lipid peroxidation
indicated a significant increase in O2·−) generation, H2O2 content, malondialdehyde (MDA)
concentration and relative electrolyte conductivity (EC) in the two rice cultivars IR 74 and
Dular due to effective UV-B (UV-BBE) treatment (Dai et al., 1997).This indicates disruption of
membrane systems as an eventual reason for UV-B induced injury in rice plants. There was a
positive correlation between O2·−) generation and increases in EC or MDA in leaves. Activities
of CAT and SOD (but not APX) and concentrations of ascorbic acid and GSH were enhanced
by UV-BBE after 14 days of UV-BBE exposure. Further, exposure to 28 days of UV-BBE was
associated with a decline in enzyme activities and ascorbic acid, but not GSH. It is suggested
that UV-BBE-induced injury may be associated with disturbance of active oxygen metabolism
through the destruction and alteration of both enzymatic and nonenzymatic defense systems in
rice (Dai et al., 1997).
Plants have evolved defense mechanisms against UV radiation. There are two basic
strategies. One is the accumulation of UV absorbing compounds (Caldwell et al., 1983; Bharti
and Khurana, 1997) and the other is the development of an efficient DNA repair mechanism
(Britt, 1999). It is suggested that the difference between cultivars in the resistance to UV-B
radiation might be due to the differences in the levels of RUBISCO and in UV-absorbing
compounds that are induced by UV-B radiation (Hidema et al., 1996). Although UV absorbing
compounds are effective in reducing cyclobutane pyrimidine dimer (CPD) induction in plants
exposed to a challenge exposure to UV-B, certain levels of CPD are maintained constitutively
in light conditions containing UV-B, regardless of the quantity or presence of visible light.
These findings imply that the systems for repairing DNA damage and scavenging ROS are
essential for plants to grow in light conditions containing UV-B. CPD photolyase activity is a
crucial factor determining the differences in UV-B sensitivity between rice cultivars. Teranishi
and coworkers (2004) examined the correlation between UV-B sensitivity and CPD photolyase
activity in 17 rice cultivars of progenitors and relatives in breeding of UV-resistant Sasanishiki
and UV-sensitive Norin 1. Results suggested that cultivars more resistant to UV-B exhibited
higher photolyase activities than less resistant cultivars and that single amino acid alteration
from glutamine to arginine leads to a deficit of CPD photolyase activity (Teranishi et al.,
2004). These findings open up the possibility of increasing the resistance of rice to UV-B
radiation, by selective breeding or bioengineering of the genes encoding CPD photolyase
(Hidema and Kumagai, 2006).
 Effect of Abiotic Stresses on Growth… 137

4. COMPONENTS ASSOCIATED WITH ABIOTIC STRESS TOLERANCE

IN RICE PLANTS

Rice feeds about one half of the world’s population, mainly in Asia, Africa, and South
America. Increases in annual rice production are no longer keeping pace with the growth in the
number of consumers (Sasaki and Burr, 2000). Rice production in the next fifty years faces
even greater challenges, so the development of new cultivars with enhanced abiotic stress
tolerance will undoubtley have an important effect on the global food production. Abiotic
stresses induce a wide range of physiological and metabolic changes in rice plants. These
changes apparently adaptive, include a host of biochemical pathways associated with signal
perception, transduction and regulation of gene expression in a temporal and spatial pattern.
The advances in physiology, genetics and molecular biology have greatly improved our
understanding of the responses of rice plants to these stresses. In rice plants these adaptations
are dependent on the activation of cascades of molecular networks involved in stress
perception, signal transduction and the expression of stress related genes and metabolites.
Figure 3 shows the components associated with abiotic stress tolerance in rice plants. Abiotic
stresses induces expression of stress responsive genes which lead to accumulation of stress
related proteins and metabolites like osmolytes, polyamines, organic acids as well as increased
activities of certain enzymes in rice plants. These components which have been discussed in
detail in the following sections can be successfully used as attractive targets to produce abiotic
stress tolerant rice plants using biotechnological approaches (Table 1).

Table 1. Transgenic rice plants produced using some of the components associated
with stress tolerance

Components Gene Tolerance References

P5Cs
cod A
Osmolytes cox Kawakami et al., 2008
Proline, otsA Su et al., 2006
Glycine betaine, otsB Su and Wu, 2004
Trehalose, OsTPP1 Low temperature Sakomoto et al., 1998
Sorbitol, mtlD Salinity Mohanty et al., 2002
Mannitol, gutD Drought Garg et al., 2002
Fructans wft1 Wang et al., 2000
wft2 Ge et al., 2008

Polyamines
Putrescine, Capell et al., 2004
adc Drought
Spermine, Roy and Wu, 2001
SAMDC Salinity
Spermidine Roy and Wu, 2002

Organic acids
PEPC Aluminum Osaki et al., 2001
Oxalate
138 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Table 1. (Continued)

Components Gene Tolerance References

Antioxidants CAT Low temperature Matsumura et al., 2002

Catalase, MnSOD Drought Wang et al., 2005a
Mn-SOD katE Salinity Moriwaki et al., 2008
HVA1
Xu et al., 1996,
Late embryogenesis abundant PMA80 Drought
Cheng et al., 2002,
proteins PMA1959 Salt stress
Xiao et al., 2007
OsLEA3-1

Katiyar-Agarwal et al., 2003

Hsp101 Heat
Murakami et al., 2004
Heat shock proteins sHSP17.7 Drought
Sato and Yokoya, 2008

nhaA Salinity Wu et al., 2005a

Transport proteins
OsNHX1 Drought Fukuda et al., 2004

OsMAPK44 Salinity Jeong et al., 2006

OsCIPK genes Multiple stresses Xiang et al., 2007
Signaling pathways
OsCDPK7 Cold Ma et al., 2005
calcineurin gene Drought Saijo et al., 2000

NAM
ATAF Drought Wang et al., 2008b
CUC (NAC) Salt stress Hu et al., 2006
Transcription factors OsDREB1F Heat Wu et al., 2009
OsWRKY11 Low temperature Wang et al., 2007
OsWRKY89 UV-B Xu et al., 2006
Sub1A-1

Figure 3. Components associated with abiotic stress tolerance in rice plants. Abiotic stresses lead to
induction of stress responsive genes expression and accumulation of stress specific proteins and
metabolites like polyamines, osmolytes, organic acids in rice plants. These components can be used to
produce abiotic stress tolerant rice plants using plant breeding or genetic transformation using
biotechnological approaches.
 Effect of Abiotic Stresses on Growth… 139

a) Osmolytes

The acclimation of plants to a constantly changing environment involves the accumulation

of certain organic compounds of low molecular mass collectively known as compatible
cytoplasmic solutes or osmolytes. These osmolytes fall into three major groups: amino acids
(e.g. proline), quaternary ammonium compounds (e.g. glycine betaine, β-alanine betaine,
dimethylsulfoniopropionate, etc.) and polyols/sugars (e.g. mannitol, trehalose). Recent studies
indicate that compatible solutes besides serving as osmoprotectants also act as free-radical
scavengers or chemical chaperones by directly stabilizing membrane phospholopids, proteins
and enzymes (Rudolph et al., 1986; Diamant et al., 2003; Sharma and Dubey, 2004; Mishra
and Dubey, 2006). Unlike perturbing solutes (such as inorganic ions), which readily enter the
hydration sphere of proteins favouring unfolding, compatible solutes tend to exclude these ions
from the hydration sphere of proteins and stabilize folded protein structures (Low, 1985).
Proposed roles of osmolytes in abiotic stress tolerance in rice plants have been shown in figure
4. Osmolytes can act as osmoprotectant, chemical chaperon, antioxidant, storage compound,
metal chelator, protein stabilizer, enzymes and hence protect DNA, lipid, protein, membrane
etc. against the denaturing effect of abiotic stresses. As rice is not capable of natural
production or accumulation of all of these compounds in response to stresses, extensive
research has been conducted examining various approaches to enhance increased production of
these compounds in rice plants. Engineering increased osmolyte content in transgenic plants is
a promising strategy for protecting plants against various abiotic stresses. Transgenic rice
plants engineered to accumulate proline, mannitol, fructans, trehalose, glycine betaine exhibit
marked improvements in salt and/or drought tolerance (Wang et al., 2000; Su and Wu, 2004;
Su et al., 2006; Ge et al., 2008; Kawakami et al., 2008). Figure 5 shows the biosynthetic
pathway of some of the common osmolytes that have been used to increase abiotic stress
tolerance in rice plants.

Amino Acids
Increase in the content of amino acids during environmental stresses has been correlated
with tolerance to many abiotic stresses in plants. Dubey and Rani (1989) reported significant
increase in the levels of free amino acids with a substantial elevated level of proline in rice
seedlings subjected to salinity treatment of 7 and 14 dS m-1. NaCl induced increase in proline
content in rice leaves was related to proteolysis, an increase in ornithine-δ-aminotransferase
activity, a decrease in proline dehydrogenase activity, a decrease in proline utilisation and an
increase in the content of the precursors of proline biosynthesis, ornithine and arginine (Lin et
al., 2002). Proline accumulation caused by NaCl in detached rice leaves was also associated
with ammonium ion accumulation (Lin et al., 2002). Proline content was observed to increase
in rice seedlings subjected to water stress also. Both drought resistant and sensitive rice
genotypes showed increased proline content when subjected to water stress. The increase was
higher in tolerant genotypes due to increased Δ1-pyrroline-5-carboxylate synthetase (P5CS)
activity (Choudhary et al., 2005). Metal toxicity also leads to increased proline accumulation
in rice plants. With Al treatment level of 160 μM in situ about 180-276% increase in proline
content was observed in roots and shoots of 15 day grown rice seedlings (Sharma and Dubey,
2005a). In rice leaves CuSO4 and CuCl2 were equally effective in inducing proline
accumulation, indicating that proline accumulation is induced by Cu (Chen et al., 2001).
140 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Figure 4. Proposed roles of osmolytes in abiotic stress tolerance in rice plants. Osmolytes can act as
osmoprotectants, enzyme protectants, antioxidants, storage compounds, metal chelators, protein
stabilizer, chemical chaperons and hence protect lipids, proteins, DNA, membranes etc against the
damaging effects of abiotic stresses.

Figure 5. Biosynthetic pathways of some of the osmolytes which accumulate in rice plants under
stresses. Enzymes used in attempts to increase abiotic stress tolerance in rice plants includes enzymes
involved in the biosynthesis of osmolytes proline, glycine betaine, trehalose, mannitol, sorbitol and
fructan as Δ1- pyrroline-5-carboxylase reductase (P5CR), Δ1- pyrroline-5-carboxylase synthase (P5CS),
glutamate-5-phospho transferase (G5P), betaine aldehyde dehydrogenase (BADH), choline
monooxygenase (CMO), choline dehydrogenase (CDH), trehalose-6-P phosphatase (T6PP), trehalose-6-
P synthetase (T6PS), non specific phosphatase (NPT), mannitol-1-P dehydrogenase (MPDH), sorbitol-6-
P phosphatase (S6PP), aldose-6-P reductase (A6PR), sorbitol-6-P dehydrogenase (S6PD), fructosyl
transferase (FT).
 Effect of Abiotic Stresses on Growth… 141

Sulfate salts of Mg, Mn, and Fe were ineffective in inducing proline accumulation in
detached rice leaves. Excess Cu had no effect on relative water content of detached rice leaves,
suggesting that Cu-induced proline accumulation is unlikely due to water deficit. Proline
accumulation induced by excess Cu was related to proteolysis and an increase in Δ1-pyrroline-
5-carboxylate reductase (P5CR) or ornithine-δ-amino-transferase activity and could not be
explained by proline utilization or stress-induced modifications in proline dehydrogenase
(ProDH) or Δ1-pyrroline-5-carboxylate dehydrogenase (P5CDH) activities. The content of
glutamic acid was decreased by excess Cu. The increase in arginine but not ornithine was
found to be associated with the increase in proline content in Cu-stressed detached rice leaves
(Chen et al., 2001). There has been little agreement regarding the mechanism by which proline
reduces heavy metal toxicity. Proline supplement to Cu-treated rice seedlings not only reduced
the Cu absorption in the roots but also increased Cu exclusion, suggesting that supplement of
proline accompanied by Cu exposure induces a barrier of Cu influx and efflux in rice roots
(Chen et al., 2001). Wang and coworkers (2009) suggested a protective effect of proline on
Hg2+ toxicity through detoxifying reactive oxygen species, rather than chelating metal ions or
maintaining the water balance under Hg2+ stress (Wang et al., 2009). In vitro experiments
using enzymes extracted from rice leaves have suggested that proline protects enzyme activity
under various stressful conditions. Activity of NR enzyme from rice seedlings appeared to be
sensitive to H2O2, PEG-6000, NaCl and various metal salts. Addition of proline in the enzyme
assay medium caused a considerable protection to the enzyme against the damaging effects of
these stressful components (Sharma and Dubey, 2005a). Similar protective effect of proline on
GS isoforms and RNase extracted from rice has been shown under water stress and metal
toxicity (Kumar and Dubey, 1999; Mishra and Dubey, 2006; Maheshwari and Dubey, 2007).
In plants, proline is synthesized from L-Glutamic acid (L-Glu) by two enzymes, P5CS and
P5CR. L-proline is metabolized to L-Glu by two enzymes, proline dehydrogenase (ProDH)
and P5CDH (Figure 5). It has been reported that P5CS and ProDH are rate-limiting enzymes in
proline synthesis and metabolism of plants under water stress, respectively. Therefore, it is
expected that genetically engineered plants produced by overexpression of P5CS gene or
suppression of ProDH gene overproduce proline and acquire osmotolerance, namely, the
ability to tolerate environmental stresses such as high salinity and drought. Chisako and
coworkers (1999) investigated whether or not transgenic plants with a ProDH antisense cDNA
accumulate proline of high level. Transgenic rice plants were generated with a ProDH
antisense cDNA from Arabidopsis thaliana by Agrobacterium method. Several transgenics
accumulated proline at a significantly higher level than wild type plants under normal growth
conditions. Iyer and Caplan (1998) found that intermediates in proline biosynthesis and
catabolism such as glutamine and Δ1-pyrroline-5-carboxylic acid (P5C) can increase the
expression of several osmotically regulated genes in rice, including salT and dhn4. One
millimolar P5C or its analog 3,4-dehydroproline, produced a greater effect on gene expression
than 1 mM proline or 75 mM NaCl. P5C- and 3,4-dehydroproline-treated plants were found to
consume less O2, had reduced NADPH and increased NADH levels and accumulated many
osmolytes. These experiments indicate that osmotically induced increases in the concentrations
of one or more intermediates in proline metabolism could be influencing some of the
characteristic responses related to osmotic stress tolerance (Iyer and Caplan, 1998).
Su and Wu (2004) compared the growth rate of transgenic rice plants in which the
expression of a mothbean p5cs cDNA was driven separately with a constitutive and a stress-
inducible promoter. They found that both constitutive expression and stress-inducible
142 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

expression of the p5cs cDNA in transgenic rice led to the accumulation of p5cs mRNA and
proline. Third-generation (R2) transgenic rice seedlings showed significantly higher tolerance
to stress produced by high levels of NaCl or water deficiency as judged by faster growth of
shoots and roots in comparison with non-transformed plants. However, stress-inducible
expression of the P5CS transgene showed significant advantages over the constitutive
expression in increasing the biomass production of transgenic rice grown in soil under stress
conditions (Su and Wu, 2004).

Quaternary Ammonium Compounds

These are amino acid derivatives in which the nitrogen atom is fully methylated. In plants,
glycine betaine is a representative member of this group of osmolytes. Glycine betaine not
only acts as an osmoregulator, but also stabilizes the structures and activities of enzymes and
protein complexes, and maintains the integrity of membranes against the damaging effects of
excessive salt, cold, heat and freezing (Gorham, 1995; Sakamoto and Murata, 2002). In vitro
experiments using enzymes extracted from rice leaves suggest that glycine betaine protects
activity of many enzymes under various abiotic stresses. Glycine betaine under in vitro
conditions protects activity of enzyme NR against NaCl, water stress and H2O2 in rice.
Activities of isoforms of GS, namely GS1 and GS2 were also reported to be protected by the
osmolytes proline, glycine betaine and sucrose. Among these three osmolytes, glycine betaine
appeared to be the most suitable protectant for GS (Kumar and Dubey, 1999).
Glycine betaine is synthesized in the chloroplast from choline by a two-step process. The
first step (choline to betaine aldehyde) is mediated by choline monooxygenase (CMO), which
can be induced by drought and salinity (Russell et al., 1998). The second step (betaine
aldehyde to glycine betaine) is catalyzed by the enzyme betaine aldehyde dehydrogenase
(BADH) a NAD+-dependent dehydrogenase (Figure 5). Rice which has two genes for BADH,
does not accumulate glycine betaine because it lacks a functional gene for CMO. Rice plants
accumulate glycine betaine in the presence of exogenously applied betaine aldehyde, which
leads to the development of a significant tolerance to salt, cold and heat stress. Kishitani and
coworkers (2000) reported the transgenic rice plants constitutively expressing precise barley
BADH1 that converted high levels of exogenously applied betaine aldehyde to glycine betaine
more efficiently than did wild-type plants. The lower conversion efficiency in the wild-type
plants probably results from the limitation of precise native BADH proteins found in this
study. Shirasawa and coworkers (2006) reported transgenic rice plants harboring a single copy
of expressed spinach CMO which accumulated detectable glycine betaine and had enhanced
tolerance to salt and temperature stresses. Because CMO alone only converts choline into
betaine aldehyde, these transgenic plants still need native functional BADH proteins for
conversion of betaine aldehyde into glycine betaine. Transgenic lines of indica rice were
generated by Agrobacterium-mediated transformation with the choline oxidase (codA) gene
from Arthrobacter globiformis. A significant amount of choline oxidase product, i.e. glycine
betaine, accumulated in R0 as well as R1 plants. Challenge studies performed with R1 plants
by exposure to NaCl stress (0.15 M) for 1 week, followed by a recovery period, revealed that
in some cases more than 50% of the transgenic plants could survive salt stress and set seed
whereas wild-type plants failed to recover (Mohanty et al., 2002). Several glycine betaine-
producing transgenic rice lines were generated in which the Arthrobacter pascens choline
oxidase (COX) gene, fused to a chloroplast targeting sequence (TP) was expressed under the
control of an ABA-inducible promoter (SIP; stress-inducible promoter) or a ubiquitin (UBI)
 Effect of Abiotic Stresses on Growth… 143

gene promoter. Saline growth conditions enhanced glycine betaine accumulation by up to 89%
in the SIP lines, whereas up to 44% increase was seen in the UBI line. In all these cases the
glycine betaine levels were many-fold below the range reported for plant species that produce
glycine betaine naturally. In spite of lower glycine betaine concentrations, statistically greater
levels of stress tolerance were found in SIP lines than in UBI lines, suggesting that the stress
protection observed in SIP plants cannot be totally explained by the increase in the glycine
betaine content (Su et al., 2006).

Polyols/Sugars
The accumulation of sugar alcohols may protect plants against environmental stresses. The
accumulation of polyols have been proposed to have dual functions: facilitating osmotic
adjustment and supporting redox control. A significant increase in sucrose content in roots and
shoots of water stressed as well as Al3+ stressed rice seedlings compared to the level in control
seedlings was reported by Sharma and Dubey (2005a). In vitro studies using enzymes
extracted from rice seedlings suggest that sucrose can act as enzyme protectant. In vitro water
stress of -0.5MPa or -2.0 MPa caused a loss in activity of the GS isoforms with an increase in
enzyme Km values. Sucrose provided considerable protection to the enzyme against the
deleterious effect of water stress induced by polyethylene glycol. Similarly activity of NR
enzyme extracted from rice seedlings appeared to be sensitive to H2O2, PEG-6000, NaCl and
various metal salts in vitro. Addition of 1 mol/L sucrose in the enzyme assay medium caused a
considerable protection to the enzyme against the damaging effects of stressful components
(Sharma and Dubey, 2005a).
Trehalose serves as a stress protectant and/or reserve carbohydrate in a variety of
organisms including bacteria, yeast and invertebrates. With the notable exception of the
desiccation-tolerant resurrection plants, trehalose is not thought to accumulate to detectable
levels in most plants. A systematic search of rice databases discovered a large TPS/TPP gene
family in the rice genome, which is similar to that found in Arabidopsis thaliana, especially in
the gene family structure. Expression analysis demonstrated that OsTPP1 was initially and
transiently up-regulated after salt, osmotic and ABA treatments but slowly up-regulated under
cold stress. OsTPP1 overexpression in rice enhanced tolerance to salt and cold stress (Ge et
al., 2008). Regulated overexpression of Escherichia coli trehalose biosynthetic genes (otsA
and otsB) as a fusion gene for manipulating abiotic stress tolerance in rice was reported by
Garg and coworkers (2002). Compared with non-transgenic rice, several independent
transgenic lines exhibited sustained plant growth, less photo-oxidative damage, and more
favorable mineral balance under salt, drought, and low temperature stress conditions.
Depending on growth conditions, the transgenic rice plants accumulate trehalose at levels 3-10
times that of the non-transgenic controls. The observation that peak trehalose levels remain
well below 1 mg g-1 fresh weight indicates that the primary role of trehalose is not as a
compatible solute. Rather, increased trehalose accumulation correlates with higher soluble
carbohydrate levels and an elevated capacity for photosynthesis under both stress and
nonstress conditions, consistent with a suggested role in modulating sugar sensing and
carbohydrate metabolism. These findings demonstrate the feasibility of engineering rice for
increased tolerance to abiotic stress and enhanced productivity through tissue-specific or
stress-dependent overproduction of trehalose (Garg et al., 2002).
Fructans are water-soluble fructose oligomers and polymers and have been implicated in
protecting plants against water stress. Rice is highly sensitive to chilling temperatures and is
144 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

not able to synthesize fructans. Two wheat fructan-synthesizing enzymes, sucrose:sucrose 1-

fructosyltransferase, encoded by wft2, or sucrose:fructan 6-fructosyltransferase, encoded by
wft1, were introduced into rice plants, and rice transformants that accumulate fructans were
successfully obtained. Transgenic rice lines expressing wheat-derived fructosyltransferase
genes accumulated large amounts of fructans in mature leaf blades and exhibited enhanced
chilling tolerance at the seedling stage. This is the first report owing that fructan accumulation
enhanced tolerance to non-freezing low temperatures in rice (Kawakami et al., 2008).
Role of mannitol and sorbitol as stress protectant was investigated. Agrobacterium
tumefaciens mediated integration of mtlD gene (encoding mannitol-1-phosphate
dehydrogenase) and gutD gene (encoding glucitol-6-phosphate dehydrogenase) was done in
the rice genome. Analysis of sugar alcohol showed that transgenic rice plants could produce
and accumulate mannitol and sorbitol. The salt tolerance of transgenic plants was much higher
than that of their controls (Wang et al., 2000). It is suggested that transgenic rice produces and
accumulates mannitol and sorbitol so as to enable itself to absorb water and grow normally
under high osmotic pressure.

b) Polyamines

Polyamines have been shown to be involved in plant stress responses. However, the
precise role(s) of polyamine metabolism in these processes remains ill-defined. Transgenic
approaches demonstrate that polyamines play essential roles in stress tolerance and open up the
possibility to exploit this strategy to improve plant tolerance to multiple environmental stresses
(Alcazar et al., 2006). The diamine putrescine and the polyamines spermidine and spermine
are ubiquitous in nature. Polyamines are abundant polycationic compounds involved in many
plant physiological processes such as cell division, dormancy breaking, plant morphogenesis
and in response to environmental stresses (Garufi et al., 2007). Figure 6 shows the biosynthetic
pathway of some of the common polyamines. The starting point for polyamine biosynthesis is
the basic amino acids ornithine and arginine, which are decarboxylated by ornithine
decarboxylase (ODC) and arginine decarboxylase (ADC), respectively, to yield putrescine.
Putrescine then serves as the substrate for the biosynthesis of spermidine and spermine via the
activities of S-adenosylmethionine decarboxylase and spermidine as well as spermine
synthases (Walters, 2000). The polycationic nature of polyamines, positively charged at
physiological pH, has attracted the attention of researchers and has led to the hypothesis that
polyamines could affect physiological systems by binding to anionic sites, such as those
associated with nucleic acids and membrane phospholipids (Groppa and Benavides, 2008).
Polyamines have been reported to be involved in protein phosphorylation (Ye et al., 1994),
post transcriptional modifications (Mehta et al., 1994), and conformational transition of DNA.
The physiological role of putrescine in abiotic stress responses is a matter of controversy. It
has been very difficult to establish a direct cause-and-effect relationship between increased
putrescine levels in plants and abiotic stress (Capell et al., 2004). Elevated amount of
putrescine might be the cause of stress-induced injury or alternatively, a protective response
resulting from stress (Reggiani et al., 1993).
Rice has a large capacity to enhance polyamines biosynthesis in leaves in response to
stresses. The role of polyamines in plant defense to stresses varies with polyamines forms and
stress stages.
 Effect of Abiotic Stresses on Growth… 145

Figure 6. Biosynthetic pathways of diamine putrescine and the polyamines spermidine and spermine.
The enzymes involved in the biosynthesis of putrescine, ornithine decarboxylase (ODC); spermidine, S-
Adenosyl-methionine decarbosxylase (ADC) and spermidine synthase; and spermine, spermine synthase;
have been used in attempts to increase abiotic stress tolerance by their overexpression in rice plants.

In rice germinating under saline condition, increased levels of polyamines spermine and
spermidine was observed (Katiyar and Dubey, 1990). Krishnamurthy and Bhagwat (1989)
compared polyamine accumulation of nine rice cultivars with different salt sensitivity, they
found that the salt-tolerant cultivars accumulated high concentrations of spermidine and
spermine, while the salt-sensitive ones accumulated excessive putrescine and low levels of
spermidine and spermine. However, marked increase in spermine as well as spermidine level
was also observed in seedlings of sensitive rice cultivars under higher level of salinity. In all
cultivars salt stressed seedlings had higher agmatine level compared to non-stressed. Salinity
led to greater accumulation of certain unidentified polyamines in seedlings of sensitive
cultivars. Increased levels of total polyamines, putrescine, spermidine and unknown
polyamines in rice seedlings under salinization suggest their possible role in combating the
adverse effects of salinity stress (Katiyar and Dubey, 1990).
A correlation was found between polyamine and salt stress-induced responses in rice
genotypes when physiological responses of various rice genotypes were studied in relation to
NaCl stress (Basu and Ghosh, 1991). Cultivars CSR-1 and Dular germinated well in different
NaCl regimes compared to cvs. Rupsail, Assam Getu and M-1-48. Cultivars CSR-1 and Dular
were relatively effective in maintaining high concentrations of polyamines as well as arginine
decarboxylase activity in coleoptiles and roots in a non-stressed condition. The activities of
two biodegradative enzymes, diamine oxidase and polyamine oxidase were lowest in cv. CSR-
1. The polyamine content was not significantly altered when seedlings of cv. CSR-1 were
exposed to 100 mM NaCl. However, in cv. M-1-48 enhancement of arginine decarboxylase
activity with concomitant accumulation of polyamines was observed suggesting a correlation
between polyamine and salt stress-induced responses in rice genotypes (Basu and Ghosh,
1991).
Yang and coworkers (2007) suggested that the physiological traits like higher levels of
free spermidine/free spermine and insoluble-conjugated putrescine, as well as early
accumulation of free polyamines, could be important for rice crop in adapting to water stress.
146 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

The activities of arginine decarboxylase, S-adenosyl-L-methionine decarboxylase and

spermidine synthase were significantly enhanced in rice leaves under water stress, in good
agreement with the increase in putrescine, spermidine and spermine contents. The
increased contents of free spermidine, free spermine, and insoluble-conjugated putrescine
under water stress were significantly correlated with the yield maintenance ratio (the ratio of
grain yield under water-stressed conditions to grain yield under well-watered conditions) of the
cultivars. Free polyamines showed significant accumulation when leaf water potentials reached
-0.51 MPa to -0.62 MPa for the drought-resistant cultivars and -0.70 MPa to -0.84 MPa for the
drought-susceptible ones (Yang et al., 2007). Enhanced production and accumulation of free
and conjugated polyamines as well as increased activities of their biosynthetic enzymes in rice
plants have also been associated with heat stress. Perchloric acid-soluble free, as well as
conjugated polyamines, and their metabolic enzymes were studied under 45°C heat stress in
callus raised from heat-tolerant and -sensitive rice cultivars. The levels of free and conjugated
polyamines, as well as arginine decarboxylase and polyamine oxidase activities were higher in
tolerant than in sensitive rice callus under non-stressed conditions (Roy and Ghosh, 1996).
Heat stress caused greater accumulation of free and conjugated polyamines and increased
activities of arginine decarboxylase and polyamine oxidase in callus of the heat-tolerant
cultivar (N 22) than in that of the heat-sensitive cultivar (IR 8). In particular, the uncommon
polyamines norspermidine and norspermine were detected in cv. N 22, which increased
appreciably during stress, but these were not detected in callus of cv. IR 8. Increased levels of
transglutaminase activity indicated the high titre of conjugated polyamines (Roy and Ghosh,
1996). Akiyama and Jin (2007) presented the first direct evidence supporting essentially
chilling-specific regulation of a rice ADC gene that also potentially influences putrescine
accumulation, a phenomenon previously noted in cold-stressed rice seedlings. RNA gel blot
analysis revealed markedly increased OsADC1 mRNA levels in rice seedling leaves subjected
to chilling stress. Interestingly, this treatment induced a concomitant increase in free putrescine
levels in these samples, coincident with the observed elevated OsADC1 mRNA levels.
At physiological concentrations spermine and spermidine are found to significantly
prevent the leakage of electrolytes and amino acids from roots and shoots induced by salinity
stress in rice seedlings. To different degrees they also prevent chlorophyll loss, inhibition of
photochemical reactions of photosynthesis as well as downregulation of chloroplast-encoded
genes like psbA, psbB, psbE and rbcL, indicating a positive correlation between salt tolerance
and accumulation of higher PAs in rice. The inhibitory effect of salinity stress and its reversal
by exogenous PAs are more pronounced in the salt-sensitive M-1-48 rice plants than in the
tolerant Pokkali plants (Chattopadhayay et al., 2002). In the case of salt stress, a beneficial
effect of an exogenous polyamine may also be related to the improvement of the ion balance in
salt-treated cells due to its cationic nature (Ndayiragije and Lutts, 2006). Exogenous putrescine
at 1 mM clearly decreased both Na+ and Cl- accumulation of rice calli exposed to salt. Roy and
coworkers (2005) determined the extent to which polyamine mediated restoration of activities
of plasma membrane (PM)-bound enzymes occurs and differs within salt-sensitive and salt-
tolerant rice cultivars. Results showed that nine-fold higher level of H+-ATPase (100%
vanadium sensitive) was detected from PM of roots of salt-tolerant cultivar (Nonabokra) in
comparison to roots of salt sensitive cultivar (M-1-48). Salinity stress alone to the seedlings
significantly reduces the activity of PM-bound H+-ATPase. The activity of H+-ATPase was
restored to some extent in the roots treated with NaCl stress in presence of 1 mM spermidine.
Analysis of PM-bound polyamine from untreated control roots showed only putrescine from
 Effect of Abiotic Stresses on Growth… 147

salt sensitive cultivars, whereas roots of salt-tolerant plants had only spermidine and spermine.
Western blot using polyclonal antibody raised against H+-ATPase (PM-bound) of Arabidopsis
thaliana showed NaCl stress-induced decrease and spermidine-induced recovery of 100 kDa
polypeptide (known MW of 100 kDa H+-ATPase from rice). Roy and coworkers (2005)
suggested that accumulation of Na+, loss of K+ ion, salinity stress-induced sharp inhibition of
PM-bound H+-ATPase activity, could be overcome by supplying spermidine exogenously.
Spermidine and spermine, but not putrescine, were found to be effective in reducing CdCl2-
induced toxicity in rice leaves (Hsu and Kao, 2007). Spermidine and spermine were shown to
protect Cd-induced oxidative damage and this protection is most likely related to the avoidance
of H2O2 generation and the reduction of Cd uptake. Spermidine and spermine prevented
CdCl2-induced increase in the contents of H2O2 and malondialdehyde (MDA), decrease in the
contents of ASC and GSH, and increase in the activities of antioxidative enzymes (Hsu and
Kao, 2007).
Arginine decarboxylase (ADC) cDNA from oat (Avena sativa L.) was introduced into rice
genome by an Agrobacterium-mediated transformation method. Expression of the ADC
transgene under the control of an ABA-inducible promoter led to stress-induced upregulation
of ADC activity and polyamine accumulation in transgenic rice plants. Second-generation (Rl)
transgenic rice plants showed an increase in biomass under salinity stress conditions, as
compared to the non-transformed control plants (Roy and Wu, 2001). Capell and coworkers
(2004) demonstrated that the manipulation of polyamine biosynthesis in plants can produce
drought-tolerant germplasm in rice. Transgenic plants expressing Datura adc produced much
higher levels of putrescine under stress, promoting spermidine and spermine synthesis and
ultimately protecting the plants from drought. Further these workers generated transgenic rice
plants expressing the Datura stramonium adc gene and investigated their response to drought
stress. Wild-type plants responded to the onset of drought stress by increasing endogenous
putrescine levels, but this was insufficient to trigger the conversion of putrescine into
spermidine and spermine (the agents that are believed to protect plants under stress). In
contrast, transgenic plants expressing Datura adc produced much higher levels of putrescine
under stress, promoting spermidine and spermine synthesis and ultimately protecting the plants
from drought (Capell et al., 2004). Transgenic plants exhibited less chlorophyll loss and leaf
curling than the wild type (Capell et al., 2004). Roy and Wu (2002) reported that the
introduction of the Tritordeum SAMDC gene into rice resulted in a three to four-fold increase
in spermidine and spermine levels in the transformed plants. These transgenic rice plants
showed normal growth and development even under NaCl stress, which indicated that the
transformants were more stress tolerant than the wild type.

c) Organic Acids

Organic acids are key intermediates in carbon metabolism but can also serve as key
components to cope with metal tolerance. One of the most interesting strategies to ameliorate
the effects of metal toxicity involves formation of complexes with organic acid molecules to
decrease the availability of the metal within the plant cell, thus limiting the toxic effects
(Peterson and Oliver, 2006). Organic acid anions such as citrate, malate, oxalate are potential
ligands for metals and so could play an important role in metal tolerance and their
detoxification (Kochian et al., 2004; Yang et al., 2006). Organic acids have been shown to
148 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

play a key role in Al exclusion via their exudation from the root apex on exposure to Al, and
internal detoxification of symplastic Al by complexation, where organic acids chelate Al and
reduce its toxic effects at the cellular level (Kochian et al., 2004). Hue and coworkers (1986)
suggested a list of acids in the decreasing order of the ability to precipitate Al: oxalic acid >
citric acid > malic acid > succinic acid. Higher levels of citrate effectively alleviate Al-induced
toxicity in Indica rice (Meriga et al., 2003). Seedlings of two Indian rice cultivars (Suraksha
and Vikas) differing in Al sensitivity when grown in Yoshida’s culture solution containing 80
μmol Al in absence and presence of citrate, showed that citrate at a concentration of 200 mM
alleviate the toxic effects of Al in both cultivars of rice, mostly by chelating with the metal.
Phosphoenolpyruvate carboxylase (PEPC) transgenic rice plants, in which the gene of
PEPC of maize was introduced, were tested for Al resistance (Osaki et al., 2001). When the
intact gene of maize PEPC was introduced into the C3 crop rice, PEPC activity in leaves of
transgenic rice plants were 2 to 3 times higher than those in maize. 14C distribution to organic
acids after 5 minutes of 14CO2 assimilation was almost two times higher in transgenic rice
plants than in control plants. Relative growth of control rice plants decreased with increasing
Al application. However, that of transgenic rice plants increased with increase of Al
application. Organic acid-anion exudation from roots of control plants persisted remained
regardless of Al application. However, Al treatment enhanced particularly oxalate exudation
from roots of the transgenic plants. These results are in agreement with the better growth of the
transgenic plants compared to the control in presence of Al. Osaki and coworkers (2001)
suggested that the higher Al resistance of the PEPC transgenic plants is due to enhanced
synthesis of organic acids in the leaves, transport to the roots and exudation from the roots.

d) Antioxidants

Under most of the abiotic stressful conditions such as drought, salinity, heat, chilling,
metal toxicity, increased gaseous pollutants, radiations, etc., many plant species overproduce
ROS. Under such conditions the scavenging system for ROS may lose its function and the
balance between producing and quenching ROS can get disturbed, resulting in oxidative
damage to plant system (Bowler et al., 1992; Halliwell and Gutteridge, 2006; Sharma and
Dubey, 2007). If stress-induced production of reactive oxygen species is not adequately
counter balanced by cellular antioxidnts, oxidative damage of lipids, proteins and nucleic acids
ensues (Halliwell and Gutteridge, 1989; Duval et al., 2002; Sharma and Dubey, 2007).
Antioxidants serve to keep down the levels of free radicals, permitting them to perform
useful biological functions without too much damage to cellular biomolecules and organelles
(Halliwell and Gutteridge, 2006). Enhancement of antioxidant defense in plants can thus
increase tolerance to different stresses. Antioxidants (ROS scavengers) include enzymes such
as CAT, peroxidase (POD), SOD, APX, MDHAR, DHAR and GR as well as non-enzyme
molecules such as ascorbic acid (AsA), glutathione (GSH), carotenoids and anthocyanins.
Table 2 shows the reactions catalyzed by enzymes involved in antioxidative defense system in
rice plants. Efficient scavenging/destruction of reactive oxygen species generated during
abiotic stresses require the action of several antioxidant enzymes. The ascorbate-glutathione
cycle present in at least four different subcellular locations including the cytosol, chloroplast,
mitochondria and peroxisomes, scavenges H2O2.
 Effect of Abiotic Stresses on Growth… 149

Table 2. Reactions catalyzed by enzymes involved in antioxidative defense system in rice

plants. Efficient scavenging/destruction of reactive oxygen species generated during
abiotic stresses requires the action of several antioxidant enzymes

Antioxidant Enzymes Reaction catalyzed

CAT
Catalase 2H2O2 2H2O + O2

POD
Peroxidase H2O2 + AH2 H2O + A

APX
Ascorbate peroxidase H2O2 + Ascorbate H2O + Monodehydroascobate

Monodehydroascorbate MDHAR
Monodehydroascorbate + NAD(P)H Ascorbate + NAD(P)+
reductase

Dehydroascorbate DHAR
Dehydroascorbate + 2GSH Ascorbate + GSSG
reductase

Glutathione reductase GSSG + NAD(P)H GR 2GSH + NAD(P)+

SOD
Superoxide dismutase O2·− + O2·− + 2H+ H2O2 + O2

In this cycle, AsA and GSH are not consumed, using NADPH as reducing power H2O2 is
reduced to H2O. APX reduces H2O2 to H2O using AsA, which generates
monodehydroascorbate. Monodehydroascorbate radical can be reduced to AsA by MDHAR. If
not reduced rapidly, monodehydroascorbate is disproportionated into AsA and
dehydroascorbate. Dehydroascorbate is reduced to AsA by dehydroascorbate reductase
(DHAR) using GSH as the reducing agent. Oxidized glutathione (GSSG) is in-turn reduced by
GR using NADPH (Figure 7). Additional compounds, such as osmolytes, proteins (e.g.
peroxiredoxin) and amphiphilic molecules (e.g. tocopherol) can also function as ROS
scavengers (Bowler et al., 1992; Noctor and Foyer, 1998).
Increased concentration of O2·−, increased level of lipid peroxidation showing oxidative
stress, chlorophyll bleaching, loss of antioxidants (AsA, GSH, α-tocopherol and carotenoids),
decline in total soluble proteins and thiols were observed in rice seedlings subjected to water
stress (Boo and Jung, 1999; Sharma and Dubey, 2005b; Bai et al., 2006). Increase in the
capacity of AsA regeneration system in rice plants by de novo synthesis of MDHAR, DHAR
and GR is one of the primary responses of plants to water deficit so as to mitigate oxidative
stress (Boo and Jung, 1999; Sharma and Dubey, 2005b). APX serves as an important
component of antioxidative defense system under water stress (Sharma and Dubey, 2005b).
150 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Figure 7. Components of ascorbate-glutathione cycle play an important role in hydrogen peroxide

decomposition in rice plants under abiotic stresses. This cycle maintains a high level of ascorbate in the
stroma. Monodehydroascorbate (MDHA) is formed by oxidation of ascorbate and is reconverted to
ascorbate via protonation by MDHA reductase (MDHAR) and NAD(P)H. This disproportionation also
forms dehydroascorbate (DHA). DHA is reduced to ascorbate by DHA reductase (DHAR) while reduced
glutathione (GSH) gets converted to oxidized glutathione (GSSG).

In the leaves of rice plants, salt stress preferentially enhanced the content of H2O2 as well
as the activities of SOD, APX, and peroxidase specific to guaiacol, whereas it decreased CAT
activity (Lee et al., 2001)On the other hand, salt stress had little effect on the activity levels of
GR. Expression of Cu/Zn-1, -2, and Mn-SOD-2 isoforms was preferentially enhanced by salt
stress. Out of seven APX isoforms the intensities of APX-4 to -7 were enhanced by salt stress,
whereas those of APX-1 to -3 remained almost uncharged. Lee and coworkers (2001)
suggested that SOD leads to the overproduction of H2O2 in the leaves of rice plants subjected
to salt stress and that the overproduction of H2O2 functions as the signal of salt stress, which
induces the induction of specific APX isoforms but not specific GR isoforms under CAT
deactivation (Lee et al., 2001). In 11-day-old rice seedlings, subjected to salt stress APX,
CatB, GR, SodCc1, and SodCc2 were found to be up-regulated, while CatA, CatC, and
guaiacol peroxidase (GPX) remained unaltered. In 6-week-old plants, higher mRNA levels
were observed for CatB, GR, and SodCc2. Salt had no significant effect on APX, GPX, and
SodCc1. CatA accumulation was significantly impaired. Salt stress was suggested to trigger a
differential modulation of antioxidant transcripts, possibly due to disruption of cell redox
homeostasis (Menezes-Benavente et al., 2004). Anand and coworkers (2006) suggested that
(a) peroxidase enzymes detoxify H2Ο2 under high temperature (b) CAT enzyme scavenges
H2Ο2 when the plant shifts from vegetative to reproductive stage (Anand et al., 2006). Under
chilling stress activities of enzymes SOD, CAT, APX and GR and content of ascorbic acid
increased in seedlings of rice cv. Xiangnuo-1 (chilling tolerant), while in cv. IR-50 (chilling
sensitive) decline was noticed. The results indicated that higher activities of defense enzymes
 Effect of Abiotic Stresses on Growth… 151

and higher content of antioxidant under stress were associated with tolerance to chilling
(Huang and Guo, 2005).
Metals like Cd, Pb and Al have been shown to induce oxidative stress in rice plants which
is evident from the increased content of lipid peroxides in the seedlings treated with these
metals (Shah et al., 2001; Verma and Dubey, 2003; Sharma and Dubey, 2007). A concomitant
increase in the activities of the enzymes SOD, GPX, APX and GR was observed in rice
seedlings with increasing concentration of Cd, Pb and Al treatment. APX activity was reported
to increase several fold in response to Cd and Al toxicity. Results suggest that those metals
induces oxidative stress in rice plants and that SOD, POX, GR and APX could serve as
important components of antioxidative defense mechanism against metal induced oxidative
injury (Shah et al., 2001; Verma and Dubey, 2003; Sharma and Dubey, 2007).
The potential role of SOD in the protection against salt stress was examined using
transgenic rice plants (Tanaka et al., 1999). The coding region of the yeast mitochondrial Mn-
SOD gene was introduced into rice protoplasts. The activities of overexpressed Mn-SOD and
cytosolic Cu/Zn-SOD did not change upon salt stress in either the transgenic or control plants,
whereas the chloroplastic Cu/Zn-SOD activity in control rice decreased significantly. At high
salinity, the APX activity of the transformant was about 1.5-fold higher than that in the
control. These results suggest that increased levels of APX and high levels of chloroplastic
SOD in the transformant are important factors for salt resistance in rice (Tanaka et al., 1999).
When the role of Mn-SOD in the drought tolerance of rice was examined by introducing Mn-
SOD from pea (Pisum sativum) into chloroplasts of rice, it was observed that under drought
stress transgenic leaf slices showed reduced electrolyte leakage compared to wild type (WT)
leaf slices, suggesting that transgenic plants were more resistant to PEG-induced oxidative
stress (Wang et al., 2005a). Transgenic plants also exhibited less injury, measured by net
photosynthetic rate, when treated with PEG. Wang and coworkers (2005a) suggested that SOD
is a critical component of the ROS scavenging system in chloroplasts and that the expression
of Mn-SOD can improve drought tolerance in rice. Moriwaki and coworkers (2008) showed
that the simple genetic modification of rice to express E. coli derived CAT can efficiently
increase its tolerance against salt stress. The expression of E. coli CAT gene, katE in BR5
plants caused 150% higher CAT activity than in nontransgenic plants and such transgenic rice
plants exhibited high tolerance to salt stress compared with nontransgenic plants (Moriwaki et
al., 2008). Similarly the expression of wheat CAT cDNA in transgenic rice was shown to
enhance tolerance against low temperature injury (Matsumura et al., 2002).
Non-enzymatic antioxidants include the major cellular redox buffers AsA and GSH, as
well as carotenoids and tocopherol. Alleviation of oxidative injury by the use of antioxidants
can enhance plant tolerance to abiotic stresses. Rice roots were fed with AsA and its putative
precursors to observe AsA and oxalate concentrations and the tolerance of rice plants to
chilling, water stress, and Al toxicity. Ascorbic acid concentration was significantly enhanced
in both shoots and roots of rice seedlings by feeding with D-glucose or L-galactono-γ-lactone
(Guo et al., 2005). Ascorbic acid or L-galactono-γ-lactone treatment increased accumulation of
oxalate mainly in soluble form, while these treatments decreased electrolyte leakage from root
cells, H2O2 and lipid peroxidation level in rice seedlings subjected to chilling, water stress and
Al toxicity. Antioxidant AsA also alleviated the inhibition of root growth by Al. These results
indicate that AsA and its immediate precursors protect plants against the oxidative damages
induced by various stresses. Enhanced Al resistance caused by AsA and L-galactono-γ-lactone
152 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

could possibly be arise from increased level of oxalate, which acts as metal chelator. Thus it is
proposed that manipulation of AsA and oxalate biosynthesis through enhancement of L-
galactono-γ-lactone level in plants could be a strategy for improving abiotic stress tolerance
(Guo et al., 2005). During the antioxidation process, AsA itself is oxidized to
dehydroascorbate; DHAR re-reduces the oxidized ascorbate. A high ratio of reduced to
oxidized ascorbate is important for ROS-scavenging efficiency. Ushimaru and coworkers
(2006) reported that overexpression of rice DHAR1 in Arabidopsis increases AsA levels,
which leads to increased salt tolerance.

e) Stress Induced Peptides and Proteins

Many abiotic stressful conditions lead to transcriptional activation of a large set of plant
genes, which in turn causes accumulation of certain novel proteins or increased synthesis of
pre-existing protein (Skriver and Mundy, 1990; Xu et al., 1996; Sharma and Dubey, 2007). It
is generally assumed that stress-induced proteins could play a role in stress tolerance (Xu et
al., 1996). Heat shock proteins (HSPs), which are synthesized in plants on exposure to high
temperatures, protect plants from damage caused due to heat stress or help repair the damage
caused by stress. All organisms produce HSPs in response to elevation in temperature and
certain other stresses (Lindquist and Craig, 1988). HSPs, many of them also called chaperones
are responsible for protein folding, assembly, translocation and degradation in many normal
cellular processes, stabilize proteins and membranes, contribute to cellular homeostasis and
can assist in protein refolding under stress conditions (Wang et al., 2004). Plant HSPs consist
of a few high-molecular-weight classes and a complex group of low-molecular-weight proteins
with molecular sizes ranging from 15 to 30 kDa (Vierling, 1991). Rice is sensitive to high-
temperature stress at almost all the stages of its growth and development. Rice seedlings
accumulate stainable amounts of the 104 and 90 kDa proteins which accumulate to different
extents on exposure to salinity, water stress, low-temperature treatment and exogenous ABA
application (Pareek et al., 1995). The in vitro polysome translation-products from heat shocked
rice seedlings showed twelve HSPs (Dai et al., 1996). Two full-length cDNA clones, pTS1 and
pTS3, specific for heat-shock proteins were isolated from a rice cDNA library. Both
encoded 16 to 20 kDa class I heat-shock proteins. Heavy-metal stress, in addition to heat stress,
increased the levels of the corresponding mRNAs (Tseng et al., 1993).
Considering the crucial role of HSP-101 in imparting thermotolerance to cells, Katiyar-
Agarwal and coworkers (2003) introduced A. thaliana HSP101 (AtHSP101) cDNA into Pusa
basmati 1 cultivar of rice. The transgenic rice lines showed significantly better growth
performance in the recovery phase following the stress. This thermotolerance advantage
appeared to be solely due to over-expression of HSP101 as neither the expression of low
molecular weight HSPs nor of other proteins was altered in the transgenic rice (Katiyar-
Agarwal et al., 2003).
Small HSPs (sHSPs) represent the major family of HSPs induced by heat stress in plants
(Waters et al., 1996). Rice seedlings subjected to high temperature showed 73 differentially
expressed proteins. A total of 48 proteins were identified. The results showed that a group of
low molecular small sHSPs were newly induced by heat stress. Among these sHSPs, a low
molecular weight mitochondrial (Mt) sHSP was validated further by western blot analysis (Lee
et al., 2007). Small heat shock protein sHSP17.7 was isolated from heated rice seedlings, and
 Effect of Abiotic Stresses on Growth… 153

the influence of rice sHSP17.7 expression on the viability of E. coli under heat-shock
conditions was assessed (Murakami et al., 2004). After heating, the survival rate of sHSP17.7
cells was 2-fold higher than that of the control cells. The molecular chaperone activity of
sHSP17.7 was investigated using CAT as a substrate. Recombinant sHSP17.7 cells had heat-
stable chaperone properties that were capable of protecting stressed CAT from precipitation.
Transgenic rice plants with increased levels of sHSP17.7 protein exhibited significantly
increased thermotolerance compared to untransformed control plants. The transgenic rice plant
with the highest constitutive expression of sHSP17.7 had significantly greater resistance to
UV-B stress than untransformed control plants. Increase in the degree of resistance of
transgenic plants to UV-B was accompanied by an increase in production of sHSP17.7 protein
(Murakami et al., 2004). Overproduction of sHSP17.7 could increase drought tolerance in
transgenic rice seedlings (Sato and Yokoya, 2008). At the end of drought treatments, only
transgenic seedlings with higher expression levels of sHSP17.7 protein were found to regrow
after rewatering.
Plants have a number of defense mechanisms for combating the toxicities of many metals.
One such mechanism involves the production of cysteine-rich peptides, such as phytochelatins
(PCs) and metallothioneins (MTs), for detoxification or homeostasis of heavy metals (Cobbett
and Goldsbrough, 2002). PCs are derived from GSH and related thiols in a γ-glutamylcysteinyl
transpeptidation reaction catalyzed by phytochelatin synthases (PC synthases) (Grill et al.,
1989; Rea et al., 2004) and have the general structure (γ-Glu-Cys)n-glycine, where n can vary
from 2 to 11 (Rea et al., 2004). PCs form stable complexes with heavy metals in the cytosol,
and these metal-PC complexes are subsequently sequestered into the vacuole (Zenk, 1996;
Cobbett, 2000). Overexpressing the PC synthase gene in transgenic plants appears to be a
promising approach for developing metal tolerance in plants. From 3 week old rice seedlings,
treated with 50 μM copper sulfate, PC was extracted and purified. Cd was the most effective
stimulator, followed by Pb, Cu, Ag, Co and other divalent cations (Yan et al., 2000). Exposure
of several species of the family Poaceae to cadmium results in the formation of metal-induced
peptides of the general structure (γ-Glu-Cys)n-Ser (n = 2-4) (Klapheck et al., 1994). These
peptides are presumably formed from hydroxymethyl-glutathione (γ-Glu-Cys-Ser) and are
termed hydroxymethyl-phytochelatins (hm-PCs). The hm-PCs were isolated from the roots of
Cd-exposed rice plants. The hm-PCs probably play a significant role in heavy metal
detoxication in rice. In addition to this new form of γ-Glu-Cys (γ-EC) peptide, PCs and γ-EC
peptides without C-terminal Ser or Gly are found. All γ-EC peptides are synthesized in roots as
well as in shoots of rice plants without delay after incubation of plants in 100 μM CdCl2
(Klapheck et al., 1994). To reduce the accumulation of Cd in rice seeds, the expression of
phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). Cd
accumulation was reduced by about half in the seeds of RNAi rice whereas no apparent
difference of growth appeared between RNAi and wild-type plants. The results suggest that
this new approach can be used to control heavy metal accumulation in seeds of rice crop. Shah
and Dubey (1998a) isolated and characterized a 18 kDa cadmium inducible protein complex
from rice seedlings and suggested that Cd2+ binds possibly with the help of 4-SH groups to this
peptide in mercaptide bonds. This complex, which has a comparatively higher molecular
weight (18 kDa) than conventional phytochelatins, may help in sequestration of excess Cd2+
ions in rice plants.
154 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

MTs are cysteine-rich polypeptides encoded by a family of genes. MTs are low molecular
weight (6-7 kDa), 60-65 amino acid residue long, cysteine (20 molecules)-rich metal-binding
(through mercaptide bonds) proteins (Liu et al., 2000). A novel rice genomic sequence
encoding coding segments homologous to other metallothionein-like genes was isolated from
rice genomic library. This sequence, designated as rgMT (rice genomic metallothionein-like
gene) was found to be differentially expressed in rice plants under different stress conditions.
Excess heavy metals and heat shock, lead to elevated expression of rgMT (Hsieh et al., 1995).
In many eukaryotic and prokaryotic organisms under salinity, water deficit, high
osmolarity and low temperature a group of glycine-rich, hydrophilic proteins known as
hydrophilins or late embryogenesis abundant (LEA) proteins are synthesized in increased
amounts. A number of mechanisms have been proposed to justify the roles of these proteins in
freezing tolerance, salinity tolerance, desiccation tolerance, water replacement, ion
sequestering and membrane stabilization (Close, 1996; Cuming, 1999; Dubey, 1999; Tompa et
al., 2006; Abu-Abied et al., 2006; Tolleter et al., 2007). It has been hypothesized, based on the
correlation of LEA gene expression with physiological and environmental stresses, that LEA
proteins may play a protective role in plant cells under various stress conditions as a protective
measure for the survival of the plant (Chandler and Robertson, 1994).
Cold-regulated gene called Wcs19 encodes a protein of unknown function (WCS19) in
rice, which shares identity with three different groups of LEA proteins LEA3-L1, LEA3-L2
and LEA3-L3 (NDong et al., 2002). Arabidopsis plants transformed with the wcs19 gene
showed a significant increase in freezing tolerance (NDong et al., 2002). Tolleter and
coworkers (2007) observed that a mitochondrial LEA protein (LEAM) when expressed in
seeds interacted with membranes in the dry state and protected liposomes as well as inner
mitochondrial membranes during desiccation (Tolleter et al., 2007). Transgenic rice expressing
wheat LEA genes PMA80 and PMA1959 showed enhanced drought and salt tolerance in
glasshouse tests (Cheng et al., 2002). When a LEA protein gene, HVA1, from barley (Hordeum
vulgare L.) was introduced into rice suspension cells, second generation transgenic rice plants
showed significantly increased tolerance to water deficit and salinity. Xu and coworkers
(1996) found that the extent of increased stress tolerance could be correlated with the level of
the HVA1 protein accumulated in the transgenic rice plants. Thus, LEA genes hold
considerable potential for use as molecular tools for genetic crop improvement toward stress
tolerance. A LEA protein gene OsLEA3-1 was over-expressed in rice to test the drought
resistance of transgenic lines under the field conditions. OsLEA3-1 is induced by drought and
salt but not by cold stress. Drought resistance pre-screening of T1 families at anthesis stage
revealed that the over-expressing families with OsLEA3-S and OsLEA3-H constructs had
significantly higher relative yield (yield under drought stress treatment/yield under normal
growth conditions) than the wild type under drought stress conditions, although a yield penalty
existed in T1 families under normal growth conditions. These results indicate that transgenic
rice with significantly enhanced drought resistance and without yield penalty can be generated
by over-expressing OsLEA3-1 gene with appropriate promoters (Xiao et al., 2007).
 Effect of Abiotic Stresses on Growth… 155

f) Other Components (Signaling pathway, Transport proteins, Transcription

Factors)

Alteration in components associated with signaling pathway may improve stress tolerance
of plants. The generalized scheme of signal transduction implies that the extracellular signal
binds to a transmembrane receptor, which in turn activates GTP-binding proteins. The GTP-
binding protein either regulates a cascade of kinases (MAPKKK, MAPKK, and MAPK;
MAPK stands for mitogen-activated protein kinase) or a G-protein effector, leading to a
change in the level of intracellular signals called second messengers (such as cAMP, cGMP,
protein kinase C, Ca2+-dependent kinases and calmodulin-dependent kinases). Mitogen
activated protein kinase cascade plays a crucial role in various biotic and abiotic stresses.
Identification and characterization of upstream kinases and other regulatory components is
necessary to understand the mechanism of MAPK activation by different external stimuli
(Rohila and Yang, 2007). MAP kinase kinase performs an important function of integrating
upstream signals to mitogen activated protein kinase for further appropriate cellular responses.
Kumar and coworkers (2008) suggested involvement of specific MAP kinase kinase in
different abiotic stress signaling and also possible cross talks that could exist during the
signaling processes. Agrawal and coworkers (2003) characterized a jasmonic acid-inducible
MAPK gene. The weak constitutive mRNA expression of OsBWMK1 (blast and wound
inducible MAPK gene of Oryza sativa L.) was potently enhanced and transiently regulated
within 15-30 min of heavy metals, drought, high salt, high temperature and environmental
pollutants such as ozone and sulfur treatment, suggesting that OsBWMK1 converges diverse
stress signals in rice (Agrawal et al., 2003). These results strongly suggest the physiological
importance of OsBWMK1 in mediating multiple extrinsic signals in rice. Jeong and coworkers
(2006) isolated and characterized a putative rice MAPK gene (designated OsMAPK44).
OsMAPK44 gene. expression in rice cv. Pokkali (salt resistant) was slightly up-regulated
within 30 min and then disappeared rapidly, while cv. IR64 (salt sensitive) maintained its
expression for 1 h following down-regulation. Under salinity stress, OsMAPK44
overexpression in transgenic rice plants showed less damage and greater ratio of potassium and
sodium than OsMAPK44 suppressed transgenic lines did, suggesting that OsMAPK44 may
have a role to prevent damages due to salinity (Jeong et al., 2006).
Cyclin-dependent protein kinases (CDKs) form a conserved superfamily of eukaryotic
serine/threonine protein kinases which require binding to a regulatory cyclin for activity.
Huang and coworkers (2008) proposed that CDKs may be involved in the salt stress signaling
in rice. The rice CDKC1 transcript was shown to be induced by salt stress. OsSIPK gene
(salicylic acid-induced protein kinase gene of Oryza sativa L.) can be implicated in salt
responsive signaling cascades and transcription of certain genes (Lee et al., 2008). A time
course (30 to 120 min) experiment using salt stress revealed that the OsSIPK mRNA is
strongly induced by sodium chloride. OsSIPK protein was found to be localized in the nucleus.
Calcium-dependent protein kinases (CDPKs) belong to the family of serine/threonine kinases.
In situ detection of the transcript and immunolocalization of rice Ca2+-dependent protein
kinase, OsCDPK7 revealed that OsCDPK7 was expressed predominantly in vascular tissues of
crowns and roots, vascular bundles and central cylinder, respectively, where water stress
occurs most severely. Similar localization patterns with stronger signals were observed in
stress-tolerant OsCDPK7 over-expressing transformants. Over-expression of OsCDPK7
enhanced induction of some stress-responsive genes in response to salinity/drought, but not to
156 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

cold. Thus, it was suggested that the downstream pathways leading to the cold and salt/drought
tolerance are different from each other. It seems likely that at least two distinct pathways
commonly use a single CDPK, maintaining the signalling specificity through unknown post-
translational regulation mechanisms. These results demonstrate that simple manipulation of
CDPK activity has great potential with regard to plant improvement (Saijo et al., 2000). The
transcript of a putative target gene of the OsCDPK7 signaling pathway, rab16A, was also
detected essentially in the same tissues upon salt stress, suggesting that the OsCDPK7 pathway
operates predominantly in these regions (Saijo et al., 2001). OsCDPK7 gene was transferred
into rice via Agrobacterium-mediated method. T2 transgenic seeds could germinate in 0.2
mol/L NaCl medium, and T2 transgenic young plants could rejuvenate after treatment with 0.4
M NaCl for 10 days, while the control plants could not germinate and died in salt stress. This
finding proved that the regulation factor of the plant signal transduction could enhance the salt
tolerance of transgenic plants (Wang et al., 2008a).
Calcineurin is a Ca2+- and calmodulin-dependent serine/threonine phosphatase and has
multiple functions in animal cells including regulating ion homeostasis. The differentially
induced expression of OsCIPK genes by different stresses and the examples of improved stress
tolerance of the OsCIPK transgenic rice plants suggest that rice CIPK genes have diverse roles
in different stress responses and some of them may possess potential usefulness in stress-
tolerance improvement of rice (Xiang et al., 2007). OsCIPK23, a member of CBL (Calcineurin
B-Like) Interacting Protein Kinase (CIPK) family, was found to be upregulated by various
abiotic stresses. RNA interference-mediated suppression of OsCIPK23 expression conferred a
hypersensitive response to drought stress, indicating its possible role in drought stress. In
consistent, overexpression of OsCIPK23 induced the expression of several drought tolerance
related genes (Yang et al., 2008). Ma and coworkers (2005) generated transgenic rice plants
that not only expressed a truncated form of the catalytic subunit of mouse calcineurin, but also
were able to grow and fertilize normally in the field. Expression of the mouse calcineurin
protein functionally improved the salt stress tolerance of rice partly by limiting Na+
accumulation in the roots (Ma et al., 2005).
14-3-3 proteins function as major regulators of primary metabolism and cellular signal
transduction in plants. However, their involvement in plant defense and stress responses is
largely unknown. Chen and coworkers (2006b) examined the rice GF14 family that comprises
eight numbers. The phylogenetic comparison with the Arabidopsis 14-3-3 family revealed that
the majority of rice GF14s might have evolved as an independent branch. At least four rice
GF14 genes, GF14b, GF14c, GF14e and Gf14f were differentially regulated by salinity and
drought (Chen et al., 2006b).
Rice plants are relatively sensitive to soil salinity, and NaCl is a major salt in saline soils
(Flowers, 2004). Sodium enters plant roots by two ways: the symplastic pathway mediated by
cation channels/transporters and the apoplastic pathway in which Na+ enters the transpiration
stream. In rice it has been shown that HKT (High-affinity K+ Transporter) transporters are
involved in root Na+ uptake (Garciadeblás et al., 2003; Platten et al., 2006). In conditions of
high Na+ concentrations, Na+ may be taken up ectopically by K+ and other cation transporters.
SKC1, a HKT family member (OsHKT8/OsHKT1;5), is a Na+ selective transporter identified
in a salt-tolerant indica variety, Nona Bokra. The Na+ transport activity of NSKC1 (from Nona
Bokra) was higher than that of KSKC1 (from a salt susceptible japonica variety, Koshihikari).
Under salt stress, rice seedlings carrying NSKC1 exhibited more tolerance to salinity than
those carrying KSKC1, resulting from greater Na+ extraction from xylem sap by NSKC1. The
 Effect of Abiotic Stresses on Growth… 157

xylem sap and shoot Na+ content in NSKC1 seedlings was lower than that noted in KSKC1
seedlings, whereas the reverse was true for K+ content (Lin et al., 2004).
Vacuolar sequestration of Na+ is catalyzed by OsNHX1 gene (Na+/H+ antiporter gene of
Oryza sativa L.) in rice (Fukuda et al., 2004). The expression of the NHX1 gene was up-
regulated by salinity in rice (Fukuda et al., 1999). The overexpression of OsNHX1 in rice
improved salt tolerance of the transgenic plants, without adverse effects on their Na+ and K+
contents and plant growth (Fukuda et al., 2004). This may be useful for genetic improvement
of salt tolerance in rice. E. coli nhaA gene encodes a Na+/H+ antiporter, which plays a critical
role in ion homeostasis. Wu and coworkers (2005a) transferred a bacterial nhaA gene into rice
and detected high expression in the transgenic rice. The germination rate, growth and average
yield per plant of the transgenic lines were better than those of control lines under salt or
drought stress. Moreover, the sodium and proline content of the transgenic lines under salt or
drought stress was also higher than in control lines, implying that nhaA over-expression
enhances osmoregulation by activating the biosynthesis of proline (Wu et al., 2005a).
Multiple transcription factors, including ICE (inducer of CBF expression), CBFs/DREBs,
AREB/ABF/ABI/bZip, MYC/ MYB and NACs, have been well characterized (Chinnusamy et
al., 2004, 2006). Induction of stress tolerance through engineering for over-expression of
transcription factor genes is emerging as an attractive proposition in recent years. A cis-acting
promoter element DRE (drought responsive element) plays an important role in regulating
gene expression in response to abiotic stresses (salt, drought and cold stresses). DREB
transcription factors play key roles in plant stress signaling transduction pathway, they can
specifically bind to DRE/CRT element (G/ACCGAC) and activate the expression of many
stress inducible genes. Dubouzet and coworkers (2003) identified five DREB cDNAs in rice:
OsDREB1A, OsDREB1B, OsDREB1C, OsDREB1D and OsDREB2A. OsDREB1A and
OsDREB1B were induced by cold, while OsDREB2A was regulated by salt and drought stress.
Chen and coworkers (2008) isolated three novel rice DREB genes, OsDREB1E, OsDREB1G
and OsDREB2B, which are homologous to Arabidopsis DREB genes. The yeast one-hybrid
assay indicated that OsDREB1E, OsDREB1G, and OsDREB2B can specifically bind to the C-
repeat/DRE element. To elucidate the function of respective OsDREB genes, these were
introduced into rice by Agrobacterium-mediated transformation. Transgenic rice plants
analysis revealed that over-expression of OsDREB1G and OsDREB2B in rice significantly
improved their tolerance to water deficit stress, while over-expression of OsDREB1E could
only slightly improve the tolerance to water deficit stress, suggesting that the OsDREBs might
participate in the stress response pathway in different manners (Chen et al., 2008). Gutha and
Reddy (2008) reported the functional characterization of a DREB transcription factor,
DREB1B gene from rice. The OsDREB1B gene was differentially regulated at the
transcriptional level by osmotic stress, oxidative stress and cold. The data obtained provided
strong in vivo evidence that OsDREB1B is involved in both abiotic and biotic stress responses,
and confers broad-spectrum stress tolerance to transgenic plants (Gutha and Reddy, 2008). A
novel rice DREB transcription factor, OsDREB1F, was cloned and characterised via
subtractive suppression hybridisation (SSH) from upland rice. Expression analysis revealed
that OsDREB1F gene was induced by salt, drought, and cold stresses. Subcellular localization
results indicated that OsDREB1F localizes in nucleus. Transgenic plants harbouring
OsDREB1F gene showed enhance tolerance to salt, drought and low temperature in rice
(Wang et al., 2008b).
158 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

WRKY transcription factors contain one or two conserved WRKY domains, about 60
amino acid residues with the WRKYGQK sequence followed by a C2H2 or C2HC zinc finger
motif. Evidence is accumulating to suggest that the WRKY proteins play significant roles in
responses to biotic and abiotic stresses, and in development in plants (Wu et al., 2005b). An
OsWRKY11 gene, which encodes a transcription factor with the WRKY domain, was identified
as one of the genes that were induced by both heat shock and drought stresses in seedlings of
rice. To determine if overexpression of OsWRKY11 confers heat and drought tolerance,
OsWRKY11 cDNA was fused to the promoter of HSP101 of rice and introduced into a rice
cultivar Sasanishiki. Overexpression of OsWRKY11 was induced by heat treatment. After heat
pretreatment, the transgenic lines showed significant heat and drought tolerance, as indicated
by the slower leaf-wilting and less-impaired survival rate of green parts of plants (Wu et al.,
2009). Wang and coworkers (2007) reported functional characterization of a rice WRKY gene,
OsWRKY89. RNA gel blot analysis indicated that OsWRKY89 was strongly induced by UV-B
radiation treatment. Overexpression of the OsWRKY89 gene enhanced tolerance to UV-B
irradiation (Wang et al., 2007). Ramamoorthy and coworkers (2008) analyzed the publicly
available rice genome sequence databases and predicted 103 genes encoding WRKY
transcription factors. Their expression profiles under normal and abiotic stress were examined.
Under normal growth conditions, 65 WRKY genes were expressed differentially either in their
transcript abundance or in their expression patterns. Under abiotic (cold, drought and salinity)
stresses and various phytohormone treatments, 54 WRKY genes exhibited significant
differences in their transcript abundance; among them three genes were expressed only in
stressed conditions. Among the stress-inducible genes, 13 genes were regulated only by abiotic
stresses, another set of 13 genes were responsive to only phytohormone treatments and the
remaining 28 genes were regulated by both factors, suggesting an interaction between abiotic
stress and hormone signaling (Ramamoorthy et al., 2008).
It has been established that ethylene response factor (ERF) proteins play important
regulatory roles in plant response to abiotic and biotic stresses. Compared with the wild-type
plants, overexpression of TERF1 (encoding a tomato ERF protein) resulted in an increased
tolerance to drought and high-salt in transgenic rice and such enhanced tolerance was
associated with the accumulation of proline and the decrease of water loss (Gao et al., 2008).
Furthermore, TERF1 can effectively regulate the expression of stress-related functional genes
Lip5, Wcor413-l, OsPrx and OsABA2, as well as regulatory genes OsCDPK7, OsCDPK13 and
OsCDPK19 under normal growth conditions. Analyses of cis-acting elements showed the
existence of DRE/CRT and/or GCC-box in TERF1 targeted gene promoters. Gao and
coworkers (2008) suggested that ectopic expression of TERF1 in transgenic rice caused a
series of molecular and physiological alterations with enhanced tolerance to abiotic stress,
indicating that TERF1 might have similar regulatory roles in response to abiotic stress in rice
(Gao et al., 2008). Most rice cultivars die within a week of complete submergence. A few
cultivars, such as the cultivar FR13A, are highly tolerant and survive up to two weeks of
complete submergence owing to a major quantitative trait locus designated Submergence 1
(Sub1) near the centromere of chromosome 9. Overexpression of Sub1A-1 in a submergence-
intolerant O. sativa sp. japonica conferred enhanced submergence tolerance to the plants,
downregulation of Sub1C and upregulation of alcohol dehydrogenase 1 (Adh1), indicating that
Sub1A-1 is a primary determinant of submergence tolerance (Xu et al., 2006).
NAM, ATAF and CUC (NAC) transcription factors comprise a large plant-specific gene
family and a few members of this family have been characterized for their roles in plant
 Effect of Abiotic Stresses on Growth… 159

growth, development, and stress tolerance. Fang and coworkers (2008) performed systematic
sequence analysis and found 140 putative NAC or NAC-like genes (ONAC) in rice. The
expression levels of stress-responsive NAC (SNAC) genes family were checked under various
abiotic stresses including drought, salinity and low temperature. Based on microarray data,
Fang and coworkers (2008) found that more than 40 genes of this family were responsive to
drought and salt stresses (Fang et al., 2008). Chao and coworkers (2005) found that multiple
rice transcription factors, including a NAC gene, were induced in the early stage of salt stress.
OsNAC6, a member of ATAF subfamily, was also induced by cold, salt and drought (Ohnishi
et al., 2005).
Hu and coworkers (2008) showed that overexpression of stress responsive gene SNAC1
significantly enhances drought resistance and salt tolerance at the vegetative stage as well as
reproductive stage while showing no phenotypic changes or yield penalty. SNAC1 is induced
predominantly in guard cells by drought and encodes a NAM, ATAF, and CUC (NAC)
transcription factor with transactivation activity. DNA chip analysis revealed that a large
number of stress-related genes were up-regulated in the SNAC1-overexpressing rice plants.
Therefore Hu and coworkers (2008) suggested that SNAC1 holds promising utility in
improving drought and salinity tolerance in rice.

5. STRATEGIES TO IMPROVE STRESS TOLERANCE

IN RICE PLANTS: PRESENT AND FUTURE

Abiotic stresses are major constraints in cultivation of rice crop throughout the world. In a
world where population growth exceeds food supply, it is imperative that scientists should
focus efforts to find solutions that may help plants overcome the increasing challenging
environmental conditions (Alcazar et al., 2006). Rice is a major crop in the world and provides
the staple food for over half of the world’s population. From thousands of years of cultivation
and breeding to recent genomics, rice has been the focus of agriculture and plant research. Rice
domestication, breeding and genetics have led a great foundation for modern rice research (Ma
et al., 2007). Rice has the smallest genome among the cultivated cereals, and it conserves
much of the gene content and, to some extent, gene order present in other species (Gale and
Devos, 1998). The full rice genome has now been sequenced (Goff et al., 2002), allowing the
identification and localization of genes related to stress tolerance. Due to recent advances in
the understanding of the rice genome, substantial progress has been made in the development
of rice varieties with tolerance to various abiotic stress factors, including drought, salinity and
flooding (Wang et al., 2005a; Xu et al., 2006; Gao et al., 2007, 2008; Jena and Mackill, 2008).
Comparative genomics and techniques such as high-throughput analysis of expressed sequence
tags, large scale parallel analysis of gene expression, targeted or random mutagenesis, and
gain-of-function or mutant complementation, discovery of novel genes, determination of their
expression patterns in response to abiotic stress, and an improved understanding of their roles
in stress adaptation (obtained by the use of functional genomics) will provide the basis of
effective engineering strategies leading to greater stress tolerance (Cushman and Bohnert,
2000). Currently, a number of genes related to abiotic stress tolerance are available and the
technology to incorporate these traits to rice varieties is practicable. However, further advances
in understanding the requirements for transgene regulation, expression, and refinement in the
160 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

gene transfer techniques will strengthen the process for the development of rice cultivars
tolerant to various abiotic stresses (Giri and Laxmi, 2000).
Two basic genetical approaches currently being utilized to improve stress tolerance
include: (1) exploitation of natural genetic variations, either through direct selection in
stressful environments or through the mapping of quantitative trait loci (QTL) and subsequent
marker-assisted selection and (2) generation of transgenic plants to introduce novel genes or
alter expression levels of the existing genes to affect the degree of abiotic stress tolerance
(Blumwald et al., 2004). If rice breeding and genetic endeavors have generated genetic
materials that paved the way for recent advances in studying specific genes that are important
for many developmental and physiological traits, then the sequencing of the rice genome and
the subsequent functional genomics and proteomics efforts have yielded great volumes of
global molecular and biochemical information on many thousands of genes and proteins (Ma
et al., 2007). Such information has already greatly benefited rice research and allows
researchers to investigate specific processes or pathways with a global perspective of the
genome and great comprehensiveness hitherto not possible (Ma et al., 2007).
Genetic improvement of rice through conventional breeding methods is an effective
strategy for developing high yielding varieties. This has been accomplished by transferring
genes from the secondary gene pool of the wild relatives to the cultivated species of rice
through distant hybridization (Giri and Laxmi, 2000). Early attempts to evaluate the genetic
basis of stress tolerance in plants were restricted to simple genetic models (Blumwald et al.,
2004). In recent years, improved understanding of how rice responds to abiotic stresses and the
basis of varietal differences in tolerance has been applied in marker-aided selection. Marker-
assisted selection of progeny from crosses between tolerant, low-yielding cultivars and
susceptible, high yield-potential lines theoretically allows for much greater efficiency in a
breeding program, because extensive unreliable phenotypic screening can be eliminated, and
linkage drag can be effectively reduced (Lafitte et al., 2004b). Through expression profiling of
many genes simultaneously, it has been possible to identify three types of stress-responsive
gene networks: early signaling pathways, adaptive responses and genes that reflect
downstream results of damage. For crop improvement, the identification of useful allelic
variation for genes related to adaptive responses may be the most promising approach. Once
such genes or gene combinations are identified, either molecular approaches or trait-specific
physiological screens can be used to search for these superior alleles. Marker-assisted
backcrossing can then be applied to incorporate these alleles into agronomically superior
germplasm (Lafitte et al., 2004a).
With the development of molecular markers, evaluating the inheritance of abiotic stress
tolerance became a more tractable problem since specific QTL could be identified. Costly and
time-consuming process of fine-mapping may be circumvented by considering the stress-
responsive candidate genes that underlie a given QTL (Wayne and McIntyre, 2002; Ishimaru
et al., 2004). A strong putative candidate region can be used directly in breeding, however,
even if final gene identity is not known, as long as its position is confirmed through association
with phenotype in mapping populations (Thorup et al., 2000; Ramalingam et al., 2003).
Moreover, combining the transgenic approaches with traditional breeding methods will be an
effective approach to develop abiotic stress-tolerant rice cultivars. Several studies have been
done to identify QTL conferring tolerance to abiotic stresses, and to relate QTLs to
physiological tolerance mechanisms (Wang et al., 2005b; Ren et al., 2005; Wan et al., 2005;
Yue et al., 2008; Frei et al., 2008). Further map-based cloning and/or marker aided selection
 Effect of Abiotic Stresses on Growth… 161

will help to map, isolate, and clone more genes of agronomic importance for its transfer to rice
plants (Martin et al., 1993; McCouch et al., 1997).
Significant advances have been made in the genetic engineering of rice since the first
transgenic rice plant production in the late 1980s. Selection and use of appropriate promoters,
selectable markers and reporter genes have been helpful for development of efficient protocols
for production of transgenic rice in a number of cultivars (Giri and Laxmi, 2000). To address
some of the problems in transferring desirable traits, however, would require either the
modification of the gene or engineering of transformation vector with multiple genes and their
exploitation in developing transgenic rice. Particle bombardment method has been used
extensively for the development of gene transfer protocols in rice to overcome genotypic
barriers however gene silencing has been found predominantly in transgenic rice plant
produced via particle bombardment (Kohli et al., 1999). This has facilitated multiple copy
integration of transgenes into the genome of rice triggering gene silencing. Recent
developments in gene transfer involving Agrobacterium appear to be beneficial to address the
problem of gene silencing (Khanna and Raina, 1999; Tyagi et al., 1999; Yokoi and Toriyama,
2000). Apprehension of environmental risks from commercial transgenic crops in general and
rice in particular cannot be ruled out. The hunch is that, the transgenics can convert the crop
plants into weeds in the cultivated area or the transgene escaping into natural habitats, and this
would affect public acceptance (Bhatia and Mitra, 1998; Ferber, 1999).
Though considerable progress has been made in the production of transgenic rice for
abiotic stress tolerance yet the achievements are not satisfactory. Some of the main problems
which have been encountered in producing stress tolerant rice plants include (1) tolerance to
abiotic stressis due to a complex trait influenced by the coordination and differential
expression of a network of genes, (2) while T-DNA integrates essentially everywhere in the
Arabidopsis genome, integration is detected only in the gene space, namely in the gene-rich,
transcriptionally active, regions of the rice genome (Barakat, 2000), (3) absence of transgene
expression in T0 plants, sterility of T0 plants, non-transmission of intact transgenes to some or
all progenies, silencing of transgene expression in progeny plants. Transgene stability was
significantly related to differences in transgene structure and expression levels (Vain et al.,
2002), (4) the marker gene used in transformation may affect the food safety and biosafety and
thus limit the application of transgenic rice in agricultural production (Giri and Laxmi, 2000).
One major limitation to progress is the lack of knowledge of the functions and interactions of
tolerance-related genes. While many genes have been identified with great potential for
abiotic-stress engineering, most of them, more or less, affect rice morphology when they are
constitutively overexpressed. Utilization of some of these genetic characteristics, therefore,
while producing desirable stress-related results, may have concomitant negative impacts.
Quantifying the advantages and disadvantages of breeding may take some time. However, it is
desirable to generate transgenic plants with gene expression driven by a controllable promoter
so that the gene products are not produced unless plants are subjected to stress.
With the study of the functional genomics of plants, considerably more information about
the mechanisms by which plants perceive and transduce these stress signals to initiate adaptive
responses will be obtained and with the improvement of the transgenic approach, marker free
transgenic rice will be produced (Breitler et al., 2004; Cao et al., 2006). The increase of the
productivity of rice and other crops is the main purpose of transgenic studies. Thereby,
different strategies need to be tested and adapted experimentally to genetically improve the
abiotic stress tolerance in rice. Ultimately, the different strategies must be integrated, and the
162 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

genes representing distinctive approaches must be combined to substantially increase abiotic

stress tolerance in rice. Our limited knowledge related to stress-associated metabolic
alterations remains a major gap in our understanding; therefore, comprehensive profiling of
stress-associated metabolites is most relevant to the successful molecular breeding of stress-
tolerant rice plants. Unraveling additional stress-associated gene resources, from both rice
plants and highly salt and drought tolerant model plants, will enable future molecular
dissection of salt-tolerance mechanisms in rice plants (Vinocur and Altman, 2005).
Abiotic stress tolerant transgenic rice plants have been produced using a host of different
genes and transcript profiling by micro- and macroarray-based methods which has opened the
gates for the discovery of novel salt stress mechanisms in rice and comparative genomics is
turning out to be a critical input in this respect. From the data on comprehensive transcript
expression profiling of clones representing abiotic stress-associated genes of rice, it is shown
that transcriptional and translational machineries are important determinants in controlling
abiotic stress response and gene expression response in tolerant and susceptible rice plants
differs mainly in quantitative terms. Interconnected signal transduction pathways that lead to
multiple responses to abiotic stresses have been difficult to study using traditional approaches
because of their complexity and the large number of genes and gene products involved in the
various defensive and developmental responses of the plants. New insights into signaling
networks involved in abiotic stress adaptation have now been gained by transcriptome analyses
that suggest the existence of both specific signaling and of crosstalk between signal
transduction pathways in response to environmental changes (Baier et al., 2006). During the
past couple of years, proteomics has been a leading technology for the high-throughput
analysis of proteins on a genome-wide scale. Considerable research effort has been made to
analyze rice proteome and remarkable progress has been achieved in the systematic and
functional characterization of proteins in various tissues and organelles of rice. As part of this
research, a system for direct differential display using 2-dimensional electrophoresis (O’Farell,
1975) has been developed for the identification of rice proteins that vary in expression under
different physiological conditions and among different tissues. The information obtained from
proteomic technologies regarding proteins modification, protein-protein interaction and the
development of new methods for differential proteomics will aid in deciphering more precisely
the functions of known and/or unknown proteins in rice (O’Farell, 1975).
Various studies have demonstrated that common genes are activated by such diverse
stresses as wounding, pathogen attack, salt stress and high temperature, etc in rice. Rabbani
and coworkers (2003) using a rice cDNA microarray including about 1,700 independent
cDNAs derived from cDNA libraries prepared from drought, cold, and high salinity treated rice
plant identified a total of 73 genes as stress inducible including 58 novel unreported genes in
rice. Among them, 36, 62, 57 and 43 genes were induced by cold, drought, high salinity and
ABA, respectively. These workers have observed strong association in the expression of
stress-responsive genes and found 15 genes that responded to all four treatments. The rice
genome database search enabled them not only to identify possible known cis-acting elements
in the promoter regions of several stress-inducible genes but also to expect the existence of
novel cis-acting elements involved in stress-responsive gene expression in rice stress-inducible
promoters. The complexities of abiotic stress responses essentially preclude the precise
experimental dissection of individual abiotic stresses, and suggest that further studies of
individual stresses might not be the best approach. Genomics, proteomics and metabolomics,
coupled with a strong bioinformatics capability, now enable a ‘broad’ approach to be taken in
 Effect of Abiotic Stresses on Growth… 163

the study of plant responses to abiotic stresses. Thus, the entire system of networks of
signalling pathways and key interconnecting processes that lead to the multiple defensive
responses can be described in detail. The identification and analysis of genes exhibiting large
expression responses to several different types of stress may provide insights into the
functional basis of multiple stress tolerance in plant species including rice (Swindell, 2006).

6. CONCLUSION
Abiotic stresses adversely affect the productivity of rice in various parts of the world. The
abiotic stresses such as drought, salinity, extremes of temperature, anerobiosis, heavy metals,
gaseous pollutants cause considerable loss in rice yield every year. These stresses lead to
disruption of homeostasis in the rice plant. Abiotic stresses lead to a series of physiological,
biochemical and molecular changes within the rice plants. The abiotic stresses adversely affect
key metabolic processes in plants like synthesis of proteins and nucleic acids, photosynthesis,
respiration, nitrogen assimilation, etc. which may ultimately result in poor growth of plants
and reduction in yield. Plants respond to these stresses by displaying complex, quantitative
traits that involve the functions of many genes. Abiotic stresses lead to accumulation of low-
molecular weight organic compounds, compatible solutes or osmolytes, stress specific
proteins, late-embryogenesis-abundant proteins, heat shock proteins, phytochelatins,
metallothioneins, and lead to activation of several detoxification and antioxidative enzymes.
Although, different rice cultivars have variable thresholds for stress tolerance, and some of
them can successfully tolerate severe stresses and still complete their life cycles, most cultivars
are highly sensitive and either die or suffer from productivity loss after being exposed to long
periods of stress. Development of crop plants tolerant to environmental stresses appears to be a
promising approach to help satisfy growing food demands of the developing and under-
developed nations where abiotic stresses are severe constraints to crop productivity. Decades
of breeding and selection have resulted in limited improvements of stress tolerance in rice
plants largely due to the physiological and genetic complexities involved. More knowledge
about the genetics and molecular basis of abiotic stress related traits will be helpful in this
direction. In conjunction with these efforts, characterization of the genetic and functional
interactions of more abiotic stress-related genes is necessary. Genomics, proteomics and
metabolomics, coupled with bioinformatics provide better approach to study entire system of
networks of signalling pathways, key interconnecting processes, genes and gene products
associated with multiple defensive responses in rice plants which will help in deep
understanding of the functional basis of multiple stress tolerance in plants. Identification and
characterization of stress inducible proteins/enzymes involving proteomics approach,
discovery of novel and responsive genes determination of their expression patterns in response
to abiotic stresses, improved understanding of their roles in stress adaptation will provide the
basis of new strategies to improve stress tolerance in rice plants.
164 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

REFERENCES
Abdullaev, A., Djumaev, B. and Karimov, K. K. (2005). Influence of UV-radiation on the
photosynthesis and photosynthetic carbon metabolism in high mountainous plants. BMC
Plant Biology, 5, S1.
Abernethy, R. H., Thiel, D. S., Peterson, N. S. and Helm, K. (1989). Thermotolerance is
developmentally dependent in germinating wheat seed. Plant Physiology, 89, 569-576.
Abu-Abied, M., Golomb, L., Belausov, E., Huang, S., Geiger, B., Kam, Z., Staiger, C. J. and
Sadot, E. (2006). Identification of plant cytoskeleton-interacting proteins by screening for
actin stress fiber association in mammalian fibroblasts. The Plant Journal, 48, 367-379.
Agrawal, G. K., Rakwal, R., Yonekura, M., Kubo, A. and Saji, H. (2002). Rapid induction of
defense/stress-related proteins in leaves of rice (Oryza sativa) seedlings exposed to ozone
is preceded by newly phosphorylated proteins and changes in a 66-kDa ERK-type MAPK.
Journal of Plant Physiology, 159, 361-369.
Agrawal, G. K., Tamogami, S., Iwahashi, H., Agrawal, V. P. and Rakwal, R. (2003). Transient
regulation of jasmonic acid-inducible rice MAP kinase gene (OsBWMK1) by diverse
biotic and abiotic stresses. Plant Physiology and Biochemistry, 41, 355-361.
Agrawal, M., Nandi, P. K. and Rao, D. N. (1982). Effect of ozone and sulphur dioxide
pollutants separately and in mixture on chlorophyll and carotenoid pigments of Oryza
sativa. Water, Air, and Soil Pollution, 18, 449-454.
Ahsan, N., Lee, D. G., Alam, I., Kim, P. J., Lee, J. J., Ahn, Y. O., Kwak, S. S., Lee, I. J., Bahk,
J. D., Kang, K. Y., Renaut, J., Komatsu, S. and Lee, B. H. (2008). Comparative proteomic
study of arsenic-induced differentially expressed proteins in rice roots reveals glutathione
plays a central role during As stress. Proteomics, 8, 3561-3576.
Ahsan, N., Lee, S. H., Lee, D. G., Lee, H., Lee, S. W., Bahk, J. D. and Lee, B. H. (2007).
Physiological and protein profiles alternation of germinating rice seedlings exposed to
acute cadmium toxicity. Comptes Rendus Biologies, 330, 735-746.
Akiyama, T. and Jin, S. (2007). Molecular cloning and characterization of an arginine
decarboxylase gene up-regulated by chilling stress in rice seedlings. Journal of Plant
Physiology, 164, 645-654.
Alcázar, R., Marco, F., Cuevas, J. C., Patron, M., Ferrando, A., Carrasco, P., Tiburcio, A. F.
and Altabella, T. (2006). Involvement of polyamines in plant response to abiotic stress.
Biotechnology Letters, 28, 1867-1876.
Al-Khatib, K. and Paulsen, G. M. (1999). High-temperature effects on photosynthetic
processes in temperate and tropical cereals. Crop Science, 39, 119-125.
Anand, A., Shantha, N. and Pathak, P. C. (2006). Effect of high temperature on hydrogen
peroxide scavenging enzymes during reproductive phase in aromatic rice cultivars. Indian
Journal of Plant Physiology, 11, 427-431.
Asch, F., Dingkuhn, M., Sow, A. and Audebert, A. (2005). Drought-induced changes in
rooting patterns and assimilate partitioning between root and shoot in upland rice. Field
Crops Research, 93, 223-236.
Bai, L. P., Sui, F. G., Ge, T. D., Sun, Z. H., Lu, Y. Y. and Zhou, G. S. (2006). Effect of soil
drought stress on leaf water status, membrane permeability and enzymatic antioxidant
system of maize. Pedosphere, 16, 326-332.
 Effect of Abiotic Stresses on Growth… 165

Baier, M., Kandlbinder, A., Dietz, K. J. and Golldack, D. (2006). New insights into abiotic
stress signalling in plants. Progress in Botany, 67, 248-274.
Baker, N. R., Nogués, S., and Allen, D. J. (1997). Photosynthesis and photoinhibition. In: P.
Lumsden (Ed.), Plants and UV-B: Responses to Environmental Change (pp. 95-111).
Cambridge, UK: Cambridge University Press.
Barakat, A., Gallois, P., Raynal, M., Mestre-Ortega, D., Sallaud, C., Guiderdoni, E., Delseny,
M. and Bernardi, G. (2000). The distribution of T-DNA in the genomes of transgenic
Arabidopsis and rice. FEBS Letters, 471, 161-164.
Barnes, P. W., Maggard, S., Holman, S. R. and Vergara, B. S. (1993). Intraspecific variation in
sensitivity to UV-B radiation in rice. Crop Science, 33, 1041-1046.
Basu, R. and Ghosh, B. (1991). Polyamines in various rice (Oryza sativa) genotypes with
respect to sodium chloride salinity. Physiologia Plantarum, 82, 575-581.
Bertin, P., Kinet, J. M. and Bouharmont, J. (1996). Evaluation of chilling sensitivity in
different rice varieties. Relationship between screening procedures applied during
germination and vegetative growth. Euphytica, 89, 201-210.
Bharti, A. K. and Khurana, J. P. (1997). Mutants of Arabidopsis as tools to understand the
regulation of phenylpropanoid pathway and UV-B protection mechanisms.
Photochemistry and Photobiology, 65, 765-776.
Bhatia C. R. and Mitra, R. (1998). Biosafety of transgenic crop plants. Proceedings of the
Indian National Science Academy, B64, 293-318.
Biswal, B., Joshi, P. N. and Raval, M. K. (2006). Photosynthetic response of green leaves to
high light stress and ultraviolet radiation: mechanisms of damage, repair and adaptation of
chloroplasts. Journal of Plant Biology, 33, 69-84.
Blaylock, M. J., and Huang, J. W. (2000). Phytoextraction of metals. In: I. Raskin, and B.D.
Ensley (Eds.), Phytoremediation of toxic metals: Using plants to clean up the environment
(pp. 53–70). New York: John Wiley and Sons.
Blokhina, O., Virolainen, E. and Fagerstedt, K. V. (2003). Antioxidants, oxidative damage and
oxygen deprivation stress: a review. Annals of Botany, 91, 179-194.
Blumwald, E., Grover, A., and Good, A. G. (2004). Breeding for abiotic stress resistance:
challenges and opportunities new directions for a diverse planet. Proceedings of the 4th
International Crop Science Congress, Brisbane, Australia, 26 September– 1 October 2004.
Bohnert, H. J., Nelson, D. E. and Jensen, R. G. (1995). Adaptation to environmental stresses.
The Plant Cell, 7, 1099-1111.
Boo, Y. C. and Jung, J. (1999). Water deficit-induced oxidative stress and antioxidative
defences in rice plants. Journal of Plant Physiology, 155, 255-261.
Bose, A. and Ghosh, B. (1995). Effect of heat stress on ribulose 1,5-bisphosphate carboxylase
in rice. Phytochemistry, 38, 1115-1118.
Bowler, C., Van Montagu, M. and Inze, D. (1992). Superoxide dismutase and stress tolerance.
Annual Review of Plant Physiology and Plant Molecular Biology, 43, 83-116.
Breitler, J. C., Meynard, D., Boxtel, J. V., Royer, M., Bonnot, F., Cambillau, L. and
Guiderdoni, E. (2004). A novel two T-DNA binary vector allows efficient generation of
marker-free transgenic plants in three elite cultivars of rice (Oryza sativa L.). Transgenic
Research, 13, 271-287.
Britt, A. B. (1999). Molecular genetics of DNA repair in higher plants. Trends in Plant
Science, 4, 20-25.
166 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Cabuslay, G. S., Ito, O. and Alejar, A. A. (2002). Physiological evaluation of responses of rice
(Oryza sativa L.) to water deficit. Plant Science, 163, 815-827.
Caldwell, M. M., Bjorn, L.O., Bornmann, J.F., Flint, S.D., Kulandaivelu, G., Teramura, A. H.
and Tevini, M. (1998). Effect of increased solar UV-B on terrestrial ecosystems. Journal
of Photochemistry and Photobiology, 46, 40-52.
Caldwell, M. M., Robberecht, R. and Flint, S. D. (1983). Internal filters: prospects for UV-
acclimation in higher plants. Physiologia Plantarum, 58, 445-450.
Cao, M. X., Huang, J. Q., Yao, Q. H., Liu, S. J., Wang, C. L. and Wei, Z. M. (2006). Site-
specific DNA excision in transgenic rice with a cell-permeable Cre recombinase.
Molecular Biotechnology, 32, 55-63.
Capell, T., Bassie, L. and Christou, P. (2004). Modulation of the polyamine biosynthetic
pathway in transgenic rice confers tolerance to drought stress. Proceedings of the National
Academy of Sciences, 101, 9909-9914.
Casati, P. and Walbot, V. (2004). Crosslinking of ribosomal proteins to RNA in maize
ribosomes by UV-B and its effects on translation. Plant Physiology, 136, 3319-3332.
Chandler, P. and Robertson, M. (1994). Gene expression regulated by abscisic acid and its
relation to stress tolerance. Annual Review of Plant Physiology and Plant Molecular
Biology, 45, 113-141.
Chao, D. Y., Luo, Y. H., Shi, M., Luo, D. and Lin, H. X. (2005). Salt-responsive genes in rice
revealed by cDNA microarray analysis. Cell Research, 15, 796-810.
Chattopadhayay, M. K., Tiwari, B. S., Chattopadhyay, G., Bose, A., Sengupta, D. N. and
Ghosh, B. (2002). Protective role of exogenous polyamines on salinity-stressed rice
(Oryza sativa) plants. Physiologia Plantarum, 116, 192-199.
Chaves, M. M., Pereira, J. S., Carvalho, I. S., Faria, T., Maroco, J., Osorio, M. L., Pinheiro, C.,
Ricardo, C. P. P. and Rodrigues, M. L. (2002). How do plants cope with water stress in the
field: photosynthesis and growth. Annals of Botany, 89, 907-916.
Chen, C. T., Chen, L. M., Lin, C. C. and Kao, C. H. (2001). Regulation of proline
accumulation in detached rice leaves exposed to excess copper. Plant Science, 160, 283-
290.
Chen, F., Li, Q., Sun, L. and He, Z. (2006b). The rice 14-3-3 gene family and its involvement
in responses to biotic and abiotic stress. DNA Research, 13, 53-63.
Chen, G. X., Liu, S. H., Zhang, C. J. and Lu, C. G. (2004). Effects of drought on
photosynthetic characteristics of flag leaves of a newly-developed super-high-yield rice
hybrid. Photosynthetica, 42, 573-578.
Chen, J. Q., Meng, X. P., Zhang, Y., Xia, M. and Wang, X. P. (2008). Over-expression of
OsDREB genes lead to enhanced drought tolerance in rice. Biotechnology Letters, 30,
2191-2198.
Chen, J., Wan, J., Jiang, H., Gao, X. L., Wang, P. R., Xi, J. and Xu, Z. J. (2006a). Cloning and
expression analysis of OsNADPH1 gene from rice in drought stress response. Rice
Science, 13, 149-154.
Chen, Y. H., Zhao S., Z., Yan Q. Q., Li, Y. S., Wu X. R. and Xiao, G. Y. (2007). Tolerance of
submergence in rice: gene studies using differential display technique Chinese Journal of
Agricultural Biotechnology, 4, 139-144
Chen, Z., Hong, X., Zhang, H., Wang, Y., Li, X., Zhu, J. K. and Gong, Z. (2005). Disruption
of the cellulose synthase gene, AtCesA8/IRX1, enhances drought and osmotic stress
tolerance in Arabidopsis. The Plant Journal, 43, 273-283.
 Effect of Abiotic Stresses on Growth… 167

Cheng, C., Yun, K. Y., Ressom, H. W., Mohanty, B., Bajic, V. B., Jia, Y., Yun, S. J. and de los
Reyes, B. G. (2007). An early response regulatory cluster induced by low temperature and
hydrogen peroxide in seedlings of chilling-tolerant japonica rice. BMC Genomics, 8, 175-
192.
Cheng, Z. Q., Targolli, J. and Huang, X. Q. (2002). Wheat LEA genes, PMA80 and PMA
1959, enhance dehydration tolerance of transgenic rice (Oryza sativa L.). Molecular
Breeding, 10, 71-82.
Chinnusamy, V., Schumaker, K. and Zhu, J. K. (2004). Molecular genetic perspectives on
cross-talk and specificity in abiotic stress signaling in plants. Journal of Experimental
Botany, 55, 225-236.
Chinnusamy, V., Zhu, J. H. and Zhu, J. K. (2006). Gene regulation during cold acclimation in
plants. Physiologia Plantarum, 126, 52-61.
Chisako, A., Yoshu, Y. and Fumihiko, S. (1999). Increase of proline content in transgenic rice
plants with a proline dehydrogenase antisense cDNA. Journal of Japan Women's
University, 7, 45-53.
Chitteti, B. and Peng, Z. (2007). Proteome and phosphoproteome differential expression under
salinity stress in rice (Oryza sativa) roots. Journal of Proteome Research, 6, 1718-1727.
Cho, K., Shibato, J., Agrawal, G., Jung, Y. H., Kubo, A., Jwa, N. S, Tamogami, S., Satoh, K.,
Kikuchi, S., Higashi, T., Kimura, S., Saji, H., Tanaka, Y., Iwahashi, H., Masuo, Y. and
Rakwal, R. (2008). Integrated transcriptomics, proteomics, and metabolomics analyses to
survey ozone responses in the leaves of rice seedling. Journal of Proteome Research, 7,
2980-2998.
Choudhary, N. L., Sairam, R. K. and Tyagi, A. (2005). Expression of Δ1-pyrroline-5-
carboxylate synthetase gene during drought in rice (Oryza sativa L.). Indian Journal of
Biochemistry and Biophysics, 42, 366-370.
Close, T. J. (1996). Dehydrins: emergence of a biochemical role of a family of plant
dehydration proteins. Physiologia Plantarum, 97, 795-803.
Cobbett, C. S. and Goldsbrough, P. B. (2002). Phytochelatins and metallothioneins: roles in
heavy metal detoxification and homeostasis. Annual Review of Plant Biology, 53, 159-182.
Cobbett, C. S. (2000). Phytochelatins and their roles in heavy metal detoxification. Plant
Physiology, 123, 825-832.
Crawford, R. M. M. and Braendle, R. (1996). Oxygen deprivation stress in a changing
environment. Journal of Experimental Botany, 47, 145-159.
Cuming, A. (1999). LEA proteins. In: P. R. Shewry, and R. Casey (Eds.), Seed Proteins (pp.
753–780). Dordrecht, The Netherlands: Kluwer Academic Publishers.
Cushman, J. C. and Bohnert, H. J. (2000). Genomic approaches to plant stress tolerance.
Current Opinion in Plant Biology, 3, 117-124.
da Cruz, R. P., Milach, S. C. K. and Federizzi, L. C. (2006). Inheritance of rice cold tolerance
at the germination stage. Genetics and Molecular Biology, 29, 314-320.
Dai, H., Lo, Y. S., Lin, Y. H., Ruddat, M. and Chiang, K. S. (1996). In vitro polysome
translation analysis of heat shock proteins in higher plants. Botanical Bulletin of Academia
Sinica, 37, 261-264.
Dai, Q., Coronel, V. P., Vergara, B. S., Barnes, P. W. and Quintos, A. T. (1992). Ultraviolet-B
radiation effects growth and physiology of four rice cultivars. Crop Science, 32, 1269-
1274.
168 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Dai, Q., Peng, S., Chavez, A. Q. and Vergara, B. S. (1995). Effects of UV-B radiation on
stomatal density and opening in rice (Oryza sativa L.). Annals of Botany, 76, 65-70.
Dai, Q., Yan, B., Huang, S., Liu, X., Peng, S., Miranda, M. L. L., Chavez, A. Q., Vergara, B.
S. and Olszyk, D. M. (1997). Response of oxidative stress defence system in rice (Oryza
sativa) leaves with supplemental UV-B radiation. Physiologia Plantarum, 101, 301-308.
Diamant, S., Rosenthal, D., Azem, A., Eliahu, N., Ben-Zvi, A. P. and Goloubinoff, P. (2003).
Dicarboxylic amino acids and glycine-betaine regulate chaperone-mediated protein
disaggregation under stress. Molecular Microbiology, 49, 401-410.
Dionisio-Sese, M. L. and Tobita, S. (2000). Effects of salinity on sodium content and
photosynthetic responses of rice seedlings differing in salt tolerance. Journal of Plant
Physiology, 157, 54-58.
Dooki, A. D., Mayer-Posner, F. J., Askari, H., Zaiee, A. and Salekdeh, G. H. (2006).
Proteomic responses of rice young panicles to salinity. Proteomics, 6, 6498-6507.
Drew, M. C. (1997). Oxygen deficiency and root metabolism: injury and acclimation under
hypoxia and anoxia. Annual Review of Plant Physiology and Plant Molecular Biology, 48,
223-250.
Dubey, R. S. and Rani, M. (1989). Influence of NaCl salinity on growth and metabolic status
of proteins and amino acids in rice seedlings. Journal of Agronomy and Crop Science,
162, 97-106.
Dubey, R. S. and Rani, M. (1990). Influence of NaCl salinity on the behaviour of protease,
amino-peptidase and carboxyl-peptidase in rice seedlings in relation to salt tolerance.
Australian Journal of Plant Physiology, 17, 215-224.
Dubey, R. S. and Singh, A. K. (1999). Salinity induces accumulation of soluble sugars and
alters activity of sugar metabolising enzymes in rice plants. Biologia Plantarum, 42, 233-
239.
Dubey, R. S. (1994). Protein synthesis by plants under stressful conditions. In: M. Pessarakli
(Ed.), Handbook of plant and crop stress (pp. 277–299). New York: Marcel Dekker Inc.
Dubey, R. S. (1999). Protein synthesis by plants under stressful conditions. In: M. Pessarakli
(Ed.), Handbook of plant and crop stress (second edition, pp. 365–397). New York:
Marcel Dekker Inc.
Dubouzet, J. G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E. G., Miura, S., Seki, M.,
Shinozaki, K. and Yamaguchi-Shinozaki, K. (2003). OsDREB genes in rice, Oryza sativa
L., encode transcription activators that function in drought, high salt and cold responsive
gene expression. The Plant Journal, 33, 751-763.
Duval, C., Augé, N., Frisach, L., Salvayre, R. and Nègre-Salvayre, A. (2002). Mitochondrial
oxidative stress is modulated by oleic acid via an epidermal growth factor receptor-
dependent activation of glutathione peroxidase. Biochemical Journal, 367, 889-894.
Fang, Y., You, J., Xie, K., Xie, W. and Xiong, L. (2008). Systematic sequence analysis and
identification of tissue-specific or stress-responsive genes of NAC transcription factor
family in rice. Molecular Genetics and Genomics, 280, 547-563.
Farrell, T. C., Fox, K. M., Williams, R. L. and Fukai, S. (2006). Genotypic variation for cold
tolerance during reproductive development in rice: screening with cold air and cold water.
Field Crops Research, 98, 178-194.
Feng, H., An, L., Chen, T., Qiang, W., Xu, S., Zhang, M., Wang, X. and Cheng, G. (2003).
The effect of ultraviolet-B radiation on growth, photosynthesis and stable carbon isotope
 Effect of Abiotic Stresses on Growth… 169

composition (δ13C) of two soybean cultivars (Glycine max) under field conditions.
Environmental and Experimental Botany, 49, 1-8.
Ferber, D. (1999). Risks and benefits: GM crops in the cross hairs. Science, 286, 1662-1666.
Fiscus, E. L., Booker, F. L. and Burkey, K. O. (2005). Crop responses to ozone: uptake, modes
of action, carbon assimilation and partitioning. Plant, Cell and Environment, 28, 997-
1011.
Flowers, T. J. and Yeo, A. R. (1995). Breeding for salinity resistance in crop plants-where
next. Australian Journal of Plant Physiology, 22, 875-884.
Flowers, T. J. (2004). Improving crop salt tolerance. Journal of Experimental Botany, 55, 307-
319.
Fox, T. C. and Kennedy, R. A. (1991). Mitochondrial enzymes in aerobically and
anaerobically germinated seedlings of Echinochloa and rice. Planta, 184, 510-514.
Frei, M., Tanaka, J. P., and Wissuwa, M. (2008). Genotypic variation in tolerance to elevated
ozone in rice: dissection of distinct genetic factors linked to tolerance mechanisms.
Journal of Experimental Botany, 59, 3741-3752.
Friso, G., Spetea, C., Giacometti, G. M., Vass, I. and Barbato, R. (1994a). Degradation of the
photosystem II reaction center D1-protein induced by UV-B radiation in isolated
thylakoids. Identification and characterization of C- and N-terminal breakdown products.
Biochimica et Biophysica Acta, 1184, 78-84.
Friso, J., Barbato, R., Giacometti, G. M. and Barber, J. (1994b). Degradation of D2 protein due
to UV-B irradiation of the reaction center of photosystem II. FEBS Letters, 339, 217-221.
Fukuda, A., Nakamura, A. and Tanaka, Y. (1999). Molecular cloning and expression of the
Na+/H+ exchanger gene in Oryza sativa. Biochimica et Biophysica Acta, 1446, 149-155.
Fukuda, A., Nakamura, A., Tagiri, A., Tanaka, H., Miyao, A., Hirochika, H. and Tanaka, Y.
(2004). Function, intracellular localization and the importance in salt tolerance of a
vacuolar Na+/H+ antiporter from rice. Plant and Cell Physiology, 45, 146-159.
Gale, M. D. and Devos, K. M. (1998). Comparative genetics in the grasses. Proceedings of the
National Academy of Sciences, 95, 1971-1974.
Gao, J. P., Chao, D. Y. and Lin, H. X. (2007). Understanding abiotic stress tolerance
mechanisms: recent studies on stress response in rice. Journal of Integrative Plant
Biology, 49, 742-750.
Gao, S., Zhang, H., Tian, Y., Li, F., Zhang, Z., Lu, X., Chen, X. and Huang, R. (2008).
Expression of TERF1 in rice regulates expression of stress-responsive genes and enhances
tolerance to drought and high-salinity. Plant Cell Reports, 27, 1787-1795.
Garciadeblas, B., Senn, M. E., Banuelos, M. A. and Rodriguez-Navarro, A. (2003). Sodium
transport and HKT transporters: the rice model. The Plant Journal, 34, 788-801.
Garg, A. K., Kim, J. K., Owens, T. G., Ranwala, A. P., Choi, Y. D., Kochian, L. V. and Wu, R.
J. (2002). Trehalose accumulation in rice plants confers high tolerance levels to different
abiotic stresses. Proceedings of the National Academy of Sciences, 99, 15898-15903.
Garufi, A., Visconti, S., Camoni, L. and Aducci, P. (2007). Polyamines as physiological
regulators of 14-3-3 interaction with the plant plasma membrane H+-ATPase. Plant and
Cell Physiology, 48, 434-440.
Ge, L. F., Chao, D. Y., Shi, M., Zhu, M. Z., Gao, J. P. and Lin, H. X. (2008). Overexpression
of the trehalose-6-phosphate phosphatase gene OsTPP1 confers stress tolerance in rice and
results in the activation of stress responsive genes. Planta, 228, 191-201.
170 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Giao, N. N., Hailstones, D., Wilkes, M., and Sutton, B. G. (2007). Water deficit induced pollen
sterility associated with a programmed cell death and oxidative stress in rice anthers.
Proceedings of the 2nd International Rice for the Future (pp. 202-209). Bangkok,
Thailand, 5-9 November 2007.
Giri, C. C. and Laxmi, G. V. (2000). Production of transgenic rice with agronomically useful
genes: an assessment. Biotechnology Advances, 18, 653-683.
Goff, S. A., Ricke, D., Lan, T. H., Presting, G., Wang, R., Dunn, M., Glazebrook, J., Sessions,
A., Oeller, P. and Varma, H. (2002). A draft sequence of the rice genome (Oryza sativa L.
ssp. japonica). Science, 296, 92-100.
Gorantla, M., Babu, P. R., Lachagari, V. B., Reddy, A. M., Wusirika, R., Bennetzen, J. L. and
Reddy, A. R. (2007). Identification of stress-responsive genes in an indica rice (Oryza
sativa L.) using ESTs generated from drought-stressed seedlings. Journal of Experimental
Botany, 58, 253-265.
Gorham, J. (1995). Betaines in higher plants - biosynthesis and role in stress metabolism. In:
R. M. Wallsgrove (Ed.), Amino acids and their derivatives in higher plants: Society for
Experimental Biology Seminar Series, (volume 56, pp. 173–203). Cambridge: Cambridge
University Press.
Goyal, A. (1986). Effects of water stress on glycolate metabolism in the leaves of rice
seedlings (Oryza sativa). Physiologia Plantarum, 69, 289-294.
Grill, E., Löffler, S., Winnacker, E. L. and Zenk, M. H. (1989). Phytochelatins, the heavy-
metal-binding peptides of plants, are synthesized from glutathione by a specific γ-
glutamylcysteine dipeptidyl transpeptidase (phytochelatin synthase). Proceedings of the
National Academy of Sciences, 86, 6838-6842.
Groppa, M. D. and Benavides, M. P. (2008). Polyamines and abiotic stress: recent advances.
Amino Acids, 34, 35-45.
Gunderson, C. A., Norby, R. J. and Wullschleger, S. D. (2000). Acclimation of photosynthesis
and respiration to simulated climatic warming in northern and southern populations of
Acer saccharum: laboratory and field evidence. Tree Physiology, 20, 87-96.
Guo, Z., Tan, H., Zhu, Z., Lu, S. and Zhou, B. (2005). Effect of intermediates on ascorbic acid
and oxalate biosynthesis of rice and in relation to its stress resistance. Plant Physiology
and Biochemistry, 43, 955-962.
Gutha, L. R. and Reddy, A. R. (2008). Rice DREB1B promoter shows distinct stress-specific
responses, and the overexpression of cDNA in tobacco confers improved abiotic and biotic
stress tolerance. Plant Molecular Biology, 68, 533-555.
Hahn, M. and Walbot, V. (1989). Effects of cold-treatment on protein synthesis and mRNA
levels in rice leaves. Plant Physiology, 91, 930-938.
Hajduch, M., Rakwal, R., Agrawal, G. K., Yonekura, M. and Pretova, A. (2001). High-
resolution two-dimensional electrophoresis separation of proteins from metal-stressed rice
(Oryza sativa L.) leaves: drastic reductions/fragmentation of ribulose-1,5-bisphosphate
carboxylase/oxygenase and induction of stress-related proteins. Electrophoresis, 22, 2824-
2831.
Halliwell, B., and Gutteridge, J. M. C. (1989). Free radicals in biology and medicine (second
edition). Oxford: Oxford University Press.
Halliwell, B., and Gutteridge, J. M. C. (2006). Free radicals in biology and medicine (fourth
edition). Oxford: Oxford University Press.
 Effect of Abiotic Stresses on Growth… 171

Hasegawa, P. M., Bressan, R. A., Zhu, J. K. and Bohnert, H. J. (2000). Plant cellular and
molecular responses to high salinity. Annual Review of Plant Physiology and Plant
Molecular Biology, 51, 463-499.
Hashimoto, M. and Komatsu, S. (2007). Proteomic analysis of rice seedlings during cold
stress. Proteomics, 7, 1293-1302.
He, J., Huang, L. K, Chow, W. S., Whitecross, M. I. and Anderson, J. M. (1993). Effects of
supplementary ultraviolet-B radiation on rice and pea plants. Australian Journal of Plant
Physiology, 20, 129-142.
Heenan, D. P., Lewin, L. G. and McCaffery, D.W. (1988). Salinity tolerance in rice varieties at
different growth stages. Australian Journal of Experimental Agriculture, 28, 343-349.
Henson, I. E. (1982). Abscisic acid and water relations of rice (Oryza sativa L.): sequential
responses to water stress in the leaf. Annals of Botany, 50, 9-24.
Hideg, E., Sass, L., Barbato, R. and Vass, I. (1993). Inactivation of photosynthetic oxygen
evolution by UV-B irradiation. A thermoluminescence study. Photosynthesis Research,
38, 455-462.
Hidema, J. and Kumagai, T. (2006). Sensitivity of rice to ultraviolet-B radiation. Annals of
Botany, 97, 933-942.
Hidema, J., Kang, H. S. and Kumagai, T. (1996). Differences in the sensitivity to UV-B
radiation of two cultivars of rice (Oryza sativa L.). Plant and Cell Physiology, 37, 742-
747.
Hidema, J., Zhang, W. H., Yamamoto, M., Sato, T. and Kumagai, T. (2005). Changes in grain
size and grain storage protein of rice (Oryza sativa L.) in response to elevated UV-B
radiation under outdoor conditions. Journal of Radiation Research, 46, 143-149.
Hirotsu, N., Makino, A., Ushio, A. and Mae, T. (2004). Changes in the thermal dissipation and
the electron flow in the water-water Cycle in rice grown under conditions of
physiologically low temperature. Plant and Cell Physiology, 45, 635-644.
Hsieh, H. M, Liu, W. K. and Huang, P. C. (1995). A novel stress-inducible metallothionein-
like gene from rice. Plant Molecular Biology, 28, 381-389.
Hsu, Y. T. and Kao, C. H. (2007). Cadmium-induced oxidative damage in rice leaves is
reduced by polyamines. Plant and Soil, 291, 27-37.
Hu, H., You, J., Fang, Y., Zhu, X., Qi, Z. and Xiong, L. (2008). Characterization of
transcription factor gene SNAC2 conferring cold and salt tolerance in rice. Plant
Molecular Biology, 67, 169-181.
Huang, M. and Guo, Z. (2005). Responses of antioxidative system to chilling stress in two rice
cultivars differing in sensitivity. Biologia Plantarum, 49, 81-84.
Huang, Y. W., Tsay, W. S., Chen, C. C., Lin, C. W. and Huang, H. J. (2008). Increased
expression of the rice C-type cyclin-dependent protein kinase gene, Orysa;CDKC;1, in
response to salt stress. Plant Physiology and Biochemistry, 46, 71-81.
Hue, N. V., Craddock, G. R. and Adams, F. (1986). Effect of organic aids on aluminum
toxicity in subsoil. Soil Science Society of America Journal, 50, 28-34.
Imin, N., Kerim, T., Weinman, J. J. and Rolfe, B. G. (2006). Low temperature treatment at the
young microspore stage induces protein changes in rice anthers. Molecular and Cellular
Proteomics, 5, 274-292.
Ishii, S., Marshall, F. M. and Bell, J. N. B. (2004). Physiological and morphological responses
of locally grown Malaysian rice cultivars (Oryza sativa L.) to different ozone
concentrations. Water, Air, and Soil Pollution, 155, 205-221.
172 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Ishimaru, K., Ono, K. and Kashiwagi, T. (2004). Identification of a new gene controlling plant
height in rice using the candidate-gene strategy. Planta, 218, 388-395.
Ito, Y., Katsura, K., Maruyama, K., Taji, T., Kobayashi, M., Seki, M., Shinozaki, K. and
Yamaguchi-Shinozaki, K. (2006). Functional analysis of rice DREB1/CBF-type
transcription factors involved in cold-responsive gene expression in transgenic rice. Plant
and Cell Physiology, 47, 141-153.
Iyer, S. and Caplan, A. (1998). Products of proline catabolism can induce osmotically
regulated genes in rice. Plant Physiology, 116, 203-211.
Izumi, O. H. E., Kuniyuki, S. and Toshiro, K. (2007). Effects of high temperature on growth,
yield and dry-matter production of rice grown in the paddy field. Plant Production
Science, 10, 412-422.
Jackson, M. B. and Ram, P. C. (2003). Physiological and molecular basis of susceptibility and
tolerance of rice plants to complete submergence. Annals of Botany, 91, 227-241.
Jackson, M. B., Waters, I., Setter, T. L. and Greenway, H. (1987). Injury to rice plants caused
by complete submergence: a contribution by ethylene (ethene). Journal of Experimental
Botany, 38, 1826-1838.
Jagadish, S. V. K., Craufurd, P. Q. and Wheeler, T. R. (2007). High temperature stress and
spikelet fertility in rice (Oryza sativa L.). Journal of Experimental Botany, 58, 1627-1635.
Jena, K. K. and Mackill, D. J. (2008). Molecular markers and their use in marker-assisted
selection in rice. Crop Science, 48, 1266-1276.
Jeong, J. M., Kon, L. S., Gi, K. B., Ryoun, K. T., Suk, C. W., Taik, P. Y., Ohk , L. J., Bin, K.
H., Ok, B. M. and Chul, P. S. (2006). A rice (Oryza sativa L.) MAP kinase gene,
OsMAPK44, is involved in response to abiotic stresses. Plant Cell, Tissue and Organ
Culture, 85, 151-160.
Jeong, S. W., Choi, S. M., Lee, D. S., Ahn, S. N., Hur, Y., Chow, W. S. and Park, Y. I. (2002).
Differential susceptibility of photosynthesis to light-chilling stress in rice (Oryza sativa L.)
depends on the capacity for photochemical dissipation of light. Molecular Cells, 13, 419-
428.
Jha, A. B. and Dubey, R. S. (2004a). Arsenic exposure alters the activities of key nitrogen
assimilatory enzymes in growing rice seedlings. Plant Growth Regulation, 43, 259-268.
Jha, A. B. and Dubey, R. S. (2004b). Carbohydrate metabolism in growing rice seedlings
under arsenic toxicity. Journal of Plant Physiology, 161, 867-872.
Jha, A. B. and Dubey, R. S. (2004c). Effect of arsenic on nitrogen assimilatory enzymes in
germinating rice seeds. Indian Journal of Plant Physiology, 9, 438-441.
Jha, A. B. and Dubey, R. S. (2005). Effect of arsenic on behaviour of enzymes of sugar
metabolism in germinating rice seeds. Acta Physiologia Plantarum, 27, 341-347.
Jiang, H., Dian, W. and Wu, P. (2003). Effect of high temperature on fine structure of
amylopectin in rice endosperm by reducing the activity of the starch branching enzyme.
Phytochemistry, 63, 53-59.
Kabaki, N. and Tajima, K. (1981). Effect of chilling on the water balance of rice seedlings.
Japan Journal of Crop Science, 50, 489-494.
Katiyar, S. and Dubey, R. S. (1990). Changes in polyamine titer in rice seedlings following
NaCl salinity stress. Journal of Agronomy and Crop Science, 165, 19-27.
Katiyar, S. and Dubey, R. S. (1992). Influence of NaCl salinity on behaviour of nitrate
reductase and nitrite reductase in rice seedlings differing in salt tolerance. Journal of
Agronomy and Crop Science, 169, 289-297.
 Effect of Abiotic Stresses on Growth… 173

Katiyar-Agarwal, S., Agarwal, M. and Grover, A. (2003). Heat-tolerant basmati rice

engineered by over-expression of hsp101. Plant Molecular Biology, 51, 677-686.
Kato-Noguchi, H. and Morokuma, M. (2007). Ethanolic fermentation and anoxia tolerance in
four rice cultivars. Journal of Plant Physiology, 164, 168-173.
Kato-Noguchi, H. and Ohashi, C. (2006). Effects of anoxia on amino acid levels in rice
coleoptiles. Plant Production Science, 9, 383-387.
Kato-Noguchi, H. (2000). Anaerobically induced proteins in rice seedlings. Plant Production
Science, 3, 225-228.
Kato-Noguchi, H. (2004). Sugar utilization and anoxia tolerance in rice roots acclimated by
hypoxic pretreatment. Journal of Plant Physiology, 161, 803-808.
Kato-Noguchi, H. (2006). Pyruvate metabolism in rice coleoptiles under anaerobiosis. Plant
Growth Regulation, 50, 41-46.
Kawakami, A., Sato, Y. and Yoshida, M. (2008). Genetic engineering of rice capable of
synthesizing fructans and enhancing chilling tolerance. Journal of Experimental Botany,
59, 793-802.
Khan, M. S. A., Hamid, A. and Karim, M. A. (1997). Effect of sodium chloride on germination
and seedling characters of different types of rice (Oryza sativa L.). Journal of Agronomy
and Crop Science, 179, 163-169.
Khanna, H. K. and Raina, S. K. (1999). Agrobacterium-mediated transformation of indica rice
cultivars using binary and superbinary vectors. Australian Journal of Plant Physiology,
26, 311-324.
Kishitani, S., Takanami, T., Suzuki, M., Oikawa, M., Yokoi, S., Ishitani, M., Alvarez-Nakase,
A. M., Takabe, T. and Takabe, T. (2000). Compatibility of glycine-betaine in rice plants:
evaluation using transgenic rice plants with a gene for peroxisomal betaine aldehyde
dehydrogenase from barley. Plant, Cell and Environment, 23, 107-114.
Klapheck, S., Fliegner, W. and Zimmer, I. (1994). Hydroxymethyl-phytochelatins [(γ-
glutamylcysteine)n-serine] are metal-induced peptides of the Poaceae. Plant Physiology,
104, 1325-1332.
Kobata, T. and Takami, S. (1986). Changes in respiration, dry-matter production and its
partition in rice (Oryza sativa L.) in response to water deficits during the grain-filling
period. Journal of Plant Research, 99, 379-393.
Kobayashi, K. and Okada, M. (1995). Effects of ozone on the light use of rice (Oryza sativa
L.) plants. Agriculture Ecosystems and Environment, 53, 1-12.
Kochian, L. V., Hoekenga, O. A. and Pineros, M. A. (2004). How do crop plants tolerate acid
soils? Mechanisms of aluminum tolerance and phosphorus efficiency. Annual Review of
Plant Biology, 55, 459-493.
Kohli, A., Gahakwa, D., Vain, P., Laurie, D. A. and Christou, P. (1999). Transgene expression
in rice engineered through particle bombardment: molecular factors controlling stable
expression and transgene silencing. Planta, 208, 88-97.
Krishna, P. (2003). Plant responses to heat stress. In: H. Hirt, and K. Shinozaki (Eds.), Plant
responses to abiotic stress (pp. 73–93). Berlin: Springer.
Krishnamurthy, R. and Bhagwat, K. A. (1989). Polyamines as modulators of salt tolerance in
rice cultivars. Plant Physiology, 91, 500-504.
Kumagai, J., Katoh, H., Miyazaki, T., Hidema, J. and Kumagai, T. (1999). Differences in the
sensitivity to UV-B radiation of two cultivars of rice (Oryza sativa L.) based on
observation of long-lived radicals. Journal of Radiation Research, 40, 303-310.
174 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Kumar, K., Rao, K. P., Sharma, P. and Sinha, A. K. (2008). Differential regulation of rice
mitogen activated protein kinase kinase (MKK) by abiotic stress. Plant Physiology and
Biochemistry, 46, 891-897.
Kumar, R. G. and Dubey, R. S. (1999). Glutamine synthetase isoforms from rice seedlings:
effect of stress on enzyme activity and the protective roles of osmolytes. Journal of Plant
Physiology, 155, 118-121.
Kumar, R. G., Shah, K. and Dubey, R. S. (2000). Salinity induced behavioral changes in
malate dehydrogenase and glutamate dehydrogenase activities in rice seedlings of
differing salt tolerance. Plant Science, 156, 23-34.
Lafitte, H. R., Ismail, A., and Bennett, J. (2004a). Abiotic stress tolerance in rice for Asia:
progress and the future new directions for a diverse planet. In: Proceedings of the 4th
International Crop Science Congress Brisbane, Australia, 26 September -1 October 2004.
Lafitte, H. R., Price, A. H. and Courtois, B. (2004b). Yield response to water deficit in an
upland rice mapping population: associations among traits and genetic marker. Theoretical
and Applied Genetics, 109, 1237-1246.
Lasanthi-Kudahettige, R., Magneschi, L., Loreti, E., Gonzali, S., Licausi, F., Novi, G., Beretta,
O., Vitulli, F., Alpi, A. and Perata, P. (2007). Transcript profiling of the anoxic rice
coleoptile. Plant Physiology, 144, 218-231.
Lawlor, D. W. and Cornic, G. (2002). Photosynthetic carbon assimilation and associated
metabolism in relation to water deficits in higher plants. Plant, Cell and Environment, 25,
275-294.
Lee, D. G., Ahsan, N., Lee, S. H., Lee, J. J., Bahk, J. D., Kang, K. Y. and Lee, B. H. (2009).
Chilling stress-induced proteomic changes in rice roots. Journal of Plant Physiology, 166,
1-11.
Lee, D. G., Ahsan, N., Lee, S. H., Kang, K. Y., Bahk, J. D., Lee, I. J. and Lee, B. H. (2007). A
proteomic approach in analyzing heat-responsive proteins in rice leaves. Proteomics, 7,
3369-3383.
Lee, D. H., Kim, Y. S. and Lee, C. B. (2001). The inductive responses of the antioxidant
enzymes by salt stress in the rice (Oryza sativa L.). Journal of Plant Physiology, 158, 737-
745.
Lee, M. O., Cho, K., Kim, S. H., Jeong, S. H, Kim, J. A., Jung, Y. H., Shim, J., Shibato, J.,
Rakwal, R., Tamogami, S., Kubo, A., Agrawal, G. and Jwa, N. S. (2008). Novel rice
OsSIPK is a multiple stress responsive MAPK family member showing rhythmic
expression at mRNA level. Planta, 227, 981-990.
Li, J. Y., Jiang, A. L. and Zhang, W. (2006). Salt stress-induced programmed cell death in rice
root tip cells. Journal of Integrative Plant Biology, 49, 481-486.
Lin, C. C. and Kao, C. H. (2000). Effect of NaCl stress on H2O2 metabolism in rice leaves.
Plant Growth Regulation, 30, 151-155.
Lin, C. C., Hsu, Y. T. and Kao, C. H. (2002). The effect of NaCl on proline accumulation in
rice leaves. Plant Growth Regulation, 36, 275-285.
Lin, D. I., Lur, H. S. and Chu, C. (2001). Effects of abscisic acid on ozone tolerance of rice
(Oryza sativa L.) seedlings. Plant Growth Regulation, 35, 295-300.
Lin, H. X., Zhu, M. Z., Yano, M., Gao, J. P., Liang, Z. W., Su, W. A., Hu, X. H., Ren, Z. H.
and Chao, D. Y. (2004). QTLs for Na+ and K+ uptake of the shoots and roots controlling
rice salt tolerance. Theoretical and Applied Genetics, 108, 253-260.
 Effect of Abiotic Stresses on Growth… 175

Lin, S. K., Chang, M. C., Tsai, Y. G. and Lur, H. S. (2005). Proteomic analysis of the
expression of proteins related to rice quality during caryopsis development and the effect
of high temperature on expression. Proteomics, 5, 2140-2156.
Lindquist, S. and Craig, E. A. (1988). The heat shock proteins. Annual Review of Genetics, 22,
631-677.
Liu, J. Y., Lu, T. and Zhao, N. M. (2000). Classification and nomenclature of plant
metallothionein-like proteins based on their cysteine arrangement patterns. Acta Botanica
Sinica, 42, 649-652.
Liu, W. X, Shen, L. F., Liu, J. W., Wang, Y. W. and Li, S. R. (2007). Uptake of toxic heavy
metals by rice (Oryza sativa L.) cultivated in the agricultural soil near Zhengzhou city,
People's Republic of China. Bulletin of Environmental Contamination and Toxicology, 79,
209-213.
Liu, X., and Huang, B. (2000). Heat stress injury in relation to membrane lipid peroxidation in
creeping bentgrass. Crop Science, 40, 503-510.
Llamas, A., Ullrich, C. I. and Sanz, A. (2008). Ni2+ toxicity in rice: effect on membrane
functionality and plant water content. Plant Physiology and Biochemistry, 46, 905-910.
Low, P. S. (1985). Molecular basis of the biological compatibility of nature's osmolytes. In: R.
Gilles, and M. Gilles-Ballien (Eds.), Transport processes, iono- and osmoregulation (pp.
469–477). Berlin: Springer-Verlag.
Luan, S. (2003). Protein phosphatases in plants. Annual Review of Plant Biology, 54, 63-92.
Ma, H., Chong, K. and Deng, X. W. (2007). Rice research: past, present and future. Journal of
Integrative Plant Biology, 49, 729-730.
Ma, X., Qian, Q. and Zhu, D. (2005). Expression of a calcineurin gene improves salt stress
tolerance in transgenic rice. Plant Molecular Biology, 58, 483-495.
Maas, E. V. (1990). Crop salt tolerance. In: K. K. Tanji (Ed.), Agricultural salinity assessment
and management: ASCE manuals and reports on engineering No. 71 (pp. 262–304). New
York: American Society of Civil Engineers.
Magneschi, L. and Perata, P. (2009). Rice germination and seedling growth in the absence of
oxygen. Annals of Botany, 103, 181-196.
Maheshwari, R. and Dubey, R. S. (2007). Nickel toxicity inhibits ribonuclease and protease
activities in rice seedlings: protective effects of proline. Plant Growth Regulation, 51, 231-
243.
Mamun, E. A., Alfred, S., Cantrill, L. C., Overall, R. L. and Sutton, B. G. (2006). Effects of
chilling on male gametophyte development in rice. Cell Biology International, 30, 583-
591.
Martin, G. B., Brommonschenke, S. H., Chunwongse, J. A., Frary, M. W., Ganal, Spivey, R.,
Wu, T., Earle, E. D. and Tanksley, S. D. (1993). Map-based cloning of a protein kinase
gene conferring disease resistance in tomato. Science, 262, 1432-1436.
Matsui, T. and Omasa, K. (2002). Rice (Oryza sativa L.) cultivars tolerant to high temperature
at flowering: anther characteristics. Annals of Botany, 89, 683-687.
Matsumura, T., Tabayashi, N., Kamagata, Y., Souma, C. and Saruyama, H. (2002). Wheat
catalase expressed in transgenic rice can improve tolerance against low temperature stress.
Physiologia Plantarum, 116, 317-327.
Matsushima, S., Ikewada, H., Maeda, A., Honma, S. and Nike, H. (1982). Studies on the rice
cultivation in the tropics. 1. Yielding and ripening response of the rice plant to the extreme
hot and dry climate in Sudan. Japanese Journal of Tropical Agriculture, 25, 14-19.
176 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

McCouch, S. R., Chen, X. L., Panaud, O., Temnykh, S., Xu, Y. B., Cho, Y. G., Huang, N.,
Ishii, T. and Blair, M. (1997). Microsatellite marker development, mapping and
application in rice genetics and breeding. Plant Molecular Biology, 35, 89-99.
Mehta, H. S., Saftner, R. A., Mehta, R. A. and Davies, P. J. (1994). Identification of post-
transcriptionally modified 18-kilodalton protein from rice as eukaryotic translocation
initiation factor 5A. Plant Physiology, 106, 1413-1419.
Melis, A., Nemson, J. A. and Harrison, M. A. (1992). Damage to functional components and
partial degradation of photosystem II reaction center proteins upon chloroplast exposure to
ultraviolet-B radiation. Biochimica et Biophysica Acta, 1100, 312-320.
Menezes-Benavente, L., Teixeira, F. K., Kamei, C. L. A. and Margis-Pinheiro, M. (2004). Salt
stress induces altered expression of genes encoding antioxidant enzymes in seedlings of a
Brazilian indica rice (Oryza sativa L.). Plant Science, 166, 323-331.
Meriga, B., Reddy, B. K., Jogeswar, G., Reddy, L. A. and Kavi Kishor, P. B. (2003).
Alleviating effect of citrate on aluminium toxicity of rice (Oryza sativa L.) seedlings.
Current Science, 85, 383-386.
Milivojevic, D. B., Nikolic, B. R. and Drinic, G. (2003). Effects of arsenic on phosphorus
content in different organs and chlorophyll fluorescence in primary leaves of soybean.
Biologia Plantarum, 50, 149-151.
Millar, A. H., Trend, A. E. and Heazlewood, J. L. (2004). Changes in the mitochondrial
proteome during the anoxia to air transition in rice focus around cytochrome-containing
respiratory complexes. Journal of Biological Chemistry, 279, 39471-39478.
Mishra, N. S., Tuteja, R. and Tuteja, N. (2006). Signaling through MAP kinase networks in
plants. Archives of Biochemistry and Biophysics, 452, 55-68.
Mishra, P. and Dubey, R. (2008a). Effect of aluminium on metabolism of starch and sugars in
growing rice seedlings. Acta Physiologia Plantarum, 30, 265-275.
Mishra, S. and Dubey, R. S. (2006). Inhibition of ribonuclease and protease activities in
arsenic exposed rice seedlings: role of proline as enzyme protectant. Journal of Plant
Physiology, 163, 927-936.
Mishra, S. and Dubey, R. S. (2008b). Changes in phosphate content and phosphatase activities
in rice seedlings exposed to arsenite. Brazilian Journal of Plant Physiology, 20, 19-28.
Mittler, R. (2006). Abiotic stress, the field environment and stress combination. Trends in
Plant Science, 11, 15-19.
Mohanty, A., Kathuria, H., Ferjani, A., Sakamoto, A., Mohanty, P., Murata, N. and Tyagi, A.
K. (2002). Transgenics of an elite indica rice variety Pusa Basmati 1 harbouring the codA
gene are highly tolerant to salt stress. Theoretical and Applied Genetics, 106, 51-57.
Mohanty, B. and Ong, B. L. (2003). Contrasting effects of submergence in light and dark on
pyruvate decarboxylase activity in roots of rice lines differing in submergence tolerance.
Annals of Botany, 91, 291-300.
Mohanty, H. K., Mallik, S. and Grover, A. (2000). Prospects of improving flooding tolerance
in lowland rice varieties by conventional breeding and genetic engineering. Current
Science, 78, 132-137.
Moll, B. A., Eilmann, M. and Steinback, K. E. (1987). Phosphorylation of thylakoid proteins
of Oryza sativa: In vitro characterization and effects of chilling temperatures. Plant
Physiology, 83, 428-433.
 Effect of Abiotic Stresses on Growth… 177

Moradi, F. and Ismail, A. M. (2007). Responses of photosynthesis, chlorophyll fluorescence

and ROS scavenging systems to salt stress during seedling and reproductive stages in rice.
Annals of Botany, 99, 1161-1173.
Moriwaki, T., Yamamoto, Y., Aida, T., Funahashi, T., Shishido, T., Asada, M., Prodhan, S.
H., Komamine, A. and Motohashi, T. (2008). Overexpression of the Escherichia coli
catalase gene, katE, enhances tolerance to salinity stress in the transgenic indica rice
cultivar, BR5. Plant Biotechnology Reports, 2, 41-46.
Mukherji, S., Dey, B., Paul, A. K. and Sircar, S. M. (1971). Changes in phosphorus fractions
and phytase activity of rice seeds during germination. Physiologia Plantarum, 25, 94-97.
Munns, R., James, R. A. and Laüchli, A. (2006). Approaches to increasing the salt tolerance of
wheat and other cereals. Journal of Experimental Botany, 57, 1025-1043.
Murakami, T., Matsuba, S., Funatsuki, H., Kawaguchi, K., Saruyama, H., Tanida, M. and Sato,
Y. (2004). Expression of a small heat shock protein, sHSP17.7, confers both heat tolerance
and UV-B resistance to rice plants. Molecular Breeding, 13, 165-175.
Muramoto, S. (1989). Heavy metal tolerance of rice plants (Oryza sativa L.) to some metal
oxides at the critical levels. Journal of Environmental Science and Health, 624, 559-568.
Ndayiragije, A. and Luttis, S. (2006). Do exogenous polyamines have an impact on the
response of a salt-sensitive rice cultivar to NaCl. Journal of Plant Physiology, 163, 506-
516.
Ndong, C., Danyluk, J., Wilson, K. E., Pocock, T., Huner, N. P. A. and Sarhan, F. (2002).
Cold-regulated cereal chloroplast late embryogenesis abundant-like proteins. Molecular
characterization and functional analyses. Plant Physiology, 129, 1368-1381.
Noctor, G. and Foyer, C. H. (1998). Ascorbate and glutathione: keeping active oxygen under
control. Annual Review of Plant Physiology and Plant Molecular Biology, 49, 249-279.
Nouchi, I., Ito, O., Harazono, Y. and Kobayashi, K. (1991). Effects of chronic ozone exposure
on growth, root respiration and nutrient uptake of rice plants. Environmental Pollution, 74,
149-164.
O'Farrell, P. H. (1975). High resolution two-dimensional electrophoresis. Journal of Biological
Chemistry, 250, 4007-4021.
Ohnishi, T., Sugahara, S., Yamada, T., Kikuchi, K., Yoshiba, Y., Hirano, H. Y. and Tsutsumi,
N. (2005). OsNAC6, a member of the NAC gene family, is induced by various stresses in
rice. Genes and Genetic Systems, 80, 135-139.
Opik, H. (1973). Effect of anaerobiosis on respiratory rate, cytochrome oxidase activity and
mitochondrial structures in coleoptiles of rice (Oryza sativa L.). Journal of Cell Science,
12, 725-739.
Osaki, M., Nursyamsi, D., Begum, H. H., and Watanabe, T. (2001). Study on aluminium
resistance in relation to organic-acid anion exudation from roots of PEPC transgenic rice
plants. In: W. J. Horst, M. K. Schenk, A. Bürkert, N. Claassen, H. Flessa, W. B. Frommer,
H. Goldbach, H. W. Olfs, V. Römheld, B. Sattelmacher, U. Schmidhalter, S. Schubert,
N. V. Wirén, and L. Wittenmayer (Eds.), Plant nutrition: Food security and sustainability
of agro-ecosystems through basic and applied research (pp. 514-515). Fourteenth
International Plant Nutrition Colloquium, Hannover, Germany: Kluwer Academic
Publishers.
Pareek, A., Singla, S. L. and Grover, A. (1995). Immunological evidence for accumulation of
two high molecular weight (104 and 90 kDa) HSPs in response to different stresses in rice
178 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

and in response to high temperature stress in diverse plant genera. Plant Molecular Biology,
29, 293-301.
Pareek, A., Singla, S. L. and Grover, A. (1997). Short-term salinity and high temperature
stress-associated ultrastructural alterations in young leaf cells of Oryza sativa L. Annals of
Botany, 80, 629-639.
Parker, R., Flowers, T. J., Moore, A. L. and Harpham, N. V. J. (2006). An accurate and
reproducible method for proteome profiling of the effects of salt stress in the rice leaf
lamina. Journal of Experimental Botany, 57, 1109-1118.
Peng, S., Huang, J., Sheehy, J. E., Laza, R. C., Visperas, R. M., Zhong, X., Centeno, G. S.,
Khush, G. S. and Cassman, K. G. (2004). Rice yields decline with higher night
temperature from global warming. Proceedings of the National Academy of Sciences, 101,
9971-9975.
Peterson, A. G. and Oliver, D. J. (2006). Leaf-targeted phytochelatin synthase in Arabidopsis
thaliana. Plant Physiology and Biochemistry, 44, 885-892.
Platten, J. D., Cotsaftis, O., Berthomieu, P., Bohnert, H., Davenport, R. J., Fairbairn, D. J.,
Horie, T., Leigh, R. A., Lin, H. X., Luan, S., Maser, P., Pantoja, O., Rodriguez-Navarro,
A., Schachtman, D. P., Schroeder, J. I., Sentenac, H., Uozumi, N., Very, A. A., Zhu, J. K.,
Dennis, E. S. and Tester, M. (2006). Nomenclature for HKT transporters, key
determinants of plant salinity tolerance. Trends in Plant Science, 11, 372-374.
Rabbani, M. A., Maruyama, K., Abe, H., Khan, M. A., Katsura, K., Ito, Y., Yoshiwara, K.,
Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2003). Monitoring expression
profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid
application using cDNA microarray and RNA gel-blot analyses. Plant Physiology, 133,
1755-1767.
Rakwal, R., Agrawal, G. K., Kubo, A., Yonekura, M., Tamogami, S., Saji, H. and Iwahashi, H.
(2003). Defence/stress responses elicited in rice seedlings exposed to the gaseous air
pollutant sulfur dioxide. Environmental and Experimental Botany, 49, 223-235.
Ram, P. C, Singh, B. B, Singh, A. K, Ram, P., Singh, P. N., Singh, H. P., Boamfa, E. I.,
Harren, F. J. M., Santosa, E., Jackson, M. B., Setter, T. L., Reuss, J., Wade, L. J., Singh,
V. P. and Singh, R. K. (2002). Submergence tolerance in rainfed lowland rice:
physiological basis and prospects for cultivar improvement through marker-aided
breeding. Field Crops Reserach, 76, 131-152.
Ramalingam, J., Cruz, C. M. V., Kukreja, K., Chittoor, J. M., Wu, J. L., Lee, S. W., Baraoidan,
M., George, M. L., Cohen, M. B., Hulbert, S. H., Leach J. E. and Leung, H. (2003).
Candidate defense genes from rice, barley, and maize and their association with qualitative
and quantitative resistance in rice. Molecular Plant-Microbe Interactions, 16, 14-24.
Ramamoorthy, R., Jiang, S. Y., Kumar, N., Venkatesh, P. N. and Ramachandran, S. (2008). A
comprehensive transcriptional profiling of the WRKY gene family in rice under various
abiotic and phytohormone treatments. Plant and Cell Physiology, 49, 865-879.
Rea, P. A., Vatamaniuk, O. K. and Rigden, D. J. (2004). Weeds, worms, and more. Papain's
long-lost cousin, phytochelatin synthase. Plant Physiology, 136, 2463-2474.
Reggiani, R., Aurisano, N., Mattana, M. and Bertani, A. (1993). Influence of K+ ions on
polyamine leve1 in wheat seedlings. Journal of Plant Physiology, 141, 136-140.
Ren, Z. H, Gao, J. P, Li, L. G, Cai, X. L, Huang, W., Chao, D. Y, Zhu, M. Z, Wang, Z. Y,
Luan, S. and Lin, H. X. (2005). A rice quantitative trait locus for salt tolerance encodes a
sodium transporter. Nature Genetics, 37, 1141-1146.
 Effect of Abiotic Stresses on Growth… 179

Ricard, B., Couée, I., Raymond, P., Saglio, P. H., Saint-Ges, V. and Pradet, A. (1994). Plant
metabolism under hypoxia and anoxia. Plant Physiology and Biochemistry, 32, 1-10.
Ricard, B., Rivoal, J., Spiteri, A. and Pradet, A. (1991). Anaerobic stress induces the
transcription and translation of sucrose synthase in rice. Plant Physiology, 95, 669-674.
Richharia, A., Shah, K. and Dubey, R. S. (1997). Nitrate reductase from rice seedlings: partial
purification, characterization and the effects of in situ and in vitro NaCl salinity. Journal
of Plant Physiology, 151, 316-322.
Rodríguez, M., Canales, E., Borroto, C. J., Carmona, E., López, J., Pujol, M. and Borrás-
Hidalgo, O. (2006). Identification of genes induced upon water-deficit stress in a drought-
tolerant rice cultivar. Journal of Plant Physiology, 163, 577-584.
Rohila, J. S. and Yang, Y. (2007). Rice mitogen-activated protein kinase gene family and its
role in biotic and abiotic stress response. Journal of Integrative Plant Biology, 49, 751-
759.
Roy, M. and Ghosh, B. (1996). Polyamines, both common and uncommon, under heat stress in
rice (Oryza sativa L.) callus. Physiologia Plantarum, 98, 196-200.
Roy, M. and Wu, R. (2001). Arginine decarboxylase transgene expression and analysis of
environmental stress tolerance in transgenic rice. Plant Science, 160, 869-875.
Roy, M. and Wu, R. (2002). Overexpression of S-adenosylmethionine decarboxylase gene in
rice increases polyamine level and enhances sodium chloride-stress tolerance. Plant
Science, 163, 987-992.
Roy, P., Niyogi, K., SenGupta, D. N. and Ghosh, B. (2005). Spermidine treatment to rice
seedlings recovers salinity stress-induced damage of plasma membrane and PM-bound H+-
ATPase in salt-tolerant and salt-sensitive rice cultivars. Plant Science, 168, 583-591.
Rudolph, A., Crowe, J. and Crowe, L. (1986). Effects of three stabilizing agents- proline,
betaine and trehalose on membrane phospholipids. Archives of Biochemistry and
Biophysics, 245, 134-143.
Russell, B. L., Rathinasabapathi, B. and Hanson, A. D. (1998). Osmotic stress induces
expression of choline monooxygenase in sugar beet and amaranth. Plant Physiology, 116,
859-865.
Rustad, L. E., Campbell, J., Marion, G. M., Norby, R. J., Mitchell, M. J., Hartley, A. E.,
Cornelissen, J. H. C. and Gurevitch, J. (2001). A meta-analysis of the response of soil
respiration, net N mineralization, and above-ground plant growth to experimental
ecosystem warming. Oecologia, 126, 543-562.
Sahar, N. M., Mehran, H. R., Manzar, H. and Ghasem, H. S. (2007). Proteomics reveals new
salt responsive proteins associated with rice plasma membrane. Bioscience,
Biotechnology, and Biochemistry, 71, 2144-2154.
Saijo, Y, Hata, S, Kyozuka, J, Shimamoto, K and Izui, K. (2000). Overexpression of a single
Ca2+-dependent protein kinase confers both cold and salt/drought tolerance on rice plants.
The Plant Journal, 23, 319-327.
Saijo, Y., Kinoshita, N., Ishiyama, K., Hata, S., Kyozuka, J., Hayakawa, T., Nakamura, T.,
Shimamoto, K., Yamaya, T. and Izui, K. (2001). A Ca2+-dependent protein kinase that
endows rice plants with cold and salt-stress tolerance functions in vascular bundles. Plant
and Cell Physiology, 42, 1228-1233.
Saini, H. S. and Westgate, M. E. (2000). Reproductive development in grain crops during
drought. Advances in Agronomy, 68, 59-96.
180 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Sakamoto, A. and Murata, N. (2002). The role of glycine betaine in the protection of plants
from stress: clues from transgenic plants. Plant, Cell and Environment, 25, 163-171.
Salt, D. E., Smith, R. D. and Raskin, I. (1998). Phytoremediation. Annual Review of Plant
Physiology and Plant Moecular Biology, 49, 643-668.
Sarvestani, Z. T., Pirdashti, H., Sanavy, S. A. and Balouchi, H. (2008). Study of water stress
effects in different growth stages on yield and yield components of different rice (Oryza
sativa L.) cultivars. Pakistan Journal of Biological Sciences, 11, 1303-1309.
Sasaki, T. and Burr, B. (2000). International Rice Genome Sequencing Project: the effort to
completely sequence the rice genome. Current Opinion in Plant Biology, 3, 138-142.
Sato, Y. and Yokoya, S. (2008). Enhanced tolerance to drought stress in transgenic rice plants
overexpressing a small heat-shock protein, sHSP17.7. Plant Cell Reports, 27, 329-334.
Seki, M, Kamei, A., Yamaguchi-Shinozaki, K. and Shinozaki, K. (2003). Molecular responses
to drought, salinity and frost: common and different paths for plant protection. Current
Opinion in Biotechnology, 14, 194-199.
Shah, K. and Dubey R. S. (1995). Effect of cadmium on RNA level as well as activity and
molecular forms of ribonuclease in growing rice seedlings. Plant Physiology and
Biochemistry, 33, 577-584.
Shah, K. and Dubey, R. S. (1997a). Effect of cadmium on proteins, amino acids and protease,
aminopeptidase and carboxypeptidase in rice seedlings. Plant Physiology and
Biochemistry (New Delhi), 24, 89-95.
Shah, K. and Dubey, R. S. (1997b). Cadmium alters phosphate level and suppresses activity of
phosphorolytic enzymes in germinating rice seeds. Journal of Agronomy and Crop
Science, 179, 35-45.
Shah, K. and Dubey, R. S. (1998a). A 18 kDa Cd inducible protein complex: its isolation and
characterization from rice (Oryza sativa L.) seedlings. Journal of Plant Physiology, 152,
448-454.
Shah, K. and Dubey, R. S. (1998b). Cadmium elevates level of protein, amino acids and alters
the activity of proteolytic enzymes in germinating rice seeds. Acta Physiologia Plantarum,
20, 189-196.
Shah, K. and Dubey, R. S. (1998c). Cadmium suppresses phosphate level and inhibits the
activity of phosphatases in growing rice seedlings. Journal of Agronomy and Crop
Science, 180, 223-231.
Shah, K. and Dubey, R. S. (1998d). Effect of cadmium on proline accumulation and
ribonuclease activity in rice seedlings: role of proline as a possible enzyme protectant.
Biologia Plantarum, 40, 121-130.
Shah, K., Kumar, R. G., Verma, S. and Dubey, R. S. (2001). Effect of cadmium on lipid
peroxidation, superoxide anion generation and activities of antioxidant enzymes in
growing rice seedlings. Plant Science, 161, 1135-1144.
Sharma, P. and Dubey, R. S. (2004). Ascorbate peroxidase from rice seedlings: properties of
enzyme isoforms, effects of stresses and protective roles of osmolytes. Plant Science, 167,
541-550.
Sharma, P. and Dubey, R. S. (2005a). Modulation of nitrate reductase activity in rice seedlings
under aluminium toxicity and water stress: role of osmolytes as enzyme protectant.
Journal of Plant Physiology, 162, 854-864.
 Effect of Abiotic Stresses on Growth… 181

Sharma, P. and Dubey, R. S. (2005b). Drought induces oxidative stress and enhances the
activities of antioxidant enzymes in growing rice seedlings. Plant Growth Regulation, 46,
209-221.
Sharma, P. and Dubey, R. S. (2007). Involvement of oxidative stress and role of antioxidative
defense system in growing rice seedlings exposed to toxic concentrations of aluminum.
Plant Cell Reports, 26, 2027-2038.
Sheoran, I. S. and Saini, H. S. (1996). Drought-induced male sterility in rice: changes in
carbohydrate levels and enzyme activities associated with the inhibition of starch
accumulation in pollen. Sexual Plant Reproduction, 9, 161-169.
Shinozaki, K., Yamaguchi-Shinozaki, K. and Seki, M. (2003). Regulatory network of gene
expression in the drought and cold stress responses. Current Opinion in Plant Biology, 6, 410-
417.
Shirasawa, K., Takabe, T., Takabe, T. and Kishitani, S. (2006). Accumulation of
glycinebetaine in rice plants that overexpress choline monooxygenase from spinach and
evaluation of their tolerance to abiotic stress. Annals of Botany, 98, 565-571.
Sinha, R. P. and Hader, D. P. (2002). UV-induced DNA damage and repair: A review.
Photochemical and Photobiological Sciences, 1, 225-236.
Siopongco J. D. L. C., Sekiya, K., Yamauchi, A., Egdane, J., Ismail, A. M. and Wade, L. J.
(2008). Stomatal responses in rainfed lowland rice to partial soil drying: evidence for root
signals. Plant Production Science, 11, 28-41.
Skriver, K. and Mundy, J. (1990). Gene expression in response to abscisic acid and osmotic
stress. The Plant Cell, 2, 503-512.
Su, J. and Wu, R. (2004). Stress-inducible synthesis of proline in transgenic rice confers faster
growth under stress conditions than that with constitutive synthesis. Plant Science, 166,
941-948.
Su, J., Hirji, R., Zhang, L., He, C., Selvaraj, G. and Wu, R. (2006). Evaluation of the stress-
inducible production of choline oxidase in transgenic rice as a strategy for producing the
stress protectant glycine betaine. Journal of Experimental Botany, 57, 1129-1135.
Sudo, E., Itouga, M., Yoshida-Hatanaka, K., Ono, Y. and Sakakibara, H. (2008). Gene
expression and sensitivity in response to copper stress in rice leaves. Journal of
Experimental Botany, 59, 3465-3474.
Suralta, R. R. and Yamauchi, A. (2008). Root growth, aerenchyma development, and oxygen
transport in rice genotypes subjected to drought and water logging. Environmental and
Experimental Botany, 64, 75-82.
Swindell, W. R. (2006). The association among gene expression responses to nine abiotic
stress treatments in Arabidopsis thaliana. Genetics, 174, 1811-1824.
Tadege, M., Brändle, R. and Kuhlemeier, C. (1998). Anoxia tolerance in tobacco roots: effect
of overexpression of pyruvate decarboxylase. The Plant Journal, 14, 327-335.
Taiz, L., and Zeiger, E. (1998). Plant Physiology (second edition). Sunderland, Massachusetts:
Sinauer Associates.
Takeuchi, A., Yamaguchi, T., Hidema, J., Strid, A. and Kumagai, T. (2002). Changes in
synthesis and degradation of Rubisco and LHCII with leaf age in rice (Oryza sativa L.)
growing under supplementary UV-B radiation. Plant, Cell and Environment, 25, 695-706.
Tanaka, Y., Hibino, T., Hayashi, Y., Tanaka, A., Kishitani, S., Takabe, T., Yokota, S. and
Takabe, T. (1999). Salt tolerance of transgenic rice overexpressing yeast mitochondrial
Mn-SOD in chloroplasts. Plant Science, 148, 131-138.
182 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Tang, R. S., Zheng, J. C., Jin, Z. Q., Zhang, D. D., Huang, Y. H. and Chen, L. G. (2008).
Possible correlation between high temperature-induced floret sterility and endogenous
levels of IAA, GAs and ABA in rice (Oryza sativa L.). Plant Growth Regulation, 54, 37-
43.
Tang, Y., Wen, X., Lu, Q., Yang, Z., Cheng, Z. and Lu, C. (2007). Heat stress induces an
aggregation of the light-harvesting complex of photosystem II in spinach plants. Plant
Physiology, 143, 629-638.
Tayal, D., Srivastava, P.S. and Bansal, K. C. (2004). Transgenic crops for abiotic stress
tolerance. In: P. S. Srivasatva, A. Narula, and S. Srivastava (Eds.), Plant biotechnology
and molecular markers (pp. 346-365). Dordrecht, The Netherlands: Kluwer Academic
Publishers.
Teramura, A. H., and Ziska, L. H. (1996). Ultraviolet-B radiation and photosynthesis. In: N. R.
Baker (Ed.) Photosynthesis and the Environment (pp. 435-450). Dordrecht, The Netherlands:
Kluwer Academic Publishers.
Teranishi, M., Iwamatsu, Y., Hidema, J. and Kumagai, T. (2004). Ultraviolet-B sensitivities in
Japanese lowland rice cultivars: cyclobutane pyrimidine dimer photolyase activity and
gene mutation. Plant and Cell Physiology, 45, 1845-1856.
Thorup, T. A., Tanyolac, B., Livingstone, K. D., Popovsky, S., Paran, I. and Jahn, M. (2000).
Candidate gene analysis of organ pigmentation loci in the Solanaceae. Proceedings of the
National Academy of Sciences, 97, 11192-11197.
Tolbert, N. E. (1971). Microbodies-peroxisomes and glyoxysomes. Annual Review of Plant
Physiology, 22, 48-78.
Tolleter, D., Jaquinod, M., Mangavel, C., Passirani, C., Saulnier, P., Manon, S., Teyssier, E.,
Payet, N., Avelange-Macherel, M. H. and Macherel, D. (2007). Structure and function of a
mitochondrial late embryogenesis abundant protein are revealed by desiccation. The Plant
Cell, 19, 1580-1589.
Tompa, P., Banki, P., Bokor, M., Kamasa, P., Kovacs, D., Lasanda, G. and Tompa, K. (2006).
Protein-water and protein-buffer interactions in the aqueous solution of an intrinsically
unstructured plant dehydrin: NMR intensity and DSC aspects. Biophysical Journal, 91,
2243-2249.
Tseng, T., Tzeng, S. S., Yeh, C. H., Chang, F. C., Chen, Y. M. and Lin, C. Y. (1993). The
heat-shock response in rice seedlings-isolation, and expression of cDNAs that encode
class-I low molecular weight heat-shock proteins. Plant and Cell Physiology, 34, 165-168.
Tuteja, N. (2007). Mechanisms of high salinity tolerance in plants. Methods in Enzymology,
428, 419-438.
Tyagi, A., Mohanty, A., Bajaj, S., Chaudhury, A. and Maheshwari, S. (1999). Transgenic rice:
a valuable monocot system for crop improvement and gene research. Critical Reviews in
Biotechnology, 19, 41-79.
Ushimaru, T., Nakagawa, T., Fujioka, Y., Daicho, K., Naito, M., Yamauchi, Y., Nonaka, H.,
Amako, K., Yamawaki, K. and Murata, N. (2006). Transgenic Arabidopsis plants
expressing the rice dehydroascorbate reductase gene are resistant to salt stress. Journal of
Plant Physiology, 163, 1179-1184.
Vain, P., James, V. A., Worland, B. and Snape, J. W. (2002). Transgene behaviour across two
generations in a large random population of transgenic rice plants produced by particle
bombardment. Theoretical and Applied Genetics, 105, 878-889.
 Effect of Abiotic Stresses on Growth… 183

Vani, B., Pardha Saradhi, P. and Mohanty, P. (1996). Effect of short term heat treatment of
rice seedlings on sensitivity of thylakoid membranes to photoinhibition. Biologia
Plantarum, 38, 501-509.
Vartapetian, B. B. and Jackson, M. B. (1997). Plant adaptations to anaerobic stress. Annals of
Botany, 79, 3-20.
Vass, I. (1997). Adverse effects of UV-B light on the structure and function of the
photosynthetic apparatus. In: M. Pessarakli (Ed.), Handbook of photosynthesis (pp. 931-
949). New York: Marcel Dekker Inc.
Verma, S. and Dubey, R. S. (2001). Effect of cadmium on soluble sugars and enzymes of their
metabolism in rice. Biologia Plantarum, 44, 117-123.
Verma, S. and Dubey, R. S. (2003). Lead toxicity induces lipid peroxidation and alters the
activities of antioxidant enzymes in growing rice plants. Plant Science, 164, 645-655.
Vierling, E. (1991). The roles of heat shock proteins in plants. Annual Review of Plant
Physiology and Plant Molecular Biology, 42, 579-620.
Vinocur, B. and Altman, A. (2005). Recent advances in engineering plant tolerance to abiotic
stress: achievements and limitations. Current Opinion in Biotechnology, 16, 123-132.
Wahid, A., Gelani, S., Ashraf, M. and Foolad, M. R. (2007). Heat tolerance in plants: an
overview. Environmental and Experimental Botany, 61, 199-223.
Walters, D. R. (2000). Polyamines in plant-microbe interactions. Physiological and Molecular
Plant Pathology, 57, 137-146.
Wan, X. Y., Wan, J. M., Weng, J. F., Jiang, L., Bi, J. C., Wang, C. M. and Zhai H. Q. (2005).
Stability of QTLs for rice grain dimension and endosperm chalkiness characteristics across
eight environments. Theoretical and Applied Genetics, 110, 1334-1346.
Wang, F. Z., Wang, Q. B., Kwon, S. Y., Kwak, S. S. and Su, W. A. (2005a). Enhanced drought
tolerance of transgenic rice plants expressing a pea manganese superoxide dismutase.
Journal of Plant Physiology, 162, 465-472.
Wang, F., Zeng, B., Sun, Z. and Zhu, C. (2009). Relationship between proline and Hg2+-
induced oxidative stress in a tolerant rice mutant. Archives of Environmental
Contamination and Toxicology, 56, 723-731.
Wang, H., Hao, J., Chen, X., Hao, Z., Wang, X., Lou, Y., Peng, Y. and Guo, Z. (2007).
Overexpression of rice WRKY89 enhances ultraviolet B tolerance and disease resistance
in rice plants. Plant Molecular Biology, 65, 799-815.
Wang, H., Huang, D., Lu, R., Liu, J., Qian, Q. and Peng, X. (2000). Salt tolerance of
transgenic rice (Oryza sativa L.) with mtlD gene and gutD gene. Chinese Science Bulletin,
45, 1685-1690.
Wang, L., Cai, H., Bai, X., Li, L. W., Li, Y. and Zhu, Y. M. (2008a). Cultivation of transgenic
rice plants with OsCDPK7 gene and its salt tolerance. Yi Chuan, 30, 1051-1055.
Wang, Q., Guan, Y., Wu, Y., Chen, H., Chen, F. and Chu, C. (2008b). Overexpression of a
rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both
Arabidopsis and rice. Plant Molecular Biology, 67, 589-602.
Wang, W., Vinocur, B., Shoseyov, O. and Altman, A. (2004). Role of plant heat-shock
proteins and molecular chaperones in the abiotic stress response. Trends in Plant Science,
9, 244-252.
Wang, X. S., Zhu, J., Locedie, M. and Richard, B. (2005b). Identification of candidate genes
for drought stress tolerance in rice by the integration of a genetic (QTL) map with the rice
genome physical map. Journal of Zhejiang University Science, 6B, 382-388.
184 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Waters, E. R., Lee, G. J. and Vierling, E. (1996). Evolution, structure and function of the small
heat shock proteins in plants. Journal of Experimental Botany, 47, 325-338.
Wayne, M. L. and McIntyre, L. M. (2002). Combining mapping and arraying: an approach to
candidate gene identification. Proceedings of the National Academy of Sciences, 99,
14903-14906.
Wu, K. L., Guo, Z. J., Wang, H. H. and Li, J. (2005b) The WRKY family of transcription
factors in rice and arabidopsis and their origins. DNA Research, 12, 9-26.
Wu, L., Fan, Z., Guo, L., Li, Y., Chen, Z. L. and Qu, L. J. (2005a). Overexpression of the
bacterial nhaA gene in rice enhances salt and drought tolerance. Plant Science, 168, 297-
302.
Wu, X., Shiroto, Y., Kishitani, S., Ito, Y. and Toriyama, K. (2009). Enhanced heat and drought
tolerance in transgenic rice seedlings overexpressing OsWRKY11 under the control of
HSP101 promoter. Plant Cell Reports, 28, 21-30.
Xiang, Y., Huang, Y. and Xiong, L. (2007). Characterization of stress-responsive CIPK genes
in rice for stress tolerance improvement. Plant Physiology, 144, 1416-1428.
Xiao, B., Huang, Y., Tang, N. and Xiong, L. (2007). Expression of a LEA gene in rice
improves drought resistance under the field conditions. Theoretical and Applied Genetics,
115, 35-46.
Xu, D., Duan, X., Wang, B., Hong, B., Ho, T. and Wu, R. (1996). Expression of a late
embryogenesis abundant protein gene, HVA1, from barley confers tolerance to water
deficit and salt stress in transgenic rice. Plant Physiology, 110, 249-257.
Xu, K., Xu, X., Fukao, T., Canlas, P., Maghirang-Rodriguez, R., Heuer, S., Ismail, A. M.,
Bailey-Serres, J., Ronald, P. C. and Mackill, D. J. (2006). Sub1A is an ethylene-response-
factor-like gene that confers submergence tolerance to rice. Nature, 442, 705-708.
Yamaguchi, T., Nakayama, K., Hayashi, T., Yazaki, J., Kishimoto, N., Kikuchi, S. and Koike,
S. (2004). cDNA microarray analysis of rice anther genes under chilling stress at the
microsporogenesis stage revealed two genes with DNA transposon Castaway in the 5′-
flanking region. Bioscience, Biotechnology and Biochemistry, 68, 1315-1323.
Yamaguchi-Shinozaki, K. and Shinozaki, K. (2005). Organization of cis-acting regulatory
elements in osmotic and cold stress responsive promoters. Trends in Plant Science, 10, 88-
94.
Yamakawa, H., Hirose, T., Kuroda, M. and Yamaguchi, T. (2007). Comprehensive expression
profiling of rice grain filling-related genes under high temperature using DNA microarray.
Plant Physiology, 144, 258-277.
Yamane, K., Kawasaki, M., Taniguchi, M. and Miyake, H. (2003). Differential effect of NaCl
and polyethylene glycol on the ultrastructure of chloroplasts in rice seedlings. Journal of
Plant Physiology, 160, 573-575.
Yamane, K., Kawasaki, M., Taniguchi, M. and Miyake, H. (2004). Pretreatment with
antioxidants decreases the effects of salt stress on chloroplast ultrastructure in rice leaf
segments (Oryza sativa L.). Plant Production Science, 7, 292-300.
Yan, S. P., Zhang, Q. Y., Tang, Z. C., Su, W. A. and Sun, W. N. (2006). Comparative
proteomic analysis provides new insight into chilling stress response in rice. Molecular
and Cellular Proteomics, 5, 484-496.
Yan, S., Tsay, C. and Chen, Y. (2000). Isolation and characterisation of phytochelatin synthase
in rice seedlings. Proceedings of the National Academy of Sciences, 24, 202-207.
 Effect of Abiotic Stresses on Growth… 185

Yang, C. M. and Heilman, J. L. (1991). Short-term high temperature effects on stomatal

behaviors of rice plants. I. Occurring at the vegetative stage. Journal of Agricultural
Research of China, 40, 233-242.
Yang, J. L., Zhang, L., Li, Y. Y., You, J. F., Wu, P. and Zheng, S. J. (2006). Citrate
transporters play a critical role in aluminium-stimulated citrate efflux in rice bean (Vigna
umbellata) roots. Annals of Botany, 97, 579-584.
Yang, J., Zhang, J., Liu, K., Wang, Z. and Liu, L. (2007). Involvement of polyamines in the
drought resistance of rice. Journal of Experimental Botany, 58, 1545-1555.
Yang, J., Zhang, J., Wang, Z., Zhu, Q. and Wang, W. (2001). Remobilization of carbon
reserves in response to water deficit during grain filling of rice. Field Crops Research, 71,
47-55.
Yang, W., Kong, Z., Omo-Ikerodah, E., Xu, W., Li, Q. and Xue, Y. (2008). Calcineurin B-like
interacting protein kinase OsCIPK23 functions in pollination and drought stress responses
in rice (Oryza sativa L.). Journal of Genetics and Genomics, 35, 531-532.
Yannarelli, G. G., Noriega, G. O., Batlle, A. and Tomaro, M. L. (2006). Heme oxygenase up-
regulation in ultraviolet-B irradiated soybean plants involves reactive oxygen species.
Planta, 224, 1154-1162.
Ye, X. S., Avdiushko, S. A. and Kuc, J. (1994). Effect of polyamines on in vitro
phosphorylation of soluble and plasma membrane proteins in tobacco, cucumber and
Arabidopsis thaliana. Plant Science, 97, 109-118.
Yeo, A. R., Caporn, S. J. M. and Flowers, T. J. (1985). The effect of salinity upon
photosynthesis in rice (Oryza sativa L.): gas exchange by individual leaves in relation to
their salt content. Journal of Experimental Botany, 36, 1240-1248.
Yokoi, S. and Toriyama, K. (2000). Transgenic rice (Oryza sativa). In: Y. P. S. Bajaj (Ed.),
Biotechnology in agriculture and forestry: Transgenic crops I (pp. 1-13). Berlin,
Heidelberg: Springer-Verlag.
Yoshida, S. (1981). Fundamentals of rice crop science. In: Growth and development of the rice
plant (pp. 1-63). Los Baños, Philippines: International Rice Research Institute.
Yue, B., Xue, W., Luo, L. and Xing, Y. (2008). Identification of quantitative trait loci for four
morphologic traits under water stress in rice (Oryza sativa L.). Journal of Genetics and
Genomics, 35, 569-575.
Zeng, L. and Shannon, M. C. (2000). Salinity effects on the seedling growth and yield
components of rice. Crop Science, 40, 996-1003.
Zenk, M. H. (1996). Heavy metal detoxification in higher plants. A review. Gene, 179, 21-30.
Zhang, Y., Mian, M. A. R. and Boutona, J. H. (2006). Recent molecular and genomic studies
on stress tolerance of forage and turf grasses. Crop Science, 46, 497-511.
Zhou, J., Wang, X., Jiao, Y., Qin, Y. and Liu, X. (2007). Global genome expression analysis of
rice in response to drought and high-salinity stresses in shoot, flag leaf and panicle. Plant
Molecular Biology, 63, 591-608.
Zhu, J. K. (2001). Plant salt tolerance. Trends in Plant Science, 6, 66-71.
Zhu, J. K. (2002). Salt and drought stress signal transduction in plants. Annual Review of Plant
Biology, 53, 247-273.
Zombori, Z., Jancsó, M., Zvara, A., Pauk, J. and Györgyey, J. (2008). Investigation of the
effect of drought stress on the rice transcriptome. Acta Biologica Szegediensis, 52, 143-
145.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 4

DOMESTICATION AND CONSERVATION GENETICS

OF THE LIMA BEAN (PHASEOLUS LUNATUS L.)
IN ITS MESOAMERICAN DIVERSITY CENTER

Jaime Martínez-Castillo1, Patricia Colunga-GarcíaMarín,

Daniel Zizumbo-Villarreal, Filogonio May-Pat
and Julián Coello-Coello
Centro de Investigación Científica de Yucatán (CICY), Calle 43 No. 130,
Col. Chuburná de Hidalgo, Mérida, Yucatán 97200, México

ABSTRACT
The lima bean (Phaseolus lunatus L.) is the second major cultivated species of the
genus Phaseolus. It possesses high levels of genetic diversity and its primary gene pool
includes both wild and domesticated forms grouped into two main gene pools:
Mesoamerican and Andean. In the Yucatan peninsula, it is integrated into the traditional
agricultural system focused on corn cultivation, known as milpa, where it is planted as an
associated crop. This region possesses the largest diversity of domesticated forms in
Mexico, a diversity that is possibly being generated and maintained, in part, by their
sympatric growth with wild populations. However, the repercussions of human population
growth and socio-economic changes occurring in this region during the last 50 years have
resulted in major modifications to the milpa. One of the most evident consequences of
these changes has been a decreased planting of the crops associated with corn and a loss of
the vegetational areas next to the milpa where wild relatives grow. This review chapter
shows the results of eight years of research on the conservation genetics of P. lunatus in
the Yucatan peninsula, México, using ethnobotanical, ecological and genetic evidence.
The results indicate that: 1) the genetic diversity of P. lunatus from the Yucatan peninsula
is higher in comparison to other Mesoamerican regions; 2) wild populations show higher
values of diversity than the domesticated ones, probably due to a founder effect or recent
processes of genetic erosion in the domesticated forms; 3) the three most abundant

1
E-mail: jmartinez@cicy.mx.
188 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

landraces (70% of the planted area) had the lowest values of genetic diversity—in contrast,
12 landraces with high levels of genetic diversity were planted only by few farmers, a
situation that shows the high risk of genetic erosion in the domesticated gene pool; 4) wild
and domesticated gene pools show a strong genetic differentiation due to distance isolation
and low levels of gene flow; 5) the wild-domesticated gene flow is low, but it is three
times higher than the domesticated to the wild populations than in the opposite direction.
This situation may lead to genetic assimilation of the wild lima bean by its domesticated
counterpart and may lead to the possible escape of transgenes in this center of diversity. In
situ programs urgently need to be established in this important Mesoamerican region to
conserve the milpa system, including the lima bean landraces and its wild populations.

INTRODUCTION
According to the Rural Advancement Foundation International (RAFI), agriculture
worldwide has lost three-quarters of the genetic diversity in major food crops, and this erosion
continues at an annual rate of 1–2% (Mazhar, 1997). Genetic erosion is the loss or reduction of
genetic diversity between and within populations of the same species over time (Jarvis et al.,
2000), and most often results from agricultural, economic and social changes (FAO, 1996). In
cultivated species, this phenomenon has been evaluated at the landrace level (Tsegaye and
Berg, 2006; Hammer and Laghetti, 2005), principally as this is the primary available genetic
pool for hybridization and genetic improvement programs (Harlan and De Wet, 1971).
However, genetic erosion is an important phenomenon in the wild relatives, too. Nowadays
there has been renewed interest in studying the wild ancestors of domesticated species as a
plant genetic resource, given their potential value as reservoirs of genetic variation for crop
improvement (Degreef et al., 2002). Genetic erosion is a significant issue in crop
domestication areas since a) they concentrate the highest genetic diversity; b) traditional
producers conserve ancestral landraces, along with the knowledge and cultural practices that
created this diversity; and c) there exist inter-reproductive wild-weedy-domesticated
complexes, favoring wild-domesticated gene flow (Bellon and Taylor, 1993; Brush, 1991).
Mexico forms part of the Mesoamerican center of domestication (Vavilov, 1926). The
ecological, productive and cultural conditions of traditional agroecosystems in Mexico have
helped to conserve a large number of domesticated species. These conditions have also
maintained these species as part of a dynamic scenario for development of new crops and
species evolution, both of which are processes that favor high levels of variation and genetic
contact with wild relatives (Hernández-Xolocotzi, 1973). In this Mesoamerican region,
Phaseolus beans are a very important crop. After corn, beans are the second most important
crop of the milpa production system, an ancestral Mesoamerican dry land farming system
based on human energy in which vegetation is cyclically slashed and burned in order to plant a
group of basic crops, such as corn (Zea mays L.) and squash (Cucurbita moschata [Duch]
Duch ex Poir; C. argyrosperma Huber). Alongside these basic crops, other secondary species
are cultivated, such as chilis (Capsicum spp.), sweet potatoes (Ipomoea batatas L.), cassava
(Manihot esculenta Crantz) and tomatoes (Solanum esculentum L.). After two to four years of
cultivation (depending on soil fertility), the land is allowed to rest for a period of five to 15
years before a new cycle is begun (Hernández-Xolocotzi, 1992; Pérez-Toro, 1945). The
conservation of patches of vegetation that are cyclically cultivated is, in turn, the mainstay of
the milpa’s productivity, as it assures the recovery of soil fertility and maintains the habitat for
 Domestication and Conservation Genetics of the Lima Bean… 189

a large part of the plant genetic resources integrated into the milpa agroforestry production
system (Colunga-GarcíaMarín and May-Pat, 1992; Hernández-Xolocotzi, 1992; Zizumbo-
Villarreal, 1992).
Phaseolus beans are the world’s most important grain legumes for direct human
consumption. Dry beans (P. vulgaris L.) were grown on 27.7 million ha in 148 countries in
2004 and total production was 18.7 million metric tons (MT) (http://faostat.fao.org/site/408/
default.aspx; 2006). The main production areas of beans are Latin America (with Brazil and
Mexico as the most important producers) and eastern Africa (Broughton et al., 2003). From an
economic perspective, dry bean exports generate US $812 million for developing countries,
whereas developed countries receive US $460 million for their exports. However, in many of
the countries in the world, especially in developing countries, beans are consumed as an
important part of the diet and not exported. The importance of beans to diets in the developing
world is reflected in the fact that for developing countries only 13% of production is exported.
This contrasts with developed countries, which export 31% of their production. Beans are
nutritionally rich, especially in protein and iron, along with being a good source of dietary
fiber and complex carbohydrates. Given their nutritional quality and high consumption levels,
beans make an important contribution to human nutrition, especially for poor consumers. In
addition to high quality protein, a single serving (1 cup) of beans provides at least half of the
USDA-recommended daily allowance of folic acid and 25–30 percent of the daily
recommended iron levels. Similarly, the same serving of beans provides 25 percent of the daily
requirements of magnesium and copper, and 15 percent of potassium and zinc (http://www.
cgiar.org/impact/research/beans.html).
Beans (Phaseolus spp.) are one of the many other groups of domesticated species that are
at risk of genetic erosion in their domestication and diversity centers. This genus has a
complex taxonomic and nomenclatural history, but recent phylogenetic investigations support
a monophyletic Phaseolus with an origin strictly in the New World, concentrated in tropical
and warm temperate America. The exact number of species within the genus is still being
debated (Delgado-Salinas et al., 1999, 2006; Freytag and Debouck, 2002). However, there are
probably around 50 species in the genus, of which five are domesticated: the common bean (P.
vulgaris L.), scarlet runner bean (P. coccineus L.), tepary bean (P. acutifolius A. Gray) and
year bean (P. polyanthus Greenm.), and lima bean (P. lunatus L.) (Baudoin et al., 2004).
After the common bean, the lima bean (Phaseolus lunatus L.) is the second most
important cultivated species of the genus Phaseolus in the world. It is an important source of
protein for rural populations in America and Africa and an important commercial species for
countries such as the United States, the world largest producer of the lima bean, followed by
Malagasy and Peru (Akande and Balogun, 2007). It is an annual or short-lived perennial
species, with a mixed mating system, that is predominantly autogamous but with outcrossing
levels up to 48% (Baudoin et al., 1998). It is characterized by high levels of genetic diversity
and its primary gene pool includes both wild and domesticated forms (Baudet, 1977). Analyses
of genetic variation and relationships among cultivars, landraces, and wild populations have
indicated the existence of two major gene pools for P. lunatus: Mesoamerican and Andean,
and a minor group of intermediate genotypes (Caicedo et al., 1999; Fofana et al., 1997; Fofana
et al., 2001; Lioi and Galasso 2002). Three cultigroups (cv-gr) are recognized in the cultivated
forms (Baudet 1977): 1) Potato, with small and round seeds; 2) Sieva, with medium-sized and
kidney-shaped seeds; and 3) Big Lima, with large and flat seeds. The Potato and Sieva
cultigroups represent the Mesoamerican gene pool and the Big Lima represents the Andean
190 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

one. Two main independent domestication events have been hypothesized for the P. lunatus
cultigroups on the basis of studies supported by archaeological (Kaplan and Lynch 1999),
biochemical (Debouck et al., 1987; Gutiérrez Salgado et al., 1995; Maquet et al., 1997), and
molecular data (Fofana et al., 1997; Fofana et al., 1999; Lioi et al., 1998; Lioi and Galasso,
2002): Big Lima cv-gr. was domesticated in South America, in the west valleys from Ecuador
and Peru, site where the Andean wild populations grown. In relation to the Sieva and Potato
cultigroups, it is considered that these were domesticated in Mesoamerica. However, the
Mesoamerican wild populations exists from north of Mexico to north of Argentina and the
cultivated forms from southeast of USA to the east coast of Brazil (Debouck et al., 1987). This
made difficult to find the domestication site, however, studies using alloenzyme markers
indicated that the region situated between southeastern of Mexico and northern of Guatemala
could be the putative domestication area of this gene pool (Gutiérrez-Salgado et al., 1995).
Recently, molecular analyses indicated that the Tehuantepec Itsmus in the southeastern of
Mexico is the putative site of domestication of this gene pool (D. Debouck, personal
communication, 2008).
Studies about the diversity and genetic structure of P. lunatus considering accessions from
all its natural geographic distribution are few. Maquet et al. (1997), using alloenzyme markers,
reported a Nei’s gene diversity (He = 0.26) and a total genetic diversity (HT = 0.317) for the P.
lunatus base collection of the Germplasm Bank of CIAT. These authors stated that the He
value found is a significant level and higher than reported for other plants that, like P. lunatus,
are mixed-mating or short-lived perennial species (He = 0.12) (Hamrick et al., 1991). This high
diversity of P. lunatus could be a result of its wide geographic distribution. According to
Hamrick et al. (1991), geographic range accounts for the largest proportion of the explained
variation in genetic diversity at the species level. Maquet et al. (1997), analyzing at the gene
pool level, found that the Andean accessions had a higher genetic diversity (He = 0.24; HT =
0.33) than the Mesoamerican accessions (He = 0.16, HT = 0.23). Also, these authors reported
that the wild accessions had higher genetic diversity than cultivated ones, HT = 0.352, 0.331,
respectively. Fofana et al. (1997) using DNA-RAPDs markers and HOMOVA two-way nested
AMOVA statistics, reported that the genetic variance within the Mesoamerican gene pool (σ2 =
0.0079) was significantly higher than the Andean gene pool (σ2 = 0.0051). Also, these authors
found that the variation within landraces was significantly higher than within wild forms.
Nienhuis et al. (1995), analyzing only cultivars and landraces accessions with RAPD markers,
found that the Mesoamerican group had more genetic diversity (He = 0.110) than the Andean
group (He = 0.097). In relation to the genetic structure, Maquet et al. (1997), found that on
average, lima bean showed 76% (GST = 0.755) and 24% of the total diversity, respectively,
among and within accessions. The mating system and life form of the species are both usually
highly associated with differences in GST values (Hamrick et al., 1991). These results indicate
that species with a limited potential for gene flow show more differentiation among
populations than do species with a greater potential for gene flow.
Considering only the Mesoamerican gene pool of P. lunatus, few studies of its diversity
and genetic structure exist. Castiñeiras et al. (2007), using AFLP DNA-markers, analyzed the
genetic diversity of Potato and Sieva landraces planted in the Cuban home gardens and they
reported a HT = 0.119. These authors, considering three collect regions, found a low genetic
differentiation (GST = 0.08). In relation to the wild populations of P. lunatus, the most
important studies have been made in the Central Valley of Costa Rica. Ouédraogo et al.
(2005), using alloenzymes markers, reported a He = 0.08 and a HT = 0.12; and using
 Domestication and Conservation Genetics of the Lima Bean… 191

microsatellite markers they found a He = 0.143 and a HT = 0.22. In relation to the genetic
differentiation, these authors found a GST = 0.303 with both type of markers. Zoro-Bi et al.
(2003), using enzyme loci, reported a He = 0.03 and a HT = 0.193. Also, they reported a GST =
0.519 and low levels of gene flow (Nm = 0.39). Maquet et al. (2001), using isozyme markers,
reported a GST = 0.575 and an Nm = 0.18. In general, all these studies suggest: 1) low levels of
genetic diversity, 2) high levels of genetic differentiation and, 3) a restricted gene flow among
populations.
In the Mesoamerican part of Mexico, the lima bean is cultivated on lowland slopes
adjacent to the Pacific Ocean and the Gulf of Mexico. It is a common cultivar in traditional
cropping systems and is cultivated by diverse ethnic groups (Ballesteros, 1999). In the Yucatan
Peninsula, domesticated forms receive the Mayan name of ib and they are the fourth most
important crop of the milpa. As reported by Ballesteros (1999), the Yucatan Peninsula is the
most important center of diversity in relation to cultivated forms for Mexico. In spite of this
and of its importance as a crop for the Mayan farmers of this part of Mexico, studies about the
genetic diversity of P. lunatus in the Yucatan Peninsula were few until year 2000, and these
were based in morphological evidence, principally (Debouck et al., 1979; Hernández and
Delgado, 1992; Nahal, 1993; Ballesteros, 1999). In short, all these studies reported a high
diversity in cultivated forms with Potato, Sieva and intermediate variants grouped in 25 local
names, and the existence of wild and weedy populations. This high number of landraces is
possibly being generated and maintained, in part, by its sympatric growth with wild
populations in the milpa. However, during the last few decades, this traditional agricultural
system has undergone a series of transformations associated, in part, with the growth of the
rural population, which has doubled in the last 30 years (Cuanalo and Arias, 1997). Among the
most notable changes are (i) a shortening of the fallow period, (ii) an increased use of and
dependency on agrochemicals, (iii) a greater integration of the Mayan farmers to an external
marketing system, (iv) a reduction in the diversity of cultivated species, and (v) a reduction of
the areas of vegetation bordering the milpas, where the wild populations usually grow (Reyes
and Aguilar, 1992; Lazos, 1995; Ku-Naal, 1995; Remmers and Ucán, 1996). Nowadays, with
the development of transgenic crops, the environmental risk of transgenics escaping via
hybridization between crops and wild relatives in centers of origin has emerged as another
potential problem (Hails, 2000; Snow, 2002).
In spite of the changes that have occurred in the milpa, it continues to be the most
important agricultural system in the Yucatan Peninsula of Mexico. In this region, the milpa has
survived over the centuries due to, in part, the rocky and shallow soils that have limited the
introduction of agricultural machinery, other cereals, and broadcast sowing. Another signifi-
cant factor contributing to the persistence of the milpa system has been the cultural resistance
offered by the Mayan people who have maintained this agricultural system as the material
basis of their culture for many generations (Zizumbo-Villarreal, 1992). At present, there are
four geographic areas in the Mexican part of the Yucatan Peninsula where the milpa continues
to be the most important economic activity. The location of these areas and their agroeco-
logical characteristics are shown in Figure 1 and Table 1, respectively. These areas correspond
to four of the 13 cultural-geographic zones established by Adams and Culbert (1977) for the
origin of the Maya lowland civilization. These four areas have their own particular physio-
graphic, vegetational, and agroecological features (Duch-Gary, 1991), and have followed their
own specific cultural and economic trajectories since the arrival of the Europeans. They
include: 1) northeastern Campeche, in “Los Chenes” zone. In this area, a series of low-to-tall
192 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

hills alternate with interspersed plains, including floodplains. Vegetation includes savanna,
seasonally flooded low tropical deciduous forest, and medium tropical semi-evergreen forest;
2) southern Yucatan, in the “Puuc” zone. This area is characterized by hillock formations,
continuous stretches of long, elevated hills and variable-sized plains between them, favorable
for intensive agriculture. In terms of vegetation, this region is noted for low tropical deciduous
forest and medium tropical sub-deciduous forest. This is the area where the influence of
commercial agriculture has most recently been the greatest; 3) southeastern Yucatan, located
within the “Northern Plains” zone. Undulating plains with hillocks and shallow bottomlands
characterize the physiography of this region. Vegetation consists of medium tropical sub-
deciduous forest. The most traditional Mayan communities in the Yucatan state are
encountered here; and 4) central eastern Quintana Roo, within the “Río Bec” zone. This area
corresponds to the region currently known as the “Mayan Resistance Area” (Bartolomé and
Barabas, 1977). It is comprised of human populations that emigrated from the southeastern
part of the Yucatan state during the Caste Wars (Guerra de Castas) in the nineteenth century.
These populations remained independent until the beginning of the twentieth century. The
dominant vegetation in this area is the medium tropical semi-evergreen forest.

Figure 1. Agricultural areas where the ethnobotanical research was made and plant material was
collected. SYUC, Southern Yucatan; NECAMP, Northeastern Campeche; SEYUC, Southeastern
Yucatan; CEQROO, Central eastern Quintana Roo. Taken from Martínez-Castillo et al., 2008.
 Domestication and Conservation Genetics of the Lima Bean… 193

Table 1. Environmental characteristics of the four studied areas in the Yucatan

Peninsula, Mexico. Modified from Martínez-Castillo et al. (2004).

Southern Northeastern Southeastern Central eastern

Yucatan Campeche Yucatan Quintana Roo
(SYUC) (NECAMP) (SEYUC) (CEQROO)
Temperature (o C) 26.4 26.3 25.3 26.1
Average annual rainfall (cm)
Vegetation types1 1-3 2-4-5 3- 4
Soil types 2 r-cl r r-l l-r
Average years of 0 0 8 15
Fallow period
Agricultural m (70%) m-lb (80%) pc pc
management 3, 4 m-lb (30%) pc (20%).
Use of herbicide 100 % 100 % 70 % 70 %
and fertilizer (%)
1
1= low tropical deciduous forest, 2 = seasonally- flooded low tropical deciduous forest, 3 = medium
tropical subdeciduous forest, 4 = medium tropical semievergreen forest, 5 = savanna.
2
r= rendzine, l = litosol, cl = cromic luvisol.
3
m = monoculture of maize, m-lb = maize with lima bean; pc = maize with lima bean and other species.
4
Percentages are on respect to 160 peasants interviewed.

Establishing guidelines for conserving native germplasm in the Mayan area of the Yucatan
Peninsula is of great relevance when this region is one of the Mesoamerican sub-areas with the
greatest cultural continuity and historical persistence of their traditional farming practices. The
objective of this chapter is to give a resume of the most important results of eight years of
research (2000-2008) about the domestication and conservation genetics of P. lunatus in the
Yucatan Peninsula, México. The basic questions to ask in this chapter are: 1) what is the
intraspecific diversity and in situ conservation problematic of P. lunatus wild and domesticated
gene pools in the Yucatan Peninsula, México?; 2) what are the structure and genetic diversity,
and levels of gene flow in these gene pools?; 3) what is the magnitude and direction of the
wild-domesticated gene flow?; and 4) what is the risk of genetic erosion of the landraces
cultivated by the Mayan farmers?. The last three questions are approached using molecular
data and the results analyzed with the support of ethnobotanical and ecological information.
With this, we expect contribute with basic information to generate in situ conservation
programs to P. lunatus as well as to all the milpa system of the Yucatan Peninsula, México.

MATERIALS AND METHODS

Ethnobotanical Research

An ethnobotanical study in the four most important geographic areas where the milpa
continues to be the most important economic activity was made to know and characterize the
in situ conservation problematic of lima bean in the Yucatan Peninsula, Mexico. The areas
were: 1) Northeastern Campeche, 2) Southern Yucatan, 3) Southeastern Yucatan, and 4)
194 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Central Eastern Quintana Roo (Figure 1). The study was undertaken during 2000 and 2001 in
eight two-week field trips, two trips for each region studied (Martínez-Castillo et al., 2004):
three agricultural communities were selected from each one of the four study areas. In each
community, 13 to 14 farmers (40 per study area) were randomly chosen from a list provided by
local civil authorities and a semi-structured interview was applied to each farmer which
focused on the following information associated with wild, weedy, and cultivated variants of
P. lunatus: Mayan name, morphological and phenological characters used for traditional
classification, selection criteria, agricultural management practices, production purpose, and
percentage of area cultivated of each variant in relation to the total area cultivated of P.
lunatus. Data obtained through the semi-structured interviews were complemented with data
obtained through participative observation during the agricultural works at the milpa done by
peasants.
We calculated relative abundance of the landraces as the number of hectares cultivated
with each landrace in relation to the total cultivated hectares for the species in the four study
areas, according to reports from the farmers; diversity using Shannon’s index (Shannon and
Weaver, 1949: H’ = - Σ pi ln pi), and dominance utilizing Simpson’s index (Simpson, 1949: D
= Σ pi2). In calculating the Shannon and Simpson indices, pi represented the percentage of the
area cultivated per landrace. These indices were calculated using the Biodiversity Professional
software Release 2.0 (McAleece, 1997).
Samples of all landraces recognized as different by each farmer were collected from
existing seed stock in the farmer’s barns and directly from the milpas, too. For the collection of
in situ germplasm from the wild and weedy populations, botanical explorations were
conducted in the agricultural areas of each community visited, with the participation of peasant
farmers. From each wild and weedy population, samples were collected that included an
average of 10 pods from 20 to 30 individuals. Botanical vouchers were collected with the help
of the interviewed farmers, and deposited in the CICY herbarium. In total, 149 cultivated
accessions obtained from the farmer barns and 24 populations (11 wild, 1 weedy, 12
domesticate) obtained in situ were collected.

Molecular Research

Samples of seed of all landraces recognized by the Mayan farmers, and seeds of the wild,
weedy and domesticated populations collected in situ were planted in a greenhouse in the
Centro de Investigación Científica de Yucatán, in Merida, Mexico. For all molecular analyses,
genomic DNA was obtained from young leaves following the CTAB method (Doyle and
Doyle, 1987).
Diversity, genetic structure and gene flow in the wild and domesticated gene pools. To
make these analyses, the microsatellite (Simple Sequence Repeat or SSR) technique was used.
SSRs are loci that consist of repeating units of 1-6 base pairs in length. Nine pair primers
reported as polymorphic for Gaitán-Solis et al. (2002) was used (Table 2). To details of PCR
conditions see Martínez-Castillo et al. (2006, 2007).
Diversity, genetic structure and gene flow were analyzed in wild and domesticated gene
pools, separately. 11 wild populations and 12 domesticated ones were used, respectively
(Table 3). The genetic diversity was estimated considering three levels of analysis:
populations, agricultural regions and the Yucatan Peninsula. The estimates were the number of
 Domestication and Conservation Genetics of the Lima Bean… 195

alleles (A), the evenness of the allelic frequencies (Ae/A), the observed heterozygosity (Ho),
and the Nei´s genetic diversity index (H). All these indices were estimated using POPGENE
1.31 (Yeh and Boyle, 1999). Using the GLM procedure of the SAS ver. 6.12 (SAS, 1997)
program, a one-way analysis of variance (ANOVA) and Duncan’s multiple comparison of
means tests (α = 0.05) were conducted to compare the values of allelic richness and diversity
obtained at the regional level.

Table 2. Characteristics of the nine microsatellite (SSR) loci used in the analysis
of the diversity, genetic structure and gene flow in the wild and domesticated gene pools

Code SSR sequence 5’ to 3’ Primer sequence Tm1 NoA2 RF 3

GATS91 (GA)17 Left GAGTGCGGAAGCGAGTAGAG 53 5 218-231
Right TCCGTGTTCCTCTGTCTGTG
AG1 (GA)8GGTA(GA)5 Left CATGCAGAGGAAGCAGAGTG 52 7 147-155
Right GAGCGTCGTCGTTTCGAT
BM140 (GA)30 Left TGCACAACACACATTTAGTGAC 55 7 162-173
Right CCTACCAAGATTGATTTATGGG
BM156 (CT)32 Left CTTGTTCCACCTCCCATCATAGC 52 10 205-225
Right TGCTTGCATCTCAGCCAGAATC
BM160 (GA)15(GAA)5 Left CGTGCTTGGCGAATAGCTTTG 52 4 178-188
Right CGCGGTTCTGATCGTGACTTC
BM164 (GT)9(GA)21 Left CCACCACAAGGAGAAGCAAC 52 5 135-143
Right ACCATTCAGGCCGATACTCC
BM183 (TC)14 Left CTCAAATCTATTCACTGGTCAGC 52 5 142-148
Right TCTTACAGCCTTGCAGACACT
BM211 (CT)16 Left ATACCCACATGCACAAGTTTGG 52 16 194-219
Right CCACCATGTGCTCATGAAGAT
BM212 (CA)13 Left AGGAAGGGATCCAAAGTCACTC 52 5 191-203
Right TGAACTTTCAGGTATTGATGAATGAAG
1
Annealing temperature in ºC (Tm). 2 Number of alleles per locus (NoA). 3 Range of fragment size
found in base pairs (RF).

Wright’s inbreeding coefficient [FIS = 1-(Ho/He)] (Wright, 1978) was obtained as an

indicator of excess or deficit of heterozygotes for each locus/population using POPGENE 1.31.
We estimated if these values were different from zero (α = 0.05) with a chi-squared test, X2 =
N (r-1) FIS2 with r (r-1)/2 degrees freedom, where N is sample size and r is the number of
alleles at the locus (Li and Horvitz, 1953). The FIS were averaged across polymorphic loci for
each population using a jackknife procedure. To estimate if these values were significantly
different from zero (α = 0.05) we used a two-tailed Student t test based on jackknife-generated
standard error values (Sokal and Rohlf, 1995).
Genetic structure was analyzed using two statistical procedures: (i) the GST statistic was
estimated by POPGENE 1.31, and (ii) analysis of molecular variance (AMOVA) using
ARLEQUIN ver 2.0 (Schneider et al., 2000). To evaluate the hypothesis of isolation by
distance, a Mantel test was performed using the matrixes of genetic and geographic distances
of the populations using ARLEQUIN. The genetic relationships among populations were
inferred with the construction of an UPGMA based on the standard genetic distance of Nei for
various loci (Nei, 1972), using the TFPGA program. Robustness of the topology was evaluated
by selecting the bootstrapping option with 1000 random resamplings with replacement over
loci (Felsenstein, 1985). Long term gene flow was indirectly estimated for both regional and
the Peninsula levels from Nm [Nm = 0.25 (1 - GST)/GST] using POPGENE.
196 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Table 3. Twenty-four wild, weedy and domesticated P. lunatus populations

from four agricultural areas on the Yucatan Peninsula, Mexico

Agricultural region Population 1

Southeastern Yucatan (SEYUC) San Fernando (w) (i)
Marcos (we) (i)
Boje (w) (i)
San Fernando (d)
Marcos (d)
X-Uilub (d)
Central eastern Quintana Roo (CEQROO) Nohca (w)
Kik (w)
Holpat (w)
Celestino (d)
Domingo (d) (i)
Julián (d)
Southern Yucatan (SYUC) Xohuayán-1 (w)
Nohcacab (w)
Xohuayán-2 (w)
Xohuayán-1 (d)
Xohuayán-2 (d)
Rubén (d)
Northeastern Campeche (NECAMP) Itzinté (w) (i)
Bolonchén (w) (i)
Chunchintok (w)
Bolonchén (d) (i)
Elias (d)
Pascual (d)
1
Domesticated (d), weedy (we), wild (w); populations with morphological or molecular evidence of
introgression (i).

Finally, the genetic structure of all wild and domesticated populations of P. lunatus was
analyzed in conjunction, using the GST statistic estimated by POPGENE 1.31, and AMOVA
using ARLEQUIN ver 2.0.
Wild-domesticated gene flow. Data obtained previously with the microsatellite technique
on the 11 wild and 12 domesticated populations, plus molecular data obtained of one weedy
population, were considered in this section (Table 3). To analyze the magnitude and direction
of wild–domesticate gene flow, we used two different approaches: genotype assignment
methods to analyze recent gene flow and frequency methods to analyze long-term gene flow.
The two approaches are complementary, providing information about gene flow on different
timescales. Differences between both methods are showed in Manel et al. (2005).
We used Bayesian genotype assignment methods implemented in the Structure 2.1
program (Pritchard et al., 2000). This program uses a Bayesian clustering approach with
Monte Carlo Markov Chain (MCMC) methods and assigns individual genotypes to a
predefined number of populations (K) in a given sample (X) to achieve Hardy-Weinberg and
linkage equilibriums. This method assumes a model with K populations, each characterized by
a set of allele frequencies at each locus. Individuals in the sample are assigned probabilistically
 Domestication and Conservation Genetics of the Lima Bean… 197

to populations, or jointly to two populations if their genotypes indicate they are admixed. Gene
flow magnitude and direction were based on the proportion of estimated ancestry of each
individual (q) and each population (Q) as calculated by Structure. Individuals were classified
into two categories according to their biological status: wild or domesticated. Weedy
individuals were classified as wild. The analysis was done on what were called the Peninsula,
interregional, intraregional, and parcel levels. The Peninsula level included a simultaneous
analysis of all studied individuals on the Yucatan Peninsula and grouping of them to calculate
Q for the different populations where they were collected. The interregional level included
simultaneous analysis of all studied populations and grouping of them to calculate Q for eight
gene pools by biological status and region. The intraregional level involved separate analyses
of populations in the same agricultural region and grouping to calculate Q in two gene pools
per region according to biological status. The parcel level involved separate analyses of the
populations in the Marcos parcel, where both weedy and domesticate populations grew, and
grouping to calculate Q for the two gene pools by biological status. For the Yucatan Peninsula,
intraregional and parcel levels, populations were assigned to K = 2 gene pools (i.e., wild and
domesticate). Populations in the interregional level were assigned to K = 8 gene pools, that is,
one wild and one domesticate per region. The model was applied using the previous data on
the population option; these data were their geographic location to determine which
individuals in the sample were immigrants or had recent immigrant ancestors. Burn-in length
was 104 and run length was 105 to allow the Markov chain to reach stationarity.
Two frequency methods were used: (1) Estimation of Nm at the Peninsula and
intraregional levels was done using the POPGENE 1.31 program (Yeh and Boyle, 1999). (2)
Estimation of mY, which is based on the average coalescence time of genes obtained from
within and between parental and admixed populations. This estimator was initially described in
Bertorelle and Excoffier (1998) and extended to any number of parental populations by
Dupanloup and Bertorelle (2001). The analysis was performed using Admix 2.0 software
developed by Dupanloup and Bertorelle http://web.unife.it/progetti/ genetica/Isabelle/admix2
_0.html. The admixture model used was based on Papa and Gepts (2003). It considers that
both wild and domesticate populations consist of two subpopulations: “true” wild (PW) and
domesticated (PD) types, without introgression from their domesticated or wild counterparts;
and hybrid wild (PhyW) and domesticated (PhyD) populations, with introgression. Each hybrid
population consists of N (1-μ) loci randomly obtained from a parent population and Nμ loci
from the other population: PhyW= μ2PD + (1- μ2)PW and PhyD = μ1PW = (1 + μ2)PD, where μ is
the parent population’s contribution to the hybrid population. This allows comparison of μ1
(contribution of PW to PhyD) and μ2 (contribution of PD to PhyW). Selection of the individuals
to create the PhyD and PhyW populations was done based on the Bayesian clustering results,
the classification of the seeds by Mayan farmers, and the morphological data collected in situ.
Genetic erosion in landraces. To analyze the genetic erosion in the domesticated gene
pool of P. lunatus, 21 landraces collected and recognized for Martínez-Castillo et al. (2004)
were chosen. For each landrace a number of accessions ranging from 1 to 5 was analyzed
(Table 4). When possible, the seeds were taken from accessions collected in the four
agricultural regions considered for this study to provide greater genetic representativity. The
21 landraces were listed on the basis of the percentage of cultivated area that a sample of 160
farmers used for each landrace. This produced three groups (Table 4): (a) abundant landraces,
consisting of three landraces, each grown on more than 16% of the cultivated area and planted
198 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

by 10–33 producers in the four agricultural zones; (b) common landraces, including six
landraces, each grown on 3–5% of the area and by 5–14 producers (this group included
Chakpetch and Balche, with low percentages but planted by nine and five producers,
respectively); and (c) rare landraces, consisting of 12 landraces, each planted on less than 2%
of the area and grown by one to four farmers.
The Inter-Simple Sequence Repeat (ISSR) technique was used. It allows detection of
polymorphism without previous knowledge of DNA sequences. It involves polymerase chain
reaction (PCR) amplification of DNA using a single primer composed of a SSR sequence,
anchored at the 3 or 5 end by two to four arbitrary, often degenerate, nucleotides (Zietkiewicz
et al., 1994). Each ISSR band was considered as an independent locus and polymorphic bands
were scored as absent (0) or present (1) for all samples. Only clearly reproducible bands were
scored and differences in band intensity were not considered. Four primers were used:
(GACA)3RG, YR(GACA)3, (GACAG)3AG and (CACAG)3RG. To details of PCR conditions
see Martínez-Castillo et al. (2008).

Table 4. Plant material used in the analysis of the genetic erosion of the 21 lima bean
landraces of the Yucatan Peninsula, Mexico. Taken from Martínez-Castillo et al. (2008).

Local name Culti-group Number of accesions Relative abundance % of cultivated area Agricultural regions1

Mulición Potato 5 Abundant 29.61 All regions

Sac Potato 5 Abundant 25.13 All regions
Putsica-sutsuy Potato 5 Abundant 16.5 All regions
Bacalar Sieva 5 Common 5.82 CEQROO
Nuk Sieva 5 Common 4.12 SYUC
Chak- saac Sieva 5 Common 4.1 CEQROO, SEYUC
Mejen Sieva 5 Common 3.00 SYUC
Chak- petch Sieva 5 Common 1.79 CEQROO, SEYUC
Balche Sieva 5 Common 0.92 CEQROO
Box-petch Sieva 1 Rare 1.85 CEQROO,
NECAMP
Balam-pach Potato 1 Rare 1.1 SEYUC
Tsisibal Potato 2 Rare 1.1 SEYUC
Kan Potato 1 Rare 1.01 SEYUC
Chak-mejen Sieva 2 Rare 0.32 NECAMP
Madza-kitam Sieva 1 Rare 0.31 SEYUC
Pool-santo Potato 1 Rare 0.26 CEQROO, SEYUC
Tabaco Sieva 1 Rare 0.16 CEQROO
Box-uolis Potato 1 Rare 0.08 CEQROO
Chak-uolis Potato 4 Rare 0.06 CEQROO, SEYUC
Chak-chi Sieva 1 Rare 0.02 SEYUC
Chocolate Sieva 1 Rare 0.02 CEQROO
1
Agricultural regions: SEYUC, southeastern Yucatan; CEQROO, central eastern Quintana Roo; SYUC,
southern Yucatan; NECAMP, northeastern Campeche.

Genetic diversity was estimated at two levels: (a) total domesticated gene pool, and (b)
landraces groups. To avoid common problems associated with the analysis of dominant data
(Culley and Wolfe, 2001; Lynch and Milligan, 1994), analyses did not involve Hardy–
Weinberg equilibrium (HWE). It was considered due to domesticated populations of P. lunatus
from the Yucatan Peninsula are known to deviate from Hardy–Weinberg equilibrium with co-
 Domestication and Conservation Genetics of the Lima Bean… 199

dominant microsatellite markers (Martínez-Castillo, 2005). It was assumed that there was no
co-migration of alleles from different loci, alleles shared by two individuals descend from a
common ancestor and each locus consisted of only two alleles that segregate in Mendelian
inheritance.
The parameters used were: (1) polymorphic loci percentage (% P), calculated directly
from the data; (2) the Shannon-Weaver diversity index (I) (Shannon and Weaver, 1949)
obtained with the POPGENE ver. 1.31 program (Yeh and Boyle, 1999); (3) Nei genetic
diversity (H) considering the Taylor expansion (Lynch and Milligan, 1994) and obtained with
the TFPGA program (Miller, 1997). Although in this study was considered that the data are not
in Hardy–Weinberg equilibrium, based in the results reported by Kremer et al. (2005) we
decided to evaluate average heterozygosity (HB) using the Bayesian approach proposed by
Zhivotovsky (1999). This estimator was obtained with AFLP-SURV version 1.0 program
(Vekemans, 2002). Paired Student t tests were done to compare I, H and HB values between
pairs of landrace groups (α = 0.05) using the Statistica ver. 6.0 program (Statsoft, Tel Aviv,
Israel).

RESULTS
1. Intraspecific diversity and in situ conservation of P. lunatus
in theYucatan Peninsula, Mexico

Wild gene pool

Wild populations were found in habitats generated by human activities where there was a
high, but variable incidence of disturbance. Both wild and weedy populations were called in
Mayan ib-cho (ib rat) because according to farmers, rats consumed the seeds of these plants.
Both types of populations showed forms with obvious differences in size, shape, and color
(Figure 2), however, in spite of these differences, farmers did not give them different names.
For these populations, no selection criteria were detected, basically because they are not given
any use. Some farmers reported that a few people have consumed these populations because of
their considerable pod production and similarity to the cultivated material, but they stopped
doing so when they subsequently became ill. The wild and weedy seeds of P. lunatus have a
high HCN content which makes them unfit for consumption (Maquet, 1991). Recently one
Mayan farmer reported that a weedy variant is planted and eaten by himself and his family (F.
Dzul, personal communication, 2008).
The wild populations were located in the four study areas, but were most abundant in
CEQROO. This situation appears to be correlated with: 1) longest fallow periods, 2) lowest
herbicide use, and 3) best soil fertility conditions (Table 1). Some farmers tolerate the presence
of wild populations within the milpas when their population density does not affect the correct
development of their crops. They were kept under control by: 1) hand weeding, when the
population density was low (<15 plants). It exist two kinds of hand weeding: haranchak and
lochepak. The first is more effective as the weeds are eliminated along with their roots.
Lochepak, on the other hand, eliminates only the aerial part of the plant, allowing a subsequent
recovery.
200 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Figure 2. Seed morphological variation of wild, weedy and cultivated variants, recognized by traditional
farmers in the Peninsula of Yucatan, Mexico. Lane 1 = Sieva variants, lane 2 = Potato variants, lane 3 =
wild and weedy populations. Traditional variants not recognized with morphological characters alone:
chakpetch-chakmejen(cp-cm), xmejen-nuk (me-nu), mulición-sacmejen (mu-sm). Wild (wi) and weedy
(we) variants. Taken from Martínez-Castillo et al., 2004.

With this kind of weeding, the farmers allow the weed population to reach the stage of
seed production along with their crops. 2) Use of herbicides. When the population density was
higher (>50 plants), as in some populations which manage to grow within the corn
monoculture, the peasants limited the density with the application of herbicides, but only until
the maize plants had reached a point in their development that assured the production of ears.
Once the harvest was secured, the peasants allowed these populations to grow freely. In
several wild populations we found seeds with colors, forms, and sizes similar to the cultivated
variants, as a consequence, perhaps, of past events of wild-domesticated gene flow. Only in the
southeast of Yucatan did the farmers report the elimination of wild populations in order to
prevent them from ‘‘mixing’’ with the landraces of this species.
The weedy populations were found in CEQROO, SEYUC and NECAMP at very low
population densities. It could be due to the differential management of the agricultural areas by
the farmers. The areas where wild populations grow are preferred for corn monoculture treated
with herbicides, since hand picking is not effective in eliminating high-density wild
populations. This agricultural management does not permit the existence of species associated
with corn as P. lunatus, thus the generation of P. lunatus weedy populations by gene flow is
not possible. So, weedy populations of P. lunatus were specifically associated with long fallow
periods that allowed the existence of vegetational patches and with traditional weeding
practices as lochepak.

Domesticate gene pool

All landraces of lima bean were named ib; however, each one had its own name. Twenty-
five landraces were recognized by farmers (Table 5), who used two morphological characters
and one phenological character to differentiate them: 1) Seed shape. Landraces pertaining to
the cv-gr. Potatoes were called x-uolis ib (ib ball) or mulición (ib birdshot). Landraces
pertaining to the cv-gr. Sieva were called petch (flat). 2) Seed color pattern. Landraces with
seeds of only one color, such as chak-ib (ib red), box-ib (ib black), and sac-ib (ib white) were
named by their color. Landraces whose seeds showed combinations of colors often received
names related to the things, plants, or animals that they resembled, such as madza-kitam (ib
 Domestication and Conservation Genetics of the Lima Bean… 201

wild boar eyebrows) and pool-santo (ib saint’s head) landraces. The variation found in these
two morphological characters is shown in Figure 2. 3) Production cycle. Landraces also
received names related to the duration of the plant’s production cycle, such as mejen-ib (ib
short cycle; a landrace with a three to four months production cycle) and nuk-ib (ib long cycle;
a landrace with a seven to eight months production cycle). The combination of these three
characteristics is used to distinguish among landraces. Synonyms for landraces’ names were
encountered on many occasions. One landrace might receive more than one name, depending
on its different attributes. Sometimes different landraces received the same name if the farmers
used only one classification criterion.
In relation to the cultivated area by landrace, the ones of greatest importance in the region
were mulición (29.61%), sac (25.12%), and putsicasutsuy (16.5%). Many of the other
landraces did not reach the 1%, being planted by just a farmer (0.02%) (Table 5). Central
eastern Quintana Roo was the most diverse area (H’ = 0.8), followed by southeastern Yucatan
(H’ = 0.76). Tied for third place were NECAMP and the SYUC region (both with H′ = 0.71).
The lowest richness of landraces observed in the SYUC area appears to have been correlated
with a high degree of agricultural intensification and with the incorporation of smallscale
farmers into markets. In this area, we encountered almost half the landraces occurring in
southeastern Yucatan. Deep soils in the SYUC area have allowed the introduction of irrigation
and farm machinery into geographically tiny areas. This has favored monocultures and
agricultural intensification due to the planting of short cycle landraces (xmejen) with high
market values.
The abundance of each landrace and the diversity of each agricultural area are a result of
the selection criteria applied for the Mayan farmers nowadays. Farmers indicated taste
(27.39%) and color (20.75%) as the main criteria, following for cooking time (12.45%),
production purpose (11.2%), and productive cycle (5.39%), among others. The landraces
identified as having the best taste were mulición, sac, xmejen, nuk, sacmejen, and
putsicasutsuy, the first five with white testa. White as primary color (5 variants) was the most
represented, followed by the red (three variants). The landraces with white testa were also
identified as the fastest cooking. In relation to the production purpose, Mayan farmers plant ib
with auto-consumption and commercial purposes. Although no variant appeared to be selected
exclusively for a commercial interest, when the production was directed mainly to the market,
the white testa variants were preferred, occupying 66.66% of the total cultivated area reported
by the farmers. Xmejen landrace reaches the highest prices because of its white testa, larger
seeds, and shorter productive cycle, allowing seed production in months when there is no
production of other landraces. Indeed, xmejen was the only one that was eaten as immature
seed. It is planted principally in SYUC and it does not represent a high percentage of cultivated
area (only 3.03%) as its production depends on mechanized and, in several cases, irrigation
systems. The production of P. lunatus also included landraces that were cultivated only for
auto-consumption as these were not popular in the market, apparently because of the dark
color and semi-bitter taste of the seed. This component of auto-consumption was reflected in
the low percentage of cultivated area for this class of landraces. In relation to the productive
cycle, 21 of the 25 variants were reported as long cycle variants and only four as short cycle
variants (Table 5). The preference of a large number of long cycle landraces is probably
related to their better adaptation to dry land farming. A phenological analysis showed that
xmejen has the most short cycle among all landraces (Martínez-Castillo et al., 2004).
202 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Table 5. Traditional landraces recognized by Mayan farmers from the Yucatan

Peninsula, Mexico. Percentage of cultivated area (A); First and second color of seed (B);
Time to the harvest (C); Agricultural management (D); Production purpose (E);
Taste (F); Cooking time (G); SEYUC (H); NECAMP (I); SYUC (J); CEQROO (K).
Modified from Martínez-Castillo et al. (2004).

Name A3 B4 C5 D6 E7 F8 G9 H I J K
cv-gr. Sieva
Bacalar 4.92 br-b l a m-s s i 0 0 0 14
1
Balche 0.92 br-b l a m-s s i 0 0 0 5
Batun 0.74 c l a S s i 0 0 1 0
Boxpetch 1.85 b l a S sb i 0 0 0 1
Chakchí 0.02 r-w s a S s i 0 0 1 0
Chakmejen 0.32 r s a s-m s f 0 1 1 0
Chakpetch 1.79 r l a s-m s i 0 1 4 4
Chaksaac 4.21 r-b l a s-m s i 0 2 1 0
Chocolate 0.02 br l a S sb s 0 0 0 1
Madzakitam 0.31 b-w l a S sb s 1 0 0 0
Mejen 3.03 w s m m-s s f 6 1 0 0
Nuk 4.12 w l a m-s s f 2 0 0 0
Tabaco 0.16 br l a S sb i 0 0 0 1
cv-gr. Papa
Balampach2 0.10 r-g l a m-s s i 0 0 0 1
Boxuolis 0.08 b l a S sb s 0 0 0 1
Chakuolis 0.06 r l a S sb s 0 0 0 4
Kan 1.01 y l a S s i 0 0 1 0
Munición 29.61 w l a m-s s f 9 7 2 15
Poolsanto 0.26 g-b l a S sb s 0 0 1 0
Putsicasutsuy 15.90 r-g l a m-s s i 1 2 5 2
Sac 25.12 w l a m-s s f 0 2 24 2
Sacmejen 4.78 w s a m-s s f 0 0 1 1
Tsisibal2 0.30 r-g l a m-s s i 0 0 2 0
Tuchasutsuy2 0.10 r-g l a m-s s i 0 0 1 0
Xananmucuy2 0.10 r-g l a m-s s i 0 0 0 1
1
Synonymous of Bacalar landrace. 2 Synonymous of Putsicasutsuy landrace. 3: % cultivated area in 160
farmers interviewed. 4: w = white, b = black, br = brown, r = red, g = gray, y = yellow, c = cream. 5:
l = 7 to 8 months, s = 3 to 4 months. 6: a = polyculture, m = monoculture. 7: m-s = subsistence and
market, s-m = principally subsistence
but also market, s = just subsistence. 10: s = sweet, sb = semibitter, b = bitter. 11: f = fast, i = intermediate,
s = slow.

The number of landraces cultivated by the farmers ranged from one to seven, with an
average of two. With the exception of xmejen, all the landraces were cultivated in polyculture
under the milpa system, with maize as the main crop and tutor plant for P. lunatus. Xmejen
was planted with sticks as tutors, in small, mechanized, irrigated areas. When the seed was
sufficient and the production had a commercial component, the farmers planted each landrace
separately in different sections of the milpa or in different milpas in order to maintain the
purity of their germplasm and obtain a better price on the market. When the quantities of seed
from each landrace were small and the production was destined to auto-consumption, they
planted their germplasm in the form of mixed seeds (the planting of seeds from different
 Domestication and Conservation Genetics of the Lima Bean… 203

landraces mixed together in the same part of the milpa), regardless of the loss of the particular
characteristics of each landrace. This practice of planting a large number of variants (up to 7)
in one milpa, either in rows or mixed, favors the possibility of gene flow between one landrace
and another and subsequently the generation of variation which eventually could have been
selected by the farmers. Indeed, this practice favors the possibility of wild-domesticated
introgression, because the management of mixed seeds could to hide the generation and
existence of weedy forms.

2. Structure, genetic diversity, and gene flow in P. Lunatus

Wild gene pool

Fifty-nine alleles were found in all wild populations. At the Yucatan Peninsula level, we
found high levels of genetic diversity: A = 7.38, Ho = 0.67 and H = 0.69. Even though this
study considered a smaller number of populations, the obtained values were greater than those
reported for Central Valley of Costa Rica using isozymes: A = 1.1, Ho = 0.006 (Zoro Bi et al.,
2003); Ho = 0.012 (Ouédraogo and Baudoin, 2002), and SSRs: Ho = 0.031 (Ouédraogo and
Baudoin, 2002). These differences can be explained considering different factors: a) the
greater sensitivity of the SSR markers in the detection of polymorphisms. b) Different
outcrossing rates. In the Central Valley of Costa Rica, the outcrossing rate was estimated
between 0.027 and 0.268 (Zoro Bi, 1999). Recently, Chimal-Chan (2008) reported higher
outcrossing rates of up to 74% to CEQROO populations favored, possibly, for the high
abundance and diversity of local pollinating insects. c) The differential size of the populations
studied. The Yucatan Peninsula populations presented in their majority more than 100
individuals in the reproductive stage, whereas the Central Valley of Costa Rica populations
were much smaller, as 66% of populations were no larger than 30 individuals (Maquet et al.,
2001). A positive correlation between intra-population genetic variation and the size of the
population has been reported for Zoro Bi et al. (2003) in the Central Valley of Costa Rica for
P. lunatus, it suggesting endogamy to be the most plausible cause. d) Founder effect and
bottlenecks. Populations of the Central Valley of Costa Rica are subject to intensive
commercial agricultural management and to encroachment from urban areas. (Zoro Bi et al.,
2003). In contrast, the Yucatan Peninsula agriculture is still essentially traditional. Although
there have been important changes, fallow periods from three to eighteen years are conserved.
It had permitted that of the lima bean populations exist and they have not undergone episodes
of extinction and re-colonization or that these episodes have not been as frequent as those in
the Central Valley of Costa Rica.
At the population level, Xohuayán-2 exhibited the highest genetic diversity (Ho= 0.90)
(Table 6). The agricultural management of this region may explain this. Xohuayán-2 is located
in SYUC, a region where the farmers plant xmejen landrace, which has a high market value.
For marketing reasons, the farmers take great care in maintaining purity of this landrace by
ensuring that it do not crossbreed with the wild populations. Thus, they plant this germplasm in
sites where wild populations are not found or, if found, they eliminate them with herbicides. In
this way, by protecting the purity of this germplasm, the farmers are indirectly maintaining the
identity and diversity of the wild populations still existing in this area. In regard to allelic
richness, the Holpat, Kik, and Nohca populations presented the highest values (Table 6), which
could be a result, in the case of the two first populations, of their larger population size. In
204 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

contrast, Bolonchén presented the lowest value, a consequence of its small population size and
recent events of extinction–recolonization, which would have caused a process of genetic drift
in this population. Theoretical works on the effects of genetic drift suggest that allelic
frequencies fluctuating in small populations will produce a reduction in Ho (Wright, 1931;
Kimura, 1955; quoted by Cole, 1998). It has also been noted that genetic drift must have a
more immediate effect on the loss of rare alleles, thus causing a reduction of A (Cole, 1998).
Apart from the Bolonchén population, the San Fernando and Boje populations showed the
lowest allelic richness of all wild populations analyzed. These populations had some plants
with morphological characteristics of flowers, pods, and seeds very similar to those of the
domesticated germplasm, which is suggestive of past introgression events with domesticated
germplasm, causing a reduction in their genetic diversity.

Table 6. Estimators of the genetic diversity of 11 wild populations of P. lunatus

from the Yucatan Peninsula, Mexico. Taken from Martínez-Castillo et al. (2006).

Agricultural region Population Name N A Ae / A Ho H

CEQROO Holpat 20 3.38 0.70 0.46 0.54
Kik 20 3.38 0.64 0.60 0.48
Nohcá 14 3.38 0.67 0.52 0.51
Mean 44.7 3.38 0.67 0.53 0.51
SEYUC Boje 20 2.87 0.72 0.51 0.47
San Fernando 20 2.38 0.70 0.49 0.35
Mean 20 2.63 0.71 0.50 0.41
NECAMP Bolonchén 20 2.37 0.81 0.67 0.41
Chunchintok 19 3.13 0.83 0.67 0.57
Itzinté 20 3.25 0.85 0.82 0.59
Mean 19.7 2.92 0.83 0.72 0.52
SYUC Nohcacab 20 3.13 0.73 0.87 0.53
Xohuayán-1 20 3.25 0.77 0.82 0.55
Xohuayán-2 20 3.01 0.81 0.90 0.57
Mean 20 3.13 0.77 0.86 0.55
CEQROO, central eastern Quintana Roo; SEYUC, southeast Yucatan; NECAMP, northeast Campeche;
SYUC, south of Yucatan; Number of plants (n); Average number of alleles (A); Allelic frequencies
eveness ( Ae / A ); Observed heterozygosity (Ho); Nei’s index of diversity (H).

A comparative analysis among agricultural areas indicated significantly higher Ho values

for SYUC and NECAMP than those of CEQROO and SEYUC (Table 7). The SEYUC had the
lowest A value, but only significantly lower than CEQROO, which had the highest value.

The high A and low Ho values for CEQROO are explained by the low evenness of allelic
frequencies evaluated by Ae/A (Table 6). The SEYUC, in addition to the lowest A value, had a
low evenness coefficient. A possible explanation for the low diversity of CEQROO and
SEYUC may be the existence of gene flow from the domesticated to the wild populations.
Martínez-Castillo et al. (2004) found weedy plants growing within two domesticated
populations of P. lunatus in CEQROO.
 Domestication and Conservation Genetics of the Lima Bean… 205

Table 7. Duncan’s test for comparison of means for the values of observed
heterozygosity (Ho) and average number of observed alleles (A) found
in 11 wild populations of P. lunatus from four agricultural regions
in the Yucatan Peninsula, Mexico. Taken from Martínez-Castillo et al. (2006).

Ho A
Agricultural region Mean Duncan test Mean Duncan test
SYUC 0.86 A 3.13 AB
NECAMP 0.72 B 2.92 AB
CEQROO 0.53 C 3.38 A
SEYUC 0.50 C 2.63 B
SYUC, south of Yucatan; NECAMP, northeast Campeche; CEQROO, central east Quintana Roo;
SEYUC, southeast Yucatan. Regions with the same letter are not different significantly (α= 0.05).

These weedy plants could be hybrid forms generated by gene flow events between
domesticated and wild populations. These authors also found a weedy population growing
beside a domesticated population in SEYUC. In this weedy population, plants were found with
wild-type seeds and others with domesticated-type seeds. Also, they found two wild
populations in SEYUC with wild–domesticated introgression characteristics (Table 3). Several
studies have indicated that the gene flow from the domesticated populations can diminish the
genetic diversity of the wild populations through the displacement of wild alleles (Gepts et al.,
1999).
The FIS tests indicated that 40.5% of the locus–population analyzed have an excess of
heterozygotes, 11.9% a deficit, and 47.6% are in Hardy-Weinberg equilibrium (Data not
showed). When the average values of FIS are obtained per population for all the loci studied,
the tests show that the 11 populations are in Hardy-Weinberg equilibrium, even though
Xohuayán-1, Nohcacab, and Xohuayan-2 had a high number of loci with heterozygote excess
(each with five). At the level of loci for the entire peninsula, the tests indicated that four of the
eight loci studied presented an excess of heterozygotes (AG1, BM140, BM156, and BM160),
one locus showed a deficit (GATS91), and three loci were in Hardy-Weinberg equilibrium
(BM164, BM183, and BM211). These results at the locus–population and the loci–Peninsula
levels show evidence of a tendency toward an excess of heterozygotes in the wild pool of P.
lunatus, an excess, perhaps, as a consequence of natural selection favoring heterozygosity
and/or of a Wahlund effect inside the populations. This result is in contrast with that reported
by Zoro Bi et al. (2003) for the Central Valley of Costa Rica. These authors found that the
populations of that region also deviated from the HWE; however, they found a deficit of
heterozygosity in those populations. These differences between both regions appear to
correspond to the difference in the size of the populations and the levels of endogamy.
In the Yucatan Peninsula, 27 % of the total variation was found among populations (GST =
0.27). This result was supported by an AMOVA, which showed that 27 % of the total variation
was found among populations and 73% within populations. These results can be explained by
a low level of long-term gene flow found (Nm = 0.66). Our results were lower than those
reported in the Central Valley of Costa Rica (GST = 0.56) (Ouédraogo and Baudoin, 2002).
This could be a consequence of a lower level of long-term gene flow present in that region
(Nm = 0.17) than in the Yucatan Peninsula. Low levels of gene flow in the wild populations of
206 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

P. lunatus in the Central Valley of Costa Rica were also reported by Hardy et al. (1977) and
Baudoin et al. (1998).
Figure 3 shows the UPGMA of the 11 wild populations analyzed. The topology indicates a
grouping in accordance with the geographical location of the populations, with the exception
of the group comprising the populations of San Fernando and Boje, located in SEYUC, and
Chunchintok, located in NECAMP. A possible explanation of the clustering of Chunchintok
with the populations of SEYUC could be the accidental transportation of seed by Campeche
farmers, who mentioned that they transport their agricultural products for sale in Valladolid,
the principal town of SEYUC. The clustering patterns of the populations agreed with the
results obtained from the Mantel test (data no showed), which indicates the existence of a
geographical isolation among these wild populations.

Domesticated gene pool

Thirty-one alleles were found in the domesticated populations. Considering the entire
Yucatan Peninsula, we found the following values of allelic richness and genetic diversity: A =
4.0, Ho = 0.62 and H = 0.51. These values were lower than those found in the wild populations
of this region. These differences can be explained for a founder effect occurring during the
domestication process, which has been reported for P. lunatus (Gutiérrez-Salgado et al., 1995)
and other cultivated species (Ladizinsky, 1985), and/or for a genetic erosion effect in the
domesticated gene pool due to changes associated with intensification of traditional agriculture
during recent decades, as it has been reported for common bean (P. vulgaris L.) in central
Mexico (Payro de la Cruz et al., 2005; Zizumbo-Villarreal et al., 2005).
At the population level, San Fernando exhibited the highest diversity (Ho and H) (Table
8). In regard to allelic richness, San Fernando, Marcos and Pascual populations presented the
highest values, the two first located in SEYUC and the other one in NECAMP. This could be a
result, in the case of the two first populations, due to they presented the biggest number of
landraces planted and they grew near to wild populations favoring the introgression of wild
alleles into the domesticated populations.
A comparative analysis among agricultural areas for genetic diversity and allelic richness
indicated significantly higher Ho values for SEYUC, NECAMP and SYUC than those of
CEQROO (Table 9). In relation to the allelic richness, the SEYUC had again the highest A
value, following for NECAMP. SYUC and CEQROO had significantly lower values.
Martínez-Castillo et al., (2004) found a weedy population growing beside a domesticated
population in SEYUC. It could be that this situation increased the genetic diversity and allelic
richness of this area due to the entrance of wild alleles to its domesticated gene pool. In the
case of SYUC, a possible explanation for the low genetic diversity and allelic richness could
be the high dominance of xmejen in this area.
This landrace has replaced to the other ones due to its highest economic value and with
this the replacement of rare alleles present in the other landraces. In the case of CEQROO, its
low genetic diversity and allelic richness could be a result of the high interchange of seeds
among Mayan farmers from the agricultural towns where the germplam analyzed was
collected. Many of the farmers of these towns are relatives or friends
When the farmers lost its seed, they recover it from the seed lot of their relatives or
friends. This situation may increase the endogamy phenomenon and with this to decrease the
genetic diversity.
 Domestication and Conservation Genetics of the Lima Bean… 207

Table 8. Estimators of the genetic diversity of 12 domesticated

and one weedy population of P. lunatus from the Yucatan Peninsula, Mexico

Agricultural region Population Name N A Ae/A Ho H

CEQROO Celestino 19 1.87 0.83 0.50 0.30
Domingo 18 1.63 0.95 0.53 0.28
Julián 20 1.63 0.97 0.56 0.30
SEYUC Marcos 20 2.13 0.82 0.63 0.34
San Fernando 20 2.13 0.92 0.73 0.41
X-Uilub 20 2.01 0.84 0.67 0.35
NECAMP Bolonchén-3 20 1.75 0.93 0.63 0.32
Elías 20 1.75 0.92 0.63 0.32
Pascual 20 2.13 0.79 0.64 0.35
SYUC Rubén 20 1.63 1.00 0.63 0.31
Xohuayán-2 20 1.75 0.93 0.62 0.32
Xohuayán-3 20 1.63 1.00 0.63 0.31
CEQROO, central eastern Quintana Roo; SEYUC, southeast Yucatan; NECAMP, northeast Campeche;
SYUC, south of Yucatan; Number of plants (n); Average number of alleles (A); Allelic frequencies
eveness ( Ae / A ); Observed heterozygosity (Ho); Nei’s index of diversity (H).

Figure 3. UPGMA based on Nei’s genetic distance (1972) of 11 wild populations of P. lunatus studied in
four agricultural areas of the Yucatan Peninsula, Mexico. The numbers above the lines are the proportion
of similar replicates supporting each node. Taken from Martínez-Castillo et al., 2006.
208 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

The FIS tests indicated that 96.96% of the locus–population analyzed has a deficit of
heterozygotes and 3.4% an excess (Data not showed). When the average values of FIS are
obtained per population for all the loci studied, the tests show that the 12 populations are not in
Hardy-Weinberg equilibrium. At the level of loci for the entire peninsula, the tests indicated
that the nine loci studied presented a deficit of heterozygotes. These results at the locus–
population and the loci–Peninsula levels show evidence of a deficit of heterozygotes in the
domesticated gene pool of P. lunatus, a deficit, perhaps, as a consequence of an interchange of
domesticated seeds among farmers into the same areas favoring homozygosity in this gene
pool.

Table 9. Duncan’s test for comparison of means for the values of observed heterozygosity
(Ho) and average number of observed alleles (A) found in 12 domesticated populations of
P. lunatus from four agricultural areas in the Yucatan Peninsula, Mexico

Ho A
Agricultural region Mean Duncan test Mean Duncan test
SEYUC 0.68 A 2.09 A
NECAMP 0.63 A 1.88 A-B
SYUC 0.63 A 1.67 B
CEQROO 0.53 B 1.71 B
SYUC, south of Yucatan; NECAMP, northeast Campeche; CEQROO, central east Quintana Roo;
SEYUC, southeast Yucatan. Regions with the same letter are not different significantly (α = 0.05).

In the Yucatan Peninsula, 36 % of the total variation was found among populations (GST =
0.36). This result was supported by an AMOVA, which showed that 35.5 % of the total
variation was found among populations and 64.5 % within populations. The AMOVA showed
that the highest differentiation was among populations from different areas, too. These results
can be explained by a low level of long-term gene flow found at the Peninsula level (Nm =
0.44) in comparison with the highest values found at the area level, where CEQROO have the
highest value (Nm = 18.1) and SYUC the lowest (Nm = 2.9).
Figure 4 shows the topology generated with a UPGMA of the 12 domesticated populations
analyzed. This topology indicates a grouping in accordance with the geographical location of
the populations. The clustering patterns of the populations agreed with the results obtained
from the Mantel test (data no showed), which indicates the existence of a geographical
isolation among the domesticated populations of P. lunatus.
Analyzing in conjunction the 24 wild, weedy and domesticated populations, at the
Peninsula level the GST value was of 0.47.
This result was supported by an AMOVA which showed that 45.89% of the total variation
was among populations (24.10% among gene pools and 21.79% among populations into each
gene pool). At the intraregional level, the GST values were of 0.33 to NECAMP, 0.37 to
CEQROO, and 0.45 to SEYUC and SYUC.
These results were supported by an AMOVA which showed that in NECAMP the 37.72%
of the total variation was among populations (27.3% among gene pools and 10.42% among
populations into each gene pool); in CEQROO was of 46.54% (41.66% among gene pools and
4.54% among populations into each gene pool); in SEYUC was of 49.17% (43.8% among
gene pools and 5.37% among populations into each gene pool); and in SYUC was of 51.49%
 Domestication and Conservation Genetics of the Lima Bean… 209

(44.7% among gene pools and 6.79% among populations into each gene pool). At the parcel
level, the GST value was of 0.29. It was supported by an AMOVA which showed that 38.33%
of the total variation was among weedy and domesticated populations.

Genetic structure of P. lunatus.

Figure 4. UPGMA based on Nei’s genetic distance (1978) of 12 domesticated populations of P. lunatus
studied in four agricultural areas of the Yucatan Peninsula, Mexico. The numbers above the lines are the
proportion of similar replicates supporting each node.

These results show that the genetic differentiation in the wild–weedy–domesticated

complex of P. lunatus was high at the different levels analyzed, even at the parcel level where
the weedy and domesticated plants grew very close to each other (inclusive on the same maize
plant). It could be a result of the low levels of gene flow between the wild and domesticate
gene pools, as it was indicated for the AMOVA analyses that showed higher levels of
differentiation among gene pools than among populations from the same gene pools.

3. Wild-domesticated gene flow

Recent gene flow

At the Peninsula level, Bayesian clustering analysis showed that most of the wild
populations were subjected to gene flow from the domesticate gene pool (Figure 5, Table 8),
with the highest Q values in the Bolonchén (0.513) and Itzinté (0.167) wild populations in
NECAMP (Table 8). Neither of these populations had morphological evidence of introgression
but they did grow a short distance from domesticated populations. The Chunchintok (0.035)
and Boje (0.027) populations had midlevel Q values (Table 8), the latter included two plants
with morphological seed characteristics indicating introgression from the domesticate gene
pool. After the Bolonchén wild population, the weedy population had the second highest Q
value (0.370) (Table 8). This population was found growing together with a domesticated
210 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

population in SEYUC and two types of seeds were collected from it: those with wild-type
characteristics and others with domesticate-type characteristics.

Figure 5. Coefficients of estimated ancestry per individual (q), grouped by population, biological status
and agricultural region. Each individual is represented by a single vertical line broken into two colored
segments, with lengths proportional to the individual’s estimated ancestry fraction from each of the two
biological statuses: Wild (gray) and domesticate (black). Populations: San Fernando-1 (1), Weedy (2),
Boje (3), San Fernando-2 (4), Marcos (5), X-Uilub (6), Celestino (7), Domingo (8), Julián (9), Nohca
(10), Kik (11), Holpat (12), Xohuayán-1 (13), Nohcacab (14), Xohuayán-2 (15), Xohuayán-3 (16),
Xohuayá n-4 (17), Rubén (18), Itzinté (19), Bolonchén-1 (20), Chunchintok (21), Bolonchén-2 (22),
Elías (23), and Pascual (24). Taken from Martínez-Castillo et al., 2007.

In contrast, most of the domesticated populations had very low gene flow levels from the
wild gene pool (Figure 5, Table 8). The highest Q values were in Pascual (0.063) and
Bolonchén (0.018), located in NECAMP, and Celestino (0.029) in CEQROO (Table 8). No
morphological evidence of introgression was noted in the Pascual population and there were
no wild populations nearby. Bolonchén was one of the domesticated populations growing next
to the Itzinté wild population, but it did not manifest any morphological evidence of
introgression. The farmer cultivating the Celestino population reported that wild plants had
grown there in the last 3 yr, and one weedy plant with wild-type seeds similar to those in the
weedy population was collected there.
The interregional analysis showed that gene flow does exist between agricultural areas,
although at low levels (Table 9). The SEYUC wild pool had a higher reception of domesticate
genes from other agricultural regions, with the CEQROO (Q = 0.004) and NECAMP (Q =
0.003) domesticate gene pools being those contributing the most domesticate alleles. One
individual from the weedy population in SEYUC had a q-probability = 0.072 of having a
domesticated parent from CEQROO, while four others had a q-probability = 0.057 of the
same. In CEQROO, one wild individual showed a q-probability = 0.012 of having a
domesticated grandparent from NECAMP, and in SYUC another individual showed a q-
probability = 0.032 for the same. The region with the highest levels of wild gene infiltration
toward the domesticate pool was CEQROO, where one domesticated individual had a q-
probability = 0.022 of belonging to the SEYUC wild pool. In NECAMP, one domesticated
individual from the Bolonchén population showed a q-probability = 0.072 of having a SEYUC
wild grandparent and a q-probability = 0.059 of having a CEQROO wild grandparent.
 Domestication and Conservation Genetics of the Lima Bean… 211

Table 8. Proportion of estimated ancestry (Q) of 24 wild and domesticated P. lunatus

populations from four agricultural regions on the Yucatan Peninsula, Mexico.
Taken from Martínez-Castillo et al. (2007).

Agricultural region Population Q domesticate pool Q wild pool

SEYUC San Fernando (w) 0.006 0.994
Marcos (we) 0.370 0.630
Boje (w) 0.027 0.973
San Fernando (d) 0.992 0.008
Marcos (d) 0.995 0.005
X-Uilub (d) 0.994 0.006
CEQROO Nohca (w) 0.028 0.972
Kik (w) 0.007 0.993
Holpat (w) 0.007 0.993
Celestino (d) 0.971 0.029
Domingo (d) 0.993 0.007
Julián (d) 0.993 0.007
SYUC Xohuayán-1 (w) 0.006 0.994
Nohcacab (w) 0.012 0.988
Xohuayán-2 (w) 0.011 0.989
Xohuayán-1 (d) 0.995 0.005
Xohuayán-2 (d) 0.994 0.006
Rubén (d) 0.995 0.005
NECAMP Itzinté (w) 0.167 0.833
Bolonchén (w) 0.513 0.487
Chunchintok (w) 0.035 0.965
Bolonchén (d) 0.982 0.018
Elias (d) 0.987 0.013
Pascual (d) 0.937 0.063
SEYUC, southeastern Yucatan; CEQROO, central eastern Quintana Roo; SYUC, southern Yucatan;
NECAMP, northeastern Campeche. Domesticated (d), weedy (we), wild (w).

The intraregional analysis showed gene flow levels even lower than at the Peninsula level
(data not shown). An appreciable gene flow from the domesticate gene pool toward the wild
gene pool was observed in SEYUC. In the weedy population one individual showed a q-
probability = 0.184 of having a domesticated parent and four individuals showed a q-
probability = 0.094 of having a domesticated grandparent. Wild individuals from other areas
showed q-probabilities from 0.000 to 0.04 of having a domesticated grandparent. Gene flow
was even lower from the wild gene pool toward the domesticate gene pool. In CEQROO, just
one individual showed a q-probability = 0.720 of being a wild immigrant, and in NECAMP
only two domesticated individuals showed q-probabilities between 0.170 and 0.199 of having
a wild grandparent. In SEYUC, one domesticated individual showed a q-probability = 0.147 of
having a wild grandparent, while the remaining individuals had q-probabilities between 0.001
and 0.004. All domesticated individuals in SYUC had q-probabilities = 0.001 of having a wild
grandparent.
212 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Table 9. Proportion of estimated ancestry (Q) of eight wild and domesticate P. lunatus
gene pools from four agricultural areas on the Yucatan Peninsula, Mexico.
Taken from Martínez-Castillo et al. (2007).

Q of agricultural region / biological status gene pool

Agricultural Biological SEYUC CEQROO SYUC NECAMP
region Status W D W D W D W D
SEYUC W 0.988 0.001 0.001 0.004 0.000 0.002 0.000 0.003
D 0.000 0.998 0.000 0.000 0.000 0.001 0.000 0.001
CEQROO W 0.000 0.000 0.998 0.000 0.000 0.000 0.000 0.000
D 0.001 0.000 0.005 0.994 0.000 0.000 0.000 0.000
SYUC W 0.001 0.000 0.001 0.000 0.997 0.000 0.000 0.000
D 0.000 0.001 0.000 0.000 0.000 0.998 0.000 0.000
NECAMP W 0.002 0.000 0.001 0.000 0.001 0.000 0.995 0.000
D 0.001 0.000 0.001 0.001 0.000 0.000 0.000 0.997
SEYUC, southeastern Yucatan; CEQROO, central eastern Quintana Roo; SYUC, southern Yucatan;
NECAMP, northeastern Campeche. Domesticate (d), wild (w).

The parcel level analysis also showed low gene flow levels between wild and domesticate
gene pools. Just one individual manifested a q-probability = 0.006 for having a domesticate
parent, while the remaining individuals showed q-probabilities ranging from 0.003 to 0.021 for
having a domesticate grandparent. Domesticate individuals generally showed lower q-
probabilities (from 0.004 to 0.005) for having a wild grandparent, though one did show a q-
probability = 0.001 for having a wild parent and a q-probability = 0.064 for having a wild
grandparent.
The low observed recent gene flow levels at the interregional, intraregional, and parcel
levels were likely due to the limited outcrossing potential of P. lunatus. This is correlated with
its short life cycle, the predominance of self-pollination and its limited ability for pollen and
seed dispersal (Maquet et al., 1997). Though crossing rates of up to 48% have been reported,
the synchronized ripening of pollen grains and the stigma, as well as their proximity in the
bud, favor autogamy in P. lunatus (Baudoin et al., 1998). These authors reported that
horizontal pollen and seed transference did not exceed 6 m. and the neighborhood size was 1.6
m. in wild populations in the Central Valley of Costa Rica.

Long-term gene flow

The Nm estimator showed relatively low gene flow values at the Peninsula level (Nm =
0.28), as well as at the intraregional level: NECAMP (Nm = 0.51), CEQROO (Nm = 0.42),
SEYUC (Nm = 0.31), and SYUC (Nm = 0.31). These results coincide with data reported for
wild populations in Costa Rica (Hardy et al., 1997; Maquet et al., 2001; Ouédraogo and
Baudoin, 2002). This may be explained by the joint action of limited recent gene flow and
continuous selective pressure exercised by Mayan farmers against wild progenitor hybrids and
retrocrosses.
The admixture analysis showed the estimated contribution of Pw to PhyD (mWD = 0.12 ±
0.02) to have been less than the estimated contribution of PD to PhyW (mDW = 0.34 ± 0.04).
These values generate a ratio of mDW/mWD = 2.83, meaning there was an asymmetrical gene
flow almost three times greater from the domesticate pool toward the wild pool. The highly
asymmetrical gene flow can be explained for the migratory-recurrent nature of the swidden
system. This characteristic, combined with the existence of wild P. lunatus seed banks in the
 Domestication and Conservation Genetics of the Lima Bean… 213

soil, can favor or limit genetic contact between wild and domesticated populations. Mayan
farmers on the Peninsula cultivate their plots for 1 to 3 yr and then leave them fallow for 5 to
15 yr. If wild P. lunatus seeds are in the soil, they will germinate when farmers cut and burn
the vegetation for a new agricultural cycle, leading to sympatric growth with domesticated
populations and thus increasing the possibility of introgression between the two gene pools.
Papa and Gepts (2003) found similar results in P. vulgaris from Central Mexico and
suggested two factors to explain the asymmetrical gene flow: (i) the smaller size or lower
density of wild populations compared to domesticated populations; and (ii) the role of farmers
in seed selection. Though hand weeding is still common on the Yucatan Peninsula, increasing
use of herbicides is leading to drastic reductions in the density of wild populations, a greater
pollen production by the domesticate pool relative to that of the wild population, and
consequently a higher pollen flow toward the wild pool. Seed selection also clearly favors the
domesticate pool. In cultivated environments, farmers easily recognize and select against F1
domesticate X wild hybrids because their seeds have generally an intermediate size between
those of the parents and a different color from the domesticated maternal parent. Natural F1
wild X domesticate hybrids, in contrast, can be better adapted due to their hybrid vigor and the
overall dominance of wild-type traits favoring later recombination and introgression of
domesticate alleles into the wild pool (Singh et al., 1995; Papa et al., 2005). In addition to this,
Mayan farmers can also distinguish and select against hybrids based on seed flavor. Wild seeds
contain high concentrations of linamarine, a cyanogenic compound that makes them inedible
(Maquet, 1991). In cases of introgression, hybrid seeds acquire a bitter taste that is easily
detected, leading farmers to dispose of the harvest. Another factor that may be further limiting
the entrance of wild genes into the domesticate gene pool is selection for external markets.
Regional markets on the Yucatan Peninsula currently prefer white-seed landraces, favoring
elimination of hybrid seeds of different colors. This may be the case in SYUC, where a
dominant selection criterion is focused on production of seed for sale. Farmers in this region
report the intentional elimination of wild populations with herbicides to avoid mixing with
their landraces and attain a better price (Martínez-Castillo et al., 2004). This may explain why
SYUC domesticated populations have a lower degree of genetic infiltration.
Certain aspects of the Mayan traditional agriculture in the region, however, favor the
entrance of wild genes into domesticated populations (Martínez-Castillo et al., 2004): (a)
lochepak allows wild and weedy plants to reach the flowering stage at the same time as
domesticated populations because it eliminates only the aerial part of the plant, allowing the
subsequent recovery: (b) wild populations growing near domesticated ones are tolerated when
they do not affect the correct development of their crops, as was the case in NECAMP and; (c)
cultivation for subsistence purposes includes up to seven different types of landraces that, after
hybridizing, create a wide variety of seed shapes, sizes, and colors that can hide the presence
of weed seeds; (d) women and children, who may not readily recognize weedy P. lunatus
seeds, sometimes participate in agricultural activities such as harvest. All of these aspects can
explain why reports for P. vulgaris in Costa Rica contrast with the present results in that gene
flow appears to move from the wild toward the domesticate gene pool in that country, as was
found by González-Torres (2004) using chloroplast DNA markers. Another explication about
the findings of González-Torres (2004) in contrast with ours could be that chloroplast
introgression occurs predominantly from wild to domesticate gene pool, whereas the
introgression of nuclear genes, as our microsatellite data, is predominantly from the
domesticate to wild gene pool (Papa and Gepts, 2003; Chacón et al., 2005).
214 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

4. Genetic erosion in the domesticated gene pool

A total of 90 loci were analyzed of which 71 were polymorphic and 19 monomorphic. At

the total domesticated gene pool level, genetic diversity was high, and the three estimators
showed similar values (I = 0.33, H = 0.28, HB = 0.31) (Table 10). Using alloenzymes, Maquet
et al. (1997) reported an H = 0.26 for the P. lunatus base collection of the Germplasm Bank of
the International Center for Tropical Agriculture (CIAT-Colombia). These authors stated that
this is a significant level and higher than reported for other plants that, like P. lunatus, are
mixed-mating or short-lived perennial species (H = 0.12) (Hamrick et al., 1991). The values
obtained in this study are higher to those found for Nienhuis et al. (1995) using RAPDs on the
domesticated Mesoamerican material (H = 0.11) and to those found for Castiñeiras et al.
(2007), using AFLP molecular markers on the Potato-Sieva landraces planted in the Cuban
home gardens (H = 0.119). Compared with these studies, our results could be reflecting the
high genetic diversity maintained by Mayan farmers in the milpa of the Yucatan Peninsula,
Mexico. However, the studies cited here were made using different methodologies to collect
the plant material (size of samples, sampling methods, different origin of samples-field or
genebank-), and cautions should be taken.
Compared to the wild gene pool, the domesticated lima bean gene pool from the Yucatan
Peninsula had lower genetic diversity values. Using SSR loci, Martínez-Castillo et al. (2006)
reported an H = 0.69 for wild lima beans, which is almost three times higher than found for the
domesticated gene pool (H = 0.28). A number of factors may explain these differences: (a) a
founder effect occurring during the domestication process, which has been reported for P.
lunatus (Gutiérrez-Salgado et al., 1995) and other cultivated species (Ladizinsky, 1985); (b) a
genetic erosion effect in the domesticated gene pool due to changes associated with
intensification of traditional agriculture during recent decades, as it has been reported for
common bean (P. vulgaris) in central Mexico (Payro de la Cruz et al., 2005; Zizumbo-
Villarreal et al., 2005); and (c) the type of data generated by the different markers used in this
analysis (ISSR-dominant markers) vs. Martínez-Castillo et al. (2006) analysis (SSR-
codominant markers).
At the landrace groups level, the common landraces had the highest genetic diversity
values (except for % P), although the differences between the three groups were not
statistically significant.
The rare landraces group had genetic diversity values (H and I) slightly lower than the
common landraces group, but higher for % P (Table 10). It is probably due to the fact that nine
of the 12 rare landraces were represented only by a single accession, whereas all the common
landraces were represented by at least five accessions.
The rare landraces’ minimal abundance is the main factor that most increases the risk of
genetic erosion since it can lead to their local extinction. During a germplasm collection in
2007, a farmer from SEYUC reported that he had lost his seed of Pool-santo and Chak-chí
landraces in the 2006 agricultural cycle due to a lack of rain.
In another case, a farmer from CEQROO stopped planting the Chocolate and Tabaco
landraces in 2005 because he became sick that year and did not cultivate his milpa.
Unfortunately, when we made the germplasm collection, this farmer was the only one who had
these landraces. At present these two rare landraces have not been collected again.
 Domestication and Conservation Genetics of the Lima Bean… 215

Table 10. Estimators of genetic diversity of lima bean landraces groups

from the Yucatan Peninsula, Mexico, using 90 ISSR loci.
Taken from Martínez-Castillo et al. (2008).

Percentage of Shannon´s Nei´s gene Average

polymorphic diversity diversity (H) heterozygosity (HB)
loci (% P) index (I)
Total domesticated gene pool 78.9 0.33 0.29 0.31
Groups of landraces
Dominant landraces 26.7 0.17 a 0.13 a 0.27 a
Common landraces 58.9 0.33 a 0.26 a 0.37 a
Rare landraces 66.7 0.27 a 0.24 a 0.28 a
Groups with the same letter are not different significantly (α= 0.05).

Two factors that could reduce the risk of genetic erosion in some of the rare landraces are
dark seed color and their mixed management by Mayan farmers. Both aspects favor the
entrance of wild alleles through formation of wild-weedy-domesticated complexes and the
generation of weedy forms (Martínez-Castillo et al., 2004). Two special cases in the use of
seed mixtures are the Bacalar and Balche landraces. These have become a kind of ‘‘genetic
dump’’ as they contain seeds similar to many different landraces, such as Box-petch, Putsica-
sutsuy, Chak-petch, Chaksaac, Pool-santo, among others. Indeed, in 2007 weedy forms were
observed among the seeds harvested of Bacalar in CEQROO.
The abundant landraces group had the lowest values of genetic diversity among the three
groups for all estimators, except for H that showed the same value showed for the rare landrace
group (Table 10). These low values could be reflecting a germplasm selection influenced by
external market demands. Martínez-Castillo et al. (2004) reported that one of the main
selection criteria applied to the three most abundant landraces is seed production for sale. As a
result of this, Mayan farmers currently tend to plant white seeded landraces. This leads to a
selection against weedy forms produced from crosses between landraces and the wild
populations surrounding milpas, consequently limiting introgression of wild alleles and
increasing the risk of genetic erosion. In relation to dominant lima bean landraces, Debouck
(1979) collected at least 10 different landraces in the Mayan community of Nohalal,
Campeche, but currently only three have been observed and these are dominated by Mulición
and Sac (direct observation). Informal interviews with Mayan producers in Nohalal suggest
that this loss of landraces is associated with the introduction of mechanized agriculture and
monoculture of improved varieties of corn. Recent field observations indicate that even the
planting of abundant lima bean landraces is decreasing in response to low prices. A similar
case is happening in SYUC, where the xmejen has been replacing the other landraces with
color of seed different from white (Martínez-Castillo et al., 2004). Recently, it has decreased in
cultivated area as a result of a low in demand markets. Even though in this study xmejen is
considered as a landrace, there are evidences that it could be a improved variety introduced
approximately 25 years ago: (1) it was not found by Debouck in 1979, (2) it is a variety
planted as a monocrop (an aspect non common in the traditional Mayan agriculture) and it is
no associated with maize as all the other landraces, and (3) it is a variety with a very short
productive cycle that depends on a lot of water, a limited resource in the Yucatan Peninsula.
This decrease in the number and density of planted populations may mean that a new genetic
bottleneck is soon to come for the abundant landraces.
216 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

One little-studied factor in the genetic erosion of crops is change in the food preferences of
the rural populations. For lima bean in the Yucatan Peninsula this currently takes three forms:
(a) young adults and children do not eat it; (b) only the elderly plant many of the rare landraces
for their own use; and (c) cowpea (Vigna unguiculata (L.) Walpers, locally known as x-pelon),
introduced to the region from Africa in the 20th century, has been replacing P. lunatus. In fact,
lima bean is progressively being replaced in some regions of Latin America by other food
legumes (Maquet et al., 1997). As it is a long process to re-introduce a crop plant, in a study
conducted in Cuba, Esquivel and Hammer (1988) proposed to maintain lima bean landraces as
part of the traditional horticultural system. In several Mayan towns of the Yucatan Peninsula,
some landraces are planted into the home gardens. However, it is not a common agricultural
practice. On the other hand, loss of landraces is also apparently linked to the different
generations in human populations. Reports document that the Mayan farmers planting a large
variety of rare landraces are elderly and their death almost surely means the loss of these
landraces (direct observation).

CONCLUSION
The greatest intra-specific diversity of P. lunatus found in the Yucatan Peninsula by
Ballesteros (1999), when compared to the rest of Mexico, could be explained by the results
presented in this chapter. The variation in P. lunatus observed suggested the presence of
complex gene pools in the Maya lowlands area that may have resulted from sympatric contact
between wild, weedy, and cultivated populations. Such a situation is similar to those described
by Beebe et al. (1997) for P. vulgaris in the Andean center and by Papa and Gepts (2003) and
Zizumbo-Villarreal et al. (2005) for Mesoamerica. In both cases, gene flow between
components of the complexes has been considered an important mechanism for generating
genetic variability (Beebe et al. 1997; Harlan 1992). Ethnobotanical data suggested that Mayan
farmers favored the formation and maintenance of these complex gene pools through: 1)
traditional weeding practices that did not totally eliminate weedy plants; 2) side-by-side
planting of different landraces; and, 3) sowing mixtures of landraces when seeds were scarce.
On the other hand, this great diversity could lie in the profound and continuous history of
selection pressures and traditional management practices exercised by Mayan farmers over
thousands of years and/or to be a result of the complexity of human migrations in the area and
the history of germplasm exchange that has been maintained with other subcultural areas in
Mesoamerica since the establishment of the first agricultural communities (Colunga-
GarcíaMarín et al., 2003).
Molecular data indicated that the wild and domesticated gene pools of P. lunatus have a
high intrapopulation genetic diversity and a structure that results from processes of geographic
isolation and low levels of gene flow. The wild gene pool has a higher genetic diversity than
the domesticated one due to, possibly, a founder effect occurring during their domestication
process. In the case of the wild populations, molecular data suggested a positive correlation
between agricultural intensification and increase in diversity, as greater values of Ho were
recorded in the areas with greater intensification. These results suggest that wild populations of
P. lunatus are actually favored by the intensification of disturbance in situations involving at
least 3 yr of fallow. However, the opposite could be true at higher levels of intensification, as
 Domestication and Conservation Genetics of the Lima Bean… 217

can be observed in the Central Valley of Costa Rica, where the diversity is diminishing. Two
aspects could explain these results: (i) long fallow periods, combined with the existence of a
soil seed bank, favors the existence of gene flow from domesticated toward the wild pool,
diminishing with this its genetic diversity, as it could be the case of the SEYUC (fallow of 10
yr): and (ii) longer fallow periods determine stronger bottlenecks and genetic drift on the soil
seed bank, diminishing with this also the genetic diversity of the wild populations. In relation
to the domesticated gene pool, although no clear relationship between genetic diversity and
intensification was observed using molecular data, the area showing the highest levels of
genetic diversity was SEYUC, which presented the lowest levels of agricultural intensification
and in which wild-weedy-domesticated complexes were found. In this way, the higher genetic
diversity found in one of the areas with lower agricultural intensification and with the presence
of weedy populations (SEYUC), in contrast with the lower allelic richness found in the
domesticated gene pool of the area with the highest agricultural intensification (SYUC),
suggested that the existence of wild-weedy-domesticated complexes and the agricultural
intensification are key factors in designing in situ conservation programs. When the genetic
diversity of the lima bean was analyzed at the landrace level, we found that it remains high in
comparison with other studies. However, it is important to say that the rare landraces from the
Yucatan Peninsula are in a higher risk of genetic erosion because, with few individuals living
per landrace and with moderate genetic diversity, it represents the greatest loss of unique
alleles if these landraces go to local extinction. On the other hand, the abundant landraces have
the lowest genetic diversity levels and are thus at great risk of genetic erosion due to selection
criteria imposed by an external market, too.
If data about relative abundance reported by Martínez-Castillo et al. (2004) reflect the
current condition of the domesticated lima bean pool in the Yucatan Peninsula, then this
species is at very high risk of genetic erosion since this region is one of its main centers of
genetic diversity in Mesoamerica. If current trends continue in the region, many lima bean
landraces may cease to be grown into the milpa in two to three generations. When compared
with other Mesoamerican regions, wild and domesticated gene pools of P. lunatus presents in
the Yucatan Peninsula showed genetic diversity values higher than those reported for Cuba and
Costa Rica, and similar genetic diversity when compared with all species. Our results could be
reflecting the high genetic diversity of this species maintained in the traditional agricultural
systems of the Yucatan Peninsula, Mexico.
On the other hand, the findings reported in this chapter are very important for the
conservation and biosafety of domesticated and wild P. lunatus populations within this
Mesoamerican center of diversity. Even with the low levels of gene flow reported in this
chapter, the asymmetrical gene flow from the domesticated to the wild gene pool may create a
drastic reduction in the genetic diversity of wild populations and even lead to local extinctions.
This in turn could affect the genetic diversity of the domesticate gene pool and the availability
of agriculturally interesting genes for plant breeders. In addition, many of the characteristics
incorporated into domesticated plants using traditional improvement methods (e.g., lack of
seed latency, dwarfing, and dependence on nutrient-rich soils) are maladaptive for wild plants
(Ellstrand and Hoffman, 1990), meaning hybrids between domesticated forms and their wild
parents may be poorly adapted to uncultivated environments, thus diminishing or even
preventing transference of domesticate genes within natural populations (Doebley, 1992;
National Research Council, 1989). However, the characteristics genetically transferred by
genetic engineering (e.g., herbicide, pest and disease resistance) may provide an adaptive
218 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

advantage to wild plants (Gasser and Fraley, 1989). If these characteristics are introduced into
this crop by genetic engineering, domesticate–weedy hybrids could threaten the current host–
pest balance (Ellstrand and Hoffman, 1990). The problem becomes even more complex taking
into account gene flow between pools from different agricultural regions through deliberate or
accidental seed movement.
The results presented here indicate the importance of initiating in situ and ex situ
conservation programs for P. lunatus in the Yucatan Peninsula, especially given the
accelerated pace of agricultural intensification in the region. To do this, areas need to be
selected that favor in situ conservation while considering the natural, economic, social and
cultural factors that contribute to this conservation. Two areas that must be considered are
CEQROO and SEYUC, areas with low agricultural intensification and a high number of rare
landraces. Unexpected conditions such as the randomness of rainfall events, relatively few
peasants planting ‘‘rare’’ varieties, and the older age of farmers could lead to significant losses
of germplasm even within the span of a single human generation. In situ conservation
programs must include significant cultural reinforcement programs, since the relevant
objective is not the conservation of available germplasm by farmers, but that farmers continue
to play a dynamic role in the generation of new germplasm. In situ conservation programs are
needed that address: (a) an emergency collecting effort to save all landraces ex situ as a backup
for the in situ conservation activities, (b) in situ conservation of landraces and the alleles they
consist of; (c) generation of wild-weedy-domesticated complexes that allow introgression of
wild alleles into landraces; and (d) reintroduction of rare landraces and programs to promote
their planting and acceptance among young Mayan producers and their families.

ACKNOWLEDGMENTS
This chapter is a result of the first author’s doctoral dissertation at the Centro de
Investigación Científica de Yucatán, A. C. The authors thank P. Gepts, Hugo Perales and P.
Delgado for their academic advice. The first author thanks the Consejo Nacional de Ciencia y
Tecnología-Mexico for the scholarship for his postgraduate studies, UCMEXUS-CONACYT
and SINAREFI-SAGARPA for the economic support to carry out this research.

REFERENCES
Adams, R. E. W., and T. P. Culbert. 1977. The origins of civilization in the Maya lowlands.
Pages 3–34 in R. E. W. Adams, ed., The origins of Maya civilization. University of New
Mexico, Albuquerque.
Akande, S. R., and M. O. Balogun. 2007. Evaluation and heritability studies of local Lima
bean (Phaseolus lunatus L.) cultivars from south-west Nigeria. Revista Científica UDO
Agrícola Vol. 7, Núm. 1, 2007, pp. 22-28.
Ballesteros, G. A. 1999. Contribuciones al conocimiento del frijol Lima (Phaseolus lunatus L.)
en América Tropical. Ph. D. thesis, Colegio de Posgraduados, Montecillos, Estado de
México, México.
 Domestication and Conservation Genetics of the Lima Bean… 219

Bartolomé, M. A., and A. M. Barabas. 1977. La resistencia Maya. Relaciones interétnicas en el

Oriente de la Península de Yucatán. No. 53. Colección Científica. Etnología. Instituto
Nacional de Antropología e Historia. México D. F.
Baudet, J. C. 1977. The taxonomic status of the cultivated types of lima bean (Phaseolus
lunatus L.). Tropical Grain Legume Bulletin 7:29–30.
Baudoin, J. P., J. Degreef, O. Hardy, F. Janart, and I. Zoro Bi. 1998. Development of an in situ
conservation strategy for wild Lima bean (Phaseolus lunatus L.) populations in the central
valley of Costa Rica. In: Owens S. J. and Rudall P. J. (eds). Reproduction biology. Royal
Botanic Garden Press, Kew.
Baudoin, J.-P, O. Rocha, J. Degreef, A. Maquet and L. Guarino. 2004. Ecogeography,
Demography, Diversity and Conservation of Phaseolus lunatus L. in the Central Valley of
Costa Rica. Systematic and Ecogeographic Studies on Crop Genepools 12. Internacional
Plant Genetic Resources Institute, Rome, Italy.
Beebe, S., O. Toro Ch., A. Viviana G., M. I. Chacón, and D. G. Debouck. 1997. Wild-weed-
crop complexes of common bean (Phaseolus vulgaris L., Fabaceae) in the Andes of Peru
and Colombia, and their implications for conservation and breeding. Gen. Resour. Crop
Evol. 44:73–91.
Bellón, M. R., and J. E. Taylor. 1993. Farmer soil taxonomy and technology adoption. Econ
Dev Cult Change 41:764–786.
Bertorelle, B., and L. Excoffier. 1998. Inferring admixture proportion from molecular data.
Mol. Biol. Evol. 15:1298–1311.
Broughton, W. J., G. Hernández, M. Blair, S. Beebe, P. Gepts, and J. Vanderleyden. 2003.
Beans (Phaseolus spp.) – model food legumes. Plant and Soil 252: 55-128.
Brush, S. B. 1991. A farmer-based approach to conservation crop germplasm. Econ Bot
45:153–165.
Caicedo, A.L., E. Gaitán, M.C. Duque, O. Toro Chica, D.G. Debouck, and J. Tohme. 1999.
AFLP fingerprinting of Phaseolus lunatus L. and related wild species from South
America. Crop Sci. 39:1497–1507.
Castiñeiras, L., F. A. Guzmán, M. C. Duque, T. Shagarodsky, R. Cristóbal, and M. C. De
Vicente. 2007. AFLPs and morphological diversity of Phaseolus lunatus L. in Cuban
home gardens: approaches to recovering the lost ex situ collection. Biodiversity and
Conservation 16: 2847-2865.
Colunga-GarcíaMarín, P., and F. May-Pat. 1992. El sistema milpero y sus recursos genéticos.
Pages 97–134 in D. Zizumbo V., C. H. Ramussen, L. M. Arias R. and S. Terán C., eds., La
modernización de la milpa en Yucatán: utopía o realidad. CICY-DANIDA. Mérida,
Yucatán, México.
Colunga-GarcíaMarín, P., R. Ruenes-Morales, and D. Zizumbo-Villarreal. 2003.
Domesticación de plantas en las tierras bajas mayas y recursos fitogenéticos disponibles
en la actualidad. Pages 116–127 in P. Colunga- GarcíaMarín and A. Larqué-Saavedra
(eds.). Naturaleza y sociedad en el área Maya: pasado, presente y futuro. Academia
Mexicana de Ciencias-CICY.
Cole, C. T. 1998. Genetic variation in rare and common plants. Annu.Rev. Ecol. Evol. Syst.
34:213–237.
Cuanalo de la Cerda, H. E., and R. L. Arias. M. 1997. Cultural and economics factors that
affect farmers decision-making in Yucatan, Mexico. In: Jarvis DI, Hodgkin T (eds)
220 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Strengthening the scientific basis of in situ conservation of agricultural biodiversity on-

farm. Options for data collecting and analysis. IPGRI, Rome, p 14
Culley, T. M., S. J. Sbita, and Wick, A. 2007. Population genetic effects of urban habitat
fragmentation in the perennial herb Viola pubescens (Violaceae) using ISSR Markers. Ann
Bot 100:91–100.
Chacón, M. I., B. Pickersgill, and D.G. Debouck. 2005. Domestication patterns in common
bean (Phaseolus vulgaris L.) and the origin of the Mesoamerican and Andean cultivated
landraces. Theor. Appl. Genet. 110:432–444.
Chimal-Chan, M. A. 2008. Polinización y flujo genético de Phaseolus lunatus L. en el sur de
la península de Yucatán. Bachelor thesis. Instituto Tecnológico de Conkal, Conkal,
Yucatán, México.
Debouck, D. G. 1979. Proyecto de recolección de germoplasma de Phaseolus en México.
CIAT-INIA, Centro Internacional de Agricultura Tropical (CIAT), Colombia.
Debouck, D.G., J.H. Liñan Lara, A. Campana Sierra, and J. H. De la Cruz Rojas. 1987.
Observations on the domestication of Phaseolus lunatus L. FAO/IBPGR Plant Genet.
Resour. Newsl. 70:26–32.
Degreef, J., O. J. Rocha, T. Vanderborght, and J. P. Baudoin. 2002. Soil seed bank and seed
dormancy in wild populations of Lima bean (Fabaceae): Considerations for in situ and ex
situ conservation. Am. J. Bot. 89(10):1644–1650.
Delgado-Salinas, A., T. Turley, A. Richman, and M. Lavin. 1999. Phylogenetic analysis of the
cultivated and species of Phaseolus (Fabaceae). Systematic Botany 23: 438–460.
Delgado-Salinas, A., R. Bibler, and M. Lavin. 2006. Phylogeny of the Genus Phaseolus
(Leguminosae): A Recent Diversification in an Ancient Landscape. Systematic Botany 4:
779–791.
Doebley, J. 1992. Molecular systematics and crop plant evolution. p. 202–222. In D.E. Soltis
et al. (ed.) Plant molecular systematics. Chapman and Hall, New York.
Doyle, J., and J. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh
leaf tissue. Phytochem. Bull. 19:11–15.
Duch-Gary, J. 1991. Fisiografía del estado de Yucatán. Su relación con la agricultura.
Universidad Autónoma de Chapingo. Texcoco, México.
Dupanloup, I., and G. Bertorelle. 2001. Inferring admixture proportions from molecular data:
Extension to any number of parental populations. Mol. Biol. Evol. 18(4):672–675.
Ellstrand, N., and C. Hoffman. 1990. Hybridization as an avenue for the escape of
engineered genes. Bioscience 40:438–442.
Esquivel, H., and Hammer, K. 1988. The ‘‘conuco’’ – an important refuge of Cuban plant
genetic resources. Kulturpflanze 36:451–463
FAO. 1996. The state of the world’s plant genetic resources: diversity and erosion. Third
World Resurgence. Farmers’ Rights and the Battle for Agrobiodiversity. Issue No. 72/ 73
KDN PP6738/1/96. An excerpt from the Report on the State of the World’s Plant Genetic
Resources prepared by the FAO Secretariat for the International Technical Conference on
Plant Genetic Resources at Leipzig, Germany, 17–23 June 1996.
Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap.
Evolution 39:783–791.
Fofana, B., P. du Jardin, and J. P. Baudoin. 2001. Genetic diversity in the lima bean
(Phaseolus lunatus L.) as revealed by chloroplast DNA (cpDNA) variations. Genetic
Resources and Crop Evolution 50:1–9.
 Domestication and Conservation Genetics of the Lima Bean… 221

Fofana, B., J. P. Baudoin, X. Vekemans, D. G. Debouck, and P. du Jardin. 1999. Molecular

evidence for an Andean origin and a secondary gene pool for the Lima bean (Phaseolus
lunatus L.) using chloroplast DNA. Theoretical and Applied Genetics 98: 202-212.
Fofana, B., X. Vekemans, P. du Jardin, and J. P. Baudoin. 1997. Genetic diversity in Lima
bean (Phaseolus lunatus L.) as revealed by RAPD markers. Euphytica 95:157–165.
Freytag G. F., and D. G. Debouck. 2002. Taxonomy, distribution, and ecology of the genus
Phaseolus (Leguminosae-Papilionoideae) in North America, Mexico and Central America.
Sida, Botanical Miscellany 23.
Gaitán-Solís, E., M. C. Duque, K. J. Edwards, and J. Tohme. 2002. Microsatellite repeats in
common bean (Phaseolus vulgaris): Isolation, characterization, and cross-species
amplification in Phaseolus ssp. Crop. Sci. 42:2128–2136.
Gasser, C. S., and R.T. Fraley. 1989. Genetically engineered plants for crop improvement.
Science 244:1293–1299.
Gepts, P., R. Papa, A. González Mejía, J. Acosta Gallegos, and A. Delgado Salinas. 1999.
Human effects on Phaseolus vulgaris adaptation during and after domestication, p. 161–
181, In L. van Raamsdonk and J. den Nijs (ed.) Proc. VIIth IOPB Symposium, Evolution
in Man-Made Habitats. Hugo de Vries Laboratory, University of Amsterdam, Amsterdam.
González-Torres, R. I. 2004. Estimación de flujo de genes en Phaseolus vulgaris L. mediante
marcadores moleculares: Microsatélites y polimorfismo de ADN de cloroplasto. Master’s
thesis. Universidad Nacional de Colombia, Bogotá, Colombia.
González, A., A. Wong, A. Delgado-Salinas, R. Papa, and Gepts, P. 2005. Assessment of inter
simple sequence repeat markers to differentiate sympatric wild and domesticated
populations of common bean. Crop. Sci. 45:606–615.
Gutiérrez-Salgado, A., P. Gepts, and D.G. Debouck. 1995. Evidence for two gene pools of the
Lima beans, Phaseolus lunatus L., in the Americas. Genet. Resour. Crop Evol. 42:15–28.
Hails, R. S. 2000. Genetically modified plants—The debate continues. Trends Ecol. Evol.
15:14–18.
Hammer, K., and G. Laghetti. 2005. Genetic erosion – examples from Italy. Genet Resour
Crop Evol 52:629–634.
Hamrick J. L., M. J. W. Godt, D. A. Murawski, and M. D. Loveless. 1991. Correlations
between species traits and allozyme diversity: implications for conservation biology. In:
Falk D. A. and Holsinger K. E. (eds) Genetics and conservation of rare plants. Oxford
University Press, New York, pp 75–86.
Hardy, O., S. Dubois, I. Zoro Bi, and J. P. Baudoin. 1997. Gene dispersal and its consequences
on the genetic structure of wild populations of Lima bean (Phaseolus lunatus) in Costa
Rica. Plant Genet. Resour. Newsl. 109:1–6.
Harlan, J. R. 1992. Crops and man. 2d ed. American Society of Agronomy and Crop Science
Society of America, Madison, WI, USA.
Harlan, J. R., and J. M. J. de Wit. 1971. Toward a rational classification of cultivated plants.
Taxon 20:509–517
Hernández, F. C., and A. Delgado-Salinas. 1992. Recursos genéticos de frijoles en el oriente
de Yucatán. Pages 147–160 in D. Zizumbo V., C. H. Ramussen, L. M. Arias R. and S.
Terán C., eds., La modernización de la milpa en Yucatán: utopía o realidad.
CICYDANIDA. Mérida, Yucatán, México.
222 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Hernández-Xolocotzi, E. 1973. Genetic resources of primitive varieties of Mesoamerica: Zea

spp., Phaseolus spp., Capsicum spp., and Cucurbita spp. In: Survey of crop genetic
resources in their centers of diversity. FAO, Roma, pp 76–115.
Hernández-Xolocotzi, E. 1992. Racionalidad tecnológica del sistema de producción agrícola
de roza-tumba-quema en Yucatán. Pages 187–194 in D. Zizumbo V., C. H. Ramussen, L
M. Arias R. and S. Terán C., eds., La modernización de la milpa en Yucatán: utopía o
realidad. CICY-DANIDA. Mérida, Yucatán, México.
Jarvis, D. I., L. Myer, H. Klemick, L. Guarino, M. Smale, and A. H. D. Brown. 2000. A
training guide for in situ conservation on farm. Version 1. International Plant Genetic
Resources Institute, Rome.
Kaplan, L., and T. F. Lynch. 1999. Phaseolus (Fabaceae) in archaeology: AMS radiocarbon
dates and their significance for pre-Columbian agriculture. Econ. Bot. 3: 261-272.
Kimura, M. 1955. Stochastic processes and distribution of gene frequencies under natural
selection. Cold Spring Harbor Symp. Quant. Biol. 20:33–53.
Kremer, A., H. Caron, S. Cavers, N. Colpaert, L. Gheysen, and R. Gribel. 2005. Monitoring
genetic diversity in tropical trees with multilocus dominant markers. Heredity 95: 274-
280.
Ku-Naal, R. 1995. Cambios técnicos en la milpa bajo roza-tumba- quema en Yaxcabá,
Yucatán. In: Hernández X. E., Bello B. E., Levy T. S. (eds). La milpa en Yucatán: Un
sistema de producción agrícola tradicional. Colegio de Postgraduados, México, pp 401–
418.
Ladizinsky, G. 1985. Founder effect in crop-plant evolution. Econ Bot 39:191–198.
Lazos-Chavero, E. 1995. La milpa en el sur de Yucatán: Dinámica y crisis. p. 35–86. In La
milpa en Yucatán: Un sistema de producción agrícola tradicional. Colegio de
Postgraduados, México.
Li, C. C., and D. G. Horvitz. 1953. Some methods of estimating the inbreeding coefficient.
Am. J. Human Genet. 5:107–117.
Lioi, L., C. Lotti, and I. Galasso. 1998. Isozyme diversity, RFLP of the rDNA and
phylogenetic affinities among cultivated Lima beans, Phaseolus lunatus (Fabaceae). Plant
Syst Evol 213:153–164.
Lioi, L., and I. Galasso. 2002. Oligonucleotide DNA fingerprinting revealing polymorphism in
Phaseolus lunatus L. Genetic Resources and Crop Evolution 49:53–58.
Lynch, M., and Milligan, B. G. 1994. Analysis of population genetic structure with RAPD
markers. Mol. Ecol. 3:91–99.
McAleece, N. 1997. Biodiversity professional beta. The Natural History Museum and The
Scottish Association for Marine Science.
Manel, S., O. E. Gaggiotti, and R. S. Maples. 2005. Assignment methods: Matching biological
questions with appropriate techniques. Trends Ecol. Evol. 20(3):136–142.
Martínez-Castillo, J. 2005. Diversidad intraespecífica de Phaseolus lunatus L. e intensificación
de la agricultura tradicional en la Península de Yucatán, México. Ph. D. Thesis, Centro de
Investigación Científica de Yucatán, A. C., Mérida, México.
Martínez-Castillo, J., D. Zizumbo-Villarreal, H. Perales-Rivera, and P. Colunga-GarcíaMarín.
2004. Intraspecific diversity and morpho-phenological variation in Phaseolus lunatus L.
from the Yucatan Peninsula, Mexico. Econ. Bot. 58 (3): 354–380.
 Domestication and Conservation Genetics of the Lima Bean… 223

Martínez-Castillo, J., D. Zizumbo-Villarreal, P. Gepts, P. Delgado-Valerio, and P. Colunga-

GarcíaMarín. 2006. Structure and genetic diversity of wild populations of lima bean
(Phaseolus lunatus L.) from the Yucatan Peninsula, Mexico. Crop Sci. 46:1071–1080.
Martínez-Castillo, J., D. Zizumbo-Villarreal, P. Gepts, P. Colunga-GarcíaMarín. 2007. Gene
flow and genetic structure in the wild-weedy-domesticated complex of Lima bean
(Phaseolus lunatus L.) in its Mesoamerican center of domestication and diversity. Crop
Sci 47:58–66.
Martínez-Castillo, J. P. Colunga-GarcíaMarín, D. Zizumbo-Villarreal. 2008. Genetic erosion
and in situ conservation of Lima bean (Phaseolus lunatus L.) landraces in its
Mesoamerican diversity center. Genet. Resour. Crop Evol. 55: 1065-1077.
Maquet, A. 1991. Lima bean (Phaseolus lunatus L.) catalogue. Working document No. 80.
Centro Internacional de Agricultura Tropical (CIAT). Cali, Colombia.
Maquet, A., B. Masumbuko, M. Ouedraogo, I. Zoro Bi, and J. P. Baudoin. 2001. Estimation of
gene flow among wild populations of Phaseolus lunatus L. using isozyme markers. Ann.
Rep. Bean Improv. Coop. 44:27–28.
Maquet, A., I. Zoro Bi, M. Delvaux, B. Wathelet, and J. P. Baudoin. 1997. Genetic structure of
a Lima bean base collection using allozyme markers. Theor Appl Genet 95:980–991.
Mazhar, F. 1997. Nayakrishi Andoland: an initiative of the Bangladesh peasants for a better
living. In: Sperling L, Loevinsohn M (eds) Using diversity: enhancing and maintaining
genetic resources on-farm. International Development Research Centre, Ottawa.
Miller, M. P. 1997. Tools for population genetic analysis (TFPGA) 1.3: a windows program
for the analysis of allozyme and molecular population genetic data. Distributed by the
author.
Nahal, J. L. 1993. Reproducción y caracterización de 30 genotipos de frijoles ibes (P. lunatus
L.) y botiles (P. coccineus L. y P. polyanthus Green) de Yucatán y Chiapas. Instituto
Tecnológico Agropecuario No. 19, Tizimin, Yucatán, México.
National Research Council. 1989. Field testing genetically modified organisms: Framework
for decisions. National Academy Press, Washington, D. C.
Nei, M. 1972. Genetic distance between populations. Am. Nat. 106 (949):283–292.
Ouédraogo, M., and J. P. Baudoin. 2002. Comparative analysis of genetic structure and
diversity in wild lima bean populations from the Central Valley of Costa Rica, using
microsatellite and isozyme markers. Ann. Rep. Bean Improv. Coop. 45:240–241.
Papa, R., J. Acosta, A. Delgado-Salinas, and P. Gepts. 2005. A genome-wide analysis of
differentiation between wild and domesticated Phaseolus vulgaris from Mesoamerica.
Theor. Appl. Genet. 111:1147–1158.
Papa, R., and P. Gepts. 2003. Asymmetry of gene flow and differential geographical structure
of molecular diversity on wild and domesticated common bean (Phaseolus vulgaris L.)
from Mesoamerica. Theor. Appl. Genet. 106:239–250.
Payró de la Cruz, E., P. Gepts, P. Colunga-GarcíaMarín, and D. Zizumbo-Villarreal. 2005.
Spatial distribution of genetic diversity in wild populations of Phaseolus vulgaris L. from
Guanajuato and Michoacán, Mexico. Genet. Resour. Crop Evol. 52:589–599.
Pérez-Toro, A. 1945. La agricultura milpera de los mayas de Yucatán. Pages 173–204 in L. H.
Hoyos-Vilanueva, R. Irigoyen-Rosado, R. Ruz-Menéndez and H. Lara-Lara, eds.,
Enciclopedia Yucatanense. Vol. 6. Oficial Edition of Government of Yucatán State.
Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using
multilocus genotype data. Genetics 155: 945–959.
224 Pallavi Sharma, Ambuj Bhushan Jha and R. S. Dubey

Remmers, G. G. A., and E. Ucan. 1996. La roza-tumba-quema maya: Un sistema agroecolo´

gico tradicional frente al cambio tecnológico. Etnoecología 3:97–109.
Reyes, G. D., C. G. Aguilar. 1992. Intensificación de la milpa en Yucatán. In: Zizumbo V. D.,
Rasmussen Ch., Arias R. L. M., Terán S. (eds). La modernización de la milpa en Yucatán:
utopía o realidad. CICY-DANIDA, Mérida, pp 347–358.
SAS. 1997. SAS/STAT user’s guide, release 6.12 edition. SAS Institute Inc., Cary, NC.
Schneider, S., D. Roessli, and L. Excoffier. 2000. Arlequin ver. 2.000: A software for
population genetics data analysis. Genetics and Biometry Laboratory, University of
Geneva, Geneva.
Shannon, C. E., and W. Weaver. 1949. The mathematical theory of communication. University
of Illinois Press, Urbana, IL.
Simpson, E. H. 1949. Measurement of diversity. Nature 163: 688.
Singh, S.P., A. Molina, and P. Gepts. 1995. Potential of wild common bean for seed yield
improvement of cultivars in the tropics. Can. J. Plant Sci. 75:807–813.
Snow, A. 2002. Transgenic crops– why gene flow matters. Nat. Biotechnol. 20:542.
Sokal, R., and F. J. Rohlf. 1995. Biometry: The principles and practice of statistics in
biological research. W. H. Freeman, New York.
Tsegaye, B., and T. Berg. 2007. Genetic erosion of Ethiopian tetraploid wheat landraces in
Eastern Shewa, Central Ethiopia. Genet Resour Crop Evol 54:715–726.
Vavilov, N. I. 1926. Centers of origin of cultivated plants. Bull Appl Bot Genet Plant Breed
16:248.
Vekemans, X. 2002. AFLP-SURV version 1.0. Distributed by the author. Laboratoire de
Génétique et Ecologie Végétale, Université Libre de Bruxelles, Belgium.
Wilson, G. A., and B. Rannala. 2003. Bayesian inference of recent migration rates using
multilocus genotypes. Genetics 163: 1177–1191.
Wright, S. 1931. Evolution in mendelian populations. Genetics 16: 97-159.
Wright, S. 1978. Variability within and among natural populations. Vol. 4. The Univ. of
Chicago Press, Chicago
Yeh, F. C., and T. J. B. Boyle. 1999. Popgene version 1.31. Microsoft Windows-based
freeware for population analysis. Univ. of Alberta and Centre for Int. Forestry Res.,
Edmonton, AB.
Zietkiewicz, E., A. Rafalski, and D. Labuda. 1994. Genome fingerprinting by simple sequence
repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20:176–183.
Zizumbo-Villarreal, D. 1992. Conclusiones Mesa Redonda. La modernización de la milpa en
Yucatán. Utopía o realidad. Pages 371–378 in D. Zizumbo V., C. H. Ramussen, L. M.
Arias R. and S. Terán C., eds., La modernización de la milpa en Yucatán: utopía o
realidad. CICY-DANIDA. Mérida, Yucatán, México.
Zizumbo-Villarreal, D., P. Colunga-GarcíaMarín, E. Payró de la Cruz, P. Delgado-Valerio,
and P. Gepts. 2005. Population structure and evolutionary dynamics of wild–weedy–
domesticated complexes of common bean in a Mesoamerican region. Crop Sci. 45:1073–
1083.
Zhivotovsky, L. A. 1999. Estimating population structure in diploids with multilocus dominant
DNA markers. Mol Ecol 8:907–913.
 Domestication and Conservation Genetics of the Lima Bean… 225

Zoro Bi, I. 1999. Variabilité génétique des populations sauvages de Phaseolus lunatus L. dans
la vallée centrale du Costa Rica et ses implications dans la mise ou point d’ une stratégíe
de conservation in situ. Ph. D. thesis. Faculté Universitaire des Sciences Agronomiques,
Gembloux, Belgium.
Zoro Bi, I., A. Maquet, and J. P. Baudoin. 2003. Population genetic structure of wild
Phaseolus lunatus (Fabaceae), with special reference to population sizes. Am. J. Bot.
90:897–904.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 5

POTENTIAL IMPACT OF BIOLOGICAL NITROGEN

FIXATION AND ORGANIC FERTILIZATION
ON CORN GROWTH AND YIELD
IN LOW EXTERNAL INPUT SYSTEMS

Márcia do Vale Barreto Figueiredo1, Mario de Andrade Lira Junior2,

Arminda Saconi Messias3 and Rômulo Simões Cezar Menezes4

ABSTRACT
Maize productivity in tropical low external input systems is usually limited by low
soil fertility because crop uptake leads to a gradual depletion of soil nutrient stocks. Since
the use of chemical fertilizers is infeasible or undesired, the management of the fertility of
these soils depends primarily on low-cost processes based on nutrient recycling. The main
processes that may contribute to this are 1) biological nitrogen fixation (BNF), 2) nutrient
recycling through organic fertilization using plant residues or animal manures, and 3)
where feasible, the use of industrial and/or urban waste. BNF may contribute to maize
growth and yield by direct fixation in corn, or through the use of legume plants either as
green manure or as crops in rotation or intercropped with corn. Either way, BNF can
usually be considered sustainable long term, and usually would be one of the preferred
nitrogen sources for low external input corn production systems. Since almost all soil
nitrogen is derived from the atmosphere, in the absence of substantial use of nitrogen

1
Biologist, PhD. Research Fellow of National Research and Technological Development, Brazil. Agronomical
Institute of Pernambuco IPA/CARH, 1371, Gen. San Martin Avenue, Recife, PE, Brazil, 50761-000. E-mail:
marcia@ipa.br
2
Agronomist, PhD. Research Fellow of National Research and Technological Development, Brazil. Federal
Agricultural University of Pernambuco, Agronomy Department. UFRPE/DEPA, s/n D. Manoel de Medeiros St,
Recife, PE, Brazil. 52171-900. E-mail: mario.lira@depa.ufrpe.br
3
Chemical engineer, PhD. Pèrnambuco Catholic University. UNICAP, 526 Principe st, Recife, PE, Brazil, 50050-
900. E-mail: saconi@unicap.br
4
Agronomist, PhD. Research Fellow of National Research and Technological Development, Brazil. Federal
University of Pernambuco, Nuclear Energy Department. UFPE/DEN, 1000 Professor Luis Freire Av., Recife,
PE, Brazil, 50740-540. E-mail: rmenezes@ufpe.br
228 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

fertilizer most of the remaining nitrogen pool is a product of BNF, either recent or past.
The main difference between on-field BNF and use of plant residues and animal manures
is that nitrogen is previously fixed or obtained from the soil pool on another field and later
taken to the corn field. At the same time, nutrient recycling through organic fertilization is
usually limited due to the low amounts of organic matter available for this use, especially
considering the concurrent demands for this material. Therefore, the efficient use of the
different types of organic matter used as fertilizer requires knowledge about its quality and
patterns of decomposition in order to guarantee synchronization between nutrient supply
and crop demand. Finally, the third approach in these systems centers on the use of urban
waste, most usually compost or sewage sludge, or industrial by-products. Some of these
may be quite rich in several nutrients at the same time, but usually require careful
investigation into possible negative effects of items such as heavy metals and pathogens.
We review information regarding BNF directly on corn, in green manure or crop rotations
involving this culture; strategies to improve the amount and quality of organic fertilizers
produced in low input systems; and some possible alternatives of urban or industrial by-
products, describing the current rationale to supply nutrients to maize crops at a low cost
using the resources available within the agroecosystems.

Keywords: BNF, legume, green manure, sludge, compost

1. INTRODUCTION
Corn (Zea mays) is a major user of synthetic nitrogen fertilizer; therefore if Biological
Nitrogen Fixation (BNF) in corn is successful, there could be far-reaching economic
consequences (Halbrendt and Blase, 1989). With the current cost of fertilizer approaching half
the total variable cost of producing corn, the potential savings could be substantial if BNF is
developed and adopted (Mendonça et al., 2006). By definition, BNF is synonymous with
sustainability. This process offers an economically attractive and ecologically sound means of
reducing external nitrogen input and improving the quality and quantity of internal resources
(Saikia and Jain, 2007). Clearly, it is not realistic to consider sustainable agriculture on a broad
scale in the absence of BNF.
Some cereal crops of commercial importance like corn, rice, wheat, and millets are found
to have association with microorganisms that are capable of assimilating atmospheric nitrogen
(Döbereiner and Boddey, 1981; Okon and Kapulnik, 1986; Baldani et al., 1986; Urquiaga et
al., 1992; Chelius and Triplett, 2001; Riggs et al., 2001; Boddey et al., 2003; Tejera et al.,
2006; Barassi et al., 2007; Herridge et al., 2008). Corn yields have also risen steadily, largely
because of use of the hybrids and increased input of fertilizer nitrogen. To accommodate the
world’s expanding population, which is projected to double by 2050, an ever-increasing
production of food crops will be necessary. This must be achieved primarily by increasing the
productivity of currently farmed areas, since suitable new land is very limited. An obvious
goal of BNF research is to find ways to enable the major cereal crops to utilize BNF directly as
a partial or major source of their nitrogen needs (Raymond et al., 2004).
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 229

2. BIOLOGICAL NITROGEN FIXATION (BNF)

BNF is the process by which the bulk of the atmospheric nitrogen has been incorporated
into living matter throughout the evolution of our planet. Even today, this process is the main
pathway of nitrogen incorporation to the ecosystem, which is constantly recycled into the
atmosphere primarily by the action of organisms’ decomposition of soil organic matter.
Therefore, the action of microorganism nitrogen fixers and denitrification warrants an
inexhaustible reservoir of nitrogen in the atmosphere. In addition to ensuring an ecosystem in
balance, a reduction in the application of excessive doses of nitrogen compounds such as
nitrate, which contaminates water and plants consumed by humans, enables the development
of less aggressive agriculture in the environment. The estimate is that the contribution of
biologically fixed nitrogen ranges from 139 to 170.106 tons of nitrogen a year, at least double
the chemical fixation (Peoples and Craswell, 1992).
The microorganisms that promote the BFN have great importance, since this element is an
essential component of proteins, nucleic acids and other nitrogen compounds, and therefore of
life for all living beings (Döbereiner, 1997). Under optimal conditions in an ecosystem the
microbiota are in balance in the soil, maintaining its biodiversity and sustainability, but this
balance can easily be broken by humans or by natural phenomena (Döbereiner, 1992). Even
though the greatest contributions of BNF has been detected in oceans and leguminous plants,
some plants of the family Gramineae have shown a very significant potential in obtaining
nitrogen by the action of nitrogen fixing bacteria (Baldani et al., 2002; Alves et al., 2006).
These plants have a fascicule root system, taking advantage of the leguminous’ pivoting
system to extract water and soil nutrients, and because they are widely used as food by
humans. Therefore, even if only part of N could be provided by association with fixing
bacteria, the economy in nitrogen fertilizers would be equal to or higher than that observed
with leguminous plants that can be self-sufficient in nitrogen (Döbereiner, 1992; Boddey et al.,
2003).
Undoubtedly, after carbon, oxygen and hydrogen, nitrogen is quantitatively the most
important element required by plants and animals for growth both in water and on land,
reaching about 1.5% of the dry weight of innumerable agricultural crops (Van Loon and
Duffy, 2001). So, this was one of the nutrients that most contributed to the so-called Green
Revolution. Its indiscriminate use has led to environmental problems (Bouchard et al., 1992).
Some of the adverse environmental effects of excessive use of nitrogenous fertilizers are the
following: (i) metheamoglobinemia in infants due to NO3 and NO2 in water and food; (ii)
cancer due to secondary amines; (iii) respiratory illness due to NO3, aerosols, NO2 and HNO3;
(iv) eutrophication due to N in surface water; (v) material and ecosystem damage due to HNO3
in rainwater; (vi) plant toxicity due to high levels of NO2 and NH4 in soils; and (vii) excessive
plant growth due to more available N and depletion of stratospheric ozone due to NO and N2O
(Saikia and Jain, 2007).
In tropical countries, 40% of the costs of maize cultivation, for instance, are committed to
the purchase of mineral nitrogen (Majerowicz et al., 2002). Overall, cereal cultivation
consumes 60% of the total nitrogen fertilizer used in the world. However, on average, only
33% of all N applied is recovered in the grains, promoting the loss of $15.9 billion in 1999
(Raun et al., 2002). Questions like these encourage the creation of technologies that reduce the
excessive amount of fertilizer applied. The study of efficiency in the use of N allows multiple
230 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

methods from the simplest, based on the mere reduction of doses of fertilizers, to productive
levels, even those based on genetic improvement able to set up productive plants in poor N
soils. On the physiological—i.e., molecular—level, the study of the acquisition and use of N
should be linked to the understanding of absorption, assimilation and redistribution of this
nutrient in cell, along with its balance between storage and use in cellular and whole plant
biology (Majerowicz et al., 2002).
Even now, new methods for its use are intensely studied. The quest for greater efficiency
in its use, through recognition of biochemical and molecular pathways of absorption and
assimilation in plants, as well as the agroecological methods, such as the BNF, are proposals to
allow the sustainable use of this material without production loss (Traore and Maranville,
1999; Pradella et al., 2001).
A number of reviews of plant-associated N2 fixation have clearly highlighted the many
methodological problems and inconsistencies in the published studies (Boddey, 1987; Chalk,
1991; Giller, 2001; Giller and Merckx, 2003). One of the key problems is distinguishing
between inputs of N by free-living and associative agents and other external sources of N
contributing to agricultural soils, e.g., N in rainfall and dry deposition (Herridge et al., 2008).
Such inputs can represent 3–50 kg N/ha/year (McNeill and Unkovich 2007). Roper and Ladha
(1995) concluded that the free-living, heterotrophic bacteria may fix significant amounts of N
in agricultural systems, using crop residues as an energy source.

2.1. Diazotrophic Bacteria

The diazotrophic bacteria occupy separate niches, and may be free-living, symbiotic or
associative. BNF was first described in diazotrophic bacteria from the rhizosphere and
rizoplane of a wide variety of non-leguminous plants (Döbereiner,1992; Boddey et al., 2003).
Common diazotrophs found in the rhizosphere of maize are Enterobacter spp., Rahnella
aquatilis, Paenibacillus azotofixans, Azospirillum spp., Herbaspirillum seropedicae, Bacillus
circulans and Klebsiella sp. (Chelius and Triplett, 2001).
The positive effects of Azospirillum on maize growth are mainly derived from
physiological changes of the inoculated plant roots, which enhance water and mineral nutrient
uptake (Okon and Kapulnik, 1986; Barassi et al., 2007). Both A. brasiliense and A. irakense
are used as inoculant biofertilizers for maize. Others species of Azospirillum capable of
increasing the yield of maize are A. lipoferum and A. indigens, and Azorhizobium caulinodans
was also capable of giving such beneficial effects (Riggs et al., 2001). The magnitude of this
increase varie with the Azospirillum strain and maize cultivar and depending on soil
conditions.
Cereals of economic importance, such as corn, sugar cane, rice, wheat, sorghum, and some
fodder were identified with hosts of different species of endophytic diazotrophic bacteria.
Among endophytic diazotrophic are: Gluconacetobacter diazotrophicus (Cavalcante and
Döbereiner, 1988; Boddey et al., 2003), Azoarcus spp. (Reinhold-Hurek et al., 1993),
Herbaspirillum seropedicae (Baldani et al., 1986; James, 2000), Herbaspirillum
rubrisubalbicans (Baldani, 1996; Gillis et al., 1991), Burkholderia spp. (Baldani et al., 1997)
and H. lusitanum (Valverde et al., 2003).
Initially the endophytic microorganisms were considered harmless to plants, but from the
1970s its importance to the plants began to be observed (Azevedo et al., 2002). There are
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 231

several positive effects attributed to endophytic bacteria, such as the promotion of plant growth
(Okon and Labandera- Gonzalez, 1994; Okon and Itz1gsohn, 1995; Raja et al., 2006),
biological control of pests and diseases in plants (Mariano et al., 2004), biological nitrogen
fixation (Döbereiner and Boddey, 1981; Downing et al., 2000; Verma et al., 2004; Reis Junior
et al., 2008), induction of systemic resistance (Hallmann et al., 1997), production of
siderophores (Burd et al., 1998; Wenbo et al., 2001) and production of antibiotics (Strobel and
Daisy, 2003).
The promotion of plant growth occurs mainly by the production of phytohormones as
auxins, cytokinins, gibberellins, abscise acid and ethylene by the endophytic bacteria. The
production of these phytohormones has been reported in bacteria as Gluconoacetobacter,
Azospirillum, Herbaspirillum, Erwinia, Pseudomonas and Pantoea (Kuklinsky-Sobral et al.,
2004). The indoleacetic acid is a naturally occurring important auxin that causes physiological
effects on the plant, such as increased growth (Lambrecht et al., 2000; Nefedieve, 2003;
Figueiredo et al., 2008).
The association of cereals and grasses with endophytic diazotrophic bacteria may
represent one of the most promising alternatives for the promotion of plant growth, soil
management and environmental quality since bacteria are able to promote growth, increase
disease resistance, through biological fixation of nitrogen or the phytohormones production
(Thuler et al., 2003; Bashan et al., 2004). In addition, diazotrophic endophytic may present
advantages in relation to diazotrophic associated with roots once they are better located to
explore the carbon sources released by plants and these bacteria have been isolated from
several grasses species (Riggs et al., 2001; Tejera et al., 2006).
There is a great interest in characterizing the diversity of these microorganisms in order to
use their potential in different cultures, especially the corn, where a wide diversity of
diazotrophic has been found colonizing this plant (Baldani et al., 1997; Chelius and Triplett,
2001; Pitnner et al., 2007). In general, studies on diversity are based on cultivation techniques
and subsequent characterization of isolates. However, the cultivation of microorganisms
provides limited information about diversity since most existing organisms is not easily
isolated by conventional cultivation techniques. Techniques of Random Amplified
Polimorphic RAPD-DNA, Polymerase chain reaction-BOX-PCR, Amplified Fragment Length
Polymorphism-AFLP and Amplified ribosomal DNA Restriction Analysis-ARDRA are
applied in assessing the diversity of microbial community cultured. The application of
independent cultivation techniques such as Denaturing Gradient Gel Electrophoresis-DGGE,
the construction and analysis of clone libraries and qPCR real time quantitative are applied to
the study of microbial communities (Andreote et al., 2008). For evaluation of BFN diversity in
different ecosystems, universal primers have been used to amplify the gene nifH through
techniques of independent cultivation (Bashan et al., 2004). Such techniques make possible to
obtain a more complete characterization of the diazotrophic community than dependent
techniques of cultivation (Roesch et al., 2007).
232 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

2.2. Plant Growth-Promoting Rhizobacteria (PGPR) Increase

Crop Performance

The mechanisms by which PGPR increase crop performance is not well understood. There
are several inoculants currently commercialized that seem to promote growth through at least
one mechanism; suppression of plant disease (termed Bioprotectants), improved nutrient
acquisition (termed Biofertilizers), or phytohormone production (termed Biostimulants).
Inoculant development has been most successful to deliver biological control agents of plant
disease, that is organisms capable of killing other organisms pathogenic or disease causing to
crops (Tenuta, 2003).

Table 1. Biology, and potential role of some diazotrophs promoting crop production
(adapted by Kennedy et al., 2004)

Condition Mechanism
Diazotrophs Habitat Energy source References
for BNF of effect

Azotobacter
Aerobic Rhizozphere Organics in soil BNF Kennedy and Tchan (1992)
chroococcum

Clostridium spp. Anaerobic Soil saprophyte Organics in soil BNF Kennedy and Tchan (1992)

Rhizozphere,
mildly Organics in soil, Reinhold and Hurek (1998)
Azospirillum spp. Microaerobic endophytic in root exudates and BNF, PGP Mirza et al. (2000)
roots, stems plant tissue Okon and Kapulnik (1986)
and leaves
Herbaspirillum Endophytic,
Microaerobic Root exudates BNF, PGP Baldani et al. (1986, 2000)
seropedicae Rhizozphere
Hurek et al. (1994)
Azoarcus sp. Microaerobic Endophytic Root exudates BNF
Reinhold-Hurek et al. (1993)
Burkholderia Rhizozphere, Organics in soil
— BNF, PGP Baldani et al., (1997, 2000)
vietnamiensis Endophytic, and root exudates
Rhizobium
Endophytic in Yanni et al. (1997)
leguminosarum bv — Root exudates PGP
roots Biswas et al. (2000)
phaseoli
Rhizobium etli bv Endophytic in Guitiérrez-Zamora (2001)
— Root exudates PGP
phaseoli roots Martínez-Romero (2001)
Endophytic in
A. caulinodans Microaerobic Root exudates PGP Matthews et al. (2001)
roots
Endophytic in
Glucanoacetobacter Root exudates Baldani et al., (1997)
Microaerobic roots, stems BNF
diazotrophicus and plant tissue Boddey et al., (1991)
and leaves
*
BFN, Biological nitrogen fixation; PGP, plant growth promoting.

BNF by associative diazotrophic bacteria is a spontaneous process where soil N is limited

and adequate C sources are available. Yet the ability of these bacteria to contribute to yields in
crops is only partly a result of BNF. A range of diazotrophic plant growth-promoting
rhizobacteria participate in interactions with C3 and C4 crop plants (e.g. rice, wheat, maize,
sugarcane and cotton), significantly increasing their vegetative growth and grain yield. The
mechanisms involved have a significant plant growth-promoting potential, retaining more soil
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 233

organic-N and other nutrients in the plant–soil system, thus reducing the need for fertilizer N
and P. Table 1 suggests that the diversity of habitat and effectiveness might logically require
more than one bacterial strain to obtain the maximum biological effects on plant growth are
summarized indicating the proposed mechanisms of PGP (plant growth promoting ) effects
(Kennedy, et al., 2004).
According to Kennedy et al. (2004), this diversity will need to be carefully considered in
the future design of the most efficient inoculant biofertilisers. For example, an important
question is whether inoculants should be restricted to a single strain of bacterium, such as
Azospirillum, or not. If all of the PGP mechanisms can be well expressed in a single strain of
bacterium this would simplify the design of inoculant products. However, it would be unlikely
that a single strain of bacterium would be capable of optimal activity.

3. LEGUME NITROGEN FIXATION

Another approach to biological nitrogen fixation used with corn is the inclusion of
legumes as part of the cropping system, most commonly as grain crops or green manures.
The widespread knowledge, and even to a large degree “faith” , that legumes always
improve soil nutritional status has historically led most farmers to include legume in the
cropping systems, either directly or indirectly through fallow periods (Van Kessel and
Roskoski, 1988; Gathumbi et al., 2002; P hoomthaisong et al., 2003; Sanginga, 2003; Sanginga
et al., 2003; Okito et al., 2004).

3.1. Crop Rotations

Legume crops are a key component of most traditional tropical cropping systems (Van
Kessel and Roskoski, 1988; Peoples et al., 1995; Sanginga, 2003), either cultivated at the same
time as the main commercial crop, which would most frequently be corn, sorghum or millet
(Anthofer, 2005; Fan et al., 2006; Okogun et al., 2007), depending on the region, or in
sequential cropping on the same field, which is usually the preferred solution for current
commercial cropping due to easier management (Goss et al., 2002; Smith et al., 2008).
Some of the results achieved with the use of a legume crop in the production system can
be shown as examples. For instance Fan et al. (2006) have found that when corn and faba bean
(Vicia faba) were intercropped in Northern China, corn yield was not significantly different
from the achieved by corn single-cropped which did not receive nitrogen fertilizer, and slightly
lower than what corn would yield if nitrogen fertilizer was used (12.04 t.ha-1 for the intercrop,
and 13.31 t.ha-1 for single corn), but this difference was not significant. In another paper,
yields in plots previously sown to soybean were significantly larger than yields in the fallow
plots, with averages of about 3 t.ha-1 and 0.5 t.ha-1, respectively (Osunde et al., 2003).
Under either of the approaches, although common sense indicates that there is always a
gain in soil fertility due to the inclusion of the legume crop, this frequently is not the case with
modern cultivars (Singh et al., 2003). This happens because these cultivars may achieve higher
nitrogen harvest indexes than the total nitrogen fixation. This possible negative nitrogen
balance may be the main responsible for the huge variation in results from the several papers
234 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

dealing with the effect of inclusion of legume crops in the cropping system (Gentry et al.,
2001; Tilman et al., 2002; Fortuna et al., 2003; Rosolem et al., 2004; Robertson et al., 2005;
Smith et al., 2008).
Besides leaving crop residues on the field, which would usually be the recommended
practice for reasons besides nitrogen balance, such as weed control, reduction of soil loss
through erosion and of superficial soil temperature (Oliveira et al., 2002; Cabezas, 2004;
Balkcom and Reeves, 2005; Silva, 2006), other manageable aspects of the legume crop that
allow a positive nitrogen yield for the following crop would be selection of legume cultivars
with longer growth period, lower nitrogen harvest indexes or higher nitrogen fixation potential.
Increasing growing period for the legume in the system will usually allow larger biomass
accumulation with all of the above-mentioned advantages, and may be applied both for cover
and grain legume crops (Anthofer, 2005; Fan et al., 2006; Chikoye et al., 2008). On the other
hand, it may be interesting when the pulse crop is grown on alternate years on the same plot
with corn, as is usually the case on the corn-soybean rotation, very common on some of the
main soybean growing regions of the world, such as Brazil and the United States. The corn-
soybean rotation is probably the most important cereal-legume rotation in large scale intensive
agriculture, since both crops are major commodities. Since both are also important potential
sources for biofuels, respectively ethanol under current American practice, and biodiesel an
increase in area under cultivation is predicted for both (Salvagiotti et al., 2008).
The importance of the possibly negative nitrogen balance in legume crops such as soybean
may be observed in Salvagiotti et al. (2008). These authors have examined 637 data sets (site-
year-treatment combinations) from field studies that had examined nitrogen balance data and
had been published in refereed journals from 1966 to 2006. In most situations they found that
the amount of N fixed was not sufficient to replace N export from the field in harvested seed.
The partial N balance (fixed N in aboveground biomass - N in seeds) was negative in 80% of
all data sets, with a mean net soil N mining of -40 kg N.ha-1. However, when an average
estimated belowground N contribution of 24% of total plant N was included, the average N
balance was close to neutral (-4 kg N.ha-1). This gap between crop N uptake and N supplied by
BNF tended to increase at higher seed yields for which the associated crop N demand is higher
On the other hand, as long as NHI is lower than the nitrogen obtained from biological
nitrogen fixation, nitrogen export through seeds would be lower than nitrogen fixation, and
there would be a net increase of available soil nitrogen (Phoomthaisong et al., 2003;.Singh et
al., 2003; Alves et al., 2006). This increase in nitrogen fixation is one of the main aims of most
soil microbiologists currently working hand in hand with the legume inoculants’ industry
(Date, 2000; Graham and Vance, 2000; Catroux et al., 2001; Hardarson and Atkins, 2003;
Deaker et al., 2005; McInnes et al., 2005). There are strong indications for some of the crops
commonly used in rotation with corn that another feasible approach is cultivar selection for
higher nitrogen fixation potential (Tsai et al., 1998; Hardarson and Atkins, 2003; Bouton,
2007).
While the results for inclusion of legume green manures on the nitrogen balance are more
positively consistent than those for legume crops, this practice has not achieved the same
degree of grower adoption as the former (Chikowo et al., 2004; Anthofer, 2005; Crews and
Peoples, 2005; Musiyiwa et al., 2005; Shelton et al., 2005; Rufino et al., 2006; Ojiem et al.,
2007).
A recent paper (Tonitto et al., 2006) discusses 36 papers on the effect of the inclusion of
legumes as green manure in North American cropping systems, of which 28 had corn as the
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 235

main crop. The authors conclude that in half of the 228 individual experiments the legume
green manure resulted in a net input of 50 to 150 kg of N.ha-1. They also conclude that with
that level of biological nitrogen input there was usually no significant difference on yield
between conventionally managed systems and legume based ones. They also conclude that if
fixed nitrogen was higher than 180 kg of N.ha-1 there was usually a 5% gain on crop yield,
while if input was below 110 kg of N.ha-1 the expected result would be loss of yield. These
results were achieved with loss of a growing season, since all experiments included only short
season green manure crops.
In another paper, a field experiment was conducted in Michigan, USA, studying how corn
was affected by inclusion of crop rotation with soybean and/or short season legume green
manures (Smith et al., 2008). The experimental design was unique in that no fertilizer or
pesticides were used, and the only management variable manipulated was number of species in
the rotation, thus providing a strong comparison to grassland diversity-ecosystem function
experiments. Corn grain yield increased linearly in response to the number of crops in the
rotation, with yields in the treatment with corn, soybean and winter wheat as crops and red or
crimson clovers and rye as short season cover crops were over 100% higher than in continuous
monoculture. Most importantly, the yields were not significantly different from the county
average for each of the 3 years despite the absence of chemical inputs.
An important point concerning use of green manures is that it is highly knowledge
dependent, since it must be highly environmentally adapted, or it won’t achieve the expected
result. Although low formal education levels are widespread among developing world farmers,
usually they have high level knowledge of their farming environment. Both of these aspects
indicate that green manure research should ideally be conducted under field conditions,
preferably with farmer management at least on final research stages (Jensen and Hauggaard-
Nielsen, 2003; Chikowo et al., 2004;Crews and Peoples, 2005; Mapfumo et al., 2005).

4. USE OF SEWAGE SLUDGE ON MAIZE CULTIVATION

Sewage sludge (SS), or pie, is waste of urban and/or industrial origin which results from
the treatment of effluents, presenting highly variable composition. The differences vary with
the type of process employed (primary, raw sludge produced in primary decanters; activated
sludge, produced in biological reactors and, digested sludge, process of biological
stabilization), with the physiographic location of Wastewater Treatment of Sewage (WTS)
(which reflects the dietary habits of the population), with the balance of nutrients from food
consumed, with a time of year and with the waste discharge (Saito, 2007; Tsutiya, 2000;
PROSAB, 1999; Vidor, 1999). According to Bettiol and Camargo (2000) depending on the
origin and the process of obtainment used, the sewage sludge presents quite variable
composition, being rich in organic matter (40 to 60%), nitrogen and some micronutrients such
as iron, copper, zinc and manganese. Typical sewage sludge contains 40 % organic matter, 4 %
of nitrogen, 2% phosphorus and 0.4% potassium.
When there is possibility of sterilization with sulfate / calcium carbonate in the process of
WTS, the resulting product becomes the biosolids. Therefore, biosolids is the name given to
the sludge resulting from the sewage treatment, with features that allow recycling in rational
and environmentally safe way. The term biosolids was created and disseminated throughout
236 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

the world to encourage the use of sewage as fertilizer and soil-conditioners (Oliveira et al.,
2005; Smith, 2005; USEPA, 1999). The urban sludge, when treated, may eliminate the
pathogenicity of viruses, bacteria, fungi, protozoa and helminthes (Barbosa et al., 2007).
However, the possible presence of pollutants such as pathogens agents and potentially toxic
elements - heavy metals are factors that may cause negative impacts, so its application requires
special care to be avoided damage to the population and the environment.
The application to soil is one of the oldest practices of final destination for sanitary sewer.
The "sewage farms", became known as the first experiments in England at the beginning of the
nineteenth century, quickly spread through Europe and the United States (Bastos, 2003). The
best known information is those from China. In the West, particularly in Prussia, irrigation
with sewage effluent was practiced since 1560. In England, around 1800, many projects were
developed for agricultural use of sewage effluent, especially due to combat cholera’s
epidemics. The adoption of the practice of using soil as means of sewage or sludge disposal
has been frequent in many countries (Nascimento et al., 2004).
The use of sewage sludge as organic fertilizer has been mentioned as an alternative to the
final destination of the waste, mainly by the predominant concentration of organic matter and
source of nutrients (Messias, 1993; Messias and Moraes, 1992; Pires, 2005; Andreoli et al.,
2004; Gadioli and Fortes Neto, 2004; Faria, 2007).
Besides the environmental and economical point of view, the use of sludge in agriculture
is advantageous once it promotes greater soil’s water holding capacity, porosity (aeration of
the roots) and aggregate stability. Also, greater resistance to erosion, residual effect usable for
subsequent crops, and possibly induce the suppression of soil to phytopatohgens (Bettiol and
Fernandes, 2004; Silva et al., 2002; Berton et al., 1997; Melo et al. 1994). The criteria for
application of SS should be based as well in soil attributes and not only in their total levels of
metals. The knowledge of how these attributes influence metals behavior is then able to show
the amount of waste that can receive the soil (Borges and Coutinho, 2004). Some inventories
were created for monitoring and managing the sludge disposal in space, including surveys of
environmental data (soil, water, geology, geomorphology and vegetation), current use of rural
and urban soil and institutional context. Gomes et al. (2001) proposed an inventory, followed
by the location of areas potentially suitable for the sludge recycling, by eliminating areas
incompatible with the necessary environmental attributes and the legislation requirements.
Therefore, it was considered the distance of water resources, urban spot, flooded areas and
land slope, among other factors. Soils’ agricultural ability was assessed from the current levels
of fertility, its ability to recover physically and chemically by organic addition, beyond the risk
of erosion of them.
Most studies have aimed to verify the effect of organic fertilizers on the yield, compared
to, in general, with complete (NPK) or incomplete mineral fertilization including corrective
soil. With rare exceptions, most studies shows effects of fertilization, both organic and
mineral, in relation to the control, but the differences between organic and mineral fertilizers
are variable, depending on the soil characteristics, doses of fertilizers, crop and study area.
According to studies performed, results expected with organic and mineral fertilization,
isolate, may be represented by a curve of quadratic type, in which production rises relative to
the dose (Malavolta, 1981). The application of organic compounds in a continuous manner
raises the nitrogen level to the point of making dispensable its application in the form of
chemical fertilizer. In poor soils, the amount of organic matter may increase considerably its
potential productivity. The efficiency of organic fertilizers to improve soil productivity
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 237

depends on several factors that should be considered: (a) quality and quantity of application,
(b) ages and conditions of use; (c) methods of implementation; (d) the adequacy to farming
systems prevailing in the region, (e) and, especially, the relative cost of their use.
Daros et al. (1993) verified residual effect of N and P in soil sludge-fertilized in the
production of millet with subsequent associated cultivation of oats and vetch. Mazzarino et al.
(1998) state that the release of P by sludge depends on the soil type and origin of the residue.
Silva et al. (2002) corroborated that the sludge used presented 25 % more efficiency than the
triple superphosphate as phosphorus source for corn. The application of increasing doses of
sewage sludge promoted decrease in pH and increase in levels of organic matter, total N, P, K,
Na, Ca and Mg in soils with crops of maize and beans, however dry material of both crops was
lower than that obtained by complete mineral fertilization (Nascimento et al., 2004). Galdo et
al. (2004) and Tsadilas et al. (1995) observed higher grains yield in maize cultivation, with
application of sewage sludge, as well as Cripps et al. (1992) found grains yield 47 % higher
with application of sewage sludge in comparison with conventional fertilization. Silva et al.
(2002) and Biscay and Miranda (1996) reported higher grain yield in relation to the control and
the NPK fertilizer for three years, after sludge application, demonstrating its residual effect.
Some authors showed an increase in levels of Cd and Cu (Logan et al., 1997; Favaretto, 1997;
Pierrisnard, 1996; Al-Jaloud et al., 1995; Reddy et al., 1989, Ritter and Eastburn, 1978), Cr, Ni
and Zn in corn, beans and sorghum, with increase in the doses of sewage sludge application
from 40.5 t ha-1 (Boaretto et al., 1992; Oliveira, 1995; Angels and Mattiazzo, 2000).
The absorption of large quantities of Zn by plants in treatments with sewage sludge
considered above the adequate range for the cultivation of corn, according to Malavolta et al.
(1989), may have caused lower productivity of this treatment. The application of increasing
doses (10, 20, 30, 40 and 60 t.ha-1) of sewage sludge promoted decrease in pH and increase in
levels of organic matter, N, P, K, Na, Ca and Mg in crops of maize and beans, however dry
matter of both cultures was lower than that obtained by mineral fertilization (Nascimento et al.,
2004). Maize’s dry matter production increased with the dose of sludge in the presence or
absence of potassium (Simonete et al., 2003; Simonete and Kiehl, 2002; Simonete, 2001;
Berton et al., 1989). Gomes et al., (2007), to evaluate the chemical changes in soil caused by
the addition of sewage sludge, installed an experiment with corn in the field conditions, in
Yellow Argisol, which consisted of six treatments (0; 7.7; 15.4; 29.7; 45.1 and 60.5 t. ha-1).
The production of grains increased depending on the doses of sewage sludge up to the
application of 26 t. ha-1 which provided the maximum agronomic efficiency for the corn
production. The sludge dose of maximum agronomic efficiency was effective at raising the
levels of Ca, Mg, Cu, Mn and Zn in the leaves of maize to nutritionally adequate
concentrations. Although the levels of N and Fe in the leaf have increased depending on the
doses of sewage sludge, they were insufficient to supply the nutritional demands. The levels of
P and K in the leaves have not changed by the doses of sewage sludge. Martins et al., (2003) in
the field experiment found that the production of grains and dry weight from the shoots of
maize increased linearly with the addition of SS (0, 20, 40, 60 and 80 t/ ha) in the period from
1983 to 1987. The concentrations of metals Cu, Fe, Mn and Zn in grains were not influenced
in any significant way by the addition of SS, and even in larger doses, within the acceptable
levels, without causing restriction for human consumption.
The field experiment, aiming to evaluate the agricultural use of biosolids in corn was
installed by Melo et al., (1994) in two soil types, Latosol Purple - LR and Red-Dark - LE,
medium texture, whose treatments were: control (without application of fertilizer in the first
238 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

agricultural season and with application of mineral fertilizers in the second year), 2.5 (L1), 5.0
(L2) and 10.0 (L3) t.ha-1 of biosolids (base dried in stove). Phosphorus required by the crop
was supplemented with mineral fertilizer, considering that the whole of the P from biosolid
would be available for culture. The potassium required by plants has been applied in the form
of KCl, completing the content in the biosolids in the first year and without considering the
content of biosolids in the second agricultural season. In the first season, in which the control
received no mineral fertilizer, the highest dose of biosolids affected the production of straw in
the soil LE, not being enough to increase grain yield; in the LR soil the highest dose of
biosolids affected the production of stem + leaf and grains production in the second season, in
which the control received mineral fertilization. In the soil LE none of the variables was
affected, meaning that the dose 2.5 t.ha-1 biosolids provided to the culture performance
comparable to that of mineral fertilizer, in the soil LR the highest dose of biosolids affected the
production of stem + leaves and the grains production, which were higher than in the control
treatment. Similar experiments were conducted by Rodrigues et al., (2006) and Barbosa et al.,
(2007).

5. THE USE OF PLANT RESIDUES

AND ANIMAL MANURE AS FERTILIZERS

The use of manure and plant residues as organic fertilizers may lead to beneficial effects
besides the addition of nutrients. First of all, the incorporation of organic residues increases the
levels of soil organic matter (SOM), which is vital for having a good growth media as it will
improve soil structure, water-holding capacity, increase microbial biomass and soil fauna, and
is essential to the cycling of nutrients. Also, a high content of organic material in the soil will
enhance soil aggregation and help decrease runoff and erosion. (Goulding et al, 2001; Weil
and Magdoff, 2004). However, in many areas of the world the use of organic fertilizers is often
limited both by the relatively low amounts of these materials normally available within farms
and also by the cost of purchasing these fertilizers from off-farm sources (Sanchez, 1995). For
these reasons, managing the fertility of soils in low external input systems requires detailed
knowledge about SOM and nutrient cycling in order to improve the use efficiency of organic
fertilizers and, in its turn, improve income generation while preserving the quality of the soils
and other natural resources.
However, there is limited information regarding the use of organic residues to ameliorate
soil fertility in low external input systems. For example, very little is known about the
relationships between the quality of residues and their effects on soil nutrient availability
(Palm et al., 2001a, 2001b: Vanlauwe, 2005). As mentioned previously in this chapter, these
relationships require site-specific information that may be very important to the success of the
fertilization strategy. For example, animal manure is one of the most common organic
fertilizers used in many areas of the world. However, the manure available is often of very low
quality and, therefore, may mineralize low amounts, or even immobilize, nitrogen (Silva and
Menezes, 2007; Menezes and Salcedo, 2007). In order to increase N supply to crops, many
studies have proposed the use of other organic amendments, such as green manures or cover
crops using legume species (Palm et al., 1997; Marin et al., 2007; Silva et al., 2007; Holmes,
1998). Other studies have investigated management options to optimize the use of organic
residues, such as mixing residues of different qualities, applying residues in the surface or
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 239

incorporated, or applying residues at different moments of the cropping cycling, among others.
In this section, we present some of these studies and discuss the strategies to optimize the use
of animal and green manures to improve maize crops within low external input systems.

5.1. Synchronization between Soil Nutrient Supply and Plant Demand

Overall, most fertilization strategies have a common goal, which is to achieve the best
possible synchronization between soil nutrient supply and plant demand, as explained by the
‘synchrony’ concept (Myers et al., 1994), with the goal of minimizing losses and increasing
the use efficiency of nutrient within agroecosystems (Mundus et al., 2008). Many experiments
have demonstrated that N use efficiency when applying fertilizers or crop residues may vary
greatly, ranging from 5 to 74%, depending on the material and the location (Ibewiro et al.,
2000; Mubarak et al., 2003; Myers et al., 1997; Palm, 1995; Sisworo, 1990).
These questions are very relevant for the production of maize, since nutrient requirements
for optimal maize growth can be demanding, given that this crop has potentially high yields
and that nutrient uptake is directly related to dry matter production (Fageria et al., 1991). The
actual amounts of maize nutrient uptake will vary among locations depending on productivity.
In tropical countries, for instance, national averages of maize yield may range from just above
1 t ha-1 until up to 5-10 t ha-1, while in many sub-tropical or temperate regions this may be over
20 t ha-1 (Fisher and Palmer, 1983; Norman et al., 1995). However, nutrient demand is not
uniform throughout the whole life cycle of the maize plant. The actual amount of nutrients
taken up is generally largest in the period near tasseling and silking and then again later during
the grain filling period, peaking from 6 to 9 weeks after germination (Karlen et al., 1988).
Similarly, Haggar et al., (1993) found maize N uptake to be highest in the period from 30 to 60
days after planting.
There are several ways of improving synchrony between maize demand and soil nitrogen
supply, such as controlling the date of planting, the length of crop growth, or using different
crops in a form of multiple cropping systems. Alternatively it is also possible to affect the
release and availability of nutrients to the plants by managing the time of application and the
quality of organic inputs, such as manure and crop residues (Mundus et al., 2008). However, as
mentioned previously, the adoption of these management options requires detailed knowledge
of the relationships between organic fertilizer quality and decomposition.

5.2. Relationships between Organic Fertilizer Quality and N Mineralization

The quality of organic residues available for use as fertilizers may vary greatly and this
may affect significantly the patterns of N release to the soil. Basically, materials with a slow
decomposition rate and limited release of nutrients are considered as low quality, while high
quality materials are more labile, i.e., release nutrients quickly. The addition of materials of
different qualities have significant impacts on the build-up of SOM, since more recalcitrant
material will be more likely to form stable complexes and increase SOM, while fast
decomposing material will do little for the maintenance and build-up of SOM (Giller, 2001;
Nyberg et al., 2002; Palm et al., 2001).
240 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

Traditionally, factors such as the C:N ratio (Mafongoya et al., 2000) as well as the initial
N content (Constantinides and Fownes, 1994) of organic fertilizers were regarded as good
indicators of fertilizer quality. However, there is consistent evidence that the contents of lignin
and polyphenols in relation to N are better indicators of decomposition rate for many organic
residues, particularly plant biomass used as green manure. The (lignin+polyphenol):N ratio
have repeatedly been found to correlate well with the rate of decomposition (Constantinides
and Fownes, 1994; Handayanto et al., 1994; Hartemink and O’Sullivan, 2001; Mafongoya et
al., 1998; Mafongoya et al. 2000; Palm 1995). On the other hand, Lehmann et al. (1995),
Oglesby and Fownes (1992) and Palm and Sanchez (1991) found that the polyphenol:N ratio
gave the best correlation. The reason for this is related to the fact that polyphenols can form
complexes with proteins (which contain N, P and S) that are resistant to degradation from most
decomposing organisms. In a similar way lignin is also capable of complexing with
carbohydrates and N and thereby slowing down degradation (Berg and McClaugherty, 2003;
Handayanto et al., 1994).
In practice, the discussion about fertilizer quality and nitrogen availability is of great
relevance. For example, even though animal manure is widely used as organic fertilizer, its
effects on soil may be highly variable but, in general, will lead to an immediate immobilization
of N (Calderón et al., 2005; Lupwayi and Haque, 1999; Kirchmann, 1991; Nyamangara et al.,
1999). This immobilization is mainly due to a much higher C:N ratio in the manure as
compared to that found in most leguminous green manures (Lupwayi and Haque, 1999). Many
studies have reported depletion of soil N after manure application (Menezes and Salcedo,
2007; Silva et al., 2007; Mafongoya et al., 2000). However, it is important to remember that
even though application of manure may lead to immobilization there will still be some benefits
(Coulter, 1998; Kapkiyai et al., 1999), such as the addition of other nutrients like P, K and
trace elements that may limit plant productivity in some systems. Besides, since manure is less
prone to degradation, it will stay longer in the soil and experiments have shown that
applications of manure will lead to a build up of SOM (Kapkiyai et al., 1999; Nyamangara et
al., 2001).
In contrast, the use of legume prunings as green manure may lead to fast decomposition
and N release, which may bring benefits to maize when well managed. For example, Mundus
et al., (2008) found that Gliricidia sepium prunings decomposed twice as fast as cattle manure
after incorporated to the soil. Additionally, Cadish et al., (1998) found that treatments with 11
materials that led to a large immediate N release continued to provide greater benefits to the
maize plants in later growth stages, compared to materials that released very little N
immediately after application. The immediate N mineralization was thus more important than
the possible release later in the cropping cycle (Cadish et al., 1998).
However, it is important to mention that, if slow decomposition of organic fertilizers may
cause nutrient limitations to crops, there are also some problems when decomposition happens
too fast. For example, many studies have reported that fertilization with fast decomposition
legumes used as green manures can cause leaching losses when applied at planting, when the
crop is unable to take up all the released N (Chirwa et al., 2006; Hagedorn et al., 1997;
Lehmann et al., 1995; Zaharah and Bah, 1999). Peinetti et al., (2008) found that the excess of
water in years with high precipitation events may reduce maize productivity due to nitrogen
leaching to deeper soil layers after the fertilization with gliricídia prunings. Hasegawa and
Denison (2005) also observed significant increases in N leaching when increasing the rate of
legume cover crop incorporated to the soil.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 241

Other reported strategies to improve the synchronization between nutrient availability and
plant demand are the mixture of high and low-quality material (Chirwa et al., 2006;
Handayanto et al., 1997); the splitting of the application of materials into several minor
applications (Hagedorn et al., 1997; Schroth et al., 1992); or the application of the materials
the on the soil surface, instead of incorporating it. The strategy of mixing low and high-quality
materials might to some degree help solve the N immobilization or leaching problems as
sometimes seen early in the maize growing period. However, this may not be enough to solve
the problem of the extra N requirement later in the growth period (Palm et al., 2001).
Mafongoya et al., (1997) found that mixtures of high and low quality prunings did not behave
as simple additions of the two materials. This finding was also supported by Zingore et al.,
(2003), who suggested that some of these unpredicted release patterns showed potential for
improving N synchrony.
Zaharah and Bah (1999) found that the incorporation of the fast decomposing Gliricidia
could be problematic, since much of the nutrients could be lost by leaching. These authors
suggested that split applications of the prunings would be a way of controlling the release and
thereby limiting N losses. In a related experiment, Zaharah et al. (1999) found that spilt
applications of Gliricidia 21 and 45 days after planting was more beneficial to maize crops
than applications earlier in the cropping cycle. Similarly, Mundus et al. (2008) concluded that
split applications of a mixture of low-quality animal manure with prunings of the highly labile
Gliricidia sepium led to a more synchronized N release to maize when compared to the single
application of these materials.
It is important to emphasize the usual limited availability of organic fertilizers in low
external input systems. For this reason, the fertilizers available must be efficiently used to
minimize losses (such as N leaching, denitrification or volatilization) while maximizing the
benefits to farmers and the environment. In this respect, using animal manure and the biomass
of cultivated or spontaneous plants available within farms is the main process to increase the
amount of nutrients to be used for maize fertilization. However, the management of organic
residues as fertilizers present several challenges, such as the high variability of the quality of
the materials available which, in its turn, will result in different patterns of decomposition and
nutrient release, particularly nitrogen. Since maize demand is greater during the period of
approximately four to nine weeks after planting, there is need to synchronize this demand to
high soil nutrient availability. The literature during the last decade has reported several
strategies that may improve this synchrony, such as the mixture of organic materials of
different qualities, splitting the application of the fertilizers, or even adjusting the time between
fertilizer incorporation and crop planting. However, the most relevant underlying message
from the information available regarding this theme is the importance of site-specific
information, such as the quality of the materials available, the patterns of decomposition of
these materials and the nutrient demand of the maize varieties adopted. The integration of this
information will allow the most efficient use of the available fertilizers to supply N to maize
crops.
242 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

6. CONCLUSION
Agricultural studies of soil systems have historically been directed toward the physical and
chemical aspects of crop production, with less importance given to the ecological dimension.
Currently, there is a need to develop greater knowledge of soil ecosystems, their biological
diversity and ecological functions, to build a broad basis for sustainable agricultural
development, which should rely as much as is feasible on renewable resources such as solar
energy, rain water, atmospheric nitrogen, and soil organic matter. Crop rotation, based on the
inclusion of legumes, is considered one of the most powerful management practices for
pursuing such aims because of its implications for maintaining soil fertility, saving energy and
avoiding pollution. Some other options would include the use of organic residues or sewage
sludge. One of the main characteristics observed in most of the available literature for any of
the above-mentioned approaches is the high variability observed from experiment to
experiment, indicating that studies should be conducted on-site as much as possible, including,
whenever feasible, farmer participation.
The adaptability of maize genotypes to environments where the nutrients are not readily
available can be related, among other factors, to the association with benefic microorganisms
such as diazotrophic bacteria and plant growth promoters. These microorganisms are potential
tools for sustainable agriculture and the trend for the future, and the BNF process offers an
economically attractive and ecologically sound means of reducing external nitrogen input and
improving the quality and quantity of internal resources.

REFERENCES
Alves, B. J. R., Zotarelli, L., Fernandes, F. M., Heckler, J. C., Macedo, R. A. T., Boddey, R.
M., Jantalia, C. P., and Urquiaga, S. (2006) Fixação biológica de nitrogênio e fertilizantes
nitrogenados no balanço de nitrogênio em soja, milho e algodão. Pesquisa Agropecuária
Brasileira 41, 449-456.
Alves, B. J. R et al. (2006) Fixação biológica de nitrogênio e fertilizantes nitrogenados no
balanço de nitrogênio em soja, milho e algodão. Pesquisa Agropecuária Brasileira,
Brasília, v.41, n.3, p.449-456,
Al-Jaloud, A. A.; Hussain, G.; Al-Saati, A. J. and Karimulla, S.(1995) Effect of wastewater
irrigation on mineral composition of corn and sorghum plants in a pot experiment. Journal
of Plant Nutrition, v.18, p.1677-1692.
Andreote, F.; Lacava, P.T. and Azevedo, J. L. (2008) Diversidade molecular de
microrganismos endofíticos, p.233-257, In: Figueiredo, M. V. B.; Burity, H.A.; Stamford,
N.P.; Santos, C.E.R.S. Microrganismos e Agrobiodiversidade: o novo desafio para a
agricultura. Guiaiba-RS: Agrolivros, v.1, 565 p.
Andreoli, C. V.; Sperling, M. V. and Fernandes, F. (2004) Princípios do tratamento biológico
de águas residuais. Curitiba: FCO, v.6.
Anjos, A.R.M.dos and Mattiazzo, M. E. (2000) Metais pesados em plantas de milho cultivadas
em Latossolos repetidamente tratados com biossólidos. Scientia Agrícola, Piracicaba,
v.57, n.4, p. 769-776.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 243

Anthofer, J. (2005) Above-ground biomass, nutrients, and persistence of an early and a late
maturing Mucuna variety in the Forest-Savannah Transitional Zone of Ghana.
Agriculture,-Ecosystems-and-Environment 110, 59-77.
Azevedo, J.L.; Maccheroni Junior, W.; Araújo, W. L. and Pereira, J. O. (2002)
Microrganismos endofíticos e seu papel em plantas tropicais, p.233-268. In:
Biotecnologia: avanços na agricultura e na agroindústria, p.433
Baldani, J. I; Baldani, V.L.D.; Seldin, L. and Döbereiner, J. (1986) Characterization of
Herbaspirillum seropedicae gen. nov., sp. nov., a root. International Journal Systemic
Bacteriology, v. 36, p. 86-93.
Baldani, J.I.; Caruso, L.; Baldani, V.L.D.; Goi, S.R. and Döbereiner, J. (1997) Recent
advances in BNF with non-legume plants. Soil Biology and Biochemistry, v. 29, p.911-
922.
Baldani, V.L.D. Efeito da inoculação de Herbaspirillum spp. no processo de colonização e
infecção de plantas de arroz e, ocorrência e caracterização parcial de uma nova bactéria
diazotrófica. Tese de Doutorado, UFRRJ, Itaguaí, 1996.
Baldani, V.L.D.; Oliveira, E.; Balota, E.; Baldani, J.I.; Kirchhof, G. and Döbereiner, J. (1997)
Burkholderia brasilensis sp. nov. Uma nova espécie de bactéria diazotrófica endofítica.
Anais da Academia Brasileira de Ciências, Rio de Janeiro, v.69, p.116.
Baldani, J.I.; Reis, V.M.; Teixeira, K.R.S. and Baldani, V.L.D. (2002) Biotecnologia: avanços
na agricultura e na agroindústria. Cap. potencial biotecnológica de bactérias diazotróficas
associativas e endofíticas. Caxias do Sul – RS: Educs, 433 p.
Balkcom,K.S. and Reeves,D.W. (2005) Sunn-hemp utilized as a legume cover crop for corn
production. Agronomy Journal 97, 26-31.
Barassi et al. (2007) Azospirillum spp., a Dynamic Soil Bacterium Favourable to Vegetable
Crop Production. Dynamic Soil, Dynamic Plant, v. 1(2) 68-82.
Barbosa, G.M.C.; Tavares Filho, J.; Brito, O.R. and Fonseca, I.C.B. (2007) Efeito residual do
lodo de esgoto na produtividade do milho safrinha. Revista Brasileira de Ciência do Solo, n.
31, p. 601- 605.
Bastos, R.K.X. (2003) Utilização de esgotos tratados em fertirrigação, hidroponia e
piscicultura. Programa de Pesquisa em Saneamento Básico – PROSAB. Rio de Janeiro:
ABES.
Bashan, Y. et al. (2004) Azospirillum-plant relationships: physiological, molecular,
agricultural, and environmental advances (1997–2003). Canadian Journal of
Microbiology v.50, p.521-577.
Berg B. and McClaugherty C. (2003) Plant Litter, Decomposition, Humus Formation, Carbon
Sequestration. 1st edition. Springer-Verlag, Berlin, Germany.
Berton, R.S.; Camargo, O.A. and Valadares, J.M.A.S. (1989) Absorção de nutrientes pelo
milho em resposta à adição de lodo de esgoto a cinco solos paulistas. Revista Brasileira de
Ciência do Solo, Campinas, v.13, n.1, p. 187-192.
Berton, R.S.; Valadares, J.M.A.S.; Camargo, O.A. and Bataglia, O.C. (1997) Peletização de
lodo de esgoto e adição de CaCO3 na produção de matéria seca e absorção de Zn, Cu e Ni
pelo milho em três Latossolos. Revista Brasileira de Ciência do Solo, Viçosa, v.21, p. 685-
691.
Bettiol, W. and Camargo, O.A. (2000) Impacto ambiental do uso agrícola do lodo de esgoto.
Jaguariúna, SP: EMBRAPA. 312p.
244 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

Bettiol, W. and Fernandes, S. A. P. (2004) Efeito do lodo de esgoto na comunidade microbiana

e atributos químicos do solo. Embrapa, Jaguariúna, SP.
Biscaia, R.C.M. and Miranda, G.M. (1996) Uso do lodo de esgoto calado na produção de
milho. Sanare, Curitiba, v.5, n.1, p.86-89.
Boddey, R.M. (1987) Methods for quantification of nitrogen fixation associated with
gramineae. Crit. Ver. Plant Sci., v.6, p.209–266.
Boddey, L.H. (2003) Ocorrência e diversidade de bactérias diazotróficas do gênero
Burkholderia, isoladas de cana-de-açúcar (Saccharum sp.) cultivadas na Austrália e no
Brasil. Tese Doutorado. PPG Ciência do Solo, IA, UFRRJ, 109 p.
Boddey, R. M.; Urquiaga, S.; Alves, B. J. R. and Reis, V. (2003) Endophytic nitrogen fixation
in sugarcane: present knowledge and future applications, Plant and Soil 252: 139–149.
Borges, M. R. and Coutinho, E. L. M. (2004) Metais pesados do solo após aplicação de
biossólido. I – Fracionamento. Revista Brasileira de Ciência do Solo, v.28: p.543-555.
Bouchard, D.C.; Willians, M.K. and Surampalli, R.Y. (1992) Nitrate contamination of ground
water: sources and potential health effects. Journal of the American Water Works
Association, v. 84, p. 85-90.
Bouton, J. (2007) The economic benefits of forage improvement in the United States.
Euphytica 154, 263-270.
Burd, G.I.; Dixon, D.G. and Glick, B.R. (1998) A plant growth-promoting bacterium that
decreases nickel toxicity in Seedlings. Applied and Environmental Microbiology, v. 64,
p.3663-3668.
Cabezas,W.-A.R.L., (2004) Influência da cultura antecessora e da adubação nitrogenada na
produtividade de milho em sistema plantio direto e solo preparado. Ciência Rural 34,
1005-1013.
Cadisch G., Handayanto E., Malama C., Seyni F. and Giller K.E. (1998) N recovery from
legume prunings and priming effects are governed by the residue quality. Plant and Soil
205: 125-134.
Calderón F.J., McCarty G.W. and Reeves J.B. III. (2005) Analysis of manure and soil nitrogen
mineralization during incubation. Biology and Fertility of Soils 41: 328-336.
Catroux, G., Hartmann, A., and Revellin, C. (2001) Trends in rhizobial inoculant production
and use. Plant and Soil 230, 21-30.
Cavalcante, V.A. and Döbereiner, J.A. (1988) New acid-tolerant nitrogen-fixing bacterium
associated with sugar-cane. Plant and Soil, v.108, p. 23-31.
Chalk, P.M. (1991) The contribution of associative and symbiotic nitrogen fixation to the
nitrogen nutrition of non-legumes. Plant and Soil, v.132, p.29–39.
Chelius, M.K. and Triplett, E.W. (2001) The diversity of archaea and bacteria in association
with the roots of Zea mays L. Microbiology Ecology, v.41, p.252-263.
Chikowo, R., Mapfumo, P., Nyamugafata, P. and Giller, K.E. (2004) Maize productivity and
mineral N dynamics following different soil fertility management practices on a depleted
sandy soil in Zimbabwe. Agriculture, Ecosystems and Environment 102, 119-131.
Chikoye,D., Ekeleme,F., Lum,A.F. and Schulz,S. (2008) Legume-maize rotation and nitrogen
effects on weed performance in the humid and subhumid tropics of West Africa. Crop
Protection 27, 638-647.
Chirwa P.W., Black C.R., Ong C.K. and Maghembe J. (2006) Nitrogen dynamics in cropping
systems in southern Malawi containing Cliricidia sepium, pigeonpea and maize.
Agroforestry Systems 67: 93-106.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 245

Constantinides M. and Fownes J.H. (1994) Nitrogen Mineralization from Leaves and Litter of
Tropical Plants: Relationship to Nitrogen, Lignin and Soluble Polyphenol Concentrations.
Soil Biology and Biochemistry 26 (1): 49-55.
Coulter J.K. (1998) Rain-fed Arable Farming Systems and their Improvement. In: Webster
C.C. and Wilson P.N. (eds.): Agriculture in the Tropics. 3rd edition. Blackwell Science
Ltd, Cambridge, England. pp. 144-178.
Crews, T. E. and Peoples, M. B. (2005) Can the Synchrony of Nitrogen Supply and Crop
Demand Be Improved in Legume and Fertilizer-based Agroecosystems? A Review.
Nutrient Cycling in Agroecosystems 72, 101-120.
Cripps, R. W.; Winfree, S. K. and Reagan, J. L. (1992) Effects of swage sludge applications
method on corn production. Community Soil Science and Plant Analitical, v.23, p.1705-
1715.
Daros, C. O.; Aita, C.; Cerita, C. A. and Fries, M. R. (1993) Lodo de esgoto: Efeito imediato
no milheto e residual na associação aveia e ervilhaca. Revista Brasileira de Ciência do
Solo, Campinas, v.17, n.2, p.257-261.
Date, R. A. (2000) Inoculated legumes in cropping systems of the tropics. Field Crops
Research 65, 123-136.
Deaker, R., Roughley, R. J., and Kennedy, I. R. (2005) Legume seed inoculation technology—
a review. Soil Biology and Biochemistry.
Döbereiner, J. and Boddey, R.M. (1981) Nitrogen fixation in association with gramineae.
Current Perspectives in Nitrogen Fixation. Australia Academic Science, p.305-312.
Döbereiner, J. (1992) Recent changes in concepts of plant bacteria interactions, endophytic N2
fixing bacteria. Ciência e cultura, v. 44 p.310-313.
Döbereiner, J. Fixação de nitrogênio em associação com gramíneas (1992) In: Cardoso, E.J.B.
N. Microbiologia do Solo, Sociedade Brasileira de Ciências do Solo, Campinas, p.173-
180.
Döbereiner, J. (1997) A importância da fixação biológica de nitrogênio para a agricultura
sustentável. Biotecnologia Ciência e Desenvolvimento, v. 1, n. 1, p. 02-03 (Encarte
Especial).
Downing, K.J et al. (2000) Biocontrol of the sugarcane borer Eldana saccharina by expression
of the Bacillus thringiensis cry1Ac7 and Serratia marcescens chiA genes in sugarcane-
associated bacteria. Applied and Environmental Microbiology, v. 66, p. 2804-2810.
Fageria N.K., Baligar V.C. and Jones C.A. (1991) Growth and Mineral Nutrition of Field
Crops. Marcel Dekker, Inc. New York.
Fan,F., Zhang,F., Song,Y., Sun,J., Bao,X., Guo,T. and Li,L. (2006) Nitrogen fixation of faba
bean (Vicia faba L.) interacting with a non-legume in two contrasting intercropping
systems. Plant and Soil 283, 275-286.
Faria, L. C. de. (2007) Uso do lodo de esgoto (biossólido) como fertilizante em eucaliptos:
demanda, potencial e crescimento das árvores e viabilidade econômica. Universidade de
São Paulo: Tese de Doutorado (Escola Superior de Agricultura Luiz de Queiroz).
Piracicaba.
Favaretto, N. (1997) Efeito do lodo de esgoto na fertilidade do solo e no crescimento e
produtividade do milho (Zea mays L.). Brazilian Archives of Biology and Technology,
Curitiba, v.40, n.4, p.836-847.
246 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

Figueiredo, M. V. B.; Burity, H.A.; Martinez, C.R. and Chanway, C.P. (2008) Alleviation of
water stress effects in common bean (Phaseolus vulgaris L. by co-inoculation
Paenibacillus x Rhizobium tropici. Applied Soil Ecology, v. 40, p. 182-188.
Fisher K.S. and Palmer A.F.E. (1983) Maize. In: Symposium on Potential Productivity of Field
Crops Under Different Environments. International Rice Research Institute, Los Baños,
Laguna, Philippines, pp. 155-180.
Fortuna, A., Harwood, R., Kizilkaya, K., and Paul, E. A. (2003) Optimizing nutrient
availability and potential carbon sequestration in an agroecosystem. Soil Biology and
Biochemistry 35, 1005-1013.
Gadioli, J.L. and Fortes Neto, P. (2004) Rendimento de milho e de feijão preto cultivado em
solo acrescido de lodo de esgoto. Sanare, v.21, p.53-58.
Galdos, M. V.; De Maria, I. C. and Camargo, O. A. (2004) Atributos químicos e produção de
milho em um latossolo vermelho eutroférrico tratado com lodo de esgoto. Revista
Brasileira de Ciência do Solo, v.28: p.569-577.
Gathumbi,S.M., Cadisch,G. and Giller,K.E. (2002) 15N natural abundance as a tool for
assessing N2-fixation of herbaceous, shrub and tree legumes in improved fallows. Soil
Biology and Biochemistry 34, 1059-1071.
Gentry, L.E., Below, F.E., David, M.B. and Bergerou, J.A. (2001) Source of the soybean N
credit in maize production. Plant and Soil 236, 175-184.
Gillis, M.; Döbereiner, J.; Pot, P.; Goor, M.; Falsen, E.; Hoste, B.; Reinhold, B. and Kersters,
K. (1991) Taxonomic relationship between (Pseudomonas) Rubrisubalbicans, some
clinical isolates (EF group 1), Herbaspirillum seropedicae and (Aquaspirillum)
Autotrophicum. In: Polsinelli, M.; Materassi, R.; Vicenzini, M. eds. Nitrogen Fixation.
Kluwer Academic Publishers. p. 293-294.
Giller K.E. (2001) Nitrogen fixation in tropical cropping systems, 2nd edn. CABI,
Wallingford, p 423
Giller, K.E. and Merckx, R. (2003) Exploring the boundaries of N2- fixation in cereals and
grasses: an hypothetical and experimental framework. Symbiosis, v.35, p.3–17.
Gomes, L.P.; Coelho, O.W.; Costa, A.N. and Marques, M.O. (2001) Resíduos sólidos do
saneamento: processamento, reciclagem e disposição final. RiMa-ABES. Rio de Janeiro,
cap.7: p. 165-187.
Gomes. S. B. V.; Nascimento, C. W. A. and Biondi, C. M. (2007) Produtividade e composição
mineral de plantas de milho em solo adubado com lodo de esgoto. Revista Brasileira de
Engenharia Agrícola e Ambiental, v.11, n.5, p.459–465.
Goss, M.J., de Varennes, A., Smith, P.S.and Ferguson, J.A. (2002) N2 fixation by soybeans
grown with different levels of mineral nitrogen, and the fertilizer replacement value for a
following crop. Canadian Journal of Soil Science 82, 139-145.
Goulding K.W.T., Murphy D.V., Macdonald A., Stockdale E.A., Gaunt J.L., Blake L., Ayaga
G. and Brookes P. (2001) The Role of Soil Organic Matter and Manures in Sustainable
Nutrient Cycling. In: Rees R.M., Ball B.C., Campbell C.D. and Watson C.A. (eds):
Sustainable Management of Soil Organic Matter. 1st edition. CAB International,
Wallingford, UK. pp. 221-232.
Graham, P. H. and Vance, C. P. (2000) Nitrogen fixation in perspective: an overview of
research and extension needs. Field Crops Research 65, 93-106.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 247

Hagedorn F., Steiner K.G., Sekayange L. and Zech W. (1997) Effects of rainfall pattern on
nitrogen mineralization and leaching in a green manure experiment in South Rwanda.
Plant and Soil 195: 365-375.
Haggar J. P., Tanner E. V. J., Beer J. W. and Kass D. C. L. (1993) Nitrogen dynamics of
tropical agroforestry and annual cropping systems. Soil Biology and Biochemistry 25 (10):
1363-1378.
Halbrendt, C. and Blase, M. (1989) Potential impact of biological nitrogen fixation: the case of
corn. North Central. North Central Journal of Agricultural Economics, v.11, p.145-156.
Halmann et al. (1997) Bacterial endophytes in agricultural crops. Canadian Jounal
Microbiology, v.43, p. 895-914.
Halbrendt, C. and Blase, M. (1989) Potential impact of biological nitrogen fixation: the case of
corn. North central. North Central Journal of agricultural Economics, vol 11, 145-156.
Handayanto E., Cadish G. and Giller K. E. (1994) Nitrogen release from prunings of legume
trees in relation to quality of the prunings and incubation method. Plant and Soil 160: 237-
248.
Handayanto E., Cadish G. and Giller K.E. (1997) Regulating N Mineralization from Plant
Residues by Manipulation of Quality. In: Cadish G. and Giller K.E. (eds.). Driven by
Nature – Plant Litter Quality and Decomposition. 1st edition. CAB International,
Wallingford, UK. pp. 175-185.
Hardarson, G. and Atkins, C. (2003) Optimising biological N2 fixation by legumes in farming
systems. Plant and Soil 252, 41-54.
Hartemink A. E. and O’Sullivan J. N. (2001) Leaf litter decomposition of Piper aduncum,
Gliricidia sepium and Imperata cylindrical in the humid lowlands of Papua New Guinea.
Plant and Soil 230: 115-124.
Hasegawa, H. and Denison, R.F. (2005) Model predictions of winter rainfall effects on N
dynamics of winter wheat rotation following legume cover crop or fallow. Field Crops
Res. 91, 251–261.
Herridge, D.F.; Peoples, M.B. and Boddey, R.M. (2008) Global inputs of biological nitrogen
fixation in agricultural systems. Plant and Soil, v.311, p.1–18.
Holmes J.C. (1998) Socio-economic Background: The World Food Problem. In: Webster C.C.
and Wilson P.N. (eds.). Agriculture in the Tropics. 3rd edition. Blackwell Science Ltd,
Cambridge, England. pp. 1-19.
Ibewiro B., Sanginga N., Vanlauwe B.and Merckx R. (2000) Nitrogen contributions from
decomposing cover crop residues to maize in tropical derived savanna. Nutrient Cycling in
Agroecosystems 57: 131-140.
James, E.K. Nitrogen fixation in endophytic and associative symbiosis (2000) Field Crops
Research, v. 65, p. 197-209.
Jensen, E. S. and Hauggaard-Nielsen, H. (2003) How can increased use of biological N2
fixation in agriculture benefit the environment? Plant and Soil 252, 177-186.
Kapkiyai J.J., Karanja N.K., Qureshi J.N., Smithson P.C. and Woomer P.L. (1999) Soil
organic matter and nutrient dynamics in a Kenyan nitisol under long-term fertilizer and
organic input management. Soil Biology and Biochemistry 31: 1773-1782.
Karlen D.L., Flannery R.L. and Sadler E.J. (1988) Aerial Accumulation and Partitioning of
Nutrients by Corn. Agronomy Journal 80: 232-242.
248 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

Kennedy, I.R.; Choudhury, A.T.M.A. and Kecske´s, M. L. (2004) Non-symbiotic bacterial

diazotrophs in crop-farming systems: can their potential for plant growth promotion be
better exploited? Soil Biology and Biochemistry v. 36: 1229–1244.
Kirchmann H. (1991) Carbon and nitrogen mineralization of fresh, aerobic and anaerobic
animal manures during incubation with soil. Swedish Journal of Agricultural Research 21:
165-173.
Kuklinsky-Sobral, J.; Araujo, W.L.; Mendes, R.; Geraldi, I.O.; Pizzirani-Kleiner, A.A.and
Azevedo, J.L. (2004) Isolation and characterization of soybeab-associated bacteria and
their potential for plant growth promotion. Environmental Microbiology, v.6, p.1244-
1251.
Lambrecht, M.; Okon, Y.; Vande Broek, A. and Vanderleyden, J. (2000) Indole-3-acetic acid:
a reciprocal signaling molecule in bacteria-plant interactions. TIM, v.8, 298-300.
Lehmann J., Schroth G. and Zech W. (1995) Decomposition and nutrient release from leaves,
twigs and roots of three alley-cropping tree legumes in central Togo. Agroforestry Systems
29: 21-36.
Logan, T. J.; Lindsay, B. J.; Goins, L. E. and Ryan, J. A. (1997) Field assessment of sludge
metal bioavailability to crops: sludge rate response. Journal of Environmental Quality,
v.26, p.534-550.
Lupwayi N.Z. and Haque I. (1999) Leucaena hedgerow intercropping and cattle manure
application in the Ethiopian highlands. I. Decomposition and nutrient release. Biology and
Fertility of Soils 28: 182-195.
Mafongoya P.L., Barak P. and Reed J.D. (2000) Carbon, nitrogen and phosphorus
mineralization of tree leaves and manure. Biology and Fertility of Soils 30: 298-305.
Mafongoya P.L., Nair P.K.R., and Dzowela B.H. (1997) Multipurpose tree prunings as a
source of nitrogen to maize under semiarid conditions in Zimbabwe. 3. Interactions of
pruning quality and time and method of application on nitrogen recovery by maize in two
soil types. Agroforestry Systems 35: 57-70.
Mafongoya P.L., Nair P.K.R., and Dzowela B.H. (1998) Mineralization of nitrogen from
decomposing leaves of multipurpose trees as affected by their chemical composition.
Biology and Fertility of Soils 27: 143-148.
Malavolta, E. (1981) Adubos minerais e orgânicos. In: Encontro de Técnicos em Solo, Rio de
Janeiro, 25p.
Malavolta, E.; Vitti, G. G. and Oliveira, S. A. (1989) Avaliação do estado nutricional das
plantas: princípios e aplicações. Piracicaba, Associação Brasileira para Pesquisas de
Potássio e Fosfato, 201p.
Mapfumo, P., Mtambanengwe, F., Giller, K. E., and Mpepereki, S. (2005) Tapping indigenous
herbaceous legumes for soil fertility management by resource-poor farmers in Zimbabwe.
Agriculture, Ecosystems and Environment 109, 221-233.
Mariano, R. L. R. et al. (2004) Importância de bactérias promotoras de crescimento e de
biocontrole de doenças de plantas para uma agricultura sustentável. Anais da Academia
Pernambucana de Ciência Agronômica, Recife, vol. 1, p.89-111.
Martins, A.L.C.; Bataglia, O.C.; Camargo, O.A. and Cantarella, H. (2003) Produção de grão e
absorção de Cu, Fe, Mn e Zn pelo milho em solo adubado com lodo de esgoto, com e sem
calcário. Revista Brasileira de Ciência do Solo, Viçosa, v. 27 n.3, p. 563-574.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 249

Majerowicz, N.; Pereira, J. M. S.; Médici, L.O.; Bizon, O.; Pereira, M. B. and Santos Júnior,
U. M. (2002) Estudo da eficiência de uso do nitrogênio em variedades locais e melhoradas
de milho. Revista Brasileira de Botânica, v. 25, p. 129-136.
Marin, A.M.P., Menezes, R. S. C., Salcedo, I. H. (2007) Produtividade de milho solteiro ou em
aléias de gliricídia adubado com duas fontes orgânicas. Pesquisa Agropecuária Brasileira,
v.42, p.669 – 677.
Mazzarino, M. J.; Laos, F.; Satti, P. and Moyano, S. (1998) Agronomic and environmental
aspects of utilization of organic residues in soils of the Andean-atagonian region. Soil
Science and Plant Nutrition, v.44, p.105-113.
McInnes, A., Thies, J. E., Abbott, L. K.,and Howieson, J. G. (2005) Structure and diversity
among rhizobial strains, populations and communities–a review. Soil Biology and
Biochemistry.
McNeill, A.M. and Unkovich, M.J. (2007) The nitrogen cycle in terrestrial ecosystems. In:
Marschner, P.; Rengel, Z. (eds) Nutrient cycling in terrestrial ecosystems. Soil Biology,
v.10, p.37–64.
Mendonça, M.M. and Urquiaga, S. S.; Reis, V. M. (2006) Variabilidade genotípica de milho
para acumulação de nitrogênio e contribuição da fixação biológica de nitrogênio. Pesquisa
Agropecuária Brasileira, v.41, p.1681-1685.
Menezes, R. S. C. and Salcedo, I. H. (2007) Mineralização de N após incorporação de adubos
orgânicos em um Neossolo Regolítico cultivado com milho. Revista Brasileira de
Engenharia Agrícola e Ambiental. , v.11, p.361–367.
Melo, W.J.; Marques, M.O.; Santiago, G. and Chelli, R.A. (1994). Efeito de doses crescentes
de lodo de esgoto sobre frações da matéria orgânica e CTC de um Latossolo cultivado com
cana-de-açúcar. Revista Brasileira de Ciência do Solo, v. 18, p. 449-455.
Messias, A. S. (1993) Fertilizantes orgânicos (lixo urbano). Recife, Universidade Católica de
Pernambuco. 48 p.
Messias, A.S. and Moraes, F.A. (1992) Emprego do lixo urbano na adubação do milheto. In:
Reunião Brasileira de fertilidade do solo e Nutrição de Plantas, 20., 1992, Piracicaba/SP.
Anais Piracicaba, p.384.
Mubarak A.R., Rosenani A.B., Anuar A.R. and Zauyah D.S. (2003) Recovery of Nitrogen
from Maize Residue and Inorganic Fertilizer in a Maize-Groundnut Rotation System in
Humid Tropics of Malaysia. Communications in Soil Science and Plant Analysis 34 (17-
18): 2375-2394.
Mundus, S., Menezes, R. S. C., Neergaard, A. and Garrido, M. S.(2008) Maize growth and soil
nitrogen availability after fertilization with cattle manure and/or gliricidia in semi-arid NE
Brazil. Nutrient Cycling in Agroecosystems, v.82, p.61 – 73.
Musiyiwa, K., Mpepereki, S., and Giller, K. E. (2005) Symbiotic effectiveness and host ranges
of indigenous rhizobia nodulating promiscuous soyabean varieties in Zimbabwean soils.
Soil Biology and Biochemistry 37, 1169-1176.
Myers R.J.K., Palm C.A., Cuevas E. Gunatilleke I.U.N. and Brossard M. (1994) The
synchronisation of nutrient mineralisation and plant nutrient demand. In: Woomer P.L.
and Swift M.J. (eds.). The Biological Management of Tropical Soil Fertility. Edition.
Wiley-Sayce Publishing, Exeter, UK, pp. 81-116.
Myers R.J.K., Van Noordwijk M. and Vityakon P. (1997) Synchrony of Nutrient Release and
Plant Demand: Plant Litter Quality, Soil Environment and Farmer Management Options.
250 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

In: Cadisch G. and Giller K.E. (eds.). Driven by Nature – Plant Litter Quality and
Decomposition. 1st edition. CAB International, Wallingford, UK. pp. 215-229.
Nascimento, C. W. A.; Barros, D. A. S.; Melo, E. E. C. and Oliveira, A. B. (2004) Alterações
químicas em solos e crescimento de milho e feijoeiro após aplicação de lodo de esgoto.
Revista Brasileira de Ciência do Solo. Viçosa. v.28, n.2, p.385-392.
Nefedieva, E.E. (2003) The influence of impulse pressure on the phytohormone content,
growth and crop productivity of buckwheat plants (Fagopyrum esculentum Moench. cv.
Aromat). Pacific Journal Science Technology, v.3, p.123–135.
Norman M.J.T., Pearson C.J. and Searle P.G.E. (1995) The Ecology of Tropical Food Crops.
2nd edition, Cambridge University Press.
Nyamangara J., Gotosa J. and Mpofu S.E. (2001) Cattle manure effects on structural stability
and water retention capacity of a granitic sandy soil in Zimbabwe. Soil and Tillage
Research 62: 157-162.
Nyamangara J., Piha M.I. and Kirchmann H. (1999) Interactions of aerobically decomposed
cattle manure and nitrogen fertilizer applied to soil. Nutrient Cycling in Agroecosystems
54: 183-188.
Nyberg G., Ekblad A., Buresh R. and Högberg P. (2002) Short-term patterns of carbon and
nitrogen mineralization in a fallow field amended with green manures from agroforestry
trees. Biology and Fertility of Soils 36: 18-25.
Oglesby K.A. and Fownes J.H. (1992) Effects of chemical composition on nitrogen
mineralization from green manures of seven tropical leguminous trees. Plant and Soil 143:
127-132.
Ojiem, J. O., Vanlauwe, B., de Ridder, N., and Giller, K. E. (2007) Niche-based assessment of
contributions of legumes to the nitrogen economy of Western Kenya smallholder farms.
Plant and Soil 292, 119-135.
Okito, A., Alves, B.J.R., Urquiaga,S.and Boddey, R.M. (2004) Nitrogen fixation by groundnut
and velvet bean and residual benefit to a subsequent maize crop. Pesquisa Agropecuaria
Brasileira 39, 1183-1190.
Okogun, J.A., Sanginga, N. and Abaidoo, R.C. (2007) Evaluation of maize yield in an on-farm
maize-soybean and maize-Lablab crop rotation systems in the Northern Guinea savanna of
Nigeria. Pakistan Journal of Biological Sciences 10, 3905-3909.
Okon, Y. and Kapulnik, Y. (1986) Development and function of Azospirillum-inoculated roots.
Plant and Soil, v.90, p.3-16.
Okon, Y. and Labandera-Gonzalez, C. (1994) Agronomic application of Azospirillum: An
evaluation of 20 years worldwide field incubation. Soil Biology and Biochemistry, Oxford,
v.26, n.12, p.1591-1601.
Okon, Y. and Itzgsohn, R. (1995) The development of Azospirillum as a commercial inoculant
for improving crop yields. BioUschnolosy Advances, Vol. 13, No. 3, p. 415-424.
Oliveira, F. C. (1995) Metais pesados e formas nitrogenadas em solos tratados com lodo de
esgoto. Piracicaba, ESALQ/USP, 90p. (Tese de Doutorado).
Oliveira, F.C.; Melo, W. J.; Pereira, G.T.; Melo, V.P. and Melo, G. M. P.H H. (2005) Heavy
metals in oxisols omended with biosolids and cropped with maize in a long-term
experiment. Scientia Agricola. (Piracicaba, Brazil), v.62, n.4, p.381-388.
Oliveira,T.K., Carvalho,G.J.and Moraes, R.N.S. (2002) Plantas de cobertura e seus efeitos
sobre o feijoeiro em plantio direto. Pesquisa Agropecuaria Brasileira 37, 1079-1087.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 251

Olivares, F.L.; Baldani, V.L.D.; Reis, V.M.; Baldani, J.I. and Döbereiner, J. (1996) Occurrence
of the endophytic diazotrophs Herbaspirillum spp. In roots, stems and leaves,
predominantly of Gramineae. Biology Fertility Soils, v.21, p.197-200.
Osunde, A. O., Bala, A., Gwam, M. S., Tsado, P. A., Sanginga, N. and Okogun, A.(2003)
Residual benefits of promiscuous soybean to maize (Zea mays L.) grown on farmers' fields
around Minna in the southern Guinea savanna zone of Nigeria. Agriculture, Ecosystems
and Environments 100, 209-220.
Palm C.A. (1995) Contribution of agro forestry trees to nutrient requirements of intercropped
plants. Agro forestry Systems 30: 105-124.
Palm C.A. and Sanchez P.A. (1991) Nitrogen release from the leaves of some tropical legumes
as affected by their lignin and polyphenolic contents. Soil Biology and Biochemistry 23:
83-88.
Palm, C.A and Rowland, A.P. A minimum dataset for characterization of plant quality for
decomposition. In: Cadisch G and Giller KE (eds) Driven by nature: Plant litter quality
and decomposition, CAB International, Wallingford, 1997. 379–392p.
Palm, C.A; Catherine, N; Gachengo, Delve, R.J; Cadisch, G and Giller, K.E. (2001b) Organic
inputs for soil fertility management in tropical agroecosystems: application of an organic
resource database. Agriculture, Ecosystems and Environment. 83:27-42.
Palm, C.A; Giller, K. E; Mafongoya P. L and Swift M.J. (2001) Management of organic in the
tropics: translating theory into practice. Nutrient Cycling in Agroecosystem. 61:63-75.
Peinetti, H. R.; Menezes, R. S. C.; Tiessen, H. and Marin, A.M.P (2008) Simulating plant
productivity under different organic fertilization practices in a maize/native pasture
rotation system in semi-arid NE Brazil. Computers and Electronics in Agriculture, v.62,
p.204 – 222.
Peoples, M.B. and Craswell, E.T. (1992) Biological nitrogen fixation: investments,
expectations and actual contributions to agriculture. Plant and Soil, v.141, p.13-39.
Peoples, M. B., Herridge, D. F. and Ladha, J. K.(1995) Biological nitrogen fixation: An
efficient source of nitrogen for sustainable agricultural production? Plant and Soil 174, 3-
28.
Phoomthaisong, J., Toomsan, B., Limpinuntana,V., Cadisch, G. and Patanothai, A. (2003)
Attributes affecting residual benefits of N2-fixing mungbean and groundnut cultivars.
Biology and Fertility of Soils 39, 16-24.
Pierrisnard, F. (1996) Impact de l’amendement des boues residuaires de la ville de Marseille
sur des sols a vocation agricole: comportement du Cd, Cr, Cu, Ni, Pb, Zn, des
hydrocarbures et des composes polaires. Marseille, 1996. 408p. These (Docteur) - Facolte
des Sciences et Techniques de Saint-Jerome, Universite de Droit d’Ecomonie et des
Sciences d’AIX-MARSEILLE.
Pires, A.M.M. (2005) Lodo de esgoto. Ambientebrasil. Embrapa Meio Ambiente, p.1-2.
Pittner, E. et al. (2007) Flutuação populacional de bactérias do gênero Azospirillum em solo
cultivado com milho e em campo nativo. Ambiência Guarapuava, v.3 n.2 p. 243-252.
Pradella, J.G.C.; Oliveira, M.S. and Urenha, L.C. (2001) Produção de inoculantes Agrícolas.
In: Lima, U.A.; Aquarone, E.; Borzani, W.; Schmidell, W. Biotecnologia industrial. São
Paulo: Edgard Blücher, v.3, p.279-305.
PROSAB - Programa de Pesquisa em Saneamento Básico. (1999) Uso e manejo do lodo de
esgoto na agricultura. Rio de Janeiro: PROSAB, 97p.
252 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

Raja, P.; Uma, S.; Gopal, H. and Govindarajan, K. (2006) Impacto of Bio inoculants
consortium on rice root exudates, biological nitrogen fixation and plant growth. Journal of
Biological Sciences v. 6(5): 815-823.
Raun, W.R. et al. (2002) Improving nitrogen use efficiency in cereal grain production with
optical sensing and variable rate application. Agronomy Journal, v.94, p.815-820.
Raymond, J.; Siefert, J. L.; Christopher R. Staples, C. R. and Blankenship, R. E. (2004) The
natural history of nitrogen fixation. Molecular Biology Evoluation 21(3):541–554.
Reddy, M. R.; Lameck, D. and Rezania, M.E. (1989) Uptake and distribuition of copper and
zinc by soybean and corn from soil treated with sewage sludge. Plant and Soil, v.113,
p.271-274.
Reinhold-Hurek, B.; Hurek,T.; Gillis, M.; Hoste, B.; Vancanneyt, M.; Kersters, K. and De
Ley, J. (1993) Nitrogen-fixing proteobacteria associated with roots of kallar grass
(Leptochloa fusca (L.) Kunth), and description of two species, Azoarcus indigens sp. nov.
and Azoarcus communis sp. nov. International Journal of Systematic Bacteriology, v.43,
p.574-584.
Reis Junior, F.B.; Toledo, C.T.; Machado, A. T. and Sodek, L. (2008) Inoculação de
Azospirillum amazonense em dois genótipos de milho sob diferentes regimes de
nitrogênio. Revista Brasileira de Ciências do Solo, 32:1139-1146.
Riggs, P.J.; Chelius, M.K.; Iniguez, A.L.; Kaeppler, S.M. and Triplett, E.W. (2001) Enhanced
maize productivity by inoculation with diazotrophic bacteria. Australian Journal of Plant
Physiology, v.28, p.829-836.
Ritter, W.F. and Eastburn, R.P. (1978) Leaching of heavy metals from sewage sludge through
coastal plain soils. Communications in Soil Science and Plant Analysis, v.9, p.785-798.
Robertson, M. J., Sakala, W., Benson, T. and Shamudzarira, Z. (2005) Simulating response of
maize to previous velvet bean (Mucuna pruriens) crop and nitrogen fertiliser in Malawi.
Field Crops Research 91, 91-105.
Roesch, L.F.W. et al. (2007) Diversidade de bactérias diazotróficas endofíticas associadas a
plantas de milho. Revista Brasileira de Ciencias do Solo, v.31, p.1367-1380.
Rodríguez, H.; Fraga, R.; Gonzalez, T. and Y. Bashan, Y. (2006) Genetics of phosphate
solubilization and its potential applications for improving plant growth-promoting
bacteria. Plant and Soil 287:15–21.
Rodrigues, T.A.N.; Arruda, R.S. and Soares, C. F. (2006) Produtividade de milho e de feijão
consorciados adubados com diferentes formas de lodo de esgoto. Suelo Nutrición Vegetal,
v.6, n.1, p.52-63. ISSN 0718-2791.
Roper, M.M. and Ladha, J.K. (1995) Biological N2 fixation by heterotrophic and phototrophic
bacteria in association with straw. Plant and Soil, v.174, p.211–224.
Rosolem,C.A., Pace,L. and Crusciol, C.A.C. (2004) Nitrogen management in maize cover crop
rotations. Plant and Soil 264, 261-271.
Rufino, M. C., Rowe, E. C., Delveb, R. J. and Giller, K. E. (2006) Nitrogen cycling
efficiencies through resource-poor African crop-livestock systems. Agriculture,
Ecosystems and Environment 112, 261-282.
Saikia, S.P. and Jain, V. (2007) Biological nitrogen fixation with non-legumes: An achievable
target or a dogma? Current Science, v.92.(n 3) p.317-322.
Saito, M. L. (2007) O uso do lodo de esgoto na agricultura: precauções com os contaminantes
orgânicos. Embrapa Meio Ambiente, Jaguariúna, SP, p.28.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 253

Salvagiotti, F., Cassman,K.G., Specht,J. E., Walters, D.T., Weiss, A. and Dobermann, A.
(2008) Nitrogen uptake, fixation and response to fertilizer N in soybeans: A review. Field
Crops Research 108, 1-13.
Sanchez, P. A. Science in Agroforestry. Agrof. Systems, 30:5-55, 1995.
Sanginga, N. (2003) Role of biological nitrogen fixation in legume based cropping systems; a
case study of West Africa farming systems. Plant and Soil 252, 25-39.
Sanginga,N., Dashiell, K.E., Diels, J., Vanlauwe,B., Lyasse,O., Carsky, R.J., Tarawali, S.,
Safo-Adjei, B., Menkir,A., Schulz,S., Singh,B.B., Chikoye,D., Keatinge,D. and Ortiz,R.
(2003) Sustainable resource management coupled to resilient germplasm to provide new
intensive cereal-grain-legume-livestock systems in the dry savanna. Agriculture,
Ecosystems and Environment 100, 305-314.
Schroth G., Zech W. and Heimann G. (1992) Mulch decomposition under agroforestry
conditions in a sub-humid tropical savannah processes and influence of perennial plants.
Plant and Soil 147: 1-11.
Shelton,H.M., Franzel,S. and Peters, M. (2005) Adoption of tropical legume technology
around the world: Analysis of success. Tropical Grasslands 39, 198-209.
Silva, J. E.; Resck, D.V.S. and Sharma, R.D. (2002) Alternativa agronômica para o biossólido
produzido no Distrito Federal. I — Efeito na produção de milho e na adição de metais
pesados em Latossolo no cerrado. Revista Brasileira de Ciência do Solo, Viçosa, v. 26,
n.2, p. 487-495.
Silva,E.-C.d. (2006) Aproveitamento do nitrogenio (15N) da crotalaria e do milheto pelo milho
sob plantio direto em Latossolo Vermelho de Cerrado. Ciência Rural 36, 739-746.
Silva, T. O.; Menezes, R. S. C.; Tiessen, H.; Sampaio, E. V. S. B. and Salcedo, I. H. (2007)
Adubação orgânica da Batata com esterco e, ou Crotalaria juncea. I-Produtividade vegetal
e estoque de nutrientes no solo em longo prazo. Revista Brasileira de Ciência do Solo,
v.31, p.39 - 49.
Silva, T.O. and Menezes, R. S. C. (2007) Adubação orgânica da Batata com esterco e, ou,
Crotalaria juncea. II- Disponibilidade de N, P e K no solo ao longo do ciclo de cultivo.
Revista Brasileira de Ciência do Solo, v.31, p.51 - 61.
Singh,A., Carsky, R.J., Lucas, E.O. and Dashiell, K. (2003) Soil N balance as affected by
soybean maturity class in the Guinea savanna of Nigeria. Agriculture, Ecosystems and
Environment 100, 231-240.
Simonete, M. A. (2001) Alterações nas propriedades químicas de um argissolo adubado com
lodo de esgoto e desenvolvimento e acúmulo de nutrientes em plantas de milho. 2001.
89p. Tese (Doutorado) - Escola Superior de Agricultura Luiz de Queiroz, Piracicaba, São
Paulo.
Simonete, M. A. and Kiehl, J. C. (2002) Extração e fitodisponibilidade de metais em resposta à
adição de lodo de esgoto no solo. Scientia Agrícola, v.59, p. 555-563.
Simonete, M. A.; Kiehl, J. C.; Andrade, C.A. and Teixeira, C.F.A. (2003) Efeito do lodo de
esgoto em um Argissolo e no crescimento e nutrição de milho. Pesquisa Agropecuária
Brasileira, Brasília, n.10, v. 38, p. 1187-1195.
Smith,R.G., Gross,K.L.and Robertson,G.P. (2008) Effects of crop diversity on agroecosystem
function: Crop yield response. Ecosystems 11, 355-366.
Sisworo W.H., Mitrosuhardjo M.M., Rasjid H. and Myers R.J.K. (1990) The relative roles of
N, fertilizer, crop residues and soil in supplying N in multiple cropping systems in a
humid, tropical upland cropping systems. Plant and Soil 121: 73-82.
254 M. do Vale Barreto Figueiredo, M. de Andrade Lira, A. Saconi Messias et al.

Strobel, G.; Daisy, B. (2003) Bioprospecting for microbial endophytes and their natural
products. Microbiology and Molecular Biology Reviews, v.67, p.491-502.
Tejera, N; Ortega, E. and Rodes, R. Lluch, C. (2006) Nitrogen compounds in the apoplastic
sap of sugarcane stem: Some implications in the association with endophytes. Journal of
Plant Physiology v. 163 80: 85.
Tenuta,2003.www.umanitoba.ca/afs/agronomists_conf/2003/pdf/tenuta_rhizobacteria.pdf
Thuler, D.S. et al. (2003) Plant growth regulators and amino acids released by Azospirillum sp.
in chemically defined media. Letter Applied Microbiology, v.37, p.174-178.
Tilman, D., Cassman, K. G., Matson, P. A., Naylor, R. and Polasky, S. (2002) Agricultural
sustainability and intensive production practices. Nature 418, 671-677.
Tonitto,C., David,M.B. and Drinkwater, L.E. (2006) Replacing bare fallows with cover crops
in fertilizer-intensive cropping systems: A meta-analysis of crop yield and N dynamics.
Agriculture, Ecosystems and Environment 112, 58-72.
Traore, A.; Maranville, J. W. (1999) Nitrate reductase activity of diverse grain sorghum
genotype and its relationship to nitrogen use efficiency. Agronomy Journal, Madison, v.
91, p. 863-869.
Tsai, S. M., Nodari, R. O., Moon, D. H., Camargo, L. E. A., Vencovsky, R. and Gepts, P.
(1998) QTL mapping for nodule number and common bacterial blight in Phaseolus
vulgaris L. Plant and Soil 204, 135-145.
Tsadilas, C. D.; Matsi, T.; Barbayiannis, N. and Dimoyiannis, D. (1995) Influence of sewage
sludge application on soil properties on the distribution and availability of heavy metals
fractions. Community Soil Science and Plant Analitical, v.26, p.2603-2619.
Tsutiya, M. T. (2000) Alternativas de disposição final de biossólidos gerados em estações de
tratamento de esgoto. In: Bettiol, W. and Camargo, O. A. (Ed) Impacto ambiental do uso
agrícola do lodo de esgoto. Jaguariúna: EMBRAPA Meio Ambiente, cap. 4, p. 69-106.
United States Environmental Protection Agency. EPA 625/10-84-003. (1999). Environmental
regulations and technology: use and disposal of municipal wastewater sludge. Federal
Register, p. 15-16.
Urquiaga S., Cruz K. H. S. and Boddey R. M . (1992) Contribution of nitrogen fixation to
sugar cane: Nitrogen-15 and nitrogen balance estimates. Soil Science Societies American
Journal 56, 105–114.
Valverde, A. et al. (2003) Herbaspirillum lusitanum sp. nov., a novel nitrogen-fixing
bacterium associated with root nodules of Phaseolus vulgaris. International Journal of
Systematic and Evolutionary Microbiology, v.53, p.1979-1983.
Van Kessel,C. and Roskoski, J.P. (1988) Row spacing effects on N2-fixation, N-yield and soil
N uptake of intercropped cowpea and maize. Plant and Soil 111, 17-23.
Van Loon, G. W. and Duffy, S. J. (2001) Microbiological processes. In: Environmental
Chemistry. New York: Oxford University, Cap.15, p. 492.
Vanlauwe, B; Gachengo, K; Shepherd, E; Barrios, G; Cadisch, G and Palm, C.A. (2005)
Laboratory validation of a resource quality-based conceptual framework for organic
matter management. Soil Science Society American Journal. 69:1135-1145.
Verma, C.S.; Singh, A.; Chowdhury, S.P. and Tripathi, A.K. (2004) Endophytic ability of two
deep-water rice endophytes, Pantoea sp. and Ochrobactrum sp. using green fluorescent
protein reporter. Biotechnology Letters, v. 26, p. 425-429.
 Potential Impact of Biological Nitrogen Fixation and Organic Fertilization… 255

Vidor, C. (1999) Descarte de lodo de estações de tratamento de efluentes domésticos no solo.

In: Tedesco, M. J. and Gianello, C. (ed.) Manejo racional de resíduos no solo. Porto
Alegre: DS/UFRGS, p. 128-150.
Weil R.R. and Magdoff F. (2004) Significance of Soil Organic Matter to Soil Quality and
Health. In: Magdoff F. and Weil R.R. (eds): Soil Organic Matter in Sustainable
Agriculture. 1st edition. CRC Press LLC, Florida, USA.
Wenbo, M.; Zalec, K. and Glick, B. R. (2001) Biological activity and colonization pattern of
the bioluminescence-labeled plant growth-promoting bacterium Kluyvera ascorbata
SUD165/26. FEMS Microbiology Ecology, v. 35, p. 137-144.
Zaharah A.R. and Bah A.R. (1999) Patterns of decomposition and nutrient release by fresh
Gliricidia (Gliricidia sepium) leaves in an ultisol. Nutrient Cycling in Agroecosystems 55:
269-277.
Zaharah A.R., Bah A.R., Mwange N.K., Kathuli P. and Juma P. (1999) Management of
Gliricidia (Gliricidia sepium) residues for improved sweet corn yield in an ultisol. Nutrient
Cycling in Agroecosystems 54: 31-39.
Zingore S., Mafongoya P., Nyamugafata P. and Giller K.E. (2003) Nitrogen mineralization and
maize yields following application of tree prunings to a sandy soil in Zimbabwe.
Agroforestry Systems 57: 199-211.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 6

DISTRIBUTION AND RISK ASSESSMENT OF PAHS

IN SOILS AND CORNS AROUND ZHONGYUAN
OIL FIELD, CHINA ∗

Shaoping Kuang, Hong Chen

Qingdao University of Science and Technology, Qingdao 266042,
Shandong Province, P.R.China

ABSTRACT
The purpose of this study was to determine the degree of contamination with
polycyclic aromatic hydrocarbons (PAHs) in samples of soils in both winter and summer,
corn roots and corn leaves around three different oily sludges in Zhongyuan Oil Field. The
contents of PAHs in samples were determined with HPLC. According to these data and
the ratio of Fla/Pyr, PAHs in oily sludge samples were mainly from petrogenic sources,
and the soil samples in both winter and summer were divided into petrogenic soil samples
and both petrogenic and pyrogenic soil samples by the source of PAHs. The PAHs
contents of soil samples in both winter and summer around three different oily sludges
from high to low present that the Third Wenming Plant of the oily sludge (3W)>the Third
Mazhai plant of the oily sludge (3M)>the Fourth Wener Plant of the oily sludge (4W), and
the contents of PAHs in soil samples in summer were lower than those in winter, and 2-4
rings were major pollutants of PAHs in oily sludge. The contents of PAHs in soil samples
around oily sludges varied widely from 434.5 to 408.8 ng·g-1. Naphthalene, acenaphthene,
fluorine, phenanthrene and pyrene were major pollutants of PAHs in petrogenic soil
samples, and the two predominant PAHs in both petrogenic and pyrogenic soil samples
were naphthalene and phenanthrene. The PAHs contents of corn root samples from soils
around three different oily sludges from high to low were 3W > 3M> 4W, which was
consistent with the order of the contents of PAHs of soil samples in three plants. And 2-4
rings PAHs were still the most predominant components of PAHs in corn root samples.
The PAHs contents of corn leaf samples from soils around three different oily sludges
from high to low were 3W> 4W > 3M, which was not consistent with the order of the
contents of PAHs of soil samples and corn root samples in three plants. And 5-6 rings

∗
The study is jointly supported by the Shandong Provincial Natural Science Foundation of China (Y2007E03), and
the Key Lab of Biogeology and Environmental Geology of Ministry of Education (BGEG), CUG
(BGEGF200804).
258 Shaoping Kuang and Hong Chen

PAHs were the most predominant components of PAHs in corn leaf samples. Based on
Nemero index P, the result of classification evaluation showed soils around oily sludge
were heavily polluted, and also present that the PAHs pollution level in soil samples in
winter was much higher than that in summer. According to the pollution characters of
PAHs in soil samples in winter and summer, and the contents characters of PAHs in corn
samples in summer, this article also determined the health risk assessment and ecological
risk assessment in soils around oily sludge in Zhongyuan Oil Field, and the security of the
corn as a crop.

Keywords: oily sludge; soil; corn; polycyclic aromatic hydrocarbons; nemero index P

INTRODUCTION
Polycyclic aromatic hydrocarbons (PAHs), which are categorized as persistent organic
pollutants (POPs), are of environmental significance, due to their widespread distribution in
the environment and potential toxicity to organisms. PAHs originate mainly from
anthropogenic sources such as combustion of fossil fuels and direct release of oil and its
products[1]. Many of the PAHs with four or more rings are carcinogenic and mutagenic
because of their metabolic transformation capability. Consequently many countries list them
into black list or gray list of priority pollutants, for example, sixteen of them are determined
priority pollutants by US. Environmental Protection Agency (EPA) and seven of them are
listed into black list of China's priority pollutants[2-4]. PAHs are easy to entrance organism
and sediment, and even enter into human body through food chain, which can make serious
latency harm to human health and ecology conditions[5].
The rapid development of the demand in the oil during the last two decades has resulted in
significant pollution of air, water and soil[6]. Sources, and environmental behaviors, ecological
effect and remediation of PAHs in these media have been presented by many authors[7-17].
However, few researches are focus on PAHs from oily sludges.
Presently, the researches of the PAHs in soil and plant have carried on a great deal of work
at home and abroad, and the main concentration is in the following aspects: the content and
source of the PAH in the soil, distribution and migration, the relation of its physical and
chemical properties with the behavior in the soil, the relation of the environment factors with
its behavior, and risk assessment and management; the mechanism of the plant absorbing the
PAH, the influence factors, phytoremediation PAH polluting soil, but the study of PAHs in the
soil and plant around oily sludge is relatively less[18-26]. We choose the agricultural soil and
corn around Zhongyuan Oil Field as research object, analyzing the distribution of PAHs
excellently controlled by EPA in the agricultural soil, the corn root and the corn leaf,
discussing the main factors which influence its distribution, in order to carry on the pollution
treatment and reasonable distribution of the agriculture production in region pertinently. Also
the present paper investigates the distribution of PAHs in oily sludge and its peripheral soil of
Zhongyuan Oil Field, and determines major sources of PAHs in different samples from these
regions. By nemero index P, the pollution level of the soil adjacent to oily sludge is
determined, which is used for oily sludge environmental health risk analysis. The results will
provide the theoretical basis for the proper utilization and the scientific management of oily
sludge in Zhongyuan Oil Field.
 Distribution and Risk Assessment of PAHs in Soils and Corns… 259

SAMPLES AND EXPERIMENTS

Samples Collection

Oily sludge samples were collected from fresh oily sludge and air-dried oily sludge of the
Third Wenming Plant of the oily sludge (3W), the Third Mazhai Plant of the oily sludge (3M)
and the Fourth Wener Plant of the oily sludge (4W) in Zhongyuan Oil Field on December 4
and 8, 2006. According to the local monsoon feature, soil samples and corn samples were
collected along with the leeway from the agricultural soil (5-10cm) distant from the oily sludge
10, 20, 50, 100, 100 and 100 m, respectively (Table 1). There are no other factories and
residents in the sampling areas. The details of sampling sites were listed in Table 1.

Table 1. Sampling sites

sample sample sample type distance

3M-1 3W-1 4W-1 fresh oil sludge -

3M-2 3W-2 4W-2 dried oil sludge -

3M-3 3W-3 4W-3 soil 10 m

3M-4 3W-4 4W-4 soil 20 m
3M-5 3W-5 4W-5 soil 50 m
3M-6 3W-6 4W-6 soil 100 m
3M-7 3W-7 4W-7 soil 200 m
3M-8 3W-8 4W-8 soil 500 m

Samples Treatment

Samples collected were air-dried among shade, and grinded with the order of the distance
to oily sludge from farness to nearness, and sieved into a particle size of 60 meshes. They were
placed in polyvinyl chloride bag and stored at room temperature after sieved. The corn samples
collected were cut up, and frozen drying using Freeze-Dryer, and grinded using agate mortar.
They were placed in brown jar and stored at freezing low-temperature awaiting analysis.

Instruments

High Performance Liquid Chromatography (HPLC, Shimadzu, Japan) with a fluorescence

detector and VP-ODS column (Serial No. 9122504, 150L×4.6) was used for determination of
PAHs ; the ultrasonic washer (KQ5200, Kun Shan in china) was used for the extraction of
PAHs; the rotary evaporator (Shen Sheng SENCO-R, china) and the thermostat water bath
(Shen Sheng W201B, china) was used for the concentration of PAHs liquors; low-speed
tabletop centrifuge (TDL-40B, Shanghai) was used for the separation of PAHs samples; water
260 Shaoping Kuang and Hong Chen

cycling multipurpose Vacuum pump (SHB-Ⅲ,Zheng Zhou in china), mixed quickly

instrument (Chang Zhou, China).

Reagents

Dichloromethane, cyclohexane and methanol (analytically pure), acetonitrile

(Chromatographic Pure), silica-gel ( dikma, and the diameter was from 0.15mm to 0.074mm)
reactivated at 130°C for 16h immediately prior to use, anhydrous sodium sulphate were heated
at 500 °C in a furnace for 2h prior to use and stored in the sealed desiccator. Sixteen PAH
standards were from Supelco Co.

Analytical Procedure

1. The extraction, concentration and purification of PAHs. 5.00 g of samples were

measured with analytical balance and put into the centrifuge bottle of 100 mL, and
then 20.00 mL of dichloromethane was added. After the samples were put into the
dichloromethane, they were kept in the ultrasonic washer of 40 °C for 2 h, and were
transferred into the centrifugal vacuum pump of 2000 r/min, and then were kept for 5
min. 10.00 mL of supernatant was moved into the egg yard type bottle, and all the
liquids were dried by rotary evaporator at 40 °C. After that, the resulting residue was
dissolved in 2.00 mL of cyclohexane, 0.50 mL of which solution was put on the
silicamini column packed with 1.0 g of silica gel. The column was eluted with
methylene chloride/hexane (v/v=1:1), and the eluate was discarded with 1.00mL. The
second fraction containing PAHs was collected with 2.00mL, and blown drying by
nitrogen. The residue was redissolved in 1mL of acetonitrile and stored at 4 °C.

2. Determination of PAHs. High Performance Liquid Chromatographywith fluorescence

detector, VP-ODS column;. The acetonitril-water (90:10) solution was used as the
mobile phase, and the flow rate is 0.5 mL/min; the column temperature was at 30 °C.
Sample preconcentration liquid and mixed certificated liquid with same volume were
extracted separately, and samples were determined by external standard method.

3. Quality control. The retention time of PAHs standard compound was used to analyze
and compare in qualitative analyses, and the determination of PAHs external standard
method was used in quantitative analyses. The recovery of known samples was
47.5%-103.4%, and the relative standard deviation was 5.8%-9.7%. In addition,
principal component analyses were conducted with SPSS1 1.0. Kinds and contents of
PAHs in samples were displayed in Table 2-4.
 Distribution and Risk Assessment of PAHs in Soils and Corns… 261

Table 2. Contents of Pahs Of Oily Sludge Samples and Peripheral Soil Samples from 3M

compound 3M-1 3M-2 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8

NaP 886.6 461.4 612.9 600.1 602.4 485.4 360.1 275.4
Any 482.3 274.5 103.5 62.3 51.0 32.3 19.5 11.4
Ane 644.3 386.1 143.5 118.6 89.7 33.5 24.2 13.3
Flu 712.1 451.4 189.4 149.8 121.7 41.8 30.2 23.0
Phe 456.8 289.6 403.2 309.6 256.8 209.6 87.2 95.2
Ant 46.5 35.3 98.3 81.0 56.3 45.8 29.3 9.00
Fla 31.5 23.6 96.5 82.8 71.4 66.1 22.8 12.2
Pyr 77.3 66.8 175.5 140.3 86.3 35.3 9.75 9.75
BaAn 70.5 57.0 113.3 96.8 75.8 57.8 24.0 12.0
Chy 96.8 73.5 120.9 98.3 61.1 23.8 6.15 5.64
Bbf 29.9 26.0 31.4 13.5 14.3 14.3 12.7 11.9
Bkf 46.2 40.8 33.9 31.6 24.7 17.0 12.4 12.4
BaP 57.5 48.1 19.9 18.3 15.2 5.94 4.06 5.40
I1P 19.6 10.0 25.3 24.5 11.6 2.41 1.28 0.96
Daa 13.0 10.6 31.2 27.0 14.7 3.25 1.30 1.16
BgP 20.0 17.5 42.6 33.7 15.1 5.12 1.33 1.16
ΣPAHs 3690.9 2272.2 2241.3 1888.2 1568.1 1079.4 646.3 499.9

Table 3. Contents of PAHs of Oily Sludge Samples and Peripheral Soil Samples from 3W

compound 3W-1 3W-2 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8

NaP 1048.6 527.4 693.9 675.1 531.1 503.4 363.9 267.1
Any 546.0 318.0 117.0 65.3 48.8 31.5 21.0 10.4
Ane 678.5 391.6 160.7 130.3 85.0 32.8 23.4 12.5
Flu 812.9 504.7 228.2 180.7 91.4 53.3 33.1 20.9
Phe 527.2 328.8 445.6 324.0 243.2 183.2 105.6 89.6
Ant 58.5 39.0 102.8 84.8 53.3 44.3 31.5 8.25
Fla 38.8 25.1 108.7 93.5 69.2 65.4 24.3 12.9
Pyr 73.4 57.0 164.3 130.5 90.0 36.8 11.3 10.5
BaAn 68.3 58.5 110.3 98.3 81.0 54.8 25.5 12.8
Chy 90.3 65.4 101.9 91.7 63.2 21.6 7.03 7.03
Bbf 26.0 23.6 27.5 18.9 18.2 15.0 13.5 13.5
Bkf 47.8 40.1 34.7 33.1 22.4 15.4 13.9 10.0
BaP 53.6 44.2 21.5 19.1 12.8 8.92 5.55 4.30
I1P 17.2 6.66 29.3 27.7 13.2 1.44 1.04 0.96
Daa 11.4 8.77 28.7 26.2 11.4 2.92 1.28 1.19
BgP 13.5 10.3 33.7 30.5 17.5 4.55 1.16 1.08
262 Shaoping Kuang and Hong Chen

Table 3. (Continued)

compound 3W-1 3W-2 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8

ΣPAHs 4112.0 2449.1 2408.8 2029.7 1451.7 1075.3 683.1 483.0
Content Unit of PAHs in oily sludge: *103 ng/g; Content Unit of PAHs in soil: ng/g ; PAHs: NaP:
naphthalene, Any: acenaphthylene, Ane: acenaphthene, Flu: fluorine, Phe: phenanthrene, Ant:
anthracene, Fla: fluoranthene, Pyr: pyrene, BaAn: benz(a)anthracene, Chy: chrysene, Bbf:
benzo[b]fluoranthene, Bkf: benzo[k]fluorathene, BaP: benzo[a]pyrene, I1P: indeno(1, 2, 3-cd)pyre,
Daa: dibenzo (a, h) anthrace, BgP: benzo(g,h,i)perylene.

Table 4. Contents of PAHs of oily sludge samples and peripheral soil samples from 4W

compound 4W-1 4W-2 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8

NaP 787.6 444.9 573.9 545.4 503.4 456.1 333.9 240.9
Any 506.3 279.8 99.8 56.3 46.5 30.0 17.3 12.0
Ane 612.3 356.5 156.8 122.5 75.7 29.6 20.3 14.0
Flu 643.7 419.8 195.1 143.3 84.2 43.9 26.6 18.7
Phe 308.0 191.2 340.8 233.6 172.0 121.6 69.6 71.2
Ant 36.8 27.0 60.8 50.3 36.0 24.0 9.48 6.03
Fla 22.8 16.7 62.3 60.0 41.0 23.6 12.2 13.7
Pyr 54.8 43.5 119.3 102.8 39.0 17.3 9.12 10.5
BaAn 43.5 36.8 49.5 32.3 26.3 18.0 11.3 12.0
Chy 60.3 46.5 65.4 49.4 33.3 18.0 6.30 4.26
Bbf 22.1 18.2 25.2 14.3 13.5 13.5 11.1 11.9
Bkf 24.7 18.5 23.1 17.7 12.4 11.6 10.0 11.6
BaP 40.3 37.1 15.2 12.8 7.90 2.18 3.83 4.06
I1P 6.66 4.09 11.6 10.0 6.90 1.12 0.96 1.12
Daa 5.97 5.47 14.7 13.9 3.09 1.36 1.28 1.36
BgP 7.70 6.73 8.51 4.07 2.70 1.16 1.08 1.16
ΣPAHs 3183.5 1953.8 1822.0 1468.7 1103.9 813.0 544.4 434.5

DISTRIBUTION CHARACTERISTICS OF PAHS

IN OILY SLUDGE SAMPLES

Total contents of sixteen PAHs are usually used to evaluate the pollution level in
researches [27, 28]. The PAH contents in oily sludges and soils are listed in Table 2-4. PAHs
are detected in oily sludge samples, and the contents of PAHs in oily sludge of different plants
change a bit. Figure 1 shows that the contents of PAHs are the highest in 3W, and fresh oily
sludge and dried oily sludge are up to 4112.0×103 ng/g and 2449.1×103 ng/g respectively. The
contents of PAHs are the lowest in 4W, but fresh oily sludge and dried oily sludge are still up
to 3183.5×103 ng/g and 1952.8×103 ng/g, respectively. The total contents of PAHs in three
different oily sludges from high to low is 3W>3M>4W. Components whose mass fraction in
total mass fraction is more than 5% are characteristic factors, and characteristic factors of
 Distribution and Risk Assessment of PAHs in Soils and Corns… 263

PAHs in oily sludges of three plants are shown in Table 5. Naphthalene, acenaphthylene,
acenaphthene, fluorine and phenanthrene were characteristic factors of PAHs in oily sludge
samples. Mass fractions of characteristic factors of PAHs in fresh oily sludge of 3M, 3W and
4W are 86.2%, 87.9% and 89.8% separately, and mass fractions of characteristic factors of
PAHs in dried oily sludge of 3M, 3W and 4W are 82.0%, 84.5% and 86.7%, respectivley.
Naphthalene, acenaphthylene, acenaphthene, fluorine and phenanthrene, which are major
pollutants of PAHs in oily sludge, affect total contents of PAHs in oily sludge[29].

4500
4000 a
b
3500
total PAHs ( 10 ng/g)

3000
3

2500
2000
1500
1000
500
0
3M 3W 4W
Plant

Figure 1 Contents of PAHs in oil sludge a. fresh oil sludge; b. dried oil sludge.

3000

2500
Total PAHs (ng/g)

2000

1500

1000
3M
500 3W
4W

0
1 10 100 1000
S(m )

Figure 2 The relations between the distances and contents of PAHs in soil samples.
264 Shaoping Kuang and Hong Chen

Table 5. Characteristic factors of PAHs of oily sludge and peripheral soils

from Zhongyuan Oil Field

Compound 3M-1 3M-2 3M-S 3W-1 3W-2 3W-S 4W-1 4W-2 4W-S
NaP √ √ √ √ √ √ √ √ √
Any √ √ √ √ √ √
Ane √ √ √ √ √ √ √ √ √
Flu √ √ √ √ √ √ √ √ √
Phe √ √ √ √ √ √ √ √ √
Pyr √ √
86.2 72.4% 72.8% 86.7 74.2%
n 82.0% 87.9% 84.5% 89.8%
% %
1. “√” represented there were Characteristic factors of PAHs; 2. PAHs without Characteristic factors
were not listed; 3. -S soil samples; 4. n represented mass fraction of Characteristic factors of PAHs
/total mass fraction of PAHs.

DISTRIBUTION CHARACTERISTICS OF PAHS IN SOIL SAMPLES

The results indicate that all sixteen PAHs in soil samples can be detected, and Figure 2
shows that the contents of PAHs in soil samples are dramatically decreased with the increase
of the distance from oily sludge. The contents of PAHs in soil samples in 3M, 3W and 4W are
499.9-2241.3ng/g, 578.1-2408.8ng/g and 434.5-1822.0ng/g, respectively[30]. The order of
pollution degree in soil near the three plants is 3W>3M>4W, which is consistent with the order
of the contents of PAHs of oily sludges in three plants. Table 3 shows that naphthalene,
acenaphthene, fluorine, phenanthrene and pyrene are characteristic factors of PAHs in soil
samples of 3M and 3W, and naphthalene, acenaphthene, fluorine and phenanthrene are
characteristic factors of PAHs in soil samples of 4W. Mass fractions of characteristic factors of
PAHs in soil samples of 3M, 3W and 4W are 72.4%, 72.8% and 74.2%, respectively.

SOURCES OF PAHS IN SAMPLES

It is important to determine sources of PAHs in samples so that environmental harm from
PAHs can be known. Different genetic PAHs have different structure and components, and can
keep stable in the process of migration and deposition. So the component characteristics of
PAHs can be employed as the basis to discriminate sources of pollution. The relative
abundances of PAHs rings can be used to reflected petrogenic sources or pyrogenic sources.
High ring (4- and more ring) PAHs are from pyrogenic sources and Low ring (2-and 3- ring)
PAHs are from petrogenic sources commonly[31]. In analysis of sources of PAHs, ratios of
fluoranthene / pyrene (Fl / Py) have been used to distinguish petrogenic sources and pyrogenic
sources. PAHs are from pyrogenic sources when Fl / Py ratios are generally more than 1, but
PAHs are from petrogenic sources when Fl / Py ratios are generally less than 1[32]. Fl / Py in
samples from Zhongyuan Oil Field are listed in Table 6.
 Distribution and Risk Assessment of PAHs in Soils and Corns… 265

Table 6. Molecular marker (Fl / Py) of PAHs in oil sludge samples and soil samples

sample Fl/Py sample Fl/Py sample Fl/Py

3M-1 0.41 3W-1 0.53 4W-1 0.42
3M-2 0.35 3W-2 0.44 4W-2 0.38
3M-3 0.55 3W-3 0.66 4W-3 0.52
3M-4 0.59 3W-4 0.72 4W-4 0.58
3M-5 0.83 3W-5 0.77 4W-5 1.05
3M-6 1.87 3W-6 1.78 4W-6 1.36
3M-7 2.34 3W-7 2.15 4W-7 1.34
3M-8 1.25 3W-8 1.23 4W-8 1.30

Figure 3 is the distribution characteristics of different rings PAHs. It shows that 2-3 rings
PAHs are the most predominant components of PAHs in fresh oily sludge samples (up to
89.2%) and dried oily sludge samples (up to 85.8%). But there are a few of 4-6 rings PAHs in
fresh oily sludge samples (only 10.8%) and dried oily sludge samples (only 14.2%). Fl / Py
ratios in fresh oily sludge samples of 3M, 3Wand 4W are 0.41, 0.53 and 0.42, respectively, and
Fl / Py ratios in dried oily sludge samples of 3M, 3Wand 4W are 0.35, 0.44 and 0.38,
respectively. Fl / Py ratios in all oily sludge samples are less than 1. These component
characteristics of PAHs reveal that the sources of PAHs in oily sludge samples are mainly
from petrogenic sources.

70
percentage of different ring PAHs( %)

60

a
50
b

40

30

20

10

0
2 3 4 5 6

rin g

Figure 3 The percentage of PAHs with different rings in oil sludge samples. a. fresh oil sludge; b. dried
oil sludge.
266 Shaoping Kuang and Hong Chen

a 3M
80
b
60

percentage of different ring PAHs( %)

40

20

0
80 3W

60

40

20

0
4W
80

60

40

20

0
1 2 3 4 5 6

rin g

Figure 4. Percentage of PAHs with different rings in soil samples. a. 2-3 ring PAHs; b. 4-6 ring PAHs; 1-
6 were distant 10m, 20m, 50, 100, 200m and 500m to oil sludge, respectively.

Figure 4 shows the 2-3 rings PAHs are predominant relative to 4-6 rings PAHs, suggesting
that sources of PAHs in soil samples are from petrogenic sources. Fl / Py ratios (Table 6) are
from 0.52 to 2.34. In soil samples nearby oily sludge of 3M, 3W and 4W, Fl / Py ratios
increase with the increase of the distance from the oily sludge. It can be explained that the
petrogenic soil samples mainly for 2-3 ring PAHs can easily volatile and spread for a long
distance, and pyrogenic soil samples mainly for 5-6 ring PAHs are with poor transfer ability in
solid phase and stable in soil, the Fl / Py ratios for the soil samples with the distance over 500
m are less than those for the soil samples with the distance over 200 m and 100 m. The
distance from the oily sludge of 3M and 3W over 100m and the distance from the oily sludge
of 4W over 50 m, Fl / Py ratios in soil samples begin to be greater than 1, indicating that
pyrogenic sources become gradually the major source of PAHs in soil out of the certain
distance from the oily sludge. According to the component characteristics of PAHs in soil
samples and Fl / Py ratios, petrogenic sources are the major source of PAHs in soil samples
next to the oily sludge. Petrogenic PAHs are mainly from the oily sludge; the effect of the oily
sludge is less with the increase of the distance from the oily sludge, and the contribution of
petrogenic sources is less and less with the increase of the distance from the oily sludge.
Pyrogenic PAHs are mainly from oil flaming in the refinery around the oily sludge; the effect
of the distance from the oily sludge was much less to pyrogenic PAHs, and the contribution of
pyrogenic sources is more and more with the contribution of petrogenic sources decreasing.
Both petrogenic and pyrogenic sources are the major sources of PAHs in soil after the distance
increase to a certain boundary.
 Distribution and Risk Assessment of PAHs in Soils and Corns… 267

180 250
120 Ane
700
NaP Any 160 Flu
140 200
600 a 100
120 a
500
80
a 100
150 a
60 80
400 b 40 60
100

300 20
b 40 b 50 b
20
200 120
0 120
0
180
450 Phe 100
Ant 100
Fla 160 Pyr
400
350 80
140 a
a 80
a
120
300
60 a 60
100
250 80
200 40 60
40
150 b 20 b b 40
b
100 20 20
50 0 0
140 0
35
120 BaAn 120 Chy Bbf 35 Bkf
30
100 100 30
80 80 25 a
a a a 25
60 60 20 20
40 40
15
b 20 b b
15
b
20
0 10 10
25
0 35 50
BaP 30
I1P 30 Daa BgP
20 25 40
25
a 20 a 30
15
15
a 20

10
15 20 a
10 10
10
5 b 5
b 5
b b
0 0 0
0
500 1000 1500 2000 2500 500 1000 1500 2000 2500 500 1000 1500 2000 2500 500 1000 1500 2000 2500

Σ PAHs Σ PAHs Σ PAHs Σ PAHs

Figure 5 The relations between sixteen PAHs in soil samples and total PAHs of the corresponding
samples. The content unit of PAHs in soil: ng/g ; a. petrogenic soil samplesand; b. mixed soil samples.

Soil samples can be divided into petrogenic soil samples and both petrogenic and
pyrogenic soil samples by the different sources of PAHs. The relation of the sixteen
components of PAHs in soil samples and the total contents of PAHs of the corresponding
sampling points are showed in Figure 5. The distribution characteristics of 2-3 ring PAHs in
petrogenic soil samples and both petrogenic and pyrogenic soil samples have a little change;
Those with 4 ring PAHs in petrogenic soil samples and both petrogenic and pyrogenic soil
samples have various especially for the sampling points far away from oily sludge; those with
5-6 ring PAHs in petrogenic soil samples and both petrogenic and pyrogenic soil samples are
completely different. Compared with 5-6 ring PAHs, 2-3 ring PAHs, which are mainly from
petrogenic sources, can easily volatile and spread for a long distance, and degrade by light and
organism in soil. However, 5-6 ring PAHs, which are mainly from pyrogenic sources, are
stable in its environment. Consequently, the distribution of 2-3 ring PAHs in petrogenic soil
samples and both petrogenic and pyrogenic soil samples have a little change. In petrogenic soil
samples, 5-6 ring PAHs are mainly from petrogenic sources, and pyrogenic sources have a
little contribution. In both petrogenic and pyrogenic soil samples, 5-6 ring PAHs are mainly
from pyrogenic sources, and petrogenic sources have little contribution, because of 5-6 ring
268 Shaoping Kuang and Hong Chen

PAHs with poor transfer ability in solid phase and stable in soil. The contents of 5-6 ring
PAHs had little change, and the distribution characteristics of 5-6 ring PAHs in petrogenic soil
samples and both petrogenic and pyrogenic soil samples were completely different.

ACCUMULATION OF PAHS IN CORN ROOT SAMPLES

Distribution Characteristics of PAHs in Corn Root Samples

The concentrations of PAHs in corn roots are listed in Table 7. The results indicate that all
sixteen PAHs in corn root samples can be detected. The contents of PAHs in corn roof samples
in 3M, 3W and 4W are 117.38-605.76ng/g, 112.32-637.93ng/g and 103.14-465.13ng/g,
respectively.
The order of PAHs contents in corn root samples is 3W>3M>4W, which is consistent with
the order of pollution degree in soil near the three plants of oily sludges[33]. Puting a
regression analysis to the contents of PAHs in the soil and the corn root around oily sludges
plants, the results indicate that they exist good linear relationship with a correlation coefficient
0.9628, so they present remarkable positive correlation which illuminants that the PAHs
contents in soil near the three plants of oily sludges influence the absorption of PAHs in the
corn root. Concentrations of PAHs with various tings in corn root samples are listed in Figure
6, showing that 2-4 rings PAHs are the most predominant components of PAHs in corn root
around Oil Field, which is consistent with the characteristic of PAHs contents in soil near the
three plants of oily sludges.

700
6 rings
Concentrations of PAHs with various rings(ng/g)

600 5 rings
4 rings
3 rings
500
2 rings

400

300

200

100

0
3M-33M-43M-53M-63M-73M-83W-33W-43W-53W-63W-73W-84W-34W-44W-54W-64W-74W-8
samples

Figure 6. Concentrations of PAHs with various rings in corn root sample.

 Distribution and Risk Assessment of PAHs in Soils and Corns… 269

Concentrations of PAHs with various rings(ng/g)

1200
6 rings
5 rings
1000 4 rings
3 rings
2 rings
800

600

400

200

0
3M-33M-43M-53M-63M-73M-83W -33W-43W-53W-63W-73W-84W-34W-44W-54W-64W-74W-8
samples

Figure 7. Concentrations of PAHs with various tings in corn leaf samples (ng/g).

The Plant Concentration Factor of PAHs in Corn Root Samples

Plant concentration factors (PCF) usually reflect accumulation ability of contamination in

plant root, the accumulation ability may stronger with the value of PCF increasing. Plant
concentration factor is a ratio of contamination content in plant and contamination
concentration in soil (dried weight). Plant concentration factors in corn roots which were
collected from Zhongyuan Oil Field are listed in Table 8.
The results (Table 8) indicate that Plant concentration factors in corn roots are 0.30-0.52,
but the Plant concentration factors of 5 and 6 rings compounds are more than 1. Generally,
PAHs of different rings have diffenent PCF, and the more rings compounds have, the bigger
PCF are.

The Relationship Between PAHs Contents in Summer Soils and in Corn Roots

The relationship between PAHs contents in summer soils and in corn roots are listed in
Table 9. The results indicate that they exist good linear relationship with a correlation
coefficient 0.9845-0.9914, so they present remarkable positive correlation which illuminants
that the PAHs contents in soil near the three plants of oily sludges influence the absorption of
PAHs in the corn root.
270 Shaoping Kuang and Hong Chen

The Relationship Between PAHs Contents in Corn Roots and the Logkow
of 16 Pahs

A good many researches indicate that the absorption of PAHs in the plant and its KOW
have remarkable relationship. Lipophilic (logKOW>4) organic pollutants are mainly in the
root epidermis, and the ability of distribution to the root related to KOW of pollutants;
currently, if pollutants have high lipophilic property, the content of them are high in the root.
The logKOW of PAHs were listed in Table 10. We can see that the logKOW of all PAHs are
bigger than 4 except NaP and Ane. The relationship between PAHs contents in corn roots and
the logKOW of 16 PAHs (Table 11) indicate that they exist good linear relationship with a
correlation coefficient 0.8298-0.9066, so they present remarkable positive correlation which
illuminants that the KOW of PAHs influence the concentration of PAHs in the corn root.

Table 9. The relationship between PAHs contents in soils and in corn roots

samples R2 samples R2 samples R2

3M-3 0.9906 3W-3 0.9909 4W-3 0.9914
3M-4 0.9893 3W-4 0.9893 4W-4 0.9899
3M-5 0.9889 3W-5 0.9886 4W-5 0.9890
3M-6 0.9884 3W-6 0.9881 4W-6 0.9885
3M-7 0.9862 3W-7 0.9869 4W-7 0.9851
3M-8 0.9851 3W-8 0.9858 4W-8 0.9845

Table 10. The logKOW of 16 PAHs

PAHs logKOW PAHs logKOW

NaP 3.29 BaAn 5.61
Any 4.07 Chy 5.16
Ane 3.98 Bbf 6.04
Flu 4.18 Bkf 6.06
Phe 4.45 BaP 6.06
Ant 4.45 I1P 6.58
Fla 4.90 Daa 6.84
Pyr 4.88 BgP 6.50

Table 11. The relationship between PAHs contents in corn roots

and the logKOW of 16 PAHs

samples R2 samples R2 samples R2

3M-3 0.9046 3W-3 0.9045 4W-3 0.9031
3M-4 0.9035 3W-4 0.9061 4W-4 0.8997
3M-5 0.9066 3W-5 0.9060 4W-5 0.9260
3M-6 0.8972 3W-6 0.8754 4W-6 0.8990
3M-7 0.8697 3W-7 0.8487 4W-7 0.8516
3M-8 0.8298 3W-8 0.8455 4W-8 0.8461
 Table 7. Concentrations (ng/g) of PAHs in corn roots

components 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8
NaP 101.07 98.98 99.35 80.27 56.02 43.31 114.96 111.88 88.25 83.70 54.59 42.07 95.56 90.87 83.95 76.17 53.09 38.14
Any 29.45 18.16 15.06 9.94 5.94 3.89 33.35 19.10 14.55 9.78 6.19 3.72 28.69 16.67 13.96 9.39 5.46 4.12
Ane 39.95 33.20 25.38 10.16 7.13 4.41 44.87 36.59 24.25 10.03 6.73 4.21 43.94 34.57 21.78 9.18 6.25 4.59
Flu 50.11 39.86 32.59 11.91 8.29 6.57 60.51 48.14 24.89 14.97 8.78 5.87 52.05 38.52 23.09 12.56 7.53 5.65
Phe 75.63 58.32 48.56 39.84 15.92 17.28 83.97 61.35 46.32 35.17 17.95 16.33 64.67 44.67 33.18 23.78 13.83 12.24
Ant 30.06 24.96 17.68 14.59 9.04 3.54 31.57 26.23 16.90 14.23 9.34 3.14 19.18 16.05 11.80 8.23 3.67 2.73
Fla 33.34 28.88 25.17 23.45 8.72 5.65 37.53 32.55 24.60 23.36 8.97 5.76 22.42 21.66 15.43 9.72 5.65 5.95
Pyr 59.87 48.23 30.38 13.52 4.76 4.86 56.50 45.26 31.79 14.10 5.04 4.79 41.66 36.16 14.87 7.64 4.87 4.79
BaAn 40.11 34.53 27.43 21.34 9.21 5.48 39.33 35.25 29.36 20.45 9.18 5.83 18.70 12.83 10.79 7.95 5.36 5.18
Chy 42.43 34.84 22.34 9.80 3.66 3.51 36.26 32.81 23.18 9.12 3.73 3.63 24.00 18.57 13.11 7.92 3.81 2.98
Bbf 15.62 7.33 7.73 7.71 6.52 6.16 13.90 9.89 9.57 8.07 6.54 6.44 12.87 7.77 7.40 7.40 5.82 5.62
Bkf 16.21 15.18 12.09 8.65 6.17 6.27 16.66 15.94 11.13 7.99 6.58 5.05 11.48 9.05 6.66 6.30 5.88 5.64
BaP 9.86 9.11 7.65 3.29 2.31 2.89 10.68 9.54 6.56 4.72 2.65 2.41 7.72 6.58 4.25 1.53 2.31 2.21
I1P 17.29 16.76 8.21 2.11 1.35 1.26 20.07 19.00 9.32 1.48 1.10 1.03 8.28 7.21 5.13 1.27 1.26 1.15
Daa 15.60 13.56 7.58 2.01 1.05 1.04 14.47 13.25 6.01 1.87 0.97 0.93 7.65 7.26 1.95 1.11 1.07 0.99
BgP 29.16 23.16 10.64 3.93 1.36 1.26 23.30 21.14 12.33 3.56 1.16 1.11 6.26 3.25 2.32 1.27 1.21 1.16
ΣPAHs 605.76 505.06 397.84 262.52 147.45 117.38 637.93 537.92 379.01 262.6 149.5 112.32 465.13 371.69 269.67 191.42 127.07 103.14
 Table 8. Plant concentration factors in corn roots

components 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8
NaP 0.19 0.22 0.34 0.34 0.32 0.32 0.19 0.24 0.34 0.34 0.31 0.329 0.20 0.21 0.34 0.345 0.33 0.32
Any 0.32 0.39 0.60 0.63 0.61 0.66 0.34 0.42 0.61 0.63 0.59 0.69 0.34 0.37 0.61 0.63 0.63 0.66
Ane 0.31 0.37 0.58 0.618 0.59 0.64 0.33 0.41 0.59 0.62 0.58 0.65 0.33 0.35 0.59 0.62 0.61 0.64
Flu 0.30 0.35 0.55 0.58 0.55 0.57 0.31 0.39 0.56 0.57 0.54 0.55 0.32 0.34 0.56 0.58 0.57 0.59
Phe 0.21 0.25 0.39 0.39 0.37 0.37 0.22 0.27 0.39 0.39 0.35 0.37 0.22 0.24 0.40 0.40 0.40 0.35
Ant 0.34 0.41 0.65 0.65 0.63 0.75 0.36 0.45 0.65 0.66 0.60 0.73 0.37 0.40 0.67 0.69 0.75 0.85
Fla 0.39 0.46 0.73 0.73 0.761 0.90 0.411 0.50 0.73 0.73 0.74 0.87 0.42 0.45 0.77 0.83 0.90 0.85
Pyr 0.38 0.45 0.73 0.79 0.97 0.99 0.40 0.50 0.73 0.79 0.88 0.90 0.41 0.44 0.78 0.90 1.06 0.90
BaAn 0.40 0.47 0.75 0.76 0.78 0.90 0.42 0.52 0.75 0.7 0.73 0.91 0.45 0.50 0.84 0.89 0.94 0.84
Chy 0.39 0.47 0.76 0.84 1.18 1.21 0.42 0.52 0.76 0.86 1.04 1.01 0.43 0.47 0.81 0.90 1.19 1.35
Bbf 0.56 0.72 1.10 1.10 1.05 1.06 0.59 0.75 1.09 1.11 0.99 0.98 0.60 0.68 1.12 1.12 1.08 0.97
Bkf 0.54 0.64 1.01 1.04 1.01 1.03 0.56 0.70 1.02 1.07 0.97 1.03 0.59 0.64 1.09 1.11 1.20 0.99
BaP 0.56 0.66 1.03 1.13 1.16 1.07 0.58 0.72 1.06 1.07 0.95 1.10 0.60 0.65 1.09 1.39 1.22 1.11
I1P 0.77 0.91 1.47 1.76 1.93 2.52 0.81 0.99 1.46 1.85 1.83 2.06 0.84 0.90 1.51 2.12 2.52 1.92
Daa 0.56 0.66 1.07 1.26 1.50 1.73 0.59 0.73 1.07 1.25 1.39 1.33 0.61 0.65 1.50 1.85 1.783 1.65
BgP 0.77 0.91 1.46 1.57 1.94 2.10 0.81 1.00 1.47 1.62 1.93 1.85 0.87 0.98 1.78 2.12 2.42 1.93
ΣPAHs 0.30 0.35 0.52 0.50 0.47 0.48 0.31 0.38 0.54 0.50 0.45 0.47 0.30 0.32 0.50 0.48 0.47 0.48
 Shaoping Kuang and Hong Chen 273

ACCUMULATION OF PAHS IN CORN LEAF SAMPLES

Distribution Characteristics of PAHs in Corn Leaf Samples

The concentrations of PAHs in corn leaf are listed in Table 12. The results indicate that all
sixteen PAHs in corn leaf samples can be detected. The contents of PAHs in corn leaf samples
in 3M, 3W and 4W are 124.43～1025.43ng/g、128.43～1121.43ng/g and121.43～1069.43
ng/g, respectively. The order of PAHs contents in corn leaf samples is 3W>4W>3M, which is
inconsistent with the order of pollution degree in soil near the three plants of oily sludges.
Concentrations of PAHs with various rings in corn leaf samples are listed in Figure 7, showing
that 5 and 6 rings PAHs are the most predominant components of PAHs in corn leaf around
Oil Field, which is inconsistent with characteristics of PAHs contents in soil and corn root
around the three plants of oily sludges. Because the volatility of diversified PAHs in the corn
leaf which originate mainly from atmosphere is different, the expressive modality and mutual
transformation character of PAHs are very great distinctive[34]. In general condition, the most
predominant existing forms of 2 and 3 rings PAHs are gaseity, gaseity and granule are
allocating balance comparatively in 4 rings PAHs, and 5 and more rings PAHs mainly exist in
granule[35]. Because the corn leaf is slightness and pilosity, it has large contact area with the
environment. During the period of adsorbing the atmosphere grain thing with long hours, the
low rings PAHs re-releases atmosphere again, so 5 and 6 rings PAHs are the most predominant
components of PAHs in corn leaf.

The Plant Concentration Factor of PAHs in Corn Leaf Samples

Plant concentration factors in corn leaves which were collected from Zhongyuan Oil Field
are listed in Table 13. The results indicate that Plant concentration factors in corn leaves are
0.43-1.47, but the Plant concentration factors of 5 and 6 rings compounds are more than 1.
Generally, PAHs of different rings have diffenent PCF, and the more rings compounds have,
the bigger PCF are.

The Relationship Among PAHs Contents in Corn Leaves and in Summer Soils
and in Corn Roots

The relationship among PAHs contents in corn leaves and in summer soils and in corn
roots are listed in Table 14 and Table 15. The results indicate that they exist good linear
relationship with a perfect correlation coefficient, so they present remarkable positive
correlation which illuminants that the PAHs contents in soil and in corn root near the three
plants of oily sludges influence the accumulation and distribution of PAHs in the corn leaf.
 Table 12 Concentrations (ng/g) of PAHs in corn leaves

compponents 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8

NaP 70.52 62.62 45.93 40.02 9.72 8.63 77.12 63.65 48.88 41.40 9.86 8.90 73.55 63.31 47.44 40.23 10.21 8.42

Any 36.08 32.04 23.52 20.50 5.02 4.46 39.45 32.57 25.02 21.20 5.09 4.60 37.63 32.40 24.29 20.60 5.26 4.35

Ane 30.37 27.04 20.02 17.54 4.79 4.33 33.14 27.48 21.26 18.11 4.85 4.44 31.64 27.33 20.66 17.62 4.99 4.24

Flu 37.66 33.61 25.06 22.03 6.51 5.95 41.04 34.14 26.57 22.74 6.58 6.09 39.21 33.97 25.84 22.14 6.76 5.84

Phe 61.01 54.34 40.24 35.25 9.68 8.75 66.57 55.21 42.74 36.41 9.79 8.98 63.56 54.92 41.52 35.43 10.08 8.57

Ant 28.13 25.05 18.54 16.23 4.41 3.98 30.70 25.45 19.69 16.77 4.47 4.09 29.31 25.32 19.13 16.31 4.60 3.90

Fla 23.15 20.65 15.38 13.52 3.95 3.60 25.23 20.98 16.31 13.95 3.99 3.69 24.11 20.87 15.86 13.58 4.10 3.53

Pyr 29.92 26.60 19.61 17.13 4.43 3.97 32.68 27.04 20.84 17.70 4.49 4.08 31.18 26.89 20.24 17.21 4.63 3.88

BaAn 36.48 32.52 24.13 21.17 5.95 5.40 39.80 33.03 25.62 21.86 6.02 5.54 38.00 32.86 24.89 21.27 6.19 5.30

Chy 41.75 37.21 27.61 24.22 6.80 6.16 45.55 37.80 29.31 25.01 6.88 6.32 43.49 37.61 28.48 24.33 7.07 6.05

Bbf 52.90 47.24 35.29 31.06 9.36 8.57 57.62 47.98 37.40 32.04 9.46 8.77 55.07 47.73 36.37 31.20 9.70 8.42

Bkf 66.24 59.04 43.83 38.45 10.84 9.84 72.25 59.98 46.52 39.70 10.97 10.09 69.00 59.67 45.21 38.63 11.28 9.65

BaP 92.08 81.99 60.65 53.10 14.38 12.98 100.51 83.30 64.43 54.86 14.56 13.33 95.95 82.86 62.58 53.36 15.00 12.71

I1P 99.02 87.43 62.93 54.26 9.81 8.20 108.70 88.94 67.27 56.28 10.01 8.60 103.45 88.44 65.15 54.57 10.52 7.90

Daa 120.69 106.73 77.23 66.79 13.25 11.31 132.34 108.55 82.45 69.21 13.49 11.79 126.03 107.94 79.90 67.15 14.10 10.94

BgP 199.42 176.31 127.46 110.18 21.54 18.32 218.72 179.32 136.11 114.20 21.94 19.13 208.27 178.32 131.89 110.78 22.94 17.72

ΣPAHs 1025.43 910.43 667.43 581.43 140.43 124.43 1121.43 925.43 710.43 601.43 142.43 128.43 1069.43 920.43 689.43 584.43 147.43 121.43
 Distribution and Risk Assessment of PAHs in Soils and Corns… 275

Table 13. Plant concentration factors in corn leaves

components 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8

NaP 0.13 0.14 0.16 0.17 0.06 0.06 0.13 0.14 0.19 0.17 0.06 0.07 0.15 0.15 0.19 0.18 0.06 0.07

Any 0.39 0.68 0.94 1.29 0.51 0.76 0.4 0.72 1.05 1.37 0.48 0.85 0.45 0.72 1.07 1.39 0.6 0.7

Ane 0.24 0.3 0.46 1.06 0.4 0.63 0.24 0.3 0.51 1.12 0.41 0.68 0.24 0.28 0.56 1.2 0.49 0.59

Flu 0.22 0.3 0.42 1.07 0.43 0.51 0.21 0.27 0.6 0.87 0.4 0.57 0.24 0.3 0.63 1.03 0.51 0.61

Phe 0.17 0.23 0.32 0.35 0.23 0.19 0.18 0.25 0.36 0.41 0.19 0.2 0.22 0.29 0.5 0.6 0.29 0.24

Ant 0.32 0.41 0.68 0.73 0.31 0.85 0.35 0.43 0.76 0.78 0.29 0.95 0.57 0.63 1.09 1.37 0.94 1.22

Fla 0.27 0.33 0.44 0.42 0.35 0.57 0.27 0.32 0.49 0.44 0.33 0.56 0.46 0.44 0.79 1.16 0.65 0.5

Pyr 0.19 0.25 0.47 1 0.9 0.81 0.23 0.3 0.48 0.99 0.79 0.77 0.31 0.33 1.07 2.02 1.01 0.73

BaP 5.2 5.94 8.2 18.31 7.19 4.81 5.49 6.31 10.39 12.47 5.2 6.06 7.44 8.12 16.05 48.51 7.89 6.36

Daa 4.34 5.23 10.88 41.74 18.93 18.85 5.42 6 14.72 46.14 19.27 16.84 10.08 9.72 61.46 111.92 23.5 18.23

BgP 5.26 6.91 17.46 44.07 30.77 30.53 7.65 8.5 16.2 51.91 36.57 31.88 28.93 54.04 101.45 184.63 45.88 29.53

ΣPAHs 0.51 0.64 0.88 1.11 0.44 0.50 0.55 0.66 1.01 1.15 0.43 0.54 0.69 0.78 1.29 1.47 0.55 0.56
276 Distribution and Risk Assessment of PAHs in Soils and Corns…

Table 14. The relationship between PAHs contents in soils and in corn leaves

samples R2 samples R2 samples R2

3M-3 0.9305 3W-3 0.9252 4W-3 0.9145
3M-4 0.9229 3W-4 0.9189 4W-4 0.9034
3M-5 0.9044 3W-5 0.9096 4W-5 0.8805
3M-6 0.8803 3W-6 0.8766 4W-6 0.8461
3M-7 0.8579 3W-7 0.8656 4W-7 0.8374
3M-8 0.8593 3W-8 0.8687 4W-8 0.8608

Table 15. The relationship between PAHs contents in corn leaves and roots

samples R2 samples R2 samples R2

3M-3 0.9604 3W-3 0.9560 4W-3 0.9438
3M-4 0.9580 3W-4 0.9555 4W-4 0.9386
3M-5 0.9457 3W-5 0.9493 4W-5 0.9273
3M-6 0.9272 3W-6 0.9252 4W-6 0.9046
3M-7 0.9218 3W-7 0.9253 4W-7 0.9112
3M-8 0.9274 3W-8 0.9246 4W-8 0.9286

THE POLLUTION DEGREE OF PAHS AND ECOLOGICAL RISK

ASSESSMENT IN SOILS AROUND ZHONGYUAN OIL FIELD
The Pollution Degree Evaluation of PAHs in Soils Around Zhongyuan
Oil Field in Winter
Many related researches at home and abroad show that the total content of the
environment priority control of 16 typical PAHs were usually chose to evaluate their pollution
level. west Europe proposed that the pollution degree of PAHs in soils were divided into four
grade, not contaminated, light contaminated, medium contaminated, heavily contaminated,
based on the content determination rang of PAHs in soils, the evaluation of exposure risk to
human and the average absorption rate. They are listed in Table 16. According to this standard,
Evaluating results of the PAHs pollution in soils of Zhongyuan oil field in winter are listed in
Table 17. The pollution level of PAHs in soils around Zhongyuan Oil Field is correlative with
the distance from oily sludge plants, which represents that the pollution level of PAHs in soils
are dramatically decreased with the increase of the distance from oily sludge plants.

Table 16. Pollution levels of PAHs in soils（ng/g）

Pollution levels of not light medium heavily

PAHs in soils (K) contaminated contaminated contaminated contaminated
Concentration ranges of
<200 200-600 600-1000 >1000
PAHs in soils
 Distribution and Risk Assessment of PAHs in Soils and Corns… 277

Table 17. Evaluating results of the PAHs pollution in soils of Zhongyuan

oil field in winter

soils K soils K soils K

heavily heavily heavily
3M-3 3W-3 4W-3
contaminated contaminated contaminated
heavily heavily heavily
3M-4 3W-4 4W-4
contaminated contaminated contaminated
heavily heavily heavily
3M-5 3W-5 4W-5
contaminated contaminated contaminated
heavily heavily medium
3M-6 3W-6 4W-6
contaminated contaminated contaminated
medium medium light
3M-7 3W-7 4W-7
contaminated contaminated contaminated
light light light
3M-8 3W-8 4W-8
contaminated contaminated contaminated

The soil samples of 3M-3、3M-4、3M-5、3M-6、3W-3、3W-4、3W-5、3W-6、4W-

3、4W-4 and 4W-5 are heavily contaminated; the soil samples of 3M-7、3W-7 and 4W-6 are
medium contaminated; the soil samples of 3M-8、3W-8、4W-7 and 4W-8 are light
contaminated. In the soil samples of Zhongyuan oil field in winter, heavily contaminated
account for 61.1%; medium contaminated account for 16.7%; light contaminated account for
22.2%. The pollution degree around soils in 4W is lower than the soils in 3M and 3W, which
because the content of PAHs in 4W oil sludge is lower than that of 3M and 3W oil sludge.

The Comparision Between the Pollution Degree of PAHs in Soils

of Zhongyuan Oil Field in Winter and Other Cities

What level was the pollution of PAHs in soils of Zhongyuan oil field in winter in need
being combined with PAHs in different areas (Table 18). In this research, the contents of
PAHs in soil samples in 3M, 3W and 4W are 499.9-2241.3ng/g, 578.1-2408.8ng/g and 434.6-
1822.0ng/g, respectively. The minimum value of the PAHs content in all soil samples are
higher than that of rest areas except Estonia city. The maximum content of PAHs in soil
samples outclass the soils of Thailand city, the soils of Britain rural and the soils of Estonia
rural, are higher than the paddy soils of South Koreas, and are approximately quite the same as
the mountain soils of South Koreas and the agricultural soils of Greece, are lower than the
agricultural soils of Dongguan city, are far lower than the soils of Britain city and the soils of
Estonia city. The pollution level of PAHs in soils of Zhongyuan oil field in winter belong to
moderately-polluted compared to the pollution of other areas.
278 Shaoping Kuang and Hong Chen

Table 18, PAHs with different areas (ng/g)

sites the number of samples the contents of PAHs

the agricultural soils of Dongguan
64 29-4079
city
the mountain soils of South Koreas 14 23.3-2834
the paddy soils of South Koreas 36 38.3-1057
the agricultural soils of Greece 24 38-2244
the soils of Thailand city 52 12-380
the soils of Estonia rural 28 233-770
the soils of Estonia city 16 2200-12390
the soils of Britain rural 34 79-894
the soils of Britain city 52 126-6274

The Health Risk Assessment in Soils of Zhongyuan Oil Field in Winter

According to the health risk assessment, different PAHs have different toxicity. We cannot
only simply plus the concentration of these compounds to evaluate human exposure dose,
while should combine with toxicity equivalent factors(TEF) of different composition to
calculate equivalent concentration. Based on the toxic equivalency factors (TEF) for 16
priority control PAHs given by Nisbet and LaGoy (Table 19)，calculated by the equivalent
concentrations (BaPep )of the reference object (BaP), BaP equivalent concentrations of PAHs
in soil samples in winter were listed in Table 20.

Table 19. The Toxic Equivalency Factors (TEF) For16 Pahs

PAHs TEF PAHs TEF PAHs TEF PAHs TEF

NaP 0.001 Phe 0.001 BaAn 0.1 BaP 1
Any 0.001 Ant 0.01 Chy 0.01 I1P 0.1
Ane 0.001 Fla 0.001 Bbf 0.1 Daa 1
Flu 0.001 Pyr 0.001 Bkf 0.1 BgP 0.01

Figure 8 shows that the distribution of BaP equivalent concentrations of PAHs in soil
samples in winter which were obtained by conversion are basically identical with the gross
distribution of PAHs which were obtained by measurement. Also it can reach maximum value
near oil sludge sampling point, and reach minimum value in the farthest oil sludge sampling
point, which mainly because the distribution of PAHs in different samples were comparative
closely.
Contribution rates of different rings PAHs on BaP equivalent concentrations in soil
samples in winter are listed in Figure 9. The distribution of different rings PAHs on BaP
equivalent concentrations and on PAHs measured total quantity have very great difference.
This is mainly caused by the difference of TEF. Because of TEF value is very low,
Contribution rates of 2-3 rings PAHs which originally occupied a large proportion in the
concentration of total PAHs on BaP equivalent concentrations are very little. While because of
 Distribution and Risk Assessment of PAHs in Soils and Corns… 279

TEF value is very high, Contribution rates of 5 rings PAHs which originally occupied a small
proportion in the concentration of total PAHs on BaP equivalent concentrations are very large.

80
BaP equivalent concentrations of PAHs (ng/g)

70

60

50

40

30

20

10

0
3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8
samples

Figure 8. The distribution of BaP equivalent concentrations of PAHs in soil samples in winter.

2 rings 3 rings 4 rings 5 rings 6 rings

100

80
percentage (%)

60

40

20

0
3M-33M-43M-53M-63M-73M-83W-33W-43W-53W-63W-73W-84W-34W-44W-54W-64W-74W-8
samples

Figure 9. Contribution rates of different rings PAHs on BaP equivalent concentrations in winter.
 Table 20. BaP equivalent concentrations of PAHs in soil samples in winter (ng/g)

Comp
o- 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8
nents
0.531 0.456
NaP 0.6129 0.6001 0.6024 0.4854 0.3601 0.2754 0.6939 0.6751 0.5034 0.3639 0.2671 0.5739 0.5454 0.5034 0.3339 0.2409
1 1
0.048
Any 0.1035 0.0623 0.051 0.0323 0.0195 0.0114 0.117 0.0653 0.0315 0.021 0.0104 0.0998 0.0563 0.0465 0.03 0.0173 0.012
8
0.029
Ane 0.1435 0.1186 0.0897 0.0335 0.0242 0.0133 0.1607 0.1303 0.085 0.0328 0.0234 0.0125 0.1568 0.1225 0.0757 0.0203 0.014
6
0.091 0.043
Flu 0.1894 0.1498 0.1217 0.0418 0.0302 0.023 0.2282 0.1807 0.0533 0.0331 0.0209 0.1951 0.1433 0.0842 0.0266 0.0187
4 9
0.243 0.121
Phe 0.4032 0.3096 0.2568 0.2096 0.0872 0.0952 0.4456 0.324 0.1832 0.1056 0.0896 0.3408 0.2336 0.172 0.0696 0.0712
2 6
Ant 0.983 0.81 0.563 0.458 0.293 0.09 1.028 0.848 0.533 0.443 0.315 0.0825 0.608 0.503 0.36 0.24 0.0948 0.0603
0.069 0.023
Fla 0.0965 0.0828 0.0714 0.0661 0.0228 0.0122 0.1087 0.0935 0.0654 0.0243 0.0129 0.0623 0.06 0.041 0.0122 0.0137
2 6
0.0097 0.0097 0.017 0.0091
Pyr 0.1755 0.1403 0.0863 0.0353 0.1643 0.1305 0.09 0.0368 0.0113 0.0105 0.1193 0.1028 0.039 0.0105
5 5 3 2
BaAn 11.33 9.68 7.58 5.78 2.4 1.2 11.03 9.83 8.1 5.48 2.55 1.28 4.95 3.23 2.63 1.8 1.13 1.2

Chy 1.209 0.983 0.611 0.238 0.0615 0.0564 1.019 0.917 0.632 0.216 0.0703 0.0703 0.654 0.494 0.333 0.18 0.063 0.0426

Bbf 3.14 1.35 1.43 1.43 1.27 1.19 2.75 1.89 1.82 1.5 1.35 1.35 2.52 1.43 1.35 1.35 1.11 1.19

Bkf 3.39 3.16 2.47 1.7 1.24 1.24 3.47 3.31 2.24 1.54 1.39 1 2.31 1.77 1.24 1.16 1 1.16

BaP 19.9 18.3 15.2 5.94 4.06 5.4 21.5 19.1 12.8 8.92 5.55 4.3 15.2 12.8 7.9 2.18 3.83 4.06

I1P 2.53 2.45 1.16 0.241 0.128 0.096 2.93 2.77 1.32 0.144 0.104 0.096 1.16 1 0.69 0.112 0.096 0.112

Daa 31.2 27 14.7 3.25 1.3 1.16 28.7 26.2 11.4 2.92 1.28 1.19 14.7 13.9 3.09 1.36 1.28 1.36
0.011
BgP 0.426 0.337 0.151 0.0512 0.0133 0.0116 0.337 0.305 0.175 0.0455 0.0116 0.0108 0.0851 0.0407 0.027 0.0108 0.0116
6
ΣPAH 75.832 65.533 19.992 11.319 10.884 74.682 66.769 40.17 22.114 13.203 9.115 9.1036
45.1443 9.8035 43.7351 36.4316 18.5818 9.5775
s 5 5 2 55 25 4 4 87 9 5 7 2
 Shaoping Kuang and Hong Chen 281

Ecological Risk Assessment of PAHs in Soils Around Zhongyuan Oil Field

in Winter

At present, the allowable PAHs residues in farmland soils of China have not been
established. In this research, the standard of PAHs in farmland soils in Canada is borrowed,
and the 9 PAHs residues in all 32 sampling points are evaluated by nemero index P. The
regulation is that the prohibitive contents of naphthalene, phenanthrene, pyrene,
Benz[a]anthracene, benzo[a]pyrene, benzo[b]fluoranthene, benzo[k]fluorathene, dibenzo[a,
h]anthrace and indeno[1, 2, 3-cd]pyre are 100 ng/g[36]. The range of values of this
classification (< 0.7, 0.7-1, 1-2, 2-3, >3), for ‘not contaminated’, ‘warning’, ‘light
contaminated’, ‘medium contaminated’ and ‘heavily contaminated’ samples, respectively, are
derived from nemero index P.
Around 3M soil samples in winter, the range of nemero index P values is 1.98-
4.49（Table 21）, and it is correlative with the distance from oily sludge plants, which
represents that the nemero index P values are increased with the increasing of the distance
from oily sludge plants. The minimum value, 1.98, appeared at the 3M-8 sampling point, and
the maximum value, 4.49, appeared at 3M-3 sampling point. The soil samples of 3M-3, 3M-4,
3M-5 and 3M-6 are heavily contaminated; the soil samples of 3M-7 are medium contaminated;
and the soil samples of 3M-8 are light contaminated. The range of nemero index P values is
1.92-5.06 around 3W soil samples, and the variation characteristics of nemero index P values
are consistent with P of 3M soils. The minimum value, 1.92, appeared at the 3W-8 sampling
point, and the maximum value, 5.06, appeared at 3W-3 sampling point. The soil samples of
3W-3, 3W-4, 3W-5 and 3W-6 are heavily contaminated; the soil samples of 3W-7 are medium
contaminated; and the soil samples of 3W-8 are light contaminated. The range of nemero index
P values is 1.72-4.16 around 4W soil samples, and the variation characteristics of nemero
index P values are consistent with P of 3M and 4W soils. The minimum value, 1.72, appeared
at the 4W-8 sampling point, and the maximum value, 4.16, appeared at 4W-3 sampling point.
The soil samples of 4W-3, 4W-4,4W-5 and 4W-6 are heavily contaminated; the soil samples
of 4W-7 are medium contaminated; and the soil samples of 4W-8 are light contaminated.
The evaluation results of the marker of P show that the soils around Zhongyuan Oil Field
in winter present 66.7% of those as ‘heavily contaminated’, 16.7% as ‘medium contaminated’,
16.6% as ‘light contaminated’. Result of classification evaluation is presented that soils around
oily sludge are serious polluted.

Table 21. The marker of P in soil samples

No. P No. P No. P

3M-3 4.49 3W-3 5.06 4W-3 4.16
3M-4 4.36 3W-4 4.90 4W-4 3.93
3M-5 4.35 3W-5 3.84 4W-5 3.61
3M-6 3.50 3W-6 3.62 4W-6 3.26
3M-7 2.58 3W-7 2.61 4W-7 2.39
3M-8 1.98 3W-8 1.92 4W-8 1.72
282 Shaoping Kuang and Hong Chen

The Pollution Degree Evaluation of PAHs in Soils Around Zhongyuan

Oil Field in Summer

Evaluating results of the PAHs pollution in soils of Zhongyuan oil field in summer ate
listed in Table 22. The pollution level of PAHs in soils around Zhongyuan Oil Field is
correlative with the distance from oily sludge plants, which represents that the pollution level
of PAHs in soils are dramatically decreased with the increase of the distance from oily sludge
plants. The soil samples of 3M-3, 3M-4, 3W-3, 3W-4, 4W-3 and 4W-4 are heavily
contaminated; the soil samples of 3M-5 and 3W-5 are medium contaminated; the soil samples
of 3M-6, 3M-7, 3M-8, 3W-6, 3W-7, 3W-8, 4W-5, 4W-6, 4W-7 and 4W-8 are light
contaminated. In the soil samples of Zhongyuan oil field in summer, heavily contaminated
account for 33.3%; medium contaminated account for 11.1%; light contaminated account for
55.6%. The pollution degree around soils in 4W is lower than the soils in 3M and 3W, which
because the content of PAHs in 4W oil sludge is lower than that of 3M and 3W oil sludge. The
pollution degree of PAHs in Soils in summer have decreased significantly comparing to the
pollution degree of PAHs in Soils in winter.

Table 22. Evaluating the results of the PAHs pollution in soils of Zhongyuan
oil field in summer

soils K soils K soils K

heavily heavily heavily
3M-3 3W-3 4W-3
contaminated contaminated contaminated
heavily heavily heavily
3M-4 3W-4 4W-4
contaminated contaminated contaminated
medium medium light
3M-5 3W-5 4W-5
contaminated contaminated contaminated
light light light
3M-6 3W-6 4W-6
contaminated contaminated contaminated
light light light
3M-7 3W-7 4W-7
contaminated contaminated contaminated
light light light
3M-8 3W-8 4W-8
contaminated contaminated contaminated

The Comparision Between the Pollution Degree of PAHs in Soils

of Zhongyuan Oil Field in Summer and Other Cities

In summer, the contents of PAHs in soil samples in 3M, 3W and 4W are 246.6-
1994.8ng/g, 238.6-2047.8ng/g and 215.1-1543.2ng/g, respectively. Comparing to the pollution
situation of other areas (Table 18), the minimum value of the PAHs content in all soil samples
are higher than that of rest areas except Estonia city. The maximum content of PAHs in soil
samples outclass the soils of Thailand city, the soils of Britain rural and the soils of Estonia
rural, are higher than the paddy soils of South Koreas, and are slightly higher than the
mountain soils of South Koreas and the agricultural soils of Greece, are lower than the
agricultural soils of Dongguan city, are far lower than the soils of Britain city and the soils of
 Distribution and Risk Assessment of PAHs in Soils and Corns… 283

Estonia city. The pollution level of PAHs in soils of Zhongyuan oil field in summer have
decreased significantly comparing to the pollution level of PAHs in soils in winter.

Table 23 Ratios of PAHs in Soils Between Summer and Winter

oil sludge fields 3 4 5 6 7 8

3M 0.89 0.76 0.48 0.49 0.49 0.49
3W 0.85 0.69 0.48 0.49 0.49 0.49
4W 0.85 0.80 0.49 0.49 0.49 0.50

The Health Risk Assessment in Soils of Zhongyuan Oil Field in Summer

Figure 10 shows that the distribution of BaP equivalent concentrations of PAHs in soil
samples in summer (Table 24) which were obtained by conversion are basically identical with
the distribution of BaP equivalent concentrations of PAHs in soil samples in winter. Also it
can reach maximum value near oil sludge sampling point, and reach minimum value in the
farthest oil sludge sampling point.
Contribution rates of different rings PAHs on BaP equivalent concentrations in soil
samples in summer are listed in Figure 11. Because of TEF value is very low, Contribution
rates of 2-3 rings PAHs on BaP equivalent concentrations are very little. While because of
TEF value is very high, Contribution rates of 5 rings PAHs on BaP equivalent concentrations
are very large. These are consistent with the contribution rates of different rings PAHs on BaP
equivalent concentrations in soil samples in winter.

70
BaP equivalent concentrations of PAHs (ng/g)

60

50

40

30

20

10

0
3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8
samples

Figure 10. The distribution of BaP equivalent concentrations of PAHs in soil samples in summer.
 Table 24. BaP equivalent concentrations of PAHs in soil samples in summer (ng/g)

components 3M-3 3M-4 3M-5 3M-6 3M-7 3M-8 3W-3 3W-4 3W-5 3W-6 3W-7 3W-8 4W-3 4W-4 4W-5 4W-6 4W-7 4W-8

NaP 0.5455 0.4537 0.2913 0.2351 0.1749 0.1343 0.5898 0.4672 0.257 0.2437 0.1768 0.1303 0.4861 0.4358 0.2437 0.221 0.1624 0.1177

Any 0.0921 0.0471 0.0249 0.0159 0.0098 0.0059 0.0995 0.0452 0.0238 0.0155 0.0105 0.0054 0.0845 0.045 0.0227 0.0148 0.0087 0.0062

Ane 0.1277 0.0897 0.0436 0.0166 0.0121 0.0069 0.1366 0.0902 0.0413 0.0162 0.0117 0.0065 0.1328 0.0979 0.0368 0.0147 0.0102 0.0072

Flu 0.1686 0.1132 0.059 0.0206 0.0151 0.0116 0.194 0.125 0.0444 0.0261 0.0164 0.0106 0.1652 0.1145 0.041 0.0216 0.0133 0.0095

Phe 0.3588 0.2341 0.1244 0.1018 0.043 0.0468 0.3788 0.2242 0.1179 0.0891 0.0518 0.0442 0.2887 0.1866 0.0837 0.0595 0.0346 0.0353

Ant 0.875 0.612 0.274 0.223 0.144 0.047 0.874 0.587 0.259 0.216 0.155 0.043 0.515 0.402 0.176 0.119 0.049 0.032

Fla 0.0859 0.0626 0.0347 0.0321 0.0114 0.0063 0.0924 0.0647 0.0336 0.0318 0.0121 0.0066 0.0528 0.0479 0.0201 0.0117 0.0063 0.007

Pyr 0.1562 0.1061 0.0417 0.0172 0.0049 0.0049 0.1397 0.0903 0.0434 0.0179 0.0057 0.0053 0.101 0.0821 0.019 0.0085 0.0046 0.0053

BaAn 10.08 7.32 3.67 2.8 1.18 0.61 9.38 6.8 3.92 2.66 1.25 0.64 4.19 2.58 1.29 0.89 0.57 0.61

Chy 1.076 0.743 0.295 0.116 0.031 0.029 0.866 0.635 0.305 0.106 0.036 0.036 0.554 0.395 0.162 0.088 0.032 0.022

Bbf 2.79 1.02 0.7 0.7 0.62 0.58 2.34 1.31 0.88 0.73 0.66 0.66 2.13 1.14 0.66 0.66 0.54 0.58

Bkf 3.02 2.39 1.2 0.83 0.61 0.61 2.95 2.29 1.09 0.75 0.68 0.49 1.96 1.41 0.61 0.57 0.49 0.57

BaP 17.7 13.8 7.4 2.9 2 2.7 18.3 13.2 6.2 4.4 2.8 2.2 12.9 10.2 3.9 1.1 1.9 2

I1P 2.25 1.85 0.56 0.12 0.07 0.05 2.49 1.92 0.64 0.08 0.06 0.05 0.98 0.8 0.34 0.06 0.05 0.06

Daa 27.8 20.4 7.1 1.6 0.7 0.6 24.4 18.1 5.6 1.5 0.7 0.7 12.5 11.1 1.3 0.6 0.6 0.6

BgP 0.379 0.255 0.073 0.025 0.007 0.006 0.286 0.211 0.084 0.022 0.006 0.006 0.072 0.033 0.013 0.006 0.005 0.006

ΣPAHs 67.5048 49.4965 21.8916 9.7533 5.6332 5.4487 63.5168 46.1598 19.5394 10.9043 6.632 5.0339 37.1121 29.0698 8.918 4.4448 4.4761 4.6682
 Shaoping Kuang and Hong Chen 285

2 rings 3 rings 4 rings 5 rings 6 rings

100

80
percentage ( %)

60

40

20

0
3M-33M-43M-53M-63M-73M-83W-33W-43W-53W-63W-73W-84W-34W-44W-54W-64W-74W-8
samples

Figure 11. Contribution rates of different rings PAHs on BaP equivalent concentrations in summer.

Ecological Risk Assessment of PAHs in Soils Around Zhongyuan Oil Field

in Summer

The evaluation results of the marker of nemero index P values are listed in Table 25.
Around 3M soil samples in summer, the range of nemero index P values is 0.69-3.99. The
minimum value, 0.69, appeared at the 3M-8 sampling point, and the maximum value, 3.99,
appeared at 3M-3 sampling point. The soil samples of 3M-3 and 3M-4 are heavily
contaminated; the soil samples of 3M-5 are medium contaminated; and the soil samples of
3M-6 and 3M-7 are light contaminated; the soil samples of 3M-8 are not contaminated. The
range of nemero index P values is 0.93-4.30 around 3W soil samples, and the variation
characteristics of nemero index P values are consistent with P of 3M soils. The minimum
value, 0.93, appeared at the 3W-8 sampling point, and the maximum value, 4.30, appeared at
3W-3 sampling point. The soil samples of 3W-3 and 3W-4 are heavily contaminated; the soil
samples of 4W-5, 4W-6 and 4W-7 are light contaminated; and the soil samples of 3W-8 are
warning. The range of nemero index P values is 0.84-3.52 around 4W soil samples, and the
variation characteristics of nemero index P values are consistent with P of 3M and 4W soils.
The minimum value, 0.84, appeared at the 4W-8 sampling point, and the maximum value,
3.52, appeared at 4W-3 sampling point. The soil samples of 4W-3 and 4W-4 are heavily
contaminated; the soil samples of 4W-5, 4W-6 and 4W-7 are light contaminated; and the soil
samples of 4W-8 are warning. The evaluation results of the marker of P show that the soils
around Zhongyuan Oil Field in summer present 33.3% of those as ‘heavily contaminated’,
5.6% as ‘medium contaminated’, 44.4% as ‘light contaminated’, 11.1% as ‘warning’, 5.6% as
‘not contaminated’. Comparing to the pollution level of PAHs in Soils Around Zhongyuan Oil
Field in winter, the soil samples of heavily contaminated are decreased 33.4%, and the soil
samples of medium contaminated are decreased 11.1%. Ecological risk have decreased
286 Shaoping Kuang and Hong Chen

significantly. That may be have several reasons, the absorption and accumulation of PAHs in
soils of the corn, the degradation of PAHs in soils of the corn roots[37, 38], and the high
temperature in summer which is beneficial to the degradation of PAHs in soils and the
volatilization of less rings PAHs.

Table 25. The marker of P in soil samples in summer

soils P soils P soils P

3M-3 3.99 3W-3 4.30 4W-3 3.52
3M-4 3.29 3W-4 3.38 4W-4 3.14
3M-5 2.10 3W-5 1.86 4W-5 1.75
3M-6 1.69 3W-6 1.75 4W-6 1.58
3M-7 1.25 3W-7 1.27 4W-7 1.16
3M-8 0.69 3W-8 0.93 4W-8 0.84

CONCLUSION
According to the determination of contamination degree with polycyclic aromatic
hydrocarbons (PAHs) in samples of soils in both winter and summer, corn roots and corn
leaves around three different oily sludges in Zhongyuan Oil Field, soils around oily sludge are
heavily polluted. Although the pollution degree of PAHs in different plants (3M, 3W,4W) are
inequable, the detection rate have reached 100%. The sources of PAHs in oily sludge samples
are mainly from petrogenic sources. Petrogenic sources are the major source of PAHs in soil
samples next to the oily sludge, and both petrogenic and pyrogenic sources are the major
sources of PAHs in soil after the distance increased to a certain boundary.
1) The total contents of PAHs in three different oily sludges from high to low is
3W>3M>4W. 2-4 rings PAHs, naphthalene, acenaphthylene, acenaphthene, fluorine and
phenanthrene were characteristic factors of PAHs in oily sludge samples，which affect total
contents of PAHs in oily sludge. In regional distribution, the content of PAHs in soils around
Zhongyuan Oil Field is correlative with the distance from oily sludge plants, which represents
that the content of PAHs in soil samples are dramatically decreased with the increase of the
distance from oily sludge plants.
2) The contents of PAHs in soil samples in 3M, 3W and 4W are 499.9-2241.3ng/g, 578.1-
2408.8ng/g and 434.5-1822.0ng/g, respectively. The order of pollution degree in soil near the
three plants is 3W>3M>4W, which is consistent with the order of the contents of PAHs of oily
sludges in three plants. Naphthalene, acenaphthene, fluorine, phenanthrene and pyrene are
characteristic factors of PAHs in soil samples of 3M and 3W, and naphthalene, acenaphthene,
fluorine and phenanthrene are characteristic factors of PAHs in soil samples of 4W.
3) The contents of PAHs in corn roof samples in 3M, 3W and 4W are 117.38-605.76ng/g,
112.32-637.93ng/g and 103.14-465.13ng/g, respectively. The order of PAHs contents in corn
root samples is 3W>3M>4W, which is consistent with the order of pollution degree in soil
near the three plants of oily sludges. 2-4 rings PAHs are the most predominant components of
PAHs in corn root around Oil Field, which is consistent with the characteristic of PAHs
contents in soil near the three plants of oily sludges.
 Distribution and Risk Assessment of PAHs in Soils and Corns… 287

4) The contents of PAHs in corn leaf samples in 3M, 3W and 4W are 124.43-1025.43ng/g,
128.43-1121.43ng/g and 121.43-1069.43ng/g, respectively. The order of PAHs contents in
corn leaf samples is 3W>4W>3M, which is inconsistent with the order of pollution degree in
soil near the three plants of oily sludges. 5 and 6 rings PAHs are the most predominant
components of PAHs in corn leaf around oily sludge plants because of structural
characteristics of the corn leaf, which is inconsistent with characteristics of PAHs contents in
soil and corn root around the three plants of oily sludges.
5)In the soil samples of Zhongyuan oil field in winter, heavily contaminated account for
61.1%; medium contaminated account for 16.7%; light contaminated account for 22.2%.
Result of classification evaluation is presented that soils around oily sludge are serious
polluted in winter. In summer, heavily contaminated account for 33.3%; medium contaminated
account for 11.1%; light contaminated account for 55.6%. The pollution degree of PAHs in
Soils in summer decreased significantly comparing to the pollution degree of PAHs in Soils in
winter.
The result of classification evaluation by nemero index P are presented that soils around
oily sludge are heavily polluted. Due to their ubiquity and persistence, PAHs exceed standards
in most soils of petrochemical area, and are harmful to the health of oil workers and ambient
residents. So pollution from oily sludges should be paid more attention to.

REFERENCES
[1] United Nations Environment Programme. Global Monitoring of Persistent Organic
Pollutants (POPs). http://www.chem.unep.ch/gmn/default.htm
[2] Baran S; Bielinska E J; Oleszczuk P. (2004). Enzymatic activity in an airfield soil
polluted with polycyclic aromatic hydrocarbons (PAHs). Geoderma, 118, 221-232.
[3] Maria B; Celia D; Cristina N. (2006). Use of Lichens as Pollution Biomonitors in
Remote Areas: Comparison of PAHs Extracted from Lichens and Atmospheric Particles
Sampled in and Around the Somport Tunnel (Pyrenees). Environ. Sci .Technol., 40,
6384-6391.
[4] Patryk O; Stanislaw B. (2005). Polycyclic aromatic hydrocarbons content in shoots and
leaves of willow (salix viminalis) cultivated on the sewage sludge-amended soil. Water,
Air and Soil Pollution, 168, 91-111.
[5] Huang J; Wei S Q. (2003). Toxic Effect of Polycylic Aromatic Hydrocarbons and
Application in the Risk Assessment of Its Biomarker. Henan, J. Prev. Med., 14, 370-374.
[6] Jiang Y; Zhao C C; Zhao D F. (2005). Characteristic of oily sludge and several treatment
methods. Environmental Protection of Oily and Gas Fields, 15 (4), 38-41.
[7] Li J; Zhang G; Qi S h, et al. (2004). Source analysis and apportionment of particulate
phase polycyclic aromatic hydrocarbons (PAHs) in Guangzhou City. Acta Scientiae
Circumstantiae, 24, 661-666.
[8] Jia R B. (1999). Studies on Determination Method of Polycyclic Aromatic
Hydrocarbons(PAHs) in Water Samples. Environmental Monitoring in China, 15, 40-42.
[9] Ge C J; An Q; Dong Y H. (2005). Residue and risk assessment of polycyclic aromatic
hydrocarbons ( PAHs) in soils around a steel mill. Rural Eco-Environment, 21, 66-69.
288 Shaoping Kuang and Hong Chen

[10] Tian Y; Zheng T L; Wang X h, et al. (2003). Contamination characteristics of polycyclic

aromatic hydrocarbons and bioremediation strategy in sediments of Western Xiamen
Harbor and its adjacent sea area. Journal of Oceanography in Taiwan Strait, 22, 192-200.
[11] Tao S; Cui Y H; Xu F L, et al. (2004). Polycyclic aromatic hydrocarbons (PAHs) in
agricultural soil and vegetables from Tianjin. Science of The Total Environment, 320, 11-
24.
[12] Doick K J; Klingelmann E; Burauel P, et al. (2005). Long-Term Fate of Polychlorinated
Biphenyls and Polycyclic Aromatic Hydrocarbons in an Agricultural Soil.
Environmental Science and Technology, 39, 3663-3670.
[13] Hafner W D; Carlson D L; Hites R A. (2005). Influence of Local Human Population on
Atmospheric Polycyclic Aromatic Hydrocarbon concentrations. Environmental Science
and Technology, 39, 7374-7379.
[14] Duan J C; Bi X H; Tan J H, et al. (2005). The differences of the size distribution of
polycyclic aromatic hydrocarbons (PAHs) between urban and rural sites of Guangzhou,
China. Atmospheric Research, 78, 190-203.
[15] Zhu L Z; Chen B L; Wang J, et al. (2004). Pollution survey of polycyclic aromatic
hydrocarbons in surface water of Hangzhou, China. Chemosphere, 56(11), 1085-1095.
[16] Kannan K; Johnson-Restrepo B; Yohn S S, et al. (2005). Spatial and Temporal
Distribution of Polycyclic Aromatic Hydrocarbons in Sediments from Michigan Inland
Lakes. Environmental Science and Technology, 39(13), 4700-4706.
[17] Qiao M; Wang C X; Huang S B, et al. (2006). Composition, sources, and potential
toxicological significance of PAHs in the surface sediments of the Meiliang Bay, Taihu
Lake, China. Environment International, 32, 28-33.
[18] Ling W T; Gao Y Z; Li Q L, Xie Z M; Xiong W. (2006). Uptake of phenanthrene and
pyrene by ryegrass from water. Acta Ecologica Sinica, 26(10), 3332-3338.
[19] Ling W T; Zhu L Z; Gao Y Z; Xing W. (2005). Root uptake and its predict ion model of
PAHs from soils. Acta Ecologica Sinica, 26(9), 2320-2325.
[20] Zhan X H; Zhou L X; Wan Y J. (2006). Impact of Dissolved Organic Matter on Plant
Uptake of Phenanthrene and Its Mechanisms. Environmental Science, 27(9), 1884-1889.
[21] Zhang H B; Luo Y M; Huang M H; Zhang G L; Zhao Q G. (2005). Hong Kong Soil
Researches Ⅲ. PAHs Contents In Soils And Their Origins. Acta Pedologica Sinica,
42(6), 936-941.
[22] Ding K Q; Luo Y M; Liu S L; Song J; Wu L H; Xing W Q; Li Z G; Tao S. (2004).
Dynamics in Benzo [a] Pyrene Concentrations in Soil As Influenced By Ryegrass Plants.
Acta Pedologica Sinica, 41(3), 348-353.
[23] Tao X Q; Dang Z; Lu G N; Yi X Y. (2003). Biodegradation Mechanism of Polycyclic
Aromatic Hydrocarbons ( PAHs) in Soil: A Review. Bulletin of Mineralogy, Petrology
and Geochemistry, (10), 356-360.
[24] Zhan X H; Zhou L X. (2003). Environmental behavior of PAHs in soil-plant system.
Ecology and Environment, l2(4), 487-492.
[25] Menzies A; Potockib B; Santodonato J. (1992). Exposure to carcinogenic PAHs in the
environment. Environ. Sci. Techno., l 26, 1278.
[26] Liste H H; Alexander M. (2000). Plant-promoted pyrene degradation in soil.
Chemosphere, 40, 7-10.
 Distribution and Risk Assessment of PAHs in Soils and Corns… 289

[27] Wu Y; Zhang J; Zhu Z J. (2003). Polycyclic aromatic hydrocarbons in the sediments of

the Yalujiang Estuary, North China. Mar. Pollut. Bull., 46, 619-625.
[28] Zeng Y E; Vista C L. (1997). Organic pollutants in the coastal environment of San
Diego, California I Source Identification and assessment by compositional indices of
polycyclic aromatic hydrocarbons. Environ. Toxic. Chem.,16, 179-188.
[29] Kuang S P; Sun D Y; Sun Y H. (2009). Pollution Characteristics of PAHs in Oily Sludge
of Zhongyuan Oil Field and Its Peripheral Soils. Chinese Journal of Geochemistry,
vol.28 (In Press).
[30] Kuang S P; Sun D Y; Sun Y H. (2008). Pollution Characteristics of PAHs in Oily Sludge
and Around Soils of Zhongyuan Oil Field. Journal of Agro-Environment Science, 27(3),
855-861.
[31] Femandes M B; Sicre M A; Boireau A; et al. (1997). Polyaromatic hydrocarbon (PAHs)
distribution in the Seine River and its Estuary. Marine Pollution Bulletin, 34, 857-867.
[32] Sicre M A; Malty J C; Saliot A, et al. (1987). Aliphatic and aromatic hydrocarbons in the
Mediterranean aerosol. Int. J. Environ. Anal. Chem., 29, 73-94.
[33] Kuang S P; Sun Dongya. (2008). Distribution of polycyclic aromatic hydrocarbons in
soils and corns around Zhongyuan Oil Field, China. Environmental Chemistry, Vol. 27,
No.6 (In Press).
[34] Dong R B; Xu D F; Liu L; He Z J; Qi M F; Zeng H Q. (1999). The Behavior of
Polycyclic Aromatic Hydrocarbons in the Environment. Environment And Exploitation,
14(4), 10-12.
[35] Halsall C J; Coleman P J. (1994). Polycyclic Aromatic Hydrocarbons in U K Urban Air.
Environmental Science and Technology, 28(13), 2380-2386.
[36] Annokkee G J. (1990). MT-TNO research into the biodegradation of soils and sediments
contaminated with oils and PAHs . Wolf K. Contaminated Soil. New York: Kluwer
Academic Publishers, 941-945.
[37] Xu S Y; Chen Y X; Lin Q; Wu W X; Wang D; Xue S G; Shen C F. (2006). Remediation
Of Phenanthrene And Pyrene-Contaminated Soil By Growingmatze ( ZEA. MAYS. L.).
Acta Pedologica Sinica, 43(2), 226-232.
[38] Yoshitomi K J; Shann J R. (2001). Corn ( Zea may L) root exudates and their impact on
14C-pyrene minerdization. Soil Biol. Biochem., 33, 1769-1776.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 7

LOW TEMPERATURE EFFECTS ON THE EARLY

DEVELOPMENT OF CORN SEEDLINGS

Ricardo Aroca
Departamento de Microbiología del Suelo y Sistemas Simbióticos,
Estación Experimental del Zaidín (CSIC), Spain

ABSTRACT
Corn farming is extended all around the world, from temperate regions to tropical
ones. Moreover, corn crop represents an essential component of the global food security.
In temperate regions, corn growth is reduced by low temperatures at the early stage of
development (from germination to fourth leaf fully developed stage). At these stages, corn
seedlings are very sensitive to low temperatures as can be determined by several
physiological processes. These physiological processes include among others water
transport, respiration, photosynthesis and oxygen metabolism. On the other hand, there is a
degree on the sensitivity to low temperature among corn genotypes cultivated worldwide.
Corn seedlings suffer a decrease in their leaf water content upon exposure to low
temperatures. This water deficit is caused by the lack of stomatal response and the
diminution of the root water uptake. Together with this water deficit, corn seedlings
diminish their respiration and their CO2 fixation. However, although CO2 fixation
decreases, the amount of light that the leaf receives remains constant. The excess of light
non used to fix CO2 causes an excess of energy in the photosystems, that ultimately is
captured by the oxygen molecules, forming the so called reactive oxygen species (ROS).
These ROS are highly harmful when they exceed the capacity of the leaves to remove
them. Thus the differences on low temperature sensitivity among corn genotypes is
partially linked to better water status maintenance, keeping higher rates of photosynthesis,
and having more effective ROS removing mechanisms. Here, we will review all these
physiological aspects involved on corn seedlings tolerance to low temperatures.
292 Ricardo Aroca

INTRODUCTION
Six to nine thousands years ago teosinte (Zea mays ssp. parviglumis) was domesticated in
Mexico to render the actual corn (Zea mays L.) varieties around the world (Yamasaki et al.,
2007). Since then, corn crop begun to compromise most of the human food products directly or
indirectly like a feed crop (Boomsma and Vyn, 2008). Because corn plants become originally
from a tropical region, breeders have been intended to select corn varieties able to growth and
yield under colder environmental conditions in order to extend their crop distribution (Enoki et
al., 2002; Bhosale et al., 2007; Rodríguez et al., 2008). Thus, there is a degree of cold tolerance
among corn genotypes worldwide (Hola et al., 2008; Hund et al., 2008). Corn plants are very
sensitive to low temperatures at the early stages of their development, from emergence to
fourth leaf stage approximately (Bhosale et al., 2007; Noli et al., 2008). In fact, corn yield
increases when seedlings are grown under warm temperatures (Leipner et al., 2008). Corn
seedlings sensitive to low temperatures have a strong importance in temperate regions, where
corn seeds are sown in the early spring, when occasional low temperatures can still happen,
mostly during nights or during early morning or late evening.
Corn seedlings suffer from several physiological disorders when they are exposed to low
temperatures. These disorders include among others failure to close the stomata, inhibition of
root water uptake, alterations in root and leaf morphology, alterations in respiration quality,
decreases of photosynthesis capacity, and increases of oxidative damage (Bos et al., 2000;
Ribas-Carbo et al., 2000; Aroca et al., 2003a, 2001b; Hund et al., 2008). In the present chapter
I will cover all these physiological disorders, predominately focusing in the differences
between cold tolerant and sensitive corn genotypes.

WATER RELATIONS
Cold sensitive plant species including corn retain their stomata opened upon exposure to
low temperatures (Irigoyen et al., 1996; Vernieri et al., 2001; Bloom et al., 2004), although
some corn tolerant genotypes are able to close them (Capell and Dörffling, 1993; Pérez de
Juan et al., 1997; Aroca et al., 2003b). Hence, different sensitivity to cold among corn
genotypes is in part related to different capacity of closing stomata under cold conditions
(Capell and Dörffling, 1993; Pérez de Juan et al., 1997; Aroca et al., 2003b). By this way, corn
tolerant genotypes are able to keep leaf water status at control values during cold periods
(Capell and Dörffling, 1993; Pérez de Juan et al., 1997; Aroca et al., 2003b). Since stomatal
closure is linked to abscisic acid (ABA) hormone levels in plant tissues (Pei and Kuchitsu,
2005), a correlation between leaf ABA contents and chilling tolerance have also been found
(Aroca et al., 2003b; Janowiak et al., 2003). Therefore, cold sensitive corn genotypes decrease
its leaf water content upon exposure to cold, because the inability to close their stomata and to
increase their ABA contents. However, cold tolerant corn genotypes are able to close their
stomata during cold conditions thanks to the increase in their ABA contents, avoiding the
water deficit induced by chilling.
In the last few years, it has been well established the mechanisms by which ABA induce
stomatal closure (Pei and Kuchitsu, 2005; Wang and Song, 2008). These mechanisms include
the generation of nitric oxide and reactive oxygen species, increase of cytosolic calcium,
 Low Temperature Effects on the Early Development of Corn Seedlings 293

activation of anion channels, inhibition of inward potassium channels, and activation of

potassium efflux. To our knowledge, no studies are available about how these different
mechanisms work differently in cold tolerant and cold sensitive corn genotypes. However,
there are some studies where the involvement of calcium homeostasis in cold tolerance both in
cold sensitive and in tolerant species has been addressed (Song et al., 2008). Thus, Wilkinson
et al. (2001) found that Commelina communis (cold-tolerant specie) guard cells take up
calcium from the apoplast causing stomatal closure upon exposure to 7ºC, independently of
ABA action, whereas Nicotiana rustica (cold-sensitive specie) guard cells did not. On the
other hand, Jiang et al. (1999) found a transitory accumulation of calcium in the cytosol and
nuclear envelope of winter wheat leaf cells, whereas in maize cells calcium accumulation was
permanent upon exposure to 2ºC. This different behaviour between the two plant species was
caused by a different activity of the Ca2+-ATPase, which was inactivated in maize cells.
However, although regulation of stomatal closure under cold conditions seems essential to
avoid cold-induced water deficit, in some circumstances, the capacity to keep root water
uptake under cold conditions can be crucial (Pavel and Fereres, 1998; Aroca et al., 2001b,
2003b). In 1998, Fennell and Markhart (1998) found an acclimation of root hydraulic
properties of spinach plants (cold tolerant specie) after 12 h of exposure to 5ºC. Then, although
spinach roots initially decrease their root hydraulic conductivity (L), after 12 h at 5ºC L
increased again (Fennel and Markhart, 1998). Thereafter, Aroca et al. (2001b) carried out a
study comparing L behaviour of two corn genotypes differing in chilling sensitivity upon
exposure to 5ºC. The two genotypes decreased their L during the first hours of cold treatment;
however, after 54 h, L of the tolerant genotype was even higher than one of the warm growing
plants, whereas L of the sensitive genotype remained at low values. This different behaviour
was unrelated to different root ABA contents between the two genotypes (Aroca et al., 2003b).
In the early nineties water transport membrane channel proteins were discovered in plants
and named aquaporins (Maurel et al., 1993; Kammerloher et al., 1994). In plants, aquaporins
are divided in four groups based on their amino acid sequence homology (Maurel, 2007). The
four groups are plasma membrane intrinsic proteins (PIPs), tonoplast intrinsic proteins (TIPs),
nodulin like intrinsic proteins (NIPs), and small and basic intrinsic proteins (SIPs). Based on
the evidences supporting the idea that PIP aquaporins could govern L (Kaldenhoff et al., 1998;
Javot et al., 2003), Aroca et al. (2005) evaluate the behaviour of different PIPs aquaporins
genes and proteins after 3 d of exposure to 5ºC in a tolerant and sensitive corn genotypes. Both
genotypes increased the amount of PIPs proteins in their roots by cold treatment, but only the
tolerant increased its L. At the same time, roots of the sensitive genotype showed symptoms of
membrane injury and also its L was very sensitive to exogenous hydrogen peroxide
application. These responses to cold were not seen in the tolerant genotype. Therefore, authors
concluded that PIPs aquaporins are necessary to recover L from cold, but not sufficient, roots
need also to have a strong antioxidant system in order to avoid the oxidative damage linked to
cold (Aroca et al., 2005).
In summary, cold corn tolerant genotypes are able to keep their leaf water status at control
values upon exposure to cold whereas the sensitive ones suffer from a water deficit. This
different behaviour between the two kinds of genotypes is explained at leaf and root levels
(Figure 1). At leaf level, cold tolerance is linked to quick stomatal closure and raised ABA
contents. At root level, cold tolerance is linked to keep root water uptake rate and to have a
strong antioxidant system together with an increase on PIPs aquaporins amount.
294 Ricardo Aroca

Figure 1. Scheme summarizing different responses to cold of different corn genotypes differing in cold
sensitive.

However, which signals are involved in this different behaviour are far to be known, and a
comprehensive experiments are needed.

LEAF AND ROOT MORPHOLOGY

At the same time that corn plants suffer from cold-induced water deficit they trait to
modify their morphology in order to cope with cold stress. Corn leaf area is determined by five
components: leaf-appearance rate, leaf-elongation rate, leaf-elongation duration, maximum
leaf width, and leaf shape parameters (Bos et al., 2000). It is well established that low
temperatures decrease the rate of leaf appearance (Tollenaar et al., 1979; Thiagarajah and
Hunt, 1982), and that different corn hybrids also differ in their appearance rate at low
temperatures (Padilla and Otegui, 2005). At the same time, leaf-elongation rate and leaf-
elongation duration are decreased and increased by low temperatures, respectively (Bos et al.,
2000). However, maximum width is strongly reduced which is associated with a decrease of
specific leaf weight (SLW), leading to thinner leaves (Bos et al., 2000). On the other hand, a
good correlation between higher SLW and higher leaf photosynthetic efficiency has been
observed in different corn hybrids exposed to cold (Hund et al., 2005). Thus, corn hybrids that
showed more tolerance to cold, also showed higher SLW and photosynthetic efficiency when
grown at low temperatures (Hund et al., 2005).
The growth of corn aerial parts during cold is not only determined by leaf intrinsic
properties, but also by root morphology changes under cold conditions (Richner et al., 1997).
In fact, a good correlation was found between plant dry weight under cold conditions and
chlorophyll content, photosynthetic efficiency and primary lateral root length in different corn
hybrids (Hund et al., 2008). As the proportion of root to shoot increases under cold conditions,
a better plant performance is found when different corn hybrids are compared (Hund et al.,
2008). This pivotal role of root morphology in coping with cold stress could be related in part
 Low Temperature Effects on the Early Development of Corn Seedlings 295

to a better nutrient acquisition capacity (Engels and Marschner, 1990; Shabala and Shabala,
2002). However, no information is available about how corns cultivars differing in cold
tolerance respond to low temperatures also differ in terms of nutrient acquisition. On the other
hand, root morphology can also affects root hydraulic properties. Thus, based on anatomical
determinations, Ciamporová and Dekánková (1998) found better root conductivity
performance in a cold-tolerant corn genotype than in a sensitive one after exposure to cold.
As summary, differences in leaf and root morphology have been found between cold-
tolerant and cold sensitive corn genotypes (Figure 2). The most important differences are
related to leaf appearance rate and to SLW, having the tolerant genotypes higher values of
these two parameters. At the same time, it is well established that root growth pattern is
essential in supporting shoot growth, although the involvement of different root nutrient uptake
capacity between cold-tolerant and cold-sensitive corn genotypes need to be addressed.

Figure 2. Scheme summarizing cold effects in corn leaf and root morphology.

RESPIRATION
Respiration is needed for several processes in plants like biosynthesis of new structural
biomass, translocation of photosynthates from sources to sinks, uptake of ions from soil
solution, assimilation of nitrogen and sulphur into organic compounds, protein turnover, and
cellular ion-gradient maintenance (Amthor, 2000). Total respiration is divided in growth
respiration and maintenance respiration (Amthor, 2000), the later increased under cold
296 Ricardo Aroca

conditions (Frei, 2000). However, although respiration decreases as temperature is going down
(Atkin et al., 2000), when plants are growing in cold conditions and respiration measurements
are taken under warm conditions, even some increases in total respiration can be observed
(Luxová and Gaspáriková, 1999; Atkin et al., 2000; Ribas-Carbo et al., 2000). When different
corn genotypes with contrasting cold tolerance were tested in order to see differences in
respiration rate, the results varied depending on the organ evaluated (root or leaf). Thus, at leaf
level, total respiration rate increased slightly after exposure of corn plants to 5ºC during 5
days, independently of the genotype cold-tolerance (Ribas-Carbo et al., 2000). However,
Luxová and Gaspáriková (1999), using the same two genotypes as Ribas-carbo et al. (2000),
found that total respiration decreased in the sensitive genotype, but it was unaltered in the
tolerant one upon exposure to cold.
Respiratory chain electron transport in the inner membrane of the mitochondria in plants
can end in two different terminal oxidases, cytochrome oxidase or the alternative oxidase
(Hoefnagel et al., 1995). When electron flow ends in the cytochrome oxidase three ATPs are
generated, but when electrons ends in the alternative oxidase (AOX) only one ATP is
generated (Sluse and Jarmuszkiewicz, 1998). The apparently wasteful of energy by the AOX
mitochondrial pathway has focused the attention of several researchers in the last decades
(Hoefnagel et al., 1995; Sluse and Jarmuszkiewicz, 1998; Affourtit et al., 2002; Juszczuk and
Rychter, 2003). Since AOX dissipates the excess of energy not used to synthesize ATP as heat,
it was speculated its involvement in cold tolerance by increasing plant tissues temperature
(Moynihan et al., 1995). At the same time, it has been largely observed an increase of the AOX
protein amount when several plants are exposed to low temperatures (Vanlerberghe and
McIntosh, 1992). However, until 1992 no technique was available to accurately measure AOX
activity (Robinson et al., 1992). Such technique is based on the different oxygen
discrimination between the two mitochondrial oxidases, avoiding the use of different inhibitors
and measuring the real activity of both electron chains (Robinson et al., 1992). Using this
technique, Ribas-Carbo et al. (2000) found that both tolerant- and sensitive-cold corn
genotypes increased AOX activity after exposure to cold, but the increase was higher in the
sensitive genotype. On the other hand, the same authors found that the cytochrome pathway
was unaltered in the tolerant genotype but decreased in the sensitive one (Ribas-Carbo et al.
2000). Thus, sensitive genotype was using more respiration activity in a futile way (AOX) than
the tolerant genotype. These results pointed out the possibility that AOX activity could be
induced by the oxidative stress linked to cold (Foyer et al., 2002), since an increase in the
AOX capacity induced by reactive oxygen species had been seen previously (Wagner, 1995).
Therefore, AOX activity was found to be related to damage caused by cold, and not to
mechanisms involved in cold tolerance (Ribas-Carbo et al., 2000). However, this observation
needs to be checked in more corn genotypes in order to clarify AOX role in corn cold
tolerance.

PHOTOSYNTHESIS
Plant growth is ultimately determined by the sum of the carbon gained by the
photosynthesis and carbon consumed by respiration. In fact, some cold corn sensitive
genotypes show a negative growth rate under cold conditions (Irigoyen et al., 1996; Pérez de
 Low Temperature Effects on the Early Development of Corn Seedlings 297

Juan et al., 1997; Koscielniak and Biesaga- Koscielniak, 2000). Under cold conditions,
photosynthesis is diminished by the means of several factors, being the most important the
decrease on carbon assimilation enzymes activity, especially in C4 plant species like corn
(Sage and Kubien, 2007). Corn photosynthesis is divided in two steps, also divided physically
in two different kinds of cells, namely mesophyll and bundle cells (Von Caemmerer and
Furbank, 2003). In mesophyll cells, anhydride carbonic is fixed by the phosphoenolpyruvate
carboxylase (PEPC) as oxalacetate (OAA). The OAA is then transported to the bundle cells in
the form of aspartate or malate. Then, both molecules are decarboxyled and render CO2, which
is then fixed by the Rubisco inside the bundle chloroplasts. The descarboxiled products
(pyruvate or phosphoenolpyruvate) are coming back to the mesophyll cells and used again by
the PEPC as substrate. For more details about this carbon fixation cycle see Wingler et al.
(1999).
Most of these corn enzymes are very sensitive to cold, being the more sensitive and
limiting steps of the cycle PEPC and NADP-malate dehydrogenase (NADP-MDH) enzyme
activities (Kingston-Smith et al., 1997; Furbank et al., 2000; Aroca et al., 2003a). The sensitive
of these two enzyme activities to cold could be caused by a dissociation of the tetrameric form
of the enzymes caused by cold (Podestá et al., 1990). Aroca et al. (2003a) found that upon
exposure to 5ºC for 5 days, a cold-tolerant corn genotype showed higher activities of NADP-
MDH and PEPC than a cold-sensitive one. At the same time, when both corn genotypes were
acclimated to cold by a previous drought treatment, the differences in the activity of these two
enzymes were almost insignificant. However, no molecular studies have been carried out to
ascertain why these two enzymes of the two genotypes respond differently to cold, e.g.
oligomeric studies.
Since carbon fixation is reduced during cold periods, an accumulation of reduced power
(NADPH) takes place. This overaccumulation of NADPH in the chloroplasts causes a drastic
reduction in the electron flow between photosystem (PS) II and PSI, which ultimately
produces NADPH (see Foyer et al., 2002). The most efficient and convenient method to
estimate photosystems electron flow is measuring leaf chlorophyll fluorescence emissions
(Baker, 2008). Among the chlorophyll fluorescence parameters, the maximum quantum yield
of PSII (Fv/Fm) have been used largely to discriminate between cold-tolerance and cold-
sensitive maize genotypes (Ribas-Carbo et al., 2000; Aroca et al., 2001a, 2003a; Pimentel et
al., 2005). The diminution of electron flow between PSII and PSI causes an excess of energy
coming to PSII reaction center (RC) and to light harvest complex (LHC). This excess of
energy can be finally captured by oxygen molecules and causes an overproduction of reactive
oxygen species (ROS; Foyer et al., 2002). However, leaves have several mechanisms to avoid
ROS production by dissipating the excess of energy coming to PSII. These mechanisms
include dissociation between PSII RC and LHC (Hong and Xu, 1999) and conversion of
energy to heat via xanthophylls cycle (Demmig-Adams and Adams, 2006).
From chlorophyll fluorescence measurements it has been inferred that cold-tolerant corn
genotypes are able to dissociate LHC II from PS II RC during cold in order to protect RC from
photodamage (Mauro et al., 1997; Aroca et al., 2001a). In fact, Mauro et al. (1997) found
different phosphorylation pattern of the LHC II protein complex CP29 in two corn genotypes
differing in cold sensitivity. When the conversion of violaxanthin to zeaxanthin was compared
between cold-tolerant and cold-sensitive corn genotypes under cold conditions, it was found
that sensitive genotypes had more zeaxanthin contents (Haldimann, 1997; Aroca et al., 2003a).
Since higher zeaxanthin contents indicate more capacity to dissipate the excedent energy as
298 Ricardo Aroca

heat (Demmig-Adams and Adams, 2006), the above results were interpreted as a sensitive
genotypes necessity of more zeaxanthin since they did not have other protective mechanisms.
The capacity of recovering photosynthesis activity from cold stress is as important as the
capacity of keeping photosynthetic activity as high as possible during cold (Aroca et al.,
2001a; Pietrini et al., 2005). In fact, corn cold-tolerant genotypes recover faster their
photosynthetic performance after exposure to cold than sensitive genotypes, and hence they
diminish the possibility of producing photooxidative damage (Aroca et al., 2001a).
As summary (Figure 3), the photosynthesis step more likely to be affected by cold is the
biochemical fixation of CO2. This inhibition on CO2 fixation causes a diminution on the
electron transport between PSII and PSI, causing at the same time the induction of energy
dissipation mechanisms in order to avoid possible photooxidative damage. In all these steps
corn cold-tolerant genotypes are more resistant than sensitive ones.

Figure 3. Scheme summarizing cold effects in leaf photosynthesis properties.

ANTIOXIDANT SYSTEMS
As it mentioned in the previous sections, cold injury in sensitive species is ultimately
caused by the overproduction of reactive oxygen species (ROS), which can not be detoxified
by the plant (Wingsle et al., 1999; Suzuki and Mittler, 2006). Plants have several mechanisms
 Low Temperature Effects on the Early Development of Corn Seedlings 299

to detoxify ROS, both enzymatic and non enzymatic antioxidants. The enzymatic antioxidants
compromise enzymes from the ascorbate-glutathione cycle (ascorbate peroxidase, APX;
glutathione reductase, GR; mono and dehydro ascorbate reductase, MDHAR and DHAR,
respectively), superoxide dismutases (SODs), catalases (CAT) and several peroxidases. On the
other hand, antioxidant compounds compromise ascorbate (Asc), glutathione (GSH), proline,
and several pigments like α-tocopherol or β-carotenoids. For recent reviews on plant
antioxidant mechanisms see Ledford and Niyogi (2005) and Navrot et al. (2007).
When different corn genotypes differing in cold sensitivity are exposed to cold, they also
differ on the behaviour of antioxidant enzymes, but with contrasting results. Thus, Aroca et al.
(2003a) did not find any significant difference in leaf SOD, APX and GR activities between
cold-tolerant and cold-sensitive genotypes after plant exposure to 5ºC during 5 days. However,
Aroca et al. (2001a), studying the same genotypes as in Aroca et al. (2003a), found that at the
beginning of cold stress, the tolerant genotype increased about four folds their SOD, APX and
GR activities, while not significant changes were observed in the sensitive genotype. These
results point out the importance of a faster response of the antioxidants enzymes activity in the
tolerant genotype compared to the sensitive one. On the other hand, Leipner et al. (1999) using
the same genotypes but grown in the field, found no differences in SOD, APX or CAT
activities, but higher GR activity in the tolerant genotype. Hodges et al. (1997) had previously
found that tolerant genotypes had more MDHAR activity than sensitive genotypes, pointing
out the importance of regenerating ascorbate to properly tolerate cold conditions. All these
apparently contradictory results are based on biochemical measurements of antioxidant
enzymes activities during different cold treatments. In order to highlight the role of antioxidant
enzymes in corn cold tolerance a genetic approach is necessary, that is, getting corn plants with
one of the antioxidant enzyme silenced and checking its cold tolerance.
Besides antioxidant enzymes, antioxidant compounds could be even more efficient in
avoiding oxidative damage during cold. Hence, Aroca et al. (2003a) found that cold-tolerant
genotype had more reduced ascorbate than sensitive one after exposure to cold, although both
genotypes had the same amount of total ascorbate. This result indicates the importance of
regenerating oxidized ascorbate in order to keep a properly antioxidant system, as previously
described (Hodges et al., 1996, 1997). At the same time, when glutathione levels were raised
artificially by exogenous application of different herbicides, Kocsy et al. (2001) found an
increase also in GR activity, keeping the glutathione pool in a reduced state. Therefore, not
only high quantities of ascorbate or glutathione are needed to tolerate cold, but also
mechanisms to keep them in a reduced form.
It is well documented that α-tocopherol is an important lipid soluble antioxidant (Li et al.,
2008). Leipner et al. (1999) also found that a cold-tolerant corn genotype had more α-
tocopherol content in their leaves than a cold-sensitive genotype when they were grown in the
field during the spring. Therefore, it is possible that this antioxidant could be also involved on
the mechanisms against oxidative damage caused by cold.
Based on what is described above, it is obvious that more efforts are needed in order to
understand the specific role of each antioxidant enzyme or compound in corn cold tolerance.
Most specifically, genetic approaches are needed where each point of the antioxidant system
will be down regulated in order to clarify its function.
300 Ricardo Aroca

CONCLUSION
All the above data support the idea that there are some important differences between
cold-tolerant and cold-sensitive corn genotypes. Cold-tolerant genotypes are able to keep their
leaf water status almost unchanged under cold conditions, mainly due to their faster stomatal
closure and their capacity to keep root water uptake unaltered. At the same time, cold-tolerant
genotypes decrease their photosynthesis rate in a less extent than sensitive ones, and also the
former have better mechanisms of excess energy dissipation. By contrast, there are still several
questions to be addressed in order to clarify the different sensitivity to cold among corn
genotypes. (1) How do the different molecular signals involved in stomatal closure behave in
the different corn genotypes under cold conditions? (2) Are there any differences in the
capacity of root nutrient uptake between the sensitive and tolerant corn genotypes? (3) How do
the different antioxidants mechanisms operate under cold conditions in the different corn
genotypes? These three questions are some of the open research fields to be studied in the
future in order to clarify the different tolerance to cold among corn genotypes.

REFERNECES

Affourtit, C; Albury, MSW; Crichton, PG; Moore, AL. Exploring the molecular nature of
alternative oxidase regulation and catalysis. FEBS Letters, 2002 510, 121-126.
Amthor, JS. The McCree-de Wit-Penning de Vries-Thornley respiration paradigms: 30 years
later. Annals of Botany, 2000 86, 1-20.
Aroca, R; Amodeo, G; Fernández-Illescas, S; Herman, EM; Chaumont, F; Chrispeels, MJ. The
role of aquaporins and membrane damage in chilling and hydrogen peroxide induced
changes in the hydraulic conductance of maize roots. Plant Physiology, 2005 137, 341-
353.
Aroca, R; Irigoyen, JJ; Sánchez-Díaz, M. Photosynthetic characteristics and protective
mechanisms against oxidative stress during chilling and subsequent recovery in two maize
varieties differing in chilling sensitivity. Plant Science, 2001a 161, 719-726.
Aroca, R; Irigoyen, JJ; Sánchez-Díaz, M. Drought enhances maize chilling tolerance. II.
Photosynthetic traits and protective mechanisms against oxidative stress. Physiologia
Plantarum, 2003a 117, 540-549.
Aroca, R; Tognoni, F; Irigoyen, JJ; Sánchez-Díaz, M; Pardossi, A. Different root low
temperature response of two maize genotypes differing in chilling sensitivity. Plant
Physiology and Biochemistry, 2001b 39, 1067-1073.
Aroca, R; Vernieri, P; Irigoyen, JJ; Sánchez-Díaz, M; Tognoni, F; Pardossi, A. Involvement of
abscisic acid in leaf and root of maize (Zea mays L.) in avoiding chilling-induced water
stress. Plant Science, 2003b 165, 671-679.
Atkin, OK; Holly, C; Ball, MC. Acclimation of snow gum (Eucalyptus pauciflora) leaf
respiration to seasonal and diurnal variations in temperature: the importance of changes in
the capacity and temperature sensitivity of respiration. Plant, Cell and Environment, 2000
23, 15-26.
 Low Temperature Effects on the Early Development of Corn Seedlings 301

Baker, NR. Chlorophyll fluorescence: a probe of photosynthesis in vivo. Annual Review of

Plant Biology, 2008 59, 89-113.
Bhosale, SU; Rymen, B; Beemster, GTS; Melchinger, AE; Reif, JC. Chilling tolerance of
central european maize lines and their factorial crosses. Annals of Botany, 2007 100, 1315-
1321.
Bloom, AJ; Zwieniecki, MA; Passioura, JB; Randall, LH ; Holbrook, NM ; St Clair, DA.
Water relations under root chilling in a sensitive and tolerant tomato species. Plant, Cell
and Environment, 2004 27, 971-979.
Bos, HJ; Tijani-Eniloa, H; Struik, PC. Morphological analysis of leaf growth of maize:
responses to temperature and light intensity. Netherlands Journal of Agriculture Science,
2000 48, 181-198.
Boomsma, CR; Vyn, TJ. Maize drought tolerance: potential improvements through arbuscular
mycorryzal symbiosis? Field Crop Research, 2008 108, 14-31.
Capell, B; Dörffling, K. Genotypic-specific differences in chilling tolerance of maize in
relation to chilling induced changes in water status and abscisic acid accumulation.
Physiologia Plantarum, 1993 88, 638-646.
Ciamporová, M; Dekánková, K. Root system morphology and anatomy of cold-sensitive
Penjalinan and cold tolerant Z7 genotypes of maize. Biologia, 1998 53, 133-139.
Demmig-Adams, B; Adams, WW. Photoprotection in an ecological context: the remarkable
complexity of thermal energy dissipation. New Phytologist, 2006 172, 11-21.
Engels, C; Marschner, H. Effect of sub-optimal root zone temperatures at varied nutrient
supply and shoot meristem temperature on growth and nutrient concentrations in maize
seedlings (Zea mays L.). Plant and Soil, 1990 126, 215-225.
Enoki, H; Sato, H; Koinuma, K. SSR analysis of genetic diversity among maize imbred lines
adapted cold regions of Japan. Theoretical and Applied Genetics, 2002 104, 1270-1277.
Fennell, A; Markhart, A. Rapid acclimation of root hydraulic conductivity to low temperature.
Journal of Experimental Botany, 1998 49, 879-884.
Foyer, CH; Vanacker, H; Gómez, LD; Harbinson, J. Regulation of photosynthesis and
antioxidant metabolism in maize leaves at optimal and chilling temperatures: review.
Plant Physiology and Biochemistry, 2002 40, 659-668.
Frei, OM. Changes in yield physiology of corn as a result of breeding in northern Europe.
Maydica, 2000 45, 173-183.
Furbank, RT; Hatch, MD; Jenkins, CLD. C4 photosynthesis: mechanisms and regulation. In:
Leegood RC, Sharkey TD editors. Photosynthesis: physiology and metabolism. Dordrecht:
Kluwer Academic Publishers; 2000; 435-457.
Haldimann, P. Chilling induced changes to carotenoid composition, photosynthesis and the
maximum quatum yield of photosystem II photochemistry in two maize genotypes
differing in tolerance to low temperature. Journal of Plant Physiology, 1997 151, 610-619.
Hodges, DM; Andrews, CJ; Johnson, DA; Hamilton, RI. Antioxidant compound responses to
chilling stress differentially sensitive inbred maize lines. Physiologia Plantarum, 1996 98,
685-692.
Hodges, DM; Andrews, CJ; Johnson, DA; Hamilton, RI. Antioxidant enzymes responses to
chilling stress in differentially sensitive inbred maize lines. Journal of Experimental
Botany, 1997 48, 1105-1113.
302 Ricardo Aroca

Hoefnagel, MHN; Millar, AH; Wiskich, JT; Day, DA. Cytochrome and alternative respiratory
pathways compete for electrons in the presence of pyruvate in soybean mitochondria.
Archives of Biochemistry and Biophysics, 1995 318: 394-400.
Hola, D; Kutik, J; Kocova, M; Rothova, O. Low-temperature induced changes in the
ultrastructure of maize mesophyll chloroplasts strongly depend on the chilling
pattern/intensity and considerably differ among inbred and hybrid genotypes.
Photosynthetica, 2008 46, 329-338.
Hong, SS; Xu, DQ. Reversible inactivation of PS II reaction centers and the dissociation of
LHC II from PS II complex in soybean leaves. Plant Science, 1999 147, 111-118.
Hund, A; Fracheboud, Y; Soldati, A; Stamp, P. Cold tolerance of maize seedlings as
determined by root morphology and photosynthetic traits. European Journal of Agronomy,
2008 28, 178-185.
Hund, A; Frascaroli, E; Leipner, J; Jompuk, C; Stamp, P; Fracheboud, Y. Cold tolerance of the
photosynthetic apparatus: pleiotropic relationship between photosynthetic performance
and specific leaf area of maize seedlings. Molecular Breeding, 2005 16, 321-331.
Irigoyen, JJ; Pérez de Juan, J; Sánchez-Díaz, M. Drought enhances chilling tolerance in a
chilling-sensitive maize (Zea mays) variety. New Phytologist, 1996 134, 53-59.
Janowiak, F; Luck, E; Dörffling, K. Chilling tolerance of maize seedlings in the field during
cold periods in spring is related to chilling-induced increase in abscisic acid levels.
Journal of Agronomy and Crop Science, 2003 189, 156-161.
Javot, H; Lauvergeat, V; Santoni, V; Martin-Laurent, F; Guclu, J; Vinh, J; Heyes, J; Franck,
KI; Schäffner, AR; Bouchez, D; Maurel, C. Role of a single aquaporin isoform in root
water uptake. Plant Cell, 2003 15, 509-522.
Jiang, LC; Li, JH; Chen, WP; Li, PH; Ahlstrand, GG. Cytochemical localization of calcium
and Ca2+-ATPase activity in plant cells under chilling stress: a comparative study between
the chilling-sensitive maize and the chilling-insensitive winter wheat. Plant and Cell
Physiology, 1999 40, 1061-1071.
Juszczuk, IM; Rychter, AM. Alternative oxidase in higher plants. Acta Biochimica Polonica,
2003 50, 1257-1271.
Kaldenhoff, R; Grote, K; Zhu, JJ; Zimmermann, U. Significance of plasmalemma aquaporins
for water transport in Arabidopsis thaliana. Plant Journal, 1998 14, 121-128.
Kammerloher, W; Fischer, U; Pietchottka, GP; Schäffner, AR. Water channel in the plant
plasma membrane cloned by immunoselection from a mammalian expression system.
Plant Journal, 1994 6, 187-199.
Kingston-Smith, AH; Harbinson, J; Williams, J; Foyer, CH. Effect of chilling on carbon
assimilation, enzyme activation, and photosynthetic electron transport in the absence of
photoinhibition in maize leaves. Plant Physiology, 1997 114, 1039-1046.
Kocsy, G; von Ballmoos, P; Ruegsegger, A; Szalai, G; Galiba, G; Brunold, C. increase the
gluthatione content in a chilling-sensitive maize genotype using safeners increased
protection against chilling-induced injury. Plant Physiology, 2001 127, 1147-1156.
Koscielniak, J; Biesaga-Koscielniak, J. The effect of short warm breaks during chilling in
water status, intensity of photosynthesis of maize seedlings and final grain yield. Journal
of Agronomy and Crop Science, 2000 184, 1-12.
 Low Temperature Effects on the Early Development of Corn Seedlings 303

Ledford, HK; Niyogi, KK. Singlet oxygen and photo-oxidative stress management in plants
and algae. Plant, Cell and Environment, 2005 28, 1037-1045.
Leipner, J; Fracheboud, Y; Stamp, P. Effect of growing season on the photosynthetic apparatus
and leaf antioxidative defence in two maize genotypes of different chilling tolerance.
Environmental and Experimental Botany, 1999 42, 129-139.
Leipner, J; Jompuk, C; Camp, KH; Stamp, P; Fracheboud, Y. QTL studies reveal little
relevance of chilling-related seedlings traits for yield in maize. Theoretical and Applied
Genetics, 2008 116, 555-562.
Li, Y; Wang, ZN; Sun, XF; Tang, KX. Current opinions on the functions of tocopherol based
on the genetic manipulation of tocopherol biosynthesis in plants. Journal of Integrative
Plant Biology, 2008 50, 1057-1069.
Luxová, M; Gaspáriková, O. The effect of low temperature on root respiration in maize.
Biologia, 1999 54, 453-458.
Maurel, C. Plant aquaporins: novel functions and regulation properties. FEBS Letters, 2007
581, 2227-2236.
Maurel, C; Reizer, J; Schroeder, JI; Chrispeels, MJ. The vacuolar membrane protein γTIP
creates water specific channels in Xenopus oocytes. EMBO Journal, 1993 12, 2241-2247.
Mauro, S; Dainese, P; Lannoye, R; Bassi, R. Cold-resisteant and cold-sensitive maize lines
differ in the phosphorylation of the photosystem II subunit, CP29. Plant Physiology, 1997
115, 171-180.
Moynihan, MR; Ordentlich, A; Raskin, I. Chilling-induced heat evolution in plants. Plant
Physiology, 1995 108, 995-999.
Navrot, N; Rouhier N; Gelhaye, E; Jacquot, JE. Reactive oxygen species generation and
antioxidant systems in plant mitochondria. Physiologia Plantarum, 2007 129, 185-195.
Noli, E; Casarini, E; Urso, G; Conti, S. Suitability of three vigour test procedures to predict
field performance of early sown maize seed. Seed Science and Technology, 2008 36, 168-
176.
Padilla, JM; Otegui, ME. Co-ordination between leaf initiation and leaf appearance in field
grown maize (Zea mays): genotypic differences in response of rates to temperature. Annals
of Botany, 2005 96: 997-1007.
Pavel, EW; Fereres, E. Low soil temperatures induce water deficits in olive (Olea europaea)
trees. Physiologia Plantarum, 1998 104, 525-532.
Pei, ZM; Kuchitsu, K. Early ABA signalling events in guard cells. Journal of Plant Growth
Regulation, 2005 24, 296-307.
Pérez de Juan, J; Irigoyen, JJ; Sánchez-Díaz, M. Chilling of drought-hardened and non-
hardened plants of different chilling-sensitive maize lines. Changes in water relations and
ABA contents. Plant Science, 1997 122, 71-79.
Pietrini, F; Chaudhuri, D; Thapliyal, AP; Massacci, A. Analysis of chlorophyll fluorescence
transients in mandarin leaves during photo-oxidative cold shock and recovery. Agriculture
Ecosystems and Environment, 2005 106, 189-198.
Pimentel, C; Davey, PA; Juvik, JA; Long, SP. Gene loci in maize influencing susceptibility to
chilling dependent photoinhibition of photosynthesys. Photosynthesis Research, 2005 85,
319-326.
304 Ricardo Aroca

Podestá, FE; Iglesias, AA; Andreo, CS. Oligomeric enzymes in the C4 pathway of
photosynthesis. Photosynthesis Research, 1990 26, 161-170.
Ribas-Carbo, M; Aroca, R; González-Meler, M; Irigoyen, JJ; Sánchez-Díaz, M. The electron
partitioning between the cytochrome and alternative respiratory pathways during chilling
recovery in two cultivars of maize differing in chilling sensitivity. Plant Physiology, 2000
122, 199-204.
Richner, W; Kiel, C; Stamp, P. Is seedling root morphology predictive of seasonal
accumulation of shoot dry matter in maize? Crop Science, 1997 37, 1237-1241.
Robinson, SA; Yakir, D; Ribas-Carbo, M; Giles, L; Osmond, CB; Siedow, JN; Berry, JA.
Measurements of the engagement of cyanide-resistant respiration in the crassulacean acid
metabolism plant Kalanchoë daigremontiana with the use of on-line oxygen isotope
discrimination. Plant Physiology, 1992 100, 1087-1091.
Rodríguez, VM; Butrón, A; Malvar, RA; Ordas, A; Revilla, P. Quantitative trait loci for cold
tolerance in the maize IBM population. International Journal of Plant Science, 2008 169,
551-556.
Sage, RF; Kubien, DS. The temperature response of C3 and C4 photosynthesis. Plant, Cell and
Environment, 2007 30, 1086-1106.
Shabala, S; Shabala, L. Kinetics of net H+, Ca2+, K+, Na+, NH4+, and Cl- fluxes associated with
post-chilling recovery of plasma membrane transporters in Zea mays leaf and root tissues.
Physiologia Plantarum, 2002 114, 47-56.
Sluse, FE; Jarmuszkiewicz, W. Alternative oxidase in the branched mitochondrial respiratory
network: an overview on structure, function, regulation, and role. Brazilian Journal of
Medical and Biological Research, 1998 31, 733-747.
Song, WY; Zhang, ZB; Shao, HB; Guo, XL; Cao, HX; Zhao, HB; Fu, ZY; Hu, XJ.
Relationship between calcium decoding elements and plant abiotic-stress resistance.
International Journal of Biological Sciences, 2008 4, 116-125.
Suzuki, N; Mittler, R. Reactive oxygen species and temperature stresses: a delicate balance
between signalling and destruction. Physiologia Plantarum, 2006 126, 45-51.
Thiagarajah, MR; Hunt, LA. Effects of temperature on leaf growth in corn (Zea mays).
Canadian Journal of Botany, 1982 60: 1647-1652.
Tollenaar, M; Daynard, TB; Hunter, RB. Effect of temperature on rate of leaf appearance and
flowering data in maize. Crop Science, 1979 19, 363-366.
Vanlerberghe, GC; McIntosh, L. Lower growth temperature increases alternative pathway
capacity and alternative oxidase protein in tobacco. Plant Physiology, 1992 100, 115-119.
Vernieri, P; Lenzi, A; Figaro, M; Tognoni, F; Pardossi, A. How the roots contribute to the
ability of Phaseolus vulgaris L. to cope with chilling-induced water stress. Journal of
Experimental Botany, 2001 52, 2199-2206.
Von Caemmerer, S; Furbank, RT. The C4 pathway: an efficient CO2 pump. Photosynthesis
Research, 2003 77, 191-207.
Wagner, AM. A role for active oxygen species as second messengers in the induction of
alternative oxidase gene expression in Petunia hybrida cells. FEBS Letters, 1995 368,
339-342.
Wang, PT; Song, CP. Guard-cell signalling for hydrogen peroxide and abscisic acid. New
Phytologist, 2008 178, 703-718.
 Low Temperature Effects on the Early Development of Corn Seedlings 305

Wilkinson, S; Clephan, AL; Davies, WJ. Rapid low temperature-induced stomatal closure
occurs in cold tolerant Commelina communis leaves but not in cold-sensitive tobacco
leaves, via a mechanism that involves apoplastic calcium but not abscisic acid. Plant
Physiology, 2001 126, 1566-1578.
Wingler, A; Walker, RP; Chen, ZH; Leegod, RC. Phosphoenolpyruvate carboxikinase is
involved in the decarboxylation of aspartate in the bundle sheath of maize. Plant
Physiology, 1999 120, 539-545.
Wingsle, G; Karpinski, S; Hallgren, JE. Low temperature, high light stress and antioxidant
defence mechanisms in higher plants. Phyton-Annales Rei Botanicae, 1999 39, 253-268.
Yamasaki, M; Wright, SI; McMullen, MD. Genomic screening for artificial selection during
domestication and improvement in maize. Annals of Botany, 2007 100, 967-973.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 8

SOIL WATER BALANCE AND YIELD OF DRYLAND

MAIZE USING THE CROPSYST MODEL

M. G. Abraha and M. J. Savage1

Soil-Plant-Atmosphere Continuum Research Unit, School of Environmental Sciences,
University of KwaZulu-Natal, Pietermaritzburg, South Africa

ABSTRACT
Crop growth models are increasingly being used as decision support tools to help
optimize crop and soil management strategies. Crop growth models need to be calibrated
and validated for the site and crop variety of interest. This study is undertaken to evaluate
the ability of CropSyst, a cropping systems simulation model, to simulate the yield and
soil water balance of dryland maize (Zea mays L. cv. PAN 6568) at Cedara, KwaZulu-
Natal, South Africa. Soil, plant, weather and management data were used as inputs for
calibration and validation of the CropSyst model. Model crop parameters were calibrated
using past experiments or obtained from model documentation, with slight modification to
account for varietal differences. Validation of crop parameters was carried out using an
independent dataset not previously used for calibration. The model-predicted phenology
and grain yield of maize with reasonable accuracy, but consistently under-estimated the
soil water content of the deeper depths with more pronounced under-estimation about 80
days after start of simulation. The CropSyst model appears to be an adequately suitable
tool for crop management applications, climate change studies and research applications.
For more accurate and reliable results, the CropSyst model should be validated for the site
and crop under study with more observed data.

INTRODUCTION
Soil water availability in the crop root zone is an important determining factor affecting
crop development, growth and yield of dryland production systems. In such systems, the

1 To whom all correspondence should be addressed.«27 +33 2605510; fax 27 +33 2605514; E-mail
savage@ukzn.ac.za.
308 M. G. Abraha and M. J. Savage

availability of soil water to the crop is dependent mainly on precipitation. As the crop canopy
and roots grow in size and space, the demand for water increases accordingly and the roots
extract more water from a larger volume of soil impacting on the soil water balance. Depletion
of the soil water content beyond a certain threshold level would affect dry matter accumulation
negatively. The processes involved in and information obtained from dry matter accumulation
and availability and transport of soil water could be logically organized for predictions of crop
development, growth and yield, and the soil water balance. To this end, computer simulation
models of crop growth and the soil water balance have been successfully used to provide
predictions of development, growth and yield of crops (Jones and Ritchie, 1990).
Computer simulation models integrate information from the crop, soil and atmosphere, at
various levels of complexity, into a comprehensive cropping system to predict their effects on
the soil water balance, nutrient dynamics, and development and growth of crops. Reliability of
these computer simulation models lies in their predictive capability and hence validation of the
model using data from field experiments becomes a necessary prerequisite (Pala et al., 1996).
Once the validation of these computer simulation models for a particular location and crop
variety is ascertained, they can be used for crop management purposes such as irrigation
scheduling, policy formulations, climate change applications and identifying research priorities
(Hoogenboom, 2000).
CropSyst, a cropping systems simulation model has been developed to study the effect of
cropping systems management on productivity (Stöckle and Nelson, 2000; Stöckle et al.,
2003). It is a user-friendly model consisting of several submodels. The CropSyst model and
submodels, as they evolved through time, have been subjected to several tests, validations and
applications for a wide range of management conditions and a variety of crops and cropping
systems in a range of locations all over the world (e.g., Campbell and Stöckle, 1993; Stöckle et
al., 1994; Donatelli et al., 1996; Pala et al., 1996; Badini et al., 1997; Stöckle and Debaeke
1997; Stöckle et al., 1997; Pannkuk et al., 1998; Ferrer-Alegre and Stöckle, 1999; Jara and
Stöckle, 1999; Abraha and Savage, 2006, 2008a, b). The work by Abraha and Savage (2006)
showed that the CropSyst model could be used to investigate the impact of climate scenarios
on maize yield. In their work, it was concluded that earlier planting of maize may be most
useful for site-specific analyses of possible mitigation of the impacts of climate change
through alteration of crop management practices. Under non-limiting soil water conditions, it
was found that for a doubling of atmospheric [CO2] and an increased mean daily air
temperature, the change in simulated grain yield is a balance between the beneficial effects of
increased atmospheric [CO2] on yield and the yield reducing effects of an increased mean daily
air temperature.
CropSyst is a multi-year, multi-crop daily time step crop growth simulation model. The
model has been developed to serve as an analytical tool to study the effect of cropping systems
management on productivity and the environment. The model simulates the soil water balance,
soil-plant nitrogen balance, crop canopy and root growth, dry matter production, yield, residue
production and decomposition, and soil erosion. Management options include: cultivar
selection, crop rotation (including fallow years), irrigation, nitrogen fertilization, tillage
operations, and residue management (Stöckle and Nelson, 2000; Stöckle et al., 2003).
CropSyst simulates the amount of water used for crop development and growth by modelling
the components of the soil water balance. The water balance components considered by
CropSyst include: irrigation, precipitation, shallow water table (finite difference), rainfall
intercepted by the crop foliage and surface residue, surface runoff and residue evaporation,
 Soil Water Balance and Yield of Dryland Maize Using the CropSyst Model 309

infiltration through soil layers, transpiration, deep percolation and water storage in the soil
profile. Above-ground crop growth is represented in terms of above-ground biomass
accumulation. CropSyst models this growth as: water-, radiation-, nitrogen- and temperature-
limited crop growth (Stöckle and Nelson, 2000; Stöckle et al., 2003).
Since daily solar radiation is an input required by most crop growth, development and
yield simulation models but is not observed at many locations, Abraha and Savage (2008a)
evaluated several existing models estimating solar radiation based on daily minimum and
maximum air temperature and/or precipitation for seven sites in the world, and investigated the
impact of the estimated solar radiation on grass reference evapotranspiration and total plant dry
biomass on simulations for maize. Their simulations of grass reference evapotranspiration and
total maize dry biomass involved use of the CropSyst simulation model.
This study is undertaken to evaluate the ability of the CropSyst model to simulate the soil
water balance and yield of dryland maize (Zea mays L. cv. PAN 6568) at Cedara, KwaZulu-
Natal, South Africa using maize grain yields and phonological phenological stages of several
years, averaged over several plots for maize. Since CropSyst computes the amount of water
used for crop development and growth by modelling the soil water balance, the validity of the
soil water balance for maize is established, and calibration and validation of the model is
undertaken using maize phenological and grain yield data.

MATERIALS AND METHODS

Data

Plant, soil and weather data for maize (L. cv. PAN 6568) were obtained from cropping
system experiments conducted at Cedara (29º32′S, 30º17′E, altitude 1076 m), KwaZulu-Natal,
South Africa, during the growing seasons of 1997/98 to 2001/02. Cedara has a humid, sub-
tropical climate with summer rainfall. Daily data on sunshine duration, precipitation and
maximum and minimum air temperatures, matching the growing seasons, for the site were
obtained. The sunshine duration was converted into solar radiant density using Ångström’s
(1924) equation with coefficients developed for South African conditions (Reid, 1986). Daily
solar radiant density was also estimated from daily maximum and minimum air temperatures
using a radiation estimation model of Donatelli and Bellochi (2001) for days with missing
sunshine duration data (e.g., part of the year 1998). These procedures are also described by
Abraha and Savage (2008a). These data were used for calibration and validation of model crop
parameters for the phenological stages and grain yield simulations.
The plant, soil and weather data for validation of the soil water balance were collected
from a field trial established at Cedara during the 2002/03 growing seasons. Dryland maize
was planted on November 21, 2002 in 18 m × 6 m plots with three replications with a row
width of 0.75 m and a planting density of 44000 seeds per hectare for silage. As described by
Abraha and Savage (2008a), observed and estimated solar radiation along with daily maximum
and minimum air temperature, precipitation, maximum and minimum relative humidity or
vapour pressure and wind speed were used to simulate grass reference evapotranspiration
(ETo) and total dry biomass of maize.
310 M. G. Abraha and M. J. Savage

The soil at the experimental site was classified according to the South African Binomial
Classification System as a Hutton form, Hayfields family (Soil Classification Working Group,
1991). On average, for the 0- to 1000-mm soil depths, the lower limit of plant available water
(permanent wilting point) was 0.18 m3 m-3 and the drained upper limit (field capacity) was
0.31 m3 m-3.
Volumetric soil water content was measured every three days to a depth of 1000 mm at
intervals of 100 mm using a Diviner 2000 capacitance profile probe (Sentek Environmental
Technologies, Stepney, Australia). Measurements taken at the same depth from two access
tubes for each plot were averaged. Measurements from the Diviner 2000 probe were calibrated
against those from a PR1-6 frequency domain reflectometer profile probe (Delta-T,
Cambridge, UK) which was in turn calibrated using gravimetric measurements. The
calibrations were made at soil depths of 100, 200, 300, 400, 600 and 1000 mm (Gebregiorgis
and Savage, 2006).
Weather data for the 2002/03 growing seasons were collected from an automatic weather
station located approximately 100 m from the experimental site. The average minimum and
maximum air temperatures, and total precipitation during the summer 2002/03 growing season
were 12 oC, 24 oC and 555 mm respectively.
Initial soil water conditions for all depths in the simulation were provided whenever
measurements were available; otherwise the simulation was made to start two days following
substantial rainfall for which the initial soil water contents of all layers were set to field
capacity. The water redistribution in the soil profile was calculated using a finite difference
approach for which upward or downward water movement depends on the soil water potential
of adjacent layers. The presence of soil surface residue and a water table were ignored. The
depth to the water table was well below the maximum crop rooting depths and did not affect
the soil water conditions within the crop root zone. The nitrogen sub-routine was disabled
since all plots were fertilized, as required, according to the standard soil chemical analyses.
The salinity sub-routine was also disabled since the chemical analyses revealed that the soil is
slightly acidic.

CALIBRATION AND VALIDATION

It is not unusual to find some discrepancies between measured data and simulated outputs
when a model is used for environments other than for which it is developed (Whisler et al.,
1986). It is, therefore, crucial to correctly interpret these discrepancies and subsequently adjust
the input parameters so that simulation outputs agree with the measured data (Whisler et al.,
1986). Such adjustments were made by calibrating the soil and crop input parameter values,
that are either available in CropSyst or obtained from other sources, within a narrow range of
reasonable variation (Stöckle and Nelson, 2000). Crop parameters that resulted in the least root
mean square error (RMSE) and largest Willmott’s (d) index of agreement (Willmott, 1981)
between the simulated and observed crop developmental stages, growth characteristics and soil
water contents were retained. For this study, the calibrated crop parameters are presented in
Table 1. Other inputs, such as weather, soil and management data were also used.
 Soil Water Balance and Yield of Dryland Maize Using the CropSyst Model 311

Table 1. Crop parameters, for maizea, used in the CropSyst model simulations

Growth parameters
Biomass-transpiration coefficient (kPa kg m-3) 10.0
Light to above ground biomass conversion (g MJ-1) 4.00
At/Pt ratio that limits leaf area growth 0.9b
At/Pt ratio that limits root growth 0.5
Optimum mean daily temperature (oC) 25
Maximum water uptake (mm day-1) 14
Leaf water potential at onset of stomatal closure (J kg-1) -1200
Wilting leaf water potential (J kg-1) -1800
Crop morphology
Maximum rooting depth (m) 1.5
Initial green leaf area index (m2 m-2) 0.011
Maximum expected leaf area index (LAI) (m2 m-2) 5
Fraction of maximum LAI at physiological maturity 0.95b
Specific leaf area (m2 kg-1) 22
Stem/leaf partition coefficient 2.8
Leaf duration (oC day) 876b
Extinction coefficient for solar radiation (m-1) 0.50
Leaf duration sensitivity to water stress 1.0
ET crop coefficient at full canopy 1.20c
Crop phenology
Growing degree day (GDD) emergence (oC day) 61d
GDD flowering (oC day) 785d
GDD grain filling (oC day) 860d
GDD physiological maturity (oC day) 1530d
GDD peak LAI (oC day) 765b
Base temperature (oC) 10.00b
Cutoff temperature (oC) 30
Phenologic sensitivity to water stress 1
Harvest
Unstressed harvest index 0.45b
Sensitivity to water stress during flowering 0.1
Sensitivity to water stress during grain filling 0.1
Translocation to grain factor 0.4b
a
Crop parameters for maize are obtained from CropSyst manual (Stöckle and Nelson, 2000) unless
indicated otherwise
b
Set by calibration
c
Taken from Allen et al. (1998)
d
Determined from the field trial data

The data used for calibration and validation of maize grain yield and phenological stages
came from the South African National Cultivar Trial (Du Plessis and Bruwer, 1999-2002)
which represents averages over several years. The 1997/98 data were used for calibration and
data for 1998/99 to 2001/02 was used for validation. For 2002/03, the maize was grown as
silage and hence no grain yield data were available.
312 M. G. Abraha and M. J. Savage

The agreement between simulated and observed volumetric soil water contents was
evaluated using coefficient of determination (R2), MAE (mean absolute error), RMSE and the
d-index of agreement. The d-index varies between 0 and 1, with an index of 1 indicating
perfect agreement between model simulations and observations (Willmott, 1981). The
agreement between observed and model-predicted phenological dates and grain yield of maize
were evaluated using χ2 and the Student t-test respectively.

RESULTS AND DISCUSSION

The model divides the soil profile into layers and simulates crop water uptake depending
on the physical and chemical properties of the soil, root extension and root growth in a
particular soil layer. The study involved dryland maize with roots potentially extending to a
depth of 1.5 m. The soil water content, therefore, needs to be considered on a layer-by-layer
basis to match the model simulations.
Since the crop plays a key role in the water balance of agricultural crops, correct
simulation of crop growth and development is a good indication of correct prediction of water
use by the crop (Campbell and Stöckle, 1993). Correspondence between the measured and the
simulated soil water balance is also as good indication of correct model prediction. For this
purpose, five years (1997/98 to 2001/02) of grain yield and phenological data of maize were
used. The 1997/98 growing season data were used for calibration and data from 1998/99 to
2001/02 were used for validation of the CropSyst model.
Model outputs in the number of days after planting to flowering and to maturity, and grain
yield were evaluated using R2, MAE, RMSE and d-index. Since the number of data points
available for validation are few, these statistics were complemented with χ 2 and the Student
t-test. The model-simulated number of days after planting to flowering agreed perfectly with
the observed field data except for one day lag in the 2001/2002 growing season. The R2, MAE,
RMSE and d-index achieved for this output were also good (Table 2). Comparison of the
observed and simulated physiological maturity date was good for the 1998/99 and 1999/2000
growing seasons with an overestimation by as much as five days for the 2000/01 and 2001/02
growing seasons. The R2, MAE, RMSE and d-index values for the maturity date are not as good
as for the flowering date but still they were reasonably good (Table 2). A χ 2 test conducted at
the 5% level of significance showed no significant difference between the observed and
model-simulated dates for both the flowering and maturity dates. The simulated and observed
grain yields also agreed reasonably well with a slight underestimation in 2000/01. This
underestimation is reflected in particularly low R2 and d-index values (Table 2). But a paired t-
test conducted at the 5% level of significance showed no significant difference between the
observed and simulated mean grain yields.
Stöckle et al. (1994) simulated grain yield of maize using the CropSyst model and
compared them with observed values for irrigation application ranging from full irrigation to
near dryland farming in Davis, California and Fort Collins, Colorado. For 27 data points
pooled together the RMSE was 0.724 t ha-1 and the d-index 0.950, compared to 0.323 t ha-1 and
0.663 respectively for four data points in our study. Besides the number of data points
considered, the average observed and simulated grain yields in the two studies were different.
 Soil Water Balance and Yield of Dryland Maize Using the CropSyst Model 313

Table 2. Comparison between observed and model-predicted results on development

stages of maize at Cedara for the 1998/99 to 2001/02 growing seasons

Flowering date (DAP)* Maturity date (DAP) Grain yield (t ha-1)

Observed Simulated Observed Simulated Observed Simulated
Minimum 81 80 153 154 11.72 11.58
Maximum 85 85 163 168 12.40 12.40
Mean 82.5 82.25 156.25 159.25 12.12 12.01
Standard deviation 1.92 2.22 4.573 6.08 0.29 0.39
R2 0.96 0.87 0.22
MAE 0.25 3 0.22
RMSE 0.50 3.67 0.32
d-index 0.98 0.86 0.66
* DAP – days after planting, R2 is the coefficient of determination, MAE is the mean absolute error,
RMSE is the total root mean square error (m3 m-3) and d-index is Willmott’s index of agreement

Similar work by Stöckle and Campbell (1985) resulted in prediction errors ranging from 1
to 11.6% compared to from 0 to 5.1% in our study. Crop growth model studies for the soil
water balance and growth and developmental stages of maize were also conducted by some
researchers in South Africa. Annandale et al. (1999) compared simulated and observed grain
yields and soil water balance under maize at the experimental station of the University of the
Orange Free State (irrigated) and on several other dryland ecotopes using the SWB (Soil Water
Balance) model. In general, the simulated versus observed grain yield and soil water balance
were more in agreement for irrigated than for dryland maize. Grain yield in particular was not
well simulated under water-logged conditions. They also reported similar simulation results for
the water-logged condition from studies conducted elsewhere using the CERES model. du Toit
et al. (2001) also evaluated CERES3 (maize) model for six maize cultivars with varying
maturity dates at Potchefstroom. They found that the simulation accuracy was extremely low
for grain yield and silking dates but reasonably good for soil water.
The agreement in the observed and simulated phenological events and grain yields of
maize achieved in this study provide confidence in the validation of the model’s soil water
balance predictions. The soil water balance for the maize crop was validated using data for the
2002/03 growing season. The statistical results achieved from the validation of the soil water
balance sub-routine of the CropSyst model under maize-planted conditions were reasonably
good (Table 3 and Figure 1). In this simulation exercise, the effect of root water extraction
from deeper levels was apparent. The observed soil water content was greater than that
simulated especially for the 400-mm soil layer and below (Figure 1). Thus, the sum of the
components of the soil water balance leaving the root zone is overestimated by the model. The
trend of the simulated soil water content also appeared to follow that observed during the first
half of the simulation days but drifts away from the observed during the other half for the 400-
mm soil layer and below. The second half of the simulation corresponded to the time when
only a few degree days remained to flowering (as simulated by CropSyst). At this time, the
model had simulated maximum root growth and dried the soil more than that indicated by
observations. This discrepancy between the observed and simulated soil water content could
probably be due to differences in model-simulated and actual root growth.
314 M. G. Abraha and M. J. Savage

Table 3. The statistical results (n = 22) for when validating the CropSyst model for the
soil water balance using field-measured soil water content (m3 m-3) for the 2002/03 season
at Cedara

Depth Slope Intercept R2 RMSEs RMSEu RMSE d-index

(mm) (m3 m-3) (m3 m-3)
100 0.692 0.077 0.483 0.018 0.033 0.038 0.814
200 0.920 0.012 0.866 0.009 0.016 0.019 0.955
300 1.016 -0.019 0.898 0.015 0.014 0.020 0.943
400 1.342 -0.155 0.826 0.049 0.019 0.053 0.678
500 1.679 -0.255 0.786 0.039 0.023 0.045 0.688
600 1.704 -0.273 0.698 0.041 0.026 0.049 0.618
700 1.957 -0.365 0.724 0.045 0.024 0.051 0.563
800 2.209 -0.438 0.810 0.039 0.018 0.043 0.598
900 2.574 -0.562 0.842 0.034 0.015 0.037 0.580
1000 2.705 -0.615 0.682 0.031 0.018 0.036 0.474
R2 is the coefficient of determination, RMSEs, RMSEu and RMSE are the systematic, unsystematic and
total, root mean square errors (m3 m-3) respectively and d-index is Willmott’s index of agreement

Figure 1. Volumetric soil water content variation with days after planting (DAP) for the various depths
for the 2002/03 growing season at Cedara. The lines correspond to the model-simulated values and the
symbols to the Diviner 2000 measured values. Planting date was on Nov 21, 2002. For the soil depths
not shown, the soil water content was similar to that shown
 Soil Water Balance and Yield of Dryland Maize Using the CropSyst Model 315

In other studies, comparison of soil water content measured using a neutron probe and
simulated using algorithms of water uptake from the CropSyst model under maize resulted in a
RMSE ranging from 0.015 to 0.024 m3 m-3 (Jara and Stöckle, 1999). This is less than that
achieved in our study. But it should be noted that their study involved just the soil water
algorithm of the CropSyst model and not the complete model and also the number of data
points for comparison were more in our study than theirs. In other instances, the CropSyst
model was reported to show good agreement between simulated and measured soil water
content under different plants but the RMSE values were not presented (e.g., Stöckle and
Campbell, 1985).
Once the validation of a crop growth model for a certain location and crop variety has
been carried out with reasonably adequate results the model can then be applied in the real
world. For example, validated crop growth models could be run using long-term historical
climate data as an input to assess the probability of yield outcomes for a given location or
region, crop variety and soil (Hoogenboom, 2000). Crop growth models could also be used to
forecast crop yields. For example, for the US Cornbelt, Hodges et al. (1987) used historical
weather data as an input to CERES-Maize, which were replaced with weather forecasts, and
later with observed weather data. The final model-forecasted yields for three years were 97, 98
and 101% of the national official reports. Production forecast for the last year was made during
the growing season. Exercises with crop growth simulations could also assist in identifying
suitable locations, soil, planting dates and crop varieties for growing crops. For instance,
Abraha and Savage (2006) using 30 years of historical climate data as an input to the CropSyst
model found that maize grain yields were greatest when an early planting date was used,
followed by locally practiced and late planting dates at Cedara, KwaZulu-Natal. A similar
yield pattern for early, intermediate and late planting dates was also reported for
Potchefstroom (du Toit et al., 2001). Crop growth models could also be used to answer ‘what
if’ questions in response to varying inputs in management within a matter of minutes, which
may take years if conventional experiments were to be conducted (Whisler et al., 1986).
Validated crop growth models could also be used in evaluating the impact of agricultural
practices on the environment (e.g., Peralta and Stöckle, 2001) which could ultimately assist
policy makers in formulating laws and management practices. The validated crop parameters
in this study were also used to explore the impact of elevated CO2 concentration accompanied
by increases in air temperature and precipitation on productivity of maize grain yield at
Cedara, Kwazulu-Natal (Abraha and Savage, 2006).

CONCLUSIONS
The CropSyst model was reasonably successful in simulating the soil water balance of
dryland maize and was capable of accurately simulating phenology and grain yield of maize at
the site under study. Discrepancies between model-simulated and measured values of soil
water content were observed with time at soil layers deeper than 400 mm. In general, the
CropSyst model appears to be an adequately suitable tool to be used for crop management,
climate change studies and research applications. For more accurate and reliable results from
crop growth models, their validity for the site and crop under study should be ascertained with
316 M. G. Abraha and M. J. Savage

more observed data on growth and developmental stages, soil water balance and other model
outputs of interest.

ACKNOWLEDGMENTS
We thank Ms S Bezuidenhout and Mr N van Rij (Crop Protection Section) of the
Department of Agriculture and Environmental Affairs, Cedara for their assistance and Mr M.
F. Gebregiorgis, Ms J. Manickum, Mr P. Dovey, Mr E. Abib and Mr T. Dorasamy of the
University of KwaZulu-Natal for technical assistance. Crop data for maize were kindly made
available by Mr K. Lawrence, ARC Grain Crops Institute, Cedara sub-centre. Funding from
the University of KwaZulu-Natal and the World Bank in Agreement with the Human Resource
Development of the University of Asmara, Eritrea for this research is also gratefully
acknowledged.

REFERENCES
Abraha, M. G. and Savage, M. J. (2006) Potential impacts of climate change on the grain yield
of maize for the midlands of KwaZulu-Natal, South Africa. Agric. Ecosyst. Environ., 115,
150-160.
Abraha, M. G. and Savage, M. J. (2008a). Comparison of estimates of daily solar radiation
from air temperature range for application in crop simulations. Agric. Forest Meteorol.,
148, 401-416.
Abraha, M. G. and Savage, M. J. (2008b). The soil water balance of rainfed and irrigated oats,
Italian rye grass and rye using the CropSyst model. Irrig. Sci., 26, 203–212.
Allen, R. G., Pereira, L. S., Raes, D. and Smith, M. (1998). Crop evapotranspiration
(guidelines for computing crop water requirements). FAO Irrig Drain Pap No. 56.
Ångström, A. (1924). Solar and terrestrial radiation. Quart. J. Roy. Meteorol. Soc., 50, 121-
126.
Annandale, J. G., Benadé, N., Jovanovic, N. Z., Steyn, J. M. and Du Sautoy, N. (1999).
Facilitating irrigation scheduling by means of the Soil Water Balance model. Pretoria,
South Africa: Water Research Commission Report, ISBN 1-86845-559-9.
Badini, O., Stöckle, C. O. and Franz, E. H. (1997). Application of crop simulation modeling
and GIS to agroclimatic assessment in Burkina Faso. Agric. Ecosyst. Environ., 64, 233-
244.
Campbell, G. S. and Stöckle, C. O. (1993). Prediction and simulation of water use in
agricultural systems. In: Int Crop Sci I. CSA, Madison, WI. pp 67-73.
Donatelli, M. and Bellocchi, G. (2001). Estimate of daily global solar radiation: new
developments in the software RadEst3.00. In: Proc of the Second Int Symp Modelling
Cropping Systems, 16-18 July. Florence, Italy. pp 213-214.
Donatelli, M., Stöckle, C. O., Ceotto, E. and Rinaldi, M. (1996). CropSyst validation for
cropping systems at two locations of Northern and Southern Italy. Eur. J. Agron., 6, 35-45.
 Soil Water Balance and Yield of Dryland Maize Using the CropSyst Model 317

Du Plessis, J. G. and Bruwer, D. de V. (1999-2002). National Cultivar Trials: Maize: Eastern

Areas, 1998/99-2001/02. Potchefstroom, South Africa: ARC-Grain Crops Institute,
Summer Grain Centre.
Du Toit, A. S., Booysen, J. and Human, J. J. (2001). Use of linear regression and a correlation
matrix to evaluate CERES3 (Maize). In: J. W. White, P. R. Grace (Eds.), Modeling
Extremes of Wheat and Maize Crop Performance in the Tropics. Proc of a Workshop,
CIMMYT, El Batán, Mexico, 19-22 April 1999. Available at
http://www.cimmyt.org/Research/NRG/map/research_results/gis_series/modeling00_01/u
se_linear/uselinear_dutoit.htm (last accessed 30 October 2008).
Ferrer-Alegre, F. and Stöckle, C. O. (1999). A model for assessing crop response to salinity.
Irrig. Sci., 19, 15-23.
Gebregiorgis, M. F. and Savage, M. J. (2006). Determination of the timing and amount of
irrigation of winter cover crops with the use of dielectric constant and capacitance soil
water content profile methods. S. Afr. J. Plant Soil, 23, 145-151.
Hodges, T., Botner, D., Sakamoto, C. and Hays Haug, J. (1987). Using the CERES-Maize
model to estimate production for the U.S. Cornbelt. Agric. Forest Meteorol., 40, 293-303.
Hoogenboom, G. (2000). Contribution of agrometeorology to simulation of crop production
and applications. Agric. Forest Meteorol., 103, 137-157.
Jara, J. and Stöckle, C. O. (1999). Simulation of corn water uptake using models with different
levels of process detail. Agron. J., 91, 256-265.
Jones, J. W. and Ritchie, J. T. (1990). Crop growth models. In G. J. Hoffman, T. A. Howell, K.
H. Solomon, (Eds.), Management of Farm Irrigation Systems. ASAE. An ASAE
Monograph, St Joseph, pp 63-89.
Pala, M., Stöckle, C. O. and Harris, H. C. (1996). Simulation of Durum wheat (Triticum
turgidum spp. durum) growth under different water and nitrogen regimes in a
Mediterranean environment using CropSyst. Agric. Syst., 51, 147-163.
Pannkuk, C. D., Stöckle, C. O. and Papendick, R. I. (1998). Validation of CropSyst for winter
and spring wheat under different tillage and residue management practices in a wheat-
fallow region. Agric. Syst., 57, 121-134.
Peralta, J. M. and Stöckle, C. O. (2001). Nitrate from an irrigated crop rotation at the Pasco-
Quincy area (Washington, USA) available for groundwater contamination: a long-term
simulation study. Agric. Ecosyst. Environ., 88, 23-34.
Reid, P. C. M. (1986). Evaluation of the coefficients of Ångström formula for the estimation of
solar radiation in South Africa. S. Afr. J. Plant Soil, 3, 45-48.
Soil Classification Working Group (1991). Soil Classification: A Taxonomic System for South
Africa. The Department of Agricultural Development, Pretoria, South Africa.
Stöckle, C. O., Cabelguenne, M. and Debaeke, P. (1997). Comparison of CropSyst
performance for water management in Southwestern France using submodels of different
levels of complexity. Eur. J. Agron., 7, 89-98.
Stöckle, C. O. and Campbell, G. S. (1985). A simulation model for predicting the effect of
water stress on yield: an example using corn. Adv. Irrig., 3, 283-312.
Stöckle, C. O. and Debaeke, P. (1997). Modelling crop nitrogen requirements: a critical
analysis. Eur. J. Agron., 7, 161-169.
Stöckle, C. O., Donatelli, M. and Nelson, R. (2003). CropSyst, a cropping systems simulation
model. Eur. J. Agron., 18, 289-307.
318 M. G. Abraha and M. J. Savage

Stöckle, C. O., Martin, S. and Campbell, G. S. (1994). CropSyst, a cropping systems model:
water/nitrogen budgets and crop yield. Agric. Syst., 46, 335-359.
Stöckle, C. O. and Nelson, R. (2000). Cropping Systems Simulation Model User’s Manual.
Pullman, WA, USA: Biological Systems Engineering, Washington State University.
Whisler, F. D., Acock, B., Baker, D. N., Fye, R. E., Hodges, H. F., Lambert, J. R., Lemmon, J.
E., Mckinion J. M. and Reddy, V. R. (1986). Crop simulation models and types of models.
Adv. Agron., 40, 141-208.
Willmott, C. J. (1981). On the validation of models. Phys. Geogr., 2, 184-194.
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 9

WRONGFUL EXPLOITATION
AND TERMINATOR TECHNOLOGY

Keith Bustos
University of Bern, Switzerland

ABSTRACT
In an effort to restrict seed piracy, Monsanto intends to implement some variation of
genetic use restriction technology (GURT). Regarding such intentions, many activist
groups throughout the world (mainly in the US, Canada, and the UK) adamantly contend
that Monsanto and possibly other multinational agrochemical corporations (MACs) will be
acting immorally if GURTs, such as Terminator Technology (TT), are implemented in the
global agricultural industry. These activists argue that the potential implementation of TT
is immoral because it will grant Monsanto the power to wrongfully exploit resource-poor
farmers (RPFs) by reducing RPFs to mere means of production.
I contend that Monsanto will not necessarily be wrongfully exploiting RPFs through
the implementation of TT. More specifically, as long as Monsanto allows these RPFs to
make an autonomous choice to use terminator seeds and sponsors public plant breeding
initiatives (PPBIs), then Monsanto cannot be accurately considered to be wrongfully
exploiting these farmers.
There are three main parts to this essay. In the first part, I explain what exploitation is
and the conditions that must obtain for it to be immoral from a Kantian perspective. In the
second part, I briefly describe a few of the major objections that some activist groups have
made regarding the potential implementation of TT. In the third part of this essay, I apply
the conception of wrongful exploitation developed below to the current debate concerning
the potential implementation of TT in the global agricultural industry.
320 Keith Bustos

I. EXPLOITATION
A. Institutional Exploitation Vs. Transactional Exploitation

Within the exploitation literature, we can make a distinction between an institutional

conception of exploitation and a transactional conception. While the terms ‘institutional’ and
‘transactional’ are not used in the literature, I employ them here to identify two complementary
conceptions of exploitation. An institutional account of exploitation is typically associated
with Karl Marx and the Analytic Marxists. Institutionalists are primarily (and possibly solely)
interested in the rules that constitute institutions or practices and the power or authority they
create and distribute. In particular they are interested in capitalism as an institution or practice.
From this perspective, capitalism is condemned as wrongfully exploitative because its
constitutive rules give rise to the class distinction between capitalists and workers while
positioning each group in a nonreciprocal relation with the other. An institutional account of
exploitation, then, does not deal with particular transactions between individual agents within
an institution or practice; instead, it focuses on the constitutive rules of the institution or
practice, the rules that specify the ways in which individual agents and organizations are able
to interact with each other.1
Conversely, a transactional account of exploitation specifically deals with the aspect of
exploitation that an institutional account does not: namely individual transactions or
interactions within a determinate institutional order or social practice. A transactional approach
to exploitation locates the moral wrongness of exploitation in interpersonal relations and picks
out individual agents morally culpable for wrongfully exploiting others.
When applying these two conceptions of exploitation to the debate concerning the possible
implementation of TT in the global agricultural industry, two sorts of questions can be asked.
1) The institutional question: Do the constitutive rules of global capitalism position MACs and
RPFs in a nonreciprocal relationship with each other (regardless of the actual transactions that
take place between individual MACs and individual RPFs)? 2) The transactional question:
Even if the rules just mentioned are not deemed wrongfully exploitive, are particular MACs
engaged in a transaction with particular RPFs that is wrongfully exploitative? While applying
an institutional conception of exploitation to the current debate concerning TT is both
interesting and important, I will focus only on a transactional conception of exploitation and
what can be said about the TT debate from the transactional perspective. So, one of the major
questions dealt with in this essay will be: Regardless of whether global capitalism as such is
institutionally exploitative or not, is Monsanto (or will Monsanto be) engaged in a transaction
with particular RPFs that is wrongfully exploitive due to the implementation of TT in the
global agricultural industry?

B. Setting the Stage for Wrongful Exploitation

The conception of descriptive and wrongful exploitation described below closely parallels
a standard conception of these two types of exploitation found in the current exploitation

1
I thank David Reidy for helping me better articulate the distinction between an institutional account of exploitation
and a transactional account.
 Wrongful Exploitation and Terminator Technology 321

literature. I particularly appeal to Allen Wood’s empirical theory of exploitation, which avoids
treating all cases of exploitation as immoral. Such a notion of exploitation takes the term
‘exploitation’ to merely be a synonym for the word ‘use’.2 Wood claims that it has been a fault
of philosophers, who explore the real or potential incidents of exploitation, to rely on a
dictionary definition to help make the distinction between the non-moral and moral sense of
exploitation. He calls the pejorative treatment of this term a “moralized” account of
exploitation since these philosophers incorrectly understand “exploitation” to be inherently
evil. For example, “exploitation” and “murder” are often treated similarly in that both are
understood to be morally wrong independent of the context in which they each occur. But this,
according to Wood, is incorrect since “murder” is defined as “wrongful homicide” whereas
“exploitation” is merely a variation of the word “use” and does not necessarily denote
wrongful use. Even Kant believed that using persons as a means to an end is not prima facie
wrong. Using persons becomes wrong when we use them merely as a means. Accordingly, we
may exploit (use) persons for various reasons and in various ways as long as we treat them, at
the same time, as ends. So, I will argue that not all instances of exploitation are immoral and
that exploitation becomes morally wrong, from a Kantian perspective, when the exploiter fails
to treat the exploitee as an end in itself.

1. DEFINING CONDITIONS OF WRONGFUL EXPLOITATION

For a particular relation to be properly considered wrongfully exploitive, it must satisfy all
of the following conditions. The first three conditions must obtain for a descriptive exploitive
relation to exist. In addition to these, a fourth condition must obtain for an exploitive relation
to be considered wrong, from a Kantian perspective.

There exists a relationship between an exploiter and an exploitee; the former

1
must be an agent whereas the latter can be either an agent or a thing.
Descriptive Exploitation

2 The exploiter is in direct control of the exploitive relation.

Wrongful Exploitation

The exploiter intends to benefit in some way and to some degree from
3
exploitive relation.

4 The exploiter fails to treat the exploitee as an end in itself.

Each of the conditions 1-3 is individually necessary for an exploitive relation (in the
descriptive sense) to obtain; and, collectively, they are jointly sufficient for an exploitive
relation to obtain. Each of the conditions 1-4 is individually necessary for a wrongful

2
Allen W. Wood, “Exploitation,” Social Philosophy and Policy 12 (1995): 137.
322 Keith Bustos

exploitive relation to obtain; and, collectively, they are jointly sufficient for a wrongful
exploitive relation to obtain. Condition 4, alone, is both a necessary and sufficient condition
for a wrongful situation to obtain, from a Kantian perspective.
These conditions are not completely novel. Instead, they reflect a standard conception of
both descriptive and wrongful exploitation found within the philosophical literature over the
past three decades. Below, these conditions are explained in a concise format so as to help
focus the discussion on the exact criteria that must be met for both descriptive and wrongful
exploitive relations to obtain. I will offer my own interpretation of each condition so as to
prepare them to be applied to the present discussion concerning TT.
Condition 1: Exploitation requires a relation to be formed between an exploiter and an
exploitee; the former must be an agent whereas the latter can be either an agent or a thing.3 The
exploiter must be an agent since only agents, due to their rational capacity for making
decisions, are capable of intentionally carrying out conscious projects that they set for
themselves. While Monsanto, as a corporation, is a legal person, it is not a moral person and as
such cannot be held morally culpable for wrongfully exploitive acts. However, there are
individuals within Monsanto or who are acting on behalf of Monsanto who can appropriately
be culpable for wrongfully exploitive acts. So, within a corporation, a multitude of individuals
can be held morally culpable for wrongfully exploiting persons either within the corporation
(such as employees) or outside the corporation (such as suppliers, customers, local community,
etc.).
Condition 2: In order to be an exploiter, one must be in direct control of the exploitive
relation.4 It seems unreasonable to think that an agent can be held responsible for a situation
that he has no direct control over. So, for one to be properly considered an exploiter, the
exploiter must have direct control over the exploitive relation in such a way as to be able to use
the exploitee as a means to his ends.
Condition 3: The exploiter must intend to benefit in some way and to some degree from
the exploitive relation.5 In order to stabilize the claim of exploitation (in all senses), so that it
actually applies to situations we commonly consider exploitive, the exploiter need only intend
to benefit from the exploitive relation. Additionally, the exploiter need not be the primary
beneficiary of the exploitive relation. For example, consider the fictional corporation Kicks.
Kicks employs an Indonesian contractor to produce a certain line of products. Due to the terms
of the labor agreement, Kicks has no direct control over the treatment of the contractor’s
employees. The Indonesian contractor wrongfully exploits its employees by requiring them to
work under hazardous conditions and paying them less than subsistence wages – essentially
treating them merely as tools. In this situation, the Indonesian contractor – not Kicks – is the
exploiter since it has direct control over the workers situation. (Incidentally, Kicks has
absolutely no control over the workers and no direct control over the contractor since it is
contributes only a small portion to the contractor’s overall income. This means that the

3
Judith Tormey, “Exploitation, Oppression, and Self-Sacrifice,” Philosophical Forum 5 (1974): 207; Allen Wood,
“Exploitation,” 7.
4
Allen Wood makes a similar comment regarding exploitation. He claims that exploitation requires some degree of
control over the object being exploited. Allen Wood, “Exploitation,” 7.
5
Allen Wood, “Exploitation,” 7. Claiming that the exploiter must benefit “in some way” and “to some degree” may
seem redundant, but there is a subtle difference between the two provisos. One can benefit from a situation by
gaining money, respect, pleasure, etc. One can also benefit in the same ways, but to differing degrees: gaining
more or less money, respect, pleasure, etc.
 Wrongful Exploitation and Terminator Technology 323

contractor would be negligibly affected if Kicks refused to do business with the contractor
until it began treating its employees with respect.) Both Kicks and the contractor benefit from
the exploitation of the workers, but the contractor’s gain is less than that of Kicks’. Kicks’
profits are greater than the contractor’s payments, making Kicks the primary recipient of the
benefits flowing from the exploitive relation. Hence, the exploiter need not be the main or only
beneficiary of the exploitive relation; the exploiter need only intend to benefit in some way and
to some degree from the relation.6
Condition 4: Finally, from a Kantian perspective, if an exploitive relation can be properly
construed as wrongfully exploitive, then the exploiter has failed to treat the exploitee as an
end. I acknowledge that this is not an altogether novel view for it is widely espoused within the
exploitation literature7 For example, both Allen Wood and Denis G. Arnold contend that an
agent is wrongfully exploited when she is degraded.8 Wood does not fully articulate what it
means to properly respect agents in his account of wrongful exploitation. However, Arnold
both appeals to Wood’s view and picks up the slack left by Wood by offering a conception of
what is involved in respecting agents within the context of exploitation. Specifically, Arnold
appeals to the second aspect of Kant’s respect for persons principle: always treat humanity as
an end in itself.9 Treating persons as ends is both a necessary and sufficient condition for
respecting persons, from a Kantian perspective, since by failing to treat persons as ends we
violate necessarily fail to respect them, and by treating persons as ends guarantees that we are
respecting them. Accordingly, an exploiter is guilty of wrongful exploitation not only when he
treats his exploitee as a mere means, but also when he fails to treat her as an end.
Consequently, to justifiably be engaged in morally permissible exploitation, the exploiter must
not only avoid treating the exploitee as a mere means, but must also treat her as an end in
itself.

A. What it Means to Treat Persons as Ends

There are two components of Kant’s respect for persons principle: 1) act in such a way
that you never treat humanity simply as a means; and 2) act in such a way that you always treat

6
This point also illuminates the fact that some exploitive relations are mutually beneficial, meaning that both the
exploiters and the exploitee benefit from the exploitive relation. This sort of exploitive relation is what
Wertheimer calls ‘mutually advantageous exploitation’. Alan Wertheimer, Exploitation, 14. In mutually
advantageous exploitive relations, the exploiter must be in direct control of the relation and intend to benefit to
some degree from the relation, but need not be the party that benefits the most. Actually, in mutually
advantageous exploitive relations existing between an employer and an employee, the exploitee (the employee)
typically stands to benefit the most because she has the most to lose – her ability to sustain her life or the lives
of her dependents.
7
See: Denis G. Arnold, “Exploitation and the Sweatshop Quandary,” Business Ethics Quarterly 13, no. 2 (2003):
243-256; Jon Elster, “Exploitation, Freedom, and Justice,” in Exploitation edited by Kai Nielsen and Robert
Ware (Atlantic Highlands, NJ: Humanities Press International, 1997), 27-44; Ruth J. Sample, Exploitation:
What It Is and Why It’s Wrong (Lanham, MD: Rowman & Littlefield Publishers, 2003); Jonathan Wolff, “Marx
and Exploitation,” 105-120; Allen W. Wood, “Exploitation,” 136-158; and Allen W. Wood, Karl Marx, 2nd ed.
(New York, NY: Routledge, 2004).
8
Allen Wood, “Exploitation,” 15; Denis G. Arnold, “Exploitation and the Sweatshop Quandary,” 254.
9
Denis G. Arnold, “Exploitation and the Sweatshop Quandary,” 254-255; Denis G. Arnold and Norman E. Bowie,
“Sweatshops and Respect for Persons,” Business Ethics Quarterly 13, no. 2 (2003): 222-225.
324 Keith Bustos

humanity as an end in itself.10 While (1) is an important part of this principle, it is only a
necessary component of Kant’s respect for persons principle. That is, if A treats B as a mere
means, then A has violated this principle. However, to avoid treating persons as mere means
does not mean that they are treated as ends. As a result, (1) may be interpreted as a negative
duty, which, if strictly adhered to, may cultivate a disposition of indifference toward others.11
To guard against such indifference toward persons, we are to not only avoid treating them as
mere means but also to always treat them as ends.12 So,
To treat persons as ends in themselves is to respect the moral law that is represented by
their rational nature – particularly their capacity for self-determination. The reason that
respecting a person’s capacity for self-determination is a necessary condition for respecting
persons (in a Kantian sense) is because self-determination is a prerequisite for being a co-
legislator of the moral law. That is, if one is not self-determined, then one cannot be a co-
legislator of the moral law. Thus, respecting a person’s capacity for self-determination is a
necessary condition for the proper moral respect due to agents, since it is the capacity for self-
determination (autonomy) that is the fundamental characteristic of humanity that makes a
moral claim on other agents.

B. Summary of Wrongful Exploitation

If exploitation is to be properly considered wrong from a Kantian perspective, then the

exploiter has satisfied conditions 1-3 from above and has failed to treat the exploitee as an end,
namely the exploiter has failed to respect the exploitee’s capacity for self-determination. What
does it mean, then, to respect a person’s capacity for self-determination? It seems that
respecting a person’s capacity for self-determination requires us to treat them with a minimal
level of beneficence. This requires that we do not ignore or act indifferently toward other
persons’ morally relevant interests when we are in a position to help satisfy such interests.
And, at minimum, the morally relevant interests here are those interests that are inextricably
linked to an agent’s capacity for self-determination.
Such interests, from a Kantian perspective, cannot merely involve increasing pleasure or
avoiding pain. Instead such interests must be, first and foremost, concerned with the moral
law.13 Moreover, the will must be self-determined and not determined by any sensuous
impulses, for all sensuous inclinations are antagonistic to the moral law.14 If A disregards B’s
morally relevant interests, then A is treating B as a thing and not as a person. That is, if by
being treated indifferently, B is also deprived of certain necessities, then she is prevented (or at
least hindered) from freeing her will of inclinations since (due to this deprivation) all B can

10
Thomas E. Hill, Jr., “Humanity as an End in Itself,” Ethics 91, no. 1 (1980): 87.
11
William K. Frankena, “The Ethics of Respect for Persons,” Philosophical Topics 15, no. 2 (1986): 153; Thomas E.
Hill, Jr., “Humanity as an End in Itself,” 87.
12
Thomas E. Hill, Jr., “Humanity as an End in Itself,” 87; Immanuel Kant, Groundwork of the Metaphysics of
Morals, ed. Mary Gregor (Cambridge: Cambridge University Press, 2000), 45 [437-438].
13
Immanuel Kant, Critique of Practical Reason, 83 [80].
14
Ibid., 76 [72].
 Wrongful Exploitation and Terminator Technology 325

focus on is having her basic necessities met. Kant regards this as A causing B to live in a state
of causal necessity.15
So, to properly respect a person’s capacity for self-determination requires us to either
provide her with or help her to acquire the resources she needs to enact her capacity for moral
agency. However, do we all have the moral duty to provide all persons with or to help them
acquire the resources they need to become and continue to be self-determined agents? While
offering a full answer to this question is beyond the scope of this essay, I will say that the
attribution of such a duty to agents is predicated upon the nature of the relationship that exists
between individual persons or groups of persons. As this applies to the current discussion, I
contend that due to the nature of the relationship between an exploiter and an exploitee, the
exploiter has a minimum moral duty to make his exploitee’s ends his own – namely, the
exploitee’s end of realizing her capacity for self-determination. Without such a minimal moral
duty, the exploiter would be granted the latitude to become indifferent to the morally relevant
interests of his exploitee, and thereby exempting him from moral blame for not properly
respecting the person (or group of persons) that he uses as a means to his ends.16 (Granted, the
discussion thus far may be too abstract, offering only a thin moral account of what an exploiter
owes to his exploitee. However, the goal up to this point has been to explain what exploitation
is and why it’s wrong. In the next section, I will apply this conception of exploitation to a real-
world case: the potential implementation of TT in the global agricultural industry.)
To conclude this discussion of exploitation: I have developed a Kantian conception of the
moral wrongness of wrongful exploitation. From this perspective, we can see that a
transactionalist conception of wrongful exploitation locates the wrongness of exploitation in
those exploitive transactions where the exploiter fails to properly respect his exploitee’s
capacity for self-determination. (Consequently, from this perspective, we cannot wrongfully
exploit things.)

II. THE CASE AGAINST TERMINATOR TECHNOLOGY

On March 3rd, 1998, the US patent entitled “Control of Plant Gene Expression” was
jointly issued to Delta and Pine Land Company and the US Department of Agriculture.17 The
actual technology protected by this patent is known within the scientific community as GURTs
(Genetic Use Restriction Technologies), which is a term used refer to a complex of genes that

15
An individual living a life of causal necessity would be determined by her basic human needs for these needs are
not being satiated to the level where she can reasonably be motivated by reason and not primal needs. That is, in
such a situation, the affected individual would, because of her unsated basic needs, be determined by physical
laws and not moral laws.
16
This moral minimum seems to satisfy the moral objection to wrongful exploitation that Wood espouses. Wood
writes, “If it is degrading and harmful to you to have someone else take advantage of your vulnerabilities for
their own ends, most of us think that when you find a person in a situation of vulnerability, it is usually
shameful or even morally evil to seize the opportunity to use the situation for your own ends, especially when
this leaves the vulnerable person in a situation which is pitiable and still vulnerable. What you should do instead
is help the person out of their position of vulnerability.” Allen W. Wood, Karl Marx, 259.
17
P.K. Gupta, “The Terminator Technology for Seed Production and Protection: Why and How?” Current Science
75 (1998): 1319-1323; Bert Visser, et al., “The Impact of ‘Terminator’ Technology,” Biotechnology and
Development Monitor 48 (2001): 9-12. There are actually three patents under the name “Control of Plan Gene
Expression”: patent numbers 5,723,765 (March 3, 1998), 5,925,808 (July 20, 1999), 5,977,441 (November 2,
1999).
326 Keith Bustos

are spliced into transgenic plants intended to control the full reproduction of certain varieties
or the expression of particular phenotypes. There are two main categories of GURTs: T-
GURTs, which restrict the expression of a certain trait (phenotype) by switching on or off a
specific group of genes responsible for particular phenotypic expressions; and V-GURTs,
which restrict the use of the entire plant variety by switching on a gene that terminates further
reproduction of the plant.18
The Action Group on Erosion, Technology and Concentration (ETC group), formerly
RAFI (Rural Advancement Foundation International), has been leading the crusade against
GURTs (specifically V-GURTs) since the late 1990’s. When it began its campaign against
GURTs, the ETC group was the first to refer to this technology as “Terminator Technology”.19
While the ETC group is not the only activist group protesting the agricultural implementation
of this technology, they are the forerunners of the opposition.20 And since the ETC group is at
the forefront of the crusade against TT, I will first focus on explaining their reasons for
opposing its use in agricultural industry.
The ETC group perceives TT to be “an immoral technology that threatens global food
security, especially for the 1.4 billion people who depend on farm-saved seed.”21 In other
words, TT is “immoral” because it infringes upon a farmer’s right to save the seeds of her
harvest for planting the next season’s crop. If terminator seeds are commercialized, farmers
will be forced to “return to the seed corporations every year and will make extinct the 12,000-
year tradition of farmers saving, adapting and exchanging seed in order to advance biodiversity
and increase food security.”22 Also, these “suicide seeds” differ from hybrid seeds in that the
latter produce fertile seeds, which allows the farmer to improve the agronomic performance of
the hybrid by cross-breeding them with indigenous varieties that are well adapted to specific
bioregions. In order to put an end to farmers violating seed patents, Monsanto genetically
altered some plant varieties so that the harvested seeds are sterile. TT’s sole purpose,
according to the ETC group, “is to force farmers to return to the commercial seed market every
year,” which is an attempt “to maximize seed industry profits by destroying the right of

18
Bert Visser, et al., “The Impact of ‘Terminator’ Technology,” 9-12; Food and Agriculture Organization of the
United Nations (FAO), “Potential Impacts of Genetic Use Restriction Technologies (GURTs) on Agricultural
Biodiversity and Agricultural Production Systems,” (Rome: 2001), 2; Derek Eaton, et al., “Economic and
Policy Aspects of ‘Terminator’ Technology,” Biotechnology and Development Monitor 49 (2002): 19-22.
19
The name “Terminator Technology” appears appropriate since this technology is used to alter the plant genome so
as to produce sterile seeds.
20
RAFI’s work is widely cited by the several activist groups such as Food First
(http://www.foodfirst.org/progs/global/ge/sactoministerial/terminator/), Primal Seeds
(http://www.primalseeds.org/terminator.htm), Union of Concerned Scientists
(http://www.ucsusa.org/publications/gene_exchange.cfm?publicationID=267), The Rockefeller Foundation
(http://www.rockfound.org/Documents/182/proprights.pdf), Greenpeace
(http://archive.greenpeace.org/geneng/highlights/pat/98_09_20.htm), and Genetic Resource Action International
(http://www.grain.org/publications/rice-en.cfm). RAFI has also been cited in several publications such as articles in
Time Magazine (http://www.organicconsumers.org/Monsanto/timeterm.cfm) and The Ecologist
(http://www.theecologist.org/archive_article.html?article=355); in Vandana Shiva’s book, Biopiracy; and in Jack
Wilson’s article, “Intellectual Property Rights in Genetically Modified Agriculture,” which can be found in
Genetically Modified Foods, eds. Michael Ruse and David Castle.
21
ETC group (The Action Group on Erosion, Technology and Concentration), “Sterile Harvest: New Crop of
Terminator Patents Threatens Food Sovereignty,” News Release 31 January 2002, http://www.etcgroup.org.
22
ETC group, “Terminate Terminator in 2002: Defend Food Sovereignty,” 19 February 2002,
http://www.etcgroup.org/documents/terminatorbrochure02.pdf .
 Wrongful Exploitation and Terminator Technology 327

farmers to save their seeds and breed their own crops.”23 So, the ETC group believes that TT
not only infringes upon a farmer’s right to save the seeds of her harvest, but more insidiously it
will be used to wrongfully exploit her.
Adding to this dismal outlook on TT, Christian Aid says in its report, “Selling Suicide,”
that “Even for better-off farmers in poor countries the terminator stands to raise costs and lock
farmers into tightly controlled marketing and licensing agreements.”24 This group concedes
that farmers are not actually coerced into using the seeds and other agricultural inputs sold by
Monsanto, but it is the specific marketing techniques used by these companies that get the
farmers hooked. Apparently, aggressive marketing schemes are employed as an attempt to
exploit uneducated farmers who are incapable of accurately discerning between
unsubstantiated claims and scientific facts regarding the products being sold. Farmers also
have to wade through enticement such as free seed trials, misleading promotions, and credits
when making decisions concerning which products to purchase.25 Moreover, if “suicide seeds”
were aggressively marketed in the manner just described, “the worst scenario would be that
within just a few years, poor farmers will no longer have their own, improved seeds to return
to.”26 Prohibited from saving their seeds by the implementation of TT, RPFs will be unable to
breed new, stronger, more locally adapted varieties, granting more control to the agrochemical
companies while weakening the bargaining power of these farmers, thereby leaving them
incapable of determining their own lives.27
So, the major moral objection to the potential implementation of TT is that it will allow
Monsanto to use RPFs as a mere means to maximize seed industry profits. If this is actually
the case, corporations implementing TT will be wrongfully exploiting farmers, especially in
poor nations. While wrongfully exploiting RPFs through the implementation of TT, Monsanto
will reap the benefits of these farmers becoming increasingly dependent upon agrochemical
products, resulting in the farmers losing their ability to determine their own lives. This would
essentially transform these farmers into indentured servants since they would be obliged to
meet the demands of their new masters (seed suppliers).28 As a result of all the alleged
problems inextricably linked to the implementation of TT, many activist groups consider its
implementation to be inherently immoral.

23
ETC group, “RAFI Annual Report: September 1997 – August 1998,”
http://www.etcgroup.org/documents/report98.PDF.
24
Christian Aid, “Selling Suicide: Farming, False Promises and Genetic Engineering in Developed Countries,” May
1999, http://www.christian-aid.org.uk/indepth/9905suic/suicide2.htm.
25
Ibid.
26
Ibid.
27
Some peasant farmers believe that patents on seeds will illegitimately infringe upon their basic rights by
drastically limiting their freedom. According to Leopold Guilaran, a Visayas farmer, “…patents on seeds
illustrate the extent to which transnationals want to establish monopolies on life, maximize profit, and dominate
the world.” GRAIN (Genetic Resource Action International), “Biopiracy, Trips and the Patenting of Asia's Rice
Bowl: A Collective NGO Situationer on IPRs on Rice,” May 1998, http://www.grain.org/publications/rice-
.
en.cfm#1 Ka Memong Patayan, a Filipino peasant farmer who experienced colonial serfdom claims that "A
patent on seeds is a patent on freedom...If you have to pay for patented seeds, it's like being forced to buy your
own freedom." Katharine Ainger, “Is George Bush the new Bob Geldof?” New Statesman 16, no.763 (2003):
22.
28
The term “indentured servant” seems appropriate if Christian Aid is correct and many of the farmers who
“choose” to abandon antiquated methods of agriculture for the sophisticated products provided by MACs become
“hooked” by the morally questionable marketing techniques of these corporations.
328 Keith Bustos

III. EXPLOITATION AND TERMINATOR TECHNOLOGY

The crux of the activists’ main argument opposing the implementation of TT is that this
technology will grant Monsanto the power to wrongfully exploit RPFs. To actually be guilty of
wrongful exploitation, Monsanto would not only have to use the RPFs as a means to making a
profit, but must also intend to use the RPF’s already vulnerable position to ensure their
perpetual dependence upon Monsanto. But, will the possible implementation of TT, in fact,
grant Monsanto the power to wrongfully exploit RPFs? For Monsanto to be accurately
construed as exploiters of RPFs (in the descriptive sense), it must meet each of the following
criteria.

1. There exists a relation between an exploiter and an exploitee; the former must be an
agent whereas the latter can be either an agent or a thing.
2. The exploiter is in direct control of the exploitive relation.
3. The exploiter intends to benefit in some way and to some degree from his relation to
the exploitee.

Additionally, to be accurately construed as wrongfully exploiting RPFs, Monsanto (or

individuals working for or on behalf of Monsanto) has to meet the above three requirements
and, at the same time, fail to adequately respect individual farmers’ capacity for self-
determination.
Before analyzing the relation that Monsanto may have to RPFs, it is necessary to point out
an important fact about the global agricultural industry. Throughout most of the world, there
are two distinct but interacting seed supply sectors: the formal seed supply sector, which is
comprised of international breeders and private national breeders (both are typically regulated
by governments); and the informal seed supply sector, which predominantly consists of
cooperative relationships formed between farmers breeding their own seed.29 Although these
two sectors currently exchange genetic information (in the form of seed), the formal seed
sector perceives such exchanges to be leaks instead of free exchanges since most breeders in
this sector seek remuneration for the use of their seeds, whereas the informal breeders are
content with the free exchange of genetic information.
To more accurately determine the impact that TT may have on farming systems we must
determine the level of input that a particular farming system uses, since a greater dependence
on purchased inputs (especially seed) renders a particular farming system more likely to
encounter this technology. In developed countries, farming has largely evolved from a
subsistence activity to a commercial enterprise, which has led to the need for an increasing
amount of agricultural inputs (e.g. seed, fertilizer, herbicides, pesticides, etc.) in order to
maximize the yield of certain crops.30 Within the global agricultural industry there are at least
three general classifications of farming systems: high-intensity farming systems, which depend
heavily on the formal seed supply sector for seed; medium-intensity farming systems, which
depend partly on the formal seed supply sector but depend mostly upon the informal seed

29
Derek Eaton, et al., “Economic and Policy Aspects of ‘Terminator’ Technology,” 19-22; FAO, “Potential Impacts
of Genetic Use Restriction Technologies (GURTs) on Agricultural Biodiversity and Agricultural Production
Systems,” 6.
30
Ibid.
 Wrongful Exploitation and Terminator Technology 329

supply sector; and low-intensity farming systems, which depend highly on the informal seed
supply sector.31 Currently, in developing countries, medium-intensity farming accounts for the
majority of agricultural production, low-intensity farming systems account for most of the
remainder of the production, and high-intensity farming systems account for a relatively small
amount of the production.32 Both medium- and low-intensity farming systems are considered
’resource-poor’ since both are dependent (to various degrees) on the informal sector and lack
the economic means to predominantly rely on the formal sector for their seed.33
Furthermore, the application of TT will be confined to crops that are currently being
genetically modified and are not able to be controlled by other means. (TT is not the only use
restriction technology; use restriction technology has been in place for several years now, but
this technology has been mainly used in hybrid varieties such as maize and sunflowers. The
use of hybrid varieties are controlled by a decreasing crop yield in F2 and subsequent
generations, forcing farmers to purchase seed each year to maintain a maximum crop yield. TT
will be used in self-pollinated crops such as wheat, corn, and soybeans, which cannot be
engineered to produce decreasing yields in subsequent generations.34) Also, given that GM
varieties are typically much more expensive than seed purchased from the informal seed
sector, many medium-intensity farmers, and probably all low-intensity farmers, will be unable
to purchase seed possessing the terminator gene. Since most RPFs are currently unable to
afford GM plant varieties, and the primary targets for implementing TT are currently modified
varieties, which are intended to only be distributed through the formal sector, Monsanto will
not have the opportunity to form a relation with these farmers and will not be able to use them
as a means to maximizing profits. Specifically, the relationship between Monsanto and RPFs
fails to meet conditions 2 and 3 from above, which means that Monsanto will not be able to
exploit RPFs, let alone wrongfully exploit them.
Even though farmers may not seek to purchase GM seed, Christian Aid contends that
Monsanto may take unfair advantage of RPFs through the use of aggressive marketing
schemes that are currently used to dupe uneducated farmers into using GM plant varieties.35 If
such a scenario obtained, the only way that Monsanto would accurately be said to be
wrongfully exploiting RPFs is if it actually engages in deceptive or aggressive marketing
schemes designed to entice these farmers to begin and continue using GM varieties that
contain the terminator gene. Such deceptive marketing schemes would amount to lying, which
reduces to using the farmers as a mere means to an end (selling seed). As long as Monsanto
allows farmers to make an autonomous choice to begin and continue to use its terminator seed,
Monsanto can avoid wrongfully exploiting RPFs (at least on this front).

31
FAO, “Potential Impacts of Genetic Use Restriction Technologies (GURTs) on Agricultural Biodiversity and
Agricultural Production Systems,” 6-7.
32
Ibid.
33
Ibid., 7.
34
P.K. Gupta, “The Terminator Technology for Seed Production and Protection,” 1319-1323; FAO, “Potential
Impacts of Genetic Use Restriction Technologies (GURTs) on Agricultural Biodiversity and Agricultural
Production Systems,” 4.
35
Christian Aid, “Selling Suicide.”
330 Keith Bustos

While RPFs might autonomously choose to being using GM or TT seeds, they might find
themselves locked into “tightly controlled marketing and licensing agreements.”36 Being
locked into such an agreement would greatly hinder one’s self-determination, by prohibiting
one from escaping the corporate-driven technology treadmill. To guard against hindering
RPFs’ self-determination in this way, Monsanto would have a moral responsibility to sponsor
PPBIs, which aim at providing farmers with economically viable seed at significantly lower
prices than seed sold by private corporations.37 This responsibility would also be predicated on
properly respecting RPFs by granting them a viable alternative to using commercial GM
varieties.
So, to what extent can Monsanto (and other MACs) be held morally culpable for
wrongfully exploiting RPFs through the implementation of TT in the global agricultural
industry? As long as Monsanto allows farmers to make an autonomous choice to use
terminator seed and helps to provide farmers with a viable alternative to using terminator seed
(e.g. PPBIs), it cannot be said to be wrongfully exploiting RPFs, for it would be treating these
farmers as ends.

IV. CONCLUSION
I have argued that the wrongness of wrongful exploitation is located not only in the fact
that the exploiter uses the exploitee merely as a means to his ends, but also in the fact that the
exploiter fails to fully respect the exploitee as a self-determined agent. When applying this
conception of wrongful exploitation to the current debate regarding the potential
implementation of TT in the global agricultural industry, we find that Monsanto will not be in
a position to form an economic relationship with RPFs so as to use them as a means to making
a profit. And because there will be no economic relationship between Monsanto and RPFs,

36
Ibid.
37
The term ‘public plant breeding’ simply refers to non-privatized breeding initiatives. Public plant breeding
initiatives vary in the sophistication of the products and services provided to the public sector; they can be as
simple as an organized group of farmers trading seed to a group of genetic engeneers developing up-to-date
germplasm that is made available to farmers coupled with education programs. It is beyond the scope of this
paper to suggest the appropriate degree of sophistication that a public plant breeding initiative in a developing
country should have. To learn more about public plant breeding initiatives see the following articles. Ann Marie
Thro, “Europe on Transgenic Crops,” AgBio Forum 7, no. 3 (2004): 142-148; J.G. Coors, “Changing Role of
Plant Breeding in the Public Sector,” in Proc. 56th Annu. Corn Sorghum Res. Conf. (Chicago, IL: December,
2001), 48-66; Paul W. Heisey, Chittur S. Srinivasan, and Colin Thirtle, “Public Sector Plant Breeding in a
 Wrongful Exploitation and Terminator Technology 331

Monsanto will not have the opportunity to wrongfully exploit RPFs. In the case that Monsanto
is able to form an economic relationship with RPFs, it has a moral responsibility to sponsor
PPBIs in underdeveloped countries so as to avoid locking RPFs into a tightly controlled
economic relationship. This moral responsibility is predicated on a duty to respect persons.
Consequently, if Monsanto embraces its duty to properly respect persons when implementing
TT, it cannot be accurately construed as wrongfully exploiting RPFs.

Privatizing World,” Agriculture Information Bulletin No. (AIB772) (United States Department of Agriculture,
Economic Research Service: August 2001).
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth, © 2009 Nova Science Publishers, Inc.

Chapter 10

MAIZE DOUBLED HAPLOIDS VIA ANTHER

AND MICROSPORE CULTURE

Bohuš Obert, Ľubica Uváčková and Anna Preťová

Institute of Plant Genetics and Biotechnology,
Slovak Academy of Sciences1, Slovak Republic

ABSTRACT
Within the past years, great progress has been made in development of technologies
for improvement of cereal crops of economic importance including maize. Induction of
embryogenesis from gametic and somatic cells and tissue culture are the main techniques
necessary for practical application of advanced biotechnological tools for targeted
improvement of plant. There is a requirement for haploid and doubled haploid material
and homozygous lines for cell culture studies and breeding in maize. Anther culture is
currently the most successful method producing doubled haploid lines in maize, but
microspore culture was also described as a good source of doubled haploids.
In this review we focus on tissue and plant regeneration using anther culture, and
cultivation of isolated microspores. The effect of genotype, physiological status of donor
plants, donor material pre-treatment, cultivation conditions for maize anthers and
microspores as well as ploidy level of regenerated tissue and plants, and use of colchicine
during early stages of androgenesis induction for chromosome doubling are discussed
here. Processes connected with developmental switch towards embryogenic development
of microspores and process of plant regeneration from anther- and microspore-derived
calli are also in the focus of this chapter.

INTRODUCTION
Since classical maize breeding processes are time consuming, there is a requirement for
the development of alternative methods producing haploid and dihaploid material and
homozygous lines in maize. The application of haploid/dihaploid techniques permits an

1
Akademická 2, P.O. Box 39/A, 950 07, Nitra 1, Slovak Republic.
334 Bohuš Obert and Anna Preťová

efficient and time-saving production of new maize hybrids. Homozygous doubled haploid
plant lines can be directly involved in breeding programmes, or they can be used for different
biotechnological applications including cell culture and genetic studies. The use of induced
haploid techniques in breeding would enable to obtain completely homozygous lines within
one generation and efficient genotypic selection (Rajhathy 1976).
Natural haploid embryos and plants, derived from gametophytic cells, have been described
in about one hundred species of angiosperms. However, such haploids are rare in the nature
(Preťová and Obert 2008). To be beneficial for breeding, haploids must be produced in larger
amounts. Besides, selective elimination of chromosomes in a hybrid embryo (after wide
hybridisation) and use of male sterile plants for pollination (female inducer lines), the induced
in vitro androgenesis via the anther culture or via the microspore culture are promising
technologies applicable in maize breeding and in wide range of scientific studies.

ANTHER CULTURE AND CULTURE OF ISOLATED MICROSPORES

Microspore totipotency was discovered by Guha and Maheshwari (1964) in Datura inoxia.
They induced first embryo-like structures and later they regenerated plants from anther derived
structures (Guha and Maheshwari 1967). First results with maize in vitro androgenesis were
achieved in China (Ku 1978, Miao et al. 1978, Mu et al. 1980, Wu et al. 1980, Ting 1981).
Generally, for induction of in vitro androgenesis there are two main techniques: anther
culture (cultivation of isolated anthers) and microspore culture (cultivation of mechanically
isolated microspores). Anther culture technique is relatively easy and is used routinely for
androgenesis induction in many plant species including some maize varieties (Bajaj 1990,
Maluszynski et al. 2003). Isolation and cultivation of microspores in maize is not a routine
procedure yet, compared to some other species, for example barley or brassica.
Isolated microspores are suitable not only for induction of androgenesis, but also for
protoplast isolation and suspension culture initiation. When microspores are used for gene
transfer, transgenic dihaploid plants can be regenerated in relatively short time. Unicellular
origin of such plant eliminates possibility of chimeric transgenic plant regeneration, what is
very often case when tissue or calli are used for gene transfer. Moreover, after gene transfer
into microspore and subsequent chromosome doubling, the regenerated plant is homozygous
for all genes including foreign gene and can serve as source of pure line. Other advantage of
microspore culture is that microspores in maize are available in large amounts, and they
represents useful for biochemical and molecular studies.
Along with other in vitro techniques, the production of dihaploid plants has a great
potential to support maize breeding. Anther and microspore cultures are used to produce maize
inbred lines, since homozygous progeny can be produced from heterozygous parents in one
generation. However, the application of anther culture in plant breeding is strongly dependent
on the production of large numbers of microspore-derived plants.
Success of anther and microspore culture depends on many factors. Key factors affecting
in vitro androgenesis from maize microspores are: genotype, physiological status of donor
plant, developmental stage of microspore, pre-treatment of donor material, isolation and
cultivation conditions.
 Maize Doubled Haploids Via Anther and Microspore Culture 335

Effect of Genotype

Since the pioneer research of Kuo et al. (1978), intensive studies have been carried out to
improve culture conditions potentially leading to high androgenic response and to the
construction of highly responsive maize stocks (Genovesi and Collins 1982, Dieu and Beckert
1986, Petolino and Jones 1986). Nevertheless, with regard to in vitro androgenic potential of
other cereals, maize still remains a recalcitrant species. Most androgenic responsive maize
material has been found in non-commercial maize germplasm (Genovesi and Collins 1982,
Petolino and Jones 1986, Pescitelli et al. 1989, Preťová et al. 1993, Antoine-Michard and
Beckert 1997, Orosz and Barnabás 1997). Some authors suggested transmission of the
androgenic response into recalcitrant elite lines by crossing (Dieu and Beckert 1986, Barloy et
al. 1989), as this trait in maize is heritable (Cowen et al. 1992, Murigneux et al. 1994,
Barnabás et al. 1998). A considerable improvement of anther response and initiation of haploid
embryo-like structures was observed in the progeny of a single cross between two dihaploid
lines of Chinese origin. Moreover, there were no significant differences in anther responses
between the different single cross and three-way cross hybrids even when one of the parents
was completely recalcitrant (Barnabás et al. 1998, Barnabás et al. 2005). These results
demonstrated that lines with higher anther response can be a good source for this trait and that
this valuable trait can be incorporated into elite maize lines via crossing (Obert et al. 1998,
Barnabás et al. 1999, 2005). On the other hand, it is still not clear to what extent this trait can
be incorporated into commercial maize lines and how this trait will influence other
agronomical characteristics of elite lines. Therefore, the right genetic ratios have to be
determined (Obert et al. 2000, Barnabás 2003, Beňová et al. 2005).

Induction of In Vitro Androgenesis

Two main physiological factors are important for successful androgenic response in
maize, namely developmental stage of the microspore and exogenous stimulus as an inductor
of the developmental switch (Reynolds 1997). Stress generally represents main signal for the
switch of microspore genetic programme from the gametophytic to the sporophytic
developmental pathway. It is mostly because stress is launching mechanism for redirection to
embryogenesis and it stops development of fertile pollen grain (Touraev et al. 1997). In the
case of anther and microspore culture stress is evoked by heat shock treatment or by starvation
(Jähne and Lörz 1995). Cultivation of tassels at 7 °C for 7–10 days is generally used in maize
(Petolino and Jones 1986, Pescitelli et al. 1990, Preťová et al. 1993, Barnabás et al. 1999) prior
to cultivation. Androgenic reaction in some highly responsive genotypes can be achieved also
without cold pre-treatment (Obert and Barnabás 2004, Barnabás et al. 2005).

Pathways of Androgenic Embryo Development

In maize, both anther and microspore cultures were tested for their morphogenetic and
embryogenic responses. Nevertheless, microspore cultures are more suitable for observations
of crucial events involved in maize androgenesis. First cultures of isolated maize microspores
were initially set up by Gaillard et al. (1991). For maize is typical that microspore cultures are
336 Bohuš Obert and Anna Preťová

very heterogeneous and many types of embryogenic structures were observed in vitro
(Barnabás et al. 1987, Preťová et al. 1993, Testillano et al. 2002, Obert et al. 2005). Thus,
Preťová et al. (1993) described several pathways in androgenic maize embryo formation. In
some cases, nuclei resulting from several divisions were irregularly distributed inside the
microspores. Most often, particularly when bicellular-stage of pollen was used, resulting
embryos showed some features of polarization. Separate regions filled with nuclei resulting
from the division of the vegetative cell and others filled with nuclei coming from the
generative cell were well distinguished in some embryos. These features are consistent with
differentiation of two domains as it was proved later on (Magnard et al. 2000, Testillano et al.
2002, Massoneau et al. 2005). On the other hand, structures derived from microspores in the
uninucleate stage did not show such polarization (Preťová et al. 1993).
Microspores after cold pre-treatment are of spherical or ellipsoidal shape. Most of these
microspores contain vacuoles and their nucleus is situated at the periphery of the cell.
Especially, the first days in the culture are quite critical. During this early period of cultivation,
the majority of microspores die (Obert et al. 2000). Only few microspores are able to respond
to the culture conditions and redirect their developmental pathway from gametophytic to
sporophytic development. Such induced microspores usually enlarge their size and can be
identified as dark cells under the light microscope. Dense cytoplasm and cytoplasmic areas
containing starch grains and/or lipid bodies could be observed in these living microspores.
Subsequently, only some of them are able to develop into microspore-derived embryos. In
maize microspore cultures several pathways have been identified. Following situations were
described in the literature: symmetrical division of the original microspore nucleus without
differentiation to the generative and vegetative nuclei; asymmetrical microspore nuclear
division, which led to the formation of generative and vegetative nuclei where only vegetative
nuclei continued to divide and to form multicellular or multinuclear structures; asymmetrical
microspore nuclear division producing generative and vegetative nuclei, where only generative
nuclei took part in the formation of multicellular or multinuclear structures; asymmetrical
microspore nuclear division producing generative and vegetative nuclei, with both continuing
to divide and to form multicellular or multinuclear structures (Sunderland et al. 1974, Miao et
al. 1978, Preťová et al. 1993). Sunderland et al. (1974) also described fusion of two nuclei
formed after the first microspore nuclear division. The two nuclei appeared to fuse into one
large nucleus that continued to divide. These findings were confirmed recently in barley
(Kasha et al. 2001) and maize (Testillano et al. 2004). Another variation, when microspores
possessed large, small, and very small nuclei, was also described by Sunderland and Dunwell
(1974). Maize microspore and anther cultures showed predominantly asymmetric microspore
nuclear divisions (Barnabás et al. 1987, 1999, 2001, Preťová et al. 1993). In wheat, the first
androgenic division in microspore culture was symmetrical (Ouyang et al. 1973, Bonet and
Olmedilla 2000), while in the anther culture it was asymmetrical (Hassawi and Liang 1990). In
barley microspore culture, the first division of microspores producing embryos was
symmetrical (Hu and Kasha 1999, Indrianto et al. 2001) or asymmetrical (Shim and Kasha
2003), depending on the pre-treatment applied. Some binucleate cells showed similarities to
binucleate microspores during gametophytic development. However, microspores after
symmetric division have different cell organization and very dense cytoplasm.
Cytoskeleton organization was studied in microspores. Actin filaments organized around
the nucleus of late uninucleate stage were hardly visible. After first division took place, the
actin filaments were detectable in the forming phragmoplast. Typical organization of actin
 Maize Doubled Haploids Via Anther and Microspore Culture 337

filaments around each nucleus became very distinct only in the multinuclear structures
(reviewed by Preťová et al. 2006).
One week after isolation, the second division of induced microspores occurred that led to
the production of multinuclear structures inside the microspore wall. Induced microspores
were spherical and contained large vacuoles. One or more nuclei were located in the centre of
the cell and were surrounded by a thin layer of cytoplasm that was connected to the subcortical
cytoplasm layer by cytoplasmic strands running through large vacuoles. This feature, called a
‘star-like’ organization of cytoplasm, can be considered as a structural marker for androgenic
response and was observed in wheat (Touraev et al. 1996), tobacco (Garrido et al. 1991) and
maize (Obert et al. 2005) in relation to androgenic response. Cell enlargement was described to
correlate with cell viability after stress pre-treatment. However, only some of the enlarged
viable microspores acquired embryogenic potential (Bolik and Koop 1991, Maraschin et al.
2003). After 21 d or 35 d of cultivation, multinuclear and multicellular structures were released
into liquid medium. Asynchrony not only in time, but also in structural morphology, can be
observed in this process. If compact structures were released from burst microspores, they
further developed into embryos. Loose structures produced calli. In case when microspores
containing multicellular structures burst too early (earlier than 21 d), solely loose calli were
produced. Scanning electron microscope observations of the surface of embryogenic structures
showed the presence of an extracellular matrix that is considered a morphological marker for
embryogenic development (Šamaj et al. 1995, Chapman et al. 2000, Bobák et al. 2003).

Genome Doubling

With regard to the relatively low number of regenerated fertile dihaploid plants, the use of
antimitotic drugs at the beginning of the anther culture for the direct doubling of the
microspore haploid genome proved to be very effective in producing genetically stable
doubled haploid offspring in the case of small grain crops like wheat and rice (Barnabás et al.
1991, Alemano and Guiderdoni 1994). This technique can be applied for maize too
(Saisingtong et al. 1996, Antoine-Michard and Beckert 1997, Kovács et al. 1999, Barnabás et
al. 1999, Obert and Barnabás 2004).
Colchicine proved to be the most effective chromosome-doubling agent for microspore-
derived structures and it helped to reduce mixoploidy and somaclonal variation in the
offspring. Generally, colchicine surpassed the other antimitotic chemicals such as oryzalin,
pronamide and amiprophos methyl. Relatively low concentrations of colchicine (200 to 300
mg/l) efficiently doubled chromosome numbers in cold-treated premitotic maize microspores
in anthero at the onset of culture (Barnabás et al. 1999, Obert and Barnabás 2004). The
frequency of fertile plants directly regenerated from maize anther cultures was significantly
higher after treatments with colchicine, especially during first three days of cultivation. Low
concentrations of colchicine slightly increased androgenic response of selected maize hybrids.
The plant regeneration capacity of microspore-derived structures, however, was not
significantly influenced by colchicine treatments. It appeared that shorter (3-day) exposure of
cold-treated anthers to the low concentration (0.03%) of colchicine in the induction phase was
sufficient for early genome doubling (Barnabás et al. 1999). Increased ploidy levels can reduce
the plant regeneration capacity of microspore-originated structures. Therefore, the above
procedure could overcome some potential problems of a possible ploidy increase in the
338 Bohuš Obert and Anna Preťová

microspores which are regularly caused by a longer (7-day) colchicine treatment (Saisingtong
et al. 1996; Antoine-Michard and Beckert 1997), As the extent of spontaneous versus
colchicine-induced chromosome doubling in maize anther culture could depend on the
genotype, and treatment parameters, appropriate culture conditions should be adjusted for each
individual case. Nevertheless, the procedure of early genome doubling described above can be
efficiently used in maize breeding programmes to save time and resources.

Plant Regeneration

In anther culture, plants can be regenerated via two pathways: direct androgenesis in
which embryo-like structures develop from microspores or indirect one through callogenesis
followed by organogenesis. The first type of division in maize microspores is generally
asymmetric, and calli are formed from most of the microspores developing androgenically
(Barnabás et al. 1987, 1999). Recently, correlations have been investigated among the
morphological trait, ploidy level and regeneration ability of microspore-derived structures
formed during the early induction phase in maize (Jäger et al. 2005).
In maize anther culture two domains, such as embryo-like and endosperm-like, are formed
within the exine of the young androgenic embryo. Surprisingly, both domains express the
endosperm specific genes ZmAE1 and ZmAE3 (Magnard et al. 2000). These findings suggest
that expression of at least some endosperm-specific features is essential for proper embryo
development. Recently, Massoneau et al. (2005) described two main types of multicellular
structures developing in maize microspore cultures. These authors reported that callus-like
structures express endosperm genes (e.g. ZmESR2, ZmAE3) and have a transitory life-span
while embryo-like compact structures rather express embryo-specific genes (e.g. LTP2,
ZmOCL1, ZmOCL3) and subsequently form true embryos. Since embryogenic structures
expressed both embryo- and endosperm-specific genes it was hypothesized that they may also
assume an endosperm role in the absence of other specialized cells (Massoneau et al. 2005).
Quality of the induced structures (callus vs. embryo) is a very important factor with regard
to plant regeneration. After transferring of multicellular structures on the surface of solid
regeneration media, plant regeneration usually took place. Maize embryogenic structures
derived from microspores must be morphologically fully differentiated before their transfer to
the regeneration medium in order to be able to develop complete plants. Generally, the absence
of a number of developmental regulatory signals usually coming from the seed or plant body
during zygotic embryogenesis may be responsible for many abnormalities and low level of
embryo recovery observed during maize gametic and somatic embryogenesis. Particularly, the
lack of proper environment for embryo maturation and accumulation of storage material seems
to be especially important for embryo germination. More profound knowledge of these
processes will help to develop new approaches to compensate these deficits and eventually
increase low embryo-plant conversion rate (Segui-Simarro and Nuez 2008).

Biotechnological Applications

The heterosis breeding of maize requires a continuous supply of new inbred lines in order
to produce hybrids that satisfy market demands. The development of homozygous lines by
 Maize Doubled Haploids Via Anther and Microspore Culture 339

conventional methods is rather a time consuming procedure, which is why haploid techniques
could be utilised to increase the efficiency of breeding. The use of doubled haploids in maize
breeding began in 1946, when Sherret S. Chase exploited a spontaneous parthenogenesis
system to produce the first maize doubled haploid inbreeds (Chase 1949). Selected DH lines
were used to produce commercial hybrids (Chase 1974). Microspore derived doubled haploids
are now widely involved in maize breeding. Various combinations of genes can be obtained in
homozygous form, and then fixed by the use of doubled haploid techniques in a relatively
short time. However, genotype dependence is still one of the main limiting factors in the anther
culture of maize, but as mentioned earlier, in vitro androgenic ability can be transmitted from
exotic sources into elite lines for breeding purposes (Barloy et al. 1989, Barnabás et al. 2005).
The totipotent microspore is a prime target for transformation: it is an easily available and
accessible single-cell target. In addition, the transgenes can be studied in both haploid and DH
levels. Although the primary target is the uni-cellular microspore, explants at particular stages
of microspore embryogenesis and regeneration have been used as recipients for gene delivery.
Many transformation techniques have been applied, including microinjection, electroporation,
particle bombardment and Agrobacterium tumefaciens-mediated transformation (Forster et al.
2007).
Successful electroporation of DNA into maize microspores and transgene expression was
reported and confirmed using chloramphenicol acetyl trasferase (Fennel and Hauptmann 1992)
and later also using GUS gene (Obert et al. 2004), but no stable transformation has been
achieved yet using this technique.
Particle bombardment of embryogenic microspores seems to be more promising method
for gene delivery, which was confirmed for barley (Jahne et al. 1994, Obert et al. 2008),
brassica (Fukuoka et al. 1998) and tobacco (Stöger et al. 1995). However, transformation
frequency is very low (less than 0.5%) and needs to be improved.
The interest in haploid research is apparent from the involvement of haploid-derived
plants and lines in maize breeding, the many applications in gamete and embryo biology, in
genetics (mapping, gene discovery and identification) and application in mutation and
transformation studies.

CONCLUSIONS AND OUTLOOK

On the basis of described cytological, morphological, biochemical and molecular features
it seems that the pathway finally leading to the androgenic embryo structure depends on the
interaction of several intracellular and external factors showing some degree of plasticity
(Obert et al. 2005).
Breeding maize hybrids normally involves the development of inbred lines by repeated
self-pollinations. Starting from heterozygous crosses, 6–8 generations of self-pollination are
required to obtain sufficient homozygosity. Selection focused on agronomic characters and
field-testing of hybrid crosses account for additional 3–4 generations. Thus, approximately 6–
10 years are needed to develop new maize hybrids, depending on the number of growing
seasons available per year. Future maize production requires new breeding approaches saving
time. The production of dihaploid plants, along with other in vitro techniques, could become
an important tool directly supporting maize breeding. Due to their unique genetic
340 Bohuš Obert and Anna Preťová

characteristics, dihaploid lines in maize are assumed to be useful for further applications such
as in vitro selections for disease and stress tolerance, gene mapping, and genetic
transformation

REFERENCES
Alemano L, Guiderdoni E (1994) Increased doubled haploid plant regeneration from rice
(Oryza sativa L.) anther culture on colchicine-supplemented media. Plant Cell Rep.13:
432-436
Antoine-Michard S, Beckert M (1997) Spontaneous versus colchicine-induced chromosome
doubling in maize anther culture. Plant Cell Tiss. Org. 48: 203-207
Barloy D, Denis L, Beckert M (1989) Comparison of the aptitude for anther culture in some
androgenic double haploid maize lines. Maydica 34: 303-308
Barnabás B, Fransz PF, Schel JHN (1987) Ultrastructural studies on pollen embryogenesis in
maize (Zea mays L.). Plant Cell Rep. 6: 212-215
Barnabás B, Pfahler PL, Kovács G (1991) Direct effect of colchicine on the microspore
embryogenesis to produce dihaploid plants in wheat (Triticum aestivum L.). Theor. Appl.
Genet. 81: 675-678
Barnabás B, Szundy T, Orosz Á, Obert B, Kovács G (1998) Studies on the recent problems of
homozygote doubled haploid plant production from anther culture of maize (Zea mays L.).
Acta Agron. Hung. 46: 217-224
Barnabás B, Obert B, Kovács G (1999) Colchicine, an efficient genome-doubling agent for
maize (Zea mays L.) microspores cultured in anthero. Plant Cell Rep. 18: 858-862
Barnabás B, Pónya Z, Szakács É, Timár I, Obert B, Preťová A (2001) Biotechnology and
micromanipulation of sexual processes in flowering plants. Biologia 56: 7-12
Barnabás B (2003) Anther culture of maize (Zea mays L.). In: Maluszynski M, Kasha KJ,
Forster BP, Szarejko I Doubled Haploid Production in Crop Plants A Manual, Kluwer
Academic Publishers pp 428
Barnabás B, Jäger K, Fehér A (2005) The effect of drought and heat stress on reproductive
processes in cereals. Plant Cell Environ. 31: 11-38
Beňová Z, Obert B, Masnica M, Preťová A (2005) Androgenic response in anther and
microspore culture. Poľnohosopárstvo (Agriculture) 51: 159-163
Bolik M, Koop HU (1991) Identification of embryogenic microspores of barley (Hordeum
vulgare L.) by individual selection and culture and their potential for transformation by
microinjection. Protoplasma 162: 61-68
Bonet FJ, Olmedilla A (2000) Structural changes during early embryogenesis in wheat pollen.
Protoplasma 211: 94-102
Chase SS (1949) The reproductive success of monoploid maize. Am. J. Bot. 36: 795-796
Chase SS (1974) Utilization of haploids in plant breeding: breeding diploid species. In: Kasha
KJ (Ed): Haploids in Higher Plants: Advances and Potentials, Guelph University Press pp
21-34
Cowen NM, Johnson CD, Armstrong K, Miller M, Woosley A, Pescitelli S, Skokut M, Belmar
S, Petolino JF (1992) Mapping genes conditioning in vitro androgenesis in maize using
RFLP analysis. Theor. Appl. Genet. 84: 720-724
 Maize Doubled Haploids Via Anther and Microspore Culture 341

Dieu P, Beckert M (1986) Further studies of androgenetic embryo production and plant
regeneration from in vitro cultured anthers in maize (Zea mays L.). Maydica 31: 245-259
Forster BP, Heberle-Bors E, Kasha KE, Touraev A (2007) The resurgence of haploids in
higher plants. Trends Plant Sci. 12: 368-375
Gaillard A, Vergne P, Beckert M (1991) Optimization of maize microspore isolation and
culture conditions for reliable plant regeneration. Plant Cell Rep.10: 55-58
Garrido D, Vicente O, Heberle-Bors E, Rodriguez-Garcia MI (1991) Cellular changes during
the acquisition of embryogenic potential in isolated pollen grains of Nicotiana tabaccum.
Protoplasma 186: 220-230
Genovesi AD, Collins GB (1982) In vitro production of haploid plants of corn via anther
culture. Crop Sci. 22: 1137-1144
Hassawi DS, Liang GH (1990) Effect of cultivar, incubation temperature and stage of
microspore development on anther culture in wheat and triticale. Plant Breeding 105: 332-
336
Jäger K, Kószegi DV, Barnabás B (2005) Regeneration capacity of microspore – derived
structures produced in anther cultures of maize (Zea mays L.). Acta Physiol. Plant. 27:
621-629
Kasha KJ, Hu TC, Oro R, Simion E, Shim YS (2001) Nuclear fusion leads to chromosome
doubling during mannitol pre-treatment of barley (Hordeum vulgare L) microspores.
J.Exp. Bot. 52: 1227-1238
Kovács G, Obert B, Barnabás B (1999) Regeneration of fertile doubled haploid plants from
colchicine-supplemented medium in maize (Zea mays L.) anther culture. Novenytermeles
48: 13-23
Kuo CS, Sun AC, Wang YY, Gui YL, Gu SR, Miao SH (1978) Studies on induction of pollen
plants and androgenesis in maize. Acta Bot. Sinica 20: 204-209
Magnard JL, Le Deunff E, Domenech J, Rogowsky PM, Testillano PS, Rougier M, Risueno
MC, Vergne P, Dumas C (2000) Genes normally expressed in the endosperm are
expressed at early stages of microspore embryogenesis in maize. Plant Mol.Biol. 44: 559-
574
Maluszynski M, Kasha KJ, Forster BP, Szarejko I (2003) Doubled Haploid Production in Crop
Plants. Kluwer Academic Publishers
Massoneau A, Coronado MJ, Audran A, Bagniewska A, Mol R, Testillano PS, Goralski G,
Dumas C, Risueno MC, Matthys-Rochon E (2005) Multicellular structures developing
during maize microspore culture express endosperm and embryo-specific genes and show
different embryogenic potentialities. Eur. J. Cell Biol. 84: 663-675
Maraschin SD, Lamers GEM, Wang M (2003) Cell death and 14-3-3 proteins during induction
of barley microspore androgenesis. Biologia 58: 59-68
Miao SH, Kuo CS, Kwei YL, Sun AT, Ku SY, Lu WL, Wang YY (1978) Introduction of
pollen plants of maize and observation on their progeny, Proc. Symp. Plant tissue culture,
Beijing 1978. Pitman, Boston, pp. 23-24
Murigneux A, Bentolila S, Hardy T, Baud S, Guiton C, Jullien H, Ben Tahar S, Freyssinet G,
Beckert M (1994) Genotypic variation of quantitative trait loci controlling in vitro
androgenesis in maize. Genome 37: 970-976
Obert B, Orosz A, Kovács G, Barnabás B (1998) Study of the androgenic capacity in crosses
between highly androgenic exotic DH lines and recalcitrant commercial inbreeds in maize
anther culture. Novenytermeles 47: 473-481
342 Bohuš Obert and Anna Preťová

Obert B, Barnabás B (2004) Colchicine induced embryogenesis in maize. Plant Cell Tiss. Org.
77:283-285
Obert B, Preťová A, Buter B, Schmid JE (2000) Effect of different saccharides on viability of
isolated microspores and androgenic induction in Zea mays. Biol Plant. 43: 125-128
Obert B, Szabó L, Mitykó J, Preťová A, Barnabás B (2005) Morphological events undergoing
in cultures of mechanically isolated maize microspores. In Vitro Cell. Dev- Pl. 41: 775-
782
Obert B, Pónya Zs, Preťová A, Barnabás B (2004) Optimization of electroporation conditions
for maize microspores. Maydica 49: 15-19
Obert B, Middlefell-Williams J, Millam S (2008) Genetic transformation of barley
microspores using anther bombardment. Biotechnol. Lett. 30: 945-949
Orosz Á, Barnabás B (1997) Per se analysis of DH maize (Zea mays L.) lines in field
experiments. In: Bedő Z, Sutka J, Tischner T, Veisz O (Eds): Proc. of the International
Symposium on “Cereal adaptation to low temperature stress in controlled environments.
June 2-4, 1997, Martonvásár, pp. 277-280
Ouyang TW, Hu H, Chuang CC, Tseng CC (1973) Induction of pollen plants from anthers of
Triticum aestivum L. cultured in vitro. Scientia Sinica 16: 79–95
Pescitelli SM, Mitchell JC, Jones AM, Pareddy DR, Petolino JF (1989) High frequency
androgenesis from isolated microspores of maize. Plant Cell Rep. 7: 673-676
Pescitelli SM, Johnson CD, Petolino JF (1990) Isolated microspore culture of maize: effect of
isolation technique reduced temperature and sucrose level. Plant Cell Rep. 8: 628-631
Petolino JF, Jones AM (1986) Anther culture of elite genotypes of maize. Crop Sci. 26: 1072-
1074
Preťová A, de Ruijter NCA, van Lammeren AAM, Schel JHN (1993) Structural observations
during androgenic microspore culture of the 4c1 genotype of Zea mays L. Euphytica 65:
61-69
Preťová A, Obert B, Bartošová Z (2006) Haploid formation in maize, barley, flax and potato.
Protoplasma 228: 107-114
Preťová A, Obert B (2008) Natural and induced haploids in flowering plants. In: Floriculture,
ornamental and plant biotechnology, Vol. V, Global Science Books pp.: 91-104
Reynolds TL (1997) Pollen embryogenesis. Plant Mol. Biol. 33: 1-10
Shim YS, Kasha KJ (2003) The influence of pre-treatment on cell stage progression and the
time of DNA synthesis in barley (Hordeum vulgare L.) uninucleate microspores. Plant
Cell Rep. 21: 1065-1071
Segui-Simarro JM, Nuez F (2008) How microspores transform into haploid embryos: changes
associated with embryogenesis induction and microspore-derived embryogenesis. Physiol.
Plantarum 134: 1-12
Saisingtong S, Schmid JE, Stamp P, Büter B (1996) Colchicine-mediated chromosome
doubling during anther culture of maize (Zea mays L.). Theor. Appl. Genet. 92: 1017-1023
Sunderland N, Collins GB, Dunwell JM (1974) The role of nuclear fusion in pollen
embryogenesis of Datura innoxia Mill. Planta 117: 227-241
Sunderland N, Dunwell JM (1974) Pathways in pollen embryogenesis. In: Street, H.E. (Ed.):
Tissue culture and plant science. Academic Press, London, pp. 141-167
Testillano PS, Ramirez C, Domenech J, Coronado MJ, Vergne P, Matthys-Rochon E, Risueno
MC (2002) Young microspore-derived maize embryos show two domains with defined
features also present in zygotic embryogenesis. Int. J. Dev. Biol. 46: 1035-1047
 Maize Doubled Haploids Via Anther and Microspore Culture 343

Testillano PS, Georgiev S, Mogensen HL, Coronado MJ, Dumas C, Risueno MC, Matthys-
Rochon E, Ting YC, Margaret YU, Wan Z (2004) Spontaneous chromosome doubling
results from nuclear fusion during in vitro maize induced microspore embryogenesis.
Chromosoma 112: 342-349
Touraev A, Ilham A, Vicente O, Heberle-Bors E (1996) Stress induced microspore
embryogenesis from tobacco microspores: an optimized system for molecular studies.
Plant Cell Rep. 15: 561-565
Touraev A, Vicente O, Heberle-Bors E (1997) Initiation of microspore embryogenesis by
stress. Trends Plant Sci. 2: 297-302
In: Corn Crop Production Growth, Fertilization and Yield ISBN 978-1-60741-955-6
Editor: Arn T. Danforth © 2009 Nova Science Publishers, Inc.

Chapter 11

MODELLING OF MAIZE PRODUCTION

AND THE IMPACT OF CLIMATE CHANGE
ON MAIZE YIELDS IN CROATIA

Višnja Vučetić∗
Meteorological and Hydrological Service, Grič 3, 10000 Zagreb, Croatia

ABSTRACT
The effect of climate change on maize growth and productivity in the central part of
Croatia has been researched using the crop CERES-Maize model. The Zagreb Maksimir
meteorological data during the period 1949–2004 and pedological, physiological and
genetic data obtained in the field maize experiment in Zagreb 1999 have been used. In
order to estimate the intensity of the regional impact of climate change on maize
production, a synthetic meteorological series was created by the stochastic weather
generator MetandRoll for different climate change scenarios. The CERES-Maize model
was run with meteorological series representing the present climate and synthetic
meteorological series representing the changed climate. All climate change scenarios
during the 21st century, including only the climate change effect, projected a shorter
growing season of 34-44 days and a reduction in maize yields of 8-15%.

1. INTRODUCTION
The weather impact on crop growth, development and yield can be the best represented by
agrometeorological (crop-weather) models. One of the most used crop model is DSSAT
programme (Decision Support System for Agrotechnology Transfer, Tsuji and Balas, 1993,
Hoogenboom et al., 1995) which includes: cereals and maize, leguminous plants and root and
tuber crops. Each crop group has its own basic simulation model, which is then adapted to a
particular crop. The most widely used are the simulation models for maize and wheat under the
common name of CERES (Crop-Environment Resource Synthesis).

∗
visnja.vucetic@cirus.dhz.hr.
346 Višnja Vučetić

Maize and winter wheat being the most important agricultural crops in Croatia, the
CERES model for maize has been applied (Vučetić (2006) presented the preliminary results) to
investigate the impact of climatic changes on biomass development and maize yield.
Dubrovský from the Academy of Sciences of the Czech Republic collaborated in the
Croatian Pilot Assessment in the frame of the AGRIDEMA project as provider who developed
the stochastic weather generator MetandRoll (Dubrovský, 1996a, 1996b, 1996c, 1997 and
2004) and prepared the climate change scenarios by the pattern scaling technique using the
different global climate models.

2. THE DSSAT SIMULATION USING HISTORICAL DATA

The DSSAT programme - CERES model for maize (Jones and Kiniry, 1986, Ritchie et al.,
1990, Hunkar, 1994), besides simulating maize growth, development and yield also assesses
the commencement of the phenological phases, soil water balance and soil nitrogen
transformation. The meteorological data used by the model are daily values of maximum and
minimum air temperature, precipitation amount and global solar radiation. As the field maize
experiment in 1999 was carried out at the farm of the Zagreb University Faculty of
Agriculture, the meteorological data used in the analysis were taken from the nearest
meteorological station, Zagreb Maksimir (1949-2004), located at about 650 m from the field
experiment site. Samples of the vertical pedological profile were taken for the chemical and
physical analysis of the soil about two weeks before sowing, according to IBSNAT
recommendations (1990a and 1990b).
The predicted values of the CERES model derived from long-term series of
meteorological data (1949–2004) and from pedological, physiological and cultivation data
measured during the 1999 field experiment are very similar to the observed values: beginning
of silking and physiological maturity, kernel mass and maximum leaf area index LAI (Table 1).
The model underestimated the 1999 yield and biomass per hectare, the grain N (%) and the
total N uptake.

Table 1. Comparison of the predicted values according to the CERES-Maize model and
the observed values collected during the field experiment and from the pedological
profile at the farm of the Faculty of Agriculture at Zagreb in 1999

Descriptions Predicted Observed

Silking date 201 200
Physiological maturity date 261 258
Grain yield (kg/ha) 9773 13095
Kernel mass (g) 0.380 0.347
Maximum LAI (m2/m2) 4.7 4.8
Biomass (kg/ha) 17121 22389
N grain (%) 1.03 1.30
Total N uptake (kg/ha) 118.0 177.0
 Modelling of Maize Production and the Impact of Climate Change on Maize Yields 347

Vegetation period in 1999 was extremenly warm but the precipitation amount was at an
average. The model underestimated the maize productivity due to too warm condition during
the vegetation period. A good assessment is a deviation of predicted and observed variables to
20% (Alexandrov et al., 2001).
As the main goal was to investigate the impact of weather conditions on maize yield
during the long period, the CERES model was also run with the same input values of plant and
soil characteristics as for 1999 year but with the varied daily meteorological data from year to
year during the period 1949–2004. Thus, 56-year time series were estimated for the beginning
of silking and physiological maturity dates, grain yield, kernel mass, biomass, maximum LAI,
grain N (%) and total N uptake.
The linear trends of particular maize parameters and the non-parametric Mann-Kendall
test (Mitchell et al., 1966, Sneyers, 1990) indicated a significantly earlier start (2 days/10
years) for silking and 5 days/10 years for physilogical maturity (Figure 1).

Zagreb Maksimir (1949-2004)

2-Nov
MATURITY DATE

2-Oct

1-Sep y = -0.5212x + 291 -5.1 day/10 years

SILKING DATE
1-Aug

y = -0.167x + 211 -1.6 day/10 years

1-Jul
1949 1955 1961 1967 1973 1979 1985 1991 1997 2003
year

21000
Zagreb Maksimir (1949-2004)
BIOMASS
19000

17000
y = 8.4105x + 17890 83 kgha-1/10 years
15000
kg/ha

GRAIN YIELD
13000

11000

9000
y = -4.8324x + 11445 -48 kgha-1/10 years
7000
1949 1955 1961 1967 1973 1979 1985 1991 1997 2003
year

Figure 1. Predicted time series and linear trends of the commencement of silking and maize
physiological maturity (days), grain yield and biomass (kg/ha) according to the CERES-Maize model for
Zagreb Maksimir in the period 1949–2004. Linear trends significant at the 0.05 level are bolded.
348 Višnja Vučetić

The linear trend analysis showed a slight decrease in maize yield (48 kg/ha) but an
increase in biomass by 83 kgha-1/10 years. This significant earlier beginning of silking and
physiological maturity started in 1995. It is result of the significant positive linear trend in air
temperature especially Tmin (0.4°C/10 years) which started in the late 1980s.

3. THE DSSAT SIMULATION USING DIFFERENT CLIMATE

CHANGE SCENARIOS
In order to estimate the intensity of regional impact of climate change on maize production
in Croatia, the synthetic meteorological series was created by the stochastic weather generator
MetandRoll for present climate and different climate change scenarios. Dubrovsky designed
the weather generator (WG) MetandRoll to provide the synthetic meteorological series of daily
data: global solar radiation (SRAD), maximum (Tmax) and minimum (Tmin) temperatures and
precipitation amount (PREC) for the CERES-Maize crop model. The WG parameters derived
from the long time series (1949–2004) for the Zagreb Maksimir station to generate synthetic
meteorological series representing the present climate. The results of validation presented that
the WG MetandRoll well preserves some features of the stochastic structures of daily
meteorological series. However, the discrepancies were found in reproducing the shape of the
distributions of SRAD and PREC. Fortunately, some discrepancies in the cold season are not
influence on the maize production.
Further investigation involved modification of the WG parameters in accordance with the
climate change scenarios and the generation of synthetic meteorological series representing the
changed climate. The climate change scenarios were prepared by the pattern scaling technique
using the following global climate models (GCM): ECHAM4/OPYC3, HadCM3 and CSIRO-
Mk2. As a validation analysis (Dubrovský et al., 2005) showed that these GCMs were a good
choice for a representative set of climate changes scenarios in the Czech Republic, the same
GCMs were used for Croatia.
The changes in global mean temperature (ΔTG) were estimated by the 1-dimensional
climate model MAGICC for different emission scenarios and climate sensitivities (IPCC, 1997
and 1999). The range of the CO2 concentration in the newer emission scenarios (SRES A1, A2,
B1 and B2) is from 548 ppm for SRES B1 to 826 ppm for SRES A2, where 333 ppm is the
baseline CO2 level. According to the IPCC proposal, the range values of ΔTG relate to climate
sensitivities within 1.5 to 4.5°C. The values of the scaling factor for the middle emission
scenario combined with intermediate climate sensitivity (ΔTG = 2.5°C) at the end of 21st
century were used. This intermediate scaling factor was obtained as an average from (emission
scenario SRES B2 + middle climatic sensitivity) and (emission scenario SRES A1 + middle
climatic sensitivity). When the three climate change scenarios had been prepared, the WG
MetandRoll was applied to generate a 99-years synthetic meteorological series representing the
changed climate. After that, the CERES-Maize model was run with this synthetic
meteorological series.
In the future climate these scenarios at the end of the 21st century projected an increase: in
SRAD 3–7%, in Tmin around 3°C and in Tmax 3–4°C and a decrease in PREC for 8% except
HadCM3 showed the increase 2% in the central part of Croatia. All transient climate change
scenarios during the 21st century, including only the climate change effect, projected a shorter
 Modelling of Maize Production and the Impact of Climate Change on Maize Yields 349

growing season and a reduction in maize yields. The main conclusion is that the maize
vegetation period, including only the climate change effect, in central part of Croatia would be
34 days shorter for CSIRO-Mk2, 43 days for ECHAM4/OPYC3 and 44 days for HadCM3,
which would result in 10%, 8% and 15% smaller yields for maize, respectively, at the end of
the 21st century (Table 2). Bacsi and Hunkar (1994) obtained a similar maize result for
Hungary when including only the climate change effect. Research in Slovenia shows that on
the assumption of a 2°C increase in temperature the cultivation area should be raised to a
higher altitude (Kajfež-Bogataj, 1993, 1996 and 1998). It has been predicted that the maize
yield at 500 m under present conditions would correspond to the yield at 900 m at the end of
2100.

Table 2. Predicted mean (MEAN) values of particular maize parameters according

to the CERES-Maize model based on the Zagreb Maksimir meteorological data
for the 1949–2004 period and the synthetic meteorological series for various climate
scenarios which were prepared by the global climatic models: ECHAM, HadCM
and CSIRO for Zagreb at the end of 21st century. STD is the standard deviation

Physiolog
Silking Biomass Grain yield Grain N Kernel Max. LAI
maturity
date (kg/ha) (kg/ha) (%) mass (g) (m2/m2)
date
Zagreb Maksimir (1949–2004)
MEAN 25-Jul 3-Oct 18130 11307 0.91 0.36 4.5
STD 6 17 962 977 0.06 0.02 0.2
ECHAM 4/OPYC3
MEAN 8-Jul 21-Aug 18503 10415 1.07 0.29 4.7
STD 3 3 689 899 0.07 0.01 0.1
HadCM3
MEAN 8-Jul 20-Aug 17737 9646 1.01 0.27 4.7
STD 3 3 1079 1217 0.08 0.02 0.2
CSIRO-Mk2
MEAN 12-Jul 27-Aug 17963 10146 1.01 0.29 4.7
STD 3 3 761 993 0.07 0.02 0.2

As carbon dioxide in the atmosphere directly affects plants by increasing photosynthesis

and decreasing transpiration the both effects (direct CO2 effect and indirect climate change
effect) showed a 17–18% increase in stressed maize yield and 5–14% in potential maize yield
in the Czech Republic (Dubrovský et al., 2000, Žalud and Dubrovský, 2002). It is also shown
that the increase in the simulated yields of other agricultural crops (e.g. winter wheat, soybean
etc.) for the 21st century was primarily because of the beneficial influence of the direct CO2
effect (Alexandrov et al., 2002).

CONCLUSION
The CERES-Maize model results using different climate scenarios for the central part of
Croatia describe the vulnerability of agroecological systems affected by possible climatic
changes, including only the indirect CO2 effect. Further investigations are to estimate the
350 Višnja Vučetić

climate change impact on maize productivity using a different climate scenarios: low/high
emission scenario combined with low/high climate sensitivity (increase in the global mean
temperature is 1.5°C/4.5°C) during the 21st century and to simulate and compare the direct
CO2 effect (through the increased fertilization effect of ambient CO2) and the indirect CO2
effect (through changed weather) on maize yields.

ACKNOWLEDGMENTS
This research has been carried out as a part of the the project Climate variations and
changes and response in affected system of the Ministry of Science, Education and Sport of
Republic of Croatia and the AGRIDEMA project Introducing tools for agricultural decision-
making under climate change conditions by connecting users and tool-providers. I thank the
Faculty of Agronomy of Zagreb University and the Geophysical Department of the Faculty of
Natural Sciences of the Zagreb University for their help. I also wish to thank Lučka Kajfež-
Bogataj, Marta Hunkar, Gordon Y. Tsuji, James R. Kiniry, Josef Eitzinger and Martin
Dubrovský for their support.

REFERENCES
Alexandrov, V., J. Eitzinger, V., and M. Oberfoster, 2001: Adaptation of crop-weather models
in Austria and Bulgaria, Proceedings of 5th European Conference on Applications of
Meteorology, Budapest, Hungary, 24–28 September 2001, 22 pp (CD-Rom).
Alexandrov, V., J. Eitzinger, V., Čajić, V. and M. Oberfoster, 2002: Pontential impact of
climate change on selected agricultural crops in north-eastern Austria, Global Change
Biology, 8, 372–389.
Bacsi, Zs. and M. Hunkar, 1994: Assessment of the impacts of climate change on the yields of
winter wheat and maize using crop models, Időjárás, 98, 2, 119–134.
Dubrovský, M., 1996a: MetandRoll: the stochastic generator of daily weather series for the
crop growth model (in Czech), Meteorological Bulletin, 49, 97–105.
Dubrovský, M., 1996b: Validation of the stochastic weather generator MetandRoll (in Czech),
Meteorological Bulletin, 49, 129–138.
Dubrovský, M., 1996c: MetandRoll: the weather generator for the crop growth model,
Regional workshop on Climate variability and climate change vulnerability and
adaptation, Prague, Czech Republic, 1995, Institute of Atmospheric Physics - U.S.
Country Studies Program, Washington, D.C., 285–292.
Dubrovský, M., 1997: Creating weather serious with use of the weather generator,
Environmetrics, 8, 409–424.
Dubrovský, M., Žalud Z. and Šta’stná M., 2000: Sensitivity of CERES-Maize yields to
statistical structure of daily weather series, Climatic Change, 46, 447–472.
Dubrovský, M., Buchtele J. and Z. Žalud, 2004: High-frequency and low-frequency variability
in stochastic daily weather generator and its effect on agricultural and hydrologic
modelling, Climatic Change, 63, 145–179.
 Modelling of Maize Production and the Impact of Climate Change on Maize Yields 351

Dubrovský, M., Nemesova, I. and J. Kalvova, 2005: Uncertainties in climate change scenarios
for the Czech Republic, Climate Research, 29, 139–156.
Hoogenboom, G., G:Y: Tsuji, N. B. Pickering, R. B. Curry, J. W. Jones, U. Singh and D. C:
Godwin, 1995: Decision support system to study climate change impacts on crop
production, Climate change and agriculture: Analysis of potentional international
impacts, ASA, Special publication, 59, 51–75.
Hunkar, M., 1994: Validation of crop simulation model CERES-Maize, Időjárás, 98, 1, 37–46.
IBSNAT, 1990a: Field and laboratory methods for the collection of the IBSNAT, Technical
Report 2, 67 pp.
IBSNAT, 1990b: Documentation for IBSNAT, Crop model input and output files, Technical
Report 5, 61 pp.
IPCC, 1997: An introduction to simple climate models used in the IPCC, Second Assessment
Report, IPCC Tech Paper 2, Geneva.
IPCC, 1999: Guidelines on the use of scenario data for climate impact and adaptation
assessment, 69 pp.
Jones, C. A. and J.R. Kiniry, 1986: CERES-Maize, A simulation model of maize growth and
development, Texas, University press, College station, 193 pp.
Kajfež-Bogataj, L, 1993: Impacts on future climate change on spring barley and maize yield in
Slovenia, Journal of Agricultural Meteorology, 48, 627–630.
Kajfež-Bogataj, L, 1996: Effects of climate warning on CERES-Maize field in Slovenia: Sensitivity study,
Res. Report, Biotechnical Faculty of the University in Ljubljana, 67, 11–18.
Kajfež-Bogataj, L, 1998: Potential crop shifts to higher altitude in Slovenia due to climatic
change, Proceedings of Agriculture and forestry – adaptability to climate change, Zagreb,
Croatia, 19–20 May 1998, 143–152.
Mitchell, J.M. Jr., B. Dzerdzeevskii, H. Flohn, W.L. Hofmeyr, H. H. Lamb, K. H. Rao and C.-
C. Wallen, 1966: Climatic change, WMO Tech. Note 79, Geneva, 58–75.
Ritchie, J., Singh, U., D. Godwin, and L. Hunt, 1990: A users guide to CERES-Maize – V2.10,
86. pp.
Sneyers, R., 1990: On the statistical analysis of series of observations, WMO Tech. Note, 143,
1–15.
Tsuji, G. and S. Balas (eds), 1993: The IBSNAT decade, University of Hawaii, Honolulu, 178 pp.
Vučetić, V., 2006: Impact of climate change on the maize productivity in Croatia, Proceedings
of Abstracts of 6thEMS/6th ECAC, Ljubljana, Slovenia, 4–8 September 2006, (CD-Rom).
Žalud Z. and Dubrovský M., 2002: Modelling climate change impacts on maize growth and
development in the Czech Republic, Theoretical and Applied Climatology, 72, 85–102.
 INDEX

adenosine, 115, 124

A adenylate kinase, 122
adjustment, 25, 89, 133, 143
abiotic, viii, 12, 31, 64, 89, 108, 111, 112, 113, 114,
ADP, 126, 297
120, 123, 129, 137, 138, 139, 140, 142, 143, 144,
adults, 216
145, 148, 149, 150, 151, 152, 155, 156, 157, 158,
aerobic, 47, 89, 116, 131, 133, 134, 248
159, 160, 161, 162, 163, 164, 165, 166, 167, 169,
aerosol, 289
170, 172, 173, 174, 178, 179, 181, 182, 183, 187,
aerosols, 229
304
AFC, 1
abnormalities, 121, 338
Africa, xi, 2, 8, 31, 50, 77, 137, 189, 216, 244, 253,
abortion, 11, 12
307, 309, 313, 316, 317
absorption, 28, 67, 89, 121, 130, 141, 230, 237, 268,
Ag, 153
269, 270, 276, 286
age, 20, 29, 47, 135, 181, 187, 218
accidental, 206, 218
aggregates, 46
accounting, 33
aggregation, 182, 187, 238
accuracy, xi, 25, 307, 313
agricultural, viii, ix, xi, xii, 9, 31, 37, 41, 49, 50, 55,
acid, viii, 13, 14, 22, 43, 47, 50, 80, 89, 91, 94, 95,
58, 67, 68, 72, 74, 77, 83, 85, 93, 96, 99, 108, 118,
96, 97, 98, 99, 101, 102, 104, 107, 108, 109, 111,
124, 161, 175, 187, 188, 191, 194, 195, 196, 197,
116, 119, 123, 125, 127, 130, 131, 132, 133, 136,
198, 200, 201, 203, 204, 205, 206, 207, 208, 209,
141, 142, 146, 147, 148, 150, 151, 154, 155, 158,
210, 211, 212, 213, 214, 215, 216, 217, 218, 220,
164, 166, 168, 170, 171, 173, 174, 177, 178, 181,
229, 230, 236, 237, 242, 243, 247, 251, 258, 259,
187, 189, 231, 244, 248, 292, 293, 300, 301, 302,
277, 278, 282, 288, 312, 315, 316, 319, 320, 325,
304
326, 327, 328, 330, 346, 349, 350
acidic, 15, 16, 41, 310
agricultural crop, 99, 229, 247, 312, 346, 349, 350
actin, 123, 164, 187, 336
agriculture, 30, 32, 50, 55, 64, 68, 70, 71, 82, 86, 89,
actinomycetes, 89
94, 96, 109, 131, 134, 159, 185, 187, 188, 192,
activase, 120
203, 206, 213, 214, 215, 222, 228, 229, 234, 236,
activation, 115, 116, 117, 122, 123, 126, 130, 137,
242, 247, 251, 258, 327, 351
152, 155, 163, 168, 169, 187, 293, 302
AGRIDEMA, 346, 350
activation state, 117
agrochemicals, 191
activators, 168, 187
agroforestry, 189, 247, 250, 253
active oxygen, 136, 177, 187, 304
aid, 162, 327
activity level, 128, 150
air, 6, 13, 25, 32, 43, 89, 124, 129, 130, 132, 134,
acute, 164, 187
168, 176, 178, 187, 258, 259, 308, 309, 310, 315,
Adams, 171, 187, 191, 218, 297, 298, 301
316, 346, 348
adaptability, 242, 351
air pollutant, 43, 129, 130, 178, 187
adaptation, 45, 64, 89, 113, 114, 120, 132, 134, 159,
air-dried, 259
162, 163, 165, 187, 202, 221, 342, 350, 351
alanine, 128, 133, 139
ADC, 144, 145, 146, 147
alanine aminotransferase, 133
354 Index

Alberta, 61, 82, 224 anther, xii, 121, 122, 123, 124, 175, 184, 187, 333,
albumin, 135 334, 335, 336, 337, 338, 339, 340, 341, 342
alcohol, 132, 133, 144, 158 anthracene, 262, 281
alfalfa, 8, 46, 99 anthropogenic, 258
algae, 60, 302 antibiotic, 87, 89, 100, 102
algorithm, 315 antibody, 130, 147
alkaline, 41, 42, 128 antioxidant, 120, 126, 129, 131, 139, 148, 149, 150,
allele, 197 164, 174, 176, 180, 181, 183, 187, 293, 299, 301,
alleles, 160, 195, 198, 203, 204, 205, 206, 207, 208, 303, 304
210, 213, 215, 217, 218 antisense, 141, 167, 187
alluvial, 94 apatite, 107
alpha, 107 apoptotic, 124
alternative, 28, 236, 296, 300, 301, 303, 304, 330, APP, 21
333 application, vii, viii, xii, 1, 2, 9, 24, 25, 27, 29, 30, 31,
alternatives, x, 30, 66, 228, 231 32, 34, 37, 38, 39, 40, 41, 42, 43, 44, 46, 47, 48,
alters, 168, 172, 180, 183, 187 49, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 63, 64,
aluminium, 176, 177, 180, 185, 187 65, 66, 68, 69, 70, 71, 72, 73, 74, 75, 78, 79, 80,
aluminum, 99, 171, 173, 181, 187 82, 83, 85, 89, 90, 91, 92, 104, 148, 152, 161, 176,
Aluminum, 137 178, 187, 200, 229, 231, 236, 237, 239, 240, 241,
amendments, 9, 18, 24, 46, 52, 55, 59, 238 248, 250, 251, 252, 254, 255, 293, 299, 312, 316,
amines, 229 329, 333, 334, 339
amino, viii, 14, 24, 41, 89, 99, 111, 128, 130, 131, applied research, 177, 187
133, 136, 139, 141, 142, 144, 146, 154, 158, 168, aptitude, 340
173, 180, 187, 254, 293 aquaporin, 302
amino acid, viii, 14, 41, 89, 111, 128, 130, 131, 133, aquatic systems, 57
136, 139, 142, 144, 146, 154, 158, 168, 173, 180, aqueous solution, 182, 187
187, 254, 293 Arabidopsis thaliana, 108, 141, 143, 147, 178, 181,
amino acids, viii, 41, 89, 111, 128, 130, 133, 139, 185, 187, 302
144, 146, 168, 180, 187, 254 ARC, 316, 317
aminopeptidase, 119, 128, 180, 187 archaea, 244
ammonia, vii, 1, 20, 38, 47, 54, 58, 89, 91, 119 Argentina, 96, 105, 106, 190
ammonium, 21, 22, 54, 66, 117, 139 arginine, 136, 139, 141, 144, 145, 146, 164, 187
ammonium sulphate, 22 argument, 51, 328
AMS, 222 arid, viii, 111, 115
Amsterdam, 221 aromatic hydrocarbons, 258, 287, 288, 289
amylase, 117, 124, 127 arsenic, 164, 172, 176, 187
amylopectin, 125, 172, 187 arsenite, 128, 176, 187
anaerobic, viii, 89, 111, 131, 132, 133, 134, 183, 187, ascorbic, 136, 148, 150, 170, 187
248 ascorbic acid, 136, 148, 150, 170, 187
analog, 141 aseptic, 89
analysis of variance, 195 Asia, 2, 8, 55, 80, 137, 174, 187, 327
anatomy, 301 Asian, 42, 81
Andes, 219 Asian countries, 42
animals, 47, 57, 64, 129, 201, 229 aspartate, 128, 297, 304
Annealing, 195 assessment, x, 25, 38, 55, 74, 109, 170, 175, 187,
annual rate, 188 248, 250, 258, 289, 316, 347, 351
ANOVA, 195 assimilation, ix, 12, 115, 117, 119, 122, 127, 130,
anoxia, 131, 132, 133, 168, 173, 176, 179, 187 135, 148, 163, 169, 174, 187, 188, 230, 295, 297,
anoxic, 132, 133, 134, 174, 187 302
ANP, 133 assumptions, 30
antagonism, 92 Atlantic, 323
antagonistic, 43, 91, 109, 324 atmosphere, ix, 32, 45, 58, 77, 129, 227, 229, 273,
antagonists, 102 308, 349
 Index 355

atmospheric deposition, 31 bioavailability, 248

ATP, 13, 115, 116, 120, 131, 132, 133, 134, 296 biochemistry, 70, 105
ATPase, 124, 127, 146, 169, 179, 187 biocontrol, 86, 89, 90, 92, 94, 96, 97, 105
attachment, 89, 108, 123 biodegradation, 289
attribution, 325 biodiesel, 234
Australia, 8, 9, 91, 165, 174, 187, 245, 310 biodiversity, 108, 220, 229, 326
Austria, 350 bioengineering, 136
authority, 320 biofuels, vii, 1, 2, 61, 62, 234
autonomy, 324 biogenesis, 132
availability, viii, 15, 16, 20, 23, 24, 26, 29, 31, 37, 38, biogeography, 95
39, 42, 43, 44, 48, 51, 52, 53, 55, 57, 58, 60, 65, bioinformatics, 162, 163
66, 69, 72, 74, 76, 82, 84, 85, 89, 102, 105, 147, biological control, 88, 92, 100, 105, 108, 109, 231,
217, 238, 239, 240, 241, 246, 249, 254, 307 232
avoidance, 147 biological control agents, 232
awareness, 63 biological nitrogen fixation, ix, 227, 231, 233, 234,
247, 252, 253
biological systems, 131
B bioluminescence, 255
biomass, 3, 4, 12, 23, 28, 30, 49, 50, 61, 64, 67, 77,
bacilli, 98
89, 96, 115, 129, 134, 135, 142, 147, 234, 238,
Bacillus, 88, 89, 90, 92, 94, 95, 96, 98, 99, 100, 102,
240, 241, 243, 295, 309, 311, 346, 347, 348
103, 106, 107, 108, 109, 230, 245
biomolecules, viii, 111, 148
Bacillus subtilis, 88, 89, 92, 108
bioremediation, 288
Bacillus thuringiensis, 88
biosafety, 161, 217
background information, 3
biosphere, 129
bacteria, vii, 31, 45, 60, 85, 87, 88, 89, 90, 91, 93, 94,
biotechnological, xii, 137, 138, 333, 334
95, 96, 97, 98, 101, 102, 103, 104, 105, 106, 107,
biotechnology, 182, 187, 342
108, 109, 143, 229, 230, 231, 232, 236, 242, 244,
biotic, 12, 64, 89, 108, 113, 120, 137, 155, 157, 158,
245, 248, 252
164, 166, 170, 179, 187
bacterial, 59, 87, 88, 89, 92, 93, 95, 98, 101, 102,
biotin, 105
105, 108, 157, 184, 187, 232, 233, 248, 254
blame, 325
bacterial strains, 88, 89, 93, 95
bleaching, 118, 149, 150
bananas, 100, 107
blot, 146, 147, 152, 158
Bangladesh, 223
bonds, 153, 154
banks, 213
bootstrap, 221
bargaining, 327
borate, 43
barley, 12, 46, 142, 154, 173, 178, 184, 187, 334,
Boron, 14, 15, 16, 22, 23, 27, 43
336, 339, 340, 341, 342, 351
Bose, 125, 165, 166, 187
barrier, 127, 141
Boston, 341
base pair, 194, 195
bottlenecks, 203, 217
basic needs, 325
branching, 116, 125, 126, 172, 187
basic rights, 327
Brazil, 91, 189, 190, 227, 234, 249, 250, 251
Bayesian, 197, 198, 209, 224
breakdown, 169, 187
beef, 5, 48, 49, 58, 61, 69
breeding, xi, xii, 47, 80, 106, 113, 131, 136, 138, 159,
behavior, 89, 236, 258, 288
160, 161, 162, 163, 176, 178, 187, 219, 301, 319,
behavioral change, 174, 187
326, 328, 330, 333, 334, 338, 339, 340
behaviours, viii, 111, 119
Britain, 277, 278, 282
Beijing, 341
buffer, 182, 187
Belgium, 224, 225
Bulgaria, 350
beneficial effect, vii, 85, 89, 90, 108, 146, 230, 238,
Burkholderia, 88, 89, 90, 91, 95, 97, 100, 106, 108,
308
230, 232, 243, 244
benefits, viii, 10, 46, 50, 54, 56, 62, 64, 80, 85, 86,
Burkina Faso, 316
107, 169, 187, 240, 241, 244, 251, 323, 327
burn, 213
bicarbonate, 42
356 Index

by-products, x, 228 cell organization, 336

cell signaling, 117
cellular homeostasis, 121, 124, 152
C cellulose, 166, 187
cellulosic, 61
cadmium, 68, 69, 106, 153, 164, 180, 183, 187
Central America, 2, 221
calcium, 13, 118, 123, 126, 235, 292, 302, 304
centromere, 158
calcium carbonate, 235
cereals, 8, 12, 36, 51, 89, 97, 106, 159, 164, 177, 187,
calibration, xi, 71, 307, 309, 311, 312
191, 231, 246, 335, 340, 345
calmodulin, 155, 156
CERES, xii, 313, 315, 317, 345, 346, 347, 348, 349,
calreticulin, 122, 123
350, 351
cAMP, 155
CH4, 58
Canada, xi, 1, 5, 6, 7, 8, 9, 10, 24, 40, 52, 54, 58, 59,
changing environment, 139, 167, 187
61, 66, 67, 68, 73, 74, 75, 76, 79, 81, 83, 84, 98,
channels, 120, 156, 293, 303
111, 281, 319
chaperones, 139, 152, 183, 187
cancer, 229
chelates, 22
capacitance, 310, 317
chemical composition, 107, 248, 250
capitalism, 320
chemical properties, 55, 72, 258, 312
carbohydrate, 13, 14, 40, 41, 65, 117, 126, 127, 131,
chemicals, 86, 101, 337
132, 134, 143, 181, 187
chemotaxis, 89, 108
carbohydrate metabolism, 14, 41, 126, 127, 143
chicken, 48, 61
carbohydrates, 2, 89, 116, 124, 133, 134, 189, 240
children, 213, 216
carbon, 10, 12, 20, 26, 58, 62, 70, 75, 89, 112, 116,
China, v, 2, 8, 60, 74, 96, 106, 175, 185, 187, 233,
117, 121, 133, 147, 164, 168, 169, 174, 185, 187,
236, 257, 258, 260, 281, 287, 288, 289, 334
229, 231, 246, 250, 296, 297, 302, 349
chloride, 16, 21, 22, 43, 155, 165, 173, 179, 187, 259,
Carbon, 13, 243, 248
260
carbon dioxide, 58, 349
Chloride, 74
carbon fixation, 297
chlorine, 13
carboxyl, 168, 187
chlorophyll, 5, 13, 14, 16, 28, 29, 30, 31, 41, 64, 66,
carcinogenic, 258, 288
76, 79, 82, 83, 118, 119, 121, 122, 130, 135, 146,
carotenoids, 118, 148, 149, 150, 151, 299
147, 149, 150, 164, 176, 177, 187, 294, 297, 303
carrier, 47, 60, 106, 132
chloroplast, 117, 119, 122, 142, 146, 148, 176, 177,
case study, 253
184, 187, 213, 221
CAT, 117, 131, 136, 138, 148, 150, 151, 153, 299
chloroplasts, 112, 116, 119, 125, 151, 165, 181, 184,
catabolism, 141, 172, 187
187, 297, 302
catalase, 117, 138, 149 175, 177, 187
cholera, 236
catalysis, 300
chromosome, xii, 158, 333, 334, 337, 340, 341, 342,
catalyst, 14
343
Catholic, 227
chromosomes, 334
cation, 40, 135, 156
cis, 118, 157, 158, 162, 184, 187
cattle, 20, 47, 48, 49, 57, 61, 67, 69, 72, 74, 75, 84,
citrus, 91
240, 248, 249, 250
classes, 126, 152
CDKs, 155
classical, 131, 333
cDNA, 117, 134, 141, 147, 151, 152, 158, 162, 166,
classification, x, 62, 117, 194, 197, 201, 221, 258,
167, 170, 178, 184, 187
281, 287
CEA, 104
clay, 10, 40, 47, 58, 61
CEC, 40, 42
cleavage, 122
cell, viii, xii, 13, 14, 38, 41, 87, 89, 111, 115, 117,
climate change, xi, xii, 307, 308, 315, 316, 345, 346,
119, 120, 124, 129, 144, 147, 150, 166, 170, 174,
348, 349, 350, 351
187, 230, 304, 333, 334, 336, 337, 339, 342
climatic factors, 44
cell culture, xii, 333, 334
clone, 161, 231
cell death, 119, 124, 170, 174, 187
cloning, 160, 164, 169, 175, 187
cell division, 144
closure, 11, 30, 83, 116, 124, 292, 293, 300, 304, 311
cell membranes, 124
 Index 357

clustering, 197, 206, 208, 209 Congress, 105, 106, 107, 165, 174, 187
clusters, 123 conifer, 96
Co, 28, 79, 92, 153, 202, 260, 303 conjugation, 123
CO2, xi, 2, 12, 58, 119, 122, 131, 291, 297, 298, 304, consensus, 30, 54
308, 315, 348, 349 conservation, ix, 9, 37, 40, 44, 46, 49, 50, 51, 61, 63,
coding, 133, 151, 154 64, 76, 78, 86, 89, 187, 188, 193, 194, 199, 217,
codominant, 214 218, 219, 220, 221, 222, 223, 225
coenzyme, 102 Constitution, 13
coffee, 91, 98 constraints, viii, 44, 86, 111, 113, 159, 163
Colombia, 214, 219, 220, 221, 223 consumers, 137, 189
colonization, viii, 85, 86, 89, 92, 94, 95, 97, 98, 99, consumption, 5, 89, 189, 199, 201, 203, 237
100, 101, 102, 103, 106, 108, 203, 255 contamination, x, 26, 32, 49, 56, 60, 68, 126, 244,
colonizers, 101 257, 269, 286, 317
Colorado, 14, 312 continuity, 193
colors, 200, 201, 213 control, vii, viii, 9, 14, 42, 49, 56, 57, 59, 68, 85, 89,
combustion, 258 90, 91, 92, 97, 99, 101, 103, 104, 106, 107, 117,
communication, 190, 199, 224 123, 124, 125, 128, 130, 131, 134, 135, 136, 142,
communities, 89, 99, 192, 194, 216, 231, 249 143, 146, 147, 148, 151, 153, 156, 157, 177, 184,
community, 86, 88, 89, 92, 194, 215, 231, 322, 325 187, 200, 234, 236, 237, 260, 276, 278, 292, 293,
compaction, 15, 53, 72 321, 322, 323, 326, 327, 328
compatibility, 175, 187 conversion, 117, 142, 147, 278, 283, 297, 311, 338
competence, 101 conversion rate, 338
competition, 11, 53, 62, 87, 88 cooking, 201
complement, 51 copper, 13, 16, 65, 153, 166, 181, 187, 189, 235, 252
complex carbohydrates, 189 corporations, xi, 319, 326, 327, 330
complex interactions, 52, 86, 87, 89 correlation, 26, 125, 132, 136, 145, 154, 182, 187,
components, viii, x, 11, 12, 17, 36, 42, 43, 44, 51, 68, 240, 268, 269, 270, 273, 292, 294, 317
78, 85, 86, 89, 108, 114, 116, 118, 120, 125, 129, correlation coefficient, 268, 269, 270, 273
137, 138, 141, 143, 147, 151, 155, 176, 180, 185, correlations, 41, 338
187, 216, 257, 264, 265, 267, 268, 271, 272, 273, Costa Rica, 190, 203, 205, 206, 212, 213, 217, 219,
275, 284, 286, 287, 294, 308, 313, 323 221, 223, 225
composition, 17, 20, 34, 45, 48, 69, 71, 74, 80, 89, costs, 9, 51, 80, 121, 229, 327
107, 129, 169, 187, 235, 242, 248, 250, 278, 301 cotton, 8, 29, 67, 103, 232
compost, x, 18, 47, 48, 49, 50, 51, 57, 58, 59, 61, 67, covering, 46, 50, 117
69, 70, 228 cows, 70
compounds, 39, 87, 89, 131, 136, 139, 140, 144, 149, CPD, 136
254, 269, 273, 278, 299 CRC, 83, 98, 100, 101, 255
Computer simulation, 308 credit, 52, 68, 246
computing, 316 creep, 175, 187
concentrates, 83 critical analysis, 317
concentration, 5, 12, 13, 14, 17, 20, 23, 26, 27, 29, critical period, 12, 52
30, 31, 32, 33, 35, 36, 38, 40, 42, 43, 54, 58, 59, critical value, 25, 27
60, 66, 72, 74, 79, 87, 89, 115, 116, 118, 119, 120, Croatia, vi, xii, 345, 346, 348, 349, 350, 351
125, 127, 128, 132, 133, 136, 148, 149, 150, 151, crop models, 350
236, 258, 259, 260, 269, 270, 272, 273, 275, 278, crop production, 8, 9, 37, 47, 51, 55, 57, 60, 63, 82,
315, 337, 348 86, 89, 93, 232, 242, 317, 351
conception, xii, 319, 320, 322, 323, 325, 330 crop residues, 9, 18, 37, 41, 42, 47, 55, 62, 230, 234,
condensation, 119 239, 247, 253
conditioning, 340 crop rotations, vii, x, 1, 45, 59, 228, 252
conductance, 116, 127, 300 crops, ix, xii, 2, 3, 6, 7, 8, 9, 23, 24, 27, 29, 36, 37,
conductivity, 118, 136, 293, 295, 301 38, 39, 41, 42, 44, 45, 46, 50, 51, 52, 54, 59, 60,
confidence, 313 61, 62, 63, 64, 66, 67, 70, 71, 72, 77, 80, 81, 82,
confusion, 24, 89 87, 89, 91, 92, 97, 99, 113, 118, 120, 121, 125,
358 Index

161, 169, 180, 182, 185, 187, 188, 191, 200, 213, decoding, 304
216, 224, 227, 228, 229, 232, 233, 234, 235, 236, decomposition, x, 18, 26, 47, 48, 60, 150, 228, 229,
237, 238, 239, 240, 241, 247, 248, 254, 308, 312, 239, 240, 241, 247, 251, 253, 255, 308
315, 317, 327, 328, 329, 333, 337, 345, 346, 349, defense, 100, 117, 118, 120, 122, 128, 129, 130, 131,
350 136, 144, 148, 149, 150, 151, 153, 156, 164, 178,
cross-talk, 167 181, 187
Crotalaria, 45, 253 defense mechanisms, 136, 153
CRT, 157, 158 deficiency, 15, 16, 24, 26, 27, 28, 29, 32, 33, 38, 40,
crust, 62 41, 42, 53, 55, 65, 66, 68, 76, 79, 81, 142, 168,
CSR, 145 187
CTAB, 194 deficit, xi, 55, 115, 116, 117, 136, 141, 149, 150, 154,
C-terminal, 153 157, 165, 166, 170, 174, 179, 184, 185, 187, 195,
Cuba, 216, 217 205, 208, 291, 292, 293, 294
cultivation, viii, ix, xii, 3, 8, 9, 40, 41, 64, 112, 159, deficits, 131, 173, 174, 187, 303, 338
176, 187, 188, 213, 229, 231, 234, 237, 333, 334, definition, 17, 87, 93, 228, 321
335, 336, 337, 346, 349 deformation, 119
cultivation conditions, xii, 333, 334 degenerate, 198
cultural factors, 218 degradation, 31, 44, 104, 116, 122, 135, 152, 176,
cultural practices, 188 181, 187, 240, 286, 288
culture, x, xii, 81, 90, 91, 94, 106, 107, 148, 191, 228, dehiscence, 124
238, 333, 334, 335, 336, 337, 338, 339, 340, 341, dehydration, 121, 123, 167, 187
342 dehydrogenase, 120, 123, 126, 132, 133, 134, 139,
culture conditions, 335, 336, 338, 341 140, 141, 142, 144, 158, 167, 173, 174, 187, 297
culture media, 94 dehydrogenases, 120
current ratio, x, 228 denitrification, 9, 24, 28, 37, 38, 53, 56, 58, 59, 60,
customers, 322 72, 229, 241
cyanide, 304 density, 5, 11, 35, 60, 132, 136, 168, 187, 200, 213,
cycling, 61, 75, 88, 238, 239, 249, 252, 260 216, 309
cyclohexane, 260 Department of Agriculture, 68, 316, 325, 331
cysteine, 122, 123, 129, 131, 153, 154, 175, 187 dephosphorylation, 112
cytochrome, 122, 132, 176, 177, 187, 296, 303 depolarization, 127
cytoplasm, 119, 124, 127, 336, 337 deposition, 31, 37, 89, 230, 264
cytoskeleton, 164, 187 depressed, 132
cytosol, 129, 148, 153, 293 deprivation, viii, 111, 131, 165, 167, 187, 324
cytosolic, 125, 151, 292 derivatives, 5, 142, 170, 187
Czech Republic, 346, 348, 349, 350, 351 desiccation, 82, 143, 154, 182, 187
destruction, 119, 136, 148, 149, 304
detection, 24, 108, 155, 198, 203, 286
D detoxification, 116, 123, 129, 147, 153, 163, 167,
185, 187
dairy, 5, 47, 48, 61, 70, 72, 78
detoxifying, 141
dairy industry, 5
developed countries, 47, 61, 64, 189, 328
damping, 93, 99, 103
developed nations, 113, 163
danger, 57
developing countries, 43, 47, 48, 51, 57, 61, 63, 64,
data analysis, 224
189, 329
data set, 234
deviation, 313, 347, 349
database, 162, 251
diacylglycerol, 116
de novo, 122, 149, 150
dielectric constant, 317
death, 59, 113, 115, 124, 216, 341
diet, vii, 2, 189
decay, 47, 59
dietary, 189, 235
deciduous, 192, 193
dietary fiber, 189
decision making, 51
dietary habits, 235
decision support tool, xi, 307
diets, 189
decisions, 26, 29, 34, 43, 223, 322, 327
 Index 359

differentiation, ix, 12, 34, 188, 190, 208, 209, 223,

336
E
diffusion, 131, 134
E. coli, 151, 153, 157
digestibility, 5
ears, 5, 11, 12, 16, 17, 25, 200
dimer, 136, 182, 187
East Asia, 80
diploid, 340
ecological, ix, x, 89, 187, 188, 193, 242, 258, 301
direct observation, 215, 216
ecologists, 86
disabled, 310
ecology, 87, 93, 95, 104, 221, 258
Discovery, 73
economic activity, 191, 194
discriminant analysis, 70
economic change, ix, 187
discrimination, 116, 296, 304
Economic Research Service, 331
diseases, 91, 92, 93, 96, 105, 231
economics, 47, 220
disequilibrium, 118
ecosystem, 88, 131, 179, 187, 229, 235
disposition, 324
ecosystems, 72, 74, 109, 166, 177, 187, 231, 242, 249
dissociation, 297, 302
Ecuador, 190
distribution, 65, 76, 81, 102, 121, 148, 165, 187, 190,
Education, 350
221, 222, 223, 254, 258, 265, 267, 270, 273, 278,
effluent, 235, 236
279, 283, 286, 288, 289, 292
egg, 31, 260
diversity, viii, ix, 45, 85, 121, 187, 188, 189, 190,
elderly, 216
191, 193, 194, 195, 198, 199, 201, 203, 204, 205,
electrical conductivity, 118
206, 207, 208, 214, 215, 216, 217, 219, 220, 221,
electrolyte, 121, 136, 151
222, 223, 224, 231, 232, 233, 235, 242, 244, 249,
electrolytes, 146
253, 301
electromagnetic, 28
division, 144, 336, 337, 338
electron, 14, 89, 119, 121, 122, 124, 132, 135, 171,
DNA, 13, 95, 119, 129, 134, 136, 139, 140, 144, 159,
187, 296, 297, 298, 302, 303, 337
161, 165, 166, 181, 184, 187, 190, 194, 198, 213,
electron spin resonance, 135
220, 221, 222, 225, 231, 339, 342
electrons, 296, 301
DNA damage, 134, 136, 181, 187
electrophoresis, 120, 126, 128, 129, 130, 131, 162,
DNA repair, 136, 165, 187
170, 177, 187
domestication, 159, 188, 189, 190, 193, 206, 214,
electroporation, 339, 342
216, 220, 221, 223, 305
elongation, 91, 116, 126, 129, 131, 133, 134, 294
dominance, 89, 194, 206, 208, 213
embryo, 334, 335, 336, 338, 339, 341
donor, xii, 333, 334
embryogenesis, xii, 118, 138, 154, 163, 177, 182,
down-regulation, 155
184, 187, 333, 335, 338, 339, 340, 341, 342, 343
draft, 170, 187
emission, 49, 58, 63, 67, 70, 77, 83, 348, 350
drainage, 47, 54, 55, 57, 59, 60, 68, 80
employees, 322
drought, viii, 14, 27, 28, 40, 42, 44, 64, 69, 71, 89,
encapsulation, 93
97, 111, 112, 113, 114, 115, 116, 117, 118, 139,
encoding, 95, 120, 123, 134, 136, 144, 154, 158, 176,
141, 142, 143, 146, 147, 148, 151, 153, 154, 155,
187
156, 157, 158, 159, 162, 163, 164, 166, 167, 168,
endoplasmic reticulum, 114, 119, 124
169, 170, 178, 179, 180, 181, 183, 184, 185, 186,
endosperm, 125, 172, 183, 187, 338, 341
187, 297, 301, 303, 340
energy, vii, xi, 1, 13, 32, 57, 61, 62, 64, 87, 101, 117,
Drought, 76, 115, 117, 137, 138, 154, 164, 181, 187,
121, 122, 123, 126, 128, 133, 134, 188, 230, 242,
300, 302
291, 296, 297, 298, 300
droughts, 115
energy transfer, 13
drugs, 337
engagement, 304
dry matter, 2, 4, 10, 11, 12, 23, 33, 35, 36, 53, 69, 80,
England, 236, 245, 247
84, 89, 115, 116, 125, 129, 132, 134, 135, 237,
enlargement, 116, 337
239, 303, 308
enolase, 123
drying, 181, 187, 259, 260
enterprise, 328
DSC, 182, 187
environment, vii, viii, 1, 3, 12, 17, 24, 25, 30, 32, 36,
duration, 6, 32, 89, 117, 119, 201, 294, 309, 311
37, 40, 43, 48, 51, 54, 56, 62, 63, 64, 67, 71, 81,
86, 89, 93, 111, 112, 127, 128, 131, 165, 176, 187,
360 Index

229, 235, 236, 241, 247, 258, 267, 273, 276, 288, exercise, 51, 313
289, 308, 315, 317, 338 experimental design, 235
environmental change, 162 exploitation, xi, 160, 161, 319, 320, 322, 323, 324,
environmental effects, 38, 49, 229 325, 328, 330
environmental factors, 30, 38, 89 exports, 189
environmental impact, 3, 55, 60, 62 exposure, xi, 120, 124, 128, 130, 131, 134, 136, 141,
environmental issues, 49 142, 148, 152, 172, 176, 177, 187, 276, 291, 292,
environmental protection, 63 293, 295, 296, 297, 298, 299, 337
Environmental Protection Agency, 254, 258 Exposure, 130, 131, 153, 288
environmental sustainability, vii, 1 expressed sequence tag, 114, 117, 159
enzymatic, 136, 151, 164, 187, 299 extinction, 203, 204, 214, 215, 217
enzymes, viii, 14, 87, 89, 96, 101, 111, 115, 117, 119, extracellular matrix, 337
120, 124, 126, 127, 129, 131, 132, 134, 135, 137, extraction, 156, 259, 260, 313
139, 140, 141, 142, 143, 144, 145, 146, 148, 149,
150, 151, 163, 164, 168, 169, 172, 174, 176, 180,
181, 183, 187, 297, 299, 301, 303 F
EPA, 254, 258
factorial, 301
epidemics, 236
failure, 115, 292
epidermal growth factor receptor, 168, 187
faith, 233
epidermis, 86, 89, 270
family, 107, 143, 152, 153, 154, 155, 156, 158, 166,
equilibrium, 120, 198, 205, 208
167, 168, 174, 177, 178, 179, 184, 187, 199, 229,
equity, 44
310
Eritrea, 316
family structure, 143
ERK1, 130
FAO, 43, 51, 66, 69, 73, 188, 220, 222, 316, 326,
erosion, ix, 9, 10, 23, 44, 46, 50, 61, 187, 188, 189,
328, 329
193, 197, 199, 206, 214, 215, 216, 217, 220, 221,
farmers, ix, xi, 9, 24, 25, 29, 40, 43, 47, 49, 50, 51,
223, 224, 234, 236, 238
53, 55, 56, 70, 77, 81, 86, 188, 191, 193, 194, 197,
Escherichia coli, 102, 143, 177, 187
198, 199, 200, 201, 202, 203, 204, 206, 208, 212,
ESR, 135
213, 214, 215, 216, 218, 220, 233, 235, 241, 248,
ESR spectra, 135
251, 319, 326, 327, 328, 329, 330
ester, 105
farming, x, 8, 20, 23, 31, 44, 45, 49, 50, 54, 81, 188,
estimating, 53, 66, 67, 222, 309
193, 202, 235, 237, 247, 248, 253, 291, 312, 328
estimator, 197, 198, 212
farmland, 281
estimators, 214, 215
farms, viii, 20, 43, 57, 75, 85, 236, 238, 241, 250
Estonia, 277, 278, 282
fauna, 238
ethanol, vii, 1, 2, 5, 61, 133, 234
fax, 307
Ethiopia, 20, 77, 224
February, 326
Ethiopian, 20, 75, 77, 224, 248
Federal Register, 254
ethnic groups, 191
feeding, 20, 49, 55, 151
ethylene, 87, 89, 98, 103, 117, 132, 133, 158, 172,
feedstock, vii, 2
184, 187, 231
fencing, 23
Europe, 3, 4, 57, 236, 276, 301, 330
fermentable carbohydrates, 133
European Union, 7, 49, 77
fermentation, 5, 133, 134, 173, 187
Europeans, 2, 191
ferritin, 120
eutrophication, 57, 60, 229
fertiliser, 34, 55, 89, 252
evaporation, 62, 308
fertility, vii, ix, 1, 3, 8, 12, 31, 43, 45, 50, 51, 57, 62,
evapotranspiration, 309, 316
67, 68, 71, 81, 83, 86, 89, 108, 121, 124, 172, 187,
evening, 292
188, 200, 227, 233, 236, 238, 242, 244, 248, 251
evil, 321, 325
fertilization, ix, 32, 37, 38, 39, 40, 41, 42, 51, 55, 57,
evolution, 86, 116, 135, 171, 187, 188, 220, 222, 229,
58, 59, 60, 66, 69, 72, 73, 74, 76, 77, 79, 80, 82,
303
103, 115, 124, 227, 236, 237, 238, 239, 240, 241,
excision, 166, 187
249, 251, 308, 350
exclusion, 120, 141, 148
 Index 361

fertilizer, viii, ix, 2, 9, 12, 15, 24, 25, 26, 27, 29, 30, frost, 180, 187
32, 33, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 48, fructose, 143
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, fuel, 9, 51, 54, 61, 62
63, 64, 65, 66, 67, 71, 73, 74, 75, 76, 77, 78, 79, fumigation, 73, 105
80, 81, 82, 83, 84, 86, 89, 90, 107, 193, 228, 229, fungal, 87, 89, 91, 93, 96, 97, 107
232, 233, 235, 236, 237, 239, 240, 241, 246, 247, fungal infection, 107
250, 253, 254, 328 fungi, 87, 89, 91, 94, 236
fertilizers, vii, ix, 1, 3, 15, 18, 20, 23, 25, 30, 33, 36, Fusarium, 78, 90, 92, 95, 99, 102, 105, 107, 108, 109
37, 38, 39, 40, 41, 42, 43, 44, 46, 47, 48, 49, 50, Fusarium oxysporum, 92, 95
51, 52, 54, 55, 56, 59, 63, 64, 66, 78, 86, 91, 227, fusion, 143, 336, 341, 342, 343
229, 230, 236, 238, 239, 240, 241
fiber, 164, 187, 189
fibroblasts, 164, 187 G
field crops, 2, 100
GABA, 133
Filipino, 327
gamete, 339
fingerprinting, 219, 222, 224
gametophyte, 115, 121, 175, 187
fish, 74
gamma-aminobutyric acid, 130
fitness, 94
gas, 70, 131, 134, 185, 187
fixation, ix, xi, 14, 50, 87, 89, 92, 98, 105, 107, 119,
gas diffusion, 134
227, 229, 230, 231, 234, 245, 246, 247, 250, 252,
gas exchange, 185, 187
253, 254, 291, 297, 298
gases, 68, 129
flavor, 91, 213
GCC, 158
flooding, viii, 111, 131, 134, 159, 176, 187
gel, 126, 130, 131, 146, 158, 178, 187, 260
flow, ix, 60, 102, 171, 187, 188, 190, 191, 193, 194,
gene combinations, 160
195, 196, 197, 200, 203, 205, 206, 208, 209, 210,
gene expression, 108, 112, 113, 114, 115, 116, 118,
211, 212, 213, 216, 217, 223, 224, 260, 296, 297
121, 123, 126, 134, 137, 141, 154, 157, 159, 161,
flow rate, 260
162, 168, 172, 181, 187, 304
flow value, 212
gene mapping, 340
fluorescence, 108, 119, 121, 135, 176, 177, 187, 259,
gene pool, ix, 160, 187, 189, 190, 193, 194, 195, 197,
260, 297, 300, 303
198, 199, 201, 203, 206, 208, 209, 210, 211, 212,
fluorine, x, 257, 262, 263, 264, 286
213, 214, 215, 216, 217, 221
focusing, 292
gene promoter, 143, 158
folding, 120, 152
gene silencing, 161
folic acid, 189
gene transfer, 160, 161, 334
food, vii, viii, x, 1, 2, 5, 43, 44, 45, 50, 51, 62, 64,
generation, 69, 120, 127, 136, 142, 147, 160, 165,
108, 111, 113, 115, 137, 159, 161, 163, 188, 216,
180, 187, 200, 203, 215, 218, 238, 292, 303, 334,
219, 228, 229, 235, 258, 291, 292, 326
348
food production, 43, 44, 113, 137
genes, viii, 5, 89, 93, 100, 106, 109, 111, 113, 114,
food products, 292
115, 116, 117, 120, 122, 123, 125, 129, 130, 133,
food safety, 161
136, 137, 138, 141, 142, 143, 144, 146, 152, 154,
forestry, 76, 96, 70, 131, 185, 187, 251, 351
155, 156, 157, 158, 159, 160, 161, 162, 163, 166,
formal education, 235
167, 168, 169, 170, 172, 176, 178, 179, 183, 184,
formal sector, 329
187, 197, 210, 213, 217, 220, 221, 245, 293, 325,
fossil, 61, 258
334, 338, 339, 340, 341
fossil fuel, 61, 258
genetic diversity, ix, 187, 188, 189, 190, 191, 193,
founder effect, ix, 187, 206, 214, 216
195, 198, 203, 204, 205, 206, 207, 208, 214, 215,
Fox, 9, 70, 72, 132, 168, 169, 187
216, 217, 222, 223, 301
fragmentation, 128, 170, 187, 220
genetic drift, 204, 217
France, 104, 317
genetic factors, 169, 187
free radicals, 148
genetic information, 328
freedom, 195, 327
genetic marker, 174, 187
free-radical, 139
genetically modified organisms, 223
freezing, 121, 123, 142, 144, 154, 259
362 Index

genetics, ix, 113, 137, 159, 163, 165, 169, 176, 187, ground-based, 30
193, 224, 339 groundwater, 49, 57, 58, 59, 60, 317
Geneva, 72, 224, 351 grouping, 197, 206, 208
Genistein, 109 groups, xi, 88, 132, 139, 153, 154, 189, 191, 198,
genome, 105, 117, 143, 144, 147, 158, 159, 160, 161, 214, 215, 293, 319, 325, 326, 327
162, 170, 180, 183, 186, 187, 223, 326, 337, 340 growth factor, 168, 187
genomes, 165, 187 growth rate, 23, 40, 89, 130, 131, 135, 141, 296
genomic, 117, 154, 185, 187, 194 growth temperature, 99, 304
genomics, viii, 112, 114, 159, 160, 161, 162 GST, 190, 195, 196, 206, 208, 209
genotype, xii, 89, 90, 115, 196, 197, 224, 254, 293, Guangzhou, 287, 288
295, 296, 297, 299, 302, 333, 334, 338, 339, 342 guard cell, 119, 159, 293, 303
genotypes, xi, 66, 68, 69, 106, 115, 116, 118, 122, Guatemala, 190
124, 125, 134, 139, 145, 165, 181, 187, 189, 197, guidelines, 193, 316
224, 242, 291, 292, 293, 294, 295, 296, 297, 298, guilty, 323, 328
299, 300, 301, 302, 335, 342 Guinea, 247, 250, 251, 253
geology, 236 Gulf of Mexico, 191
Germany, 57, 94, 104, 177, 187, 220, 243
germination, x, 39, 86, 89, 92, 96, 98, 118, 121, 124,
127, 128, 133, 134, 157, 165, 167, 173, 175, 177, H
187, 239, 291, 338
H2, 21
GHG, 58
handling, 78
gibberellins, 87, 89, 94, 99, 231
haploid, xii, 333, 334, 335, 337, 339, 340, 341, 342
girth, 91
harm, 42, 87, 258, 264
GIS, 316
harvest, 2, 4, 5, 10, 12, 17, 22, 25, 27, 30, 32, 36, 37,
global warming, 58, 178, 187
42, 46, 54, 57, 59, 60, 61, 62, 64, 70, 71, 81, 115,
glucose, 126, 151
200, 202, 213, 233, 234, 297, 311, 326
glutamate, 120, 140, 174, 187
harvesting, vii, 1, 27, 135, 182, 187
glutamic acid, 141
Hawaii, 351
glutamine, 117, 128, 136, 141
health, x, 30, 37, 51, 59, 62, 64, 86, 89, 126, 244,
glutathione, 118, 129, 148, 149, 150, 153, 164, 168,
258, 278, 287
170, 177, 187, 299
health effects, 244
glutathione peroxidase, 168, 187
health status, 64
glycine, 122, 123, 126, 139, 140, 142, 153, 154, 168,
healthcare, 68
173, 180, 181, 187
heat, viii, 6, 67, 80, 82, 111, 113, 114, 123, 124, 125,
glycol, 143, 184, 187
126, 142, 146, 148, 152, 154, 158, 163, 165, 167,
glycolysis, 133
173, 174, 175, 177, 179, 180, 182, 183, 184, 187,
glycosylated, 126
296, 297, 298, 303, 335, 340
goals, 38, 51
heat shock protein, 123, 124, 126, 152, 163, 167, 175,
government, iv, 328
177, 183, 184, 187
G-protein, 155
heating, 23, 153
grains, 3, 5, 11, 12, 23, 32, 33, 40, 43, 62, 69, 125,
heavy metal, x, 112, 114, 129, 141, 153, 154, 155,
212, 229, 237, 238, 336, 341
163, 167, 175, 187, 228, 236, 252, 254
grana, 116
heavy metals, x, 112, 114, 129, 153, 154, 155, 163,
granules, 116, 119, 124
175, 187, 228, 236, 252, 254
grass, 2, 12, 74, 89, 103, 105, 252, 309, 316
height, 4, 5, 62, 89, 91, 115, 135, 172, 187
grassland, 235
heme, 132
Greece, 277, 278, 282
hemp, 46, 243
green fluorescent protein, 254
herbicide, 54, 193, 200, 218
Green Revolution, 229
herbicides, 9, 46, 200, 204, 213, 299, 328
greenhouse, vii, viii, 1, 34, 35, 58, 68, 70, 85, 89, 90,
heritability, 218
94, 103, 124, 194
heterogeneous, 336
greenhouse gases (GHG),1, 58
heterosis, 338
ground water, 25, 56, 59, 62, 73, 244
heterotrophic, 230, 252
 Index 363

heterozygosity, 195, 198, 204, 205, 207, 208, 215 hypoxic, 132, 134, 173, 187
heterozygote, 205
heterozygotes, 195, 205, 208
hexane, 260 I
high risk, ix, 188, 217
IBM, 304
high temperature, 124, 125, 126, 150, 152, 155, 162,
ice, 113, 127, 133, 143, 153, 154, 156, 157, 159
164, 172, 175, 178, 182, 184, 185, 187, 286
ICE, 157
highlands, 4, 20, 75, 81, 248
id, 212
hips, 5
identification, 101, 114, 118, 159, 160, 162, 163, 168,
HK, 302
184, 187, 339
hog, 47, 48, 49, 67
identity, 154, 160, 204
holistic, 63, 68
Illinois, 24, 224
holoenzyme, 125
illumination, 121
homeostasis, 116, 121, 126, 150, 153, 156, 157, 163,
imbalances, 26
167, 187, 293
Immanuel Kant, 324
homicide, 321
immigrants, 197
homology, 128, 134, 293
immobilization, 9, 37, 52, 67, 240, 241
homozygosity, 208, 339
immunoprecipitation, 122
homozygote, 340
implementation, xi, 64, 237, 319, 320, 325, 326, 327,
Hong Kong, 288
328, 330
horizon, 58
in situ, 76, 89, 127, 139, 179, 187, 193, 194, 197,
Horticulture, 14, 76
199, 217, 218, 219, 220, 222, 223, 225
host, 89, 95, 97, 98, 100, 137, 162, 218, 249
in vitro, 89, 101, 103, 104, 106, 107, 125, 128, 133,
household, 45
142, 143, 152, 179, 185, 187, 334, 335, 336, 339,
HPLC, x, 89, 257, 259
340, 341, 342, 343
HSP, 123, 152
inactivation, 302
human, ix, 5, 51, 58, 64, 86, 187, 188, 189, 192, 199,
inbreeding, 195, 222
216, 218, 237, 258, 276, 278, 292, 325
inbreeding coefficient, 195, 222
human exposure, 278
incidence, 107, 132, 199
humanity, 323, 324
inclusion, 45, 233, 234, 235, 242
humans, 126, 129, 229
income, 45, 238, 322
humidity, 309
incubation, 153, 244, 247, 248, 250, 341
humus, 40
indexing, 76
Hungary, 349, 350
India, 8, 85, 97, 111, 131
hybrid, 5, 6, 12, 35, 36, 38, 51, 66, 76, 81, 157, 166,
Indian, 69, 93, 98, 103, 107, 148, 164, 165, 167, 172,
187, 197, 205, 213, 302, 326, 329, 334, 339
187
hybridization, 160, 188, 191
indication, 29, 312
hybrids, 4, 5, 12, 23, 29, 32, 35, 36, 65, 69, 73, 75,
indicators, vii, 1, 26, 29, 30, 55, 64, 70, 75, 240
78, 79, 81, 82, 83, 212, 213, 217, 228, 294, 334,
indices, 29, 64, 65, 70, 71, 194, 195, 289
335, 337, 338, 339
indigenous, 55, 248, 249, 326
hydration, 139
Indigenous, 80, 81
hydro, x, 154, 257, 258, 286, 287, 288, 289
indirect effect, 12
hydrocarbon, 289
inducer, 157, 334
hydrogen, 13, 89, 117, 150, 164, 167, 187, 229, 293,
inducible protein, 128, 153, 163, 180, 187
300, 304
induction, viii, xii, 100, 102, 111, 113, 115, 124, 126,
hydrogen peroxide, 117, 150, 164, 167, 187, 293,
128, 130, 131, 136, 138, 150, 155, 164, 170, 187,
300, 304
231, 298, 304, 333, 334, 337, 338, 341, 342
hydrologic, 350
inductor, 335
hydrolysis, 117, 127
industrial, ix, 2, 5, 227, 235, 251
hydrophilic, 154
industry, xi, xii, 5, 234, 319, 320, 325, 326, 327, 328,
hypersensitive, 131, 156
330
hypertrophy, 121
infancy, 61
hypoxia, 131, 132, 168, 179, 187
infants, 59, 229
364 Index

infections, 108 isolation, ix, 100, 103, 180, 182, 187, 188, 195, 206,
informal sector, 329 208, 216, 220, 334, 337, 341, 342
infrared, 28, 74 isotope, 116, 168, 187, 304
inheritance, 160, 198 isozyme, 191, 223
inhibitor, 60, 122 isozymes, 203
inhibitors, 131, 296 Israel, 198
inhibitory, 119, 128, 146 Italy, 69, 73, 219, 221, 316
initiation, 31, 33, 116, 118, 133, 176, 187, 303, 334, ITC, 92
335
injection, 10
injuries, 114 J
injury, viii, 54, 111, 119, 124, 129, 130, 136, 144,
jackknife, 195
151, 168, 175, 187, 293, 298, 302
Japan, 28, 100, 167, 172, 187, 259, 301
inorganic, 31, 37, 39, 41, 44, 47, 48, 49, 50, 57, 59,
Japanese, 74, 176, 182, 187
73, 89, 93, 99, 128, 139
Jordan, 68
inositol, 105
Jung, 80, 118, 149, 150, 165, 167, 174, 187
insecticides, 9
insects, 9, 12, 203
insight, 184, 187 K
instability, 136
institutions, 320 K+, 14, 127, 147, 156, 157, 175, 178, 187, 304
insurance, 32 Kant, 321, 323, 324, 325
integration, 144, 161, 183, 187, 191, 241 Kazakhstan, 69
integrity, 142 Kenya, 49, 50, 55, 73, 81, 250
intentions, xi, 319 kernel, 5, 11, 12, 32, 34, 66, 68, 75, 78, 346, 347
interaction, 43, 72, 86, 89, 102, 158, 162, 169, 187, kidney, 189
339 killing, 232
interactions, 26, 38, 52, 62, 77, 86, 87, 89, 92, 93, 94, kinase, 120, 122, 126, 130, 155, 164, 171, 172, 174,
96, 104, 105, 108, 161, 163, 182, 183, 187, 232, 175, 176, 179, 185, 187
245, 248, 320 Kinase, 156
interface, 105 kinases, 112, 116, 123, 155
interference, 153, 156 kinetics, 67
Intergovernmental Panel on Climate Change, 72 King, 98
internode, 5 Korea, 85
interpersonal relations, 320 Krebs cycle, 133
interval, 12
interviews, 194, 215
intra-population, 203 L
intrinsic, 88, 293, 294
inventions, 9 L1, 154, 238
inventories, 236 L2, 154, 238
invertebrates, 143 LA, 304
investment, 29 labeling, 36, 119
ion channels, 120 labor, 322
ionic, 118, 120 laboratory method, 351
ions, viii, 39, 40, 43, 50, 111, 139, 141, 153, 178, labour, 9, 26, 30, 44, 50, 52
187, 295 lactate dehydrogenase, 133
IPCC, 58, 72, 348, 351 Lafayette, 80
iron, 13, 16, 26, 87, 89, 189, 235 lakes, 60
irradiation, 112, 136, 158, 169, 171, 187 lamina, 120, 178, 187
irrigation, 8, 17, 37, 42, 43, 55, 57, 59, 65, 70, 72, 77, land, 4, 7, 8, 9, 11, 23, 40, 43, 44, 49, 52, 54, 58, 62,
82, 96, 201, 236, 242, 308, 312, 316, 317 68, 115, 118, 188, 202, 228, 229, 236
isoforms, 128, 141, 142, 143, 150, 174, 180, 187 Laos, 249
latency, 217, 258
 Index 365

Latin America, 2, 8, 50, 189, 216 London, 81, 95, 98, 342
laws, 315, 325 long distance, 266, 267
LEA, 154, 167, 184, 187 long period, 163, 347
leach, 15, 43 losses, 37, 38, 46, 47, 49, 50, 54, 56, 58, 59, 60, 61,
leachate, 65, 72 63, 65, 70, 71, 74, 77, 82, 124, 218, 239, 240, 241
leaching, vii, 1, 16, 25, 28, 34, 37, 38, 43, 44, 46, 47, low temperatures, x, 121, 122, 144, 291, 292, 294,
49, 53, 56, 57, 59, 60, 61, 62, 66, 70, 72, 76, 79, 295, 296
82, 83, 240, 241, 247 lower prices, 330
leaf blades, 122, 135, 144 low-intensity, 329
leakage, 121, 126, 146, 151 low-intensity farming systems, 329
leaks, 328 low-temperature, 152, 259
legislation, 236 LSM, 57
legume, ix, 8, 45, 46, 51, 64, 74, 78, 87, 89, 94, 98, lying, 329
227, 228, 233, 234, 235, 238, 240, 243, 244, 245, lysis, 119, 124
247, 253
legumes, 8, 31, 45, 46, 50, 51, 89, 96, 189, 216, 219,
233, 234, 240, 242, 244, 245, 246, 247, 248, 250, M
251, 252
M.O., 67, 246, 249
Legumes, 8, 45
machinery, 9, 112, 121, 128, 191, 201
Leguminosae, 220, 221
macronutrients, 13, 54
lesions, 131
macropores, 60
lettuce, 91
MACs, xi, 319, 320, 327, 330
leucine, 128
Madison, 69, 70, 73, 74, 221, 254, 316
LHC, 297, 302
magnesium, 13, 118, 189
licensing, 327, 330
Magnesium sulfate, 21
life cycle, 10, 13, 89, 115, 124, 163, 212, 239
maintenance, xi, 31, 41, 117, 126, 134, 146, 216, 239,
lifetime, 135
291, 295
ligands, 147
Maintenance, 3
light conditions, 136
maladaptive, 217
lignin, 5, 89, 129, 240, 251
malate dehydrogenase, 120, 174, 187, 297
likelihood, 60
Malaysia, 249
limitation, 24, 142, 161
malic, 148
limitations, viii, 64, 111, 134, 183, 187, 240
malondialdehyde, 125, 136, 147
linear, 23, 30, 34, 98, 268, 269, 270, 273, 317, 347,
malondialdehyde (MDA), 136, 147
348
management, vii, viii, ix, xi, 1, 2, 3, 6, 8, 9, 10, 12,
linear regression, 317
20, 25, 26, 28, 30, 32, 34, 36, 37, 38, 43, 44, 47,
linkage, 160, 197
49, 51, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67,
lipid, 116, 118, 122, 125, 126, 127, 129, 136, 139,
68, 69, 70, 71, 72, 74, 75, 77, 78, 79, 81, 82, 85,
149, 150, 151, 175, 180, 183, 187, 299, 336
92, 93, 95, 100, 109, 129, 175, 187, 193, 194, 200,
lipid peroxidation, 118, 125, 126, 127, 129, 136, 149,
202, 203, 204, 215, 216, 227, 231, 233, 235, 238,
150, 151, 175, 180, 183, 187
239, 241, 242, 244, 247, 248, 251, 252, 253, 254,
lipid peroxides, 151
258, 302, 307, 308, 310, 315, 317
lipids, 140, 148
management practices, vii, 1, 3, 6, 30, 43, 51, 52, 56,
lipophilic, 270
57, 62, 64, 70, 75, 194, 216, 242, 244, 308, 315,
liposomes, 154
317
liquids, 260
manganese, 13, 16, 183, 187, 235
livestock, 19, 23, 47, 62, 67, 69, 74, 252, 253
Manganese, 14, 15, 16, 20, 22, 23, 27
Livestock, 77
manganese superoxide, 183, 187
living environment, 89
manganese superoxide dismutase, 183, 187
local community, 322
Manhattan, 74
localization, 127, 155, 157, 159, 169, 187, 302
manners, 157
locus, 158, 179, 187, 195, 197, 198, 205, 208
mannitol, 139, 140, 144, 341
logging, 15, 89, 181, 187
manufacturing, 14
366 Index

manure, ix, 3, 18, 19, 20, 23, 25, 27, 37, 38, 41, 44, metallothioneins, 153, 163, 167, 187
45, 46, 47, 48, 49, 51, 52, 54, 56, 57, 58, 59, 60, metals, 127, 128, 147, 151, 153, 165, 187, 236, 237,
61, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 76, 250
77, 78, 82, 84, 227, 228, 234, 235, 238, 239, 240, meteorological, xii, 345, 346, 347, 348, 349
241, 244, 247, 248, 249, 250 methane, 58
map unit, 83 methanol, 260
MAPK, 126, 155, 164, 174, 187 methionine, 120, 145, 146
MAPKs, 130 methionine synthetase, 120
mapping, 78, 160, 174, 176, 184, 187, 254, 339, 340 methyl bromide, 105
market, vii, 1, 5, 38, 44, 75, 201, 202, 203, 204, 215, methylene, 260
217, 326, 338 methylene chloride, 260
market value, 201, 204 metric, 189
marketing, 191, 204, 327, 329, 330 Mexican, 191
Markov, 197 Mexico, vii, ix, 2, 71, 77, 80, 81, 187, 188, 189, 190,
Markov chain, 197 191, 193, 194, 196, 199, 200, 202, 204, 205, 206,
Marx, 320, 323, 325 207, 208, 209, 211, 212, 213, 214, 215, 216, 217,
Marxists, 320 218, 220, 221, 223, 292, 317
mass spectrometry, 107, 120, 131 Mg2+, 117
Massachusetts, 181, 187 MgSO4, 21
maternal, 213 microarray, 117, 123, 129, 159, 162, 166, 178, 184,
matrix, 317, 337 187
Maya, 191, 216, 218, 219 microbes, 86, 89
MDA, 136 Microbes, 109
MDH, 120, 123, 297 microbial, viii, 47, 49, 85, 86, 89, 91, 93, 96, 99, 103,
measurement, 10, 26, 30, 67, 72, 75, 77, 278 231, 238, 254
measures, 25, 28, 30, 41 Microbial, 86, 89, 91, 93, 94, 95, 96, 98, 103, 104,
media, 94, 238, 254, 258, 338, 340 108
medicine, 170, 187 microbial communities, 89, 99, 231
Mediterranean, 289, 317 microbiota, 88, 229
meiosis, 115 microflora, 86, 89
membrane permeability, 164, 187 microhabitats, 88
membranes, viii, 14, 107, 111, 119, 124, 140, 142, microinjection, 339, 340
152, 154, 183, 187 micronutrients, 13, 16, 22, 42, 43, 51, 52, 54, 63, 76,
meristem, 301 80, 235
Mesoamerica, 190, 216, 217, 222, 223 microorganisms, 47, 86, 87, 88, 89, 94, 95, 99, 100,
mesophyll, 116, 131, 297, 302 104, 105, 106, 107, 109, 228, 229, 230, 231, 242
messengers, 155, 304 microscope, 336, 337
meta-analysis, 179, 187, 254 Microsoft, 224
metabolic, viii, 13, 14, 38, 89, 111, 112, 113, 115, microspore, xii, 122, 123, 171, 187, 333, 334, 335,
116, 125, 127, 128, 137, 146, 162, 163, 168, 187, 336, 337, 338, 339, 340, 341, 342, 343
258 migration, 89, 198, 224, 258, 264
metabolic changes, viii, 111, 113, 115, 137 millet, 8, 46, 81, 233, 237
metabolism, x, 14, 41, 78, 89, 112, 114, 115, 117, mineralization, 9, 15, 16, 24, 25, 28, 32, 37, 45, 47,
122, 123, 125, 126, 127, 129, 132, 133, 136, 141, 48, 51, 52, 53, 55, 57, 58, 67, 69, 72, 75, 83, 179,
143, 144, 147, 156, 164, 168, 170, 172, 173, 174, 187, 240, 244, 247, 248, 250, 255
176, 179, 183, 187, 291, 301, 304 mineralized, 33, 41, 49
metabolites, viii, 87, 89, 90, 111, 115, 133, 137, 138, minerals, 5, 89
162 mining, 234
metabolomics, viii, 93, 112, 130, 162, 163, 167, 187 Ministry of Education, 257
metal chelators, 140 Minnesota, 6, 14, 78
metal ions, 141 misleading, 63, 327
metal oxides, 177, 187 missions, 72, 74, 297
metal salts, 141, 143 Missouri, 67
 Index 367

mitochondrial, 119, 124, 132, 151, 152, 154, 176,

177, 181, 182, 187, 296, 304
N
mitochondrial membrane, 154
Na+, 120, 146, 156, 157, 169, 175, 187, 304
mitogen, 116, 123, 126, 155, 174, 179, 187
NaCl, 22, 118, 119, 120, 139, 141, 142, 143, 145,
mitogen activated protein kinase, 155, 174, 187
146, 147, 156, 168, 172, 173, 174, 177, 179, 184,
mitogen-activated protein kinase, 123, 126, 155, 179,
187
187
NAD, 142, 150
mixing, 200, 213, 238, 241
NADH, 134, 141
MnSOD, 138
NAM, 138, 158, 159
mobility, 14, 15
nanotechnology, 63
modeling, 316
naphthalene, x, 257, 262, 264, 281, 286
models, xi, 98, 117, 160, 307, 308, 309, 315, 317,
National Academy of Sciences, 166, 169, 170, 178,
318, 345, 346, 348, 349, 350, 351
182, 184, 187
modulation, 150
National Research Council, 218, 223
moisture, 9, 10, 11, 23, 28, 37, 46, 47, 50, 58, 75, 116
natural, 47, 64, 89, 97, 132, 139, 160, 161, 190, 205,
molecular biology, 99, 113, 137
218, 222, 224, 229, 238, 246, 252, 254
molecular changes, 163
natural habitats, 161
molecular markers, 160, 182, 187, 214
natural resources, 238
molecular mass, 131, 139
natural selection, 205, 222
molecular mechanisms, viii, 112
NCA, 342
molecular oxygen, 131
Nebraska, 78
molecules, xi, 89, 112, 116, 126, 147, 148, 149, 154,
necrosis, 15
291, 297
need-based, 55, 64
molybdenum, 13
needles, 18
money, 51, 322
nematodes, 101
monosaccharide, 121
Nepal, 8, 43, 50, 65, 80, 81
monsoon, 50, 259
Netherlands, 97, 101, 167, 182, 187, 301
Montana, 73
New Jersey, 100
Monte Carlo, 197
New Mexico, 218
Moon, 101, 254
New World, 189
morning, 292
New York, 70, 71, 78, 93, 95, 105, 165, 168, 175,
morphogenesis, 144
183, 187, 220, 221, 224, 245, 254, 289, 323
morphological, 113, 115, 171, 187, 191, 194, 196,
Newton, 97
197, 200, 201, 204, 210, 219, 337, 338, 339
NGO, 327
morphology, viii, 85, 86, 89, 128, 134, 135, 161, 292,
Ni, viii, 13, 36, 111, 127, 237, 243, 251
294, 295, 301, 302, 303, 311, 337
nickel, 128, 244
mosaic, 92
Nicotiana rustica, 293
mountains, 50
Nielsen, 37, 108, 235, 247, 323
mouse, 156
nif genes, 106
movement, 57, 60, 89, 104, 218, 310
Nigeria, 73, 218, 250, 251, 253
mRNA, 118, 126, 133, 135, 142, 146, 150, 155, 170,
Nike, 176, 187
174, 187
Nile, 109
MSW, 300
NIR, 28, 30
MTs, 153, 154
nitrate, vii, 1, 2, 15, 20, 21, 25, 27, 54, 60, 65, 66, 67,
multiple regression, 98
68, 70, 71, 72, 75, 76, 78, 79, 80, 81, 82, 83, 119,
murder, 321
128, 173, 180, 187, 229
mutagenesis, 114, 159
nitric oxide, 74, 292
mutagenic, 258
nitrification, 26, 58, 60
mutants, 94, 96, 107
nitrogen, ix, 2, 12, 13, 37, 65, 66, 67, 68, 69, 70, 71,
mutation, 182, 187, 339
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,
MYC, 157
87, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 103,
myelin basic protein, 130
105, 107, 108, 109, 112, 115, 117, 121, 127, 135,
142, 163, 172, 187, 227, 228, 229, 231, 232, 233,
368 Index

234, 235, 236, 238, 239, 240, 241, 242, 244, 246, organic, viii, ix, 2, 3, 9, 10, 13, 16, 18, 24, 31, 38, 39,
247, 248, 249, 250, 251, 252, 253, 254, 260, 295, 41, 42, 43, 44, 47, 48, 49, 50, 52, 55, 58, 60, 61,
308, 310, 317, 318, 346 62, 64, 65, 71, 72, 73, 77, 84, 89, 105, 111, 113,
nitrogen compounds, 77, 229 137, 138, 139, 147, 148, 163, 171, 177, 187, 227,
nitrogen fixation, ix, 87, 89, 91, 92, 94, 97, 98, 99, 229, 232, 233, 235, 236, 237, 238, 239, 240, 241,
100, 108, 227, 231, 232, 233, 234, 244, 247, 251, 242, 247, 249, 251, 254, 258, 270, 295
252, 253, 254 organic C, 10
nitrogen fixing, 91, 93, 95, 96, 98, 100, 229 organic compounds, 139, 163, 236, 295
nitrogen-fixing bacteria, 91, 97, 103 organic matter, ix, 2, 3, 9, 13, 47, 61, 71, 72, 77, 228,
nitrous oxide, vii, 1, 67, 72, 73, 74 229, 235, 236, 237, 238, 242, 247, 254
N-mineralization, 48 orientation, 4, 54
NMR, 182, 187 ornithine, 139, 141, 144, 145
nodes, 3, 89 oryzalin, 337
nodulation, 92, 94, 102 osmotic, 13, 115, 116, 118, 120, 133, 141, 143, 144,
non-destructive, 65, 69 157, 166, 181, 184, 187
normal, 4, 5, 27, 40, 42, 65, 69, 89, 92, 115, 117, 118, osmotic pressure, 144
124, 141, 147, 152, 154, 158 overproduction, viii, 89, 111, 113, 115, 143, 150,
North America, vii, 2, 3, 4, 6, 56, 57, 63, 221, 234 297, 298
North Carolina, 84 oxalate, 22, 147, 148, 151, 170, 187
Northeast, 79, 83 oxalic acid, 148
Northern China, 233 oxidation, 14, 104, 127, 132, 150
NPT, 140 oxidative, viii, 111, 118, 120, 126, 127, 129, 131,
N-terminal, 133, 169, 187 143, 147, 148, 149, 150, 151, 157, 165, 168, 170,
nuclear, 119, 122, 214, 293, 336, 342, 343 171, 181, 183, 187, 292, 293, 296, 299, 300, 302,
nuclei, 336, 337 303
nucleic acid, 13, 115, 144, 148, 163, 229 oxidative damage, viii, 111, 131, 143, 147, 148, 151,
nucleotides, 198 165, 171, 187, 292, 293, 299
nucleus, 112, 155, 157, 336 oxidative stress, 118, 120, 126, 127, 129, 149, 150,
nutrient cycling, 61, 88, 238 151, 157, 165, 168, 170, 181, 183, 187, 296, 300,
nutrition, 4, 6, 12, 33, 34, 45, 69, 84, 89, 177, 187, 302
189, 244 oxide, vii, 1, 21, 22, 41, 58, 67, 72, 73, 74, 77, 83,
292
oxygen, viii, x, 13, 14, 59, 105, 111, 128, 131, 132,
O 133, 134, 135, 136, 165, 171, 175, 177, 181, 187,
229, 291, 296, 297, 302, 303, 304
oat, 8, 46, 147
Oxygen, 13, 167, 168, 187
observations, 17, 29, 215, 312, 313, 335, 337, 342,
ozone, 129, 130, 131, 134, 155, 164, 167, 169, 171,
351
173, 174, 177, 187, 229
oceans, 229
Ozone, 129, 130
ODS, 259, 260
Ohio, 66
oil, 23, 43, 47, 57, 59, 99, 258, 259, 263, 265, 266, P
276, 277, 278, 282, 283, 287, 288, 310, 316
Oklahoma, 84 Pacific, 66, 73, 74, 76, 79, 81, 191, 250
oligomer, 117 PAHs, v, x, 257, 258, 259, 260, 261, 262, 263, 264,
oligomeric, 297 265, 266, 267, 268, 269, 270, 271, 273, 274, 276,
oligomers, 143 277, 278, 279, 280, 281, 282, 283, 284, 285, 286,
olive, 303 287, 288, 289
online, 67, 72, 77, 79, 80, 81, 84 pain, 324
on-line, 304 Pakistan, 42, 77, 105, 180, 187, 250
opposition, 326 PAN, xi, 307, 309
optical, 30, 64, 78, 252 Pap, 316
organ, 115, 117, 127, 182, 187, 296 Papain, 178, 187
organelles, 114, 148, 162 Papua New Guinea, 247
 Index 369

paradox, 108 Philippines, 100, 185, 187, 246

parameter, 310 philosophers, 321
parents, 213, 218, 334, 335 philosophical, 322
parthenogenesis, 339 phonological, 309
particles, 26, 40, 86 phosphatases, 107, 112, 128, 175, 180, 187
partition, 17, 173, 187, 311 phosphate, 15, 21, 22, 39, 89, 91, 94, 99, 102, 105,
Pasco, 317 117, 126, 128, 144, 169, 176, 180, 187, 252
pasta, 5 Phosphate, 21, 60, 67, 89, 100, 105, 107
pasture, 251 phosphates, 54, 60, 89, 93, 98, 99, 105
patents, 325, 326, 327 phosphoenolpyruvate, 297
pathogens, viii, x, 85, 87, 88, 89, 91, 92, 97, 100, 105, phospholipids, 144, 179, 187
109, 228, 236 phosphorous, 68
pathways, 56, 59, 89, 112, 113, 120, 130, 133, 137, phosphorus, 13, 65, 66, 69, 70, 71, 72, 73, 74, 76, 77,
138, 140, 145, 156, 160, 162, 163, 230, 301, 303, 78, 79, 82, 83, 84, 87, 89, 102, 105, 128, 173, 176,
336, 338 177, 187, 235, 237, 248
Pb, viii, 111, 127, 151, 153, 251 phosphorylation, 112, 120, 121, 130, 144, 185, 187,
PCF, 269, 273 297, 303
PCR, 123, 129, 134, 194, 198, 231 Phosphorylation, 177, 187
PCS, 153 photochemical, 119, 146, 172, 187
PDC, 132 photon, 122
peak demand, 52 photoperiod, 6
peat, 16 photosynthesis, x, 12, 13, 14, 40, 112, 115, 119, 121,
peer, 3 124, 129, 130, 131, 134, 143, 146, 163, 164, 166,
penalty, 154, 159 168, 170, 172, 177, 182, 183, 185, 187, 291, 292,
Pennsylvania, 79 296, 298, 300, 301, 302, 303, 304, 349
peptidase, 128, 168, 187 photosynthetic, 28, 31, 36, 75, 76, 116, 119, 121, 125,
peptides, 129, 153, 170, 173, 187 128, 135, 151, 164, 166, 168, 171, 183, 187, 294,
perception, 114, 116, 130, 137 298, 302
perceptions, 70 Photosystem, 125
percolation, 59, 309 phototrophic, 252
periodic, 44, 59 phylogenetic, 156, 189, 222
Peripheral, 261, 289 physical properties, 45, 66
permeability, 14, 164, 187 physiological, vii, viii, x, xii, 1, 2, 5, 32, 71, 74, 75,
permit, 200 80, 89, 92, 97, 101, 112, 113, 115, 116, 118, 124,
peroxide, 129 128, 137, 144, 145, 146, 154, 155, 158, 160, 162,
peroxisomes, 112, 148, 182, 187 163, 169, 178, 187, 230, 231, 243, 291, 292, 311,
Persistent Organic Pollutants (POPs), 287 312, 333, 334, 335, 345, 346, 347, 348
personal communication, 190, 199 physiological factors, 124, 335
perturbations, 127 physiologists, 36
Peru, 189, 219 physiology, 70, 89, 113, 137, 167, 187, 301
perylene, 262 phytotoxicity, 54
pesticides, 26, 235, 328 pigments, 164, 187, 299
pests, vii, 1, 28, 231 pigs, 47
petrochemical, 287 piracy, xi, 319
Petrology, 288 Pisum sativum, 46, 151
PGPR, viii, 85, 86, 87, 88, 89, 92, 93, 96, 100, 103, pith, 5
232 plant growth promoting rhizobacteria (PGPR), viii,
pH, 15, 16, 38, 39, 41, 42, 44, 49, 51, 54, 72, 91, 133, 85, 87, 90, 92, 94, 101
144, 237 plasma, 114, 120, 124, 127, 129, 146, 169, 179, 185,
phenolic, 131 187, 293, 302, 304
phenolic compounds, 131 plasma membrane, 114, 120, 124, 127, 129, 146, 169,
phenotypes, 4, 5, 120, 160, 326 179, 185, 187, 293, 302, 304
phenotypic, 159, 160, 326 plasmolysis, 119
370 Index

plasticity, 339 potassium, 13, 66, 71, 76, 89, 155, 189, 235, 237,
play, 30, 45, 61, 86, 89, 90, 93, 112, 123, 127, 133, 238, 293
144, 147, 150, 152, 153, 154, 157, 158, 185, 187, potassium channels, 293
218 potato, 87, 91, 94, 95, 97, 99, 101, 104, 107, 342
pleasure, 322, 324 Potchefstroom, 313, 315, 317
ploidy, xii, 333, 337, 338 poultry, 47, 60, 73
ploughing, 9 power, xi, 61, 64, 149, 297, 319, 320, 327, 328
PMA, 167, 187 PPD, vii, 1, 2, 11, 12, 36, 37, 51
polarization, 336 precipitation, 8, 25, 42, 44, 55, 57, 59, 153, 240, 308,
policy makers, 315 309, 310, 315, 346, 347, 348
pollen, 3, 70, 80, 115, 117, 121, 122, 124, 134, 170, prediction, 56, 57, 75, 81, 312, 313
181, 187, 212, 213, 335, 336, 340, 341, 342 pre-existing, 152
pollination, 3, 14, 78, 185, 187, 212, 334, 339 preference, 202
pollutants, viii, x, 111, 112, 113, 114, 129, 148, 155, pressure, 10, 89, 144, 212, 250, 309
163, 164, 187, 236, 257, 258, 263, 270, 289 Pretoria, 316, 317
pollution, x, 25, 130, 242, 258, 262, 264, 268, 273, prices, 44, 201, 215
276, 277, 282, 285, 286, 287 priming, 244
polyacrylamide, 126, 131 private, 328, 330
polyamine, 123, 144, 145, 146, 147, 166, 172, 178, probability, 60, 89, 210, 211, 212, 315
179, 187 probe, 300, 310, 315
polycyclic aromatic hydrocarbon, x, 257, 258, 286, producers, 36, 38, 51, 55, 56, 60, 63, 68, 188, 189,
287, 288, 289 198, 215, 218
polyethylene, 143, 184, 187 production costs, 121
polymerase, 198, 224 productivity, viii, ix, xii, 43, 44, 55, 62, 68, 73, 81,
polymerase chain reaction, 198, 224 83, 89, 101, 105, 109, 111, 113, 114, 115, 118,
polymers, 143 121, 134, 143, 161, 163, 188, 227, 228, 236, 237,
polymorphism, 117, 198, 222 239, 240, 244, 250, 251, 252, 308, 315, 345, 347,
polymorphisms, 203 350, 351
polypeptide, 122, 147 profit, 55, 327, 328, 330
polypeptides, 122, 154 profitability, 55
polyphenols, 240 profits, 57, 61, 323, 326, 327, 329
polyvinyl chloride, 259 progenitors, 136
pools, ix, 39, 187, 189, 193, 197, 209, 216, 218 progeny, 160, 161, 334, 335, 341
poor, xi, 30, 49, 51, 55, 89, 92, 115, 118, 121, 131, program, 160, 195, 196, 197, 198, 223
163, 189, 230, 236, 248, 252, 266, 268, 319, 327, prokaryotic, 154
329 promoter, 92, 117, 123, 141, 142, 147, 157, 158, 161,
POPs, 258 162, 170, 184, 187
population, vii, viii, ix, 1, 2, 9, 11, 51, 65, 66, 80, 81, promoter region, 117, 162
86, 89, 92, 95, 108, 111, 112, 137, 159, 174, 182, property, 270
187, 191, 194, 195, 196, 197, 200, 203, 204, 205, proposition, 157
206, 207, 208, 210, 211, 213, 222, 223, 224, 225, protection, 46, 63, 88, 93, 103, 120, 141, 143, 147,
228, 235, 236, 304 151, 165, 180, 187, 302
population density, vii, 1, 2, 11, 89, 200 protective mechanisms, 298, 300
population growth, ix, 159, 187 protective role, 154, 174, 180, 187
population size, 204, 225 protein, 14, 20, 40, 49, 89, 112, 116, 117, 118, 120,
pores, 129 121, 122, 123, 125, 126, 127, 128, 129, 130, 131,
porosity, 107, 236 132, 133, 134, 135, 139, 140, 142, 144, 152, 153,
positive correlation, 25, 89, 124, 136, 146, 203, 216, 154, 155, 156, 158, 162, 164, 168, 169, 170, 171,
268, 269, 270, 273 175, 176, 177, 179, 180, 182, 184, 185, 187, 189,
positive relation, 32 295, 296, 297, 303, 304
positive relationship, 32 protein folding, 120, 152
post-translational, 120, 126, 156 protein function, 156
Potash, 67 protein kinase C, 155
 Index 371

protein kinases, 112, 116, 123, 155

protein oxidation, 127
R
protein structure, 139
radiation, 2, 11, 12, 28, 29, 62, 74, 113, 134, 135,
protein synthesis, 14, 40, 122, 126, 170, 187
136, 158, 164, 165, 167, 168, 169, 171, 174, 176,
proteinase, 122, 131
181, 182, 187, 309, 311, 316, 317, 346, 348
proteins, viii, 13, 14, 31, 41, 89, 108, 111, 112, 113,
Radiation, 83, 134, 171, 174, 187
115, 116, 118, 120, 121, 122, 123, 124, 125, 126,
rain, 27, 51, 214, 215, 242
128, 129, 130, 131, 133, 135, 137, 138, 139, 140,
rainfall, 15, 16, 43, 44, 57, 59, 60, 61, 65, 82, 193,
142, 148, 149, 150, 152, 154, 155, 156, 158, 160,
218, 230, 247, 308, 309, 310
162, 163, 164, 166, 167, 168, 170, 173, 174, 175,
rainwater, 229
176, 177, 179, 180, 182, 183, 184, 185, 187, 229,
random, 114, 159, 182, 187, 196
240, 293, 341
randomness, 218
proteobacteria, 252
range, viii, 11, 28, 29, 44, 60, 62, 70, 87, 89, 91, 92,
Proteobacteria, 95
97, 112, 115, 126, 128, 137, 143, 190, 232, 237,
proteolysis, 119, 139, 141
239, 281, 285, 308, 310, 316, 334, 348
proteolytic enzyme, 180, 187
RAPD, 190, 221, 222, 231
proteome, 120, 123, 126, 129, 162, 176, 178, 187
rat, 199
proteomics, viii, 93, 112, 130, 160, 162, 163, 167,
rats, 199
187
reaction center, 121, 122, 135, 169, 176, 187, 297,
protocols, 161
302
protoplasts, 125, 151
reactive oxygen, viii, xi, 111, 112, 141, 148, 149,
protozoa, 236
185, 187, 291, 292, 296, 297, 298
pruning, 248
reactive oxygen species, viii, xi, 111, 112, 141, 148,
pseudo, 91
149, 185, 187, 291, 292, 296, 297, 298
Pseudomonas, 87, 88, 89, 90, 91, 93, 95, 97, 98, 99,
reactive oxygen species (ROS), viii, xi, 111, 112,
100, 101, 102, 103, 104, 105, 106, 107, 108, 109,
291, 298
231, 246
reading, 28
Pseudomonas spp, 104, 105, 106, 107
real time, 231
PSI, 122, 125, 297, 298
reality, 30
PSS, 84
receptors, 120
public sector, 330
recognition, 93, 230
pulse, 234
recombination, 213
pumping, 129
recovery, 32, 53, 57, 63, 72, 81, 119, 142, 147, 152,
pumps, 120
188, 200, 213, 244, 248, 260, 300, 303, 304, 338
pure line, 334
recycling, ix, 50, 227, 235, 236
purification, 179, 187, 260
redistribution, 57, 59, 230, 310
putrescine, 144, 145, 146, 147
redox, 121, 126, 143, 150, 151
pyrene, x, 257, 262, 264, 281, 286, 288, 289
reducing sugars, 127
pyrimidine, 136, 182, 187
reflection, 28
pyrolysis, 107
refuge, 220
pyruvate, 125, 133, 176, 181, 187, 297, 301
regeneration, xii, 149, 150, 333, 334, 337, 338, 339,
340, 341
Q regional, xii, 345, 348
regression, 268, 317
Quantitative trait loci, 304 regulations, 254
quantum, 122, 135, 297 regulators, viii, 89, 93, 94, 112, 156, 169, 187, 254
quaternary ammonium, 139 reinforcement, 218
Quebec, 5 relationship, 6, 23, 30, 32, 34, 45, 55, 61, 72, 119,
quinone, 102, 135 129, 144, 217, 246, 254, 268, 269, 270, 273, 276,
302, 320, 321, 325, 329, 330
relationships, 26, 70, 82, 86, 89, 189, 195, 238, 239,
243, 328
relatives, ix, 136, 160, 187, 188, 191, 208
372 Index

relevance, 34, 193, 240, 303 RNA, 121, 122, 128, 133, 146, 153, 156, 158, 166,
reliability, 27, 89 178, 180, 187
Reliability, 308 RNA processing, 121
remediation, 258 RNAi, 153
remote sensing, 28, 29, 55, 59, 64, 70 rocky, 191
renewable resource, 242 rods, 105
repair, 129, 136, 152, 165, 181, 187 rolling, 116
reproduction, 13, 118, 326 Rome, 69, 73, 219, 220, 222, 326
reserves, 185, 187 room temperature, 259
reservoir, 229 ROS, viii, xi, 111, 112, 123, 126, 127, 131, 136, 148,
reservoirs, 188 149, 151, 152, 177, 187, 291, 297, 298
residues, ix, 9, 18, 23, 37, 41, 42, 47, 55, 61, 62, 158, rotations, 8, 45, 52, 72, 73, 83
227, 230, 234, 238, 239, 240, 241, 242, 247, 249, Royal Society, 81
253, 255, 281 RP, 304
resistance, 14, 40, 87, 89, 93, 100, 101, 102, 107, runoff, 10, 43, 46, 50, 53, 54, 57, 58, 60, 61, 62, 65,
108, 116, 119, 136, 148, 151, 153, 154, 159, 165, 70, 71, 82, 238, 308
169, 170, 175, 177, 178, 183, 184, 185, 187, 191, rural, 189, 191, 216, 236, 277, 278, 282, 288
218, 231, 236, 304 rural population, 189, 191, 216
resource management, 253 Rwanda, 247
resources, x, 11, 44, 48, 55, 134, 162, 189, 220, 222, rye, 46, 235, 316
223, 228, 236, 238, 242, 325, 338 rye grass, 316
respiration, x, 13, 14, 26, 34, 115, 117, 124, 131, 133,
163, 170, 173, 177, 179, 187, 291, 292, 295, 296,
300, 303, 304 S
respiratory, 131, 132, 176, 177, 187, 229, 301, 303,
saline, 118, 119, 145, 156
304
salinity, viii, 40, 42, 89, 111, 112, 113, 114, 118, 119,
respiratory rate, 177, 187
120, 139, 141, 142, 145, 146, 147, 148, 151, 152,
retardation, 124
154, 155, 156, 157, 158, 159, 162, 163, 165, 166,
retention, 9, 38, 250, 260
167, 168, 169, 171, 172, 173, 175, 177, 178, 179,
reticulum, 114, 119, 124
180, 182, 185, 186, 187, 310, 317
returns, 51, 55
salinization, 145
reverse transcriptase, 134
salt, 50,118, 119, 120, 123, 139, 141, 142, 143, 144,
Reynolds, 71, 335, 342
145, 146, 150, 151, 152, 154, 155, 156, 157, 158,
RFLP, 222, 340
159, 162, 168, 169, 171, 173, 174, 175, 176, 177,
rhizobia, 87, 89, 102, 249
178, 179, 182, 183, 184, 185, 186, 187
Rhizobium, 88, 89, 90, 94, 96, 99, 101, 103, 109, 232,
sample, 26, 27, 28, 195, 197, 198, 259, 265, 268
246
sampling, 24, 25, 26, 27, 48, 55, 56, 70, 132, 214,
Rhizoctonia solani, 97, 108
259, 267, 278, 281, 283, 285
rhizome, 92
sand, 61
rhizosphere, viii, 85, 86, 87, 88, 89, 90, 91, 92, 94,
saprophyte, 232
95, 96, 97, 98, 100, 101, 102, 104, 105, 106, 107,
SAS, 195, 224
230
saturation, 30, 61
rhythm, viii, 111, 124
savannah, 253
ribosomal, 122, 166, 187, 231
savings, 228
ribosomes, 119, 124, 166, 187
scaling, 346, 348
rice genes, 178, 187
scattering, 28
rings, x, 257, 258, 264, 265, 266, 268, 269, 273, 278,
scheduling, 308, 316
279, 283, 285, 286, 287
Schmid, 342
risk, ix, x, 25, 27, 37, 57, 59, 60, 61, 68, 188, 189,
scholarship, 218
191, 193, 214, 215, 217, 236, 258, 276, 278, 285,
scientific community, 325
287
sea level, 2
risk assessment, x, 258, 278, 287
search, viii, 85, 143, 160, 162
risks, 161
second generation, 154
 Index 373

security, viii, x, 45, 112, 115, 177, 187, 258, 291, 326 signaling pathways, 124, 160
sediments, 61, 288, 289 signalling, 156, 163, 165, 187, 303, 304
seeding, vii, 1, 39 signals, 64, 89, 93, 112, 114, 116, 121, 155, 161, 181,
seedlings, viii, x, 26, 89, 90, 92, 96, 99, 100, 102, 187, 294, 300, 338
103, 104, 107, 112, 117, 118, 119, 122, 123, 124, silica, 260
125, 127, 129, 130, 132, 133, 136, 139, 141, 142, silk, 3
143, 145, 146, 149, 150, 151, 152, 153, 156, 158, similarity, 199
164, 167, 168, 169, 170, 171, 172, 173, 174, 175, simulation, xi, 307, 308, 309, 310, 312, 313, 316,
176, 178, 179, 180, 181, 182, 183, 184, 187, 291, 317, 318, 345, 351
292, 301, 302, 303 simulations, 309, 311, 312, 315, 316
selecting, 38, 196 SiO2, 21
Self, 322 sites, 25, 39, 41, 70, 73, 87, 89, 127, 144, 204, 259,
semantic, 87 278, 288, 309
semiarid, 77, 112, 115, 248 249, 251 skills, 24
semi-structured interviews, 194 skin, 129
senescence, 5, 31, 66, 75, 78, 82, 117 slag, 21
sensing, 28, 29, 30, 53, 55, 59, 64, 66, 67, 70, 78, Slovenia, 349, 351
143, 252 sludge, x, 18, 228, 235, 236, 237, 242, 245, 248, 252,
sensitivity, xi, 116, 117, 120, 121, 123, 125, 129, 135, 254, 257, 258, 259, 262, 263, 264, 265, 266, 267,
136, 145, 148, 165, 171, 174, 181, 183, 187, 203, 276, 277, 278, 281, 282, 283, 286, 287
291, 292, 293, 297, 299, 300, 303, 311, 348, 350 SO2, 129, 130
sensors, 30, 121 SOC, 2, 10
separation, 170, 187, 259 social change, 188
septum, 124 SOD, 119, 120, 128, 131, 134, 136, 138, 148, 150,
sequencing, 131, 133, 160 151, 181, 187, 299
series, xii, 345, 346, 347, 348, 349, 350, 351 sodium, 22, 118, 119, 155, 157, 165, 168, 173, 179,
serine, 155, 156, 173, 187 187, 260
services, 330 software, 194, 197, 224, 316
severe stress, 12, 163 soil analysis, 73
severity, 45 soil erosion, 42, 43, 50, 60, 62, 308
sewage, x, 228, 235, 236, 237, 242, 252, 254, 287 soil particles, 26, 86
shade, 259 soil seed bank, 217
Shanghai, 259 soils, viii, ix, x, 10, 15, 16, 23, 25, 31, 37, 38, 39, 40,
shape, 199, 201, 294, 336, 348 41, 42, 43, 47, 48, 53, 54, 56, 57, 58, 60, 61, 62,
shares, 154 63, 67, 71, 72, 74, 80, 83, 89, 90, 95, 98, 105, 106,
shear, 87 108, 109, 111, 118, 131, 156, 173, 187, 191, 201,
Sheep, 19 217, 227, 229, 230, 236, 237, 238, 249, 252, 257,
shelter, 9 262, 264, 269, 270, 273, 276, 277, 278, 281, 282,
shock, 123, 124, 126, 134, 138, 152, 153, 154, 158, 285, 286, 287, 288, 289
163, 167, 175, 177, 180, 182, 183, 184, 187, 303, solar, 11, 28, 134, 166, 187, 242, 309, 311, 316, 317,
335 346, 348
shoot, 12, 23, 26, 34, 42, 69, 89, 90, 91, 92, 116, 117, solar energy, 242
124, 127, 129, 130, 135, 157, 164, 186, 187, 294, solid phase, 266, 268
295, 301, 303 sols, 251
short period, 119 solubility, 118
shortage, 15, 38, 40, 52, 64, 134 somatic cells, xii, 333
Short-term, 62, 119, 178, 185, 187, 250 sorbitol, 140, 144
sign, 16 Sorghum, 69, 80, 107, 330
signal transduction, viii, 112, 116, 117, 120, 121, sorption, 48, 60, 61
129, 137, 155, 156, 162, 186, 187 sorting, 126
signaling, 112, 114, 116, 117, 120, 121, 124, 126, South Africa, xi, 307, 309, 310, 311, 313, 316, 317
130, 133, 155, 157, 158, 160, 162, 167, 187, 248 South America, 2, 137, 190, 219
signaling pathway, 124, 155, 156, 160 South Korea, 277, 278, 282
374 Index

soybean, 7, 8, 29, 45, 46, 49, 50, 60, 65, 68, 73, 75, strategies, viii, x, xi, 2, 34, 43, 55, 56, 62, 77, 79, 112,
83, 92, 94, 96, 106, 109, 169, 176, 185, 187, 233, 114, 120, 134, 136, 147, 159, 161, 163, 228, 239,
234, 235, 246, 250, 251, 252, 253, 301, 302, 349 241, 307
soybean seed, 92, 106 stratification, 40, 41, 54
soybeans, 246, 253, 329 strawberries, 91
Spain, 291 strength, 62
spatial, 3, 24, 25, 52, 55, 79, 112, 137 Streptomyces, 92
specialized cells, 338 stress factors, 159
species, viii, ix, xi, 3, 8, 45, 46, 47, 79, 82, 86, 88, 89, stroma, 150
90, 91, 98, 109, 111, 112, 121, 123, 125, 132, 134, structural characteristics, 287
141, 143, 148, 149, 153, 159, 160, 163, 185, 187, Student t test, 195, 198
188, 189, 190, 191, 193, 194, 200, 206, 214, 217, Subcellular, 157
219, 220, 221, 230, 231, 235, 238, 252, 291, 292, subjective, 23
296, 297, 298, 301, 303, 304, 334, 335, 340 Sub-Saharan Africa, 31
specificity, 97, 156, 167, 187 subsistence, 3, 8, 9, 20, 23, 44, 45, 46, 49, 50, 51,
spectroscopy, 135 202, 213, 322, 328
spectrum, 28, 135, 157 subsistence farming, 3, 8, 20, 23, 44, 45, 46, 49, 50,
speed, 121, 259, 309 51
spermidine, 144, 145, 146, 147 substrates, 13, 86, 89, 128
spermine, 144, 145, 146, 147 sucrose, 117, 119, 122, 126, 127, 132, 142, 143, 144,
spin, 135 179, 187, 342
spinach, 142, 181, 182, 187, 293 Sudan, 176, 187
sponsor, 330, 331 sugar, 4, 5, 14, 24, 91, 93, 102, 103, 104, 108, 116,
Sri Lanka, 108 117, 133, 143, 144, 168, 172, 179, 187, 230, 244,
stability, 46, 69, 78, 126, 161, 236, 250 254
stabilization, 154, 235 sugar beet, 91, 93, 103, 179, 187
stabilize, 133, 139, 152, 322 sugar cane, 104, 108, 230, 254
stages, x, xii, 3, 10, 25, 26, 29, 30, 32, 34, 37, 42, 52, sugars, viii, 4, 5, 89, 111, 127, 132, 139, 168, 176,
53, 62, 64, 72, 114, 124, 135, 144, 152, 171, 177, 183, 187
180, 187, 235, 240, 291, 292, 309, 310, 311, 313, suicide, 326, 327
316, 333, 339, 341 sulfate, 22, 54, 89, 131, 153, 235
standard deviation, 260, 349 sulfur, 121, 155, 178, 187
standard error, 195 sulphate, 20, 21, 22, 41, 78, 108, 260
standards, 260, 287 sulphur, 13, 21, 68, 69, 73, 164, 187, 295
starch, 2, 5, 6, 116, 117, 121, 125, 126, 127, 172, 176, summer, x, 48, 257, 269, 273, 282, 283, 284, 285,
181, 187, 336 286, 287, 309, 310
starvation, 133, 335 Sun, 46, 164, 166, 183, 184, 187, 245, 289, 303, 341
statistical analysis, 351 superimposition, 115
statistics, 190, 224, 312 supernatant, 260
STD, 349 superoxide, 118, 119, 149, 165, 180, 187, 299
steel, 287 superoxide dismutase, 119, 299
steel mill, 287 supplemental, 82, 135, 168, 187
sterilization, 235 supplements, 18, 39, 47
stigma, 212 suppliers, 322, 327
stimulus, 335 supply, x, 5, 11, 12, 14, 15, 17, 24, 26, 32, 33, 34, 35,
stochastic, xii, 345, 346, 348, 350 36, 37, 38, 41, 44, 47, 51, 53, 55, 57, 63, 66, 81,
Stochastic, 222 89, 131, 159, 228, 237, 238, 239, 241, 301, 328,
stock, 20, 58, 62, 194 338
storage, 13, 47, 49, 58, 62, 64, 125, 130, 135, 139, suppression, 46, 89, 92, 95, 103, 104, 122, 128, 135,
140, 171, 187, 230, 309, 338 141, 156, 157, 232, 236
strains, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 102, surface area, 90
104, 105, 106, 107, 108, 249 surface water, 32, 37, 49, 60, 229, 288
survival rate, 153, 158
 Index 375

susceptibility, 78, 172, 187, 303 threatening, 126

sustainability, vii, viii, 1, 63, 81, 86, 98, 112, 177, threonine, 155, 156
187, 228, 229, 254 threshold, 118, 119, 308
swelling, 118 threshold level, 308
switching, 326 thresholds, 163
Switzerland, 319 time, 347, 348
symbiosis, 87, 247, 301 time consuming, 27, 333, 339
symbiotic, 45, 87, 89, 230, 244, 248 time series, 347, 348
symbols, 314 timing, vii, 1, 9, 32, 34, 37, 38, 43, 44, 52, 54, 55, 60,
symptom, 15, 16, 24, 121 63, 65, 70, 71, 79, 81, 82, 317
symptoms, 15, 16, 24, 26, 40, 41, 42, 68, 118, 129, TIP, 303
293 tissue, vii, xii, 1, 13, 14, 16, 17, 26, 29, 30, 33, 34, 40,
synchronization, x, 228, 239, 241 41, 42, 43, 53, 68, 69, 72, 87, 89, 91, 103, 106,
synergistic, 43, 93 107, 112, 117, 123, 124, 132, 143, 168, 187, 220,
synthesis, viii, 13, 14, 40, 87, 89, 90, 111, 113, 115, 232, 333, 334, 341
116, 117, 118, 122, 125, 126, 127, 128, 129, 130, tobacco, 109, 170, 181, 185, 187, 304, 337, 339, 343
132, 133, 135, 141, 147, 148, 149, 150, 152, 163, tocopherols, 131
168, 170, 181, 187, 342 Togo, 248
systematics, 220 tolerance, viii, xi, 12, 14, 40, 76, 80, 82, 104, 112,
systems, 349 113, 114, 115, 118, 119, 120, 121, 123, 129, 131,
132, 133, 137, 138, 139, 140, 141, 142, 143, 144,
145, 146, 147, 148, 151, 152, 153, 154, 155, 156,
T 157, 158, 159, 160, 161, 163, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, 175, 176, 177, 178,
Taiwan, 288
179, 180, 181, 182, 183, 184, 185, 186, 187, 291,
Taiwan Strait, 288
292, 293, 294, 295, 296, 297, 299, 300, 301, 302,
tandem mass spectrometry, 120
304, 340
targets, 137, 329
tomato, 91, 93, 100, 103, 107, 158, 175, 187, 188,
taste, 201, 213
301
taxonomic, 189, 219
topology, 196, 206, 208
taxonomy, 219
total product, 189
Taylor expansion, 198
totipotent, 339
technical assistance, 316
toxic, 42, 127, 147, 165, 175, 181, 187, 236, 278
technology transfer, 63
toxic effect, 147
Tel Aviv, 198
toxic metals, 165, 187
temperature, viii, xi, 6, 7, 9, 37, 39, 47, 50, 52, 69, 80,
toxicities, 26, 27, 52, 54, 153
89, 95, 111, 112, 121, 122, 123, 124, 125, 126,
toxicity, viii, 42, 57, 111, 113, 127, 128, 139, 141,
137, 138, 142, 143, 150, 151, 152, 154, 155, 157,
147, 148, 151, 164, 171, 172, 175, 176, 180, 183,
159, 162, 163, 164, 167, 171, 172, 175, 178, 182,
187, 229, 244, 258, 278
183, 184, 185, 187, 195, 234, 259, 260, 286, 291,
toxicological, 288
296, 300, 301, 302, 303, 304, 308, 309, 311, 315,
trace elements, 240
316, 341, 342, 346, 348, 349, 350
tracers, 104
temporal, 24, 52, 76, 94, 112, 129, 137
trading, 330
tension, 116
tradition, 326
test procedure, 303
traditional practices, 46
tetrad, 121
training, 222
Texas, 351
traits, 45, 71, 89, 93, 145, 159, 160, 161, 163, 174,
Thailand, 8, 170, 187, 277, 278, 282
185, 187, 213, 221, 300, 302, 303
thermal energy, 301
transactions, 320, 325
thermal index, 69
transcript, 117, 122, 155, 158, 162
thermoluminescence, 171, 187
transcriptase, 134
Third World, 220
threat, 44, 115, 134
threatened, 112
376 Index

transcription, viii, 111, 117, 120, 121, 123, 124, 133, turgor, 115, 118, 119, 121
135, 155, 157, 158, 159, 168, 171, 172, 179, 184, Turkey, 74
187 turnover, 295
transcription factor, viii, 111, 123, 157, 158, 159, two-dimensional, 120, 126, 128, 129, 130, 131, 170,
168, 171, 172, 184, 187 177, 187
transcription factors, viii, 111, 123, 157, 158, 172, two-way, 93, 190
184, 187 tyrosine, 135
transcriptional, 117, 123, 126, 144, 152, 157, 162,
178, 187
transcriptomics, 130, 167, 187 U
transcripts, 117, 131, 133, 135, 150
ubiquitin, 123, 142
transduction, viii, 93, 112, 114, 116, 117, 120, 137,
Uganda, 70
157, 162
ultrastructure, 116, 119, 121, 184, 187, 302
transfer, 13, 14, 44, 63, 77, 122, 160, 161, 266, 268,
ultraviolet, 165, 168, 171, 176, 183, 185, 187
334, 338
Ultraviolet, 134, 167, 182, 187
transference, 212, 218
ultraviolet B, 183, 187
transformation, 47, 138, 142, 147, 157, 161, 173, 187,
uncertainty, 11
258, 273, 339, 340, 342, 346
unfolded, 10
transformations, 191
uniform, 55, 56, 64, 83, 84, 121, 239
transgene, 142, 147, 159, 161, 173, 179, 187, 339
United Kingdom, 98
transgenic, viii, 35, 112, 114, 123, 139, 141, 142,
United Nations, 118, 287, 326
143, 144, 147, 148, 151, 152, 153, 154, 155, 156,
United Nations Environment Program, 118, 287
157, 158, 160, 161, 162, 165, 166, 167, 170, 172,
United States, 68, 189, 234, 236, 244, 254, 331
173, 175, 177, 179, 180, 181, 182, 183, 184, 187,
urban areas, 203
191, 326, 334
urea, 20, 38, 48, 54, 89
Transgenic, 137, 139, 141, 142, 144, 147, 151, 153,
uric acid, 47
154, 157, 165, 182, 185, 187, 224, 330
USAID, 68
transgenic plants, 139, 141, 142, 144, 147, 148, 151,
USDA, 189
153, 156, 157, 160, 161, 165, 180, 187, 326
USEPA, 236
transglutaminase, 146
UV-radiation, 136, 164, 187
transition, 4, 144, 176, 187
translation, 120, 121, 124, 152, 166, 167, 179, 187
translational, 112, 162 V
translocation, 14, 26, 40, 66, 152, 176, 187, 295
transmembrane, 155 vacuole, 129, 153
transmission, 161, 335 vacuum, 260
transpiration, 23, 34, 76, 116, 119, 120, 121, 127, validation, xi, 70, 254, 307, 308, 309, 311, 312, 313,
156, 309, 311, 349 315, 316, 318, 348
transplant, 92, 101, 104 validity, 309, 315
transport, x, 57, 60, 89, 117, 119, 121, 129, 148, 156, values, ix, 6, 17, 23, 27, 28, 30, 45, 48, 83, 116, 143,
169, 181, 187, 206, 291, 293, 296, 298, 302, 308 187, 190, 195, 198, 201, 203, 204, 205, 206, 207,
transportation, 13, 61, 206 208, 209, 212, 213, 214, 215, 217, 281, 285, 292,
transposon, 184, 187 293, 295, 310, 312, 314, 315, 346, 347, 348, 349
travel, 94 vanadium, 146
treatment methods, 287 variability, 24, 25, 36, 39, 44, 52, 55, 56, 68, 75, 79,
trees, 45, 105, 129, 222, 247, 248, 250, 251, 303 216, 241, 242, 350
trial, 309, 311 variables, 238, 347
tricarboxylic acid, 132 variance, 190, 195
tricarboxylic acid cycle, 132 variation, xi, 35, 38, 55, 56, 59, 66, 76, 83, 89, 131,
Trichoderma viride, 90 160, 165, 168, 169, 187, 188, 189, 190, 200, 201,
trifolii, 88, 89, 90, 109 203, 206, 208, 209, 216, 220, 223, 233, 281, 285,
triggers, 130 310, 314, 319, 321, 336, 337, 341
troubleshooting, 26 vascular bundle, 155, 179, 187
 Index 377

vector, 161, 165, 187 151, 154, 164, 177, 178, 187, 224, 228, 230, 232,
vegetables, 25, 89, 104, 288 235, 247, 293, 302, 317, 329, 336, 337, 340, 341,
vegetation, 2, 28, 29, 65, 70, 74, 81, 188, 191, 192, 345, 346, 349, 350
213, 236, 347, 349 wild type, 141, 147, 151, 154
vehicles, 61 wilderness, 108
velocity, 34 wildlife, 126
velvet, 8, 45, 46, 250, 252 wind, 60, 61, 64, 309
Vermont, 73 windows, 223
Verticillium wilt, 107 winter, x, 46, 47, 48, 59, 74, 97, 235, 247, 257, 276,
Vicia faba, 104, 233, 245 277, 278, 279, 280, 281, 282, 283, 285, 286, 287,
viral diseases, 92, 93 293, 302, 317, 346, 349, 350
virus, 92, 100, 103 Wisconsin, 53, 69, 80
viruses, 236 women, 213
visible, 28, 74, 121, 129, 132, 135, 136, 336 workers, 55, 119, 147, 162, 287, 320, 322
volatilization, vii, 1, 37, 38, 47, 49, 54, 56, 241, 286 World Bank, 316
vouchers, 194 worms, 178, 187
VRA, 2, 55, 56
vulnerability, 325, 349, 350
X

W Xenopus oocytes, 303

wages, 322
warrants, 229 Y
wastes, 47
yeast, 143, 151, 157, 181, 187
wastewater, 242, 254
yield loss, 27, 34, 53, 57
water absorption, 121
young adults, 216
water quality, 47, 57
water resources, 236
water table, 308, 310 Z
water-holding capacity, 238
water-soluble, 143 Zea mays, vii, xi, 1, 2, 4, 72, 77, 80, 83, 90, 96, 99,
wavelengths, 28, 29 104, 107, 188, 228, 244, 245, 251, 292, 300, 301,
web, 197 302, 303, 304, 307, 309, 340, 341, 342
weedy, 188, 191, 194, 196, 197, 199, 200, 203, 205, Zimbabwe, 49, 244, 248, 250, 255
206, 207, 208, 209, 210, 211, 213, 215, 216, 217, zinc, 13, 65, 69, 72, 76, 77, 78, 81, 158, 189, 235,
218, 223, 224 252
Weinberg, 197, 198, 205, 208 Zinc, 14, 15, 16, 20, 22, 23, 27, 42
West Africa, 244, 253 ZnO, 22, 127
western blot, 152
wheat, 8, 12, 29, 46, 65, 67, 69, 70, 71, 80, 89, 94, 95,
97, 98, 101, 102, 103, 105, 106, 107, 108, 144,