Advances in Genetics Research Vol 17

Complimentary Contributor Copy

ADVANCES IN GENETICS RESEARCH
ADVANCES IN
GENETICS RESEARCH
VOLUME 17
No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or
by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no
expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of information
contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in
rendering legal, medical or any other professional services.
Additional books in this series can be found on Nova’s website

under the Series tab.
Additional e-books in this series can be found on Nova’s website

under the eBooks tab.

ADVANCES IN
GENETICS RESEARCH
VOLUME 17
KEVIN V. URBANO
EDITOR

Copyright © 2017 by Nova Science Publishers, Inc.
All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted
in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying,
recording or otherwise without the written permission of the Publisher.
We have partnered with Copyright Clearance Center to make it easy for you to obtain permissions to
reuse content from this publication. Simply navigate to this publication’s page on Nova’s website and
locate the “Get Permission” button below the title description. This button is linked directly to the
title’s permission page on copyright.com. Alternatively, you can visit copyright.com and search by
title, ISBN, or ISSN.
For further questions about using the service on copyright.com, please contact:
Copyright Clearance Center
Phone: +1-(978) 750-8400 Fax: +1-(978) 750-4470 E-mail: info@copyright.com.
NOTICE TO THE READER

The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or
implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is
assumed for incidental or consequential damages in connection with or arising out of information
contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary
damages resulting, in whole or in part, from the readers’ use of, or reliance upon, this material. Any
parts of this book based on government reports are so indicated and copyright is claimed for those parts
to the extent applicable to compilations of such works.
Independent verification should be sought for any data, advice or recommendations contained in this
book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to
persons or property arising from any methods, products, instructions, ideas or otherwise contained in
this publication.
This publication is designed to provide accurate and authoritative information with regard to the subject
matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in
rendering legal or any other professional services. If legal or any other expert assistance is required, the
services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS
JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A
COMMITTEE OF PUBLISHERS.
Additional color graphics may be available in the e-book version of this book.
Library of Congress Cataloging-in-Publication Data
ISSN: 2159-1563
ISBN:H%RRN
Published by Nova Science Publishers, Inc. † New York

CONTENTS
Preface vii
Chapter 1 Genetics and Evolution of Entomopathogenic Fungi 1
A. Garcia, M. Michel, S. Villarreal, F. Castillo,
E. Osorio, M. T. García-Ruiz, F. Veana,
A. C. Flores and R. Rodríguez
Chapter 2 Mitochondrial Population Genetics Inferences About
the Phylogeography and Systematics of the Tayra (Eira
barbara, Mustelidae, Carnivora) 63
Manuel Ruiz-García, Nicolás Lichilín-Ortíz,
Yolanda Mejia, Juan Manuel Ortega and
Joseph Mark Shostell
Chapter 3 The Precision Medicine and Precision Public Health
Approaches to Cancer Treatment and Prevention:
A Cross-Comparison 107
Stephen M. Modell, Sharon L. R. Kardia
and Toby Citrin
Chapter 4 Neuropsychological Profile of People with
Williams Syndrome (WS) 139
Anne-Sophie Pezzino, Nathalie Marec-Breton
and Agnès Lacroix
Chapter 5 Preimplantation Genetic Diagnosis (PGD) for
Chromosome Rearrangements 169
Chun Kyu Lim

vi Contents
Chapter 6 A Family-Based Association Study Between the BDNF

Gene and Attention Deficit Hyperactivity Disorder in
Mexican Children and Adolescents 197
Alan López-López, Miriam Margot Rivera-Angles,
Carlos Alfonso Tovilla-Zárate,
Roberto Molina-Solís, Araceli Valencia-Hernández,
Luis Gómez-Valencia,
Thelma Beatriz González-Castro,
Isela E Juárez-Rojop, María Lilia López-Narváez,
Ana Fresan and Yazmin Hernández-Díaz
Index 211

PREFACE
A.Garcia, M. Michel, S. Villarreal, F. Castillo, E. Osorio, M.T. García-

Ruiz, F. Veana, A.C. Flores, and R. Rodríguez open the book by presenting an
overview of modern research on the evolution and genetics of
entomopathogenic fungi in Chapter One, including their function in the
environment, relationship with the insect immune system, and their genetic
diversity, among other things. Following this, Manuel Ruiz-García, Nicolás
Lichilín-Ortíz, Yolanda Mejia, Juan Manuel Ortega, and Joseph Mark Shostell
discuss a study in Chapter Two where it was found that the genetic diversity
levels for samples of Eira Barbara were very high. In Chapter Three, Stephen
M. Modell, Sharon L.R. Kardia, and Toby Citrin compare and contrast
methods of cancer treatment for three cancer types: lung, breast, and
colorectal. Anne-Sophie Pezzino, Nathalie Marec-Breton, and Agnès Lacroix
review the current research on the neuropsychological profiles of persons with
Williams syndrome, focusing on the heterogeneity of the observed profiles, in
Chapter Four. In Chapter Five, Chun Kyu Lim presents a study on
chromosome rearrangements and preimplantation genetic diagnosis. In
conclusion, Chapter Six by Alan López-López, Miriam Margot Rivera-Angles,
Carlos Alfonso Tovilla-Zárate, Roberto Molina-Solís, Araceli Valencia-
Hernández, Luis Gómez-Valencia, Thelma Beatriz González-Castro, Isela E
Juárez-Rojop, María Lilia López-Narváez, Ana Fresan, and Yazmin
Hernández-Díaz attempt to determine a family-based link between three
polymorphisms of the brain-derived neurotrophic factor gene and attention
deficit hyperactivity disorder in a Tabascan-Mexican population.
Chapter 1 - Entomopathogenic fungi have been mentioned as one of the
best alternatives for insect pest control. These fungi cause insects death. More
than 750 fungal species have been described infecting insects, some of the

viii Kevin V. Urbano
most utilized for insect control are: Beauveria bassiana and Metarhizium
anisopliae. This is evidence of cosmopolitan distribution of entomopathogenic
fungi and its evolutionary success, this type of fungi is related to a serie of
interactions among fungi, plants, and insects. In this chapter, the main
objective is to review and discuss the most recent information on genetics and
evolution of entomopathogenic fungi. In this chapter are covered the following
themes: Entomopathogens role in nature, Entomopathogenic fungi and their
interactions with the insect immune system, Isolation and identification of
entomopathogenic fungi, Genetic diversity among strains of entomopathogenic
fungus, Genes involved in virulence of entomopathogenic fungi, Molecular
phylogeny of entomopathogenic fungi and their biogeographic implications,
Evolution of entomopathogenicity in fungi, Genetic improvement of
entomopathogenic fungi for insect biocontrol, Future trends and Conclusions.
Chapter 2 – The authors sequenced the mitochondrial (mt) ND5 gene of
100 specimens of Eira barbara (Mustelidae, Carnivora). The samples
represented six out of the seven putative morphological subspecies recognized
for this Mustelidae species (E. b. inserta, E. b. sinuensis, E. b. poliocephala, E.
b. peruana, E. b. madeirensis, and E. b. barbara) throughout Panama,
Colombia, Venezuela, French Guiana, Brazil, Ecuador, Peru, Bolivia,
Paraguay, and Argentina. The main results show that the genetic diversity
levels for the overall samples and within each one of the aforementioned
putative taxa were very high. The phylogenetic analyses showed that the
ancestor of the Central and South-American E. barbara originated during the
Miocene or Pliocene (6.3-4 millions of years ago, MYA). Furthermore, the
ancestors of some geographical groups, (the authors detected at least four)
originated during the Pliocene (3.7-2.5 MYA). These four groups (or lineages)
were placed in the Cesar-Antioquia Departments (northern Colombia), Bolivia
and northwestern Argentina, northern-central Peru, and in the trans-Andean
area of Ecuador. However, during the Pleistocene, this species experienced a
strong population expansion and many haplotypes expanded their geographical
distributions. They became superimposed on the geographical areas of older
geographical groups that originally differentiated during the Pliocene. Until
new molecular studies are completed, including those with nuclear markers,
the authors proposed the existence of only two subspecies of E. barbara (E. b.
inserta in southern Central America, and E. b. barbara for all South America).
All of the demographic analyses showed a very strong population expansion
for this species in the last 400,000 YA during the Pleistocene.
Chapter 3 - Like other forms of diagnostics, genetic testing comes with a
retinue of costs and benefits. Significant benefits in terms of morbidity and

Preface ix
mortality have accrued to individuals tested for more prevalent genetic

conditions like cystic fibrosis and sickle cell disease, including persons seen in
the emergency room or identified through public health surveillance. These
benefits do not mitigate the drawbacks of genetic testing, false and missed
diagnoses and sheer cost among them.
Both medicine and public health have aimed at means of maximizing
genetic test benefits in the interventions that they apply. The President’s
Precision Medicine Initiative (PMI) holds promise in that its results could be
used to tailor medical treatments to the individual characteristics of patients,
“precision” implying a more accurate and precise regimen overall. The
National Cancer Institute (NCI) has already launched the NCI-MATCH
precision medicine trial, which assigns targeted treatments based on the
genetic abnormalities in a tumor, regardless of cancer type. Other trials, such
as the NCI Pediatric MATCH trial, are yet to happen. The efficacy of cancer
treatments also intersects public health concerns. The Evaluation of Genomic
Applications in Practice and Prevention (EGAPP) Working Group has
evaluated the use of UGT1A1 genotyping to determine the best dose of
irinotecan to prevent side effects when treating patients for metastatic
colorectal cancer. Analytic validity does not always equate with improved
patient outcomes, however, thus the public health emphasis on development of
a suitable evidence base for precision medical and public health efforts.
The public health approach to precision medicine, or “precision public
health”, differs from the medical approach in several important ways: (1)
population-based with attention to at-risk populations, as opposed to being
strictly individualized; (2) focus on primary and secondary prevention, rather
than frank disease (tertiary prevention); and (3) prioritizing interventions that
have already demonstrated readiness for large-scale implementation, in
contrast to the undertaking of novel clinical trials. Precision public health is
exemplified in the Centers for Disease Control and Prevention’s emphasis on
the implementation of Tier 1 genetic tests that have passed systematic review
for analytic and clinical validity and utility – the use of family history for
referral for hereditary breast and ovarian cancer genetic testing (BRCA1/2
mutations), and hereditary nonpolyposis colorectal cancer cascade screening
(Lynch syndrome MLH1, MSH2, MSH6 mutations).
This paper will cross-compare the precision medical approach to cancer
based on pharmacogenomic regimens using companion diagnostics, and the
public health approach to precision management of hereditary cancer for 3
cancer types – lung, breast, and colorectal. It will describe methods of early
detection and consider how lives can be saved through precise management –

x Kevin V. Urbano
from predictive testing and cancer monitoring of the at-risk population, to

tailored chemoprevention that fits the needs of the individual. In the
population context, a cascade screening “multiplier effect” exists in that
relatives can also be assessed and followed for mutations identified in the
proband. Cost-benefit analyses (T4 translational research) of medical and
public health approaches will be closely examined and compared. Points of
commonality between the two approaches will also be discussed, since
primary/secondary and tertiary disease prevention represent a continuum.
These analyses point to the value of allocating resources towards the health of
at-risk populations. Questions remain if particular forms of genetic testing are
to become “universalized”, and if the needs of all at-risk groups, including
racial-ethnic, are to be addressed.
Chapter 4 - Williams syndrome (WS) is a genetic neurodevelopmental
disorder (prevalence close to 1 in 20,000-30,000 births) resulting from the
deletion of 16-25 genes on the long arm of Chromosome 7. Individuals with
WS have an intelligence quotient of 40-70. Theirs is a unique
neuropsychological profile, characterized by an apparent dissociation between
cognition and language, as language is relatively well preserved, compared
with other cognitive skills. However, a more complex profile is now emerging,
with good lexical, short-term memory (especially auditory-verbal) and face
processing skills, but visuospatial (especially local processing of information),
executive (planning and inhibition), memory (working memory and long-term)
and attentional deficits.
Individuals with WS also have specific auditory-perceptual cognitive
skills (hyperacusis), category-specific perception of speech sounds, and
musical skills that exceed their cognitive level. Other behavioral
characteristics include hypersociability.
In this chapter, the authors provide a review of the literature on the
specific neuropsychological profile of individuals with WS, from a cognitive-
behavioral and neuroanatomical point of view. Early studies of the
neuropsychological profile in WS focused on the dissociation between
cognition and language. Since then, research has shown this syndrome to be
more complex.
The authors aim is to highlight the heterogeneity of the cognitive profiles
observed in this syndrome, and to identify the factors that might explain this
heterogeneity. The complexity and specific features of the neuropsychological
profile in WS need to be understood in order to develop therapeutic and
learning methods adapted to the developmental pace of individuals with WS.

Preface xi
Chapter 5 - Chromosome rearrangements are the most common genetic

abnormalities in humans. Abnormal chromosomal configurations are formed
among non-homologous chromosomes to allow full synapsis of homologous
chromosomes at meiosis I of chromosome rearrangement carriers. These
abnormal chromosomal configurations result in the production of gametes
with various chromosomal complements due to malsegregation of derivative
chromosomes or recombination. Most of the gametes have unbalanced
chromosomal complements and only a small number of gametes have normal
or balanced chromosomal complements. Carriers of balanced chromosome
rearrangements are phenotypically normal but they are at an increased risk of
abnormal pregnancies due to the unbalanced gametes. However, chromosome
rearrangement carriers who cannot have babies or experience repeated
abortions or abnormal pregnancies can have healthy babies after introduction
of PGD. Balanced reciprocal translocation is the most common chromosome
rearrangement. Thirty-two types of gametes can be produced in meiosis of
reciprocal translocation carrier. According to the results that analyze the
meiotic segregation of embryos from PGD cycles of reciprocal translocation
carriers, 2:2 segregation is the main segregation mode. The meiotic
segregation might be affected by the gender of carriers. The frequency of
balanced embryos was not different between female and male carriers.
However, the frequencies of 2:2 segregation, especially adjacent-1
segregation, 3:1 and 4:0 segregation were significantly different between
female and male carriers. Robertsonian translocation is also common
chromosome rearrangement in humans. Gametes with eight different
chromosomal complements can be produced in Robertsonian translocation
carriers. The frequency of balanced embryos was higher in male carriers than
in female carriers. Carriers of complex chromosome rearrangements (CCR),
very rare chromosome rearrangements, can achieve pregnancy by PGD
although the number of normal or balanced embryos was extremely low.
Although it is very difficult to estimate the rate of normal or balanced
embryos, the rate is estimated to be less than 10% in PGD for CCR carriers.
The 3:3 segregation and chaotic segregation (meiotic segregation whose
meiotic segregation cannot be defined) are prevalent segregation modes in
carriers of three-way translocation. In PGD cycles of CCR carriers, cycle
cancellation is very frequent due to the absence of the normal of balanced
embryos. Therefore, it is important that a large number of embryos are
obtained in one cycle. Occasionally, abnormalities of chromosome
rearrangement-unrelated chromosomes are observed in embryos or abortuses
although chromosome rearrangement-related chromosomes are normal or

xii Kevin V. Urbano
balanced. At present, PGD that diagnose all 24 chromosomes using array-

CGH, SNP array or NGS is carried out worldwide. In those PGD cycles, the
risk that embryo transfer is cancelled might be increased. However, the rate of
normal or balanced embryos is unexpectedly increased and pregnancy rate is
improved. Surely, PGD is the very effective assisted reproductive technique in
achieving pregnancy of chromosome rearrangement carriers by preventing
repeated abortions that chromosome rearrangement carriers usually
experience. In the field of PGD for chromosome rearrangements, the next
stage will be the development of technique that can discriminate between
normal embryos and balanced embryos.
Chromosome rearrangements, such as translocation (reciprocal or
Robertsonian), inversion and complex chromosome rearrangements, are the
most common genetic abnormalities in humans. Chromosome rearrangements
are classified as balanced or unbalanced. Carriers of balanced chromosome
rearrangements have the normal chromosomal complements but carriers of
unbalanced chromosome rearrangements have additional or missing
chromosomal material. Generally, the incidence of balanced chromosome
rearrangements is about 0.19% of newborns. Carriers of balanced chromosome
rearrangements are phenotypically normal because they have all the genetic
materials. However, they are at an increased risk of implantation failure,
repeated abortions or birth of chromosomally unbalanced offspring. Of course,
not all carriers of balanced chromosome rearrangements experience the
abnormal pregnancies. The abnormal pregnancies are resulted from the
unbalanced gametes generated during meiosis of chromosome rearrangement
carriers. Abnormal chromosomal configurations are formed to allow full
synapses of homologous chromosomes during meiosis of balanced
chromosome rearrangement carriers. The unbalanced gametes are produced as
a results of malsegregation of these abnormal chromosomal configuration.
Most of the gametes produced during meiosis of chromosome rearrangement
carriers have unbalanced chromosomal complements. These unbalanced
gametes result in implantation failure, repeated abortions or birth of
chromosomally unbalanced offspring.
After the first successful clinical application of preimplantation genetic
diagnosis (PGD) in 1990, PGD has been widely used worldwide to select
normal or balanced embryos in in vitro fertilization and embryo transfer (IVF-
ET) programs of balanced chromosome rearrangement carriers. Cleavage-
stage fluorescence in situ hybridization (FISH) has been widely used to PGD
for carriers of balanced chromosome rearrangements till the early 2010s and
PGD based on array comparative genomic hybridization (CGH) or next

Preface xiii
generation sequencing (NGS) is widely applied nowadays. The only

abnormalities of rearranged chromosomes can be diagnosed in FISH-based
PGD and the abnormalities of other chromosomes cannot be diagnosed.
However, abnormalities of all 24 chromosomes can be diagnosed after the
application of array CGH or NGS into PGD.
Chapter 6 - Aims: Attention deficit hyperactivity disorder (ADHD) is a
multifactorial psychiatric and neurobehavioral disorder. The brain-derived
neurotrophic factor gene (BDNF) has been proposed as a strong candidate for
this pathology. The aim of this study was to determine a family-based
association between three polymorphisms of the BDNF gene and the ADHD in
a Tabascan-Mexican population.
Methods: The authors analyzed the rs6265, rs12273363 and rs11030119
polymorphism of the BDNF gene through a family-based association study. A
total of 105 individuals grouped in family-trios (mother, father and ADHD
patient) were studied. Allelic and haplotypic transmission were assessed
through transmission disequilibrium test (TDT), using HaploView software.
Results: No statistically significant association was observed between the
BDNF gene polymorphisms and the ADHD etiology in Tabascan-Mexican
families: rs6265 (χ2 = 1.33; p = 0.24); rs12273363 (χ2 = 1.33; p = 0.24);
rs11030119 (χ2 = 0.66; p = 0.41). Furthermore, no preference of transmission
was observed for any of the haplotypes.
Conclusions: It was not possible to prove any association between the
BDNF gene polymorphic variants and ADHD in a Mexican population. Future
studies comprising larger samples are necessary to determine the potential role
of the BDNF gene in ADHD.

In: Advances in Genetics Research. Volume 17 ISBN: 978-1-53612-722-5
Editor: Kevin V. Urbano © 2017 Nova Science Publishers, Inc.
Chapter 1
GENETICS AND EVOLUTION

OF ENTOMOPATHOGENIC FUNGI
A. Garcia2, M. Michel1, S. Villarreal1, F. Castillo3,

E. Osorio4, M. T. García-Ruiz6, F. Veana5,
A. C. Flores1 and R. Rodríguez1,
1
Food Research Department, School of Chemical Sciences,
Universidad Autónoma de Coahuila, Saltillo, Coahuila, Mexico
2
Department of Agricultural Parasitology,
Universidad Autónoma Agraria Antonio Narro,
Buenavista, Saltillo, Coahuila, México
3
INIFAP-C. E. Saltillo, Saltillo, Coah, Mexico
4
School of Engineering and Sciences,
Universidad Autónoma de Tamaulipas, Victoria Tamaulipas, México
5
Proteomics and Molecular Biomedicine Laboratory,
Molecular Biology Division-IPICYT. San Luis Potosi. Mexico
6
Universidad Autónoma Chapingo. Texcoco, Edo, de Mexico, Mexico

Corresponding author: raul.rodriguez@uadec.edu.mx.

2 A. Garcia, M. Michel, S. Villarreal et al.
ABSTRACT
Entomopathogenic fungi have been mentioned as one of the best
alternatives for insect pest control. These fungi cause insects death. More
than 750 fungal species have been described infecting insects, some of
the most utilized for insect control are: Beauveria bassiana and
Metarhizium anisopliae. This is evidence of cosmopolitan distribution of
entomopathogenic fungi and its evolutionary success, this type of fungi is
related to a series of interactions among fungi, plants, and insects. In this
chapter, the main objective is to review and discuss the most recent
information on genetics and evolution of entomopathogenic fungi. In this
chapter are covered the following themes: Entomopathogens role in
nature, Entomopathogenic fungi and their interactions with the insect
immune system, Isolation and identification of entomopathogenic fungi,
Genetic diversity among strains of entomopathogenic fungus, Genes
involved in virulence of entomopathogenic fungi, Molecular phylogeny
of entomopathogenic fungi and their biogeographic implications,
Evolution of entomopathogenicity in fungi, Genetic improvement of
entomopathogenic fungi for insect biocontrol, Future trends and
Conclusions.
Keywords: isolation, identification, diversity, virulence, pathogenicity,

breeding, evolution, phylogeny
ENTOMOPATHOGENS ROLE IN NATURE

Entomopathogenic fungi are employed in different fields, to control
various insect species. These microorganisms are widely distributed
throughout the fungi kingdom. Some insect pathogenic fungi have restricted
host range, while others have a wide host range, with individual isolates to be
more specific (Barreto et al., 2004, Hesketh, et al., 2009). Entomopathogenic
fungi have been isolated from almost all regions of the earth and almost all
types of soil. This is evidence of cosmopolitan distribution and its evolutionary
success, involving a series of interactions between fungi, plants, insects and
other sources nutrients in their environments. Entomopathogenic fungi are
distinguished from other fungi and are transmitted directly by contact with

Genetics and Evolution of Entomopathogenic Fungi 3
susceptible guests, rather than having to be ingested to initiate infection (Cory

and Ericsson, 2010). Early studies with entomopathogenic fungi occurred in
early 1800 and focused on developing ways of diseases management that were
ravaging the silkworm industry in France (Vega et al., 2009).
Biological Control
Entomopathogenic fungi are a large group of microorganisms which

provide a great variety of services to agro ecological systems (Téllez et al.,
2009). Among these are: ability to regulate pests and also to keep them at
adequate levels. Entomopathogenic fungi have great potential as control agents
(Hesketh, et al., 2009), forming a group with more than 750 species, scattered
in the environment and causing fungal infections with arthropod populations;
among the most important genera of entompthogen fungi are: Metarhizium,
Beauveria, Aschersonia, Entomophthora, Zoophthora, Erynia, Eryniopsis,
Akanthomyces, Fusarium, Hirsutella, Hymenostilbe, Paecelomyces and
Verticillium (López-Llorca and Jansson, 2001), while for FAO (2003), the
most important geneous are Metarhizium, Beauveria, Paecilomyces,
Verticillium, Rhizopus and Fusarium. However, Oliveira et al., 2013
mentioned that entomopathogenic fungi group includes natural enemies of
insect pests and the most important genera are: Beauveria bassiana (Bals.)
Vuill., B. brongniartii (Sacc.) Petch, Metarhizium anisopliae (Metsch.)
Sorokin, Isaria farinosa Holms. and I. fumosorosea Wize, which have a wide
range of insect hosts. These fungi are particularly common in soils, where
often cause epizootic disease in their hosts.
The entomopathogenic fungus Verticillium lecanii naturally infects a wide
range of sucking pests such as thrips, whiteflies, aphids and mites; these are
economically important pests of major horticultural crops. By increasing the
incidence level of this entomopathogenic fungus could improve the control of
target pests (Visalakshy et al., 2005). Efforts to develop methods of biological
control of insect pest have been pursued; one of the best entomopathogen
fungi is M. anisopliae which uses a combination of enzymes and mechanical
force to penetrate the host cuticle and hemolymph, this fungus produces
chitinases for invasion and as one of the host-killing components (Barreto et
al., 2004). Production of enzymes, mechanical mechanisms of invasion,
improved mycelia growth and formation of conidia increase the infectivity of

entomopathogenic fungi as biopesticide (Visalakshy et al., 2005). Several

unexpected roles have been reported by fungi entomopathogens, among them
their presence as endophytes, plant disease antagonists, colonizers and
rhizosphere plant growth promoting fungi (Vega et al., 2009).
Entomopathogenic fungi are very important ecological components since they
perform insect control functions, which is very important because mishandling
of pesticides by humans has promoted that insects pest become uncontrollable
and some have develop resistance to pesticides.
Table 1. Entomopathogenic fungi used in biological control
Genus Species
Metarhizium M. anisopliae
M. flavoviridae
Paecilomyces P. fumosoroseus
Rhizopus Rhizopus spp.
Cordyceps Cordyceps spp.
Culicinomyces Culicinomyces spp.
Lagenidium Lagenidium giganteum
Nomuraea N. rileyi
Gliocladium Gliocladium spp.
Lecanicillium L. lecanii
(verticillium) L. longispoum
L. muscarium (Verticillium lecanii)
Beauveria B. bassiana
B. brongniartii
Motta-Delgado and Murcia-Ordoñez, 2011.
Plants Manipulate Fungal Entomopathogens
There is scientific evidence that plants can influence behavior of certain

groups of natural enemies, particularly parasitoids to increase herbivorous
suppression and presumably increase the plant fitness. Plants can also
influence entomopathogens in a similar manner. Entomopathogens fungi
perhaps offer the best opportunities to become bodyguards of plant (Cory and
Hoover, 2006). Any plant traits that improves entomopathogen fungal
infection and shows a variation of genetic base could theoretically be selected
as an adaptive response. For entomopathogenic fungi act as bodyguards’ plant
they must have benefits for plant processes (Cory and Ericsson, 2010).

The Ecology of Fungal Entomopathogens in the

Rhizosphere
The ecology of fungal entomopathogens in the rhizosphere is an

understudied area of insect pathology. Entomopathogenscity is a lifestyle that
has emerged and lost several times in many lines of fungi (Bruck, 2010). The
abundance of entomopathogenic fungi in the environment is correlated with
the host abundance of species, and is facilitated by epizootic events (Cory and
Ericsson, 2010).
ENTOMOPATHOGENIC FUNGI AND THEIR

INTERACTIONS WITH THE INSECT IMMUNE SYSTEM
Entomopathogenic fungi are microscopic creatures living in the
environment at expense of other organisms from where they get food; they are
morphologically hyphae, which are cylindrical filiform structures 2 to 10
micrometers in diameter and several centimeters long, which together form a
mycelium.
Classification
Two divisions are proposed: Myxomycota, those who are plasmodia, and
Eumycota, which do not form plasmodia and have mycelia. Entomopathogenic
fungi are located in the Eumycota division within five subdivisions;
Mastigomycotina (form zoospores, or oospores), Zygomycotina (form
zygosporas), Ascomycotina (form ascospores), Basidiomycotina (form
basidiospores) and Deuteromycotina (Ainsworth, 1973).
Important Species
According to Tellez et al., (1999), more than 750 species of

entomopathogenic fungi in 100 genera have been described, the most
important ones are Metarhizium, Beauveria, Aschersonia, Entomophtora,
Zoophtora, Erynia, Eryniopsis, Fusarium, Hirsutella, Hymenostilbe,
Paecilomyces (Isaria) and Verticillium; the more widely used species

worldwide for biological control of insects are, Metarhizium anisopliae

(33.9%), Beauveria bassiana (33.9%), Isaria fumosorosea (formerly known as
Paecilomyces fumosoroseus) (5.8%) and Beauveria brongniartii (4.1%) (De
Faria and Wraight, 2007).
Mode of Action
Entomopathogenic fungi act by contact through the cuticle, as they are

able to enter and invade the insect completely, thus causing death by infection
(Figure 1). According to different authors, the development cycle can be
divided in two or three phases respectively; Parasitic and saprophytic
(Elosegui, 2006) and infection, growth and reproduction (Boomsma et al.,
2014); adhesion and germination, penetration into the haemocele and
development of the fungus (Tanada and Kaya, 1993); adhesion, penetration
and replication (Tellez et al., 2009).
Figure 1. Scheme of entomopathogenic fungal infection procces to a suceptible insect.

1. Adhesion and germination. 2. Penetration of the cuticle and epidermis. 3.
Reproduction. 4. Sporulation.
Adhesion and Germination
The adhesin is a molecule produced by the fungus with adherent property

and comes into operation for spores adhesion to insect cuticle, this molecule is

recognized by specific receptors of glycoprotein nature. Once bound to the

epicuticle, spore germination phase starts in which the spore emits one or more
germinating appresioria tubes. This phase is not determined entirely by the
percentage of spore germination, but rather by the way of germination, type of
spore, aggressiveness of the fungus and host susceptibility (Tellez et al.,
2009).
Penetration
This process is achieved through the penetration tube (hyphae) by

enzymatic degradation of the cuticle involving enzymes such as proteases,
aminopeptidases, lipases esterases, chitinases and mechanical pressure
haustoria which deforms the cuticular layer and subsequently sclerotic that
breaks the membrane areas of the cuticle. This phase is determined by cuticle
hardness, thickness and presence of antifungal substances or nutrients. Even at
this stage, the insect has a last defense against foreign body that is within the
insect, physiological reactions such as phagocytosis, cell encapsulation and
formation of antimicrobial compounds (Tanada and Kaya, 1993).
Reproduction and Replication
When the fungus enters the haemocele, evades the insect immune defense
through a transformation of mycelium cells to yeast, which are called
blastosporas, accelerating the process of reproduction and dispersal, resulting
in septicemia (Pérez, 2004; Tellez et al., 2009). Among the physiological
symptoms produced by fungal infection in insects are seizures, lack of
coordination in their movements, altered or abnormal behavior (stops feeding,
reduces movement) and total paralysis. Death is the end result of infection due
to fluid loss, physical injury and toxicosis (Bustillo, 2001).
With the insect death, the fungus parasitic phase ends, and the saprofita
phase begins, where large amounts of mycelia masses emerge to the outside
through natural openings like mouth, spiracles and anus as well as the
intersegmental abdomen and thorax regions thereof; fruiting on the body and
generating inoculum to infect other insects (Cañedo and Ames, 2004).
Each of the different stages is influenced by internal and external factors.
Although most insects have defense mechanisms against entomopathogens,

they somehow manage to evade and penetrate these barriers; insect defenses
are considered physical, cellular, humoral and even social behavior (Marmaras
et al., 1996). Some factors influence or determine behavior of the spores, when
they achieved and adhere to the epicuticle host insect, such as water, nutrients
or debris on the surface of the exoskeleton, ions, fatty acids and even the
developmental stage of insect (larva, nymph, pupa or adult) (Hassan et al.,
1989). In this matter, the insect epicuticle is well known for its hydrophobic
feature, and sets the pattern as an excellent reservoir for adhesion and spore
germination; however, a combination of external factors such as temperature,
humidity, radiation and insect’s habits determine the full or no adhesion of the
fungal spore. The main ways of fungal transmission or infection that an insect
is exposed are by direct contact on the ground, scattered spores in the air,
contact with bodies of other infested insects and the infection routes are the
oral cavity and spiracles; the entomopathogenic fungi liquid solutions that are
used in modern agriculture for biological control of insects, naturally
contributed to the regulation of a wide range of pests affecting world
agriculture (Bustillo, 2001).
ISOLATION OF ENTOMOPATHOGENIC FUNGI

The fungi species of major interest for its potential as insect pathogens
are: Beauveria bassiana, Metarhizium anisopliae, M. flavoviride, Nomuraea
rileyi, Lecanicillium lecanii, Hirsutella thompsonii, Aschersonia aleyrodis,
Paecilomyces spp., and the fungi belonging to the Entomophthorales order
(Zoophthora, Entomophthora and Entomophaga). For isolation of
entomopathogenic fungi, some artificial media are used such as: sabouraud
dextrose agar, potato dextrose agar (PDA) and malt extract agar (MEA)
(Elósegui et al., 2006). In addition, some specific media to isolate
entomopathogenic fungi have been developed (Inglis et al., 2012). Different
methodologies for entomopathogen fungi isolation have been developed.
Isolation by Serial Dilution
This method involves placing a mycosed insect in a vessel containing 10

ml of Tween 80 (0.01%) in sterile distilled water. The resulting suspension has

to be stirred for 1 minute to release conidia insect body. As a result, there is

obtained a concentrated suspension or stock solution of inoculums with other
particles. The stock solution can be used to prepare serial dilutions. The first
dilution (10-1) can be obtained by mixing 1 ml of the stock solution in a tube
containing 9 ml of Tween 80 (0.01%) in sterile distilled water. This operation
is repeated several times until dilution series (10-1 to 10-6) are obtained. For
inoculating and obtaining fungus, the latest dilutions (10-4, 10-5, 10-6) are used.
Subsequently, they are inoculated in Petri dishes with 100 µL of PDA medium
and incubated at 25 ± 1°C for 5 to 7 days. Once the fungi are grown, the next
step is to identify them, especially some of interest (primarily Metarhizium
anisopliae, Beauveria bassiana and Entomophthora spp.). Identification can
be accomplished using a compound microscope and dichotomous keys based
on morphological characteristics of reproductive structures, such as
conidiophores, conidia and phialides.
Direct Isolation of Entomopathogenic Fungi from

Insects
For direct isolation, it is necessary to monitor the culture of interest. For

this, dead insects, suspected of fungal infections with mummification
symptoms, or sporulation of fungal nature in the cuticular surface have to be
collected (Diaz et al., 2008). Samples are handled with soft tweezers and
placed into microcentrifuge tubes (depending on the size of the insect). In
aseptic conditions, insects are disinfested in a solution of 2% sodium
hypochlorite for 3 minutes and rinsed three times with sterile distilled water.
Such type of isolation can be done in two ways: first, by scraping with a
bacteriological loop all fungal particles present in a disinfected insect, and then
passing them in Petri dishes with PDA culture medium through the technique
of rifling; second, with a dry, sterile forceps, take the sporulated insect
previously disinfested and shake it with vertical and horizontal movements on
the surface of Petri dishes with PDA medium and incubated at 25 ± 1°C for 5
to 7 days. Once fungal growth is observed, proceed to the characterization.
Isolation of Entomopathogenic Fungi from Soil
Insect trap technique which use in most cases Galleria mellonella

(Lepidoptera: Pyralidae) and Tenebrio molitor (Coleoptera: Tenebrionidae)

(Zimmermann 1986); these insects are reproduced under lab conditions

besides they are susceptible to fungi. Soil samples are collected from depth of
0-20 cm and placed in properly labeled plastic bags. At each site a subsample
is taken, in order to form a composite sample of 1 kg. From each sample of
homogenized soil, 500 g are taken and placed in a plastic container of 14 × 18
× 6 cm with seven larvae of G. mellonella or T. molitor of last stage and
incubated at 25 ± 1°C for 7 days. Subsequently, the dead larvae with
symptoms of fungal infection are placed in a moist chamber. Isolation and
purification of the fungi is performed in a laminar flow chamber for direct
transfer of conidia and/or mycelia in Petri dishes containing PDA medium
with 100 µg streptomycin sulfate and 10 µg of tetracycline hydrochloride
(antibiotics) (Khudhair et al., 2014). After incubation, observation of fungal
growth is performed to identify them.
MORPHOLOGICAL CHARACTERISTICS
Beauveria bassiana
Colonies on PDA at the beginning are white and fluffy, become beige
slightly and dusty and eventually sporulate. On the reverse side, they are
slightly yellow. This fungus has abundant conidiophores with dense groups of
phialidic cells, conidiogenous and globose cells, both bottle shaped with
intermediate forms, 1.5-3.0 (2.7 µm) × 2.0-3.0 (22 µm) and hyaline conidia,
sometimes with a very definite globose to ellipsoid apex 1.5-3.0 (2.3 µm)
×1.5-3.0 (21 µm).
Metarhizium anisopliae
This fungus has white and cottony colonies on PDA, in the beginning turn
greenish yellow and finally dark olive green and crusted with areas with
abundant white aerial mycelium. The reverse of the Petri dish is intense
yellow. Also it has conidiophore typical pattern with 2-3 whorled branches
each, with dark olive green tones but, clarifies the apex. Others charateristis of
this fungus are conidiogenous cells 6.0-10.0 (8.1 µm) × 2.0-2.5 (2.1 µm),

subhyaline to slightly green, and cylindrical to slightly ellipsoidal conidia, 5.0-

8.5 (6.6 µm) × 2.0-3.0 (2.4 µm).
Paecilomyces lilacinus
Colonies of this fungus on PDA at the beginning are downy white, then
they turn in gray to purple depending on age and shown an irregular aerial
mycelium. On Petri dish reverse, it is observed a red color. Alone or in groups,
conidiophores form synnemata with whorls of up to six phialides, which with
age become wrinkled. Typical conidiogenous cells, 7.0-13.0 (9.5 µm) x 1.5-
3.0 (2.8 µm) have catenulate conidia, light gray-violet, ellipsoidal to fusiform,
some with an apex, 1.5-3.0 (2.2 µm) × 1.5-3.0 (2.4 µm).
Nomurae rileyi (Metarhizium rileyi)
This fungal specie grows slowly in culture medium (Sabouraud-maltose

agar) showing initially a pale green colony, changing its conidia into malachite
green or olive green as they mature. Vegetative hyphae are septate, smooth,
hyaline or slightly pigmented wall; its reproductive structure is a septate
conidiophore born from hyphae forming dense clusters with groups of 2 or 3
compacted phialides around the conidiophore, the phialides are cylindrical
with occasionally flared base and very short neck or absent of 4.7-6.5 × 2.3-3
µm. Conidia in chain are ellipsoid or sometimes cylindrical of 3.5-4.5×2-3.1
µm (Samson, 1974). Mainly limited to the Lepidoptera order: Spodopotera
frugiperda and Helicoverpa armígera (Adsure and Mohite, 2015), and at least
two species of beetles: Hypera puctata (Fabricius) and Leptinotarsa
decemlineata (Kroatz).
Lecanicillium (=Verticillium) lecanii
In potato-carrot agar, the colonies of this fungus are fluffy and white.
Solitary or whorled and prostrated conidiophores, carrying a hyaline apical
mass of subglobose, oval, falcate, fusiform and unicellular subcolumnar
conidia, non-adhesive and do not exhibit latent structures (Zare et al., 2001).
Conidia with dimensions between 6.2 to 11.3 µm diameter, and phialides from
11.2 to 30 × 1.7-2.5 µm, the conidia are 3.0 to 4.0 0 µm width and 5.8 to 10.5

µm length (Sugimoto et al., 2002). This fungus has a wide host range:
Hemiptera insects (Toxoptera aurantii, Aphis gossypii, Myzus persicae and
Bemicia tabaci), Coleoptera, Diptera and Lepidoptera orders and mites of
Tetranychidae family.
Isaria fumosorosea
This fungal specie presents yellowish hyaline, septate hyphae with thin
walls. Most I. fumosorosea isolates have whorled or irregularly branched,
carrying in its terminal part at each branch phialides groups, which can also be
lonely. Its phialides have a cylindrical or swollen basal portion, often abruptly
tapering to form a very noticeable neck. Conidiophores carry conidia chains;
these are hyaline, unicellular and ovoid (Bustillo, 2001). This
entomopathogenic fungus is characterized by bright colors like white, yellow,
pale green, pink, red or purple. It has hyaline to yellowish, septate hyphae with
smooth walls. The condiogen structure is a synnema or monosynnema
consisting of compacted hyphae, irregular and whorled conidiophores with
terminal branches, which clusters widened bottle-shaped with a distinct neck
where the conidia are born and grow as chain in a basipetal form by a cell,
rarely two, hyaline or slightly pigmented with smooth, echinulate walls or
more forms (Berlanga, 1997; Hernandez, 1997). I. fumosorosea is used to
control mainly Bemisia tabaci and Diaphorina citri (Flores et al., 2013).
Hirsutella thompsonii
This fungal specie presents septate, fine and hyaline mycelium with a
diameter from 1.7 to 3.3 cm. Hyphae usually develops in a simple form except
in species producing synnema, sporulates moderately, its conidiogenous cell is
a gray phialide, from 10 to 15 mm long, originating from the sides of hyphae.
The conidia are spherical from 2 to 4 mm diameter with verrucose surface
(McCoy, 1981). Growth in malt agar medium, has an abundant mycelial mass
and subsequently acquires light gray shades between gray and bluish gray with
presence of hyaline droplets of liquid and white synnemata over 10 cm in
length (Cabrera and Dominguez, 1987). H. thompsonii is specific to mites,
mainly Eriophyidae and Tetranychidae, and it has been reported on plowman
of citrus P. oleivora in the United States, China and Cuba (Samson et al.,

1980); E. gerreronis in coconut in Cuba and Mexico and other citrus mites and
cherry, in laboratory Tetranychus cinnabarinnus, Eutetranychus orientalis and
Tetranychus turkestain are susceptible (Gerson et al., 1979).
Aschersonia aleyrodis
Colonies of this fungal specie on PDA grow slowly reaching 35 mm in

diameter in three weeks at 23°C, filamentous white to yellowish white hyphae,
sometimes with a grayish-yellow color with peripheral circle. Conidia masses
of variable color, light, intense or reddish orange. Most conidia measure 10-16
× 1.0-1.5 µm, thick-walled hyphae, or in a whorl of 2-6 from the end of the
thick-walled hyphae; conidiphores with multiple ramifications of 35-65 µm,
some elongated phialides that reach paraphyses (Liu et al., 2006). Aschersonia
species form a simple small stroma which consists of a dense interweaving
hyphal of thick wall forming a structure or a fruiting body called pycnidium, in
which conidia are produced. Different species of this fungus can be
distinguished by the color of the stroma and conidia, which presents a red,
brown, orange or yellow tonality. The conidia have little variation in shape,
being generally fusoid or oval with pointed ends (Mains, 1959). A. aleyrodis is
reported by infect midge benches of agricultural importance highlighting
Dialeurodes citrii, D. citrifolii, Bemisia tabaci (Genn), Trialeurodes
floridensis (Quaintance) T. vaporariorum (Westw) Aleurocanthus woglumi
(Ashby) and Aleurothrixus floccosus (Mask) (Hernandez et al., 2005).
Entomophthora muscae
The species are subspherical, ellipsoidal, kidney-shaped or rounded bodies

hyphae measuring 24-54 × 17-41 µm with 10 to 24 nuclei (average 15-19).
Conidiophores are unbranched and contain 10 to 27 nuclei (average 15 to 20).
Primary conidia average measured is 27 to 31 × 20 to 24 µm with a
length/diameter ratio of 1.20-1.32 and 10 to 27 nuclei (average 15-20)
relationship. The secondary conidia average measured is 19-24 x 15-19 µm
with a length/diameter ratio of 1.20-133 (Keller et al., 1999). Bemisia tabaci,
Aphis fabae, Acyrtosiphon pisum, Delia radicum, Pollenia angustigena,
Coenosia tigrina, Musca domestica, Scatophaga stercoraria, Syrphidae and
Anthomyiidae. (MacLeod et al., 1976; Jensen et al., 2006) are controlled by E.
muscae.

MOLECULAR IDENTIFICATION
There are several molecular techniques for DNA analysis and search for
information to identify entomopathogenic fungi. Among the most important
techniques are RAPD’s (Random Amplification of Polymorphic DNA) and
AFLP’s (Amplification Length Polymorphism Fragments). For these
techniques, combinations of primers (oligonucleotides) that produce different
banding patterns can differentiate DNA from different individuals (Bulat et al.,
2000). On the market are available kits with universal oligonucleotides for
microorganisms and plants, which can be used for fungi. It is also possible to
design PCR protocols to amplify the internal transcribed spacer regions (ITS)
which can be cut using enzymes. It is known that ITS are highly conserved in
all organisms, so small changes in them can be used for classification. There
are PCR-based primers used for characterization of specific entomopathogenic
fungi such as B. brongniartii (Enkerli et al., 2001), B. bassiana (Rehner and
Buckley, 2003), M. anisopliae (Enkerli et al., 2005), as well as Isaria
fumosorosea (Gauthier et al., 2007).
Ribosomal RNA (rRNA) and its template ribosomal DNA (rDNA)
sequence comparisons are useful for estimating both close and distant
relationships among fungi. Small subunit rRNA gene (18S rDNA and 5.8S)
sequence divergence has contributed in phylogenetic analysis among distantly
relaxed taxa; however, those sequences are generally too conserved and
attempts have been made to utilize the more variable domains of the large
subunit (26 or 28S) for species identification and detection. Since 2012, the
internal transcribed spacers of the nrDNA (ITS) are accepted as the official
DNA barcode for fungi (Schoch et al., 2012). The high number of copies of
the ITS per cell, in particular, makes it an attractive target for diagnostics and
it can be detected with great sensitivity. Nevertheless, a secondary
identification marker is sometimes needed and calmodulin (CaM), ß-tubulin
(benA) and the RNA polymerase II second largest subunit (rpb2) have been
suggested for this purpose (Samson et al., 2014). The rpb2 gene is not easy to
amplify, rendering its use as secondary identification marker frustrating. In
contrast, benA is easy to amplify, but has been reported to vary in the number
of introns and PCR sometimes results in the amplification of paralogous genes
(Peterson, 2008; Hubka and Kolarik, 2012). In addition, the CaM sequence
database is almost complete for all accepted species.

GENETIC DIVERSITY AMONG ENTOMOPATHOGENIC

FUNGAL STRAINS
Diversity of entomopathogenic fungi is determined in an ecological
community by ecological indices based on morphological characteristics.
However these indices are not enough to determine the genetic diversity
within communities (Garrido-Jurado et al., 2015). Genetic diversity and
population structure are required to understand and direct the use of fungi as
biological control agent. The overall genetic diversity in entomopathogenic
fungi resulted from the genetic variation within geographical populations. This
genetic diversity correlates with presence or absence of recombination.
Molecular tools can be used to identify the genetic differences between
and among fungal species (Garrido-Jurado et al., 2015) which can allow
understanding population structure and gene flow within communities. The
genetic variability has been studied using several molecular markers such as
RFLPs (length polymorphisms of restriction fragments), RAPD (DNA
polymorphisms amplified random), minisatellities, AFLP (Amplified
Fragment Length Polymorphism), SCAR (sequence-characterized amplified
region), SSR (simple sequence repeats or microsatellities), ISSR (inter-simple
sequence repeat), SSCP (single-strand conformation polymorphism), TGGE
(temperature gradient gel electrophoresis) and DGGE (denaturing gradient gel
electrophoresis) (Enkerli and Widmer, 2010; Guo, 2010). Specific DNA
sequences are used as genetic markers and allow to descriminate within
taxonomic groups a community structure and the phylogenetic relationship, or
characterization and monitoring of strains in differents environments con be
studied (Enkerli and Widmer, 2010). Genetic variability in several species of
Beauveria sp, Metarhizium sp, Paecilomyces sp. and other entomopathogenic
fungi has been evaluated by several molecular techniques.
Garrido-Jurado et al., (2015) analyzed the diversity of entomopathogenic
fungi during four seasons in olive orchards, holm oak reforestation, holm oak
dehesa and sunflower plantation. In this study were identified
entomopathogenic fungi species such as: Beauveria amorpha, B. bassiana, B.
pseudobassiana, B. varroae, Metarhizium brunneum, M. guizhoense, M.
robertsii, Paecilomyces marquandii and lilacinum using gene EF-1ɑ
sequences and ISSR. The Shannon–Wiener index was used to measure
diversity and abundance in the eco-system. The ISSR and ITS analysis
revealed a high degree of polymorphism among the different isolates with
80% of polymorphic bands particularly in all species of B. bassiana; which

was dominant in all cropping system and all seasons. In some studies, it has
been found differences among communities of entomopathogenic fungi in
different types of soils such as Beauveria bassiana in forest soil and
Metarhizium anisopliae in cultivated soil; these differences reflected a high
level of DNA polymophism (Garrido-Jurado et al., 2015).
Beauveria spp
In this fungal specie were used molecular markers such as RAPD to

determine the genetic diversity among isolates from different geographical
regions of Chile. The RAPD analysis indicated high genetic diversity with
43% similarity between isolates, indicating that genetic diversity was not
associated with the geographical origin of the isolates (Becerra et al., 2007).
Fernandes et al., (2009) evaluated the genetic diversity among 49 species of
Beauveria bassiana from Brazil and 4 species of Beauveria spp. from USA.
The isolates were analyzed by ITS (including the 5.8S gene) and AFLP and
reveled considerable genetic variability among B. bassiana isolated from
different geographical regions of Brazil, and differences between Brazilian and
USA B. bassiana isolates. Other study reported the genetic diversity in
Beauveria, where were used 82 polymorphic AFLP loci; several alleles were
found in the Beauveria strains as alleles 2 and 5 in the locus MDH in all
strains, allele 3 in the loci PGM and 6PGD in 96% of B. bassiana, allele 2 in
the locus G2D in 90%, allele 2 and 3 in the loci FUM and PK in the 88% and
allele 1 in IDH to 86%. The geographical distance between entomopathogenic
fungi demonstrated notable genotypic variation but no correlation was
observed according to the host (Fernandes et al., 2009).
SSR markers are often highly polymorphic and can be used for
genotyping of different fungal strains and monitor entomopathogenic fungus
in different environments. Reineke et al., (2014) monitored Beauveria
bassiana in different environments using SSR markers and found that SSR
were important tools to monitor fungal strains. The microsatellite primers used
were Ba01, Ba02, Ba08, Ba12 and Ba13. B. bassiana strains from different
origin shared the same alleles at 5 SSR loci, among them 18 isolated strains, 3
strain from India and 2 from the USDA culture collection.
Meyling et al., (2009) identified B. bassiana, B. brongniartii and a
monophylogenetic group nearby from B. bassiana. The entomopathogen fungi
were collected from insects sampled in cultivated field and soils in Denmark;
for the phylogenetic analysis were used some markers identified from B.

bassiana such as Ba06, Ba08, Ba12, Ba13, Ba15, Ba18, Ba21, Ba26, Ba27 and
markers isolated from B. brongniartii such as Bb1F4, Bb2A3, Bb2F8, Bb4H9,
Bb5F4 and Bb8D6. The same authors determined multilocus microsatellites
for five phylogenetic species of B. bassiana; these species co-exist on the sites
of collect. The five population showed multiple allelic differences of
microsatellite loci by EF-1α phylogenetic analysis; the Eu_3, Eu_4, Eu_5 and
Eu_6 populations had low allelic variation, only show 1, 2, 5 and 2
polymorphic loci respectively, while the population Eu_1 had the greatest
genotypic variability with 12 polymorphic loci. This variability could be
attributed to recombination; also they found that Beauveria diversity was
highest in the semi natural habitat because of great abundance and diversity of
insect hosts. The semi-natural habit had increased humidity and environmental
stability compared with the agricultural field.
The virulence of 21 isolates of B. brongniartii and 2 isolates of B.
bassiana was evaluated against adults and larvae of Schizonycha affinis and
Hypopholis sommeri, respectively. The isolates of B. brongniartii showed low
level of genetic diversity using microsatellite markers. In this study, it was
found that 21 isolates of B. brongniartii represent 17 haplotypes and that were
genetically close. The isolates of B. brongniartii may vary in their virulence
with a mortality of 50.1–95% to S. affinis and 39–74% of mortality to
Tenebrio molitor (Goble et al., 2015).
Metarhizium spp
The fungus is usually isolated from soil, but the distribution of species in
soil is unknown. The phylogenetic relationship and genetic diversity of
Metarhizium spp. isolated from Schiodtella formosana were analyzed by
ISSR. The 86% of the generated bands were polymorphic and the polymorphic
loci P was from 70 to 100%. The Metarhizium populations were differentiated
into 2 clades, reflecting a proportion of 79.2% of gene differentiation within
the populations. The isolates of Metarhizium spp. were identified based on ITS
sequences in M. anisopliae var. anisopliae and M. robertsii (Luan et al., 2012).
In diverse Asia and European countries was determined the genetic
diversity of Metarhizium anisopliae by microsatellite markers (SSR) and ITS
rDNA regions (ITS-1, ITS-2 and 5.8S gene regions). Using SSR was found
that existed a low level of polymorphism in M. anisopliae, gene diversity was
0.37 and the result of ITS-rDNA sequence confirmed that SSR had minimal

genetic variation in all isolates with a genetic distance of 0.34%, the closely
related genotypes of M. anisopliae were dominant in different ecosystems in
regions of China (Freed et al., 2011).
Metarhizium spp. were obtained from bulked soil samples of agricultural
field and surrounding hedgerow in single agro ecosystem in Denmark. The
genotypic diversity of Metarhizium isolates was analyzed by SSR and it was
found co-occurrence of four species in the soil of the smaem agro ecosystem.
To determine the different genotypes were used 18 SSR markers: Ma145,
Ma325, Ma307, Ma2049, Ma2054, Ma2055, Ma2056, Ma2057, Ma2060,
Ma2063, Ma2069, Ma2070, Ma2077, Ma2089, Ma2283, Ma2287, Ma2292,
and Ma2296. Metarhizium brunneum was most frequent (78.8%) followed by
M. robertsii (14.6%), while M. majus and M. flavoviride were infrequent
(3.3% each). Based on SSR analysis were identified 5 genotype of M.
brunneum and 6 genotypes of M. robertsii indicating particular adaptations to
these soil environments (Steinwender et al., 2104).
SSR markers were used to characterize polymorphisms in one collection
of 65 strain of Metarhizium. These strain included M. anisopliae, M.
brunneum, M. guizhouense, M. lepidiotae, M. majus, M. pingshaense and M.
robertsii, represent more of 75% of the strain isolated and were amplified
using 21 markers (15 polymorphic) based on EF1alpha sequence (Mayerhofer
et al., 2015). Bischoff et al., (2009) evaluated phylogenetic relationships
within M. anisopliae, M. taii, M. pingshaense and M. guizhouense by EF-1ɑ,
RPB1, RPB2, IGS and β-tubulin gene regions.
Paecilomyces spp
Genetic relationship of several isolates of Paecilomyces fumosoroseus

from various host species and geographical locations was investigated; the
isolates of P. fumosoroseus from Bremisi tabaci indicated the association of
genotypes with this insect. The analysis of allelic variability by microsatellite
loci allowed group in two lineages, one lineage included genotypes related to
B. tabaci in America and other lineage distributed in Asia (Gauthier et al.,
2007). Other specie of Paecilomyces in which genetic diversity was evaluated
by SSR markers was Paecilomyces variotti. The isolates were obtained from
pistachio gardens and were identified 22 alleles; this allowed grouped all the
isolates into 8 groups with high genetic variability but not demonstrated the
relationship between isolates and the geographical regions of collect; the SSR

primers PfrBtB04 and PfrBtD05 amplified alleles at numerous loci (Ebrahimi

et al., 2015). In addition, genetic diversity of P. variotii was examined by SSR
analysis using the primers PfrBtD11a, PfrBtD11b, and PfrBtB04 and RFLP
analysis. The polymorphism information content and marker index were
calculated; in this study was evaluated the amount of detectable polymorphism
in the isolates, RFLP produced 20 loci con 90% of polymorphism and SSR
produced 32 loci with 37.5% of polymorphism (Rostami et al., 2015).
Paecilomyces liliacinus is other specie in which was analyzed the degree
of polymorphisms and haplotype diversity. Li et al., (2013) analyzed 80
specimens of P. liliacinus and observed diversity among six gene fragments
and the haplotype h18 which was the most common in 20 isolates. Besides, it
was found an extensive gene flow among strains. The phylogenetic trees based
on the six gene fragments allowed grouping the strains in four clades.
Evaluation of composition and dynamic of entomopathogenic fungi
populations may improve the effects of entomopathogenic fungi for
biocontrol. In addition, resolution of genetic markers allows description of
population structures and help to understand local migration and dissemination
patterns.
GENES INVOLVED IN VIRULENCE

Entomopathogenic fungi comprising a group of approximately 100

genera, however, a low percentage is used for pest control. It is important to
known that genes involved in the virulence of entomopathogenic fungi, with
the objective of genetic manipulation and decrease of agricultural losts
(Sansores-Lara et al., 2014). Most fungal species used for biological control
are Beauveria bassiana, Metarhizium brunneum, and M. anisopliae.
The virulence of entomopathogen fungi involves adhesion, germination,
differentiation and penetration steps. Particularly, genes involved in virulence
from Beauveria bassiana are distributed in the seven step of infection, as
follow: host adhesion, germination, cuticle degradation, growth as
blastospores, host colonization and killing, immune response interactions and
hyphal extrusion and conidiation. During this procedure, 53 genes are
expressed and correspond to hydrophobin, mitogen-activated protein kinase
(MAPK), protein kinase, subtilisin-like protease, chitinase mannitol-1-

phosphate dehydrogenase, regulates calcium sensor (acidification regulator),

beauvericin toxin, bassianolide toxin, bassiacridin, among others (Valero-
Jiménez et al., 2016).
In cuticle degradation and hyphal extrusion and conidiation, a chitinase
gene (Bbchit1) is related. (Fang et al., 2005). The Bbchit1 from B. bassiana
has a length of 1047 bp and encode for a protein of 348 amino acids, where the
28 amino acid residues corresponding to signal peptide. Later, a hybrid
protease was development by fusion of a chitin binding domain BmChBD
from Bombyx mori chitinase to the C-terminal of CDEP-1, a subtilisin-like
protease from B. bassiana. The hybrid was able to increased fungal virulence
compared with the wild-type native protease (Fan et al., 2010). Since
glycosidase hydrolase family 18 of the M. anisopliae has been studied for
importance in virulence. Family 18 and 19 are responsible of hydrolysis of
chitin present in the insects, and have been identified 24 genes belonging to
family 18, including chit1, chi2 and chi3 (Junges et al., 2014).
Other gene that regulates fungal conidiation, virulence and stress control
in B. bassiana is Ras homologs (Ras1, Ras2 and Ras3). Ras1 and Ras2 genes
have length of 648 and 708 bp, which encodes for 216 and 236 amino acid,
with molecular mass of 24.3 and 26.2 kDa, respectively (Xie et al., 2013). The
Ras3 GTPase gene is localized in plasma membrane and is involved in the
HOG1 pathway necessary for osmoregulation. By the way, the Ras3 can be
regulating conidiation, germination, multi-stress tolerance and virulence (Guan
et al., 2015).
Two hydrophobins encoded by hyd1 and hyd2 genes, which have been
detected in B. bassina, can be involved in cell surface hydrophobicity,
adhesion, virulence and constitute the spore coatrodlet layer in fungi (Zhang et
al., 2011). The hydrophobin gene (hyd1) promoter (GenBank ID:GU936631)
has a size of 1798 bp, however a truncated 1290 bp fragment (Phyd1-t1) was
used for eGFP expression (enhanced green fluorescence protein) which was
decreased. In addition, an insect midgut-specific toxin gene (vip3Aa1) was
expressed in transgenic strains of B. bassiana (BbHV8, BbV28 and Bb2860),
where BbHV8 strain produced nearly 10-fold more toxin molecules in conidia
and thus killed Spodoptera litura larvae more rapidly and effectively
irrespective of normal or heat-killed conidia ingested (Wang et al., 2012). On
the other hand, in Metarhizium brunneum, three genes with relationship
virulence (HYD1, HYD2 and HYD3) were reported, which codified for
hydrofobines class I and class II (form rodlet structures at interfaces and do
not, respectively). These genes were deleted in the fungi and conidia or

blastospores of each mutant were applied versus S. exigua larvae. Reductions

in virulence and delayed mortality were presented in comparison with wild-
type strain (Sevim et al., 2012).
Adhesin genes (MAD1 and MAD2, adhesion-like protein) from M.
anisopliae are responsible for anchor to insect cuticle and facilite the
colonization. Full length genes are 2151 bp and 306 bp that encode for 717
and 306 amino acids (Wang and St-Leger, 2007). Other entomopathogenic
fungus enzyme related with cell-surface localization and host adhesion is
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with 338 amino acids.
However the gene (gpdh1) is a full length of 1230 bp (GenBank id:
EF050456) (Broetto et al., 2010).
A mitogen-activated protein kinase (MAPK) regulates the fungal
development, growth, and pathogenicity over insects (Luo et al., 2012).
According to Koduru et al., (2014), protein osmosensor (MOS1), laccase,
superoxide dismutase (Bb-SOD2), mutation in β tubulin genes and adenylate
cyclase, are related in abiotic stress and virulence of insect pathogenic fungi. A
MAPK gene was identified in B. bassiana (Bbmpk1), which is essential for
spore adhesion, formation of appressoria and ability to cross the insect cuticle
both during infection and exit after insect death. Other gene with same action
is an HOG (high osmolarity glycerol response) kinase. Both genes affect the
transcript levels of hydrophobin encoding genes (Koduru et al., 2014). Bbslt2
gene (GenBank: JF932503.1) is required for full virulence in B. bassiana. This
gene has a length of 1257 bp, which encode for a protein of 418 amino acids
that correspond to Slt2 family MAPK (Luo et al., 2012).
Recently, a correlation between Pr1 and Pr2 gene associated to virulence
of M. anisopliae strains has been established. These genes encode for
proteases such as subtilisin-like enzyme (Pr1) and trypsin-like enzymes (Pr2),
these enzymes are important for insect cuticle degradation. A bioassay of
mortality was performed with four strains of M. anisopliae (6342, 6345, 6347
and 798), which possess 11 pr1 genes, versus adults of Prosapia sp. and larvae
of Spodoptera exigua. The highest mortality (73%) on this insect was
generated by the 6342 strain, which showed the maximum Pr2 enzymatic
activity. However, subtilin and trypsin production are not indispensable for
pathogenicity (Rosas-García et al., 2014). In addition, Ifa-Pr1A gene from
Isaria farinose (GenBank id: JN014832) was detected using the RACE
technique with a length of 960 bp, which encode for a protein of 320 amino
acids. The Ifa-Pr1A transcripts exhibit 58 800-fold at 12 h post-induction.
Therefore, the gene is considered as major cuticle-degrading proteases in the

studied fungus. Besides, the Ifa-Pr1A gene is an important virulence factor for
the development of biopesticides (Wang et al., 2013). An in vivo infection
study of insects (Galleria mellonella, Eupoecilia ambiguella and Cactoblastis
cactorum) infected by B. bassiana reveled the expression of three genes:
subtilin (Pr1h), exocyst component (Sec15) and EC391425 with a length of
98, 160 and 120 bp (Galidevara et al., 2016). The same gene from M. acridum
and M. anisopliae has been described as heavily involved in the initial steps of
fungal invasion of arthropod-host cuticle (Leão et al., 2015; Golo et al., 2015).
During immune response interactions, a superoxide dismutase is
expressed in B. bassiana 2860. The BbSod2 gene (630 bp) from B. bassiana
2860 encodes a 209-aa protein with a theoretical molecular mass of 23.1 kDa
and isoelectric point of 7.14. (Xie et al., 2010). Secondary metabolites tenellin
(BbtenS), beauvericin (BbbeaS) and bassianolide (BbbslS) were measured by
quantitative reverse transcription real-time PCR (qRT-PCR) during infection
of Triatoma infestans (Chagas disease) by the entomopathogenic fungus B.
bassiana. BbtenS and BbbeaS were highly expressed at days 3 and 12 post-
treatment. In blastospore-injected insects, BbtenS and BbbeaS expression
peaked at 24h post-injection and were also highly expressed in insect cadavers
(Lobo et al., 2015).
The methyltransferase (mtrA) have a role in fungal physiological process.
The mtrA gene (921 bp) encoding a protein of 307 amino acids (molecular
mass 36 kDa, GenBank accession number EJP69472) in B. bassiana. Insect
bioassay using wild-type B. bassiana, ∆BbmtrA, ∆BbmtrA : : mtrA strains on
larvae of the greater wax moth, G. mellonella, reveled that median lethal time
(LT50) for wild-type strain is the 7.2 days and 80% of mortality, these values is
decreased in ∆BbmtrA : : mtrA strains with values of 10 days and 60% for
LT50 and mortality, respectively (Qin et al., 2014). Actually, an insect-toxic
protein (Bb70p) from B. bassiana was assayed versus G. mellonela with the
activation of phenol oxidase cascade. The Bb70p can be enhancing the fungi
virulence (Khan et al., 2016).
Some fungal genes have been mentioned in host colonization and killing,
one of them is calcium sensor-1 (Bbcsa1) from B. bassiana which is
homologue with a neuronal calcium-sensor. Bbcsa1 is associated in pre-
penetration or early penetration events, but is dispensable once the insect
cuticle has been breached (Fan et al., 2012). For conidiation, multi-stress
tolerance and virulence in B. bassiana, a response regulator denominated
Bbssk1 is necessary. A full-length sequence of Bbssk1 is 2355 bp, encoding a
784 amino acids protein with a molecular mass of 84.5 kDa (Wang et al.,

2014). Other gene expressed during colonization of insects is alcohol

dehydrogenase (Adh1) from M. anisopliae, which is important for full
capability of fungus for penetrate/colonize the insect.
MOLECULAR PHYLOGENY OF ENTOMOPATHOGENIC

FUNGI AND THEIR BIOGEOGRAPHIC IMPLICATIONS
Entomopathogenic fungi constitute an important biotic component in the
natural regulation of arthropod population sizes (Meyling and Eilenberg,
2007). More than 750 entomopathogenic fungal species have been isolated and
described worldwide (Nielsen et al., 2008) but species of the Deuteromycete
fungal genera Metarhizium and Beauveria are virulent, generalist
entomopathogens that are well established as infecting a wide variety of non-
social insect hosts. They are principally associated with hosts in the soil
environment, and thus soil-nesting social insects, such as most ants and
termites. Although these taxa are probably the most intensively studied
entomopathogenic fungi, relatively little is known about their diversity in the
environment. While they are known to be highly diverse across species or
between widely separated populations, very few studies have looked at within
population diversity (Tigano-Milani et al., 1995; Driver et al., 2000; Pantou et
al., 2003).
Numerous commercial products using biological control agents (BCAs)
have been developed. Most of them have used Metarhizium spp.
(Zimmermann, 2007; Copping, 2009). Strains from the Metarhizium genus
infect a range of insects comprising agronomically important pests such as
locusts, grasshoppers, termites, noctuids, scarabiid beetle larvae, spittlebugs
and other hemipterans (Zimmermann, 2007). First, the classification of
Metarhizium was based on morphological characters and was reviewed by
Tulloch (1976), who only accepted M. avoviride and M. anisopliae, the latter
with the short spored var. anisopliae and the long-spored var. majus. The
taxonomy of Metarhizium, and particularly, the M. anisopliae morphospecies
has been investigated by applying morphological, biochemical as well as
genetic characteristics (Tulloch, 1976; Driver et al., 2000; Pantou et al., 2003).
However, the proposed taxonomies have been incomplete and partially
inconsistent. Traditional identification of Beauveria species is based on
conidial morphology but also molecular phylogenies have revealed that the
genus includes cryptic species (Rehner and Buckley, 2005).

Differentiation between inter- and intra-specific groups of

entomopathogenic fungi has been possible because of molecular techniques
using DNA sequences. Techniques involving polymerase chain reaction (PCR)
amplification of DNA, such as RAPD (random amplified polymorphic DNA)
or RFLP (restriction fragment length polymorphism), analyses of nuclear or
mitochondrial DNA have been particularly useful in resolving taxonomic and
evolutionary problems in fungi (Rosewich and McDonald, 1994). These tools
have also led to a new phylogenetic classification of the fungi that has
challenged many assumptions about the relationships among
entomopathogenic and other fungi (Blackwell et al. 2006; Hibbett et al. 2007).
The globally distributed B. bassiana consists of members placed in three
separate clades which have been proposed to be considered separate species
(Rehner and Buckley, 2005; Ghikas et al., 2010): Clade A, corresponds to B.
bassiana and is the sister clade of Clade B, which comprises Beauveria
brongniartii (Rehner and Buckley, 2005). The third clade, Clade C, is distantly
related and includes members being morphologically indistinguishable from
those of Clade A (Rehner and Buckley, 2005). Therefore, identification of
Beauveria isolates of Clade C is only possible with the use of molecular
markers. In addition, Clade A consists of an assemblage of cryptic species for
which an identification system has been established designating phylogenetic
species by continent and in the order of their discovery using terminology
from Rehner et al., (2006) and Meyling et al., (2009). In case of Clade C, it has
been reported that occurs at relatively low frequencies in a Beavueria
community within a hedgerow habitat in Denmark (Meyling et al., 2009).
Phylogenetic assignment of Beauveria isolates to specific clades can be done
by sequencing the genomic DNA regions of the internal transcribed spacer
(ITS) region of the ribosomal RNA (rRNA) gene cluster (White et al., 1990),
the 5 end of Elongation Factor 1-alpha (EF1-α) (Bischoff et al., 2009) and the
intergenic Bloc region (Rehner et al., 2006). Efficiency of these regions has
been evaluated using a global collection of Beauveria spp, resulting that the
entire EF1 region provided more phylogenetic resolution than the ITS region
(Rehner and Buckley, 2005). Moreover, sequencing both EF1α and the Bloc
region of Beauveria isolates from a single community in an agro ecosystem in
Denmark has resolved isolates among Clade A, B and C as well as identified
five phylogenetic species within Clade A isolates (Meyling et al., 2009).
Further molecular characterization of isolates has become possible by using
molecular markers such as simple sequence repeat (SSR) in case of Clade A
(Rehner and Buckley, 2003; Meyling et al., 2009) and Clade B (Enkerli et al.,

2001) to assess genetic diversity of isolates from a single host species.

Meyling et al., (2012) studied the genetic diversity among 32 Beauveria
strains isolated from pollen beetles Meligethes aeneus collected in oilseed rape
fields at different sites in Switzerland, in this study it was possible to identify
three clades based on sequences of the ITS region and de 5’ end of EF1-α.
About half of the Beauveria isolates belonged to Clade C (18 of 32) indicating
that it may be widespread in the investigated Swiss farmland. In fact, studies
based on Beauveria isolates obtained from culture collections and representing
worldwide distributions have revealed frequencies of Beauveria Clade C of
17% (Rehner and Buckley, 2005) and 22% (Ghikas et al., 2010), respectively.
According to Rehner and Buckley, (2005), Beauveria Clade C isolates have
been shown to originate from five separate insect host orders indicating a wide
host range. In addition, the intergenic region Bloc provided best resolution of
the clades A and B. Further genotypic diversity was revealed by simple
sequence repeats (SSR) characterization of isolates within the clades except
for Clade A (B. bassiana) which appeared to be clonal. However, the
individual SSR markers were differentially amplified from isolates of the
different clades, suggesting that not all available SSR markers are suitable for
reliable characterization of diversity within Beauveria Clade C.
Phylogeny has been also assessed in Beauveria bassiana through analysis
of genes encoding secondary metabolites that can mediate the interaction of a
fungal pathogen with an insect host and help the fungus compete with other
microbes. Major classes of secondary metabolites include no ribosomal
peptides, alkaloids, terpenes, and polyketides, whose production appear to be
controlled by various genetic and cellular regulatory mechanisms (Punya et al.,
2015). Polyketides, in particular, have been recognized as a structurally
diverse family of natural products with various biological activities and
pharmacological properties, which are synthesized by enzymes called
polyketide synthases (PKSs). There are three types of PKSs, but fungi possess
only type I PKSs and the presence of β-keto reductase (KR), dehydratase (DH)
and enoyl reductase (ER) domains has led to classification of fungal PKSs into
three subgroups (Cox, 2007; Chooi and Tang, 2012). Amnuaykanjanasin et al.,
(2009) conducted PCR employing PKS-specific degenerate primers to identify
PKS genes from several fungi isolated from different habitats (insect cadavers,
soil, ocean, lichen, and wood), founding a group of insect-specific PKSs
classified into clade III. However, Punya et al., (2015) screened insect-specific
PKS of 23 isolates of entomopathogenic fungi amplifying 72 PKS gene
fragments in order to develop a more comprehensive phylogeny. Subsequent

phylogenetic analysis, identified three insect-specific PKS groups in reducing

clades IIa, IIb, and III which are highly conserved in entomopathogenic fungal
species. PKS genes from insect-specific clades IIa and IIb were expressed only
in insect-containing medium, while others were expressed only in PDB or in
CYB, PDB and SDY. Also, three distinct reducing PKS clades V, VI, and VIII
formed tight clusters of PKSs from various fungi with >94% NJ bootstrap
support, supporting the notion that these are three new reducing PKS clades.
As fungal polyketides from these entomopathogens represent valuable natural
product resources, these PKSs phylogeny and expression data would be
important for further studies of valuable polyketides in the future.
Metarhizium is a frequently isolated from soil environments. However,
profound knowledge of natural occurrence and distribution, genetic diversity
and community structure of the species is required to evaluate consequences of
biocontrol initiatives (Meyling and Eilenberg, 2007). In 2009, Bischoff et al.,
provided a multilocus phylogeny of the Metarhizium anisopliae (Metschn.)
Sorokin lineage and revised the taxonomy recognizing nine species within the
M. anisopliae lineage, including several cryptic species. Given the cryptic
diversity within the M. anisopliae lineage, discrimination of species cannot
solely be based on morphology but requires the use of molecular methods for
accurate identification. For species discrimination, 5’ end of the elongation
factor 1a has been highlighted as a reliable marker (Bischoff et al., 2009).
However, this region does not provide sufficient resolution for identification of
genotypes within species. Thus, for genotyping and assessing within species
diversity, simple sequence repeat (SSR) markers are currently among the most
suitable markers (Enkerli and Widmer, 2010). Enkerli et al., (2005) and
Oulevey et al., (2009) have developed SSR markers for strain-level genotyping
within the M. anisopliae lineage, which have successfully been used to
investigate molecular diversity of isolates collection (Velasquez et al., 2007;
Oulevey et al., 2009). In 2014, Steinwender et al., evaluated Metarhizium
community in soil from an agricultural field in Denmark using Tenebrio
molitor as bait insect. By sequence analysis of 5’ end of elongation factor 1a
and their genotypic diversity characterized by multilocus simple sequence
repeat (SSR) typing, 123 isolates were identified. In this study, Metarhizium
brunneum was most frequent (78.8%) followed by M. robertsii (14.6%), while
M. majus and M. flavoviride were infrequent (3.3% each). It revealed co-
occurrence of at four Metarhizium species in the soil of the same agro
ecosystem with a single M. brunneum multilocus genotype being highly

prevalent. Abundance of a single genotype could be due to variability among

Metarhizium genotypes in response to biotic and abiotic factors prevalent in
the ecosystem (Bidochka et al., 2005). Moreover, five genotypes of M.
brunneum and six genotypes of M. robertsii were identified among the isolates
based on SSR fragment length analysis, demonstrating to be highly effective in
detecting genotypic diversity beyond what could be found by sequencing 5’
EF-1α within the M. anisopliae lineage.
Additionally, the entomopathogenic hyphomycete Paecilomyces
fumosoroseus is a promising candidate for biocontrol of the Silverleaf
Whitefly Bemisia tabaci-argentifolii (Hemiptera: Aleyrodidae), which is
considered as a major insect pest in field and greenhouse crops (Lacey et al.,
1996). Since 1995, Tigano-Milani et al., demonstrated intraspecific genetic
variation in this fungus by RAPD-PCR and tRNA-PCR. However, the analysis
of 28S-rDNA sequences did not provide enough information for
differentiation of P. fumosorosesus isolates. Fargues et al., (2002) investigated
the genetic variability in 48 isolates of this fungus by analyzing the RFLPs and
sequence data of the internal transcribed spacer sequences ribosomal RNA
gene (rDNA-ITS). Digestion with six endonucleases (AluI, HaeIII, Hin6I,
HpaII, NdeII, and SmaI) allowed their separation into three distinct groups.
The group 1 was composed of strains isolated only from the host B. tabaci-
argentifolii. By contrast, the group 3 included strains from various insect host
and geographical origins. These data were strongly supported by phylogenetic
analysis of rDNA-ITS sequence that recognized three monophyletic groups
within the P. fumosoroseus complex. Thus, these molecular tools could be
useful to assess genetic relatedness of these species into the monitoring of such
biocontrol products. Genetic variations has been also suggested in P. farinosus
according to the broad geographic and host origins and morphological
variation correlated with one or more distinguishing adaptations. In the study
of Chew et al., (1997) the genetic relatedness of twenty isolates of P. farinosus
collected from seven insect species in eastern Canada was determined by
RAPD analysis. All P. farinosus isolates were clearly distinguished from three
other entomopathogenic fungi, including P. fumosoroseus; however, RAPD
banding patterns did not correlate with ecological backgrounds or
morphological phenotypes. These observations support the conclusion that P.
farinosus from eastern Canada is not composed of strains which can be
separated on the basis of the ecological or morphological criteria selected.

EVOLUTION OF PATHOGENICITY GENES

IN ENTOMOPATHOGENS
Entomopathogenous fungi have devolped production of different enzyme

and metabolites to parasitize susceptible insect hosts, among them, hydrolytic,
assimilatory, and/or detoxifying enzymes such as lipase/esterases, catalases,
cytochrome P450s, proteases, and chitinases; and (b) secondary metabolites
which facilitate infection (Ortiz-Urquiza and Keyhani, 2013). In B. bassiana
bacterial-like toxins and effector-type proteins were reported (Xiao et al.,
2012). Evolution of the genes codifying for these enzymes has been in a
convergent way. Phylogenomic studies of different species in the
Cordyceps/Metarhizium genera suggest that have evolved into insect
pathogens independently of each other, and that their similar large secretomes
and gene family expansions are due to convergent evolution (Zheng et al.,
2011). Sequencing of B. bassiana genome confirmed that ascomycete
entomopathogenicity is polyphyletic and convergent evolution to insect
pathogenicity (Xiao et al., 2012).
Lipases are the first enzymes synthesized by the entomopathogenic fungi,
in Beauveria bassiana and Metarhizium robertsii was reported a cytochrome
P450 subfamily, these enzyme break down long-chain alkenes and fatty acids
(Sanchez-Perez et al., 2014). Then, proteases are synthesized. The catalytic
function of proteases is to hydrolyze proteins releasing amino acids which
could be used for fungal nutrition (Ventura-Sobrevilla et al., 2015). One of the
protease produced are subtilisin type (Pr1) which are considered as virulence
indicators. This type of enzyme are regulated by a signal transduction
mechanism activated by the protein kinase A (PKA) mediated by AMPc
(Sanchez-Perez et al., 2014). Other important group of enzyme produced by
the entomopathogen fungi is chitinases which are used to break down the
insect chitin.
Entomopathogens fungi descend from plant–asociated fungi. Quiroz-
Velasquez et al., (2014), studying the transcriptome of Lagenidium giganteum
which is an oomycete entomopathogenic mentioned that alignments of the
cellulose synthase sequence indicated that this fungus appears to be evolved
from a phytopathogenic ancestor. In addition, these fungal species have
retained genes indicative of plant associations, and may share similar cores of
virulence factors. Members of the glycoside hydrolase family 5 subfamily 27
(GH5_27) have been proposed as putative virulence factors which may be

active on the host insect cuticle, these genes are shared by different
entomopathogenic fungi. These virulence factors may be very host specific
with a very low risk of attacking non-target organisms or beneficial insects
(Shahid et al., 2012). Metarhizium and Beauveria are also found as plant
symbionts. Recent studies showed that these fungi are more closely related to
grass endophytes and developed genes for insect pathogenesis while
maintaining an endophytic lifestyle. Some genes for insect pathogenesis may
have been co-opted from genes involved in endophytic colonization. In
contrast, other genes may be multifunctional and serve in both lifestyles
(Barelli et al., 2015).
Contraction and Expansion of Different Gene Families
Different entomopathogenic fungi such as Ophiocordyceps polyrhachis-

furcata, Beauveria bassiana, Metarhizium robertsii, Metarhizium acridum,
Cordyceps militaris, and Ophiocordyceps sinensis have similar genes
implicated in pathogenicity and virulence. In B. bassiana, many species-
specific virulence genes and gene family expansions and contractions correlate
with host ranges and pathogenic strategies (Xiao et al., 2012). Contractions of
some gene families in this type of fungi are implicated in narrow host-range
insect species (specialists), some of these genes are cuticle-degrading genes
and families of pathogen-insect interaction (PHI) genes. In some of the most
specialized entomopathogens such as O. polyrhachis-furcata, for many genes-
families has the least number of genes found (Wichadakul et al., 2015).
Reduction in gene family sizes was reported in other entomopathogen
(Hirsutella thompsonii) (Agrawal et al., 2015). The loss of different genes
involved with pathogenicity result in a reduced capacity to exploit larger
ranges of insect hosts and therefore in the different level of host specificity.
Specialization is associated with retention of sexuality and rapid evolution of
existing protein sequences (Hua et al., 2014). It is reported a co-evolution
between entomopathogens and insect-host which in some case followed
different patterns. Jensen et al., (2009) indicated that because of a high
diversification over time among dipteran insects, the insect pathogenic fungi
associated with these insects have also diversified.
On the other hand, expansions of genes involved in 1) the production of
bacterial-like toxins, and 2) retrotransposable elements have been mentioned
in O. polyrhachis-furcata, in comparison to other entomopathogenic fungi.

Expansions of gene families suggest an adaptation to particular environments

or sophisticated mechanisms underlying pathogenicity through
retrotransposons (Wichadakul et al., 2015). Similar pattern of evolutionary
expansion of gene families such as chitinases, lipases, and proteases has been
reported for Beauveria bassiana, Cordyceps militaris, and Metarhizium
anisopliae which could be attributed to their insect killing strategies and host
ranges (Agrawal et al., 2015). Generalist entomopathogens attack a wide range
of insects; this condition has been associated with protein-family expansion,
loss of genome-defense mechanisms, genome restructuring, horizontal gene
transfer, and positive selection that accelerated after reinforcement of
reproductive isolation. Generalists evolved from specialists via transitional
species with intermediate host ranges and that this shift paralleled insect
evolution (Hua et al., 2014). Species from the Metarhizium and Beauveria
genera are recognized as generalists infecting a range of insects (Meyling et
al., 2011).
Entomopathogen Fungi Pathogenicity versus

Insect-Host Defense
Insects have evolved different mechanisms in response to pathogens

attack, some of these mechanisms are: production of (epi) cuticular
antimicrobial lipids, proteins, and metabolites; (b) shedding of the cuticle
during development; and (c) behavioral-environmental adaptations (Ortiz-
Urquiza et al., 2013). After 25th generations under constant selective pressure
from Beauveria bassiana, the larvae of Greater wax moth, Galleria
mellonella, exhibited significantly enhanced resistance, which was specific to
this pathogen, and not to another insect pathogenic fungus, Metarhizium
anisopliae (Dubovskiy et al., 2013). It was hypothesized by the same authors
that insects developed a transgenerationally primed resistance which was
achieved not by compromising life-history traits but rather by prioritizing and
re-allocating pathogen-species-specific augmentations to integumental front-
line defenses that are most likely to be encountered by invading fungi.
However, there is a coevolution between entomopathogen virulence factors
and host defense molecules of insects.
Virulence is thought to co evolve as a result of reciprocal selection
between pathogens and their hosts. Because of shorter generation times and
smaller genomes, microbes exhibit a high evolutionary adaptability in

comparison with their hosts. In contrasts, insects can only compete with its
pathogens if they develop mechanisms providing a comparable genetic
plasticity (Vilcinskas, 2010). During B. bassiana infection, Galleria
mellonella systemic immune defenses are suppressed in favor of a more
limited but targeted repertoire of enhanced responses in the cuticle and
epidermis of the integument (Dubovskiy et al., 2013). If a diversification of
fungal proteinases for pathogenesis arose, an expansion of host proteinase
inhibitors subsets contributing to insect innate immunity may occur. For
example, the spectrum of proteolytic enzymes encompasses thermolysin-like
metalloproteinases and this is associated with the pathogen-virulence. This
spectrum putatively promoted the evolution of corresponding host inhibitors of
these virulence factors (Vilcinskas, 2010). The same authors mentioned other
molecular adaptations for host insect’s defense such as sensing and feedback-
loop regulation of microbial metalloproteinases. The genetic events behind the
countermeasures in host defense effectors are gene or domain duplication and
shuffling by recombination. The entomopathogens also develop different
strategies in order to avoid the host insect’s defenses. It has been proposed that
M. anisopliae and B. bassiana survive to insect phagocytic haemocytes which
are analogous to the mammalian macrophages as consequence of adaptations
that have evolved in order to avoid predation by soil amoebae (Bidochka et al.,
2010).
GENETIC IMPROVEMENT OF ENTOMOPATHOGENIC

FUNGI FOR INSECT BIOCONTROL
Mycoinsecticides are being used for the control of many insect pests as an
environmentally acceptable alternative to chemical insecticides uses (Leger et
al., 1996; Hussain et al., 2014; Ortiz, et al., 2015). From 1960s, a substantial
number of mycoinsecticides have been developed worldwide (Sardul et al.
2012). All groups of insects may be affected and over 700 species of fungi
from around 90 genera are pathogenic to insects (Khachatourians and Sohail,
2008). Basically, the fungi pathogen activity depends on the ability of its
enzymatic equipment, consisting of lipases, proteases and chitinases, which
are in charge of breaking down the insect’s integument (Sardul et al., 2012).
Besides exoenzymes, the entomopathogenic fungi are reported to secrete toxin
proteins and metabolites in vitro and sometime in vivo as well. There are a

number of toxic compounds in the filtrate of entomopathogenic fungi such as

small secondary metabolites, cyclic peptides and macromolecular proteins
(Khan et al., 2012). To improve both commercial and technical efficiency of
these entomopathogen fungi, a large number of studies had been conducting to
improve their virulence which can be achieved by understanding the
mechanisms of fungal pathogenesis and genetically modifying targeted genes.
In response, Fan et al., (2010) in order to accelerate penetration speed and
have better target protein-chitin on the cuticle, they constructed a hybrid
protease (CDEP-BmChBD) by fusion of a chitin binding domain BmChBD
from Bombyx mori chitinase to the C-terminal of CDEP-1, a subtilisin-like
protease from B. bassiana. After comparing studies, the hybrid protease was
able to bind chitin and released greater amounts of peptides/proteins from
insect cuticles. The insecticidal activity of B. bassiana was improved by
including proteases, CDEP-1 or CDEP: BmChBD produced in Pichia pastoris,
as an additive, however, the improved effect of CDEP: BmChBD was
significantly higher than that of CDEP-1. Expression of the hybrid protease in
B. bassiana also significantly increased fungal virulence compared to wild-
type and strains overexpressing the native protease. These results
demonstrated that rational design of virulence factor is a potential strategy for
strain improvement by genetic engineering. Recently, a cytochrome P450
subfamily, referred as CYP52XI and MrCYP52 has been identified in
Beauveria bassiana and Metarhizium robertsii, respectively (Sanchez-Perez et
al., 2014). Entomopathogens such as M. anisopliae and B. bassiana are well
characterized in respect to pathogenicity to several insects and have been used
as myco-biocontrol agents for biological control of agriculture pests
worldwide (Sardul et al., 2012).
Lenger et al., (2012) reported the development of a genetically improved
entomopathogenic fungus because integration of copies from the gene
encoding a regulated cuticle degrading protease (Prl) which were inserted into
the genome of M. anisopliae. Prl was constitutively overproduced in the
hemolymph of Manduca sexta, activating the prophenoloxidase system. The
combined toxic effects of Prl and the reaction products of phenoloxidase
caused larvae challenged with the engineered fungus to exhibit a 25%
reduction in time of death and reduced food consumption by 40% compared to
infections by the wild-type fungus. In addition, infected insects were rapidly
melanized, and the resulting cadavers were poor substrates for fungal
sporulation.

Fang et al., (2009) found that overexpression of a subtilisin-like protease

(Pr1A) or a chitinase (Bbchit1) resulted in increased virulence of M.
anisopliae and B. bassiana, respectively. In this study, they found that a
mixture of the B. bassiana Pr1A homolog (CDEP1) and Bbchit1 for
degradation of insect cuticle were in vitro more efficient than either CDEP1 or
Bbchit1 alone. Based on this, they constructed three plasmids; (1) Bbchit1, (2)
CDEP1, and (3) a fusion gene of Bbchit1 linked to CDEP1 each under the
control of the constitutive gpd promoter from Aspergillus nidulans. B.
bassiana transformants secreting the fusion protein (CDEP1:Bbchit1) which
penetrated the cuticle significantly faster than the wild type or transformants
overexpressing either Bbchit1 or CDEP1. Compared to the wild type, the
transformant overexpressing CDEP1 showed a 12.5% reduction in LT (50),
without a reduction in LC (50). The LT (50) of the transformant expressing
CDEP1:Bbchit1 was reduced by 24.9%. Strikingly, expression of
CDEP1:Bbchit1 resulted in a 60.5% reduction in LC (50), more than twice the
reduction obtained by overexpression of Bbchit1 (28.5%). This work
represents a significant step towards the development of hypervirulent insect
pathogens for effective pest control.
FUTURE TRENDS
It is very important to investigate more about the relation of
entomopathogenic fungi to grass endophytes and how they developed genes
for insect pathogenesis while maintaining an endophytic lifestyle. Although,
there is known that some genes for insect pathogenesis may have been co-
opted from genes involved in endophytic colonization, it is important to
understand the protein changes that lead this adaptation. On the other hand, it
has been mentioned that other genes may be multifunctional and serve in both
lifestyles, but still there is a lack of knowledge about the genes modification
and protein changes to have this dual activity. Advances in molecular tools for
phylogeny analysis could lead to significant new insights that should allow us
a better understand of the ecology of fungal entomopathogens as well as their
additional roles in nature, including as plant endophytes, antagonists of plant
pathogens, beneficial rhizosphere-associates and possibly even plant growth
promoters.

Although some entomopathogen fungi are well known, some of the fungi
of the Entomophtorales order such as Entomophtora, Erynia and Pandora
species are poorly investigated because, the culture medium used to propagate
entomopathogens such as Beauveria, Metarhizium, and Lecanicillium, are not
the most adequate for these especial entomopathogens.
CONCLUSION
Different fungal entomopathogenic species such as B. bassiana, M.
acridum, M. anisopliae, and Metarhizium brunneum have showed commercial
potential for insect control, and are considered as friendly mycoinsecticide.
The complete genome of some entomopathogen fungi such as B. bassiana has
been sequenced, which has revealed multiples gene associated with virulence.
In addition, many bacterial-like toxins and effector-type proteins were also
discovered. Entomopathogenic fungi are able to adapt to different
environments by activating well-define gene sets. During infection
entomopathogenic fungi, many genes are involved in seven steps: host
adhesion, germination, cuticle degradation, growth as blastospores, host
colonization and killing, immune response interactions and hyphal extrusion
and conidiation.
ACKNOWLEDGMENTS
A. Garcia, M. Michel, and S. Villarreal want to thank to the National
Council of Science and Technology of Mexico (CONACYT) for the financial
support during their postgraduate studies.
REFERENCES
[1] Adsure, S. P., and Mohite, P., B. 2015. Efficacy of entomopathogenic
fungi against gram pod borer, Helicoverpa armigera (HUB.) on
chickpea. Journal of Global Biosciences, 4 (8): 3154-3157.

[2] Agrawal, Y., Khatri, I., Subramanian, S., Shenoy, B. D., 2015. Genome
sequence, comparative analysis, and evolutionary insights into
chitinases of entomopathogenic fungus Hirsutella thompsonii. Genome
Biol. Evol. 916–930 DOI:10.1093/gbe/evv037.
[3] Ainsworth, G., 1973. Introduction and keys to higher taxa. In: The
fungi: An advanced treatise. Ainsworth, G., F. Sparrow and A.
Sussman. Academic Press, New York (IVA): 1-7.
[4] Amnuaykanjanasin, A., Ponghanphot, S., Sengpanich, N.,
Cheevadhanarak, S., Tanticharoen, M., 2009. Insect-specific polyketide
synthases, potential PKS-NRPS hybrids, and novel PKS clades in
tropical fungi. Appl. Environ. Microbiol. 75, 3721-3732.
[5] Barelli, L., Moonjely, S., Behie, S. W., Bidochka, M. J., 2015. Fungi
with multifunctional lifestyles: endophytic insect pathogenic fungi.
Plant Mol Biol. DOI 10.1007/s11103-015-0413-z.
[6] Barreto, C. C., Staats, C. C., Schrank, A., Vainstein, M. H., 2004.
Distribution of chitinases in the entomopathogen Metarhizium
anisopliae and effect of N-acetylglucosamine in protein secretion.
Current microbiology, 48(2), 102-107.
[7] Becerra, V. V., Paredes, M. C., Rojo, C. M., France, A. L., 2007.
RAPD and ITS reveal molecular variation of Chilean populations of
Beauveria bassiana. Agricultura Técnica. 67(2), 115-125.
[8] Berlanga, P. A. Mª. 1997. Aislamiento, identificación y conservación
de hongos entomopatógenos. Memoria del II Curso Taller de
Producción de Agentes de Control Biológico[“Isolation, identification
and conservation of entomopathogenic fungi”. Report of the II Course
Workshop on the Production of Biological Control Agents.]. Tecoman,
Colima. 18-30.
[9] Bidochka, M. J., Clark, D. C., Lewis, M. W., Keyhani, N. O., 2010.
Could insect phagocytic avoidance by entomogenous fungi have
evolved via selection against soil amoeboid predators? Microbiology
156: 2164–2171.
[10] Bidochka, M. J., Small, C. L. N., Spironello, M., 2005. Recombination
within sympatric cryptic species of the insect pathogenic fungus
Metarhizium anisopliae. Environ. Microbiol. 7, 1361–1368.
[11] Bischoff, J. F., Rehner, S. A., Humber, R. A., 2009. A multilocus
phylogeny of the Metarhizium anisopliae lineage. Mycologia, 101(4),
512–530.

[12] Blackwell, M., Hibbett, D. S., Taylor, J. W., Spatafora, J. W., 2006.
Research coordination networks: a phylogeny of the kingdom Fungi
(Deep Hypha). Mycol. 98, 829–837.
[13] Boomsma, J. J; Jensen, A. B; Meyling, N. V; Eilenberg, J., 2014.
Evolutionary interaction networks of insect pathogenic fungi. Annu.
Rev. Entomol. 59:467-85.
[14] Broetto, L., Da Silva, W. O. B., Bailão, A. M., De Almeida Soares, C.,
Vainstein, M. H. and Schrank, A., 2010, Glyceraldehyde-3-phosphate
dehydrogenase of the entomopathogenic fungus Metarhizium
anisopliae: cell-surface localization and role in host adhesion. FEMS
Microbiology Letters, 312: 101–109. DOI: 10.1111/j.1574-
6968.2010.02103.x.
[15] Bruck, D. J., 2010. Fungal entomopathogens in the rhizosphere.
BioControl, 55(1), 103-112.
[16] Bulat, S. A., Lubeck, M., Alekhina, I. A., Jensen, D. F., Knudsen, I. M.
B., Lubeck, P. S., 2000. Identification of a universally primed-PCR-
derived sequence characterized amplified region marker for an
antagonistic strain of Clonostachys rosea and development of a strain-
specific PCR detection assay. Appl. Environ. Microbiol., 66:4758–
4763.
[17] Bustillo, A., 2001. Hongos en insectos y posibilidades de uso en el
control biológico de plagas en Colombia. In: seminario Uso de
entomopatógenos en Colombia. Sociedad Colombiana de Entomología.
30-53.
[18] Cabrera, R. I., Domínguez, D. 1987. Hirsutella nodulosa e Hirsutella
kirchneri; dos nuevos hongos patógenos del ácaro del moho
Phyllocoptruta oleivora. Ciencia y Técnica en la agricultura, Cítricos
y otros Frutales [Hirsutella nodulosa and Hirsutella kirchneri; two
new pathogenic mold fungus phyllocoptruta oleivora fungi. Science
and Technology in Agriculture, Citrus and other Fruit Trees], 10
(2):135-138.
[19] Cañedo, V and Ames, T., 2004. Manual de laboratorio para el manejo
de hongos entomopatógenos. Primera edición. Centro Internacional de
la Papa. [Laboratory manual for the management of entomopathogenic
fungi. First edition. International Potato Center]

[20] Chew, J. S. K., Strongman, D. B., MacKay, R. M., 1997. RFLP

analysis of rRNA intergenic spacer region of 23 isolates of the
entomopathogen Paecilomyces farinosus. Can. J. Bot. 75, 2038-2044.
[21] Chooi, Y. H., Tang, Y., 2012. Navigating the Fungal Polyketide
Chemical Space: From Genes to Molecules. J Organ. Chem. 77, 9933-
9953.
[22] Cory, J. S., and Ericsson, J. D., 2010. Fungal entomopathogens in a
tritrophic context. BioControl, 55(1), 75-88.
[23] Cory, J. S., and Hoover, K., 2006. Plant-mediated effects in insect–
pathogen interactions. Trends in ecology & evolution, 21(5), 278-286.
[24] Cox, R. J., 2007. Polyketides, proteins and genes in fungi: programmed
nano-machines begin to reveal their secrets. Organ. Biomol. Chem. 5,
2010-2026.
[25] De Faria, M., and S. Wraight., 2007. Mycoinsecticides and
Mycoacaricides: A comprehensive list with worldwide coverage and
international classification of formulation types. Biological Control
43:237256.
[26] Díaz, B. M., López Lastra, C. C., Oggerin, M., Fereres, A., Rubio, V.,
2008. Identificación de hongos entomopatógenos asociados a pulgones
en cultivos hortícolas en la zona centro de la Península Ibérica. Bol.
San. Veg. Plagas, 34: 287-296.
[27] Driver, F., Milner, R. J., Trueman, J. W. H., 2000. A taxonomic
revision of Metarhizium based on a phylogenetic analysis of
rDNAsequence data. Mycol. Res. 104, 134–150.
[28] Dubovskiy I. M, Whitten MM, Yaroslavtseva ON, Greig C, Kryukov
VY, Grizanova EV, Mukherjee K, Vilcinskas A, Glupov VV, Butt TM.
2013. Can insects develop resistance to insect pathogenic fungi?. PLoS
One 8(4):e60248. doi: 10.1371/journal.pone.0060248. Epub 2013 Apr
1.
[29] Ebrahimi, S. Sabbagh, S. K, Aminaei, M., Khosravimoghadam, F.,
Rostami, F., 2015. Genetic diversity of Paecilomyces variotii isolates
by SSR marker in Kerman province, Iran. Mycologia Iranica. 2(1), 38
– 45.
[30] Elósegui, C. O., Jiménez, R. J., Carr, P, A., 2006. Aislamiento,
identificación y caracterización morfométrica de aislados nativos de
hongos mitospóricos con potencialidad para el control de especies de
insectos plaga. Fitosanidad, 10 (4):265-272.

[31] Elósegui, C. O. Primera edición. Métodos artesanales de reproducción

de plaguicidas a partir de hongos entomopatógenos y antagonistas.
Instituto de Investigaciones de Sanidad Vegetal. [Handmade methods
of reproduction of pesticides from entomopathogenic fungi and
antagonists. Institute of Plant Health Research] 2006.
[32] Enkerli, J., Kolliker, R., Keller, S., Widmer, F., 2005. Isolation and
characterization of microsatellite markers from the entomopathogenic
fungus Metarhizium anisopliae. Molecular Ecology Notes, 5:384-386.
[33] Enkerli, J., Widmer, F., 2010. Molecular ecology of fungal
entomopathogens: molecular genetic tools and their applications in
population and fate studies. Biocontrol 55, 17–37.
[34] Enkerli, J., Widmer, F., Gessler, C. Keller, S., 2001. Strain-specific
microsatellite markers in the entomopathogenic fungus Beauveria
brongniartii. Mycological Research, 105, 1079-1087.
[35] Fan Y, Pei X, Guo S, Zhang Y, Luo Z, Liao X, Pei Y., 2010. Increased
virulence using engineered protease-chitin binding domain hybrid
expressed in the entomopathogenic fungus Beauveria bassiana. Microb
Pathog. 49(6):376-80. DOI: 10.1016/j.micpath.2010.06.013.
[36] Fan Y, Ortiz-Urquiza A, Kudia RA, Keyhani NO., 2012. A fungal
homologue of neuronal calcium sensor-1, Bbcsa1, regulates
extracellular acidification and contributes to virulence in the
entomopathogenic fungus Beauveria bassiana. Microbiology
158(7):1843-51. DOI: 10.1099/mic.0.058867-0.
[37] Fang W, Feng J, Fan Y, Zhang Y, Bidochka MJ, Leger RJ, Pei Y.,
2009. Expressing a fusion protein with protease and chitinase activities
increases the virulence of the insect pathogen Beauveria bassiana. J
Invertebr Pathol., 102(2):155-9. DOI: 10.1016/j.jip.2009.07.013.
[38] Fang W, Leng B, Xiao Y, Jin K, Ma J, Fan Y, Feng J, Yang X, Zhang
Y, Pei Y., 2005. Microbiology. All Rights Reserved. Cloning of
Beauveria bassiana Chitinase Gene Bbchit1 and Its Application To
Improve Fungal Strain Virulence. Applied and Enviromental
Microbiology 71(1): 363-370. DOI:10.1128/AEM.71.1.363–370.
[39] FAO. Resistencia a los antiparasitarios: estado actual con énfasis en
América Latina. Roma: Dirección de producción y sanidad animal de
la FAO [Resistance to antiparasitics: current state with emphasis in
Latin America. Rome: FAO Production and Animal Health Division],
2003. 33-35.

[40] Fargues, J., Bon, M-C., Manguin, S., Couteaudier, Y., 2002. Genetic
variability among Paecilomyces fumosoroseus isolates from various
geographical and host insect origins based on the rDNA-ITS regions.
Mycol. Res. 106, 1066-1074.
[41] Fernandes, E. K. K., Moraes, A. M. L., Pacheco, R. S., Rangel, D. E.
N., Miller, M. P., Bittencourt, V. R. E. P., Roberts, D. W., 2009.
Genetic diversity among Brazilian isolates of Beauveria bassiana:
comparisons with non-Brazilian isolates and other Beauveria species.
Journal of Applied Microbiology. 107, 760-774.
[42] Flores, M. A., Pucheta, D. M., Ramos-López, M. A., Rodríguez, N. S.,
Ramos, E. G., Juárez, R. D. 2013. Estudio del hongo entomopatógeno
Isaria fumosorosea como control microbiológico de la mosquita blanca
[Study of the entomopathogenic fungus Isaria fumosorosea as
microbiological control of the white mosquito]Bemicia tabaci.
Interciencia, 38 (7):523-527.
[43] Freed, S., Jin, F. L., Ren, S. X., 2011. Determination of genetic
variability among the isolates of Metarhizium anisopliae var.
anisopliae from different geographical origins. World J Microbiol
Biotechnol. 27. 359–370.
[44] Galidevara S, Reineke A, Koduru UD., 2016. In vivo expression of
genes in the entomopathogenic fungus Beauveria bassiana during
infection of lepidopteran larvae. J Invertebr Pathol. 2(136):32-34.
DOI: 10.1016/j.jip.2016.03.002.
[45] Garrido-Jurado, I., Fernandez-Bravo, M., Campos, C., Quesada-
Moraga, E., 2015. Diversity of entomopathogenic Hypocreales in soil
and phylloplanes of five Mediterranean cropping systems. Journal of
Invertebrate Pathology. 130, 97–106.
[46] Gauthier, N., Dalleau-Clouet, C., Fargues, J., 2007. Microsatellite
variability in the entomopathogenic fungus Paecilomyces
fumosoroseus: genetic diversity and population structure. Mycologia,
99:693-704.
[47] Gerson, U., Kenneth, R., Muttath, T. l. 1979. Hirsutella thompsonii a
fungal pathogen of mites. II Host-pathogen interacctions. Ann. Appl.
Biol. 91:29-40.

[48] Ghikas, D. V., Kouvelis, V. N., Typas, M. A., 2010. Phylogenetic and
biogeographical implications inferred by mitochondrial intergenic
region analyses and ITS15. 8S-ITS2 of the entomopathogenic fungi
Beauveria bassiana and B. brongniartii. BMC Microbiol. 10, 174.
[49] Goble, T. A., Conlong, E. E., Hill, M. P., 2015. Virulence of Beauveria
brongniartii and B. bassiana against Schizonycha affinis white grubs
and adults (Coleoptera: Scarabaeidae). J. Appl. Entomol. 139, 134–145.
[50] Golo PS, Santos HA, Perinotto WM, Quinelato S, Angelo IC, Camargo
MG, Sá FA, Massard CL, Fernandes ÉK, Roberts DW, Bittencourt
VR., 2015. The influence of conidial Pr1 protease on pathogenicity
potential of Metarhizium anisopliae senso latu to ticks. Parasitol Res.
114(6):2309-15. DOI: 10.1007/s00436-015-4426-y.
[51] Guan Y, Wang DY, Ying SH, Feng MG., 2015. A novel Ras GTPase
(Ras3) regulates conidiation, multi-stress tolerance and virulence by
acting upstream of Hog1 signaling pathway in Beauveria bassiana.
Fungal Genet Biol. 82:85-94. DOI: 10.1016/j.fgb.2015.07.002.
[52] Guo, L. D., 2010. Molecular diversity and identification of endophytic
fungi. In Gherbawy, Y., Voigt, K. editors. Molecular Identification of
Fungi. Springer Heidelberg Dordrecht London New York. Springer,
277-296.
[53] Hassan, A. E. M., Dillion, R. J., and A. K. Charnley., 1989. J Invert.
Pathol, 54, 227-279.
[54] Hernández, M. A. A., Rosón, Á. C., Daquinta, R., C. Trujillo, M., R.
2005. Evaluación in vitro de la patogenicidad de Aschersonia aleyrodis
webber sobre algunos insectos plaga de interés económico.
Fitosanidad, 9(4): 29-34.
[55] Hernández, V., V. M., Berlanga P., A. M., Garza G. E., 1997.
Detección de Metarhizium flavoviridae sobre Schistocerca piceifrons
(Orthoptera: Acrididae) en las Islas Socorro, Archipiélago de
Revillagigedo, México. Vedalia 4: 45-46.
[56] Hesketh, H., Roy, H. E., Eilenberg, J., Pell, J. K., & Hails, R. S., 2009.
Challenges in modelling complexity of fungal entomopathogens in
semi-natural populations of insects. In The Ecology of Fungal
Entomopathogens (pp. 55-73). Springer Netherlands.

[57] Hibbett, D. S., Binder, M., Bischoff, J. F., Blackwell, M., Cannon, P.
F., Eriksson, O., Huhndorff, S., James, T., Kirk, P. M., Lücking, R.,
Lumbsch, T., Lutzoni, F., Matheny, P. B., McLaughlin, D. J., Powell,
M. J., Redhead, S., Schoch, C. L., Spatafora, J. W., Stalpers, J. A.,
Vilgalys, R., Aime, M. C., Aptroot, A., Bauer, R., Begerow, D., Benny,
G. L., Castlebury, L. A., Crous, P. W., Dai, Y.-C., Gams, W., Geiser,
D. M., Griffith, G. W., Gueidan, C., Hawksworth, D. L., Hestmark, G.,
Hosaka, K., Humber, R. A., Hyde, K., Köljalb, U., Kurtzman, C. P.,
Larsson, K.-H., Lichtwardt, R., Longcore, J., Mialikowska, J., Miller,
A., Moncalvo, J.-M., Mozley-Standridge, S., Oberwinkler, F.,
Parmasto, R., Reeb, V., Rogers, J. D., Roux, C., Ryvarden, L.,
Sampaio, J. P., Schuessler, A., Sugiyama, J., Thorn, R. G., Tibell, L.,
Untereiner, W. A., Walker, C., Wang, Z., Weir, A., Weiss, M., White,
M., Winka, K., Yao, Y.-J., Zhang, N., 2007. A higher-level
phylogenetic classification of the fungi. Mycol. Res. 111, 509–547.
[58] Hua, X., Xiao, G., Zhenga, P., Shanga, Y., Sub, Y., Zhangb, X., Liub,
X., Zhana, S., Legerc R. J., Wanga, Ch., 2014. Trajectory and genomic
determinants of fungal-pathogen speciation and host adaptation. PNAS
111(47):16796–16801.
[59] Hubka, V., and Kolarik, M., 2012. ß-tubulin paralogue tubC is
frequently misidentified as the benA gene in Aspergillus section Nigri
taxonomy: primer specificity testing and taxonomic consequences.
Persoonia 29, 1–10. Hussain, A., Tian, MY., Ahmed S., Shahid M.,
2012. Current status of entomopathogenic fungi as mycoinsecticides
and their inexpensive development in liquid cultures. In García M. D.,
(Ed.), Zoology InTech, Available from: http://www.intechopen.com/
books/zoology/current-status-of-entomopathogenic-fungi-as-
mycoinecticides-andtheir-inexpensive-development-in-liq.
[60] Hussain, A., Rizwan-ul-Haq, M., Al-Ayedh, H., Al-Jabr, A. M. 2014.
Mycoinsecticides: Potential and future perspective. Recent Patents on
Food, Nutrition & Agriculture, 6:45-53.
[61] Inglis, G. A., Enkerl, J., Goettel, M. S. Laboratory Techniques Used
for Entomopathogenic Fungi: Hypocreales. pp. 189-253. In: L. Lacey
(Ed.). Manual of Techniques in Insect Pathology.2da. Edition
Academic Press. 2012.
[62] Jensen, A. B.; Eilenberg, J; Lastra, C. L., 2009: Differentially aphid
and fly host driven divergence of obligate insect pathogenic
Entomophthora species. FEMS Microbiology Letters 300: 180-187.

[63] Jensen, A., B., Thomsen L., Eilenberg. J. 2006. Value of host range,
morphological, and genetic characteristics within the Entomophthora
muscae species complex. Mycol., Res 110: 941-950.
[64] Junges Â, Boldo JT, Souza BK, Guedes RL, Sbaraini N, Kmetzsch L,
Thompson CE, Staats CC, de Almeida LG, de Vasconcelos AT,
Vainstein MH, Schrank A., 2014. Genomic analyses and
transcriptional profiles of the glycoside hydrolase family 18 genes of
the entomopathogenic fungus Metarhizium anisopliae. PLoS One. 18;
9(9):e107864. DOI: 10.1371/journal.pone.0107864.
[65] Keller, S., Kalsbeek V., Eilenberg J., 1999. Redescription of
Entomophthora muscae (Cohn) Fresenius. Sydowia, 51 (2): 197-209.
[66] Khachatourians G. G., Sohail S. Q., 2008. Entomopathogenic fungi, In:
Brakhage A. A., and Zipfel P. F. (eds.), Biochemistry and molecular
biology, human and animal relationships, 2nd Edition. The Mycota VI,
Springer-Verlag, Berlin, Heidelberg.
[67] Khan S, Nadir S, Lihua G, Xu J, Holmes KA, Dewen Q., 2016.
Identification and characterization of an insect toxin protein, Bb70p,
from the entomopathogenic fungus, Beauveria bassiana, using
Galleria mellonella as a model system. J Invertebr Pathol. 133:87-94.
DOI: 10.1016/j.jip.2015.11.010.
[68] Khan, S., Guo L., Maimaiti Y., Mijit M., Qiu D., 2012.
Entomopathogenic fungi as microbial biocontrol agent. Molecular
Plant Breeding, 3(7):63-79 (DOI: 10.5376/mpb.2012.03.0007).
[69] Khudhair M. W., Alrubeai, H. F., Khalaf, M. Z., Shbar, A. K., Hamad,
B. S., Khalaf, H. S., 2014. Occurrence and distribution of
entomopathogenic fungi in Iraqi agro-ecosystems. Int. J. Entomol. Res.
2: 117-124.
[70] Koduru UD, Galidevara S, Reineke A, Pathan AAK., 2014.
Bioinformatic tools in the analysis of determinants of pathogenicity
and ecology of entomopathogenic fungi used as microbial insecticides
in crop protection. In: Kavi Kishor PB, Rajib Bandopadhyay,
Prashanth Suravajhala (eds). Agricultural Bioinformatics. 215-234.
[71] Lacey, L. A., Fransen, J. J., Carruthers, R. I., 1996. Global distribution
of naturally occurring fungi of Bemisia, their biologies and use as
biological control agents. In Bemisia 1995: taxonomy, biology,
damage, control and management (D. Gerling & R. Mayer, eds): 401-
433. Intercept, Andover.

[72] Leão MP, Tiago PV, Andreote FD, de Araújo WL, de Oliveira NT.,
2015. Differential expression of the pr1A gene in Metarhizium
anisopliae and Metarhizium acridum across different culture
conditions and during pathogenesis. Genet Mol Biol. 38(1):86-92. DOI:
10.1590/S1415-475738138120140236.
[73] Leger, R. J., Lokesh Joshi, Michael J. Bidochka, and Donald W.
Roberts., 1996. Construction of an improved mycoinsecticide
overexpressing a toxic protease. Proc. Natl. Acad. Sci. 93:6349-6354.
[74] Li, J., Li, H., Bi, X., Zhang, K. Q., 2013. Multiple gene genealogical
analyses of a nematophagous fungus Paecilomyces lilacinus from
China. Journal of Microbiology. 51(4), 423–429.
[75] Liu, M., Chaverri, P., Hodge, K., T., 2006. A taxonomic revision of the
insect biocontrol fungus Aschersonia aleyrodis, its allies with white
stromata and their Hypocrella sexual states. Mycological Research,
110(5): 537–554.
[76] Lobo LS, Luz C, Fernandes ÉK, Juárez MP, Pedrini N., 2015.
Assessing gene expression during pathogenesis: Use of qRT-PCR to
follow toxin production in the entomopathogenic fungus Beauveria
bassiana during infection and immune response of the insect host
Triatoma infestans. J Invertebr Pathol. 128:14-21. DOI:
10.1016/j.jip.2015.04.004.
[77] López-Llorca, L. V., and Jansson, H. B., 2001. Biodiversidad del
suelo: control biológico de nemátodos fitopatógenos por hongos
nematófagos. Cuadernos de biodiversidad: publicación cuatrimestral
del Centro Iberoamericano de la Biodiversidad [Soil Biodiversity:
biological control of phytopathogenic nematodes by nematophagous
fungi. Biodiversity notebooks: four-monthly publication of the Ibero-
American Biodiversity Center], (6), 12-15.
[78] Luan, F., Zhang, S., Wang, B., Huang, B., Li, Z., 2012. Genetic
diversity of the fungal pathogen Metarhizium spp., causing epizootics
in Chinese burrower bugs in the Jingting Mountains, eastern China.
Mol Biol Rep. 40(1), 515-23.
[79] Luo X, Keyhani NO, Yu X, He Z, Luo Z, Pei Y, Zhang Y., 2012. The
MAP kinase Bbslt2 controls growth, conidiation, cell wall integrity,
andvirulence in the insect pathogenic fungus Beauveria bassiana.
Fungal Genet Biol 49(7):544-55. DOI: 10.1016/j.fgb.2012.05.002.
[80] MacLeod, D., M., Muller-Kogler, E., Wilding N., 1976.
Entomophthora species with E. muscae-like conidia. Mycologia, 68: 1–
29.

[81] Mains, E., B., 1959. North American Species of Ashersonia Parasitic
on Aleyrodidae. Journal of Insect Pathology, 1:43-47.
[82] Marmaras, V. J., N. D. Charalambidis, C. G. Zervas., 1996. Immune
response in insects: the role of phenoloxidase in defense reactions in
relation to melanization and sclerotization. Archives of Insect
Biochemistry and Physiology 31:119-133.
[83] Mayerhofer, J., Lutz, A., Widmer, F., Rehner, S. A., Leuchtmann, A.,
Enkerli, J., 2015. Multiplexed microsatellite markers for seven
Metarhizium species. Journal of Invertebrate Pathology. 132, 132–
134.
[84] McCoy, C. W., 1981. Pest Control by the fungus Hirsutella thompsonii
pp. 449-512. In: Burges H. D. (ed) Academic Press, Londres.
Microbial Control of Pest and Plant Diseases 1970-1980.
[85] Meyling NV, Thorup-Kristensen K; Eilenberg J., 2011. Below- and
aboveground abundance and distribution of fungal entomopathogens in
experimental conventional and organic cropping systems. Biological
Control, 59: 180-186.
[86] Meyling, N. V., Eilenberg, J., 2007. Ecology of the entomopathogenic
fungi Beauveria bassiana and Metarhizium anisopliae in temperate
agroecosystems: potential for conservation biological control. Biol.
Control 43, 145–155.
[87] Meyling, N. V., Lübeck, M., Buckley E. P., Eilenbera, J., Rehner, S.
A., 2009. Community composition, host range and genetic structure of
the fungal entomopathogen Beauveria in adjoining agricultural and
seminatural habitats. Molecular Ecology. 18, 1282-1293.
[88] Meyling, N. V., Pilz, C., Keller, S., Widmer, S. Enkerli, J., 2012.
Diversity of Beauveria spp. isolates from pollen beetles Meligethes
aeneus in Switzerland. Journal of Invertebrate Pathology. 109, 76-82.
[89] Motta-Delgado, P. A., and Murcia-Ordoñez, B., 2011. Hongos
entomopatógenos como alternativa para el control biológico de
plagas/Entomopatogenic fungi as an alternative for biological pest
control/fungos entomopatogênicos como alternativa para o controle
biológico de pragas[Entomopathogenic fungi as an alternative for
biological pest control as an alternative for the biological control of
pests.]. Revista Ambiente & Água, 6(2), 77.

[90] Nielsen, C., Jensen, A. B., Eilenberg, J., 2008. Survival of

entomophthoralean fungi infecting aphids and higher flies during
unfavorable conditions and implications for conservation biological
control. In: Ekesi, S., Maniania, N. K. (Eds.), Use of
Entomopathogenic Fungi in Biological Pest Management. Research
SignPost, Kerala, India, 13–38.
[91] Oliveira, I., Pereira, J. A., Quesada-Moraga, E., Lino-Neto, T., Bento,
A., & Baptista, P., 2013. Effect of soil tillage on natural occurrence of
fungal entomopathogens associated to Prays oleae Bern. Scientia
Horticulturae, 159, 190-196.
[92] Ortiz-Urquiza A, Luo Z, Keyhani NO., 2015. Improving
mycoinsecticides for insect biological control. Appl Microbiol
Biotechnol., 99(3):1057-68. DOI: 10.1007/s00253-014-6270-x.
[93] Ortiz-Urquiza, A., Keyhani, N.O., 2013. Action on the surface:
Entomopathogenic fungi versus the insect cuticle. Insects, 4:357-374;
DOI:10. 3390/insects4030357.
[94] Oulevey, C., Widmer, F., Kölliker, R., Enkerli, J., 2009. An optimized
microsatellite marker set for detection of Metarhizium anisopliae
genotype diversity on field and regional scales. Mycol. Res. 113, 1016–
1024.
[95] Pantou, M. P., Mavridou, A., Typas, M. A., 2003. IGS sequence
variation, group-I introns and the complete nuclear ribosomal DNA of
the entomopathogenic fungus Metarhizium: excellent tools for isolate
detection and phylogenetic analysis. Fungal Genet. Biol. 38, 159.
[96] Pérez, C. N., 2004. Manejo ecológico de plagas. Primera edición.
CEDAR.
[97] Peterson, S. W., 2008. Phylogenetic analysis of Aspergillus species
using DNA sequences from four loci. Mycologia 100, 205-226.
[98] Punya, J., Swangmaneecharern, P., Pinsupa, S., Nitistaporn, P.,
Phonghanpot, S., Kunathigan, V., Cheevadhanarak, S., Tanticharoen,
M., Amnuaykanjanasin, A., 2015. Phylogeny of type I polyketide
synthases (PKSs) in fungal entomopathogens and expression analysis
of PKS genes in Beauveria bassiana BCC 2660. Fung. Biol. 119, 538-
550.
[99] Qin Y, Ortiz-Urquiza A, Keyhani NO., 2014. A putative
methyltransferase, mtrA, contributes to development, spore viability,
protein secretion and virulence in the entomopathogenic fungus
Beauveria bassiana. Microbiology. 160(Pt 11):2526-37. DOI: 10.1099/
mic.0.078469-0.

[100] Quiroz-Velasquez, P. F., Abiff, S. K., Fins, K. C., Conway, Q. B.,

Salazar, N. C., Delgado, A. P., Dawes, J. K., Douma, L. G., Tartar, A.,
2014. Transcriptome analysis of the entomopathogenic oomycete
Lagenidium giganteum reveals putative virulence factors. Appl.
Environ. Microbiol. 80(20): 6427-6436.
[101] Rehner, S. A., Buckley, E. P., 2003. Isolation and characterization of
microsatellite loci from the entomopathogenic fungus Beauveria
bassiana (Ascomycota: Hypocreales). Mol. Ecol. Notes 3, 409–411.
[102] Rehner, S. A., Buckley, E. P., 2005. A Beauveria phylogeny inferred
from nuclear ITS and EF1α sequences: evidence for cryptic
diversification and links to Cordyceps telemorphs. Mycol. 97, 84–98.
[103] Rehner, S. A., Posada, F., Buckley, E. P., Infante, F., Castillo, A.,
Vega, F. E., 2006. Phylogenetic origins of African and Neotropical
Beauveria bassiana s.l. pathogens of the coffee berry borer,
Hypothenemus hampei. J. Invert. Pathol. 93, 11–21.
[104] Reineke, A., Brischoff-Schaefer, M., Rondot, Y., Galidevara, S.,
Hirsch, J., Devi, K. U., 2014. Microsatellite markers to monitor a
commercialized isolate of the entomopathogenic fungus Beauveria
bassiana in different environments: Technical validation and first
applications. Biological Control. 70, 1–8.
[105] Rosas-García NM, Ávalos-de-León O, Villegas-Mendoza JM, Mireles-
Martínez M, Barboza-Corona JE, Castañeda-Ramírez JC., 2014.
Correlation between pr1 and pr2 gene content and virulence in
Metarhizium anisopliae strains. J. Microbiol. Biotechnol. 24(11):
1495-1502 http://dx.DOI.org/10.4014/jmb.1404.04044.
[106] Rosewich, U. L., McDonald, B. A., 1994. DNA fingerprinting in fungi.
Methods Mol. Cel. Biol. 5, 41-48.
[107] Rostami, F., Khosravi, M. F., Kazem, S. S., Saeidi, S., 2015.
Comparison of PCR-RFLP based on ribosomal regions and ssr markers
in genetic diversity of pistachio die-back caused by Paecilomyces
variotii. Gene Cell Tissue. 2(1), 2-4.
[108] Samson, R. A., 1974. Paecilomyces and some allied Hyphomycetes.
Studies in Mycology, 6: 80-83.
[109] Samson, R. A., McCoy, C. W., O’Donnell, K. L., 1980. Taxonomy of
the acarine parasite Hirsutella thompsonii. Mycologia, 72: 359-377.

[110] Samson, R. A., Visagie, C. M., Houbraken, J., Hong, S. B., Hubka, V.,
Klaassen, C. H. W., Perrone, G., Seifert, K. A., Susca, A., Tnney, J. B.,
Varga, J., Kocsubé, S., Szigeti, G., Yaguchi, T., Frisvad, J. C., 2014.
Phylogeny, identification and nomenclature of the genus Aspergillus.
Studies in Mycology 78, 141-173.
[111] Sánchez-Pérez, L. C, Barranco-Florido, J. E., Rodríguez-Navarro, S.,
Cervantes-Mayagoitia, J. F., Ramos-López, M. Á., 2014. Enzymes of
entomopathogenic fungi, advances and insights. Advances in Enzyme
Research, 2:65-76. http://dx.DOI.org/10.4236/aer.2014.22007.
[112] Sansores-Lara LI, Palomo-Kumul J, Mijangos C., 2014. Manual de
producción y formulación de hongos entomopatógenos: Manejo de
hongos entomopatogenos, EAE.
[113] Sandhu, S. S., Sharma A. K., Beniwal V., Goel G., Batra P., Kumar A.,
Jaglan S., Sharma AK., Malhotra S., 2012. Myco-biocontrol of insect
pests: Factors involved, mechanism and regulation. J. Pathogens, Vol.
2012. 10.1155/2012/126819. DOI:10.1155/2012/126819.
[114] Schoch, C. L., Seifert, K. A., Huhndorf, S., et al., 2012. Nuclear
ribosomal internal transcribed spacer (ITS) region as a universal DNA
barcode marker for Fungi. Proceedings of the National Academy of
Sciences of the USA 109, 6241–6246.
[115] Sevim A, Donzelli BGG, Wu D, Demirbag Z, Gibson DM, Turgeon
BG., 2012. Hydrophobin genes of the entomopathogenic fungus,
Metarhizium brunneum, are diferentially expressed and corresponding
mutants are decreased in virulence. Curr Genet 58:79-92. DOI
10.1007/s00294-012-0366-6.
[116] Shahid, A. A., Rao, A. Q., Bakhsh, A., Husnain, T., 2012.
Entomopathogenic fungi as biological controllers: New insights into
their virulence and pathogenicity. Arch. Biol. Sci., Belgrade, 64 (1): 21-
42, DOI:10. 2298/ABS1201021S21.
[117] Steinwender, B. M., Enkerli, E., Widmer, F., Eilenber, J., Thorup-
Kristensen, K., Meyling, N. V., 2014. Molecular diversity of the
entomopathogenic fungal Metarhizium community within an
agroecosystem. Journal of Invertebrate Pathology. 123, 6–12.
[118] Sugimoto, M., Koike M., Hiyama N., Nagao H., 2002. Genetic,
morphological, and virulence characterization of the entomopathogenic
fungus Verticillium lecanii. Journal of Invertebrate Pathology 82:176–
187.

[119] Tanada, Y. and H. K. Kaya., 1993. Insect pathology. Primera edición.

Academic Press, San Diego, California.
[120] Tellez, J. A; Cruz, R. M. G; Mercado, F. Y; Assaf, T.; Arana, C. A.,
2009. Mecanismos de acción y respuesta en la relación de hongos
entomopatógenos e insectos. Revista Mexicana de Micología. 30: 73-
80.
[121] Tigano-Milani, M. S., Honeycutt, J., Lacey, L. A., Assis, R.,
McClelland, M., Sobral, W. S., 1995. Genetic variability of
Paecilomyces fumosoroseus isolates revealed by molecular markers. J.
Inv. Pathol. 65, 274-282.
[122] Tulloch, M., 1976. Genus Metarhizium. T. Brit. Mycol. Soc. 66, 407–
411.
[123] Valero-Jiménez CA, Wiegers H, Zwaan BJ, Koenraadt CJM, van Kan
JAL., 2016. Genes involved in virulence of the entomopathogenic
fungus Beauveria bassiana. Journal of Invertebrate Pathology. 133:
41-49.
[124] Vega, F. E., Goettel, M. S., Blackwell, M., Chandler, D., Jackson, M.
A., Keller, S., and Pell, J. K., 2009. Fungal entomopathogens: new
insights on their ecology. Fungal Ecology, 2(4), 149-159.
[125] Velasquez, V. B., Carcamo, M. P., Merino, C. R., Iglesias, A. F.,
Duran, J. F., 2007. Intraspecific differentiation of Chilean isolates of
the entomopathogenic fungi Metarhizium anisopliae var. anisopliae as
revealed by RAPD, SSR and ITS markers. Genetics Mol. Biol. 30, 89–
99.
[126] Ventura-Sobrevilla J., Boone D., Rodriguez-Herrera R., Martinez-
Hernandez J. L., Aguilar C., 2015. Microbial biosynthesis of enzymes
for food applications. In edited by Rickey Yada. Improving and Tailoring
Enzymes for Food Quality and Functionality. Elsevier. 85-99.
[127] Vilcinskas, A., 2010. Coevolution between pathogen-derived
proteinases and proteinase inhibitors of host insects, Virulence, 1:3,
206-214, DOI: 10.4161/viru.1.3.12072.
[128] Visalakshy, P. G., Krishnamoorthy, A., & Kumar, A. M., 2005. Note:
Effects of plant oils and adhesive stickers on the mycelia growth and
conidiation of Verticillium lecanii, a potential entomopathogen.
Phytoparasitica, 33(4), 367-369.

[129] Wang C and St Leger RJ., 2007. The MAD1 Adhesin of Metarhizium
anisopliae links adhesion with blastospore production and virulence to
insects, and the MAD2 adhesin enables attachment to plants. Eukaryot
Cell 6(5): 808-816. DOI: 10.1128/EC.00409-06.
[130] Wang Z, Meng H, Zhuang Z, Chen M, Xie L, Huang Bo., 2013.
Molecular cloning of a novel subtilisin-like protease (Pr1A) gene from
the biocontrol fungus Isaria farinose. Appl Entomol Zool 48:477–487
DOI: 10.1007/s13355-013-0208-0.
[131] Wang ZL, Li F, Li C, Feng MG., 2014. Bbssk1, a response regulator
required for conidiation, multi-stress tolerance, and virulence of
Beauveria bassiana. Appl Microbiol Biotechnol. 98(12):5607-18. DOI:
10.1007/s00253-014-5644-4.
[132] White, T. J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and
direct sequencing of fungal ribosomal RNAgenes for phylogenetics. In
PCR Protocols: a guide to methods and applications (M. A. Innis, D.
H. Gelfand, J. J. Sninsky & T. J. White, eds): 315-322. Academic
Press, San Diego.
[133] Wichadakul, D., Kobmoo, N., Ingsriswang, S., Tangphatsornruang, S.,
Chantasingh, D., Luangsa, J. J., Eurwilaichitr, L., 2015. Insights from
the genome of Ophiocordyceps polyrhachis-furcata to pathogenicity
and host specificity in insect fungi. BMC Genomics, 16:881.
[134] Xiao, G., Ying, S. H., Zheng, P., Wang, ZL., Zhang, S., Xie, X. Q.,
Shang, Y., Leger, R. J., Zhao, G. P., Wang, Ch., Feng, M.G., 2012.
Genomic perspectives on the evolution of fungal entomopathogenicity
in Beauveria bassiana. Scientific Reports, 2: 483. DOI:
10.1038/srep00483.
[135] Xie X-Q, Wang J, Huang B-F, Ying S-H, Feng M-G., 2010. A new
manganese superoxide dismutase identified from Beauveria bassiana
enhances virulence and stress tolerance when overexpressed in the
fungal pathogen. Appl Microbiol Biotechnol 86:1543-1553. DOI:
10.1007/s00253-010-2437-2.
[136] Xie XQ, Guan Y, Ying SH, Feng MG., 2013. Differentiated functions
of Ras1 and Ras2 proteins in regulating the germination, growth,
conidiation, multi-stress tolerance and virulence of Beauveria
bassiana. Environ Microbiol. 15(2):447-62. DOI: 10.1111/j.1462-
2920.2012. 02871.x.

[137] Zare, R., Gams, W., 2001. A revision of Verticillium sect. Prostata IV.
The genera Lecanicillium and Simplicillium gen. Nova Hedwigia, 73:1-
50.
[138] Zhang S, Xia YX, Kim B, Keyhani NO., 2011. Two hydrophobins are
involved in fungal spore coat rodlet layer assembly and each play
distinct roles in surface interactions, development and pathogenesis in
the entomopathogenic fungus, Beauveria bassiana. Mol Microbiol.
80(3):811-26. DOI: 10.1111/j.1365-2958.2011.07613.x.
[139] Zheng, P., Xia, Y., Xiao, G., Xiong, Ch., Hu, X., Zhang, S., Zheng, H.,
Huang, Y., Zhou, Y., Wang, S., Zhao, G. P., Liu, X., Leger, R. J.,
Wang, Ch., 2011. Genome sequence of the insect pathogenic fungus
Cordyceps militaris, a valued traditional Chinese medicine. Genome
Biology, 12:R116.
[140] Zimmermann, G., 2007. Review on safety of the entomopathogenic
fungus Metarhizium anisopliae. Biocontrol Sci. Technol. 17, 879–920.
[141] Zimmermann, G., 1986. The Galleria baits method for detection of
entomopathogenic fungi in soil. J. Appl. Entomol. 102:213-215.
BIOGRAPHICAL SKETCH
Raúl Rodríguez-Herrera
Affiliation: School of Chemistry- Universidad Autónoma de Coahuila
Education: Agriculture minor Horticulture. 1981. Universidad Autónoma

Agraria Antonio Narro. México
M. S. Plant Breeding. 1986. Universidad Autónoma Agraria Antonio
Narro. México
Ph. D. Plant Breeding 1999. Texas A&M University. USA.
Post-doctorate and sabbatical training 1999, 2014. United States
Department of Agriculture. USA
Address: School of Chemistry

Universidad Autónoma de Coahuila
Blvd. V. Carranza e Ing. José Cárdenas S/n
Col. Republica Saltillo Coahuila 25280 México

Research and Professional Experience:
1999-to date Full professor- Universidad Autónoma de Coahuila- México

1999 Post-doctorate training Texas A&M University-USDA USA
1997-1998 Graduate Assistant Texas A&M University-USA
1986-1998 Researcher-National Research Institute for Forestal, Agricultural
and Livestock-Mexico
1982-1984 Administrator- Ministry of Agrarian Reform-Mexico
Professional Appointments:
Mexican Society of Biotechnology and Bioengineering. México

Directive Committee Symposium “Genomes and Proteomes in XXI Century.”
México
Institute of Food Technologists. USA
Mexican Association of Food Science (AMECA). Mexico
Honours
1981. Graduated with honours from the UAAAN.

1988. Award to outstanding research. PCCMCA Congress. San José, Costa
Rican.
1990. Award to outstanding research. PCCMCA Congress. San Salvador, El
Salvador.
2001. Distinguished as National Researcher- Level 2 Mexico.
2003. National Prize on Food Science and Technology. CONACYT-Coca
Cola México, D. F.
2005. Coahuila State Prize for outstanding Food Research Project. Saltillo
Coahuila, Mexico.
2005. National Agro-Bio Prize on Agricultural Biotechnology-Mexico
Publications Last 3 Years:
Selected Publications (Total 216 refereed publications, 60 divulgation

papers, 51 book chapters, 5 books, 6 patents, 8 bulletins, recent refereed
publications are listed).

1. Meléndez Rentería, NP., Aguilar, CN., Rodríguez Herrera, R., Nevárez

Moorillón, GV., 2013. Microbiological effect of fermented Mexican
oregano (Lippia berlandieri Schauer) waste. Waste and Biomass
Valorization. DOI 10.1007/s12649-013-9222-2
2. M. Cruz-Requena, H. De La Garza-Toledo, C. N. Aguilar-González, A.
Aguilera-Carbó, H. Reyes-Valdés, M. Rutiaga and R. Rodríguez-
Herrera. 2013. Chemical and molecular properties of sotol plants
(Dasylirion cedrosanum) of different sex and its fermentation products.
International Journal of Basic and Applied Chemical Sciences 3 (1):.
41-49.
3. Diana B. Muñiz-Márquez, Guillermo C. Martínez-Ávila, Jorge E.
Wong-Paz, Ruth Belmares-Cerda, Raúl Rodríguez-Herrera, Cristóbal N.
Aguilar. 2013. Ultrasound-assisted extraction of phenolic compounds
from Laurus nobilis L. and their antioxidant activity. Ultrasonics
Sonochemistry 20: 1149–1154. doi: 10.1016/j.ultsonch.2013.02.008.
4. Juan A. Ascacio-Valdés, José J. Buenrostro, Reynaldo De la Cruz,
Leonardo Sepúlveda, Antonio F. Aguilera, Arely Prado, Juan C.
Contreras, Raúl Rodríguez and Cristóbal N. Aguilar. 2014. Fungal
biodegradation of pomegranate ellagitannins. Basic Journal of
Microbiology. 54:28-34. DOI 10.1002/jobm.201200278.
5. Ascacio-Valdés, Juan, Burboa, Edgardo, Aguilera-Carbo Antonio F.,
Aparicio Mario, Pérez-Schmidt Ramón, Rodríguez Raúl, Aguilar
Cristóbal N. (2013). An antifungal ellagitannin isolated from Euphorbia
antisyphilitica Zucc. Asian Pac J Trop Biomed. 3(1): 41–46. doi:
10.1016/S2221-1691(13)60021-0. IF = 0.371.
6. T. López, A. Prado-Barragán, G.V. Nevárez-Moorillón, J. C. Contreras,
R. Rodríguez and C.N. Aguilar. 2013. Incremento de la capacidad
antioxidante de extractos de pulpa de café por fermentación láctica en
medio sólido CyTA – Journal of Food, 11(4):359-365. dx.doi.org/10.
1080/19476337.2013.773563.
7. Luis C. Mata, Catalina Chavez, Raúl Rodríguez-Herrera, Daniel
Hernández-Castillo and Cristobal N. Aguilar. 2013. Growth inhibition of
some phytopathogenic bacteria by cell-free extracts from Enterococcus
sp. British Biotechnology Journal, 3(3): 359-366.

8. Emilio Ochoa-Reyes, Gabriela Martínez-Vazquez, Saul Saucedo-Pompa,

Julio Montañez, Romeo Rojas-Molina, Miguel A. de Leon-Zapata, Raúl
Rodríguez-Herrera and Cristóbal N. Aguilar. 2013. Improvement of
shelf life quality of green bell peppers using edible coating formulations.
Journal of Microbiology, Biotechnology and Food Sciences, 2 (6) 2448-
2451
9. Tanya Cecilia Espinoza-Hernández, Raúl Rodríguez-Herrera, Cristóbal
Noé Aguilar- González, Faustino Lara-Victoriano, Manuel Humberto
Reyes-Valdés and Francisco Castillo- Reyes. 2013. Characterization of
three novel pigment-producing Penicillium strains isolated from the
Mexican semi-desert. African Journal of Biotechnology 12(22): 3405-
3413.
10. Lorena Lara-Fernández, Heliodoro de la Garza-Toledo, Jorge E. Wong-
Paz, Ruth Belmares, Raúl Rodríguez-Herrera and Cristóbal N. Aguilar.
2013. Separation conditions and evaluation of antioxidant properties of
boldo (Peumus boldus) extracts. Journal of Medicinal Plant Research,
7(15): 911-917.
11. Delgado-García, M. Cruz Hernández, M.A., De la Garza-Rodríguez, I.,
Balagurusamy N, Aguilar, C., Rodríguez-Herrera, R. 2013.
Characterization of halophilic microorganisms isolated from Mexican
saline soils, ARPN Journal of Agricultural and Biological Science,
8(6):457-464.
12. Ascacio-Valdés, J., Aguilera-Carbo Antonio F., Rodríguez Raúl, Aguilar
Cristóbal N. (2013). Análisis de ácido elágico en algunas plantas del
semidesierto mexicano[Analysis of ellagic acid in some Mexican semi-
desert plants]. Revista Mexicana de Ciencias Farmacéuticas. 44(2): 36-
40.
13. Y.N. Mora, J.C. Contreras, C. N. Aguilar, P. Meléndez, I. De la Garza,
R. Rodríguez, 2013. Chemical composition and functional properties
from different sources of dietary fiber. American Journal of Food and
Nutrition. 1(3):27-33. DOI:10.12691/ajfn-1-3-2.
14. Mondragon-Preciado, G., Escalante-Minakata, P., Osuna-Castro, J.A.,
Ibarra-Junquera, V., Morlett-Chavez, J.A., Aguilar-Gonzalez, C.N.,
Rodriguez-Herrera, R., 2013. Bacteriocinas: características y aplicación
en alimentos. Investigacion y Ciencia 59[Bacteriocins: characteristics
and application in foods. Research and Science 59]: 64-70.

15. M. Cruz-Requena, C.N. Aguilar-González, J. Espinoza-Velázquez, M.H.

Reyes-Valdés and R. Rodríguez-Herrera. 2013. AFLPs loci associated
with polyembryonic maize using selective genotyping analysis. Israel
Journal of Plant Sciences. 61(1-4):46-50. DOI: 10.1080/07929978
.2014.950045
16. Jorge E. Wong-Paz, Diana B. Muñiz-Márquez, Pedro Aguilar-Zárate,
Raúl Rodríguez-Herrera and Cristóbal N. Aguilar. 2013. Microplate
quantification of total phenolic content from plant extracts obtained by
conventional and ultrasound methods. Phytochem. Anal. DOI
10.1002/pca.2512.
17. D.B. Muñiz-Márquez, R. Rodríguez, N. Balagurusamy, M.L. Carrillo, R.
Belmares, J.C. Contreras, G.V. Nevárez & C.N. Aguilar (2014) Phenolic
content and antioxidant capacity of extracts of Laurus nobilis L.,
Coriandrum sativum L. and Amaranthus hybridus L., CyTA - Journal of
Food, 12:3, 271-276, DOI: 10.1080/19476337.2013.847500
18. V. Padilla-García, F. Castillo-Reyes, C. N. Aguilar-González, A.
Cuenca-Arana, A. Téllez-Jurado, M. H. Reyes-Valdez and R.
Rodríguez-Herrera. 2014. Molecular characterization of six tannase-
producers Aspergillus strains using PCR-RFLP of ITS and IGS regions
and RAPD´s. International Journal of Molecular Biology 8(12): 451-
459.
19. GCG Martinez-Avila, A.F. Aguilera, S. Saucedo, R. Rojas, R. Rodriguez
and CN Aguilar. 2014. Fruit wastes fermentation for phenolic
antioxidants production and their application in manufacture of edible
coatings and films, Critical Reviews in Food Science and Nutrition.
54(3):303-11 DOI:10.1080/10408398.2011.584135 ISSN 1040-8398
(Print), 1549-7852 (Online). JCR FI= 4.510.
20. Salvador Eduardo Vásquez Rivera, Mayra Alejandra Escobar-Saucedo,
Diana Morales, Cristóbal Noé Aguilar and Raúl Rodríguez-Herrera.
2014. Synergistic effects of ethanolic plant extract mixtures against
food-borne pathogen bacteria. African Journal of Biotechnology 13(5):
699-704.
21. Norma P. Meléndez, Virginia Nevárez-Moorillón, Raúl Rodríguez-
Herrera, José C. Espinoza and Cristóbal N. Aguilar. 2014. A microassay
for quantification of 2,2-diphenyl-1- picrylhydracyl (DPPH) free radical
scavenging. African Journal of Biochemistry Research 8(1):14-18.

22. Dulce A. Flores-Maltos, Solange I. Mussatto, Juan C. Contreras

Esquivel, Juan J. Buenrostro, Raúl Rodríguez, José A. Teixeira and
Cristóbal N. Aguilar. 2014. Typical Mexican agroindustrial residues as
supports for solid-state fermentation. American Journal of Agricultural
and Biological Sciences 9 (3): 289-293.
23. Reynaldo De la Cruz Quiroz, Sevastianos Roussos, Daniel Hernández,
Raúl Rodríguez, Francisco Castillo, and Cristóbal N. Aguilar. 2014.
Challenges and opportunities of the bio-pesticides production by solid-
state fermentation: filamentous fungi as a model. Critical Reviews in
Biotechnology. (doi:10.3109/07388551.2013.857292).
24. Veana F., Fuentes-Garibay J.A., Aguilar C.N., Rodríguez-Herrera R.,
Guerrero-Olazarán M., Viader-Salvadó J. M. (2014). Gene encoding a
novel invertase from a xerophilic Aspergillus niger strain and production
of the enzyme in Pichia pastoris. Enzyme and Microbial Technology 63:
28-33.
25. M. Delgado, J. Mendez, R. Rodríguez-Herrera, C.N. Aguilar, M. Cruz-
Hernández & N. Balagurusamy (2014): Characterization of phosphate-
solubilizing bacteria isolated from the arid soils of a semi-desert region
of north-east Mexico, Biological Agriculture & Horticulture: An
International Journal for Sustainable Production Systems, 30(3):211–
217. DOI: 10.1080/01448765.2014.909742
26. Jorge E. Wong-Paz, Juan C. Contreras-Esquivel, Diana Muñiz-Marquez,
Ruth Belmares, Raul Rodriguez, Patricia Flores and Cristobal N.
Aguilar. 2014. Microwave-assisted extraction of phenolic antioxidants
from semiarid plants. American Journal of Agricultural and Biological
Sciences 9 (3): 299-310. ISSN: 1557-4989doi:10.3844/ajabssp.2014.
299.310.
27. K. Cruz-Aldaco, C. N. Aguilar, A. Ilyina, R. Rodríguez-Herrera and J.
L. Martínez-Hernández. 2014. Surface adhesion fermentation for lipase
production by Mucor griseocyanus Micol. Apl. Int., 26(1): 9-16.
28. J.A. Borrego-Terrazas, F. Lara-Victoriano, A.C. Flores-Gallegos, F.
Veana, C.N. Aguilar and R. Rodríguez-Herrera. 2014. Nucleotide and
amino acid variation of tannase gene from different xerophylic
Aspergillus strains. Canadian Journal of Microbiology. 60: 509–516.
10.1139/cjm-2014-0163.

29. Chávez-González, Mónica L.; Guyot, Sylvain; Rodríguez-Herrera, Raúl,

Prado-Barragán, Arely; Aguilar, Cristóbal N. 2014. Production profiles
of phenolics from fungal tannic acid biodegradation in submerged and
solid-state fermentation. Process Biochemistry. 49(4):541-546.
30. Ayerim Hernández-Almanza, Julio Montanez-Sáenz, Cristian Martínez-
Ávila, Raúl Rodríguez-Herrera, Cristóbal N. Aguilar. 2014. Carotenoid
production by Rhodotorula glutinis YB-252 in solid-state fermentation.
Food Bioscience 7:31–36.
31. Hernández-Almanza, Ayerim; Cesar Montanez, Julio; Aguilar-González,
Miguel A.; Martínez-Ávila, Cristian; Rodríguez-Herrera, Raúl; Aguilar,
Cristóbal N. 2014. Rhodotorula glutinisas source of pigments and
metabolites for food industry. Food Bioscience. 5(3):64-72.
32. Burboa E.A., Ascacio V., J.A., Zugasti C., A., Rodriguez H., R., Aguilar
G., C.N. 2014. Capacidad antioxidante y antibacteriana de extractos de
residuos de candelilla. Revista Mexicana de Ciencias
Farmaceuticas.[Antioxidant and antibacterial capacity of extracts of
candelilla residues. Revista Mexicana de Ciencias Farmaceuticas]
45(1):51-56.
33. Sepúlveda, L.; Buenrostro -Figueroa, J. J.; Ascacio-Valdés, J A.;
Aguilera-Carbó, A. F.; Rodríguez -Herrera, R.; Contreras-Esquivel, J.
C.; Aguilar, C. N. 2014. Submerged culture for production of ellagic
acid from pomegranate husk by Aspergillus niger GH1. Micología
Aplicada International, 26(2): 27-35.
34. Veana F., Martínez-Hernández J. L., Aguilar C. N., Rodríguez-Herrera
R. and Michelena G. 2014. Utilization of molasses and sugar cane
bagasse for production of fungal invertase in solid state fermentation
using Aspergillus niger GH1. BMJ, 45(2): 373-377.
35. JuanBuenrostro-Figueroa, Alberto Ascacio-Valdés, Leonardo
Sepúlveda, Reynaldo De la Cruz, Arely Prado-Barragán, Miguel A.
Aguilar-González, Raúl Rodríguez, Cristóbal N. Aguilar (2014).
Potential use of different agroindustrial by-products assupports for
fungal ellagitannase production undersolid-state fermentation. Food and
Bioproducts Processing 9(2): 376–382.
36. Buenrostro, J., Huerta, S., Prado, A., Ascacio, J., Sepulveda, L.,
Rodriguez-Herrera R., Aguilera, A., Aguilar, C.N., 2014. Continuous
production of ellagic acid in a packed-bed reactor. Process Biochemistry
49: 1595–1600.

37. Reynaldo de la Cruz, Juan A. Ascacio, José J. Buenrostro, Leonardo

Sepúlveda, Raúl Rodríguez, Arely Prado-Barragán, Juan C. Contreras,
Antonio Aguilera & Cristóbal N. Aguilar. 2014. Optimization of
ellagitannase production by Aspergillus niger GH1 by solid state
fermentation. Preparative Biochemistry & Biotechnology. 45:7, 617-
631, DOI:10.1080/10826068.2014.940965.
38. Flores-Gallegos AC., Morlett-Chávez JA., Aguilar CN., Riutort M.,
Rodríguez-Herrera R., 2014. Gene encoding inulinase isolated from
Penicillium citrinum ESS and its molecular phylogeny. Applied
Biochemistry and Biotechnology. 175:1358-1370 DOI 10.1007/s12010-
014-1280-9
39. Flores-Gallegos, A.C., Morlett-Chavez J.A., Rodríguez-Herrera R. 2014.
Inulin potential for enzymatic obtaining of prebiotic oligosaccharides.
Critical Reviews in Food Science and Nutrition. DOI:10.1080/
10408398.2013.807220.
40. Delgado-García, M., Aguilar, C.N., Contreras-Esquivel, J.C. and
Rodríguez-Herrera, R. 2014. Screening for extracellular hydrolytic
enzymes production by different halophilic bacteria. Mycopath 12(1):
17-23.
41. F. Veana, D. G. Rodríguez-Reyna, E. T. Aréchiga-Carvajal, C. N.
Aguilar and R. Rodríguez-Herrera. 2014. Isolation of a putative
Invertase gene from the xerophilic Aspergillus niger GH1 strain.
Mycopath Mycopath (2014) 12(2): 77-82.
42. M. Govea Salas, A.M. Rivas Estilla, Jesus Morlett, Sonia Amelia
Lozano Sepúlveda, R. Rodríguez Herrera, C.N. Aguilar González. 2014.
P420 gallic acid has antiviral effect against hepatitis c virus (hcv), which
is mediated by its antioxidant activity. Journal of Hepatology (Impact
Factor: 11.34). 60(1):S208. DOI: 10.1016/S0168-8278(14)60582-.
43. Naivy Y. Nava-Cruz, Miguel A. Medina-Morales, Jose L. Martinez, R.
Rodriguez, and Cristobal N. Aguilar. 2015. Agave biotechnology: an
overview. Critical Reviews in Biotechnology. 35(4):546-559.
(doi:10.3109/07388551.2014.923813).
44. Silvia Marina González-Herrera, Raul Rodriguez Herrera, Mercedes
Guadalupe López, Olga Miriam Rutiaga, Cristobal Noe Aguilar, Juan
Carlos Contreras Esquivel, Luz Araceli Ochoa Martínez, (2015),”Inulin
in food products: prebiotic and functional ingredient,” British Food
Journal, 117 (1): 371 – 387.

45. Jorge E. Wong-Paz, Juan C. Contreras-Esquivel, Raúl Rodríguez-

Herrera, María L. Carrillo-Inungaray, Lluvia I. López, Guadalupe V.
Nevárez-Moorillón, Cristóbal N. Aguilar. (2015). Total phenolic
content, in vitro antioxidant activity and chemical composition of plant
extracts from semiarid Mexican region. Asian Pacific Journal of
Tropical Medicine 8(2): 104-111.
46. Virgilio Cruz, Romeo Rojas, Saúl Saucedo-Pompa, Dolores G.
Martínez, Antonio F. Aguilera-Carbó, Olga B. Alvarez, Raúl Rodríguez,
Judith Ruiz, and Cristóbal N. Aguilar. 2015. Improvement of shelf life
and sensory quality of pears using a specialized edible coating. Journal
of Chemistry 1-7. Article ID 138707.
47. Miguel A. De León-Zapata, Aide Sáenz-Galindo, Romeo Rojas-Molina,
Raúl Rodríguez-Herrera, Diana Jasso-Cantú,Cristóbal N. Aguilar. 2015.
Edible candelilla wax coating with fermented extract of tarbush
improves the shelf life and quality of apples. Food Packaging and Shelf
Life. 3:70-75 doi:10.1016/j.fpsl.2015.01.001.
48. Jose Antonio Fuentes-Garibay, Cristobal Noe Aguilar, Raul Rodrıguez-
Herrera, Martha Guerrero-Olazaran, Jose Marıa Viader-Salvado. 2015.
Tannase sequence from a xerophilic Aspergillus niger strain and
production of the enzyme in Pichia pastoris. Molecular Biotechnology
57:439–447. DOI 10.1007/s12033-014-9836-z.
49. Flores-Gallegos, A.C., Morlett-Chávez, J.M., Contreras-Esquivel, J.C.,
Aguilar, C.N., Rodríguez-Herrera, R. 2015. Comparative study of
Mexican fungal strains for thermostable inulinase production. Journal of
Bioscience and Bioengineering. 119 (4):421-426, http://dx.doi.org/
10.1016/j.jbiosc.2014.09.020.
50. Castillo-Reyes, F., Hernández-Castillo, FD., Gallegos-Morales, G.,
Flores-Olivas, A., Rodríguez-Herrera, R., Aguilar, CN., 2015.
Efectividad in vitro de Bacillus y polifenoles de plantas nativas de
México sobre Rhizoctonia-Solani. [In vitro effectiveness of Bacillus and
polyphenols from native plants of Mexico on Rhizoctonia-Solani]
Revista Mexicana de Ciencias Agrícolas. 6(3): 549-562.
51. Marselino Avendaño-Sanchez, José Espinoza-Velázquez, Alondra
Gutiérrez-López, Adriana Carolina Flores-Gallegos, Raúl Rodríguez-
Herrera. 2015. Secuencias nucleotídicas de la región ITS en familias S1
y PL de maíces poliembriónicos. [Nucleotide sequences of the ITS
region in S1 and PL families of polyembryonic maize] Revista Mexicana
de Ciencias Agrícolas 6(3): 509-521.

52. Garduño-Velázquez, S., Quero-Carrillo, AR., Bonnett, D., Rodríguez-

Herrera, R., Pérez-Hernández, A., Hernández-Garay, A. 2015. Nivel de
ploidía en poblaciones de Leptochloa dubia (Kunth) Nees nativas de
México. [Level of ploidy in populations of Leptochloa dubia (Kunth)
Nees native to Mexico] Revista Mexicana de Ciencias Agricolas,
6(3):539-548.
53. González-Morales S., Cruz-Requena, M., Rodríguez-Vidal A, Aguilar-
González C.N., Rebolloso-Padilla O, and Rodríguez-Herrera R 2015.
Persistence of transgenic genes and proteins during soybean food
processing. Food Bioscience, 1 1: 4 3 – 4 7.
54. Marco Mata-Gómez, Solange I. Mussatto, Raul Rodríguez, Jose A.
Teixeira, Jose L. Martinez, Ayerim Hernandez, Cristóbal N. Aguilar.
2015. Gallic Acid Production with Mouldy Polyurethane Particles
Obtained from Solid State Culture of Aspergillus niger GH1. Applied
Biochemistry and Biotechnology (on line). DOI 10.1007/s12010-015-
1634-y
55. Santiago Garduño Velázquez, Raúl Rodríguez Herrera, Adrián
Raymundo Quero Carrillo, Javier Francisco Enríquez Quiroz, Alfonso
Hernández Garay y Alejandra Pérez Hernández. 2015. Diversidad
morfológica, citológica y valor nutritivo de siete nuevos genotipos de
pasto buffel (Cenchrus ciliaris L.) y un cultivar tolerante al frío.[
Morphological, cytological and nutritional value of seven new genotypes
of buffel grass (Cenchrus ciliaris L.) and a cold tolerant cultivar] Revista
Mexicana de Ciencias Agrícolas 6(7): 1679-1687.
56. Juan de Dios Hernández-Quintero, M. Humberto Reyes-Valdés, Dulce
V. Mendoza-Rodríguez, Martha Gómez-Martínez y Raúl Rodríguez-
Herrera. (2015). Estudio de los cromosomas mitóticos y meióticos del
sotol (Dasylirion cedrosanum Trel.)[Study of mitotic and meiotic
chromosomes of sotol (Dasylirion cedrosanum Trel.)]. YTON
International Journal of Experimental Botany. 84(1):107-113
57. Mayra Alejandra Escobar-Saucedo, Raúl Rodríguez-Herrera, Alfonso
Reyes-López, Marisol Cruz-Requena, Héctor Flores-Chávez, Cristóbal
N. Aguilar. 2014. Análisis genético y bromatológico de siete mutantes
de manzano (Malus domestica Borkh) del cultivar Golden Delicious.
Ecosistemas y Recursos Agropecuarios 1[Genetic and bromatological
analysis of seven apple mutants (Malus domestica Borkh) of cultivar
Golden Delicious. Ecosystems and Agricultural Resources 1](3):269-
279.

58. Aarón Casas Acevedo, Cristóbal Noé Aguilar González, Heliodoro De

La Garza Toledo, Jesús Antonio Morlett Chávez, Didier Montet, Raúl
Rodríguez Herrera. 2015. Importancia de las levaduras no-
Saccharomyces durante la fermentación de bebidas alcohólicas.
Investigacion y Ciencia 65(5):73-79.Muñiz-Marquez, D. M., Contreras-
esquivel J.C., Rodriguez-Herrera R., Wong-Paz, J.E., Texeira A.,
Musato SI., Aguilar CN., 2015. Influence of thermal effect on sugars
composition of Mexican Agave syrup. CyTA - Journal of Food, 13:4,
607-612 DOI.org/10.1080/1947 6337.2015.1028452.
60. Gabiela Macias de la Cerda, Fabiola Veana, Juan Carlos Contreras
Esquivel, Cristóbal Noé Aguilar y Raúl Rodríguez Herrera. 2015.
Cinética de crecimiento de Fusarium oxysporum cultivado en diferentes
niveles de glucosa y pectina. Revista Investigación y Ciencia
(ACEPTADO).
61. Mayela Govea-Salas, Ana Maria Rivas-Estilla, Raul Rodríguez-Herrera,
Sonia A. Lozano-Sepúlveda, Cristobal N. Aguilar-Gonzalez, Alejandro
Zugasti-Cruz, Tanya B. Salas-Villalobos and Jesus Antonio
Morlett-Chávez. 2015. Gallic acid decreases hepatitis C virus expression
through its antioxidant capacity. Experimental and Therapeutic
Medicine. DOI: 10.3892/etm.2015.2923.
62. Eduardo Osorio, Francisco Daniel Hernández Castillo, Raúl Rodríguez
Herrera, Sostenes Edmundo Varela Fuentes, Benigno Estrada Drouaillet
y José Alberto López Santillan. 2015. Actividad antagónica de
trichoderma spp. sobre Rhizoctonia solani in vitro. Revista Investigación
y Ciencia (ACEPTADO).
63. Francisco Castillo-Reyes, Francisco Daniel Hernández-Castillo, Julio
Alberto Clemente-Constantino, Gabriel Gallegos-Morales, Raúl
Rodríguez-Herrera and Cristóbal Noé Aguilar. 2015. In vitro antifungal
activity of polyphenols-rich plant extracts against Phytophthora
cinnamomi Rands. Africa Journal of Agricultural Research.
10(50):4554-4560.
64. Mónica L. Chávez-González, Lluvia I. López-López, Raúl Rodríguez-
Herrera, Juan C. Contreras-Esquivel, Cristóbal N. Aguilar. 2015.
Enzyme-assisted extraction of citrus essential oil. Chemical Papers.
DOI: 10.1515/chempap-2015-0234.
65. Pedro Aguilar-Zárate, Mario A. Cruz, Julio Montañez, Raúl Rodríguez-
Herrera, Jorge E. Wong-Paz, Ruth E. Belmares, Cristóbal N. Aguilar,
2015. Gallic acid production under anaerobic submerged fermentation
by two bacilli strains. Microbial Cell Factories. 14:209.

66. De la Cruz R, Ascacio JA, Buenrostro J, Sepúlveda L, Rodríguez R,

Prado-Barragán A, Contreras JC. Aguilera A, Aguilera CN. 2015.
Optimization of ellagitannase producion by Aspergillus niger GH1 by
solid-state fermentation. Preparative Biochem Biotechnol. 45(7). Pp
617-631. doi: 10.1080/10826068.2014.940965.
67. Ascacio-Valdes, J.A., Aguilera-Carbo, A.F., Buenrostro, J.J., Prado-
Barragan, A., Rodriguez-Herrera, R. Aguilar, C.N. 2015. The complete
biodegradation pathway of ellagitannins by Aspergillus niger in solid-
state fermentation. J. Basic Microbiol. 55, 1–8.
68. Silvia Marina Gonzalez-Herrera, Olga Miriam Rutiaga-Quiñones,
Cristobal Noe Aguilar, Luz Araceli Ochoa-Martínez, Juan Carlos
Contreras-Esquivel, Mercedes G. Lopez, Raúl Rodríguez-Herrera. 2016.
Dehydrated apple matrix supplemented with Agave fructans, inulin, and
oligofructose. LWT - Food Science and Technology. 65:1059-1065.
69. Miguel A. De León-Zapata, Lorenzo Pastrana-Castro, María Luisa Rua-
Rodríguez, Olga Berenice Alvarez-Pérez, Raul Rodríguez-Herrera &
Cristóbal N. Aguilar. 2016. Experimental protocol for the recovery and
evaluation of bioactive compounds of tarbush against postharvest fruit
fungi. Food Chemistry 198: 62–67.
70. Dulce A. Flores-Maltos, Solange I. Mussatto, Juan C. Contreras-
Esquivel, Raúl Rodríguez-Herrera, J.A. Teixeira, Cristóbal N. Aguilar
2016. Biotechnological production and applications of
fructooligosaccharides Critical Reviews in Biotechnology. 36(2)18:1-9.
doi:10.3109/07388551.2014.953443.
Books
Aguilar, C.N., R. Rodríguez H., S. Saucedo P., D. Jasso C. 2008. Phyto-

chemicals from Mexican semi-desert: from plant to natural chemicals and
biotechnology. Ed. Path Design. Saltillo Coahuila México 579 p (in
Spanish).
Soto-Cruz, O., P.M. Ángel, A. Gallegos-Infante and R. Rodríguez-Herrera.
2008. Advances in Food Science and Food Biotechnology in Developing
Countries. AMECA. Saltillo Coahuila México 330 p.
Rodríguez H., R., O. Soto C., J.L. Martínez, C.N. Aguilar. 2009. Proteomes
and Genomes in the XXI century: Environmental Biotechnology. Ed. Valle
del Candamo, Monclova Coah. México 356 p. (in Spanish).

Rodríguez Herrera, R., Aguilar González, C.N., Simpson-Williamson, J.K.,

Gutiérrez Sánchez, G.. 2011 Phytopathology in the omics era. Signpost
Research. Kerlala India. 366p. ISBN 978-81-308-0438-5.
Flores AC., González VM., Aguilar CN., Rodríguez R., 2014. Microbial
Biofertilizers. Ed. Plaza y Valdes. 434p. ISBN: 978-607-402-177-1.
Mexico (in Spanish).

Chapter 2
MITOCHONDRIAL POPULATION
GENETICS INFERENCES ABOUT
THE PHYLOGEOGRAPHY AND
SYSTEMATICS OF THE TAYRA (EIRA
BARBARA, MUSTELIDAE, CARNIVORA)
Manuel Ruiz-García1,, Nicolás Lichilín-Ortíz1,

Yolanda Mejia1, Juan Manuel Ortega1
and Joseph Mark Shostell2
1
Laboratorio de Genética de Poblaciones-Biología Evolutiva,
Unidad de Genética. Departamento de Biología,
Facultad de Ciencias. Pontificia Universidad Javeriana,
Bogotá DC, Colombia
2
Department of Math Science and Technology,
University of Minnesota Crookston, Crookston, MN, US

Corresponding Author Email: mruizgar@yahoo.es, mruiz@javeriana.edu.co.

64 Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.
ABSTRACT
We sequenced the mitochondrial (mt) ND5 gene of 100 specimens of
Eira barbara (Mustelidae, Carnivora). The samples represented six out of
the seven putative morphological subspecies recognized for this
Mustelidae species (E. b. inserta, E. b. sinuensis, E. b. poliocephala, E. b.
peruana, E. b. madeirensis, and E. b. barbara) throughout Panama,
Colombia, Venezuela, French Guiana, Brazil, Ecuador, Peru, Bolivia,
Paraguay, and Argentina. The main results show that the genetic diversity
levels for the overall samples and within each one of the aforementioned
putative taxa were very high. The phylogenetic analyses showed that the
ancestor of the Central and South-American E. barbara originated during
the Miocene or Pliocene (6.3-4 millions of years ago, MYA).
Furthermore, the ancestors of some geographical groups, (we detected at
least four) originated during the Pliocene (3.7-2.5 MYA). These four
groups (or lineages) were placed in the Cesar-Antioquia Departments
(northern Colombia), Bolivia and northwestern Argentina, northern-
central Peru, and in the trans-Andean area of Ecuador. However, during
the Pleistocene, this species experienced a strong population expansion
and many haplotypes expanded their geographical distributions. They
became superimposed on the geographical areas of older geographical
groups that originally differentiated during the Pliocene. Until new
molecular studies are completed, including those with nuclear markers,
we proposed the existence of only two subspecies of E. barbara (E. b.
inserta in southern Central America, and E. b. barbara for all South
America). All of the demographic analyses showed a very strong
population expansion for this species in the last 400,000 YA during the
Pleistocene.
Keywords: Tayra, Eira barbara, mitochondrial ND5 gene, putative

geographical subspecies, genetic diversity, phylogeography, population
expansion during the Pleistocene
INTRODUCTION
Tayra (Eira barbara) is a Mustelidae (Carnivora, Mammalia) with a long,
and slender body. Its length varies from 56 to 71 cm, not including a 37 to 46
cm long bushy tail. Its weight ranges from 2.7 to 7 kg with males larger than
females. This species has short, dark brown to black fur that is relatively

Mitochondrial Population Genetics Inferences … 65
uniform across the body, limbs, and tail, except for a yellow or orange spot on
the chest. The fur on the head and neck is much paler, typically tan or greyish
in color. The head has small, rounded, ears, long whiskers and black eyes with
a blue-green shine. The feet have toes of unequal length with tips that form a
strongly curved line when held together. The claws are short and curved, but
strong, being adapted for climbing and running rather than digging.
This species occurs from southern Veracruz (Mexico) throughout Central
America and across South America to northern Argentina save for the high
Andes and the Caatinga and Cerrado (eastern Brazil; Emmons and Feer 1990).
It is one of the most common medium-size predators throughout its range
(Emmons and Feer 1990).
E. barbara is a diurnal, sometimes crepuscular species (González-Maya et
al., 2015), with a solitary behavior and large home range (Sunquist et al.,
1989). Emmons and Feer (1990) showed that the tayra inhabits tropical and
subtropical forests, secondary rain forests, gallery forests, gardens, cloud
forests, and dry scrub forests. Hall and Dalquest (1963) affirmed that it can
live near human disturbed habitats. It frequently occurs in agricultural areas
and along the edge of human settlements. Tayra usually inhabits areas below
1,200 m, but there are reports of it being in areas as high as 2,400 m
(Eisenberg 1989, Emmons and Feer 1990) and it is common at 2,000 m
(Cuarón et al., 2016). Its diet is omnivorous, including fruits, carrion, small
vertebrates, insects, honey and small vertebrates such as marsupials, rodents,
and iguanids among others (Cabrera and Yepes 1960, Hall and Dalquest 1963,
Emmons and Feer 1990). This species is listed as Least Concern (Cuarón et
al., 2016).
Cabrera (1957) and Hall (1981) recognized seven morphological
subspecies, two in Central America and five in South-America: 1- E. b. senex
(Thomas in 1900). The type locality is Hacienda Tortugas, Jalapa, Veracruz,
Mexico; 2- E. b. inserta (Allen in 1908), with the type locality in Ulse,
Matagalpa, Nicaragua; 3- E. b. sinuensis (Humboldt in 1812), with the type
locality for the Sinu River in the Bolivar Department in northern Colombia; 4-
E. b. poliocephala (Traill in 1821), with type locality Demerara in Guyana; 5-
E. b. madeirensis (Lonnberg in 1913), with type locality in Humaitá, Madeira
River, Brazilian Amazon; 6- E. b. peruana (Nehring in 1886), with type
locality in YuracYaku in the San Martin Department in Peru and 7- E. b.
barbara (Linnaeus in 1758) with the type locality assigned by Lonnberg
(1913) to Pernanbuco, Brazil. See Figure 1. Although it is a relatively common

species, only one preliminary study on its molecular population genetics and
infra-specific systematics has been published (Ruiz-García et al., 2013).
Therefore, we expanded upon our initial molecular population genetics
study with mitochondrial genes of the tayra with the following main aims: 1-
To estimate the mitochondrial levels of genetic diversity in the overall tayra
population and in some putative morphological subspecies; 2- To determine if
there is a correlation between the molecular clades obtained in the
phylogenetic analyses with the traditional putative morphological and
geographical subspecies of tayras; 3- To estimate the possible temporal splits
in the mitochondrial diversification within the evolution of the tayra; and 4- To
determine if demographic evolutionary changes have characterized the natural
history of the tayra.
MATERIALS AND METHODS
Samples
We sequenced 100 tayras at the mt ND5 gene. The samples came from 11
countries and represent seven of the eight putative morphological subspecies
(Table 1 & Figure 1). They are: 1- Argentina, eight individuals (putative E. b.
barbara); 2- Bolivia, 16 specimens (putative E. b. barbara); 3- Brazil, nine
exemplars (four putative E. b. barbara; five putative E. b. madeirensis); 4-
Colombia, 12 individuals (three putative E. b. madeirensis; nine putative E. b.
sinuensis); 5- Ecuador, 27 specimens (four putative E. b. sinuensis; 23 putative
E. b. madeirensis); 6- French Guiana, five exemplars (putative E. b.
poliocephala); 7- Panama, one individual (putative E. b. inserta); 8- Paraguay,
four specimens (putative E. b. barbara); 9- Peru, 17 exemplars (nine putative
E. b. peruana; eight putative E. b. madeirensis); 10- Trinidad and Tobago, one
individual (putative E. b. poliocephala). Thus, these samples represent six out
of the seven putative morphological subspecies recognized for this species.
The DNA of some of the tayra individuals we analyzed was extracted
from hairs obtained from animals found alive in diverse Indian communities
throughout Central and South America. Another fraction of the DNA was
obtained from skins, bones, and teeth of hunted individuals of E. barbara. We
requested permission to collect biological materials from these skins, bones,
and teeth that were already present in the Indian communities. In the case of

the skins, we sampled 1-2 cm2. Communities were visited only once. All
sample donations were voluntary, and no financial or other incentive was
offered for supplying specimens for analysis. For more information about
sample permissions, see the Acknowledgment section.
Table 1. Samples of taya (Eira barbara), by countries, localities and

putative geographic subspecies, sequenced at the mitochondrial
ND5 gene for this work
Country Number of Localities Putative geographic

samples studied subspecies
Panama 1 1 Chiriqui E. b. inserta
Colombia 12 2 Agustín Codazzi-Cesar 9 E. b. sinuensis
1 PNN Los Katios-Chocó 3 E. b. madeirensis
1 Zaragoza-Antioquia
1 Yarumal-Antioquia
1 PNN Tama, Norte de
Santander
2 El Tuparro-Vichada
1 San Martín-Meta
1 Playa Blanca-Guainia
1 Puerto Arara-Amazonas
1 Leticia-Amazonas
Trinidad & 1 1 Rio Claro E. b. poliocephala
Tobago
French 5 5 Camopi River E. b. poliocephala
Guiana
Ecuador 27 3 Yarinacocha-Pastaza 4 E. b. sinuensis
2 Sucua-Morona Santiago 22 E. b. madeirensis
2 La Perla-Santo Domingo de
Tsáchilas
2 Miashi-Zamora
2 Pillaro-Tungurahua
2 Canelos-Pastaza
2 Sarayaku-Pastaza
1 Coca-Napo
1 Misahuallí-Napo
1 La Bonita-Napo
1 Macuma-Morona Santiago
1 Loreto-Napo
1 Hushafindi-Napo
1 Pichincha
1 Miazal-Morona Santiago
Ecuador 1 Yangana-Loja
1 Cononaco-Pastaza
1 Tinigua-Napo
1 Nuevo Rocafuerte-Napo

Table 1 (Continued)
Peru 17 2 Iquitos-Loreto 8 E. b. madeirensis

1 Caballococha-Loreto 9 E. b. peruana
1 Nauta-Loreto
1 Luceropata-Loreto
1 Puerto Venus-Loreto
1 Lamas-San Martin
1 Moyobamba-San Martin
1 Rioja-San Martin
1 Nuevo Cajamarca-San Martin
1 Bagua Grande-Amazonas
1 Oxamarca-Cajamarca
1 Puerto Bermudez-Pasco
1 Bolognesi-Ucayali
1 Seshea-Ucayali
1 Manu-Madre de Dios
1 Marcapata-Cusco
Bolivia 16 3 Ballivian-Beni E. b. barbara
1 Piso Firme-Beni
1 Nicolas Suarez-Pando
1 Sena-Pando
1 Franz Tamayo-La Paz
1 Coripata-La Paz
1 Cajuata-La Paz
1 Totora-Cochabamba
1 Pojo-Cochabamba
1 Vila vila-Cochabamba
1 Julpe River-Cochabamba
1 El Cerro-Santa Cruz
1 Puerto Pailas-Santa Cruz
1 San Jose de Chuiquitos-Santa
Cruz
Brasil 9 3 Foz de Iguazu-Parana 4 E. b. barbara
3 Novo Airao-Negro River- 5 E. b. madeirensis
Amazonas
1 Moora-Negro River-Amazonas
1 Paumari-Yavari River-
Amazonas
1 Tres Rios-Rio de Janeiro
Paraguay 4 2 Los Cedrales E. b. barbara
2 Loma Grande
Argentina 8 2 Salta E. b. barbara
1 Abra Pampa-Jujuy
1 Humahuaca-Jujuy
1 La Cocha-Tucuman
1 Burruyacu-Tucuman
1 El Dorado-Misiones
1 San Javier-Misiones

Figure 1. Map with the approximate geographical distributions of the six putative
geographical tayra’s subspecies (Eira barbara) sequenced at the mitochondrial ND5
gene. X represent localities where samples were obtained.
Molecular Analyses
The DNA from skins and bones was extracted using the phenol-
chloroform procedure (Sambrook et al., 1989), whereas DNA samples from
hairs and teeth were extracted with 10% Chelex resin (Walsh et al., 1991).
Primers and PCR conditions for the ND5 gene (265 bp) were brought to a
volume of 25 l with 13.5 l of Mili-Q H2O, 3 l of MgCl2
1 mM, 1 l of dNTPs 0.2 mM, 1 l of each primer (0.1 M), 2.5 l of buffer
10X, and one unity of Taq Polymerase with 50-100 ng of DNA.
We used the primers L12673 and H12977 (5’-GGTGCAACTC
CAAATAAAAGTA -3’ and 5´- AGAATTCTATGATGGATCATGT 3’;
Waits et al., 1999). The PCR temperatures were 95° for 5 minutes followed by
10 cycles of 1 minute at 95°C, 1 minute at 64°C and 1.5 minute at 72°C, 25
cycles of 1 minute at 95°C, 1 minute at 60°C and 1.5 minute at 72°C and one
final extension of 15 minutes at 72°C. All amplifications, including positive
and negative controls, were checked in 2% agarose gels. Those samples that
amplified were purified using membrane-binding spin columns (Qiagen). The

PCR products were sequenced in both directions using the Big Dye™ kit in an
ABI 377A automated DNA sequencer. A consensus of the forward and reverse
sequences was determined using the Sequencher program.
It is possible that some of the sequences represent numts (mitochondrial
DNA fragments inserted into the nuclear genome) rather than true mtDNA
(Chung and Steiper, 2008). However, we note that all amino acid translations
of the obtained sequences showed the presence of initial start and terminal stop
codons and the absence of premature stop codons. Protein translation was also
checked to evaluate the possible presence of numts. Nevertheless, the
mutations we observed were synonymous changes, thus suggesting that there
were no numts in the sequences.
Data Analyses
Genetic Diversity
The statistics used to determine the genetic diversity in the overall tayra
sample and within the five South American putative tayra subspecies were as
follows: the haplotypic diversity (Hd), the nucleotide diversity (), the average
number of nucleotide differences (K), and the statistic by sequence. These
statistics were obtained using the DNAsp 5.1 software (Librado and Rozas,
2009).
Phylogenetics Analyses
The sequence alignments were carried out manually as well as with the
DNA Alignment program (Fluxus Technology Ltd.). MrModeltest
v2.3 software (Nylander, 2004) and Mega 6.05 software (Tamura et al., 2013)
were applied to determine the best evolutionary mutation model. The Akaike
and Bayesian information criteria (AIC and BIC; Akaike, 1974; Schwarz,
1978) were used to determine the best evolutionary nucleotide model in the
overall sequence set of E. barbara.
Phylogenetic trees were constructed by using two procedures: Maximum
Likelihood (MLT) and Bayesian analysis (BI). The ML trees were obtained
using the RAxML v.7.2.6 software (Stamatakis, 2006). To select the best
fitting model, 50 independent iterations were run using three data partitions
(codon 1, codon 2, and codon 3). Additionally, 50 iterations were run using
two data partitions (codons 1+2 combined, and codon 3). For each sequence
data set, the GTR + G model (General Time Reversible + gamma distributed

rate variation among sites; Tavaré, 1986) was used to search for the ML tree
and topologic support was estimated with 500 bootstrap replicates using GTR.
A BI tree was completed with the BEAST v. 1.8.1 program (Drummond et
al., 2012). Four independent iterations were run using three data partitions
(codon 1, codon 2, and codon 3) with six MCMC chains sampled every 10,000
generations for 30 million generations after a burn-in period of 3 million
generations. We checked for convergence using Tracer v1.6 (Rambaut et al.,
2013). We plotted the likelihood versus generation and estimated the effective
sample size (ESS > 200) of all parameters across the four independent
analyses to determine convergence and optimal results. The results from
different runs were combined using LogCombiner v1.8.0 and TreeAnnotator
v1.8.0 software (Rambaut and Drummond, 2013). A Yule speciation model
and a relaxed molecular clock with an uncorrelated log-normal rate of
distribution (Drummond et al., 2006) were used. Posterior probability values
provide an assessment of the degree of support of each node on the tree. The
tree was visualized in FigTree v. 1.4 software (Rambaut, 2012). This BI tree
was used to estimate the time to most recent common ancestor (TMRCA) for
the different nodes. We used a prior of 24.0 + 1 MYA (95% confidence
interval: 26.24-22.36 MYA) for the split between the ancestors of Eira and
one Procyonidae, as Potos flavus. This prior followed the results of Koepfli
et al., (2008).
Following Pennington and Dick (2010), the previous BI temporal
estimates belong to one of two different approaches for inferring divergence
times. The first approach is based on fossil-calibrated DNA phylogenies. The
second approach is named “borrowed molecular clocks” and uses direct
nucleotide substitution rates inferred from other taxa. For this second
approach, we used a median joining network (MJN) with the help of Network
4.6.10 software from Fluxus Technology Ltd (Bandelt et al., 1999). The 
statistic (Morral et al., 1994) was estimated and transformed into years of
divergence among the haplotypes studied. To determine the temporal splits, it
is necessary to estimate a mutation rate at the mt ND5 gene. We used a
nucleotide divergence of 1.22% per each million years (Culver et al., 2000),
which yielded one mutation each 309,310 years. This estimate was obtained
for Felidae. In this work, we assumed that this mutation rate could be similar
in Mustelidae. The networks are more appropriate for intraspecific
phylogenies than tree algorithms because they explicitly allow for the co-
existence of ancestral and descendant haplotypes, whereas trees treat all
sequences as terminal taxa (Posada and Crandall, 2001).

Heterogeneity Analyses
Several procedures were carried out to estimate the genetic heterogeneity
among the diverse putative tayra subspecies analyzed. To determine the
overall genetic heterogeneity in E. barbara, we used the statistics GST, ST,
NST and FST (Nei, 1973; Hudson et al., 1992). Additionally, we relied on the
HST, KST, KST*, Z, Z*, and Snn tests (Hudson, 2000), and the chi-square test
on the haplotypic frequencies with permutation tests using 10,000 replicates to
measure genetic heterogeneity. Also, we estimated the genetic heterogeneity
by subspecies pairs within E. barbara. For this task, we used three procedures:
1- Exact tests with Markov chains, 10,000 dememorizations parameters, 20
batches, and 5,000 iterations per batch; 2- Indirect gene flow estimates (Nm)
from the FST statistic with a n-dimensional island model (Slatkin, 1985; Ruiz-
García, 1993, 1994, 1997, 1999; Ruiz-García and Álvarez, 2000); and 3-
Kimura 2P genetic distances (Kimura, 1980). These genetic heterogeneity
statistics were completed with DNAsp 5.1 (Librado and Rozas, 2009) and
Arlequin 3.5.1.2 (Excoffier and Lischer, 2010).
Demographic Changes
We relied on three procedures to detect possible historical population
changes in the tayra: 1- We used the Strobeck's S statistic (Strobeck, 1987), Fu
and Li D* and F* tests (Fu and Li, 1993), the Fu FS statistic (Fu, 1997), the
Tajima D test (Tajima, 1989) and the R2 statistic (Ramos-Onsins and Rozas,
2002). A 95% confidence interval and probabilities were obtained with 10,000
coalescence permutations. 2- The mismatch distribution (pairwise sequence
differences) was obtained following the method of Rogers and Harpending
(1992) and Rogers et al., (1996). We used the raggedness rg statistic to
determine the similarity between the observed and the theoretical curves. 3- A
Bayesian skyline plot (BSP) was obtained by means of the BEAST v. 1.8.1
and Tracer v1.6 software. The Coalescent-Bayesian skyline option in the tree
priors was selected with four steps and a piecewise-constant skyline model
with 30,000,000 generations (the first 3 million discarded as burn-in), kappa
with log Normal [1, 1.25] and Skyline population size with uniform [0,
infinite; initial value 80]. In the Tracer v1.6, the marginal densities of temporal
splits were analyzed and the Bayesian Skyline reconstruction option was
selected for the trees log file. A stepwise (constant) Bayesian skyline variant
was selected with the maximum time as the upper 95% high posterior density
(HPD) and the trace of the root height as the treeModel.rootHeight. To
determine the time range for possible demographic changes for E. barbara, we
consider that the evolution of this taxon occurred during the last 4 MY.

RESULTS
Genetic Diversity and Phylogenetic Inferences
The BIC showed that the best nucleotide substitution model was
T92 + G (7,649.51). In contrast, the AIC detected GTR + G + I (5,881.29) as
the best model.
The genetic diversity levels in the overall studied sample of tayra were
very high. For the 100 individuals analyzed, we found 70 different haplotypes
with Hd = 0.983 + 0.006,  = 0.0422 + 0.0048 and k = 11.175 + 5.117. The
genetic diversity for four out of five South American putative morphological
subspecies were very similar, all of them with very high genetic diversity
levels (Hd = 0.991-0.960 and  = 0.0562-0.0308). The genetic diversity of E.
b. poliocephala was somewhat lower (Hd = 0.600 and  = 0.0176), although
the sample size for this putative subspecies was the lowest (Table 2).
Table 2. Genetic diversity in the overall sample of Eira barbara and in the
five putative South American morphological subspecies at the mt ND5
gene represented by the number of haplotypes (NH), the haplotype
diversity (Hd), the nucleotide diversity (), and the average number of
nucleotide differences (K)
Eira barbara taxa NH Hd K

Overall Sample 70 0.983 + 0.006 0.0422 + 0.0048 11.175 + 5.117
E. b. sinuensis 12 0.987 + 0.065 0.0562 + 0.0311 14.884 + 8.344
E. b.poliocephala 14 0.600 + 0.147 0.0176 + 0.0093 4.667 + 2.556
E. b. peruana 13 0.989 + 0.063 0.0517 + 0.0299 13.703 + 7.324
E. b. madeirensis 26 0.960 + 0.009 0.0308 + 0.0071 8.162 + 3.233
E. b. barbara 25 0.991 + 0.012 0.0412 + 0.0092 10.928 + 4.111
The MLT and BI can be seen in Figures 2 and 3. Both phylogenetic trees
showed that the first diverging branch represented the animal sampled in
northcentral Panama (putatively, E. b. inserta) (MLT: low bootstrap 28%; BI:
p = 1). All of the South American specimens we analyzed were placed in the
remaining cluster. However, although putatively animals from five different
subspecies were included, very few significant clades were observed, and only
partially related to the morphological subspecies. The first diverging cluster in
the South American animals was one composed by three animals from
northern Colombia (Cesar and Antioquia Departments; 50% and p = 0.97,
respectively), which corresponded with the putative E. b. sinuensis.

Nevertheless, a Bolivian exemplar and many other specimens “a priori”

classified as E. b. sinuensis by their geographical origins that did not belong to
this cluster, were present in the BI, within this clade. Henceforth, there was
only a partial correspondence between this clade and E. b. sinuensis. There
were other interesting clades in both phylogenetic trees. 1- One was composed
of three individuals from the Pacific area of trans-Andean Ecuador (61% and p
= 1, respectively), which also partially corresponded with E. b. sinuensis; 2-
Another cluster was composed of individuals from different areas of Bolivia
and mainly by individuals from northwestern Argentina (Salta, Jujuy and
Tucuman provinces) in MLT (41%). In the BI, this group was only composed
of five individuals from northwestern Argentina (p = 0.96). This cluster
was partially correlated with E. b. barbara. In the BI there was another cluster
with several Bolivian and Argentinian specimens (p = 0.84).
It was separated from the first Argentinian cluster we aforementioned.
However, as we commented for E. b. sinuensis, this relationship was
incomplete because other individuals “a priori” classified as E. b. barbara
were dispersed by other clusters; 3- Another cluster of certain relevance was
detected in the MLT and BI. It was composed of individuals of central Peru
and one individual from the northern Peruvian Amazon (80% and p = 0.72,
respectively). This cluster also partially supported the existence of the
morphological subspecies E. b. peruana; 4- Small clusters of animals from the
Ecuadorian and Colombian Amazon were present. One of them contained two
animals from the Ecuadorian and Colombian Amazon (62% and p = 1,
respectively) and other three from the Ecuadorian Amazon (73% and p = 1;
89% and p = 1; 28% and p = 0.8, respectively). These very locally restricted
clusters were inside the putative morphological subspecies, E. b. madereinsis.
Many other individuals of E. b. madereinsis were distributed in clusters with
other individuals “a priori” considered different morphological subspecies.
The BI temporal split estimate showed an initial divergence of the
ancestors of the Panamanian individual (E. b. inserta) and South-American
specimens around 6.26 MYA (95%: 5.4-8.49 MYA; Miocene divergence).
The ancestor of the clade from northern Colombia split around 3.7 MYA
(1.55-6.37 MYA). The ancestor of the animals from northwestern Argentina
diverged around 3.15 MYA (1.01-4.23 MYA). In contrast, the ancestors of
animals of north-central Peru, trans-Andean Ecuador and one of the
Ecuadorian Amazonas clusters diverged 2.88 MYA (1.23-4.2 MYA), 2.35
MYA (0.31-2.7 MYA), and 1.49 MYA (0.42-3.74 MYA), respectively.

Figure 2. (Continued)


Figure 2. Maximum likelihood tree with the 100 specimens of tayra (Eira barbara)
sequenced at the mitochondrial ND5 gene. The number in the nodes are the bootstrap
percentages. The procyonidae, Potos flavus, was employed as outgroup. In different
colors, some relevant clusters which showed a limited correspondence with some
putative morphological geographic subspecies of E. barbara.



Figure 3. Bayesian tree with the 100 specimens of tayra (Eira barbara) sequenced at
the mitochondrial ND5 gene. The three numbers in the nodes are the posteriori
probabilities, estimated temporal splits in the nodes in millions of years, and the 95%
high posterior density of these temporal splits. The procyonidae, Potos flavus, was
employed as outgroup. In different colors, some relevant clusters which showed a
limited correspondence with some putative morphological geographic subspecies of
E. barbara.

Figure 4. Median Joining Network (MJN) for the haplotypes detected in 100 tayra
(Eira barbara) sequenced at the mitochondrial ND5 gene. In light blue, one haplotype
of E. b. inserta; in pink, haplotypes of E. b. barbara; in green, haplotypes of E. b.
peruana; in yellow, haplotypes of E. b. madeirensis; in black, haplotypes of E. b.
sinuensis; and in brown, haplotypes of E. b. poliocephala. Therefore, the five putative
geographical subspecies of South American tayras and one Central America subspecies
were represented in this analysis. Little red circles are extinct or not found haplotypes.
The MJN analysis revealed a view very similar to the phylogenetic trees
(Figure 4). The major fraction of haplotypes were distributed irrespective of
the geographical distribution of the morphological subspecies. For instance,
the most frequent haplotypes (H1, H30, H7, H49, H19 and H9) included
individuals of different putative subspecies: H1 contained exemplars classified
“a priori” as madereinsis, sinuensis and barbara; H30 and H7 were composed
of madereinsis and peruana individuals; H49 enclosed individuals of
sinuensis; H19 consisted of specimens of sinuensis, peruana, madereinsis, and
barbara, whilst H9 included poliocephala and peruana.

Table 3. Temporal splits among different Eira barbara’s lineages

estimated by means of a Median Joining Network (MJN).
Values of temporal splits are in millions of years.
SD = Standard deviation
Lineages compared  + SD Temporal

divergence
Between the Panamanian haplotype (inserta) 13.000 + 1.000 4.021 + 0.309
and H49 (sinuensis)
Between the Bolivian and northern-western 12.077 + 2.097 3.735 + 0.648
Argentinian haplotypes and H7
(madereinsis, peruana)
Between the Cesar-Antioquia 10.625 + 1.829 3.286 + 0.565
(northern Colombia) haplotypes
and H7 (madereinsis, peruana)
Between the trans-Andean Ecuadorian haplotypes 3.375 + 1.008 1.043 + 0.311
Between the northcentral Peru and H7  2.886 + 0.471
Between H9 (poliocephala, peruana) and H19  0.309 + 0.154
(sinuensis, peruana, madeirensis, barbara)
Between H9 (poliocephala, peruana)  0.422 + 0.140
Between H19 (sinuensis, peruana, madeirensis,  0.141 + 0.141
barbara) and H7 (madereinsis, peruana)
Between H49 (simuensis) and H7  0.441 + 0.220
Between H30 (sinuensis) and H7  0.193 + 0.193
Between H9 (poliocephala, peruana)  0.742 + 0.185
and H1 (madeirensis, sinuensis)
Between H19 (sinuensis, peruana, madeirensis,  0.371 + 0.185
barbara) and H1 (madeirensis, sinuensis)
Between H49 (sinuensis) and H1 (madeirensis,  0.759 + 0.253
sinuensis)
Between H7 (madereinsis, peruana)  0.198 + 0.198
and H1 (madeirensis, sinuensis)
Between H30 (sinuensis) and H1  0.463 + 0.231
(madeirensis, sinuensis)
Therefore, some haplotypes were widely distributed, which agrees quite

well with extensive gene flow of this species across all of South America.
Many of these main haplotypes presented other small haplotypes in star-like

form, which is highly related to possible population expansions across the

entire South American range of the tayra. Nevertheless, the MJN, as the
phylogenetic trees, detected some haplotype clusters to be well delimited
geographically. For example, there were the cases of the Central American
individual (H66), the Cesar-Antioquia cluster (H65, H67, and H68), the trans-
Andean Ecuadorian cluster (H45, H63, and H64), and the central Peruvian
cluster (H11, H13, H18, and H20). The MJN temporal splits were slightly less
than that those obtained with BI, but relatively similar. The temporal splits
among these haplotypes and the main groups can be seen in Table 3. Some of
these time splits are interesting. The divergence between the Panamanian
individual and H7 was estimated to occur around 4.02 + 0.31 MYA. The
temporal divergence between clusters from the areas of northwestern
Argentina, Cesar-Antioquia area (northern Colombia), trans-Andean Ecuador,
and north-central Peru in reference to H7 were 3.73 + 0.65 MYA, 3.29 + 0.57,
1.04 + 0.31 MYA, and 2.89 + 0.47 MYA, respectively.
Therefore, the phylogenetics tree and the MJN analyses showed that the
ancestor of Central and South American tayras originated during the Miocene
or Pliocene. Also, the ancestors of some geographical groups, at least four of
certain relevance, originated during the Pliocene and first part of the
Pleistocene. However, during the Pleistocene (as we will show later), tayra
experienced a strong population expansion and many haplotypes expanded
their geographical distributions. They superimposed onto the geographical
areas of these older and geographical groups that originally differentiated
during the Pliocene.
Genetic Distances and Genetic Heterogeneity among

Putative Morphological Subspecies of Eira barbara
The Kimura 2P genetic distances among all of the comparison pairs of the
six putative morphological subspecies of tayra are shown in Table 4. The
differentiation between the Central American subspecies (E. b. inserta) and the
five South American subspecies was elevated (5.5% - 7.8%), which confirmed
that the Central America taxon is, at least, a different subspecies. It is
interesting to note that the less differentiated South American taxon with
regard to the Central American one was E. b. sinuensis (5.5%). It was the
South American taxon closest geographically. The genetic distances with the
other four South American taxa ranged from 7.1%-7.8%.

Table 4. Kimura 2P genetic distance (Kimura, 1980) in percentages (%)

among six different morphological subspecies of Eira barbara
(Mustelidae) (below main diagonal) and standard deviations in
percentages (%) (above main diagonal) at the mt ND5 gene.
1 = E. b. barbara; 2 = E. b. peruana; 3 = E. b. madeirensis;
4 = E. b. poliocephala; 5 = E. b. sinuensis; 6 = E. b. inserta;
7 = Potos flavus (Procyonidae)
1 2 3 4 5 6 7
1 0.1 0.1 0.4 0.1 1.4 3.5
2 0.2 0.1 0.2 0.1 1.5 3.5
3 0.2 0.1 0.4 0.1 1.5 3.7
4 0.9 0.5 0.8 0.5 1.5 3.2
5 0.3 0.5 0.4 1.2 1.2 3.5
6 7.1 7.7 7.4 7.8 5.5 3.5
7 27.5 27.5 28.5 24.6 26.5 24.9
In contrast, the genetic distances among the five South American

subspecies were very small. They ranged from 0.1% to 1.2%. The pairs of
subspecies with the greatest genetic distances were E. b. poliocephala-E. b.
sinuensis (1.2%) and E. b. poliocephala-E. b. barbara (0.9%). The overall
genetic heterogeneity for all five South American tayra subspecies taken
together was significant (Table 5), but the genetic heterogeneity was relatively
small. For example, the FST and the ST statistics showed values of 0.095 and
0.109, respectively. Their respective gene flow estimates of 4.75 and 4.10,
were relatively high among the putative South-American subspecies.
Table 5. Overall genetic heterogeneity and gene flow (Nm) statistics for
the five putative South American subspecies of Eira barbara at
the mt ND5 gene. * P < 0.05; ** P < 0.01
Estimated Genetic Differentiation P Gene flow

2 = 313.351 df = 272 0.0429* GST = 0.0336 Nm = 14.40
HST = 0.0236 0.0001** γST = 0.0951 Nm = 4.75
KST = 0.0559 0.0001** NST = 0.1108 Nm = 4.01
KST* = 0.0362 0.0001** FST = 0.1086 Nm = 4.10
ZS = 2279.890 0.0001**
ZS* = 7.360 0.0001**
Snn = 0.511 0.0001**
The analysis of subspecies pair comparisons with exact probability tests

(Table 6) only showed two significant pairs: E. b. madereinsis-E. b. barbara

(p = 0.0066 + 0.0017) and E. b. madereinsis-E. b. poliocephala

(p = 0.0135 + 0.0034). In this analysis, the Central American taxon was
deleted because only one sequence was analyzed. The estimates of Nm by
subspecies pair comparisons (Table 7) clearly yielded that the values lower
than 1 (which is considered the limit for low gene flow; Wright, 1943) always
implied the Central American taxon: E. b. inserta-E. b. peruana (Nm = 0.584),
E. b. inserta-E. b. barbara (Nm = 0.459), E. b. inserta-E. b. madereinsis (Nm
= 0.286), E. b. inserta-E. b. poliocephala (Nm = 0.137). Only a South
American taxon, E. b. sinuensis, (Nm = 1.202) had a more substantial gene
flow with E. b. inserta. This agrees quite well with that determined in the
phylogenetic trees and in the genetic distance analysis. The gene flow
estimates among the South American taxa were all above 1, ranging from
2.469 to 11.847. These values strongly correlate to elevated historical gene
flows among the populations of tayra throughout South America.
Demographic Evolutionary Changes in the Tayra
All of the demographic change statistics indicated population expansion in

the tayra (Strobeck's S statistic, P = 0.0001; Tajima D = -2.258, p = 0.0040; Fu
& Li D* = -3.175, p = 0.0115; Fu & Li F* = -3.335, P = 0.0052; Fu’s Fs = -
52.632, P = 0.00001; and R2 = 0.037, P = 0.0041). The mismatch distributions
also indicated population expansion (rg = 0.0040, P = 0.00280) (Figure 5).
Assuming one year as one generation in the tayra, the population expansion
began 343,586 YA, during the Pleistocene.
Table 6. Exact probability tests (P) (below main diagonal) and standard
deviations (above main diagonal) among six different putative
morphological subspecies of Eira barbara by means of
the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana;
3 = E. b. madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis;
6 = E. b. inserta. * = Significant probability
1 2 3 4 5 6
1 0.0000 0.0017 0.0138 0.0197 --------
2 1.0000 0.0071 0.0132 0.0088 ---------
3 0.0066* 0.0679 0.0034 0.0201 ---------
4 0.2307 0.3472 0.0135* 0.0036 ---------
5 0.4044 0.4796 0.1032 0.0893 ---------
6 --------- ---------- ---------- --------- -----------

Figure 5. Historical demographic analysis by means of the mismatch

distribution procedure (pairwise sequence differences) for the mitochondrial
ND5 gene studied in the overall sample of Eira barbara. The analysis showed
a clear population expansion of this species during the Pleistocene.
Table 7. Gene flow (Nm) estimates (below main diagonal) among six
different putative morphological subspecies of Eira barbara by means of
the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana; 3 = E. b.
madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis; 6 = E. b. inserta
1 2 3 4 5 6
1
2 9.8245
1 2 3 4 5 6
3 9.2893 11.8471
4 2.6879 5.3236 2.2686
5 7.1919 5.8729 4.8435 2.4691
6 0.4597 0.5843 0.2862 0.1373 1.2019
The BSP analyses also determined a strong female population expansion

during the Pleistocene for the tayra (Figure 6). The analyses showed the
beginning of the expansion around 400,000 YA, very similar to the temporal
estimate previously showed. Therefore, there is incontrovertible evidence that
the tayra experienced a strong population expansion during the Pleistocene, as
was previously suggested by the MJN analysis.

Figure 6. Bayesian skyline plot analysis (BSP) to determine possible demographic

changes across the natural history of the overall sample of tayra (E. barbara)
sequenced at the mitochondrial ND5 gene. The analysis showed a clear female
population expansion during the Pleistocene. On the x-axis, time in millions of years;
on the y-axis, log effective population size of females.
DISCUSSION
Genetic Diversity
The levels of nucleotide diversity found in E. barbara ( = 0.0422) were

quite high. They were higher than those found in many other neotropical
carnivores. For example, they were higher than three fox species (Lycalopex
culpaeus:  = 0.008, Ruiz-García et al., 2013a; Lycalopex sechurae:  = 0.015,
Ruiz-García et al., 2013a; Cerdocyon thous:  = 0.019, Tchaika et al., 2006),
three otter species (Lontra felina:  = 0.005, Vianna et al., 2010; Lontra
longicaudis:  = 0.011, Ruiz-García et al., 2017a; Pteronura brasiliensis: =
0.0086, Ruiz-García et al., 2017a), and two vulnerable Neotropical cats
(Leopardus jacobita:  = 0.0047, Ruiz-García et al., 2013b; Leopardus
guigna:  = 0.00461, Napolitano et al., 2013). The values of E. barbara were
similar to those found in certain Neotropical cats, which are characterized by
very elevated genetic diversity levels (Puma yaguaroundi:  = 0.0661; Ruiz-
García and Pinedo-Castro, 2013 and Ruiz-García et al., 2017b; Leopardus
pajeros:  = 0.0513, Ruiz-García et al., 2013b; Leopardus pardalis:  = 0.068,

Eizirik et al., 1998; Leopardus wiedii:  = 0.035-0.074, Ruiz-García et al.,

2017c).
These high levels of genetic diversity in “a priori” neutral markers, as that
we studied, could be related with the fact that many other genes in the genome
of a given species contains enough variability for the action of natural
selection (Kimura, 1986). This could be the origin of the great morphological
variation and behavior plasticity found in the tayra. Emmons and Freer (1990)
determined that tayras could live in a wide variety of habitats such as tropical
and subtropical forests, primary rain forest (as throughout the Amazonian
forest in Brazil, Peru, Colombia and Ecuador), secondary rain and gallery
forests (as in the Llanos of Venezuela and Colombia), gardens, plantations,
and cloud forests. They also inhabit dry scrub and deciduous forests (as in the
Pantanal in Brazil, Paraguay and Bolivia) and tall grass savannas (as in
Argentina, Bolivia, and Paraguay). Sunquist et al., (1989) showed that the
extreme plasticity of this species for habitat preferences, activity periods, and
diet preferences may reduce interspecific competition between E. barbara and
other carnivores. This could also be the explanation why Konecny (1989)
found no significant habitat preference for this mustelid in Belize. The
abundance of the tayra throughout much of Central and South America may be
a consequence of its ecological flexibility compared to sympatric carnivores.
Associated with this, the tayra is a generalist predator, consuming a variety of
fruits, carrion, small and medium vertebrates, insects, and honey (Cabrera and
Yepes, 1960; Galef et al., 1976; Hall and Dalquest, 1963; Konecny, 1989;
Sunquist et al., 1989).
Genetic Heterogeneity, Gene Flow and the Systematics

of the Tayra
Our results clearly showed that the specimen sampled in Central America
was highly divergent from all of the individuals sampled in South America.
However, the genetic heterogeneity among the putative morphological
subspecies of South American tayras, although significant, is very small as we
found with the FST statistic, exact probability tests, and genetic distances. The
indirect gene flow estimates were clearly higher than 1. Wright (1943) stated
that in an island model, if Nm > 1, then gene flow is important enough to erase
the genetic heterogeneity among populations. In a stepping-stone model, this
amount must be larger than 4 (Trexler, 1988). In both models, Nm < 0.5 means
that the populations are highly disconnected from a reproductive point of view.

For instance, the gene flow estimates between E. b. inserta and E. b.

poliocephala (Nm = 0.137), E. b. inserta and E. b. madereinsis (Nm = 0.286)
and E. b. inserta and E. b. peruana (Nm = 0.459) showed that the Central
American taxon is completely isolated from these three South American taxa.
However, recall that certain genetic relatedness was detected between the
Central American taxon and the most northern South American taxon (E. b.
sinuensis). Additionally, we found several gene flow comparison pairs
between South American taxa, such as E. b. madereinsis-E. b. barbara (Nm =
9.289) and E. b. madereinsis-E. b. poliocephala (Nm = 2.168). They were
elevated, although these comparison pairs showed significant heterogeneity.
This might be explained according to Alledorf and Phelps (1981), who argued
that the most correct interpretation of Nm > 1 is that the populations share the
same alleles, although not necessarily with the same allele frequencies. By
means of simulations, these authors showed that significant allele divergence
occurred in 50% of the generations with a gene flow of Nm = 50. Significant
allele divergence happened on most occasions when Nm = 10.
The tayra seems to have a strong dispersion capacity, which could be
related with these high gene flow estimates detected for all the putative South
American subspecies. For instance, in the Venezuelan and Colombian Llanos,
tayras are usually found along gallery forests. However, tayras cross these
extensive grasslands at night, presumably moving from one forest to another
covering long distances (Defler, 1980).
Taking into consideration all these facts, we suggest that the six putative
morphological subspecies analyzed could be reduced to two different
subspecies: E. b. inserta for southern Central America and E. b. barbara for
all South America. The name should be E. b. barbara because it was given by
Linneus in 1758 versus E. b. sinuensis given by Humboldt in 1812, E. b.
peruana given by Nehring in 1886, E. b. madeirenis given by Lonnberg in
1913 and E. b. poliocephala given by Traill in 1821. In reference to the
putative northern Central America subspecies (E. b. senex), we cannot add any
comment on its systematics because no individual of this putative subspecies
was analyzed. Therefore, it is essential to sample tayras from this putative
subspecies to determine its relationships with other tayra taxa.
Here we suggest another alternative point of view. As we showed, the first
tayra’s splits originated during the Miocene-Pliocene and beginning of the
Pleistocene. However, during the Pleistocene, tayra experienced a strong
population expansion and many haplotypes expanded their geographical
distributions and they became superimposed on the geographical areas of older
geographical groups that originally differentiated during the Pliocene. We

suggest that future studies analyze nuclear genes to determine if there was
hybridization between the older geographical groups (northern Colombia, part
of Bolivia and northwestern Argentina, trans-Andean area of Ecuador, and
north-central Peru) and the tayra’s population that expanded throughout South
America during the Pleistocene. If data support this, then our view of a unique
tayra’s subspecies in South America should be valid. On the contrary, if there
was little or no hybridization between the original groups and Pleistocene
colonizers in sympatry, then the number of subspecies in South America could
be higher. Therefore, the northern Colombian population (Cesar, Antioquia
and possibly nearby areas) should be named E. b. sinuensis and the northern
central Peruvian population should be named E. b. peruana. Also, the Bolivian
and especially the northwestern Argentinian population should be defined as a
new subspecies (tentatively E. b. saltensis). The trans-Andean Ecuadorian
population should be defined as a new subspecies (tentatively E. b.
aequatorialis). The remaining populations of tayra in South America should
be named as E. b. barbara. Additionally, the range distribution of E. b.
sinuensis and E. b. peruana should be more restricted than traditionally
accepted (see Presley, 2000). Even, if some reproductive isolation mechanism
had emerged between the Central and the South America tayras due to the old
split estimated during the Miocene-Pliocene, both tayra populations should be
consider two different species (E. barbara and E. inserta; this last should be E.
senex if both Central American forms of tayra were genetically
undifferentiated because senex was firstly named by Thomas in 1900 and
inserta was named by Allen in 1908).
Only future nuclear genetic studies can clarify which of the two points of
view is more acceptable.
Temporal Splits in the Tayras
Our results showed that the divergence between the Central and the South
American tayras occurred around 6.3 to 4 MYA (Miocene or Pliocene periods
depending of the temporal estimation). Johnson and O´Brien (1997) and
Johnson et al., (2006) showed that seven of the eight primary lineages of felids
radiated in the early part of the Late Miocene (10.8-6.2 MYA). There was a
noteworthy cooling of the global climate near the end of the Middle Miocene.
This period of cooling coincides with formation of a permanent Antarctic ice
sheet in the Middle and in the Late Miocene and an Arctic ice sheet in the
Pliocene. A large peak of diversification in many vertebrate taxa occurred

during the Pliocene epoch. The cold and dry climate during the Pliocene,
coincides with the onset of high latitude glacial cycles, causing an explosive
expansion of low-biomass vegetation, including grasslands and steppe at mid-
latitudes and development of taiga at high latitudes of Eurasia and North
America. These changes were correlated with the diversification of prey
species such as muroid rodents and passerine birds that exploited these new
habitats, which in turn provided new niches for little or medium carnivores,
such as the tayra. Additionally, this Pliocene period agrees quite well with the
last phase of rising of the Andes as shown by Dollfus (1974) and Clapperton
(1993) (see, for instance, the rising of the “tablazos” of Piura, Peru) and very
high volcanic activity in the Andes, with replacement of rainforests with
steppe and grassland environments.
Our initial divergence estimates in the tayra agrees relatively well with
other molecular studies in the reconstruction of the phylogenetic relationships
in the Mustelidae (Bryant et al., 1993; Dragoo and Honeycutt, 1997; Koepfli
and Wayne, 1998, 2003; Sato et al., 2003, 2004; Flynn et al., 2005; Fulton and
Strobeck, 2006; Koepfli et al., 2008). Two molecular studies are fundamental
to understanding the phylogenetics of the Mustelidae (Koepfli and Wayne,
2003; Koepfli et al., 2008). In the first study, the authors used five nuclear
gene segments and the mt Cyt-b gene. The genes APOB, FES, GHR, RH01 and
mtCyt-b clustered E. barbara together with Martes americana, Martes
pennanti and Gulo gulo. On the other hand, CHRNA1 clustered E. barbara
with Meles meles and Arctonyx collaris. The major part of the trees generated
by these authors showed that Mustelinae and Melinae were polyphyletic
within the Mustelidae, whereas Lutrinae was monophyletic. The authors of the
second study analyzed 22 nuclear and mitochondrial gene segments and
determined Mustelidae to consist of seven primary groups. These groups
include four major clades and three monotypic lineages. It also included Eira
barbara clustered into the subfamily Martinae, together with Martes and Gulo,
the most divergent taxa within this subfamily (100% of bootstrap and posterior
probability of 1). In that study, the branch of E. barbara diverged from the
other Mustelidae around 6.7-7.7 MYA (calculated using the mean values),
which agrees with our estimate.
These molecular results are not in conflict with the fossil record we know
and understand for Mustelidae in America. Many species of Mustelidae
appeared in North America during the Late Miocene-Early Pliocene. For
instance, Cernictis hesperus, from the Pinole Tuff Local Fauna of California,
has been dated radiometrically to have lived 5.3-5.5 MYA (Tedford et al.,

2004; Baskin, 2011). Other cases of extinct genera appearances are

Trogonictis and Sminthosinis as well as extant genera such as Lutra and
Mustela during the Hemphilian period (4.7-5.9 MYA, Tedford et al., 2004).
There is also Legionarictis fortidens from the Barstovian (Middle Miocene)
marine Temblor Formation in California (Tseng et al., 2009). This form has
shown a very close resemblance to other Miocene Mustelidae genera such as
Dehmictis, Eirictis, Iberictis, and Trochictis, all from the Old World. The form
also closely resembles Sminthosinis, Trigonictis (all from the New World),
and, especially, with two extant genera, Galictis and Eira (Ray et al., 1981;
Ginsburg and Morales, 1992; Baskin, 1998; Ginsburg, 1999). In fact, the
cladistic analysis of Tseng et al., (2009) determined that this genus could be an
evolutionary basal stage closely related to Eira. At the Longdan Fauna of the
Gansu Province in China, a similar fossil to Eira was found by Qiu
et al., (2004) from the Late Pliocene (Eirictis robusta; 2.58-2.15 MYA).
However, the cladistic analysis of Tseng et al., (2009) determined that this
mustelid was not very close to Eira and it is probably younger than Eira. Two
possible fossil species of Eira have been described from post-Pliocene
deposits of Maryland and Virginia under the names Galera macrodon and G.
perdicida. However, the former has been assigned to Trigonictis based on
additional material collected from deposits of the Blancan land mammal age
from Washington, Idaho, Nebraska, Kansas, Texas, North Carolina, and
Florida (Ray et al., 1981). Trigonictis is considered an intermediate form
between Galictis and Eira and could be ancestral to both. The second species
may be Mephitis (Alston, 1882). In addition, extinct species of Eira were
noted from the Pliocene of the Eastern Hemisphere, but specific names were
not given (Scott, 1937). Hershkovitz, (1972) claimed that Eira and other
endemic monotypic mustelid genera, such as Lyncodon and Pteronura, may
have evolved in South America and moved north as part of the north and south
American interchange across the Panamanian land bridge. In contrast, fossil
records suggest that Eira may have a North American origin (Ray et al., 1981).
Therefore, the process of diversification within Eira could be at the end of
the first mustelid diversification peak or at the beginning of the second
mustelid diversification peak detected by Koepfli et al., (2008). In either case,
this mitochondrial diversification process occurred before the Panamanian
land bridge (3-2.5 MYA). Therefore, Eira’s could have radiated in North
America before South America in concordance with the fossil record (Ray et
al., 1981) and against the view of Hershkovitz (1972). If so, tayras arrived in
South America before the complete formation of the Panamanian land bridge,

coinciding with the Choco-Panama island bridge (Galvis, 1980), which could
have been used by the ancestors of the current E. barbara to colonize northern
South America from Central America. During the upper Pliocene orogeny, the
present Tuira, Atrato and Sinu river basins and the nearby lowlands were
raised above sea level. Thus, the mountains of southern Central America and
of the northern Andes were uplifted to about their present elevation (Van der
Hammen, 1961). Although the Nicaraguan, Panamanian and Colombian
portals remained open (upper Miocene-middle Pliocene), numerous volcanic
islands existed from the lower Atrato Valley and the Tuira River Basin of
eastern Panama to the Nicaraguan portal. They could have been used by Eira’s
ancestor to migrate southward. The Cuchillo Bridge of the Uraba region,
connecting the Tertiary Western Colombian Andes with the Panamanian
islands was probably above sea level during this period. Henceforth, tayras
could be another “island hopper” species (Simpson 1950, 1965, 1980).
Our results could also be considered as indirect evidence of a Miocene
origin of the Isthmus of Panama (Montes et al., 2012, 2015). Indeed, the
Isthmus of Panama formation began earlier and seems to be associated with
the Northern Andean uplift, around 24 MYA (Farris et al., 2011).
Therefore, the tayra could have arrived in South America before other
Mustelidae. Koepfli et al., (2008) claimed that genera and species of mustelids
found in South America today are largely descended from North American
immigrants that arrived as part of the GABI following the rise of the
Panamanian isthmus, 3.0-2.5 MYA. Several informational points support the
statement of Koepfli et al., (2008). 1-For example, there is the clade of New
World otters where Lutra canadensis is sister to Lontra felina, and Lontra
longicaudis. The latter two species are found in South America and are
estimated to have diverged 2.8–3.4 MYA (95% HPD: 1.6–5.2 MYA)
overlapping with the formation of the Panamanian land bridge. 2-The long-
tailed weasel, Mustela frenata, ranges from North America to northern South
America. In addition, Mustela africana and Mustela felipei are endemic to
South America. Fossil evidence clearly indicates that Mustela colonized South
America from the north, apparently well after the Panamanian isthmus was in
place. 3- Fossils of the current Lyncodon patagonicus, (and a fossil form very
related as Lycodon bosei) and Stipanicicia sp (closely related to the extant
Galictis cuja) have been registered in the Ensenadean and Bonaerense periods
of the Argentinian Pleistocene (Forasiepi et al., 2007). However our results
could be ratified by other results provided by the same authors (Koepfli et al.,
2008). They found that Pteronura, Galictis and Eira could have a Eurasian

origin for each genus with posterior diversification in North America. For
example, Pteronura may be related to the extinct genus Satherium from the
Pliocene of North America. Additionally, Eira may be related to Trigonictis
and Legionarictis, also North American fossils (Tseng et al., 2009). Fossil
evidence suggests mustelids colonized the New World across Beringia during
different intervals when the land bridge between Eurasia and North America
was open. Multiple genera of mustelids migrated into North America during
the Late Miocene (around 11.2-5.3 MYA), prior to the first opening of the
Bering Strait 5.4–5.5 MYA, which severed the route across Beringia. Many
genera that colonized North America during the Late Miocene or earliest
Pliocene became extinct. However, Eira could be one of the surviving genera
that began to diversify in North America and also in South America if we
accept that they arrived in South America before the complete formation of the
Panamanian land bridge.
The mitochondrial diversification of the oldest groups of South American
tayra occurred 3.7-2.3 MYA. This coincided with the climatic changes that
originated from the completion of the Panamanian land bridge (3.1–2.8 MYA;
Marshall et al., 1979, 1982; Marshall, 1985, 1988; Webb, 1985, 1997; Coates
and Obando, 1996) in the Last Pliocene. Diversification in the tayra occurred
close to the Gelasian period (2.5–1.8 MYA), a period characterized by the last
stages of a global cooling trend that led to the quaternary ice ages
(International Commission on Stratigraphy 2007). Around 2.5 MYA, the
Andean forests were transformed into open cold dry savannah (‘paramo’),
which could have potentially isolated populations of different species. They
could have crossed the Northern Andes coming from Central America. Van
der Hammen (1992) demonstrated that the mean temperature in the Colombian
Andes was 4 ° C lower than today. He also stated that the rain level descended
below the level reported for today (500–1,000 mm). At 2,500 meters above sea
level (masl), the temperature was 10 °C lower than it is today. Tayra’s
diversification could have been affected by the rapid uplift that resulted in a
significant elevation of the Northern Andes. The mountain range’s height
climaxed around 2.7 MYA when the northern Colombian Andes reached its
present day elevation (Gregory-Wodzicki, 2000). This also coincides with the
last formation of the Central Andes. All of the Andean chain between
Cajamarca and Huancavelica in Peru appeared by volcanism in this period.
Much of the mitochondrial diversification process of the typical
Pleistocene colonizer haplotypes occurred around 1.5-0.8 MYA. This
divergence could have been initiated by the pre-Pastonian glacial period (1.3-

0.8 MYA), which had the highest glacial peak of the first Quaternary glacial
period (Günz). This glacial period was extremely dry, and there was a great
degree of forest fragmentation. This period was a time for haplotype
diversification. It was also a time of separation for many carnivores as it was
previously determined for the Pampas cat (Cossíos et al. 2009), and for the
foxes of the Lycalopex genus (Ruiz-García et al. 2013a). Around 1.3 MYA,
the Buenos Aires’s fauna transformed into a typical semi-arid Patagonian
fauna, represented by the guanaco, Lestodelphys and Lyncodon. Therefore, the
climate was considerably colder and drier than today and could have
influenced the mitochondrial fragmentation within the tayra.
The strong population expansion detected around 0.4 MYA for the tayra
agrees well with an interglacial period (0.39-0.20 MYA, West 1967)
characterized by higher temperatures and humidity and forest expansions
(Hoxniense in the British Islands, Yarmouth in North America, Holstein in
northern Europe and Mindel-Riss interglacial period in central Europe).
Future analyses with nuclear markers are needed as well as samples from
Central America (especially, southern Mexico, Guatemala, Belize and
Honduras), the Pacific areas of Colombia and Ecuador, other areas of Central
Peru, and the Guyana shield. These markers and additional samples will help
us to determine the exact number of subspecies or ESUs (Moritz, 1994). This
information is crucial for the development of effective conservation plans for
this species.
ACKNOWLEDGMENTS
Special thanks to Dr. Diana Álvarez, Dr. Francois Catzeflis, Pablo
Escobar-Armel, and Lina Arguello for their help in obtaining samples of tayras
throughout Panama, Colombia, Trinidad, French Guiana, Peru, Ecuador,
Brazil, Bolivia, Paraguay and Argentina. Thanks also go to the Instituto von
Humboldt (Colombia), the Ministry of Environment, Consejo Nacional del
Ambiente and the Instituto Nacional de Recursos Naturales in Peru, to the
Colección Boliviana de Fauna (Dr. Julieta Vargas), to CITES in Bolivia and to
the Ministerio del Ambiente in Coca and Santo Domingo de Tsáchilas
(Ecuador) for their role in facilitating the obtainment of the collection permits
in Colombia, Peru, Bolivia and Ecuador. Also thanks go to the Panamanian
and Argentinian Ministries of Environment for their roles in obtaining

permissions in these countries. Additional thanks to the many people of the

diverse Indian tribes in Peru (Bora, Ocaina, Shipigo-Comibo, Capanahua,
Angoteros, Orejón, Cocama, Kishuarana, and Alamas), Colombia (Jaguas,
Ticunas, Huitoto, Cocama, Tucano, Nonuya, Yuri, Yucuna, Curripacos, and
Desano), and Ecuador (Kichwa, Huaorani, Shuar, and Achuar) for their help in
obtaining tayra samples.
REFERENCES
Akaike, H. (1974). A new look at the statistical model identification. IEEE
Transactions on Automatic Control, AC, 19, 716–723.
Allendorf, F. W., Phelps, S. R. (1981). Use of allelic frequencies to describe
population structure. Canadian Journal of Fish and Aquatic Sciencies, 38:
1507-1514.
Alston, E. R. (1882). Biologia Centrali-Americana: Mammalia. R. H. Porter,
London, United Kingdom.
Bandelt, H. J, Forster, P., and Rohl, A. (1999) Median-joining networks for
inferring intraspecific phylogenies. Molecular Biology and Evolution, 16,
37-48.
Baskin, J. A. (1998). Mustelidae. In C. M. Janis, K. M. Scott, and L. L. Jacobs
(Eds.), Evolution of Tertiary Mammals of North America Volume 1 (pp.
152-173). Cambridge, England: Cambridge University Press.
Baskin, J. A. (2011). A new species of Cernictis (Mammalia, Carnivora,
Mustelidae) from the Late Miocene Bidahochi Formation of Arizona,
USA. Palaeontologia Electronica, 14, 1-7.
Bryant, H. N, Russell, F. L. S, A. P., and Fitch, W. D. (1993). Phylogenetic
relationships within the extant Mustelidae (Carnivora): appraisal of the
cladistic status of the Simpsonian subfamilies. Zoological Journal of
Linnean Society, 108, 301-334.
Cabrera, A. (1957). Catálogo de los mamíferos de América del Sur. I
(Metatheria, Unguiculata, Carnívora). Revista del Museo Argentino de
Ciencias Naturales “Bernardo Rivadavia,” Zoología 4:1-307.
Cabrera, A., and Yepes, J. (1960). Mamíferos sudamericanos. Second Ed.
Buenos Aires, Argentina: Ediar.
Chung, W. K., Steiper, M. E. (2008). Mitochondrial COII introgression into
the nuclear genome of Gorilla gorilla. International Journal of
Primatology, 29, 1341–1353.

Clapperton, C. (1993). Quaternary Geology and Geomorphology of South

America. Elsevier, Amsterdam.
Coates, A. G., and Obando, J. A. (1996). The geological evolution of the
Central American isthmus. In J. B. C. Jackson, A. F. Budd, and A. G.
Coates (Eds.), Evolution and Environment in Tropical America (pp. 21-
56). Chicago, Illinois: University of Chicago Press.
Cossíos, E. D., Lucherini, M., Ruiz-García, M., and Angers B. (2009).
Influence of ancient glacial periods on the Andean fauna: the case of the
Pampas cat (Leopardus colocolo). BMC Evolutionary Biology, 9, 68-79.
Cuarón, A. D., Reid, F., Helgen, K., and González-Maya, J. F. (2016). Eira
barbara. The IUCN Red List of Threatened Species 2016:
e.T41644A45212151. http://dx.doi.org/10.2305/IUCN.UK.2016-
1.RLTS.T41644A45212151.en. Downloaded on 05 July 2017.
Culver, M., Johnson, W. E., Pecon-Slattery, J. and O’Brien, S. J. (2000).
Genomic ancestry of the American puma (Puma concolor). Journal of
Heredity, 91, 186-197.
Defler, T. R. (1980). Notes on interactions between tayra (Eira barbara) and
the white-fronted capuchin (Cebus albifrons). Journal of Mammalogy, 61,
156.
Dollfus, O. (1974). La cordillera de los Andes: Presentación de los problemas
geomorfológicos. Bulletin de l’Institut Francois d’Etudes Andines, 3, 1-
36.
Dragoo, J. W., and Honeycutt, R. L. (1997). Systematics of mustelid-like
carnivores. Journal of Mammalogy, 78, 426-443.
Drummond, A. J., Ho, S. Y. W., Phillips, M. J., and Rambaut, A. (2006).
Relaxed phylogenetics and dating with confidence. PLOS Biology, 4(5),
e88.
Drummond, A. J., Suchard, M. A., Xie, D., and Rambaut, A. (2012). Bayesian
phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and
Evolution, 29, 1969–1973.
Eisenberg, J. F. (1989). Mammals of the Neotropics. Volume 1. The Northern
Neotropics. University of Chicago Press, USA. Pp. 1-449.
Eizirik, E., Bonatto, S. L., Johnson, W. E., Crawshaw Jr. P. G., Vié, J. C.,
Brousset, D. M., O’Brien, S. J. and Salzano, F. M. (1998).
Phylogeographic patterns and evolution of the mitochondrial DNA control
region in two Neotropical cats (Mammalia, Felidae). Journal of Molecular
Evolution, 47, 613-624.

Emmons, L. H., and Freer, F. (1990). Neotropical rainforest mammals: a field

guide. University of Chicago Press, Illinois.
Excoffier, L., Lischer, H. E. L. (2010). Arlequin suite ver 3.5: a new series of
programs to perform population genetics analyses under Linux and
Windows. Molecular Ecology Resour., 10, 564–567.
Farris, D. W., Jaramillo, C., Bayona, G., et al., (2011). Fracturing of the
Panamanian Isthmus during initial collision with South America. Geology,
39, 1007–1010.
Flynn, J. J., Finarelli, J. A., Zehr, S., Hsu, J., and Nedbal, M. A. (2005).
Molecular phylogeny of the Carnivora (Mammalia): assessing the impact
of increased sampling on resolving enigmatic relationships. Systematic
Biology, 54, 317-337.
Forasiepi, A., Martinelli, A., and Blanco, J. (2007). Bestiario Fósil. Mamíferos
del Pleistoceno de la Argentina (pp. 1-190) Buenos Aires, Argentina:
Editorial Albatros.
Fu, Y. X. (1997). Statistical tests of neutrality against population growth,
hitchhiking and background selection. Genetics, 147, 915-925.
Fu, Y. X., and Li, W. H., 1993. Statistical tests of neutrality of mutations.
Genetics, 133, 693-709.
Fulton, T. L., and Strobeck, C. (2006). Molecular phylogeny of the Arctoidea
(Carnivora): effect of missing data on supertree and supermatrix analyses
of multiple gene data sets. Molecular Phylogenetics and Evolution, 41,
165-181.
Galef, B. G., JR., Mittermeier, R. A., and Bailey, R. C. (1976). Predation by
the tayra (Eira barbara). Journal of Mammalogy, 57, 760–761.
Galvis, J. (1980). Un arco de islas Terciario en el Occidente colombiano.
Geología Colombiana, 11, 7-43.
Ginsburg, L. (1999). Order Carnivora. In The Miocene Land Mammals of
Europe. Rössner, G. E., and Heissig, K. (Eds.). Verlag Dr. Friedrich Pfeil,
München. Pp. 109–148.
Ginsburg, L., and Morales, J. (2000). Origin and evolution of the Melinae
(Mustelidae, Carnivora, Mammalia). Earth Planet Science, 330, 221-225.
González-Maya, J. F., Zárrate-Charry, D., Vela-Vargas, I. M., Jiménez-
Alvarado, J. S., and Gómez-Hoyos, D. (2015). Activity patterns of Tayra
Eira barbara populations from Costa Rica and Colombia: evidence of
seasonal effects. Rev. Biodivers. Neotrop., 5, 96-104.

Gregory-Wodzicki, K. M. (2000). Uplift history of the central and northern

Andes: a review. Geol. Soc. of Am. Bull., 112, 1091–1105.
Hall, E. R. (1981). The mammals of North America. Second Ed. New York,
New York: John Wiley and Sons.
Hall, E. R., and Dalquest, W. W. (1963). The mammals of Veracruz.
University of Kansas Publication Museum of Natural History, 14, 165–
362.
Hershkovitz, P. (1972). The recent mammals of the Neotropical region: a
zoogeographical and ecological review. In A. Keast, F. Erk, and B. Glass
(Eds.). Evolution, mammals, and southern continents (pp. 311-431).
Albany, New York: State University of New York Press.
Hudson, R. R. (2000). A new statistic for detecting genetic differentiation.
Genetics, 155, 2011-2014.
Hudson, R. R., Boss, D. D., and Kaplan, N. L. (1992). A statistical test for
detecting population subdivision. Molecular Biology and Evolution, 9,
138-151.
International Commission on Stratigraphy. (2007). International Stratigraphic
Chart. http://www.sratigraphy.org/chus.pdf.
Johnson, W. E., and O’Brien, S. J. (1997). Phylogenetic reconstruction of the
Felidae using 16S rRNA and NADH-5 mitochondrial genes. Journal of
Molecular Evolution, 44 (Suppl 1), S98-S116.
Johnson, W. E., Eizirik, E., Pecon-Slattery, J., Murphy, W. J., Antunes, A.,
Teeling, E., and O’Brien, S. J. (2006). The Late Miocene radiation of the
modern Felidae: a genetic assessment. Science, 311, 73–77.
Kimura, M. (1980). A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences.
Journal of Molecular Evolution, 16, 111-120.
Kimura, M, (1986). DNA and the neutral theory. Philosophical Transactions
of the Royal Society of London, series B, 312: 343-354.
Koepfli, K-P., and Wayne, R. K. (1988). Phylogenetic relationships of otters
(Carnivora: Mustelidae) based on mitochondrial cytochrome b sequences.
Journal of Zoology (London), 246, 401-416.
Koepfli, K-P., and Wayne, R. K. (2003). Type-1 STS markers are more
informative than cytochrome b in phylogenetic estimation of the
Mustelidae (Mammalia: Carnivora). Systematic Biology, 52, 571-593.

Koepfli, K. P., Deere, K. A., Slater, G. J., Begg, C., Begg, K., Grassman, L.,
Lucherini, M., Veron, G., and Wayne, R. K. (2008). Multigene phylogeny
of the Mustelidae: Resolving relationships, tempo and biogeographic
history of a mammalian adaptive radiation. BMC Evolutionary Biology, 6,
10.
Konecny, M. J. (1989). Movement patterns and food habits of four sympatric
carnivore species in Belize, Central America. In K. Redford and J.
Eisenberg (Eds.), Advances in Neotropical Mammalogy (pp. 243-264).
Gainesville, Florida: Sandhill Crane Press.
Librado, P., Rozas J. (2009). DnaSP v5: A software for comprehensive
analysis of DNA polymorphism data. Bioinformatics, 25, 1451-1452 | doi:
10.1093/bioinformatics/btp187.
Lönnberg, E. (1913). Mammals from Ecuador and related forms. Arkiv
Zoologi, 16, 1–36.
Marshall, L. G. (1985). Geochronology and land-mammal biochronology of
the transamerican faunal interchange. In F. G. Stehli and S. D. Webb
(Eds.), The Great American Interchange (pp. 49-85). New York, New
York: Plenum Press.
Marshall, L. G. (1988). Land mammals and the great American interchange.
American Science, 76, 380–388.
Marshall, L., Butler, R., Drake, R., Curtis, G., and Tedford, R. (1979).
Calibration of the Great American Interchange. Science, 204, 272-279.
Marshall, L. G., Webb, S. D., Sepkoski Jr., J. J., and Raup, D. M. (1982).
Mammalian evolution and the great American interchange. Science, 215,
1351–1357.
Montes, C., Bayona, G., Cardona, A., Buchs, D. M., Silva, C. A., Morón, S.,
Hoyos, N., Ramírez, D. A., Jaramillo, C. A., and Valencia, V. (2012).
Arc-continent collision and orocline formation: Closing of the Central
American seaway. J. Geophysical Research, 117, B04105,
doi:10.1029/2011JB008959.
Montes, C., Cardona, A., Jaramillo, C., Pardo, A., Silva, J. C., Valencia, V.,
Ayala, V. C., Pérez-Angel, L. C., Rodriguez-Parra, L. A., Ramirez, V., et
al., (2015). Middle Miocene closure of the Central American sea way.
Science, 348, 226–229.
Moritz, C. (1994). Defining evolutionary significant units for conservation.
Trends in Ecology and Evolution, 9, 373-375.
Morral, N., Bertrantpetit, J., and Estivill,. X (1994). The origin of the major
cystic fibrosis mutation (delta F508) in European populations. Nature
Genetics, 7, 169-175.

Napolitano, C., Sanderson, J., Johnson, W. E., O’Brien, S. J., Rus Hoelzel, A.,
Freer, R., Dunstone, N., Ritland, K., and Poulin E. (2013). Population
Genetics of the felid Leopardus guigna in Southern South America:
Identifying intraspecific units for conservation. In Ruiz-García, M and
Shostell, J. M. (Eds.), Molecular Population Genetics, Phylogenetics,
Evolutionary Biology and Conservation of the Neotropical Carnivores.
New York, New York: Nova Science Publishers.
Nei, M. (1973). Analysis of gene diversity in subdivided populations. Proc
Natl Acad Sci USA, 70, 3321–3323.
Nylander, J. A. (2004). MrModeltest v2. Evolutionary Biology Center,
Uppsala University.
Pennington, R. T., Dick, C. W. (2010). Diversification of the Amazonian flora
and its relation to key geological and environmental events: a molecular
perspective. In: Hoorn C, Wesselingh F (eds). Amazonia, Landscape and
Species Evolution: A Look into the Past. Wiley-Blackwell, Oxford. Pp
373-385.
Posada, D., Crandall, K. A. (2001). Intraspecific gene genealogies: trees
grafting into networks. Trends in Ecology and Evolution, 16, 37–45.
Presley, S. J. (2000). Eira barbara. Mammalian Species, 636, 1-6.
Qiu, Z. X., Deng, T. and Wang, B. Y. (2004). Early Pleistocene mammalian
fauna from Longdan, Dongxiang, Gansu, China. Palaeontologia Sinica
Series C, 191, 1–198.
Rambaut, A. (2012). FigTree v1.4. http://tree.bio.ed.ac.uk/software/
figtree/.
Rambaut, A., Drummond, A. J. (2013). TreeAnnotator v1.8.0. http://beast.
bio.ed.ac.uk/.
Rambaut, A., Suchard, M. A., Xie, W., Drummond, A.J. (2013). Tracer v1.6.
http://tree.bio.ed.ac.uk/software/tracer/.
Ramos-Onsins, S. E., and Rozas, J. (2002). Statistical properties of new
neutrality tests against population growth. Molecular Biology and
Evolution, 19, 2092-2100.
Ray, C. E., Anderson, E., and Webb, S. D. (1981). The Blancan carnivore
Trigonictis (Mammalia: Mustelidae) in the eastern United States.
Brimleyana, 5, 1-36.

Rogers, A. R., Fraley, A. E., Bamshad, M. J., Watkins, W. S., and Jorde, L. B.
(1996). Mitochondrial mismatch analysis is insensitive to the mutational
process. Molecular Biology and Evolution, 13, 895-902.
Rogers, A. R., and Harpending, H. C. (1992). Population growth makes waves
in the distribution of pairwise genetic differences. Molecular Biology and
Evolution, 9, 552-569.
Ruiz-García, M. (1993). Analysis of the evolution and genetic diversity within
and between Balearic and Iberian cat populations. Journal of Heredity, 84,
173-180.
Ruiz-García, M. (1994). Genetic profiles from coat genes of natural Balearic
cat populations: An Eastern Mediterranean and North-African origin.
Genetics Selection and Evolution, 26, 39-64.
Ruiz-García, M. (1997). Genetic relationships among some new cat
populations sampled in Europe: a spatial autocorrelation analysis. Journal
of Genetics, 76, 1-24.
Ruiz-García, M. (1999). Genetic structure of different cat populations in
Europe and South America at a microgeographic level: Importance of the
choice of an adequate sampling level in the accuracy of population
genetics interpretations. Genetics and Molecular Biology, 22, 493-505.
Ruiz-García, M., Alvarez, D. (2000). Genetic microstructure in two Spanish
cat populations I: Genic diversity, gene flow and selection. Genes and
Genetics Systems, 75, 269-280.
Ruiz-García, M., and Pinedo-Castro, M. (2013). Population genetics and
phylogeographic analyses of the jaguarundi (Puma yagouaroundi) by
means of three mitochondrial markers: the first molecular population
study of this species. In Ruiz-García, M., Shostell, J. (Eds.), Molecular
Population Genetics, Phylogenetics, Evolutionary Biology and
Conservation of the Neotropical Carnivores. New York, New York: Nova
Science Publishers. Pp. 245-288.
Ruiz-García, M., Lichilín, N., Jaramillo, M. F. (2013a). Molecular
phylogenetics of two Neotropical Carnivores, Potos flavus (Procyonidae)
and Eira barbara (Mustelidae): No clear existence of putative
morphological subspecies. In Ruiz-García, M., Shostell, J. (Eds.),
Molecular Population Genetics, Phylogenetics, Evolutionary Biology and
Conservation of the Neotropical Carnivores. New York, New York: Nova
Science Publishers. Pp. 37-84.

Ruiz-García, M., Rivas-Sánchez, D., and Lichilín-Ortiz, N. (2013b).

Phylogenetics relationships among four putative taxa of foxes of the
Pseudoalopex genus (Canidae, Carnivora) and molecular population
genetics of Ps. culpaeus and Ps. sechurae. In Ruiz-García, M., Shostell, J.
(Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary
Biology and Conservation of the Neotropical Carnivores. New York, New
York: Nova Science Publishers. Pp. 97-128.
Ruiz-García, M., Cossíos, D., Lucherini, M., Yáñez, J., Pinedo, M., and
Angers, B. (2013c). Population genetics and spatial structure in two
Andean cats (the Pampas cat, Leopardus pajeros and the Andean
mountain cat, L. jacobita) by means of nuclear and mitochondrial markers
and some notes on skull biometrics. In Ruiz-García, M., Shostell, J.
(Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary
Biology and Conservation of the Neotropical Carnivores. New York, New
York: Nova Science Publishers. Pp. 187-246.
Ruiz-García, M., Escobar-Armel, P., De Thoisy, B., Martínez-Agüero, M.,
Pinedo-Castro, M., and Shostell, J. M. (2017a). Biodiversity in the
Amazon: origin hypotheses, intrinsic capacity of species colonization, and
comparative phylogeography of river otters (Lontra longicaudis and
Pteronura brasiliensis, Mustelidae, Carnivora) and pink river dolphin
(Inia sp, Iniidae, Cetacea). Journal of Mammalian Evolution, 24, 1-28.
DOI 10.1007/s10914-016-9375-4.
Ruiz-García, M., Pinedo-Castro, M., Shostell, J. M. (2017b). Mitogenomics of
the jaguarundi (Puma yagouaroundi, Felidae, Carnivora): unclear
correlation between morphological subspecies and molecular data. PLOS
ONE, (in press).
Ruiz-García, M., Pinedo-Castro, M., Shostell, J. M. (2017c). Mitogenomics of
the margay (Leopardus wiedii, Felidae, Carnivora): some geographic
regional clusters but low correspondence with putative morphological
subspecies. Journal of Heredity, (in press).
Sambrock, J., Fritsch, E., Maniatis, T. (1989). Molecular Cloning: A
Laboratory manual. 2nd edition. V1. Cold Spring Harbor Laboratory
Press. New York.
Sato, J. J., Hosoda, T., Wolsan, M., Tsuchiya, K., Yamamoto, Y., and Suzuki,
H. (2003). Phylogenetic relationships and divergence times among
mustelids (Mammalia: Carnivora) based on nucleotide sequences of the
nuclear interphotoreceptor retinoid binding protein and mitochondrial
cytochrome b genes. Zoological Scripta, 20, 243-264.

Sato, J. J., Hosoda, T., Wolsan, M., and Suzuki, H. (2004). Molecular
phylogeny of arctoids (Mammalia:Carnivora) with emphasis on
phylogenetic and taxonomic positions of ferret badgers and skunks.
Zoological Scripta, 21, 111-118.
Schwarz, G. E. (1978). Estimating the dimension of a model. Annals of
Statistics, 6, 461-464.
Scott, W. B. (1937). A History of Land Mammals in the Western Hemisphere.
NewYork, New York, Macmillan.
Simpson, G. G. (1950). History of the fauna of Latin America. American
Scientist, 38,361-389.
Simpson, G. G. (1965). The geography of evolution. Collected essays.
Philadelphia, Pennsylvania and New York, New York: Chilton Books.
Simpson, G. G. (1980). Splendid Isolation: The Curious History of South
American Mammals. New Haven, Connecticut: Yale University Press.
Slatkin, M. (1985). Rare alleles as indicators of gene flow. Evolution, 39, 53-
65.
Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based
phylogenetic analyses with thousands of taxa and mixed models.
Bioinformatics, 22, 2688– 1243.
Strobeck, C. (1987). Average number of nucleotide differences in a sample
from a single subpopulation: a test for population subdivision. Genetics,
117, 149-153.
Sunquist, M. E., Sunquist, F., and Daneke, D. E. (1989). Ecological separation
in a Venezuelan llanos carnivore community. In Redford, K., and
Eisenberg, J. (Eds.), Advances in Neotropical mammalogy (pp. 197-232).
Gainsville, Florida: Sandhill Crane Press.
Tajima, F. (1989). Statistical method for testing the neutral mutation
hypothesis by DNA polymorphism. Genetics, 123, 585-595.
Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S. (2013).
MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.
Molecular Biology and Evolution, 30, 2725-2729.
Tavaré, S. (1986). Some Probabilistic and Statistical Problems in the Analysis
of DNA Sequences. Lectures on Mathematics in the Life Sciences, 17, 57–
86.
Tchaicka, L., Eizirik, E., De Oliveira, T., Cándido, J. F., and Freitas, T.
(2006). Phylogeography and population history of the crab-eating fox
(Cerdocyon thous). Molecular Ecology, 16, 819-838.

Tedford, R. H., Albright, L. B. III., Barnosky, A. D., Ferrusquia-Villafranca,

I., Hunt, R. M. Jr, Storer, J. E., Swisher, C. C. III, Voorhies, M. R., Webb,
S. D., and Whistler, D. P. (2004). Mammalian biochronology of the
Arikareean through Hemphilian interval (Late Oligocene through Early
Pliocene epochs. In Woodburne, M. O. (Eds.), Late Cretaceous and
Cenozoic mammals of North America (pp. 169-231). New York, New
York: Columbia University Press.
Trexler, J. C. (1988). Hierarchical organization of genetic variation in the
sailfin molly, Poecilia latipinna (Pisces: Poeciliidae). Evolution, 42,
1006–1017.
Tseng, Z. J., Wang, X., and Stewart, J. D. (2009). A new immigrant mustelid
(Carnivora, Mammalia) from the middle Miocene Temblor Formation of
central California. PaleoBios, 29, 13–23.
Van der Hammen, T. (1961). The Quaternary climatic changes of northern
South America. Annals of the New York Academy of Sciences, 95, 676-
683.
Van der Hammen, T. (1992). La paleoecología de Suramérica Tropical.
Cuarenta años de investigación de la historia del medio ambiente y de la
vegetación. In Historia, Ecología y Vegetación (pp. 1-411). Bogotá,
Colombia: Corporación Colombiana para la Amazonía-Araracuara.
Vianna, J. A., Ayerdi, P., Medina-Vogel, G., Mangel, J. C., Zeballos, H.,
Apaza, M., and Faugeron, S. (2010). Phylogeography of the marine otter
(Lontra felina): Historical and contemporary factors determining its
distribution. Journal of Heredity, 101, 676–689.
Waits, L., Sullivan, J., O’Brien, S. J., and Ward, R. H. (1999). Rapid radiation
events in the family Ursidae indicated by likelihood phylogenetic
estimations from multiple fragments of mtDNA. Molecular Phylogenetics
and Evolution, 13, 82-92.
Walsh, P. S., Metzger, D. A., and Higuchi, R. (1991). Chelex 100 as a medium
for simple extraction of DNA for PCR-based typing from forensic
material. BioTechniques, 10, 506-513.
Webb, S. D. (1985). Late Cenozoic mammal dispersals between the Americas.
In F. G. Stehli and S. D. Webb (Eds.), The great American biotic
interchange. (pp. 357-386). New York, New York: Plenum Press.
Webb, S. D. (1997). The great American faunal interchange. In A. G. Coates
(Ed.), Central America: A Natural and Cultural History
(pp. 97-122). New Haven, Connecticut: Yale University Press.

West, R. G. (1967). The Quaternary of the British Isles. The geologic systems.
In Rankama K (Ed.). The Quaternary. Vol 2. Interscience, New York. Pp.
1-87.
Wright, S. (1943). Isolation by distance. Genetics, 28, 114-138.

Chapter 3
THE PRECISION MEDICINE AND

PRECISION PUBLIC HEALTH
APPROACHES TO
CANCER TREATMENT AND PREVENTION:
A CROSS-COMPARISON
Stephen M. Modell1,*, Sharon L. R. Kardia2

and Toby Citrin1
1
Department of Health Management and Policy,
2
Department of Epidemiology
University of Michigan School of Public Health, Ann Arbor, MI, US
ABSTRACT
Like other forms of diagnostics, genetic testing comes with a retinue
of costs and benefits. Significant benefits in terms of morbidity and
mortality have accrued to individuals tested for more prevalent genetic
*
Corresponding Author: Stephen M. Modell. Center for Public Health and Community
Genomics, University of Michigan School of Public Health, 4628 SPH Tower, 1415
Washington Hts., Ann Arbor, MI 48109-2029. Tel.: (734) 615-3141; Fax: (734) 764-1357;
Email: mod@umich.edu.

108 Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin
conditions like cystic fibrosis and sickle cell disease, including persons
seen in the emergency room or identified through public health
surveillance. These benefits do not mitigate the drawbacks of genetic
testing, false and missed diagnoses and sheer cost among them.
Both medicine and public health have aimed at means of maximizing
genetic test benefits in the interventions that they apply. The President’s
Precision Medicine Initiative (PMI) holds promise in that its results could
be used to tailor medical treatments to the individual characteristics of
patients, “precision” implying a more accurate and precise regimen
overall. The National Cancer Institute (NCI) has already launched the
NCI-MATCH precision medicine trial, which assigns targeted treatments
based on the genetic abnormalities in a tumor, regardless of cancer type.
Other trials, such as the NCI Pediatric MATCH trial, are yet to happen.
The efficacy of cancer treatments also intersects public health concerns.
The Evaluation of Genomic Applications in Practice and Prevention
(EGAPP) Working Group has evaluated the use of UGT1A1 genotyping
to determine the best dose of irinotecan to prevent side effects when
treating patients for metastatic colorectal cancer. Analytic validity does
not always equate with improved patient outcomes, however, thus the
public health emphasis on development of a suitable evidence base for
precision medical and public health efforts.
The public health approach to precision medicine, or “precision
public health”, differs from the medical approach in several important
ways: (1) population-based with attention to at-risk populations, as
opposed to being strictly individualized; (2) focus on primary and
secondary prevention, rather than frank disease (tertiary prevention); and
(3) prioritizing interventions that have already demonstrated readiness for
large-scale implementation, in contrast to the undertaking of novel
clinical trials. Precision public health is exemplified in the Centers for
Disease Control and Prevention’s emphasis on the implementation of Tier
1 genetic tests that have passed systematic review for analytic and clinical
validity and utility – the use of family history for referral for hereditary
breast and ovarian cancer genetic testing (BRCA1/2 mutations), and
hereditary nonpolyposis colorectal cancer cascade screening (Lynch
syndrome MLH1, MSH2, MSH6 mutations).
This paper will cross-compare the precision medical approach to
cancer based on pharmacogenomic regimens using companion
diagnostics, and the public health approach to precision management of
hereditary cancer for 3 cancer types – lung, breast, and colorectal. It will
describe methods of early detection and consider how lives can be saved
through precise management – from predictive testing and cancer
monitoring of the at-risk population, to tailored chemoprevention that fits
the needs of the individual. In the population context, a cascade screening
“multiplier effect” exists in that relatives can also be assessed and
followed for mutations identified in the proband. Cost-benefit analyses

The Precision Medicine and Precision Public Health Approaches … 109
(T4 translational research) of medical and public health approaches will

be closely examined and compared. Points of commonality between the
two approaches will also be discussed, since primary/secondary and
tertiary disease prevention represent a continuum. These analyses point to
the value of allocating resources towards the health of at-risk populations.
Questions remain if particular forms of genetic testing are to become
“universalized”, and if the needs of all at-risk groups, including racial-
ethnic, are to be addressed.
Keywords: lung cancer, breast cancer, colorectal cancer, Lynch syndrome,

genetic testing, cascade screening, universal screening, cost-effectiveness,
precision medicine, pharmacogenomics, public health, race, ethnicity
FROM THE HUMAN GENOME PROJECT

TO THE PRECISION MEDICINE INITIATIVE
If the twentieth century is known for its success in mapping the human
genome, the twenty-first century is becoming equally well known for
scientists’ attempts at making genetic interventions “precise” – appropriately
chosen, and delivered to the right person and physical target within the human
body. The Precision Medicine Initiative (PMI), launched by the Obama
administration in January 2015 with a $215 million outlay in the President’s
2016 Budget and continuing onward in the current administration, brought
medicine closer than ever to the ability to tailor medical regimens to the needs
of the individual patient [1]. An article by Francis Collins, Director of the U.S.
National Institutes of Health (NIH), and Harold Varmus, former Director of
the U.S. National Cancer Institute (NCI), which appeared shortly after the
announcement, broke the Initiative into two stages: a near-term focus on
cancers, and a longer-term aim to yield new knowledge applicable to the
broader range of health and disease [2]. Muin Khoury, Director of the Office
of Public Health Genomics at the U.S. Centers for Disease Control and
Prevention (CDC-OPHG), and Sandro Galea, Dean of Boston University
School of Public Health, followed-up with the affirmation that the PMI could,
in time, be used to develop, evaluate, and deliver health interventions with
greater “precision” for both individuals and populations [3].
The distance between a strictly individualized approach to precision
medicine and one that is population-oriented, fitting the right intervention to
the right population, is transcended by a common denominator shared by

medicine and public health – cost-effectiveness. Translational research spans

several distinct territories, from basic genome-based discovery as it yields
candidate health applications (e.g., new genetic tests and therapeutic
interventions) - T1 translational research, to evaluation of real-world outcomes
(e.g., morbidity and mortality, cost-effectiveness, and quality-of-life
indicators) - T4 translational research [4]. In this piece we take the position
that whatever the molecular genetic or behavioral approach used, it must make
sense dollar-wise such that the interventions are being mustered in an effective
and economical way. Our analysis will show that the criterion of cost-
effectiveness naturally shifts the prospect of a national precision medicine
effort in the population-oriented direction. Though the two may seem like
strange bedfellows, both the pharmacogenomics industry and public health
community are in agreement that the PMI must be a sustainable effort, so that
the real question becomes, “What direction(s) can the PMI effectively take?”.
DEFINITIONS OF PRECISION MEDICINE AND

PRECISION PUBLIC HEALTH
The definition of a particular medical intervention illustrates both the
basic actions to be taken and its scope. Jameson and Longo define “precision
medicine” as “treatments targeted to the needs of individual patients on the
basis of genetic, biomarker, phenotypic, or psychosocial characteristics that
distinguish a given patient from other patients with similar clinical
presentations” [5]. Implicit in this definition is the goal of improving clinical
outcomes for individual patients, while avoiding unnecessary side-effects that
could be incurred by ignoring patients’ individual characteristics. The authors
admit that medicine to date has more or less employed such an approach.
Hemophilia requires the administration of an appropriate clotting factor, be it
factor VIII or factor IX (these days in recombinant form), to stop the bleeding.
Clinicians need to undertake a thorough work-up in order to arrive at a precise
diagnosis of the hemophilia, which will enable the appropriate therapy to be
administered. Choice of antibiotic is another example. For the antibiotic to
take hold, the right type of antibiotic must be given for the particular bacterial
infection. The latter example suggests that targeted approaches, aimed at
particular persons for specific conditions, could actually have population-level
applicability, since antibiotics and vaccinations are given on a widespread

basis. They are the very opposite of “orphan drugs”, designed to cater to the
needs of very rare cases.
Shen and Hwang point out that despite the commonality with past
precedent, a substantive shift in methodology between the old medicine and
the new medicine is occurring [6]. The practice of medicine has so far
remained largely “empirical”. Physicians typically rely on a combination of
patient and occasionally family medical history, physical examination, and
laboratory data to secure a diagnosis and choose a drug. Treatments are based
on a provider’s experience with similar patients. Drugs administered are most
often “blockbuster” drugs designed to accommodate the “typical” patient. If
the wrong analgesic, antibiotic, or antiarrhythmic is given, the patient will be
weaned off the current drug, and a new one tested until the right drug and
dosage are chosen. The idea behind precision medicine is to rely on new
biomarkers and genomic tests to “deliver the right treatment to the right patient
at the right time” [6]. It is a personally tailored, as opposed to “one size fits
all” approach. The fit is “precise” – one person; one drug.
Classic pharmacogenomic examples readily demonstrate this novel
approach. Warfarin (brand name Coumadin) dosing allows the frequently used
anticoagulant to be titrated to the needs of the patient susceptible to clotting
events associated with atrial fibrillation and deep vein thrombosis [7]. Two
genes are known to be involved in warfarin therapeutic outcomes – CYP2C9,
which codes for an enzyme primarily responsible for warfarin metabolism, and
VKORC1, which codes for the warfarin drug target. Genotyping can yield
information useful to guide a person’s initial warfarin dose and allow the
clinician to readily stabilize his or her prothrombin measures, a process which
usually takes several weeks. Cost-effectiveness studies of genotype-guided
dosing have concluded that considerable potential exists for cost savings, but
that it cannot be realized until test costs decrease and the uncertainty
concerning effectiveness is reduced. The U.S. Centers for Medicare and
Medicaid Services (CMS) has consequently adopted a provisional “coverage
with evidence development” approach [7]. A physiologic measure, the ratio of
the patient’s prothrombin time to a control or “normal” sample, continues to
be the professional standard for warfarin dosing. Since the patient is followed
with this measure, its use may be considered a tool in “personalized” or
individually-tailored medicine.
Imatinib (Gleevec) for chronic myelogenous leukemia (CML) and
gastrointestinal stromal tumors is another prime example of the tailoring in
drug regimens that may take place. Medical researchers developed this drug
over a multi-decade period to inhibit the function of a translocation-related

“fusion” gene, BCR-Abl, which produces an abnormal tyrosine kinase that is

not properly regulated [8]. In initial trials, all of 31 research participants
experienced complete remission. The five year survival rate for CML has
increased from 31% (1993) to 59% (2003 – 2009) [9]. The drug is
administered to patients who are Ph+ (Philadelphia chromosome positive),
with effectiveness monitored by white blood cell and platelet counts. Like
warfarin, Gleevec targets a particular type of patient and has a very specific
chemical target – the ATP-binding site on a particular kinase – and is a drug
that can be closely monitored. Gleevec’s cost is about $3,500 per month,
which may evade some patients’ pocketbooks. However, it is covered by
Medicare Part D and Medicare Advantage Plans. Both of the above examples
describe “personalized medicine” – separating patients into different groups
then individually tailoring the treatment to the patient.
Though many authors use the two terms interchangeably, Khoury
distinguishes “personalized medicine” from “precision medicine” in that the
latter inculcates multiple determinants of health, genetics being one rung, thus
can absorb the notion of social determinants as easily as it can molecular
determinants. The President’s PMI plan is data intensive in a way that would
allow the recording of multiple determinants for large numbers of people,
ostensibly through a planned million-person cohort:
Participants will be involved in the design of the Initiative and will

have the opportunity to contribute diverse sources of data – including
medical records; profiles of the patient’s genes, metabolites (chemical
makeup), and microorganisms in and on the body; environmental and
lifestyle data; patient generated information; and personal device and
sensor data. [1]
Collins and Varmus write that the numerous clinical trials stemming from
the PMI and its large-scale cohort will require the building of a “cancer
knowledge network” to store all the resulting molecular and medical data in
digital form and make it readily deliverable to providers and patients [2].
Simonds and Khoury illustrate this idea with the example of a cancer clinical
trials and effectiveness research infrastructure developed by the H. Lee Moffitt
Cancer Center. The system is part of its personalized cancer care initiative
started in 2006 – Total Cancer Care. The program: (1) integrates data from
multiple sources (electronic medical records, biospecimen databases, and
molecular data); (2) makes resultant information available to patients by
providing active feedback about their health and upcoming appointments and

expanded electronic health record; and (3) affords data interfaces for
researchers and clinicians [10].
It is to be hoped that the streamlining of cancer clinical trials and
centralization of incoming data will reduce costs and increase efficiency over
standard medical practices. According to Cancer Research U.K., between 2003
and 2007 cancer trials were accompanied by a 75% increase in administrative
costs, a figure in need of remedy [11]. Cost-effectiveness and clinical utility
will enter into assessments of the PMI. Public health efforts in the U.S. have to
date assumed a twin duty – assessment of the cost-effectiveness of clinical
programs, at the same time that a vision of precision medicine’s meaning in
terms of population health is being formulated. This vision departs from the
medical model of precision health in a number of important respects: (1) it is
population-based, with attention to at-risk populations, as opposed to being
strictly individualized; (2) the focus is on primary and secondary prevention,
rather than frank disease (tertiary prevention); and (3) the emphasis is on
interventions that have already demonstrated readiness for large-scale
implementation, in contrast to the undertaking of novel clinical trials [12]. To
glimpse the future, it is helpful to visit recent experience with precision
medicine in the cancer arena. This inspection will take our trek from the
individually-focused domain of clinical medicine to the population-oriented
territory of public health. The next section will focus on three major cancer
categories of mutual interest to clinical medicine and public health – lung,
breast, and colorectal cancer – from the medical pharmacogenomics point of
view.
PHARMACOGENOMIC INTERVENTIONS AND

COST-EFFECTIVENESS
The Precision Medicine Approach to Lung Cancer
Lung cancer is the second most common cancer in both men and women,
and is the leading cause of cancer-related death in both genders [13, 14]. Of
note, the lung cancer incidence rate for black women is roughly equal to that
of white women, despite the fact that they smoke fewer cigarettes [13]. The
two major forms of lung cancer are non-small cell lung cancer (NSCLC), and
small cell lung cancer (SCLC). NSLC comprises ~85% of all lung cancers;

SCLC ~10-15% [15]. The 5-year survival rate for NSCLC is 21%, suggesting
progress that has been and that is yet to be made [16].
Targeted therapies aimed at cancers harboring very specific genetic
alterations are becoming more and more common in oncogenomics. A 2012
review of the role of pharmacogenomics in moving genetic association studies
from bench to bedside describes the use of EGFR tyrosine kinase inhibitors
(TKI) in the treatment of lung cancer and HER2 (tyrosine kinase ERBB2)-
directed therapies in the treatment of HER2 (human epidermal growth factor
2)-positive early-stage breast cancer as prime examples of success in the area
of cancer pharmacogenomics [17]. A 2016 review of precision medicine
approaches in oncology cites ALK (anaplastic lymphoma kinase) fusion
oncogene and EGFR (epidermal growth factor receptor (EGFR)) mutations as
the main molecular predictive biomarkers supporting NSCLC treatment [15].
Molecular testing for ALK fusion genes has proven valuable. Abbott
Molecular already offers a multiplexed assay, the Vysis ALK Break Apart
FISH Probe Kit, endorsed by the 2016 National Comprehensive Cancer
Network (NCCN) NSCLC practice guidelines [15]. Though ALK fusion gene
rearrangements are relatively rare (< 5% of NSCLC cases), clinical responses
to targeted inhibitors (e.g., crizotinib) can be quite dramatic [5]. In favor of the
precision medicine approach, excluding patients without these mutations can
also minimize the exposure of patients to costly and potentially toxic therapies
unlikely to benefit them.
EML4-ALK is the specific biomarker used in determining patient efficacy
for the choice of a TKI agent such as crizotinib in the tertiary or after-the-
cancer-has-arisen management of NSCLC [5]. A 2014 cost-effectiveness study
on the use of EML4-ALK fusion oncogene testing in first-line crizotinib
treatment for patients with advanced NSCLC reveals the complexity inherent
in this precision medicine approach [18, 19]. The investigative team found that
EML4-ALK testing to govern therapeutic decisions improved patient outcomes
by an average of 0.011 quality-adjusted life-years (QALYs) while adding extra
costs of $2,725 per patient, of which only $60 was attributable to the
molecular assay itself. The overall interpretation of the cost-benefit calculus
changes dramatically, however, when the cost of the companion drug
(crizotinib) is considered. The incremental cost-effectiveness ratio is defined
as the difference in cost between two alternative interventions, divided by the
difference in their effect or impact. The incremental cost effectiveness ratio for
administration of the drug itself was $250,632 per QALY gained. The
investigators concluded that the regimen is “likely not considered cost-
effective in the current setting” [19]. This assessment was unaltered when the

model was subjected to a sensitivity analysis of alternative costs for the

molecular testing. States one reviewer, “Where companion diagnostic
precision medicine is considered, these assays are by nature tightly coupled to
the cost of the specific associated drug” [18].
Assays for EGFR inhibition may be used when other TKI inhibitors, such
as gefitinib and osimertinib, are being considered for NSCLC therapy [15].
The U.S. Food and Drug Administration (FDA) has approved two multiplex
assay kits, also NCCN endorsed, for this purpose – the therascreen EGFR
RGQ PCR Kit (for use with gefitinib), and the cobas EGFR Mutation Test (for
use with osimertinib). A cost-effectiveness analysis performed by an
Australian team compared the use of combined multiplex testing and targeted
therapy with NSCLC chemotherapy without testing, and thirdly with best
supportive care without testing [20]. The combined strategy resulted in an
additional 0.009 life-years (LYs) gained, compared to 1.458 LYs gained in the
case of each of the other two strategies. The combined strategy resulted in an
incremental cost-effectiveness ratio of $485,199 (Australian)/QALY
comparing combined and best supportive care strategies, and $489,338
(Australian)/QALY comparing combined and chemotherapy only strategies.
Decreasing test and test interpretation costs by half reduced the ratios, but they
still remained greater than $200,000 (Australian)/QALY. The authors
concluded that multiplex testing and targeted therapy is not cost-effective as a
fourth-line treatment in metastatic lung cancer when first-line treatments such
as chemotherapy without pharmacogenomics testing can be employed.
Other predictive biomarkers for NSCLC treatment are on the horizon. For
example, KRAS mutations can suggest lack of therapeutic efficacy to EGFR
targeted therapies. The FDA has cleared KRAS mutation detection assays for
use in colorectal cancer, but such assays have not yet been approved for use in
NSCLC [15].
The Precision Medicine Approach to Breast Cancer
Breast cancer is the most common cancer among American women. It is

the second leading cause of cancer death in women, exceeded only by lung
cancer [21]. About 85% of breast cancer cases occur in women with no family
history of breast cancer. These cases are due to somatic cell mutations which
occur as a result of aging, various exposures (such as pre- and postmenopausal
hormone therapy), and other life events.

Precision medicine efforts for breast cancer due to somatic mutations fall
into at least four categories, two of them – endocrine therapy and HER2
therapy – being mainstay treatment categories. HER2-directed therapies, for
which trastuzumab (Herceptin) is often used, are one of the two major
pharmacogenomics successes in the cancer area cited by Ritchie [17].
Tamoxifen is a major drug of choice in the category of endocrine therapies,
itself being a selective estrogen receptor modulator [15].
Herceptin has proven utility in reducing risk for cancer recurrence after
surgery for early-stage HER2-positive (HER2+) breast cancer, and improving
survival in late-stage (metastatic) HER2+ breast cancer, but it also poses
serious side-effects such as heart damage. Herceptin therapy can also cost a
sizable amount, up to $50,000 per year [22]. Overexpression of the HER2 gene
(HER2+ status) is associated with rapid tumor growth and negative diagnostic
and prognostic indicators. A systematic review and meta-analysis performed in
Canada compared seven different strategies employing immunohistochemistry
(IHC) and fluorescence in situ hybridization (FISH) to determine HER2 status,
thus appropriateness of using Herceptin [22]. Each strategy utilized an IHC
score (0, 1+, 2+, 3+) alone or coupled with FISH confirmation to form this
inference. The incremental cost-effectiveness ratio was lowest when cases
with an IHC score of 2+ or 3+ (as opposed to 0 or 1+) were confirmed by
FISH, which yielded a ratio of $3,351 (Canadian)(minimum) to $12,230
(Canadian)(maximum) per accurately determined case. The cost-effectiveness
analysis is favorable given that accurate assessment of HER2 status is capable
of reducing the cost of Herceptin therapy by $0.6 million per year, and saving
$12 million per year in women who are HER2-, thus can be kept off Herceptin
[22].
Estrogen-focused therapies have been a part of standard care for more than
thirty years, and have displayed an evolution in policy analysts’ thoughts about
the gold standard for precision management [15]. The Evaluation of Genomic
Applications in Practice and Prevention (EGAPP) Working Group was
launched by the CDC Office of Public Health Genomics in 2004 to conduct
systematic, evidence-based reviews of burgeoning genetic tests and other
applications of genetic technologies in transition from research to clinical and
public health practice. EGAPP has produced two systematic reviews of the use
of gene expression profiling to improve therapeutic outcomes in women with
breast cancer. EGAPP’s 2009 review examined the validity and utility of three
tests – Oncotype DX, MammaPrint, and the H:I (normalized gene expression)
ratio [23]. These tests have been designed to go beyond the standard
estrogen/progesterone receptor status indicator to predict tumor recurrence risk

for women on tamoxifen, for whom alternative therapies might be considered.

The EGAPP Working Group found adequate evidence from the NSABP B-14
randomized controlled trial to support the association between Oncotype DX
recurrence scores and 10-year distant metastases in estrogen receptor positive
(ER+) patients, and adequate evidence to support the association between RS
score and overall chemotherapy benefit, particularly for patients in the high
risk category [23]. Recent publication of interim results for the TAILORx
study has shown a further association between recurrence score and 5-year
disease-free survival and distant recurrence in patients at low risk [24].
A follow-up systematic review by the EGAPP Working Group published
in 2016 confirmed its previous findings but also noted the lack of direct
evidence that the use of Oncotype DX improves clinical outcomes [25]. It also
highlighted contradictory cost-effectiveness results in studies performed in the
U.S. (for which $2,000 in cost savings per patient were due to a decrease in
post-testing chemotherapy use) and the U.K. (for which an incremental cost-
effectiveness ratio of 26,940 £/QALY gained were due to an increase in
chemotherapy use) [25]. The U.K. National Institute for Health and Care
Excellence (NICE) Diagnostics Advisory Committee concluded that, under the
assumption of equal chemotherapy benefit for all Oncotype DX risk
categories, the test is not cost-effective at its current pricing level. In the first
EGAPP review, data were adequate to support an association between the
MammaPrint Index and 5- to 10-year metastasis rates, but the efficacy relative
to classical clinical factors was unclear. More conclusive results await the
completion of the MINDACT trial. For the H:I ratio test, populations studied
were quite heterogeneous, and the test’s commercial offering was based on a
single study in women with primary, untreated breast cancer.
The Precision Medicine Approach to Colorectal Cancer
Colorectal cancer (CRC) is the third most common cancer in both men
and women in the U.S. [26]. It is the third leading cause of cancer deaths when
men and women are considered separately, and the second leading cause in
both sexes combined.
Considerable effort has been placed into targeted therapies and companion
diagnostics for CRC. About 70-80% of patients present with resectable
localized disease, treated by surgery and often followed by adjuvant therapy
[27]. CRC patients with advanced disease may receive first-line
chemotherapy, or chemotherapy and radiation before surgery is considered.

The EGAPP Working Group published in 2009 a systematic review of one

first-line chemotherapeutic agent, irinotecan, which may be accompanied by
UGT1A1 genotyping to check for ability to adequately clear the drug [27].
Such genotyping aids decisions to either increase drug dose for more
aggressive therapy, or switch to common alternate drugs, bevacizumab or
cetuximab, for instance, in individuals with reduced clearance at risk for
adverse events. EGAPP had two major findings: (1) unless patients receive a
certain threshold dose of irinotecan, the increase in risk for toxicity is not
significant, thus testing may not be warranted; and (2) reducing the dose of
irinotecan (personalized dosing) to avoid adverse events may lead to more
cases of unresponsive tumors than instances of adverse events avoided. It is
inconclusive that benefits outweigh harms in the application of a precision
approach here.
The alternate drugs mentioned above are positioned among the three main
classes of targeted therapies approved for metastatic CRC: (1) multikinase
inhibitors; (2) angiogenic inhibitors; and (3) anti-EGFR antibodies [15]. Up to
50% of CRC patients respond to anti-EGFR therapy, which includes
cetuximab [28]. KRAS wild-type status is considered an important factor in
achieving a clinical response from this category of therapy [29]. However, 40-
60% of patients with wild-type status do not respond to such therapy. Data
suggest that BRAF gene status also plays a role in anti-EGFR response, and
that the BRAF V600E mutation, present in 5-10% of CRC tumors, can lead to
a positive response. To date the FDA has cleared two genetic testing kits, the
therascreen KRAS kit from Qiagen, and the cobas KRAS Mutation Test from
Roche [15]. The American Society for Clinical Oncology (ASCO) and three
other professional organizations released new consensus guidelines in 2015
strongly recommending KRAS mutational testing for patients being considered
for anti-EGFR therapy, and that BRAF V600 testing also be considered.
The EGAPP Working Group conducted a systematic review of companion
diagnostic use of KRAS and BRAF mutation testing in anti-EGFR therapy in
2013 [30]. The systematic review looked at multiple pooled assessments, each
consisting of up to seven studies, which together indicated statistically
significant increased response rates to cetuximab and other anti-EGFR drugs,
reduced risk of disease progression, and enhanced overall survival with KRAS
wild-type status. EGAPP cited a cost-effectiveness study of KRAS testing in
metastatic CRC patients in the U.S. and Germany [30, 31]. For the U.S.
patients, use of KRAS testing to select patients for EGFR inhibitor therapy
saved $7,500 to $12,400 per case. A second cited study from Japan displayed
an incremental cost-effectiveness ratio for cetuximab with KRAS testing to be

$180,000 per QALY gained compared to therapy without testing [32]. Due to
this cost, the investigators concluded that the protocol was not cost-effective,
even when treatment was limited to patients with wild-type KRAS. Two of
three studies looking at BRAF testing found associations similar to the KRAS
studies in terms of progression-free and overall survival, but these findings,
however, were not contingent on whether or not cetuximab was included in the
combination therapy. Thus, while the review supported recommendations for a
precision approach using KRAS mutation testing, it found insufficient evidence
to link BRAF V600E mutation testing with treatment response independent of
prognostic association.
Table 1 summarizes the cost-effectiveness and descriptive findings for the
pharmacogenomics or companion diagnostic precision medicine approach to
the three cancers.
Table 1. Pharmacogenomic/Companion diagnostic approach – 3 cancers
Condition Therapy Biomarkers Cost- References

Effectiveness
Non-small Tyrosine EML4-ALK $255,970/QALY Djalalov et al.
cell lung kinase gained [19]
cancer inhibitors
(NSCLC)
EGFR $489,338 Doble et al. [20]
(Austr.)/QALY
gained
HER2+ Herceptin IHC, FISH $3,351 – 12,230 Dendukuri et al.
Breast (Can.) saved per [22]
cancer case
ER+ Breast Endocrine 21-gene 26,940 £ (Brit.) EGAPP [25];
cancer assay cost/QALY Ward et al. [33]
gained
Metastatic Topoisomerase UGT1A1 ambivalent EGAPP [27]
colorectal 1 inhibitor genotyping results –
cancer (TOP1) – reducing toxicity
irinotecan vs. reducing
tumor burden
Anti-EGFR KRAS $7,500 – 12,400 EGAPP [30];
saved per case Vijayaraghavan
et al. [31]
$180,000/QALY EGAPP [30];
gained Shiroiwa et al.
[32]

TAKING PRECISION MEDICINE BEYOND

THE PERSONALIZED LEVEL
One argument against the informativeness of the above studies is that they
represent a personalized medicine approach, but not a precision medicine
approach in its full capacity [3]. The electronic storage of information, which
can be multifactorial, including relevant lifestyle, would seem to be crucial to
maximizing benefits and minimizing cost. The investigative team looking at
the infrastructure characteristics of the Lee Moffit Cancer Center “Total
Cancer Care” program also examined six other major healthcare programs
engaged in cancer care comparative effectiveness research in genomic and
precision medicine [10]. Four of the researched programs – at Duke
University, Kaiser Permanente, University of Pennsylvania, and the Fred
Hutchinson Cancer Center – had established a complex infrastructure (with
data and biospecimen registries and multidisciplinary research teams), were
engaged in “knowledge generation” (via randomized controlled trials and
observational studies), and had reached the stage of “knowledge synthesis”
(horizon scanning, evidence synthesis, and decision modeling). These
programs display a depth of information and range of multidisciplinary
expertise that is reflective of the type of knowledge synthesis of which the
PMI’s million person cohort will be capable.
The Duke University and Kaiser Permanente teams noted a number of
strategic challenges to the amassing of cancer study data – limited data quality,
large variation in genomic methodology used, and poor demonstration of
clinical utility for the genomic tests supplying the data [10]. These
observations point out challenges that could foreseeably face PMI
investigators attempting to collate information from the expansive precision
medicine cohort. The Kaiser Permanente group was able to show that in
screening for Lynch syndrome, a hereditary form of CRC, microsatellite
instability testing (MSI) was preferable compared to immunohistochemical
staining (IHC). In the treatment phase, the investigators found that screening
for KRAS and BRAF mutations improved the cost-effectiveness of anti-EGFR
therapy, but that the cost of the therapy surpassed generally accepted cost-
effectiveness thresholds of $100,000/quality-adjusted life-year. These findings
allude to the capability of the PMI to develop new data on useful oncogenomic
screening, mutational testing, and therapeutic procedures, and to the
correspondingly likely possibility that many of the discoveries, while being

individually beneficial, could elude effectiveness for the clinical population as

a whole.
The PMI will no doubt be carried in new directions that have not yet been
quantified, however. NCI is engaged a new type of clinical trial called “NCI-
MATCH” [34]. In this innovative program, adult cancer patients are assigned
to targeted treatments based on the genetic abnormalities in their tumors,
regardless of the type of cancer they have. This concept represents the
therapeutic end of what has been happening with diagnostics. KRAS and
EGFR mutation testing is now occurring for multiple cancer types. Why
should cancer therapies be restricted to just one cancer type? New
management models may also evolve. The data infrastructure supporting
precision medicine can and is being used to develop procedural algorithms that
combine genetic testing with genetically targeted therapies. These algorithms,
if tailored to the lay person, can then be used by both medical providers and
patients in collaboration, improving the effectiveness of the prescribed
regimen. Shen and Hwang use CYP2C9 (they cite CYP450) testing for
warfarin dose performed at home first by nurses then by patients as an
example [6]. This linkage of “big” or “rich” data and the development of new,
useful algorithms is cited by multiple authors [2, 5, 35]. The issue is whether
providers of various types, and consumers, can understand the test results and
appreciate the connection to one-size-does-not-fit-all therapeutic management
[36].
Authors discussing the translation of big data into usable guidelines and
algorithms are not just limiting the payoff to individualized treatment,
however. Jameson and Longo, for instance, speak of not just a
pharmacogenomic future, but one in which “guideline-based screening”, e.g.,
colonoscopy, can be targeted on the basis of age and family history [5]. Family
health history is one of several tools, including individualized genetic testing
and family cascade testing, fueling the public health drive towards precision
interventions [37, 38].
The public health approach to precision medicine, or “precision public
health”, is highly evidence-based. Precision public health is exemplified in the
Centers for Disease Control and Prevention’s emphasis on the implementation
of Tier 1 genetic tests that have passed systematic review for analytic and
clinical validity and utility – family history-based hereditary breast and
ovarian cancer (HBOC) genetic testing (BRCA1/2 mutations in relatives), and
hereditary nonpolyposis colorectal cancer genetic testing (Lynch syndrome
MLH1, MSH2, MSH6, PMS2, EPCAM mutations) [39]. Indeed, genetic
counseling and testing for HBOC are already incorporated into healthcare

reform as services not requiring co-pay for individuals deemed at risk by their
providers [40]. The PMI promises much more, however, and part of the vision
of public health is that precision techniques can be used to direct genetic
preventive strategies to those subsets of the population that will derive
maximal benefit [41].
PUBLIC HEALTH INTERVENTIONS AND

COST-EFFECTIVENESS
The Precision Public Health Approach to Lung Cancer
It has been remarked that “although personalized treatments can help save
the lives of sick people, prevention applies to all” [3]. This comment applies
especially to lung cancer, which can be tackled as we have seen individually
and after it has manifested, or by using a preventive, population-based
approach. Initial genome-wide association studies (GWAS) published by
several investigative teams in 2008 were suggestive of lung cancer
susceptibility genes being situated on the long arm of chromosome 15 [42].
The studies were all large (3,500 to 14,000 participants) and replicated,
yielding strong evidence for an association between SNP variations at
15q24/15q25.1 and lung cancer. Thorgeirsson et al. found a highly significant
association (P = 1.5 x 10-8) between a common variant in the nicotinic
acetylcholine receptor gene cluster on chromosome 15q24 and smoking
frequency, with an odds ratio of 1.31 (1.19 – 1.44, 95% C.I.) between nicotine
dependent cases and low quantity smokers plus population controls [43].
Studies by Hung et al. [44] and Amos et al. [45] found odds ratios between
1.21 and 1.77 for associations between the nicotinic acetylcholine receptor
regions 15q25 and 15q25.1 and lung cancer in ever smokers, the former
accounting for 14% (attributable risk) of the lung cancer cases in the first
study. The second study examined 2,724 NSCLC cases, the same type of
cancer being treated in later stages by pharmacogenomics regimens.
More recent GWAS in never-smoking Asian females have pointed out
genetic associations independent of smoking status. Case-control studies of
never-smoking Asian females funded through the National Institutes of Health
[46] and the Mayo Foundation [47] have identified genetic variants in the 3q28
and 13q31.3 regions associated with risk for lung cancer (N = 754 to 7,254
participants). These associations show both statistical significance (P = 10-6 to

10-8) in terms of odds ratios and allelic risk, and biological plausibility
(association with the regulation of cell proliferation and division). These two
lines of discovery – lung cancer in connection with nicotine dependence and
independent of it – could beneficially lead to both personalized smoking-
cessation interventions, and to increased screening of people at risk for lung
cancer [41]. The difficulty is that the association studies are at the primary
research (T1) stage and do not yet imply clinical validity.
Precision medicine in public health terms involves targeting groups at
risk. Various professional societies have developed guidelines for lung cancer
screening, generally beginning at age 55 [48]. The NCCN lung cancer
screening guidelines recommend screening individuals age 50-55 years, those
who have between 20 and 30 pack-years of exposure, and who exhibit one
additional risk factor, such as family history. The relative risk of developing
lung cancer is 1.8 if the individual has at least one first-degree relative with
lung cancer, and 3.0 given two first-degree relatives with the condition [49].
The positive and negative predictive values for lung cancer appearing in a
proband’s first-degree relatives are 89.9% and 99.1%, respectively [50]. In the
Utah Family High Risk Program, the cost of taking a family health history
varied between $10 and $25 depending upon receipt of follow-up educational
interventions [51]. These figures indicate cost-effectiveness for the use of
family history in risk assessment for lung cancer.
Public health programs are especially concerned with the rights and
welfare of underserved groups, an aim that is built into public health codes of
ethics [52]. Surprisingly, of the 58,160 lung disease studies published between
1993 and 2013, less than 5% reported the inclusion of minority participants
[53]. NIH is presently consulting researchers adept at recruiting under-
represented groups into studies as part of PMI Research Cohort formation. An
admixture study of 1812 African Americans performed by the Karmanos
Cancer Institute in Detroit, MI demonstrates what can come out of the use of
the PMI Cohort. Excess African ancestry was observed on chromosome 3q
among ever smokers with NSCLC, a chromosomal region identified by
previous studies with mostly persons of European ancestry [54].
The Precision Public Health Approach to Breast Cancer
About 10 to 15% of women diagnosed with breast cancer have germline

mutations in the BRCA1 or 2 genes. Between 10 and 30% of women under age
60 diagnosed with triple-negative breast cancer (cancer which does not have

receptors for estrogen, progesterone, or HER2/neu) display a BRCA1/2

mutation [55]. Ashkenazi Jewish ancestry confers an increased risk, though
such mutations are by no means relegated to just one group. Like lung cancer,
the public health approach to hereditary breast and ovarian cancer (HBOC)
focuses on primary prevention before disease has appeared. Primary
prevention can be conducted through a variety of means, several of which fit
under a public health precision model. A study out of the Cleveland Clinic
Genomic Medicine Institute compared two methods for cancer risk assessment
– “family history-based risk assessment” and “DTC [Direct-to-Consumer]
personal genomic screening,” the latter using a variety of risk alleles [56]. Of
22 high risk females appearing in clinic, family history classified eight
individuals as being at risk for breast cancer, but only one of the eight was
classified as high-risk through personal genomic screening method.
Family history is a quick way of identifying risk, and has value in this
instance as it does with lung cancer. Valdez et al. note that the relative risk of
developing breast cancer is 1.8 and ovarian cancer 2.9 if the individual has at
least one first-degree relative with these conditions [49]. It is 3.0 and 14.7
given two affected first-degree relatives. The positive and negative predictive
values for these cancers appearing in a proband’s first-degree relatives are
89.1% and 98.9% for breast cancer, and 76.1% and 99.3% for ovarian cancer
[50]. The U.S. Preventive Services Task Force (USPSTF) has conducted
evidence reviews of genetic testing for the key mutations involved in HBOC,
BRCA1 and 2. It recommends:
Primary care providers screen women who have family members

with breast, ovarian, tubal, or peritoneal cancer with 1 of several
screening tools designed to identify a family history that may be
associated with an increased risk for potentially harmful mutations in
breast cancer susceptibility genes (BRCA1 or BRCA2). Women with
positive screening results should receive genetic counseling and, if
indicated after counseling, BRCA testing. [57]
The CDC-OPHG classifies the use of family history of known

breast/ovarian cancer with deleterious BRCA mutations as Tier 1 [39]. CDC
defines Tier 1 genetic interventions as those supported by clinical practice
guidelines based on thorough systematic review. These modalities are ready
for implementation not just on the individual but on the level of the at-risk
population as well [38].

Family history, however, is part of a train of diagnostic interventions,

including genetic counseling and genetic testing. The latter can lead to annual
screening via MRI or to surgery. A 2012 cost-effectiveness analysis of
BRCA1/2 testing of women >= 35 years at elevated risk of carrying a mutation,
considering the eventual use of these MRI and surgery, determined genetic
testing to be cost-effective if testing cost were <= $8,948 [58]. Currently
targeted BRCA1/2 mutation testing ranges from $4,500 to $650 [58, 59].
Economies of scale operate when identifying persons at risk for cancer.
Identifying single individuals can be expected to be less efficient than
pinpointing families at risk, just as using information reflecting population risk
data can be expected to be more efficient than utilizing separate family
histories. Cascade screening is the testing of successive test positive family
members starting with a positive index case. Two studies delineate that the
success of BRCA1/2 cascade screening in affected families, as measured by
actual uptake of genetic testing, is a function of ability of family members to
communicate with one another, and to attend a clinical session [60, 61].
Uptake rates of 54% (Utah study) and 73% (Manchester portion of U.K. study)
were achieved when these conditions were satisfied. The London portion of
the U.K. study, which covered a more dispersed population, achieved 62% for
those clinically seen. George et al. indicate that the cost of BRCA testing in 30
at-risk relatives can be brought down from a minimum of $66,000 to $12,000
once the responsible mutation has been identified in a family member [62].
On a population level, it is possible to gather information on early-stage
breast and ovarian cancer, and to report aggregate information back to
participating institutions. A breast cancer incidence study utilizing the
Connecticut Tumor Registry found that the ability to detect cases depends on
the relative population size of the groups being assessed (here white versus
nonwhite) [63]. Population-based risk assessment has the advantage of
detecting BRCA1/2 carriers with a negative family history. Clinical validity
goes up with the prevalence of a disorder in a given population. Rubinstein et
al. performed a decision analysis of BRCA1/2 testing in American Ashkenazi
Jewish women aged 35-55 years [64]. At a cost of $460 for founder mutation
testing, the investigators concluded that such a program is cost-effective,
amounting to $8,300/QALY gained.
The PMI, like state cancer registries, is especially geared towards
targeting at-risk individuals and populations. The CDC notes that state health
departments have engaged in bidirectional reporting, i.e., identification of
cases from the state tumor registry, and reporting back of information to
participating facilities. The Michigan Department of Health and Human

Services and Connecticut Department of Health have both identified thousands

of cases of breast and ovarian cancer suggesting risk for HBOC, and returned
back facility-specific data [65]. In the case of Connecticut, facility-specific
reports on numbers of breast and ovarian cancers, compiled from 3,792 cases
in the state cancer registry, were reported back to providers to alert them that
patients might be at an increased risk for HBOC. Staff at 70% of the 32
involved hospitals also requested and received an HBOC training session.
In the age of electronic health records (EHRs), systems can be designed to
provide physicians with decision support tools that alert them to the need for
genetic testing, and assist with interpretation of results and potential impact on
patients and their families [11]. It is also possible with EHR systems to flag
patients who are members of high-risk families to make them aware of their
risk status and available options [66, 67].
The Precision Public Health Approach to Colorectal

Cancer
The hereditary form of CRC that has received the most public health and
medical attention is hereditary nonpolyposis colorectal cancer (HNPCC) or
Lynch syndrome (LS), which produces only a small number of polyps or none
at all. LS is the most common heritable cause of CRC, representing 1 in 35
cases [66]. Whereas the lifetime risk for developing CRC is 2 to 5% in the
general population, it is 80% in those with LS.
Family history as an instrument for performing cancer risk assessment in
first- and second-degree relatives is even more accurate for CRC than for the
other two families of cancers. Valdez et al. report that the relative risk for CRC
is 2.2 given a first-degree relative with the condition, and 4.0 given at least
two first-degree relatives with CRC [49]. Lynch syndrome is notoriously
underdiagnosed, however. The vast majority of families with a history of CRC
do not know they may have LS, or even that a genetic test is available [66].
Nevertheless, the EGAPP Working Group, using a chain of evidence
methodology comparing four preliminary testing (MSI, IHC, and BRAF) and
mismatch repair (MMR) gene strategies leading to medical and surgical
management, found that adequate evidence exists that an appropriate testing
strategy can improve clinical outcomes for patients and their families [68].
A precision public health approach to Lynch syndrome entails spotting
cases before the management is made more complex by disease advancement,

coupled with identifying at-risk relatives free of disease. A 2014 consensus

statement by the U.S. Multi-Society Task Force on Colorectal Cancer looked
at initial approaches for index case identification. Use of clinical criteria (e.g.,
the Revised Bethesda Guidelines) and a CRC risk assessment tool using
family history – “selective approaches” used to identify a range of patients –
both showed adequate sensitivity in identifying individuals with germline
mutations, but up to 28% of LS patients can be missed with a liberal
interpretation of the revised guidelines [69]. A more “universal approach”
assessing LS risk based on IHC testing of all incoming cases of CRC was
found to have greater sensitivity than selective strategies including the use of
the Bethesda guidelines. Such an approach is still shy of being considered
population-wide risk assessment in that testing begins with confirmed
colorectal cancer cases. Multiple studies have shown that: (1) the systematic
application of testing among patients with newly diagnosed CRC could
provide substantial clinical benefits at acceptable costs; and (2) adopting a
“universal” approach towards CRC genetic testing is cost-effective [69].
Palomaki et al., for example, found that a strategy employing IHC and BRAF
preliminary testing followed by MMR mutation testing in BRAF negative
cases would cost an average of $18,863 per LS case detected [70].
Having identified an index case, the public health approach is then to
move on to relatives to identify those at risk for LS, and those who are not.
The EGAPP Working Group cites seven studies showing how uptake of
colonoscopy by relatives with LS ranged from 53 to 100% [68]. Sharaf et al.,
in a sub-analysis of four select articles from a broader LS studies review,
concluded that 52% or less of the first-degree relatives received LS genetic
testing [71]. This number was critiqued by Jasperson, who noted that the
Sharaf analysis excluded a large study containing 466 family members
composed almost exclusively of first-degree relatives at high-risk of
developing LS [72]. The latter study found 75% of the members to have been
tested for LS mutations.
The cost of cascade testing is also a consideration. The per mutation cost
of MMR gene testing for LS can decrease from $1,000 to $350 once a specific
familial mutation has been identified in the proband [59]. The consequence is
that the cost per LS index case can decrease from $18,863 to $13,000 [68]. In
the most comprehensive cost-effectiveness assessment of universal and “near-
universal” genetic screening to date, covering seven LS studies that also
looked at medical/surgical follow-up and testing of relatives, Grosse found
that all except one reported incremental cost-effectiveness ratios less than the

threshold $100,000 per life-year or quality-adjusted life-year gained [73]. As

with HBOC, collection and reporting of LS data has occurred at the state level.
Michigan identified 10,000 CRC cases from its cancer registry, and returned
facility-specific data and educational materials to 145 reporting institutions
[74]. Connecticut reported back information on 3,517 CRC cases in its cancer
registry to targeted practitioners at acute care hospitals. These bidirectional
reporting efforts show that health-related information may be stored en masse
for both practical and research purposes (as in the PMI Cohort), and can be
reissued for clinical and public health purposes.
Table 2. Public health precision approach – 3 cancers
Condition Genetic test Cost-effectiveness References

Familial lung Family history *FP rate: 1.9 (female) – Ziogas and Anton-
cancer (FH) 6.1 (male) Culver [50]
FN rate: 29.1 (female) –
37.5 (male)
**PPV: 81.0 (68.6 –
90.1)***
NPV: 97.1 (96.0 – 98.0)
Cost $10 – 25/FH taken Johnson et al. [51]
GWAS – remains
investigational
Hereditary breast BRCA1/2 Cost-effectiveness Goodman [58]
and ovarian threshold $8,948
cancer (HBOC) (current testing $650 –
4,500)
$8,300/QALY gained Rubinstein et al.
(U.S. Ashkenazi [64]
population)
Hereditary Multi-gene $18,863 cost/index case EGAPP [68];
nonpolyposis testing (MLH1, $13,000 cost/relative Palomaki et al.
colorectal cancer MSH2, MSH6, [70]
(Lynch syndrome PMS2, EPCAM)
– LS)
$29,600 – 63,900/ Grosse [73]
QALY gained
(“universal” testing)
* False positive (FP) and false negative (FN) rates.
** Positive predictive value (PPV) and negative predictive value (NPV).
*** 95% Confidence interval.

The Colorado Department of Public Health and Environment also targeted

educational outreach relating to hereditary CRC to 430 medical providers and
200 at-risk cases [74]. A survey was conducted which showed that 98% of
provider and patient respondents thought that the information was clear and
useful, many patients having indicated they engaged in further dialogue with
their physician, a genetic counselor, or a family member. About 1/3 of the
patient respondents communicated that they planned to have a risk assessment
as a result of receiving the materials. The Colorado educational efforts were
conducted by mail. An extensive, 33-study article review by Naylor et al.
found that further patient education involving phone or in-person contact
combined with patient navigation of resources can lead to improvements on
the order of 15% in colorectal screening rates in minority populations [75].
Table 2 outlines the array of precision public health efforts, which
involves targeting of screening, genetic testing, and education for the three
cancer conditions.
CONCLUSION: CONTINUITY AND EMERGENCE IN

PRECISION HEALTH APPROACHES
A major point brought out by the two tables is that pharmacogenomic
regimens cost considerably more than primary prevention approaches to
cancer management. From the articles reviewed herein, the former often
exceed cost-effectiveness thresholds, though this conclusion need not
necessarily be true for the regimens that are being offered. The cancer drug
being prescribed is typically the main contributor to the cost, as opposed to the
companion diagnostic, which can actually bring the price down. One can then
view this conclusion in three ways: (1) optimistically, economies of scale or
institutional policy changes might ultimately bring the cost of the
pharmacogenomic regimen down; (2) the value of a person’s life is to be held
paramount, thus the costs incurred, from a private perspective, are worth it; or
(3) the value of the primary prevention approach, due to its cost-effectiveness,
is to be emphasized.
The medical and public health approaches are not to be viewed as
mutually exclusive. Their territories are more like the circles of a Venn
diagram which intersect with plenty of shared space in the middle. Both the
CDC and its EGAPP program have devoted considerable attention to

companion diagnostics and the attempt to prove that they have overall utility,
including cost-effectiveness. Public health has an evaluative role that dips into
hospital-based interventions. The national view is more one of mergence [3].
The fact that BRCA1/2 genetic testing takes off where chemotherapeutic
approaches to breast cancer leave off, in terms of the host cancer’s hormone
receptor status, indicates that the domains of the primary/secondary and
tertiary prevention camps are complementary. It would be idealistic to assume
that predictive genetic testing plus monitoring could eliminate all tumors
before they spread. Both ends of the prevention continuum are needed, and the
more targeted they are, the better. It is also important to recognize that the
medical and public health approaches both defy stereotyping. The use of KRAS
testing in anti-EGFR therapy of metastatic colorectal cancer can be cost-
saving. The value of a public health approach genetic to lung cancer is limited
by the current state of GWAS findings and the heavy influence of gene-
environment interactions in the genesis of lung cancer. Indeed, some would
argue that federal and state policy approaches towards smoking and lung
cancer should take center stage.
Policymakers have a role in deciding allocation of healthcare dollars. In
providing arguments for and against utility in this paper, we are not advocating
a withdrawal of dollars from either medical or public health oncogenomic
approaches. The case has been made for a more detailed consideration of the
proportion of dollars that go towards prevention, however. The paper has not
dealt just with chemotherapy, or just with Tier 1 genetic testing, however –
emphasis has been placed on a precision approach for both. In public health,
this nuance translates into tailoring the intervention towards communities at-
risk or in-need. It will be more cost-effective thereby, and will achieve the
ethical standard of addressing the health of all by attending to those most in
need.
A final point should be made about the medical and public health
precision approaches that are emerging. The medical approach is showing
healthy signs of growth. The PMI Research Cohort will grant it the ability to
host more clinical trials with suitable cohorts of participants, and to speed up
the process of conducting clinical trials. As NCI plans, some of these trials
will cross typological borders and target treatments based on somatic
abnormalities in the tumors regardless of cancer type [34]. Public health
research will also benefit from the PMI Cohort, especially in instances where
major germline mutations have not turned up and GWAS are actively
identifying lower risk alleles having a cumulative effect. Given the thought
being given to participating groups, the discovery of new risk alleles will most

certainly benefit diverse communities. The promise of tapping into lifestyle

and environmental factors as data on the cohort participants builds will
strengthen prevention approaches even further. The word “precision” also
applies to the educational component of health programs. Educational efforts
can become more tailored to the needs of at-risk groups as the data
accumulates. Precision public health does not end with the target molecule, but
with the whole person and the community to which he or she belongs.
REFERENCES
[1] The White House, Office of the Press Secretary. FACT SHEET:
President Obama’s Precision Medicine Initiative. Washington, D.C.
2015. https://obamawhitehouse.archives.gov/the-press-office/2015/01/
30/fact-sheet-president-obama-s-precision-medicine-initiative.
[2] Collins, F.S., Varmus, H. A new initiative on precision medicine. N.
Engl. J. Med. 2015; 372(9): 793-795.
[3] Khoury, M.J., Galea, S. Precision public health: more precision ahead
for individual and population interventions. Atlanta, GA. 2016.
https://blogs.cdc.gov/genomics/201 6/09/07/precision_public_health.
[4] Khoury, M.J., Gwinn, M., Yoon, P.W., Dowling, N., Moore, C.A.,
Bradley, L. The continuum of translation research in genomic medicine:
how can we accelerate the appropriate integration of human genome
discoveries into health care and disease prevention? Genet. Med. 2007;
9(10): 665-674.
[5] Jameson, J.L., Longo, D.L. Precision medicine – personalized,
problematic, and promising. N. Engl. J. Med. 2015; 372(23): 2229-
2234.
[6] Shen, B., Hwang, J. The clinical utility of precision medicine: properly
assessing the value of emerging diagnostic tests. Clin. Pharmacol. Ther.
2010; 88(6): 754-756.
[7] Institute of Medicine (U.S.) Roundtable on Translating Genomic-Based
Research for Health. The value of genetic and genomic technologies:
workshop summary. Board on Health Sciences Policy. Washington,
D.C.: The National Academies Press; 2010.
[8] Pray, L.A. Gleevec: the breakthrough in cancer treatment. Nature Educ.
2008; 1(1): 37.

[9] Cancer.Net. Leukemia – chronic myeloid – CML: statistics. 2015.

http://www.cancer.net/cancer-types/leukemia-chronic-myeloid-cml/
statistics.
[10] Simonds, N.I., Khoury, M.J., Schully, S.D., Armstrong, K., Cohn, W.F.,
Fenstermacher, D.A., Ginsburg, G.S., Goddard, K.A.B., et al.
Comparative effectiveness research in cancer genomics and precision
medicine: current landscape and future prospects. J. Natl. Cancer Inst.
2013; 105(13): 929-936.
[11] Mirnezami, R., Nicholson, J., Darzi, A. Preparing for precision
medicine. N. Engl. J. Med. 2012; 366(6): 489-491.
[12] Khoury, M.J., Gwinn, M.L., Glasgow, R.E., Kramer, B.S. A population
approach to precision medicine. Am. J. Prev. Med. 2012; 42(6); 639-
645.
[13] American Cancer Society. Key statistics for lung cancer. 2016a.
https://www.cancer.org/cancer/non-small-cell-lung-cancer/about/key-
statistics.html.
[14] Cancer Research Institute. Lung cancer. 2016. http://www.
cancerresearch.org/cancer-immunotherapy/impacting-all-cancers/lung-
cancer?gclid=CM3a26TUqNACFQIDaQod5nsDaw.
[15] Millner, L.M., Strotman, L.N. The future of precision medicine in
oncology. Clin. Lab. Med. 2016; 36(3): 557-573.
[16] Cancer.Net. Lung cancer – non-small cell – statistics. 2016. http://www.
cancer.net/cancer-types/lung-cancer-non-small-cell/statistics.
[17] Ritchie, M.D. The success of pharmacogenomics in moving genetic
association studies from bench to bedside: study design and
implementation of precision medicine in the post-GWAS era. Hum.
Genet. 2012; 131(10): 1615-1626.
[18] Brunstein, J. Cost-effectiveness considerations with molecular
diagnostics in oncology. MLO Med. Lab. Obs. 2016; 48(5): 30-31.
[19] Djalalov, S., Beca, J., Hoch, J.S., Krahn, M., Tsao, M.-S., Cutz, J.-C.,
Leighl, N.B. Cost effectiveness of EML4-ALK fusion testing and first-
line crizotinib treatment for patients with advanced ALK-positive non-
small-cell lung cancer. J. Clin. Oncol. 2014; 32(10): 1012-1019.
[20] Doble, B., John, T., Thomas, D., Fellowes, A., Fox, S., Lorgelly, P.
Cost-effectiveness of precision medicine in the fourth-line treatment of
metastatic lung adenocarcinoma: an early decision analytic model of
multiplex targeted sequencing. Lung Cancer 2016; doi:
10.1016/j.lungcan.2016.05.024. [Epub ahead of print]

[21] American Cancer Society. What are the key statistics about
breast cancer? 2016b. http://www.cancer.org/cancer/breastcancer/
detailedguide/breast-cancer-key-statistics.
[22] Dendukuri, N., Khetani, K., McIsaac, M., Brophy, J. Testing for HER2-
positive breast cancer: a systematic review and cost-effectiveness
analysis. Can. Med. Assoc. J. 2007; 176(10): 1429-1434.
[23] Evaluation of Genomic Applications in Practice and Prevention
(EGAPP) Working Group. Recommendations from the EGAPP
Working Group: can tumor gene expression profiling improve outcomes
in patients with breast cancer? Genet. Med. 2009a; 11(1): 66-73.
[24] Sparano, J.A., Gray, R.J., Makower, D.F., Pritchard, K.I., Albain, K.S.,
Hayes, D.F., Geyer, C.E., Jr., Dees, E.C., et al. Prospective validation of
a 21-gene expression assay in breast cancer. N. Engl. J. Med. 2015;
373(21): 2005-2014.
[25] EGAPP Working Group. Recommendations from the EGAPP Working
Group: does the use of Oncotype DX tumor gene expression profiling to
guide treatment decisions improve outcomes in patients with breast
cancer? Genet. Med. 2016; 18(8): 770-779.
[26] American Cancer Society. Key statistics for colorectal cancer. 2016c.
www.cancer.org/cancer/colon-rectal-cancer/about/key-statistics.html.
Group: can UGT1A1 genotyping reduce morbidity and mortality in
patients with metastatic colorectal cancer treated with irinotecan? Genet.
Med. 2009b; 11(1): 15-20.
[28] Markman, M. Colorectal cancer and KRAS/BRAF. 2016. http://
emedicine.medscape.com/article/1690010-overview.
[29] Wang, G., Kelley, R.K., and GAPPNet. KRAS mutational analysis for
colorectal cancer. PLoS Curr. 2010; 1: doi: 10.1371/currents.RRN1175.
Group: can testing of tumor tissue for mutations in EGFR pathway
downstream effector genes in patients with metastatic colorectal cancer
improve health outcomes by guiding decisions regarding anti-EGFR
therapy? Genet. Med. 2013; 15(7): 517-527.
[31] Vijayaraghavan, A., Efrusy, M.B., Göke, B., Kirchner, T., Santas, C.C.,
Goldberg, R.M. Cost-effectiveness of KRAS testing in metastatic
colorectal cancer patients in the United States and Germany. Int. J.
Cancer 2012; 131(2); 438-445.

[32] Shiroiwa, T., Motoo, Y., Tsutani, K. Cost-effectiveness analysis of

KRAS testing and cetuximab as last-line therapy for colorectal cancer.
Mol. Diagn. Ther. 2010; 14(6): 375-384.
[33] Ward, S. Scope, A., Rafia, R., Pandor, A., Harnan, S., Evans, P., Wyld,
L. Gene expression profiling and expanded immunohistochemistry tests
to guide the use of adjuvant chemotherapy in breast cancer
management: a systematic review and cost-effectiveness analysis.
Health Technol. Assess. 2013; 17(44); 1-302.
[34] National Cancer Institute. NCI and the Precision Medicine Initiative ®.
Bethesda, MD. 2016. https://www.cancer.gov/research/key-initiatives/
precision-medicine.
[35] Shaikh, A.R., Butte, A.J., Schully, S.D., Dalton, W.S., Khoury, M.J.,
Hesse, B.W. Collaborative biomedicine in the age of big data: the case
of cancer. J. Med. Internet Res. 2014; 16(4): e101.
[36] Graber, C. The problem with precision medicine. The New Yorker Feb
5, 2015. http://www.newyorker.com/tech/elements/problem-precision-
medicine.
[37] Marcus, P.M., Pashayan, N., Church, T.R., Doria-Rose, V.P., Gould,
M.K., Hubbard, R.A., Marrone, M., Miglioretti, D.L., et al. Population-
based precision cancer screening: a symposium on evidence,
epidemiology, and next steps. Cancer Epidemiol. Biomarkers Prev.
2016; 25(11): 1449-1455.
[38] Green, R.F., Dotson, W.D., Kolor, K., Khoury, M.J. Genomics in public
health: perspective from the Office of Public Health Genomics at the
Centers for Disease Control and Prevention (CDC). Healthcare 2015;
3(3): 830-837.
[39] Centers for Disease Control and Prevention, Office of Public Health
Genomics. Public Health Genomics Knowledge Base (v1.3). Atlanta,
GA. 2016. https://phgkb.cdc.gov/GAPPKB/topicStartPage.do.
[40] Centers for Medicare & Medicaid Services. Affordable Care Act
Implementation FAQs – Set 12. Baltimore, MD. 2013. https://www.
cms.gov/CCIIO/Resources/Fact-Sheets-and-FAQs/aca_implementation_
faqs12.html.
[41] Khoury, M.J., Evans, J.P. A public health perspective on a national
precision medicine cohort: balancing long-term knowledge generation
with early health benefit. J. Natl. Med. Assoc. 2015; 313(21): 2117-
2118.
[42] Chanock, S.J., Hunter, D.J. Genomics: when the smoke clears…. Nature
2008; 452(7187): 537–538.

[43] Thorgeirsson, T.E., Geller, F., Sulem, P., Rafner, T., Wiste, A.,
Magnusson, K.P., Manolescu, A., Thorleifsson, G., et al. A variant
associated with nicotine dependence, lung cancer and peripheral arterial
disease. Nature 2008; 452(7187); 638-642.
[44] Hung, R.J., McKay, J.D., Gaborieau, V., Boffetta, P., Hashibe, M.,
Zaridze, D., Mukeria, A., Szeszenia-Dabrowska, N., et al. A
susceptibility locus for lung cancer maps to nicotinic acetylcholine
receptor subunit genes on 15q25. Nature 2008; 452(7187): 633-637.
[45] Amos, C.I., Wu, X., Broderick, P., Gorlov, I.P., Gu, J., Eisen, T., Dong,
Q., et al. Genome-wide association scan of tag SNPs identifies a
susceptibility locus for lung cancer at 15q25.1. Nat. Genet. 2008; 40(5):
616-622.
[46] Hosgood, H.D., Wang, W.C., Hong, Y.C., Wang, J.C., Chen, K., Chang,
I.S., Chen, C.J., Lu, D., et al. Genetic variant in TP63 on locus 3q28 is
associated with the risk of lung adenocarcinoma among never-smoking
females in Asia. Hum. Genet. 2012; 131(7): 1197-1203.
[47] Li, Y., Sheu, C.C., Ye, Y., de Andrade, M., Wang, L., Chang, S.C.,
Aubry, M.C., Aakre, J.A., et al. Genetic variants and risk of lung cancer
in never smokers: a genome-wide association study. Lancet Oncol.
2010; 11(4): 321-330.
[48] Marcus, P.M., Freedman, A.N., Khoury, M.J. targeted cancer screening
in average-risk individuals. Am. J. Prev. Med. 2015; 49(5); 765-771.
[49] Valdez, R., Yoon, P.W., Qureshi, N., Green, R.F., Khoury, M.J. Family
history in public health practice: a genomic tool for disease prevention
and health promotion. Annu. Rev. Public Health 2010; 31: 69-87.
[50] Ziogas, A., Anton-Culver, H. Validation of family history data in cancer
family registries. Am. J. Prev. Med. 2003; 24(2): 190-198.
[51] Johnson, J., Giles, R.T., Larsen, L., Ware, J., Adams, T., Hunt, S.C.
Utah’s Family High Risk Program: bridging the gap between genomics
and public health. Prev. Chronic Dis. 2005; 2(2): A24.
[52] Thomas, J.C., Irwin, D.E., Zulker, E.S., Millikan, R.C. Genomics and
the Public Health Code of Ethics. Am. J. Public Health 2005; 95(12):
2139-2143.
[53] Reardon, S. U.S. tailored-medicine project aims for ethnic balance.
Nature 2015; 523(7561): 391-392.
[54] Schwartz, A.G., Wenzlaff, A.S., Bock, C.H., Ruterbusch, J.J., Chen, W.,
Cote, M.L., Artis, A.S., Van Dyke, A.L., et al. Admixture mapping of
lung cancer in 1812 African-Americans. Carcinogenesis 2011; 32(3):
312-317.

[55] Cancer.Net. Hereditary breast and ovarian cancer. 2015. http://www.

cancer.net/cancer-types/hereditary-breast-and-ovarian-cancer.
[56] American Society of Human Genetics. New research validates clinical
use of family health history as the ‘gold standard’ for assessing personal
disease risk. Bethesda, MD. 2010. http://www.ashg.org/pdf/PR_
FamilyHealthHistory_110510.pdf.
[57] U.S. Preventive Services Task Force. Final recommendation statement:
BRCA-related cancer: risk assessment, genetic counseling and genetic
testing, December 2013. Rockville, MD. 2013. https://www.
uspreventiveservicestaskforce.org/Page/Document/RecommendationSta
tementFinal/brca-related-cancer-risk-assessment-genetic-counseling-
and-genetic-testing.
[58] Goodman, A. BRCA1/2 genetic testing found cost-effective in current
era. Am. J. Manag. Care 2012; 18(3 Spec. No.): SP133.
[59] American Public Health Association. Advancing cancer genomics in
public health. Washington, D.C. 2013. http://www.apha.org/policies-
and-advocacy/public-health-policy-statements/policy-database/2014/07/
23/10/25/advancing-cancer-genomics-in-public-health.
[60] Brooks, L., Lennard, F., Shenton, A., Lalloo, F., Ambus, I., Ardem-
Jones, A., Belk, R., Kerr, B., et al. BRCA1/2 predictive testing: a study
of uptake in two centres. Eur. J. Hum. Genet. 2004; 12(8): 654-662.
[61] Botkin, J.R., Smith, K.R., Croyle, R.T., Baty, B.J., Wylie, J.E., Dutson,
D., Chan, A., Hamann, H.A., et al. Genetic testing for a BRCA1
mutation: prophylactic surgery and screening behavior in women 2
years post testing. Am. J. Med. Genet. 2003; 118A(3): 201-209.
[62] George, R., Kovak, K., Cox, S.L. Aligning policy to promote cascade
genetic screening for prevention and early diagnosis of heritable
diseases. J. Genet. Counsel. 2015; 24(3): 388-399.
[63] Crabbe, J.C.F., Gregorio, D.I., Samociuk, H., Swede, H. Secular trends,
race, and geographic disparity of early-stage breast cancer incidence: 25
years of surveillance in Connecticut. Am. J. Public Health 2015;
105(Suppl. 3): e64-e70.
[64] Rubinstein, W.S., Jiang, H., Dellefave, L., Rademaker, A.W. Cost-
effectiveness of population-based BRCA1/2 testing and ovarian cancer
prevention for Ashkenazi Jews: a call for dialogue. Genet. Med. 2009;
11(9): 629-639.

Genomics. Genomics implementation: more detailed information on key
Tier 1 applications – hereditary breast and ovarian cancer (HBOC).
Atlanta, GA. 2015. https://www.cdc.gov/genomics/implementation/
toolkit/hboc_1.htm.
[66] Modell, S.M., Greendale, K., Citrin, T., Kardia, S.L. Expert and
advocacy group consensus findings on the horizon of public health
genetic testing. Healthcare 2016; 4(1): pii: E14. doi: 10.3390/
healthcare4010014.
[67] Center for Public Health and Community Genomics, Genetic Alliance.
Priorities for public health genomics 2012-2017: stakeholder
consultation/priorities conference report, September 2011. Ann Arbor,
MI. 2011. https://stacks.cdc.gov/view/cdc/11738.
Group: genetic testing strategies in newly diagnosed individuals with
colorectal cancer aimed at reducing morbidity and mortality from Lynch
syndrome in relatives. Genet. Med. 2009c; 11(1): 35-41.
[69] Giardiello, F.M., Allen, J.I., Axilbund, J.E., Boland, C.R., Burke, C.A.,
Burt, R.W., Church, J.M., Dominitz, J.A., et al. Guidelines on genetic
evaluation and management of Lynch syndrome: a consensus statement
by the US Multi-Society Task Force on Colorectal Cancer. Am. J.
Gastroenterol. 2014; 109(8): 1159-1179.
[70] Palomaki, G.E., McClain, M.R., Melillo, S., Hampel, H.L., Thibodeau,
S.N. EGAPP supplementary evidence review: DNA testing strategies
aimed at reducing morbidity and mortality from Lynch syndrome.
Genet. Med. 2009; 11(1): 42-65.
[71] Sharaf, R.N., Myer, P., Stave, C.D., Diamond, L.C., Ladabaum, U.
Uptake of genetic testing by relatives of Lynch syndrome probands: a
systematic review. Clin. Gastroenterol. Hepatol. 2013; 11(9): 1093-
1100.
[72] Jasperson, K. Cascade genetic testing in Lynch syndrome: room for
improvement. Nat. Rev. Gastroenterol. 2013; 122: 505-508.
[73] Grosse, S.D. When is genomic testing cost-effective? Testing for Lynch
syndrome in patients with newly-diagnosed colorectal cancer and their
relatives. Healthcare 2015; 3(4): 860-878. doi: 10.3390/healthcare
3040860.

Genomics. Lynch syndrome phase 1. Atlanta, GA. 2014. https://www.
cdc.gov/genomics/implementation/toolkit/lynch_2.htm.
[75] Naylor, K., Ward, J., Polite, B.N. Interventions to improve care related
to colorectal cancer among racial and ethnic minorities: a systematic
review. J. Gen. Intern. Med. 2012; 27(8): 1033-1046.

Chapter 4
NEUROPSYCHOLOGICAL PROFILE
OF PEOPLE WITH
WILLIAMS SYNDROME (WS)
Anne-Sophie Pezzino, Nathalie Marec-Breton

and Agnès Lacroix
Center for the Psychology of Cognition, Communication and Behavior
University of Rennes 2, Rennes, France
ABSTRACT
Williams syndrome (WS) is a genetic neurodevelopmental disorder
(prevalence close to 1 in 20,000-30,000 births) resulting from the deletion
of 16-25 genes on the long arm of Chromosome 7 (Scherer & Osborne,
2006). Individuals with WS have an intelligence quotient of 40-70
(Howlin, Davies, & Udwin, 1998). Theirs is a unique neuropsychological
profile, characterized by an apparent dissociation between cognition and
language, as language is relatively well preserved, compared with other
cognitive skills (Karmiloff-Smith, et al., 2004; Martens, Wilson, &
Reutens, 2008). However, a more complex profile is now emerging, with
good lexical, short-term memory (especially auditory-verbal) and face
processing skills, but visuospatial (especially local processing of

Corresponding Author Email: agnes.lacroix@univ-rennes2.fr.

140 Anne-Sophie Pezzino, Nathalie Marec-Breton and Agnès Lacroix
information), executive (planning and inhibition), memory (working

memory and long-term) and attentional deficits (Bellugi, Lichtenberger,
Jones, Lai, & George, 2000; Schmitt, Eliez, Warsofsky, Bellugi, & Reiss,
2001; Fayasse & Thibaut, 2003; Menghini, Addona, Costanzo, & Vicari,
2010; Costanzo et al., 2013; Dessalegn, Landau & Rapp, 2013).
Individuals with WS also have specific auditory-perceptual cognitive
skills (hyperacusis), category-specific perception of speech sounds
(Majerus, Palmisano, Van Der Linden, Barisnikov, & Poncelet, 2001;
Majerus, Barisnikov, Vuillemin, Poncelet, & Linden, 2003), and musical
skills that exceed their cognitive level (Levitin, Cole, Lincoln, & Bellugi,
2005). Other behavioral characteristics include hypersociability (Jones et
al., 2000; Mervis, Morris, Klein-Tasman, et al., 2003).
In this chapter, we provide a review of the literature on the specific
neuropsychological profile of individuals with WS, from a cognitive-
behavioral and neuroanatomical point of view. Early studies of the
neuropsychological profile in WS focused on the dissociation between
cognition and language. Since then, research has shown this syndrome to
be more complex.
Our aim is to highlight the heterogeneity of the cognitive profiles
observed in this syndrome, and to identify the factors that might explain
this heterogeneity. The complexity and specific features of the
neuropsychological profile in WS need to be understood in order to
develop therapeutic and learning methods adapted to the developmental
pace of individuals with WS.
Keywords: genetic syndrome, Williams syndrome, neuropsychological

profile, learning abilities
INTRODUCTION
Williams syndrome (WS) is a rare genetic disease (one case per 20,000
births) caused by a microdeletion on the long arm of Chromosome 7 (7q11.23)
leading to the loss of 16-25 genes (Scherer & Osborne, 2006). At the cognitive
level, individuals with WS have an intelligence quotient (IQ) of about 40-70
(Howlin et al., 1998; Mervis, Morris, Bertrand, & Robinson, 1999). Their
unique neuropsychological profile is characterized by a dissociation between
oral language (relatively preserved) and other (impaired) cognitive abilities
(Hoffman, Landau, & Pagani, 2003; Tager-Flusberg, Plesa-Skwerer, Faja, &
Joseph, 2003; Karmiloff-Smith et al., 2004; Reiss, Hoffman, & Landau, 2005;
Meyer-Lindenberg, Mervis, & Berman, 2006; Martens et al., 2008; O’Hearn,
Courtney, Street, & Landau, 2009). Neuroanatomical studies suggest that these

Neuropsychological Profile of People with Williams Syndrome 141
cognitive profiles can be explained by brain defects: preservation of the

frontotemporal lobe (oral language), but parietal lobe (visuospatial skills)
deficiency (Bellugi et al., 2000; Martens et al., 2008; Eisenberg, Jabbi, &
Berman, 2010; Thomas, Purser, & Van Herwegen, 2012).
In this chapter, we explore the complex neuropsychological profile of
individuals with WS, which goes far beyond a straightforward dissociation
between language and other cognitive skills. Research on the
neuropsychological profile of individuals with WS has been based on four
major domains: intellectual ability, perception (auditory and visual), language
and, more recently, memory and executive functions. Results suggest
specificity and considerable variability in cognitive abilities (Bellugi et al.,
2000; Martens et al., 2008). The purpose of this chapter is to analyze more
recent studies, in order to find explanations for the heterogeneity of the
neuropsychological profile in WS. From a developmental perspective, we
attempt to understand the complexity and characteristics of this profile.
INTELLECTUAL ABILITY
Historically, studies have relied on the IQ of individuals with WS to
characterize their cognitive profile (Howlin et al., 1998; Mervis et al., 1999;
Martens et al., 2008). Research has highlighted a syndrome-specific
dissociation between language skills and other cognitive abilities (Mervis &
Klein-Tasman, 2000; Martens et al., 2008). Studies show that verbal IQ is
higher than performance IQ among individuals with WS (Boddaert et al.,
2006; Searcy et al., 2004). It should be noted that there is less heterogeneity in
subtests measuring performance IQ (Searcy et al., 2004).
Studies have yielded discrepant findings on the IQ of children with WS
across development. Some studies have demonstrated a decline in IQ (Gosh &
Pankau, 1994), while others have found an increase of 3-17 points (Udwin,
Davies, & Hosylin, 1996).
There therefore seems to be considerable variability in results on
intellectual ability and, consequently, in behavioral abilities. For example,
studies have shown that teenagers with WS have difficulty with Piagetian tests
of number, weight and substances that children are normally able to perform
successfully by the age of 8 years (Dehaene, 1997). However, while some
adults with WS have difficulty with arithmetic, others are able to master basic
operations such as addition, subtraction and division (Howlin et al., 1998).

More recently, research has suggested that intellectual level is relatively

stable (Searcy et al., 2004), with most studies ruling out a link between
intellectual ability and the development of cognitive processes underlying the
learning behavior of individuals with WS (Majerus et al., 2003; Menghini,
Verucci, & Vicari, 2004; Steele, Scerif, Cornish, & Karmiloff-Smith, 2013). It
is now acknowledged that full-scale IQ alone does not reflect the variability in
cognitive skills and behaviors of people with WS. For example, although a
longitudinal study by Udwin, Davies, and Howlin (1996) of 23 participants
with WS (IQ = 70) revealed weaknesses that could be correlated with IQ
(WAIS-R; 1981) in reading, spelling and arithmetic tasks, other results suggest
a lack of connection between intellectual ability and the acquisition of reading
skills (Majerus et al., 2003; Menghini et al., 2004; Steele et al., 2013).
To sum up, previous findings highlight the importance of describing the
cognitive skills elicited by the tasks administered to individuals with WS. In
the rest of this section, we therefore describe the cognitive skills of individuals
with WS, including visual and auditory perception, oral language, memory,
and executive functions.
PERCEPTUAL SKILLS (VISUAL AND AUDITORY)

One way of exploring the marked heterogeneity of individuals with WS is
to study their perceptual abilities, both auditory (categorical and allophonic
perception) and visual (visuospatial and face processing).
Auditory processing performances seem atypical in WS (Majerus et al.,
2003). The hyperacusis that is frequently mentioned in studies of WS may
induce categorical and allophonic perception of speech sounds, preventing the
formation of stable phonological representations (Majerus et al., 2003; Nazzi,
Paterson, & Karmiloff-Smith, 2003; Eckert et al., 2006; Bogliotti, Serniclaes,
Messaoud-Galusi & Sprenger-Charolles, 2008; Martens et al., 2008; Majerus
D'Argembeau, Martinez Perez et al., 2010).
These auditory peculiarities could explain other cognitive and behavioral
specificities (Carrasco, Castillo, Aravena, Rothhammer, & Aboitiz, 2005;
Levitin et al., 2005). Surprisingly, despite their lower pain threshold and
fearful reactions to specific sounds, some people with WS spontaneously
exhibit a strong interest in music (Carrasco et al., 2005; Levitin et al., 2005).
For example, 85% of individuals with WS display high musical creativity and
high emotional reactivity to music, not to mention perfect and relative pitch

(Lenhoff, 1998), compared with mental age-matched controls (Martens et al.,

2008). Other studies have reported performances equivalent to those of
chronological and mental age-matched controls on melodies and phrasing, but
lower performances on pitch measurements, rhythm, musical interpretation
and directional tone (Deruelle, Schön, Rondan, & Mancini, 2005). These
results are corroborated by neuroanatomical data indicating intact limbic brain
structures (emotional functions; Reiss et al., 2000), reduced temporal and
perisylvian cortical thickness, and activation of the right tonsil (music;
Thompson et al., 2005). Individuals with WS therefore appear to have
preserved musical ability, despite a certain modularity in this cognitive
domain.
Furthermore, studies exploring visual processing have revealed impaired
performances on tests featuring visuospatial components (Farran & Jarrold,
2003; Farran, Jarrold, & Gathercole, 2003; Hoffman et al., 2003; Vicari,
Bellucci, & Carlesimo, 2003; Farran, 2005; Landau, Hoffman, & Kurz, 2006;
Dilks, Landau, & Hoffman, 2008; O’Hearn et al., 2011). Individuals with WS
perform similarly to chronological and mental age-matched controls on visual
perception tasks (length estimation; Vicari, Bellugi, & Carlesimo, 2006), but
less well on spatial tasks. They also perform better on visual imagery tasks
than on visuospatial tasks (block tapping, copying, drawing, hierarchical forms
and line orientation; Bellugi et al., 2000; Hoffman et al., 2003; Tager-Flusberg
et al., 2003; Karmiloff-Smith et al., 2004; Vicari, Bellugi, & Carlesimo, 2006;
Landau, 2011).
This visuospatial deficit seems to be related to the development of the
spatial lexicon (Bellugi et al., 2000). A dissociation can be observed between
impaired visuospatial representations and preserved language skills (Bellugi et
al., 2000; Schmitt et al., 2001; Vicari et al., 2003). Despite relatively well
preserved linguistic development, studies have shown that the comprehension
of individuals with WS and the language (spatial prepositions) they use to
describe spatial locations are below the level expected for their intellectual
ability (Bellugi et al., 2000; Jarrold, Baddeley, Hewes, & Phillips, 2001;
Vicari et al., 2003; Searcy et al., 2004).
In another cognitive domain, namely face processing, individuals with WS
appear to have good face recognition, face discrimination, and recall of both
familiar and unknown faces, despite their visuospatial deficits (Bellugi et al.,
2000; Mervis, Robinson, Bertrand et al., 2000; Grice et al., 2001; Karmiloff-
Smith, Brown, Grice & Paterson, 2003; Carrasco et al., 2005; Farran &
Jarrold, 2003; Tager-Flusberg, Plesa-Skwerer, Faja, & Joseph, 2003;
Karmiloff-Smith et al., 2004; Martens et al., 2008; O’Hearn et al., 2009).

Researchers have investigated the visuoconstructive skills of individuals with

WS in order to better understand the atypical cognitive processes involved in
face processing (Bellugi et al., 2000). Results indicate that individuals with
WS are better able to extract the characteristics of human faces than those of
geometric forms (Farran, 2005; Reiss et al., 2005; Porter & Coltheart, 2006;
Atkinson et al., 2006; Landau et al., 2006; Musolino & Landau, 2010). For
example, individuals with WS display deficits in judgement of line orientation
and localization tasks, but not in face recognition (Bellugi et al., 2000).
However, these studies suggest that the presence of hair on these faces could
facilitate face recognition processes in individuals with WS. It should be noted
that in neuroimaging, no difference is observed in the behavior of individuals
with WS performing recognition versus localization tasks (Meyer-Lindenberg,
Mervis, & Berman, 2006). Research therefore points to incomplete
modularization or another specific form of face processing in people with WS
(Grice et al., 2001; Martens et al., 2008).
A specific form of face processing does indeed seem to take place in
people with WS. Studies have revealed the use of mainly componential (local)
processes in face processing/recognition, whereas controls favor global
processes (Farran, 2005; Reiss et al., 2005; Atkinson et al., 2006; Landau et
al., 2006; Porter & Coltheart, 2006; Musolino & Landau, 2010). A bias toward
global rather than local processing of the information therefore appears to be
involved in the visuospatial deficits (visuomotor integration, copy tests)
observed in individuals with WS (Bellugi et al., 2000; Farran & Jarrold, 2003;
Fayasse & Thibaut, 2003; Martens et al., 2008; Majerus et al., 2010). More
specifically, studies suggest difficulty alternating between the underlying
global and local processing strategies (Mervis & Klein-Tasman, 2000; Meyer-
Linderberg et al., 2004; Porter & Coltheart, 2006). Similar results have been
yielded by neuroimaging studies, which have revealed atrophy of the parietal
(deterioration of the dorsal stream) and temporal cortices, and deterioration of
the dorsal spatial stream (intraparietal sulcus) compared with the ventral visual
stream (Boddaert et al., 2006; Eckert et al., 2006; Meyer-Lindenberg,
Buckholtz et al., 2006; Van Essen et al., 2006; Martens et al., 2008; Sarpal et
al., 2008; Eisenberg et al., 2010; O’Hearn et al., 2011; Thomas et al., 2012). It
is important to put these results into perspective, as there may be a local bias in
tasks involving drawing when these are administered to individuals with WS
(Farran & Jarrold, 2003). Furthermore, the latter’s performances on low-level
perceptual tasks requiring global processing are similar to those of mental age-
matched controls (Mervis et al., 1999; Georgopoulos, Georgopoulos, Kuz, &
Landau, 2004). From a functional point of view, there is also a deficit in the

saccadic eye movements involved in visuospatial processes (Scerif, Cornish,

Wilding, Driver, & Karmiloff-Smith, 2004).
ORAL LANGUAGE
The linguistic development of individuals with WS is often claimed in the
literature to be largely unimpaired (Karmiloff-Smith et al., 2003; Carrasco et
al., 2005). Their language skills certainly seem to be relatively protected
(linguistic age: 8-15 years), compared with their other cognitive skills (Bellugi
et al., 2000; Porter & Coltheart, 2005; Alloway & Gathercole, 2006; Porter &
Coltheart, 2006; Brock, 2007; Martens et al., 2008; Rhodes, Riby, Fraser, &
Campbell, 2011a; Rowe & Mervis, 2012). We find the same dissociation in
neuroimaging, between the relative preservation of the temporal lobes (oral
language) and a deterioration in the parietal and frontal lobes (visuospatial
processing, attention, and executive functions; Reiss et al., 2005; Landau et al.,
2006; Meyer-Lindenberg, Mervis, & Berman, 2006; Musolino & Landau,
2010). More specifically, there is a dissociation between the relatively
preserved level of vocabulary and difficulties in the syntactic, morphosyntactic
and lexical-semantic production domains, grammatical understanding, gender
agreement, pragmatics, and oral expression among individuals with WS
(Karmiloff-Smith et al., 2003; Carrasco et al., 2005). There is now a large
body of published research on oral language, and it is possible to distinguish
between the different language skills of individuals with WS, by looking at
their phonological, syntactic and semantic levels, their pragmatic skills, and
their narrative productions.
Early language development seems delayed by approximately 2 years in
individuals with WS, compared with their chronological age-matched peers,
but follows a similar trajectory to that of their mental age-matched peers
(Bellugi et al., 2000; Laing et al., 2002; Martens et al., 2008). One explanation
for this delay concerns the beginning of communication. Studies show that
they make less use of gestural language (self-referencing behaviors), which is
supposed to be a precursor of language development, than mental age-matched
controls (Laing et al., 2002). Moreover, individuals with WS exhibit category-
specific perception of speech sounds, indicating a possible deficit in early
phonological processing (Karmiloff-Smith, Scerif, & Thomas, 2002; Nazzi et
al., 2003).

Furthermore, the appearance of first words is delayed (at around 30-40

months) in WS (Martens et al., 2008). Mervis and Robinson (2000) noticed
that 2-year-olds with WS exhibit a smaller lexical repertoire and poorer
(expressive) vocabulary skills than their chronological age-matched peers.
Nevertheless, the lexical store expands at around 11 years and the complexity
of the sentences that are produced increases across development (Bellugi et al.,
2000; Volterra, Caselli, Capirci, Tonucci, & Vicari, 2003). It should be noted
that adults with WS have a higher vocabulary level than their chronological
age-matched peers (animal naming tests; Bellugi et al., 2000). The basic
morphosyntactic structures develop quickly among individuals with WS
(Martens et al., 2008). Moreover, they exhibit metalinguistic abilities even
before they have mastered grammar (Bellugi et al., 2000). However, compared
with their mental age-matched counterparts, individuals with WS exhibit
delays in terms of mean length of utterance (whose articles and prepositions
substitution) (Levy, 2004) and the ability to classify objects (Nazzi, Gopnik, &
Karmiloff-Smith, 2005). Karmiloff-Smith et al. (1997) suggested that
individuals with WS initially lack the semantic information they need to
integrate into syntactic processing.
Apart from lagging behind their chronological age-matched peers,
individuals with WS appear to display typical development of linguistic skills
(Karmiloff-Smith et al., 2003; Martens et al., 2008; Lacroix, Stojanovik, &
Lukács, 2009). Research therefore demonstrates that phonology, vocabulary,
syntax, morphosyntax and semantics are protected but delayed (Karmiloff-
Smith et al., 2003; Alloway & Gathercole, 2006). Young people with WS
nevertheless produce more atypical morphosyntactic errors (Martens et al.,
2008) and take longer to resolve them (until age 14-16 years) than their mental
age-matched peers do (until age 8-9 years; Bellugi et al., 2000). It should be
noted that this gap between the appearance and development of language in
WS could be explained by an imbalance between phonological and semantic
skills, leading to fragile semantic representations (Mervis & Bertrand, 1997).
Naming precedes identification in WS (Jarrold et al., 2001), but both skills are
delayed with regard to those of chronological and mental age-matched
children (Laing, Hulme, Grant, & Karmiloff‐Smith, 2001). There therefore
seem be two dissociations in oral and semantic fluencies in WS (Temple,
Almazan, & Sherwood, 2002; Vicari, Bates, Caselli, Pasqualetti et al., 2004;
Stojanovik, 2006): greater ease performing semantic fluency tasks than
naming ones, as mentioned earlier; and an intact computational component
(form of linguistic expressions) versus an impaired lexical one (shape and
meaning of parts of speech).

Beyond language development, several studies have investigated the

lexical and morphological, syntactic and grammatical, semantic and pragmatic
skills of individuals with WS (Brock, 2007; Martens et al., 2008). Research on
lexical skills indicates that vocabulary (expressive aspect), verbal fluency, and
grammatical (oral fluency, irregular form of past tense, plural, word
roots/suffixes), syntactic, and semantic skills are relatively protected, albeit
delayed (Bellugi et al., 2000; Thomas et al., 2001; Zukowski, 2005; Martens et
al., 2008).
At first sight, individuals with WS use more sophisticated words than their
chronological age-matched peers (idiomatic and stereotypical linguistic
expressions), despite some errors of contextual use (Udwin & Yule, 1991).
The grammatical and syntactic abilities of adults with WS seem equivalent to
those of mental age-matched individuals (i.e., 5-10 years; (Losh, Bellugi, &
Anderson, 2001), and poorer than those of chronological age-matched ones
(Karmiloff-Smith et al., 1997). Measures of grammar, syntax (grammatical
understanding, morphosyntax, gender agreement), more complex semantics
(many words produced but not necessarily understood) and pragmatics
indicate atypical skills and delays among individuals with WS (Bellugi et al.,
2000; Temple et al., 2002; Vicari et al., 2004; Lacroix & Bernicot, 2006;
Stojanovik, 2006). More specifically, just like their mental age-matched peers,
they are capable of using a variety of complex grammatical forms (passive,
anaphoric and relative sentences, conditional forms, irregular past tense),
despite some morphosyntactic errors, during oral production (Bellugi et al.,
2000; Mervis & Klein-Tasman, 2000; Karmiloff-Smith et al., 2003; Ring &
Clahsen, 2005). Other studies have reported poorer performances than those of
mental age-matched controls when it comes to finding complex similarities
(semantic cues; Klein & Mervis, 1999; Mervis & Klein-Tasman, 2000).
The narrative productions of individuals with WS are poorer than those of
mental age-matched controls on some tests (e.g., sentence-repetition task;
Bellugi et al., 2000). Their expressive linguistic skills are better than their
receptive ones, even if they spend more time on the pronunciation and
articulation of words than their verbal ability-matched peers (around 8 years)
do (Bellugi et al., 2000; Losh et al., 2001; Jarrold, Cowan, Hewes, & Riby,
2004b; Stojanovik, 2006). Furthermore, teenagers with WS display preserved
affective language (expression and prosody) in their narratives (Losh et al.,
2001) despite their difficulty with mutual communication (Stojanovik, 2006).
These results point to heterogeneous oral language development in WS
(Temple et al., 2002; Vicari et al., 2004; Porter & Coltheart, 2005; Stojanovik,
2006; Martens et al., 2008). Furthermore, Stojanovik, Perkins, and Howard

(2001) have suggested that the language skills of individuals with WS should
be regarded as a relative, but not necessarily effective, cognitive strength.
MEMORY ABILITIES
The past few years have witnessed an increase in research on memory in
people with WS. More specifically, since the 1990s, there has been a surge of
interest in the underlying processes that are necessary for learning. In this
section, we review these studies of short-term memory (including working
memory) and long-term memory, which show the memory skills of individuals
with WS to be fragile and unloss-making (Jarrold et al., 2004b; Martens et al.,
2008; Rhodes et al., 2011a).
Early studies focused on short-term memory, neglecting the executive
components of working memory. They failed to reach a consensus, mainly
because of evaluation differences (Klein & Mervis, 1999; Mervis & Klein-
Tasman, 2000). Some studies reported preserved phonological short-term
memory in comparison with mental age-matched controls (Bellugi et al., 2000;
Mervis & Klein-Tasman, 2000; Jarrold et al., 2001; Laing et al., 2005;
Sampaio, Sousa, Fernandez, Henriques, & Goncalves, 2008), while others
compared these performances with those of verbal ability-matched controls
(Laing et al., 2001; Majerus et al., 2003; Jarrold, Baddeley, Hewes, Leeke, &
Phillips, 2004a; Sampaio et al., 2008; Lacroix, Stojanovik, & Lukács, 2009).
Individuals with WS appear to have greater short-term memory difficulties for
recall (explicit episodic encoding) than for recognition (O'Hearn et al., 2009;
Rhodes, Riby, Park, Fraser, & Campbell, 2010) leading to peculiarities in
learning information (Baddeley, 2000). Other studies report poorer
performances than those of chronological and mental age-matched individuals
on spatial (location) as opposed to visual (recognition) short-term memory
tasks (Vicari, Bellugi, & Carlesimo, 2006).
As for working memory skills, they seem fragile because of genuine
difficulties in data accumulation (Jarrold et al., 2004b; O’Hearn et al., 2009;
Menghini et al., 2010; Rhodes et al., 2010). Scores on working memory tasks
(digit and word spans) are therefore lower than those of chronological and
mental age-matched controls (Vicari, Bellugi, & Carlesimo, 2006).
Furthermore, there are executive dissociations between verbal and
nonverbal working memory among individuals with WS. For example, the
verbal/spatial dissociation seems to extend to the functioning of working

memory. Individuals with WS display executive deficits in both verbal and

spatial working memory (manipulating and updating information), associated
with preserved short-term maintenance of spatial, but not verbal, information
(Menghini et al., 2010; Rhodes et al., 2011a).
Other results point to specific deficits in spatial versus verbal working
memory (Alloway & Gathercole, 2006; Vicari, Bellugi, & Carlesimo, 2006;
Sampaio et al., 2008; Rhodes et al., 2011a; Rowe & Mervis, 2012).
Neuroimaging studies have shown that a deficit in the dorsal stream (parietal
regions) is behind the specific impairment of memory for spatial information
(Vicari et al., 2003; Sarpal et al., 2008). These spatial specificities seem to be
observed in more complex tasks involving high levels of processing and/or of
the handling of a large volume of spatial information (O’Hearn et al., 2009;
Menghini et al., 2010; Rhodes et al., 2010; Rhodes et al., 2011a).
Another dissociation concerns visual/visuospatial working memory.
Individuals with WS exhibit relatively preserved maintenance of visual
information (recognition and visual span tests), but a deficit in handling spatial
information, or more specifically, connecting visual and spatial information
(Corsi Block localization task; Vicari et al., 2003; Vicari, Bellugi, &
Carlesimo, 2006; Jarrold, Phillips, & Baddeley, 2007). For example, it has
been reported that, compared with mental age-matched individuals, individuals
with WS exhibit a general localization deficit, rather than a specific one for
face or house identification (Vicari et al., 2003; Meyer-Lindenberg, Mervis, &
Berman, 2006; Vicari, Bellugi, & Carlesimo, 2006; Jarrold et al., 2007; Sarpal
et al., 2008; Vicari O’Hearn et al., 2009). One possible explanation for the
specificities of their visuospatial working memory is that they have a
visuospatial sketchpad deficit that is independent of their mental ability
(Munir, Cornish, & Wilding, 2000; Jarrold et al., 2007; O'Hearn et al., 2009;
Menghini et al., 2010; Rhodes et al., 2010; Rhodes et al., 2011a). Research
indicates a possible dissociation between the processes linked to the
visuospatial sketchpad, as visual information seems protected, but not spatial
information (Benton Facial Recognition Test; Vicari et al., 2003; Kittler,
Krinsky-McHale, & Devenny, 2008; Sampaio et al., 2008). For example, it has
been suggested that visuospatial working memory tasks may require mental
rotation (Luzzatti, Vecchi, Agazzi, Cesa-Bianchi, & Vergani, 1998). Another
explanation therefore concerns deficits in mental rotation, rather than visual
abilities, in WS.
Numerous studies of WS have focused on one of the most homogeneous
cognitive skills, namely phonological memory. Results indicate relative
preservation of phonological short-term memory (Majerus et al., 2003; Laing

et al., 2005; Porter & Coltheart, 2005; Sampaio et al., 2008; Lacroix,
Stojanovik, & Lukács, 2009). Despite the multiplicity of tests used (digit and
word span, nonword repetition) the phonological memory performances of
individuals with WS are better than those of their mental age-matched peers
(Danielsson, Henry, Messer, Carney, & Rönnberg, 2016). Certain studies
indicate poorer performances on phonological memory tasks with regard to a
verbal age of 8 years (Jarrold et al., 2004b), contrary to other studies (Majerus
et al., 2003). There is a degree of variability in short-term phonological
memory abilities (Mervis & Klein-Tasman, 2000; Jarrold et al., 2004b). One
possible explanation is that the articulatory flow is slower (more time needed
for subvocal repetition, planning and pausing), which requires information to
be retained for longer, and therefore causes difficulties with short-term recall
(Jarrold et al., 2004b; Laing et al., 2005). These articulatory specificities may
reflect phonological loop deficits (Kittler et al., 2008; Sampaio et al., 2008).
These data suggest that the short-term memory deficits lead to association
difficulties during the learning of new information (Baddeley, 2000). We
therefore postulate that the link between short-term memory and long-term
episodic learning (episodic buffer; Baddeley, 2000) is impaired. The long-term
memory weakness is therefore secondary to greater deficits in short-term
memory, particularly if long-term compensation strategies are used (Baddeley
et al., 2000). Individuals with WS perform more poorly on long-term memory
tasks (recall and recognition) than chronological age-matched controls. More
specifically, they display a greater deficit on recall tasks than on recognition
(Jarrold et al., 2007). For example, findings point to a visual deterioration in
long-term memory for delayed recall rather than a recognition difficulty (fewer
elements recalled than copied in the Rey-Osterreith Complex Figure test) in
WS (Vicari et al., 1996). We also find this verbal/spatial dissociation in long-
term memory performances, with the preservation of verbal rather than
visuospatial information, in comparison with the performances of mental age-
matched controls (Jarrold et al., 2007).
All these results demonstrate that individuals with WS have weaknesses
and atypical verbal and nonverbal memory development, with regard to their
mental age-matched peers (Jarrold et al., 2007; Vicari, Verucci, & Carlesimo,
2007; Sampaio et al., 2008). Furthermore, their deficits in visuospatial and
phonological short-term memory may be secondary to more general problems
in visuospatial and phonological processing. In short, some memory deficits
seem to be more generally connected to learning difficulties (Jarrold et al.,
2007; Kittler et al., 2008).

Furthermore, memory abilities must be studied in relation to executive and

attentional functions, as both these areas play a fundamental role in the
cognitive and behavioral development of individuals with WS.
EXECUTIVE AND ATTENTIONAL FUNCTIONS

Children with WS exhibit attentional and executive deficits that decrease
in adolescence (Farran & Jarrold, 2003; Carrasco et al., 2005; Willcutt,
Sonuga-Barke, Nigg, & Sergeant, 2008; Rhodes et al., 2010). Neuroimaging
studies show a deficit in the frontal and parietal lobes for particular attentional
tasks (Atkinson & Braddick, 2010; Rhodes et al., 2010). More specifically, the
performances of individuals with WS on selective, divided and sustained
attention tasks are poorer than those of their chronological age-matched peers,
but equivalent to those of mental age-matched controls (Farran & Jarrold,
2003; Menghini et al., 2010; Costanzo et al., 2013; Greer, Riby, Hamilton &
Riby, 2013). Individuals with WS also perform better on tasks requiring
sustained rather than selective attention, compared with their mental age-
matched peers (Atkinson & Braddick, 2010).
Furthermore, there seem be verbal/visuospatial dissociations in selective
and sustained attention tasks. For example, individuals with WS perform
equally well on both visual sustained and verbal selective attention tasks, but
more poorly compared with chronological or mental age-matched controls
(Scerif et al., 2004; Menghini et al., 2010; Costanzo et al., 2013).
More generally, people with WS have deficits in flexibility and attentional
set-shifting (pointing/counter-pointing, face fixation) that extend to the
visuomotor domain (Mervis, Robinson, Rowe, Becerra, & Klein-Tasman,
2003; Willcutt et al., 2008; Menghini et al., 2010; Rhodes et al., 2010;
Hocking et al., 2013). More specifically, individuals with WS have impaired
performances on attentional switching tasks (Rhodes et al., 2010). Analysis of
these performances has revealed a dissociation whereby verbal performances
are better than visuospatial ones (Carney, Brown & Henry, 2013; Menghini et
al., 2010). One possible explanation is an inhibition deficit in verbal skills
(Davidson, Amso, Anderson, & Diamond, 2006).
The executive function planning is also impaired in individuals with WS,
compared with chronological and mental age-matched controls (Vicari,
Bellugi, & Carlesimo, 2006; Willcutt et al., 2008; Menghini et al., 2010;
Rhodes et al., 2010; Cowie, Braddick & Atkinson, 2012; Costanzo et al., 2013;

Greer et al., 2013). These results have been confirmed by neuroimaging

studies showing a deficit in the dorsal and frontoparietal circuits involved in
planning, motor execution, and inhibition (Campbell et al., 2009; Faria et al.,
2011). However, when individuals with WS are given more time to specify
their answers, their planning performances seem relatively protected (Rhodes
et al., 2010; Menghini et al., 2010). This points to cognitive slowing rather
than an executive deficit in WS.
Inhibition functions are impaired in individuals with WS (Vicari, Bellugi,
& Carlesimo, 2006; Jarrold et al., 2007; Porter, Coltheart, & Langdon, 2007;
Kittler et al., 2008; Sampaio et al., 2008; O’Hearn et al., 2009; Menghini et al.,
2010; Rhodes et al., 2010; Osório et al., 2012; Costanzo et al., 2013; Hocking
et al., 2013). Individuals with WS take longer and make more errors
(inhibition deficits) than chronological or mental age-matched controls (Greer
et al., 2013). More specifically, individuals with WS exhibit poorer visual
inhibition in the visuospatial domain (Costanzo et al., 2013). Carney, Brown,
and Henry (2013) observed poorer performances compared with those of
chronological and mental age-matched participants. Neuroimaging studies
indicate deficits in the frontal lobe and frontostriatal networks that could
account for failures in the inhibition process and thus for inappropriate social
behaviors (hypersociability, social disinhibition, and emotional problems;
Porter et al., 2007; Rhodes et al., 2010; Rhodes, Riby, Matthews, & Coghill,
2011b; Greer et al., 2013; Hocking et al., 2013; Little et al., 2013).
Compared with chronological age-matched controls, individuals with WS
therefore display deficits in a range of executive functions (attention, memory,
problem solving, planning and inhibition; Vicari, Bellugi, & Carlesimo, 2006;
Jarrold et al., 2007; Porter et al., 2007; Kittler et al., 2008; Sampaio et al.,
2008; Willcutt et al., 2008; O’Hearn et al., 2009; Lanfranchi, Jerman, Dal
Pont, Alberti, & Vianello, 2010; Rhodes et al., 2010; Osório et al., 2012).
These executive deficits may also contribute to the social phenotype (behavior
and adaptive functioning), resulting in hypersociability, inattention,
distractibility, low frustration threshold, anxiety, and poor social
understanding (Carrasco et al., 2005; Meyer-Lindenberg, Mervis, & Berman,
2006; Martens et al., 2008; Willcutt et al., 2008; Campbell et al., 2009;
Martens, Wilson, Dudgeon, & Reutens, 2009; Menghini et al., 2010; Rhodes
et al., 2010; Faria et al., 2011; Rhodes et al., 2011b; Meda, Pryweller &
Thornton-Wells, 2012; Greer et al., 2013). Howlin and colleagues (1998)
found that adults with WS (mean age = 27 years) exhibit socio-adaptive
behavior equivalent to that of 6-year-olds. Neuroimaging studies indicate
differences in the left temporal lobe (hyperactivity; Campbell et al., 2009) and

a deficit in the frontal and parietal lobes (hypersociability) among children

with WS (Thompson et al., 2005; Boddaert et al., 2006; Eckert et al., 2006;
Campbell et al., 2009; Faria et al., 2011; Osório et al., 2012).
These results underscore the importance of examining interdomain
interactions from a developmental point of view, as cognitive strengths and
weaknesses beyond the domain of interest can have a considerable impact on
the behavioral phenotype (Karmiloff-Smith, 2009; Karmiloff-Smith, 2012).
DISCUSSION AND PERSPECTIVES

Approximately 95% of individuals with WS display considerable learning
difficulties (Paterson, Girelli, Butterworth, & Karmiloff-Smith, 2006).
However, despite their intellectual deficiency and neuropsychological profile,
individuals with WS appear to be capable of learning more than the basic
skills of reading, spelling and mathematics at school (Howlin et al., 1998;
Bellugi et al., 2000). For example, those aged between 6 and 16 years have the
reading, spelling, arithmetic and social adaptation levels of 6- to 8-year-olds
(Howlin et al., 1998; Bellugi et al., 2000).
None of these studies simultaneously considered all the cognitive
processes underlying the unique neuropsychological profile responsible for
these learning difficulties. Instead, most focused on two or three
cognitive-behavioral or neuroanatomical features. In this chapter, we have
therefore tried to provide an overview of the specific neuropsychological
profile of individuals with WS, which might explain their learning difficulties.
Although they exhibit considerable heterogeneity in the cognitive, linguistic,
perceptual, memory and executive functions involved in the behavioral
phenotypes (Majerus et al., 2001; Majerus et al., 2003; Porter & Coltheart,
2005), we can nevertheless identify universal cognitive characteristics
At the cognitive level, the development of cognitive functions seems
typical, albeit delayed, in WS (Majerus et al., 2001; Porter & Coltheart, 2005).
The study by Bellugi, Lichtenberger, Jones, Lai, and St. George (2000) was
the first to establish clear dissociations in the cognitive architecture of
individuals with WS. Certain skills seem relatively protected (oral language,
lexical level, short-term memory, face processing) while others seem impaired
(visuospatial processing, planning, inhibition, attention, long-term and
working memory; Fayasse & Thibaut, 2003; Karmiloff-Smith et al., 2003;
Martens et al., 2008; Menghini et al., 2010; Costanzo et al., 2013; Dessalegn et

al., 2013). Several explanations have been put forward for these deficits,
which include a linguistic imbalance between semantics and phonology
leading to poor semantic representations (Laing et al., 2002; Nazzi et al.,
2003), the use of local rather than overall processing of visuospatial
information and difficulty alternating between strategies (Meyer-Lindenberg,
Mervis, & Berman, 2006; Porter & Coltheart, 2006; Dessalegn et al., 2013),
working memory deficits concerning the visuospatial sketchpad and/or
phonological loop (Kittler et al., 2008; Sampaio et al., 2008; O'Hearn et al.,
2009; Menghini et al., 2010; Rhodes et al., 2010; Rhodes et al., 2011a), and
deficits in the dorsal frontoparietal circuit involved in inhibition, planning and
social behavior (Campbell et al., 2009; Rhodes et al., 2011b; Faria, Landau,
O’Hearn, et al., 2012; Hocking et al., 2013; Greer et al., 2013; Little et al.,
2013). However, the results of some studies suggest that these dissociative
profiles are not perceptible in all individuals with WS (Porter & Coltheart,
2005; Vicari, Bellugi, & Carlesimo, 2006; Sampaio et al., 2008; Rhodes et al.,
2011a). This heterogeneity of results may stem from experimental artefacts
(use of different tools), but may also reveal the existence of developmental
subprofiles.
At the experimental level, there seem to be disparities in results depending
on the test, control group, age range, size and developmental specificities of
the sample (Vicari, Bellugi, & Carlesimo, 2006; Jarrold et al., 2007; Van der
Molen, Van Luit, Jongmans, & Van der Molen, 2007; Martens et al., 2008;
Sampaio et al., 2008; Schuchardt, Mäehler, & Hasselhorn, 2011; Greer et al.,
2013). For example, floor and ceiling effects have been found for visuospatial
processing, depending on the choice of test and type of control (e.g., mental,
chronological, verbal or vocabulary age-matched, other pathologies; Farran &
Jarrold, 2003). Some studies that did not include a control group based on
verbal ability have reported good performances on verbal memory (Sampaio et
al., 2008), in contrast to other studies (Jarrold et al., 2004a). Furthermore, 68%
of the studies of language or visuospatial skills included samples that varied
from 1 to 54 individuals with WS (Martens et al., 2008).
At the behavioral level, a direct window on the initial state (Karmiloff-
Smith, 1998), individuals with WS exhibit hypersociability, hypersensitivity,
anxiety, specific phobias and socially inappropriate language (Martens et al.,
2008; Carrasco et al., 2005). These behavioral characteristics seem to persist
with age (Dykens, 2003; Rosner, Hodapp, Fidler, Sagun, & Dykens, 2004).
However, this behavioral change in individuals with WS seems to take place
later than it does in controls (see research on depression: Meyer-Lindenberg,
Mervis, & Berman, 2006). It should be noted that most behavioral research has

used two types of assessment: self-report questionnaire and/or parental

questionnaire. It is thus advisable to temper results on hyperactivity, anxiety
and attentional difficulties among individuals with WS and/or parental fears
(Dykens, 2003) owing to potential biases.
At the neuroanatomical and functional levels, results clarify the
specificities of the cognitive profile. Limbic structures (hypersensitivity) are
preserved (Reiss et al., 2000), as is the lower temporal lobe and the activation
of the right tonsil (language and music) (Thompson et al., 2005), but there are
deficits in the intraparietal/occipitoparietal sulcus (visuospatial deficits and
hypersociability), and reduced connectivity between the tonsil and
orbitofrontal cortex (hypersociability and anxiety) (Van Essen et al., 2006;
Marenco et al., 2007; Dilks et al., 2008; Sarpal et al., 2008; O’Hearn et al.,
2009; Faria et al., 2011).
All these results therefore suggest that there is a specific and
heterogeneous cognitive pattern in WS. This cognitive specificity seems stable
across development (Karmiloff-Smith & al., 2002; Dykens, 2003; Rosner et
al., 2004). Moreover, the numerous cognitive dissociations may explain this
considerable heterogeneity. It is therefore important to understand the
trajectories of developmental disorders better by favoring longitudinal studies
(Karmiloff-Smith et al., 2002). We dispute the usefulness of nativist
hypotheses or modular continuity for estimating cognitive profiles from adult
models, that is, without studying developmental trajectories (Karmiloff-Smith
et al., 2002). For example, comparisons of individuals with WS versus Down
syndrome (DS) reveal different cognitive profiles in adulthood, despite
resemblances during development (Klein & Mervis, 1999).
Intersyndrome comparisons can improve current understanding of the
cognitive specificities of individuals with WS. For example, studies indicate
similar IQ scores across WS and DS (Klein & Mervis, 1999; Mervis & Klein-
Tasman, 2000), and show that good face processing skills are not specific to
individuals with WS. They report similar abilities to distinguish between faces
across WS and other types of intellectual deficiency or learning disorder
(Tager-Flusberg & Sullivan, 2000; Martens et al., 2008). By contrast, good
verbal abilities and verbal working memory seem to be specific to WS.
Several studies indicate better verbal skills (vocabulary and grammar) in WS
compared with DS for the same vocabularylexicon age?? and mental ages
(Bellugi et al., 2000) or children with a mental retardation of mixed etiology or
a learning disorder (Udwin & Yule, 1991). Moreover, verbal working memory
skills (digit and word spans) are better in WS than in DS (Klein & Mervis,
1999; Edgin, Pennington, & Mervis, 2010) but equivalent in disorders of

mixed etiology (Devenny, Krinsky-McHale, Kittler, et al., 2004). It should be

noted that we find this dissociation between the verbal and visuospatial
domains. Data indicate lower spatial associative and short-term memory
performances in WS than in DS (Klein & Mervis, 1999). Finally, we can put
the visuo-spatial deficits displayed by individuals with WS into perspective:
performances on visuospatial tasks are better in WS than in learning disorders
(Udwin & Yule, 1991) or DS (Klein & Mervis, 1999).
Studying atypical populations such as individuals with WS allows us to
gain a better understanding of typical learning development. If we are to
provide appropriate treatment, it is vital that we identify the cognitive
specificities of individuals with WS and their developmental trajectory.
Questions about the adaptability of tests to individuals with intellectual
deficiency, the processes that are studied, and the generalization of the results
require particular attention. For instance, results can only be generalized if the
sample size is sufficiently large and there is a reasonable age range between
the participants. It is also crucial to take account of the trajectory and
developmental specificities of samples with neurodevelopmental disorders,
such as participants with WS (Karmiloff-Smith, 1998). Longitudinal studies of
individuals with WS are therefore needed in order to carry out a more
thorough examination of their relatively typical cognitive abilities, albeit
delayed with regard to controls (Karmiloff-Smith et al., 2002; Martens et al.,
2008).
REFERENCES
Alloway, T. P., Gathercole, S. E. and Pickering, S. J. (2006). Verbal and
visuospatial short-term and working memory in children: Are they
separable? Child development, 77 (6): 1698-1716.
Atkinson, J. and Braddick, O. (2010). From genes to brain development to
phenotypic behavior: "Dorsal-stream vulnerability" in relation to spatial
cognition, attention, and planning of actions in Williams syndrome (WS)
and other developmental disorders. Progress in brain research, 189: 261-
283.
Atkinson, J., Braddick, O., Rose, F. E., Searcy, Y. M., Wattam-Bell, J. and
Bellugi, U. (2006). Dorsal-stream motion processing deficits persist into
adulthood in Williams syndrome. Neuropsychologia, 44 (5): 828-833.

Baddeley, A. D. (2000). Short-term and working memory. In E. Tulving and

F. I. M. Craik (Eds.), The Oxford handbook of memory (pp. 77-92). New
York: Oxford University Press.
Bellugi, U., Lichtenberger, L., Jones, W., Lai, Z. and George, M. S. (2000). I.
The neurocognitive profile of Williams Syndrome: A complex pattern of
strengths and weaknesses. Journal of cognitive neuroscience, 12
(Supplement 1): 7–29.
Boddaert, N., Mochel, F., Meresse, I., Seidenwurm, D., Cachia, A., Brunelle,
F., ... Zilbovicius, M. (2006). Parieto-occipital grey matter abnormalities
in children with Williams syndrome. NeuroImage, 30 (3): 721-725.
Bogliotti, C., Serniclaes, W., Messaoud-Galusi, S. and Sprenger-Charolles, L.
(2008). Discrimination of speech sounds by children with dyslexia:
Comparisons with chronological age and reading level controls. Journal of
experimental child Psychology, 101 (2): 137-155.
Brock, J. (2007). Language abilities in Williams syndrome: A critical review.
Development and psychopathology, 19 (01): 97-127.
Campbell, L. E., Daly, E., Toal, F., Stevens, A., Azuma, R., Karmiloff-Smith,
A. ... Murphy, K. C. (2009). Brain structural differences associated with
the behavioural phenotype in children with Williams syndrome. Brain
Research, 1258: 96-107.
Carney, D. P. J., Brown, J. H. and Henry, L. A. (2013). Executive function in
Williams and Down syndromes. Research in developmental disabilities,
34 (1): 46–55.
Carrasco, X., Castillo, S., Aravena, T., Rothhammer, P. and Aboitiz, F. (2005).
Williams syndrome: Pediatric, neurologic, and cognitive development.
Pediatric neurology, 32 (3): 166–172.
Cashon, C. H., Ha, O. R., Allen, C.L., Graf, K. M., Saffran, J. R. and Mervis,
C. B. (2009). 9- to 20-month-olds with Williams syndrome are linguistic
statistical learners. Paper presented at the biennial meeting of the Society
for Research in Child Development, Denver, CO.
Costanzo, F., Varuzza, C., Menghini, D., Addona, F., Gianesini, T. and Vicari,
S. (2013). Executive functions in intellectual disabilities: A comparison
between Williams syndrome and Down syndrome. Research in
developmental disabilities, 34 (5): 1770–1780.
Cowie, D., Braddick, O. and Atkinson, J. (2012). Visually guided step descent
in children with Williams syndrome. Developmental science, 15 (1): 74-
86.

Danielsson, H., Henry, L., Messer, D., Carney, D. P. and Rönnberg, J. (2016).
Developmental delays in phonological recoding among children and
adolescents with Down syndrome and Williams syndrome. Research in
developmental disabilities, 55: 64-76.
Davidson, M. C., Amso, D., Anderson, L. C. and Diamond, A. (2006).
Development of cognitive control and executive functions from 4 to 13
years: Evidence from manipulations of memory, inhibition, and task
switching. Neuropsychologia, 44 (11): 2037-2078.
Dehaene, S. (1997). The number sense: How the mind creates mathematics.
New York: Oxford University Press.
Deruelle, C., Schön, D., Rondan, C. and Mancini, J. (2005). Global and local
music perception in children with Williams syndrome. NeuroReport, 16
(6): 631-634.
Dessalegn, B., Landau, B. and Rapp, B. (2013). Consequences of severe
visual-spatial deficits for reading acquisition: Evidence from Williams
syndrome. Neurocase, 19 (4): 328-347.
Devenny, D. A., Krinsky-McHale, S. J., Kittler, P. M., Flory, M., Jenkins, E.
and Brown, W. T. (2004). Age-associated memory changes in adults with
Williams syndrome. Developmental neuropsychology, 26 (3): 691-706.
Dilks, D., Landau, B. and Hoffman, J. E. (2008). Vision for perception and
vision for action: Normal and unusual development. Developmental
Science, 11 (4): 474–486.
Dykens, E. M. (2003). Anxiety, fears, and phobias in persons with Williams
syndrome. Developmental neuropsychology, 23 (1-2): 291-316.
Eckert, M. A., Galaburda, A. M., Karchemskiy, A., Liang, A., Thompson, P.,
Dutton, R. A. ... Rose, F. E. (2006). Anomalous sylvian fissure
morphology in Williams syndrome. NeuroImage, 33 (1): 39-45.
Edgin, J. O., Pennington, B. F. and Mervis, C. B. (2010). Neuropsychological
components of intellectual disability: The contributions of immediate,
working, and associative memory. Journal of Intellectual Disability
Research, 54 (5): 406-417.
Eisenberg, D. P., Jabbi, M. and Berman, K. F. (2010). Bridging the gene–
behavior divide through neuroimaging deletion syndromes:
Velocardiofacial (22q11. 2 Deletion) and Williams (7q11. 23 Deletion)
syndromes. NeuroImage, 53 (3): 857-869.
Faria, A., Landau, B., O’Hearn, K. M., Li, X., Jiang, H., Oishi, K., Zhang, J.,
Miller, M. I. and Mori, S. (2011). Quantitative analysis of gray and white
matter in Williams syndrome. Unpublished manuscript, Johns Hopkins
University.

Farran, E. K. (2005). Perceptual grouping ability in Williams syndrome:

Evidence for deviant patterns of performance. Neuropsychologia, 43 (5):
815-822.
Farran, E. K. and Jarrold, C. (2003). Visuospatial cognition in Williams
syndrome: Reviewing and accounting for the strengths and weaknesses in
performance. Developmental neuropsychology, 23 (1-2): 173-200.
Farran, E. K., Jarrold, C. and Gathercole, S. E. (2003). Divided attention,
selective attention and drawing: Processing preferences in Williams
syndrome are dependent on the task administered. Neuropsychologia, 41
(6): 676–687.
Fayasse, M. and Thibaut, J. P. (2003). Visuo-construction impairments in
Williams syndrome. L'année psychologique, 103 (4): 695-727.
Georgopoulos, M. A., Georgopoulos, A. P., Kuz, N. and Landau, B. (2004).
Figure copying in Williams syndrome and normal subjects. Experimental
brain research, 157 (2): 137-146.
Gosh, A. and Pankau, R. (1994). Social-emotional and behavioral adjustment
in children with Williams-Beuren syndrome. American journal of medical
genetics, 53: 335–339.
Greer, J., Riby, D. M., Hamiliton, C. and Riby, L. M. (2013). Attentional lapse
and inhibition control in adults with Williams Syndrome. Research in
developmental disabilities, 34 (11): 4170–4177.
Grice, S. J., Spratling, M. W., Karmiloff-Smith, A., Halit, H., Csibra, G., de
Haan, M. and Johnson, M. H. (2001). Disordered visual processing and
oscillatory brain activity in autism and Williams syndrome. NeuroReport,
12 (12): 2697-2700.
Hocking, D. R., Thomas, D., Menant, J. C., Porter, M. A., Smith, S., Lord, S.
R. and Cornish, K. M. (2013). The interplay between executive control
and motor functioning in Williams syndrome. Developmental science, 16
(3): 428–442.
Hoffman, J. E., Landau, B. and Pagani, J. (2003). Spatial breakdown in spatial
construction: Evidence from eye movements in children with Williams
syndrome. Cognitive Psychology, 46: 260–301.
Howlin, P., Davies, M., & Udwin, O. (1998). Cognitive functioning in adults
with Williams syndrome. Journal of child psychology and psychiatry, 39
(2): 183-189.

Jarrold, C., Baddeley, A. D., Hewes, A. K., Leeke, T. C. and Phillips, C. E.

(2004a). What links verbal short-term memory performance and
vocabulary level? Evidence of changing relationships among individuals
with learning disability. Journal of memory and language, 50 (2): 134-
148.
Jarrold, C., Baddeley, A. D., Hewes, A. K. and Phillips, C. (2001). A
longitudinal assessment of diverging verbal and non-verbal abilities in the
Williams syndrome phenotype. Cortex, 37 (3): 423-431.
Jarrold, C., Baddeley, A. and Phillips, C. (2007). Long-term memory for
verbal and visual information in Down syndrome and Williams syndrome:
Performance on the Doors and People test. Cortex, 43(2): 233-247.
Jarrold, C., Cowan, N., Hewes, A. K. and Riby, D. M. (2004b). Speech timing
and verbal short-term memory: Evidence for contrasting deficits in Down
syndrome and Williams syndrome. Journal of memory and language, 51
(3): 365–380.
Jones, W., Bellugi, U., Lai, Z., Chiles, M., Reilly, J., Lincoln, A. and Adolphs,
R. (2000). II. Hypersociability in Williams syndrome. Journal of cognitive
neuroscience, 12 (Supplement 1): 30-46.
Karmiloff-Smith, A. (1998). Development itself is the key to understanding
developmental disorders. Trends in cognitive sciences, 2 (10): 389-398.
Karmiloff-Smith, A. (2009). Nativism versus neuroconstructivism: Rethinking
the study of developmental disorders. Developmental psychology, 45 (1):
56.
Karmiloff-Smith, A. (2012). Brain: The neuroconstructivist approach. In E. K.
Farran and A. Karmiloff-Smith (Eds.), Neurodevelopmental disorders
across the lifespan (pp. 37-58). New York: Oxford University Press.
Karmiloff-Smith, A., Brown, J. H., Grice, S. and Paterson, S. (2003).
Dethroning the myth: Cognitive dissociations and innate modularity in
Williams syndrome. Developmental Neuropsychology, 23 (1-2): 227–242.
KarmiloffSmith, A., Grant, J., Berthoud, I., Davies, M., Howlin, P. and
Udwin, O. (1997). Language and Williams syndrome: How intact is
“intact”? Child development, 68 (2): 246-262.
KarmiloffSmith, A., Scerif, G. and Thomas, M. (2002). Different approaches
to relating genotype to phenotype in developmental disorders.
Developmental psychobiology, 40 (3): 311-322.
Karmiloff-Smith, A., Thomas, M., Annaz, D., Humphreys, K., Ewing, S.,
Brace, N. ... Campbell, R. (2004). Exploring the Williams syndrome face-
processing debate: The importance of building developmental trajectories.
Journal of child psychology and psychiatry, 45 (7): 1258-1274.

Kittler, P. M., Krinsky-McHale, S. J. and Devenny, D. A. (2008). Dual-task

processing as a measure of executive function: A comparison between
adults with Williams and Down syndromes. American journal on mental
retardation, 113 (2): 117-132.
Klein, B. P. and Mervis, C. B. (1999). Contrasting patterns of cognitive
abilities of 9- and 10-year-olds with Williams syndrome or Down
syndrome. Developmental neuropsychology, 16 (2): 177-196.
Kuhl, P. (2004). Early language acquisition: Cracking the speech code. Nature
Reviews Neuroscience, 5: 831–843.
Lacroix, A. and Bernicot, J. (2006). French-speaking children and adolescents
with Williams syndrome: Pragmatics, language and sociability. Paper
presented at the 3rd Williams syndrome workshop, Reading, UK, 6-7 July.
Lacroix, A., Stojanovik, V. and Lukacs, A. (2009). What do we learn on
language acquisition from Williams’ syndrome? In [editors], Language
and linguistics: Emerging trends (pp. 177-192). Lieu: Nova Publishers.
Laing, E., Butterworth, G., Ansari, D., Gsödl, M., Longhi, E., Panagiotaki, G.
... Karmiloff-Smith, A. (2002). Atypical development of language and
social communication in toddlers with Williams syndrome.
Developmental science, 5 (2): 233-246.
Laing, E., Hulme, C., Grant, J. and Karmiloff-Smith, A. (2001). Learning to
read in Williams syndrome: Looking beneath the surface of atypical
reading development. Journal of Child Psychology and Psychiatry, 42 (6):
729-739.
Laing, E., Grant, J., Thomas, M., Parmigiani, C., Ewing, S., & Karmiloff-
Smith, A. (2005). Love is… an abstract word: The influence of lexical
semantics on verbal short-term memory in Williams syndrome. Cortex, 41
(2): 169-179.
Landau, B. (2011). The organization and development of spatial cognition:
Insights from Williams syndrome. In J. Burack, R. M. Hodapp, G. Iarocci
and E. Zigler (Eds.), The Oxford handbook of intellectual disabilities and
development, 2nd Ed. NewYork: Oxford University Press.
Landau, B., Hoffman, J. and Kurz, N. (2006). Object recognition with severe
spatial deficits in Williams syndrome: Sparing and breakdown. Cognition,
100 (3): 483–510.
Lanfranchi, S., Jerman, O., Dal Pont, E., Alberti, A. and Vianello, R. (2010).
Executive function in adolescents with Down syndrome. Journal of
intellectual disability research, 54 (4): 308-319.

Levitin, D. J., Cole, K., Lincoln, A. and Bellugi, U. (2005). Aversion,

awareness, and attraction: Investigating claims of hyperacusis in the
Williams syndrome phenotype. Journal of child psychology and
psychiatry, 46 (5): 514-523.
Levitin, D. J., Menon, V., Schmitt, J. E., Eliez, S., White, C. D., Glover, G. H.
... Reiss, A. L. (2003). Neural correlates of auditory perception in
Williams syndrome: An fMRI study. NeuroImage, 18 (1): 74-82.
Levy, Y. (2004). A longitudinal study of language development in two
children with Williams syndrome. Journal of child language, 31 (02):
287-310.
Little, K., Riby, D. M., Janes, E., Clark, F., Fleck, R. and Rodgers, J. (2013).
Heterogeneity of social approach behaviour in Williams syndrome: The
role of response inhibition. Research in developmental disabilities, 34 (3):
959-967.
Losh, M., Bellugi, U. and Anderson, J. D. (2001). Narrative as a social
engagement tool: The excessive use of evaluation in narratives from
children with Williams syndrome. Narrative inquiry, 10 (2): 265-290.
Luzzatti, C., Vecchi, T., Agazzi, D., Cesa-Bianchi, M. and Vergani, C. (1998).
A neurological dissociation between preserved visual and impaired spatial
processing in mental imagery. Cortex, 34 (3): 461-469.
Majerus, S., Barisnikov, K., Vuillemin, I., Poncelet, M. and Linden, M. V. D.
(2003). An investigation of verbal short-term memory and phonological
processing in four children with Williams syndrome. Neurocase, 9 (5):
390-401.
Majerus, S., D'Argembeau, A., Martinez Perez, T., Belayachi, S., Van der
Linden, M., Collette, F., Salmon, E., Seurinck, R., Fias, W. and Maquet,
P. (2010). The commonality of neural networks for verbal and visual
short-term memory. Journal of cognitive neuroscience, 22: 2570-2593.
Majerus, S., Palmisano, I., Van Der Linden, M., Barisnikov, K. and Poncelet,
M. (2001). An investigation of phonological processing in Williams
syndrome [Abstract]. Twenty-ninth annual INS meeting abstracts, 7: 153.
Marler, J. A., Elfenbein, J. L., Ryals, B. M., Urban, Z. and Netzloff, M. L.
(2005). Sensorineural hearing loss in children and adults with Williams
syndrome. American journal of medical genetics part A, 138 (4): 318-327.
Marenco, S., Siuta, M. A., Kippenhan, J. S., Grodofsky, S., Chang, W., Kohn,
P., … Meyer-Lindenberg, A. (2007). Genetic contributions to white matter
architecture revealed by diffusion tensor imaging in Williams syndrome.
Proceedings of the National Academy of Sciences, 104 (38): 15117–
15122.

Martens, M. A., Wilson, S. J., Dudgeon, P. and Reutens, D. C. (2009).

Approachability and the amygdala: Insights from Williams syndrome.
Neuropsychologia, 47 (12): 2446-2453.
Martens, M. A., Wilson, S. J., & Reutens, D. C. (2008). Williams syndrome: A
critical review of the cognitive, behavioral, and neuroanatomical
phenotype. Journal of child psychology and psychiatry, 49 (6): 576–608.
Meda, S. A., Pryweller, J. R. and Thornton-Wells, T. A. (2012). Regional
brain differences in cortical thickness, surface area and subcortical volume
in individuals with Williams syndrome. PLoS One, 7 (2): e31913.
Menghini, D., Addona, F., Costanzo, F. and Vicari, S. (2010). Executive
functions in individuals with Williams syndrome: Executive functions in
Williams syndrome. Journal of intellectual disability research, 54 (5):
418–432.
Menghini, D., Verucci, L. and Vicari, S. (2004). Reading and phonological
awareness in Williams syndrome. Neuropsychology, 18 (1): 29.
Mervis, C. B. and Bertrand, J. (1997). Developmental relations between
cognition and language: Evidence from Williams syndrome. In: Adamson
LB, Romski MA, editors. Communication and language acquisition:
Discoveries from atypical development. New York: Brookes; 1997. pp.
75–106.
Mervis, C. B. Developmental relations between cognition and language:
Evidence Klein-Tasman, B. P. (2000). Williams syndrome: Cognition,
personality, and adaptive behavior. Mental retardation and developmental
disabilities research reviews, 6 (2): 148-158.
Mervis, C. B., Morris, C. A., Bertrand, J. and Robinson, B. F. (1999).
Williams syndrome: Findings from an integrated program of research. In
Tager-Flusberg H. (ed), Neurodevelopmental disorders: Developmental
cognitive neuroscience (pp.65-110). Cambridge, MA: MIT Press.
Mervis, C. B., Morris, C. A., Klein-Tasman, B. P., Bertrand, J., Kwitny, S.,
Appelbaum, L. G. and Rice, C. E. (2003). Attentional characteristics of
infants and toddlers with Williams syndrome during triadic interactions.
Developmental neuropsychology, 23 (1-2): 243-268.
Mervis, C. B. and Robinson, B. F. (2000). Expressive vocabulary ability of
toddlers with Williams syndrome or Down syndrome: A comparison.
Developmental neuropsychology, 17 (1): 111-126.
Mervis, C. B., Robinson, B. F., Bertrand, J., Morris, C. A., Klein-Tasman, B.
P. and Armstrong, S. C. (2000). The Williams syndrome cognitive profile.
Brain and cognition, 44 (3): 604-628.

Mervis, C. B., Robinson, B. F., Rowe, M. L., Becerra, A. M. and Klein-

Tasman, B. P. (2003). Language abilities of individuals with Williams
syndrome. International review of research in mental retardation, 27: 35-
81.
Meyer-Lindenberg, A., Buckholtz, J. W., Kolachana, B., Hariri, A. R.,
Pezawas, L., Blasi, G., ... Egan, M. (2006). Neural mechanisms of genetic
risk for impulsivity and violence in humans. Proceedings of the National
Academy of Sciences, 103 (16): 6269-6274.
Meyer-Lindenberg, A., Mervis, C. B. and Berman, K. F. (2006). Neural
mechanisms in Williams syndrome: a unique window to genetic
influences on cognition and behaviour. Nature reviews neuroscience, 7
(5): 380-393.
Munir, F., Cornish, K. M. and Wilding, J. (2000). A neuropsychological
profile of attention deficits in young males with fragile X syndrome.
Musolino, J. and Landau, B. (2010). When theories don't compete: Response
to Thomas, Karaminis, and Knowland's commentary on Musolino,
Chunyo, and Landau. Language learning and development, 6 (2): 170-
178.
Nazzi, T., Gopnik, A. and Karmiloff-smith, A. (2005). Asynchrony in the
cognitive and lexical development of young children with Williams
syndrome. Journal of child language, 32 (02): 427-438.
Nazzi, T., Paterson, S. and Karmiloff-Smith, A. (2003). Early word
segmentation by infants and toddlers with Williams syndrome. Infancy, 4
(2): 251-271.
Newman, R., Ratner, N. B., Jusczyk, A. M., Jusczyk, P. W. and Dow, K. A.
(2006). Infants' early ability to segment the conversational speech signal
predicts later language development: A retrospective analysis.
Developmental psychology, 42 (4): 643.
O’Hearn, K., Courtney, S., Street, W. and Landau, B. (2009). Working
memory impairment in people with Williams syndrome: Effects of delay,
task and stimuli. Brain and cognition, 69 (3): 495–503.
O’Hearn, K., Landau, B. and Hoffman, J. E. (2005). Multiple object tracking
in people with Williams syndrome and in normally developing children.
Psychological science, 16 (11): 905–912.
O’Hearn, K., Roth, J. K., Courtney, S. M., Luna, B., Street, W., Terwillinger,
R. and Landau, B. (2011). Object recognition in Williams syndrome:
Uneven ventral stream activation. Developmental science, 14 (3): 549–
565.

Osório, A., Cruz, R., Sampaio, A., Garayzábal, E., Martínez-Regueiro, R.,
Gonçalves, Ó. F. ... Fernández-Prieto, M. (2012). How executive functions
are related to intelligence in Williams syndrome. Research in
developmental disabilities, 33 (4): 1169-1175.
Paterson, S. J., Girelli, L., Butterworth, B. and Karmiloff‐Smith, A. (2006).
Are numerical impairments syndrome specific? Evidence from Williams
syndrome and Down's syndrome. Journal of child psychology and
psychiatry, 47 (2): 190-204.
Porter, M. and Coltheart, M. (2005). Cognitive heterogeneity in Williams
syndrome. Developmental neuropsychology, 27 (2): 275–306.
Porter, M. A. and Coltheart, M. (2006). Global and local processing in
Williams syndrome, autism, and Down syndrome: Perception, attention,
and construction. Developmental neuropsychology, 30 (3): 771-789.
Porter, M. A., Coltheart, M. and Langdon, R. (2007). The neuropsychological
basis of hypersociability in Williams and Down syndrome.
Reiss, A. L., Eliez, S., Schmitt, J. E., Straus, E., Lai, Z., Jones, W. and Bellugi,
U. (2000). IV. Neuroanatomy of Williams syndrome: A high-resolution
MRI study. Journal of cognitive neuroscience, 12 (Supplement 1): 65-73.
Reiss, J. E., Hoffman, J. E. and Landau, B. (2005). Motion processing
specialization in Williams syndrome. Vision research, 45 (27): 3379-
3390.
Rhodes, S. M., Riby, D. M., Fraser, E. and Campbell, L. E. (2011a). The
extent of working memory deficits associated with Williams syndrome:
Exploration of verbal and spatial domains and executively controlled
processes. Brain and cognition, 77 (2): 208–214.
Rhodes, S. M., Riby, D. M., Matthews, K. and Coghill, D. R. (2011b).
Attention-deficit/hyperactivity disorder and Williams syndrome: Shared
behavioral and neuropsychological profiles. Journal of clinical and
experimental neuropsychology, 33 (1): 147–156.
Rhodes, S. M., Riby, D. M., Park, J., Fraser, E. and Campbell, L. E. (2010).
Executive neuropsychological functioning in individuals with Williams
syndrome. Neuropsychologia, 48 (5): 1216–1226.
Ring, M. and Clahsen, H. (2005). Distinct patterns of language impairment in
Down's syndrome and Williams syndrome: The case of syntactic chains.
Journal of neurolinguistics, 18 (6): 479-501.

Rosner, B. A., Hodapp, R. M., Fidler, D. J., Sagun, J. N. and Dykens, E. M.

(2004). Social competence in persons with Prader‐Willi, Williams and
Down's Syndromes. Journal of applied research in intellectual
disabilities, 17 (3): 209-217.
Rossen, M., Klima, E. S., Bellugi, U., Bihrle, A. and Jones, W. (1996).
Interaction between language and cognition: Evidence from Williams
syndrome. In J. H. Beitchman, N. Cohen, M. Konstantareas and R.
Tannock (Eds.), Language, learning, and behavior disorders:
Developmental, biological, and clinical perspectives (pp. 367-392). New
York: Cambridge University Press.
Rowe, M. L. and Mervis, C. B. (2012). 12 Working memory in Williams
syndrome 1. Working memory and neurodevelopmental disorders, 267.
Sampaio, A., Sousa, N., Férnandez, M., Henriques, M. and Gonçalves, O. F.
(2008). Memory abilities in Williams syndrome: Dissociation or
developmental delay hypothesis? Brain and cognition, 66 (3): 290-297.
Sarpal, D., Buchsbaum, B. R., Kohn, P. D., Kippenhan, J. S., Mervis, C. B.,
Morris, C. A. ... Berman, K. F. (2008). A genetic model for understanding
higher order visual processing: Functional interactions of the ventral
visual stream in Williams syndrome. Cerebral cortex, 18 (10): 2402-2409.
Scerif, G., Cornish, K., Wilding, J., Driver, J. and Karmiloff‐Smith, A. (2004).
Visual search in typically developing toddlers and toddlers with Fragile X
or Williams syndrome. Developmental science, 7 (1): 116-130.
Scherer, S.W. and Osborne, L.R. (2006). Williams-Beuren syndrome. In P. T.
Stankiewicz and J. R. Lupski (Eds.), Genomic disorders: The genomic
basis of disease (pp. 221-236). Totowa, NJ: Humana Press.
Schmitt, J. E., Eliez, S., Warsofsky, I. S., Bellugi, U. and Reiss, A. L. (2001).
Corpus callosum morphology of Williams syndrome: Relation to genetics
and behavior. Developmental medicine & child neurology, 43 (3): 155-
159.
Schuchardt, K., Mäehler, C. and Hasselhorn, M. (2011). Functional deficits in
phonological working memory in children with intellectual disabilities.
Research in developmental disabilities, 32 (5): 1934-1940.
Searcy, Y. M., Lincoln, A. J., Rose, F. E., Klima, E. S., Bavar, N. and
Korenberg, J. R. (2004). The relationship between age and IQ in adults
with Williams syndrome. American journal on mental retardation, 109
(3): 231-236.
Serniclaes, W., Ventura, P., Morais, J. and Kolinsky, R. (2005). Categorical
perception of speech sounds in illiterate adults. Cognition, 98 (2): B35-
B44.

Steele, A., Scerif, G., Cornish, K. and Karmiloff-Smith, A. (2013). Learning to

read in Williams syndrome and Down syndrome: Syndrome-specific
precursors and developmental trajectories. Journal of child psychology
and psychiatry, 54 (7): 754-762.
Stevens, K. N. (2005). Features in speech perception and lexical access. In D.
Pisoni and E. Remez (Eds.), The handbook of speech perception (pp. 125–
155). Oxford: Blackwell.
Stojanovik, V. (2006). Social interaction deficits and conversational
inadequacy in Williams syndrome. Journal of neurolinguistics, 19 (2):
157-173.
Stojanovik, V., Perkins, M. and Howard, S. (2001). Language and
conversational abilities in Williams syndrome: How good is good?
International journal of language & communication disorders, 36 (sup1):
234-239.
Tager-Flusberg, H. and Sullivan, K. (2000). A componential view of theory of
mind: Evidence from Williams syndrome. Cognition, 76 (1): 59-90.
Temple, C. M., Almazan, M. and Sherwood, S. (2002). Lexical skills in
Williams syndrome: A cognitive neuropsychological analysis. Journal of
neurolinguistics, 15: 463-495.
Thomas, M. S. C., Purser, H. R. and Van Herweger, J. (2012). Cognition: The
developmental trajectory approach. In E. K. Farran and A. Karmiloff-
Smith (Eds.), Neurodevelopmental disorders across the lifespan (pp.
13-36). New York: Oxford University Press.
Thompson, P. M., Lee, A. D., Dutton, R. A., Geaga, J. A., Hayashi, K. M.,
Eckert, M. A. ... Toga, A. W. (2005). Abnormal cortical complexity and
thickness profiles mapped in Williams syndrome. The journal of
neuroscience, 25 (16): 4146-4158.
Udwin, O., Davies, M. and Hosylin, P. (1996). A longitudinal study of
cognitive abilities and educational attainment in Williams syndrome.
Developmental medicine & child neurology, 38 (11): 1020-1029.
Udwin, O. and Yule, W. (1991). A cognitive and behavioral phenotype in
Williams syndrome. Journal of clinical and experimental
neuropsychology, 13: 232–244.
Vaissière, J. (2005). Perception of intonation. In D.B. Pisoni and R.E. Remez.,
The handbook of speech perception (pp. 236-263). Oxford: Blackwell.
Van Essen, D. C., Dierker, D., Snyder, A. Z., Raichle, M. E., Reiss, A. L. and
Korenberg, J. (2006). Symmetry of cortical folding abnormalities in
Williams syndrome revealed by surface-based analyses. Journal of
neuroscience, 26 (20): 5470–5483.

Vicari, S., Bates, E., Caselli, M. C., Pasqualetti, P., Gagliardi, C., Tonucci, F.
and Volterra, V. (2004). Neuropsychological profile of Italians with
Williams syndrome: An example of a dissociation between language and
cognition? Journal of the international neuropsychological society, 10
(06): 862-876.
Vicari, S., Bellucci, S. and Carlesimo, G. A. (2003). Visual and spatial
working memory dissociation: Evidence from Williams syndrome.
Developmental medicine & child neurology, 45 (4): 269–273.
Vicari, S., Bellucci, S. and Carlesimo, G. A. (2006). Evidence from two
genetic syndromes for the independence of spatial and visual working
memory. Developmental medicine & child neurology, 48 (02): 126–131.
Vicari, S., Carlesimo, G., Brizzolara, D. and Pezzini, G. (1996). Short-term
memory in children with Williams syndrome: A reduced contribution of
lexical-semantic knowledge to word span. Neuropsychologia, 34: 919–
925.
Vicari, S., Verucci, L. and Carlesimo, G. A. (2007). Implicit memory is
independent from IQ and age but not from etiology: Evidence from Down
and Williams syndromes. Journal of intellectual disability research, 51
(12): 932-941.
Volterra, V., Caselli, M. C., Capirci, O., Tonucci, F. and Vicari, S. (2003).
Early linguistic abilities of Italian children with Williams syndrome.
Developmental neuropsychology, 23 (1-2): 33-58.
Willcutt, E., Sonuga-Barke, E., Nigg, J. and Sergeant, J. (2008). Recent
developments in neuropsychological models of childhood psychiatric
disorders. In T. Banachewski & L.A. Rohde (eds), Biological child
psychiatry: Recent trends and developments (pp. 195-226). Basel: Karger
Publishers.

Chapter 5
PREIMPLANTATION GENETIC
DIAGNOSIS (PGD)
FOR CHROMOSOME REARRANGEMENTS
Chun Kyu Lim

Laboratory of Reproductive Medicine, Cheil General Hospital
and Women’s Healthcare Center, Dankook University College
of Medicine, Seoul, South Korea
INTRODUCTION
Chromosome rearrangements are the most common genetic abnormalities
in humans. Abnormal chromosomal configurations are formed among non-
homologous chromosomes to allow full synapsis of homologous chromosomes
at meiosis I of chromosome rearrangement carriers. These abnormal
chromosomal configurations result in the production of gametes with various
chromosomal complements due to malsegregation of derivative chromosomes
or recombination. Most of the gametes have unbalanced chromosomal
complements and only a small number of gametes have normal or balanced
chromosomal complements. Carriers of balanced chromosome rearrangements
are phenotypically normal but they are at an increased risk of abnormal

170 Chun Kyu Lim
pregnancies due to the unbalanced gametes. However, chromosome

rearrangement carriers who cannot have babies or experience repeated
abortions or abnormal pregnancies can have healthy babies after introduction
of PGD. Balanced reciprocal translocation is the most common chromosome
rearrangement. Thirty-two types of gametes can be produced in meiosis of
reciprocal translocation carrier. According to the results that analyze the
meiotic segregation of embryos from PGD cycles of reciprocal translocation
carriers, 2:2 segregation is the main segregation mode. The meiotic
segregation might be affected by the gender of carriers. The frequency of
balanced embryos was not different between female and male carriers.
However, the frequencies of 2:2 segregation, especially adjacent-1
segregation, 3:1 and 4:0 segregation were significantly different between
female and male carriers. Robertsonian translocation is also common
chromosome rearrangement in humans. Gametes with eight different
chromosomal complements can be produced in Robertsonian translocation
carriers. The frequency of balanced embryos was higher in male carriers than
in female carriers. Carriers of complex chromosome rearrangements (CCR),
very rare chromosome rearrangements, can achieve pregnancy by PGD
although the number of normal or balanced embryos was extremely low.
Although it is very difficult to estimate the rate of normal or balanced
embryos, the rate is estimated to be less than 10% in PGD for CCR carriers.
The 3:3 segregation and chaotic segregation (meiotic segregation whose
meiotic segregation cannot be defined) are prevalent segregation modes in
carriers of three-way translocation. In PGD cycles of CCR carriers, cycle
cancellation is very frequent due to the absence of the normal of balanced
embryos. Therefore, it is important that a large number of embryos are
obtained in one cycle. Occasionally, abnormalities of chromosome
rearrangement-unrelated chromosomes are observed in embryos or abortuses
although chromosome rearrangement-related chromosomes are normal or
balanced. At present, PGD that diagnose all 24 chromosomes using array-
CGH, SNP array or NGS is carried out worldwide. In those PGD cycles, the
risk that embryo transfer is cancelled might be increased. However, the rate of
normal or balanced embryos is unexpectedly increased and pregnancy rate is
improved. Surely, PGD is the very effective assisted reproductive technique in
achieving pregnancy of chromosome rearrangement carriers by preventing
repeated abortions that chromosome rearrangement carriers usually
experience. In the field of PGD for chromosome rearrangements, the next
stage will be the development of technique that can discriminate between
normal embryos and balanced embryos.

Preimplantation Genetic Diagnosis (PGD) … 171
Chromosome rearrangements, such as translocation (reciprocal or

Robertsonian), inversion and complex chromosome rearrangements, are the
most common genetic abnormalities in humans. Chromosome rearrangements
are classified as balanced or unbalanced (Nussbaum et al., 2016). Carriers of
balanced chromosome rearrangements have the normal chromosomal
complements but carriers of unbalanced chromosome rearrangements have
additional or missing chromosomal material. Generally, the incidence of
balanced chromosome rearrangements is about 0.19% of newborns (Jacobs, et
al., 1974; Hamerton, et al., 1975). Carriers of balanced chromosome
rearrangements are phenotypically normal because they have all the genetic
materials. However, they are at an increased risk of implantation failure,
repeated abortions or birth of chromosomally unbalanced offspring. Of course,
not all carriers of balanced chromosome rearrangements experience the
abnormal pregnancies. The abnormal pregnancies are resulted from the
unbalanced gametes generated during meiosis of chromosome rearrangement
carriers. Abnormal chromosomal configurations are formed to allow full
synapses of homologous chromosomes during meiosis of balanced
chromosome rearrangement carriers. The unbalanced gametes are produced as
a results of malsegregation of these abnormal chromosomal configuration.
Most of the gametes produced during meiosis of chromosome rearrangement
carriers have unbalanced chromosomal complements. These unbalanced
gametes result in implantation failure, repeated abortions or birth of
chromosomally unbalanced offspring.
After the first successful clinical application of preimplantation genetic
diagnosis (PGD) in 1990 (Handyside et al., 1990), PGD has been widely used
worldwide to select normal or balanced embryos in in vitro fertilization and
embryo transfer (IVF-ET) programs of balanced chromosome rearrangement
carriers. Cleavage-stage fluorescence in situ hybridization (FISH) has been
widely used to PGD for carriers of balanced chromosome rearrangements till
the early 2010s (Van Assche, et al. 1999; Otani, et al. 2006; Bernicot, et al.
2012; Ko, et al. 2013) and PGD based on array comparative genomic
hybridization (CGH) (Alfarawati, et al. 2011; Fiorentino, et al., 2011; Colls, et
al. 2012; Huang, et al. 2013; Tan, et al. 2013) or next generation sequencing
(NGS) (Fiorentino, et al. 2014a, b; Huang, et al. 2014; Wells, et al. 2014; Tan
et al., 2014; Lukaszuk et al., 2015) is widely applied nowadays. The only
abnormalities of rearranged chromosomes can be diagnosed in FISH-based
PGD and the abnormalities of other chromosomes cannot be diagnosed.
However, abnormalities of all 24 chromosomes can be diagnosed after the
application of array CGH or NGS into PGD.

172 Chun Kyu Lim
EMBRYO BIOPSY
To perform PGD, one cell or a few cells have to be removed from oocytes
or embryos. Cells necessary for PGD can be removed at three different stages,
polar body from the oocytes and/or the zygotes, one or two blastomeres from
cleavage stage embryos or trophectoderm (TE) from the blastocysts. Embryo
biopsy is mainly performed at cleavage stage but trophectoderm biopsy is
gradually increasing these days (Moutou et al., 2014; Cimadomo et al., 2016).
A small hole has to be made within the zona pellucid to remove polar
body or blastomere(s). This zona breaching can be conducted by one of
following methods; mechanical, laser-assisted or acidified Tyrode’s drilling
methods. Recently, laser-assisted zona breaching is most popularly used
(Moutou et al., 2014). Clinical outcomes are not different among these three
methods (De Vos and Van Steirteghem, 2001; Jones et al., 2006; Geber et al.,
2011; Eldar-Geva et al., 2014).
Cleavage stage biopsy is performed on day 3 embryos. One or two
blastomeres with one distinct nucleus are removed from embryos with at least
6 cells. Blastomere biopsy is usually conducted in Ca2+/Mg2+-free medium in
order to facilitate removal of blastomere from embryos. However, there are
controversies about the effect of Ca2+ depletion on embryo development
(Sefton et al., 1996; Dumoulin et al., 1998; Pey et al., 1998). Preimplantation
embryos show high chromosomal mosaicism and some of these embryos can
develop to blastocysts (Wells and Delhanty, 2000; Bielanska et al., 2002).
Embryonic mosaicism cannot be identified by single-blastomere biopsy.
Therefore, two-blastomere biopsy can be performed to compensate the
problems caused by single-blastomere biopsy. However, embryonic
development can be affected by two-blastomere biopsy because too much
embryonic mass is removed from embryos (Cohen et al., 2007). ESHRE
guidelines suggested that two-blastomere biopsy could be safely applied to
PGD when embryos with ≥6 cells and ≤30% of fragmentation (Goosens et al.,
2008).
Polar body biopsy can be performed as an alternative to blastomere
biopsy. In some countries, polar body biopsy is mainly performed since
blastomere biopsy is legally prohibited. Zona breaching is performed with the
same method as blastomere biopsy. Chromosomal abnormalities from mitotic
errors or paternally derived aneuploidies cannot be detected when polar body
biopsy is adopted. Nowadays the use of polar biopsy is decreasing. Blastocyst

stage preimplantation genetic screening (PGS) is emerging as the most

promising approach to select euploid embryos. Several cells (five to ten cells)
are removed from the blastocyst on day 5 or 6. PGD coupled with blastocyst
biopsy is barely affected by biopsy operators (Capalbo et al., 2015) and
embryonic mosaicism that is common in preimplantation embryos, because
PGD is carried out using several cells. Therefore, the application of blastocyst
biopsy is increasing and gradually replacing both polar body biopsy and
blastomere biopsy. One of two different blastocyst biopsy methods is carried
out currently. The first method is that a few cells herniated from blastocyst are
removed using laser on day 5 or 6 through the small hole that is made in the
zona pellucid on day 3 (McArthur et al., 2005). Embryonic development might
be affected by zona breaching and some of inner cell mass (ICM) may be
biopsied together with trophectoderm cells because the position that ICM is
formed is unpredictable. The second method is that TE cells are removed
simultaneously with zona breaching on day 5 or 6 (Capalbo et al., 2014).
According to this method, only TE cells can be isolated from blastocyst and
embryonic development is not disturbed since the biopsy operator can choose
the site of biopsy. However, high standards of embryo culture and
cryopreservation techniques have to be established for blastocyst biopsy to be
carried out.
PREGNANCY HISTORY OF CHROMOSOME

REARRANGEMENT CARRIERS
In general, chromosome rearrangement carriers have poor pregnancy
history before PGD. They spend several years (mean of 3.2 years) to have a
baby (Chang et al., 2012). And most of them experienced repeated
miscarriages or live births of babies with multiple congenital anomalies due to
unbalanced karyotypes. More than 90% of spontaneous pregnancies resulted in
miscarriages (Munne et al., 2000a; Lim et al. 2008a; Keymolen et al., 2012;
Liao et al., 2014). Most couples with chromosome rearrangements choose
PGD to overcome the repeated miscarriage and have healthy babies. Actually,
miscarriage rate decrease significantly when they become pregnant after PGD.
Therefore, PGD can be a useful option that chromosome rearrangement
carriers can choose to have healthy babies (Munne et al. 2000a; Lim et al.,
2004).

174 Chun Kyu Lim
PGD FOR BALANCED RECIPROCAL

TRANSLOCATION
Balanced reciprocal translocation is the most common structural
abnormalities of chromosomes with an incidence of about 0.16% in livebirth
(Van Dyke et al., 1983). The risk that reciprocal carriers conceive a
chromosomally abnormal embryo varies from 20% to 80%, depending on
types of translocation, chromosomes involved in the translocation, position of
the breakpoints, and gender of the carrier (Goldman and Hulten, 1993; Martin
and Hulten, 1993). However, the risk of abnormal pregnancy or pregnancy
loss can reduced by PGD in reciprocal translocation carriers (Munne et al.,
2000a, 2002; Lim et al., 2004; Grace et al., 2006). During meiosis I of
reciprocal translocation carriers, a quadrivalent is formed to make synapses
between homologous chromosomes. And then, the quadrivalent segregate
according to one of five segregation modes; 2:2 segregation (alternate,
adjacent-1 and adjacent-2), 3:1 segregation and 4:0 segregation. Crossing-over
between the centromere and the breakpoint or anaphase II non-disjunction
result in gametes with unbalanced chromosomal complements. In theory,
thirty-two different gametes with different chromosome complements can be
generated at the end of meiosis I (Scriven et al., 1998). Only two among the
gametes have normal chromosomal complements and the other gametes have
partial aneuploidy. Uncommon viable conceptuses with abnormal
chromosomal complement can be resulted from the gametes with partial
aneuploidy.
Reciprocal translocation carrier couples can achieve successful
pregnancies through PGD and the pregnancy rate of them is comparable to that
of couples with normal karyotype. PGD results can be obtained in more than
90% of diagnosed embryos and about 11 ~ 45% of the embryos are identified
as normal or balanced and transferable embryos (Table 1). Biopsy stage of
embryos can affect the rate of normal or balanced embryos. The rate of normal
or balanced embryos is higher when embryos are biopsied at blastocyst stage
than cleavage stage (Xiong et al., 2014; Tobler et al., 2014; Idowu et al.,
2015). Compared to blastomere biopsy, the fewer embryos are available for
biopsy in blastocyst biopsy. The unbalanced embryos can develop to the
blastocyst stage but it seems that the developmental potential of unbalanced
embryos is inferior to that of balanced embryos. Therefore, the rate of normal
or balanced embryos is higher when biopsy is carried out in blastocysts (Tan et
al., 2013).

Table 1. PGD outcomes of reciprocal translocation carriers
References Biopsy stage % of normal % of % of % of ET PGD

or balanced clinical abnormal cancel** techniques
embryos pregnancy pregnancy*
Gianaroli Cleavage stage 11.5 (7/61) 25.0 66.7 FISH
et al.
(2002)
Lim et al. Cleavage stage 23.1 35.1 5.6 9.3 FISH
(2004) (164/710)
Lim et al. Cleavage stage 23.2 38.6 6.8 13.7 FISH
(2008) (114/508)
Ko et al. Cleavage stage 18.7 28.4 7.8 12.8 FISH
(2010) (282/1,508)
Fiorentino Cleavage stage 11.8 63.6 0 38.9 aCGH
et al. (16/136)
(2011)
Keymolen Cleavage stage 20.8 26.7 0 44.6 FISH
et al. (323/1,553) (51.9)
(2012)
Tan et al. Cleavage stage 19.9 38.9 6.3 31.9 FISH
(2013) (449/2,258)
Blastocyst 35.5 73.8 8.2 29.9 SNP array
stage (177/499)
Xiong et Blastocyst 35.5 29.9 SNP array
al. (2014) stage (177/499)
Tobler et Cleavage stage 45.0 61.3 14.7 SNP array
al. (2014) + Blastocyst (226/498) + aCGH
stage
Tan et al. Blastocyst 34.4 NGS
(2014) stage (84/244)
35.6 SNP array
(216/606)
Idowu et Cleavage stage 19.0 59.3 7.4 38.0 SNP array
al. (2015) + Blastocyst
stage
*
Percent per embryos transfer.
**
Embryo transfer was canceled because of the absence of normal/balanced embryos
or insufficient quality of embryos for transfer.
Embryo transfers are occasionally cancelled due to the absence of normal

or balanced embryos in several cycles, ranging from 9.3 to 51.3% of started
cycles. The main reason for the absence of normal or balanced embryos is that
the number of embryos available for PGD is small. Although rare, embryo

176 Chun Kyu Lim
transfer might be cancelled due to the absence of normal or balanced embryos

when a large number of embryos are available for PGD. And among
pregnancies achieved by PGD, several pregnancies are aborted within the first
trimester of gestation. Aneuploidies of translocation-unrelated chromosomes
are frequently observed in embryos or abortuses. Aneuploidies of
translocation-unrelated chromosomes are observed in 12 ~ 26% of diagnosed
embryos (Xiong et al., 2014; Idwou et al., 2015). It is known that the incidence
of aneuploidy or mosaicism is very high in human preimplantation embryos.
Chromosomal aneuploidy is increased in translocation carriers (Blanco et al.,
2000; Morel et al., 2001; Oliver-Bonet et al., 2001) and about 50% of the
embryos diagnosed as normal-balanced are aneuploid (Pujol et al., 2006). It
has been suggested that translocations might disturb the meiotic disjunction of
the translocation-unrelated chromosome pairs resulting in non-disjunction.
Diagnoses for translocation-unrelated chromosomes are not possible when
PGD for chromosome rearrangement is performed using FISH. However,
abnormalities of translocation-unrelated chromosomes can be diagnosed since
PGD for 24 chromosomes using array CGH or NGS is currently performed
(Xiong et al., 2014; Tan et al., 2014; Idwou et al., 2015; Gui et al. 2016). PGD
for 24 chromosomes has the merit of diagnosing aneuploidies of translocation-
unrelated chromosomes together with translocation-related chromosomes.
However, at the same time, the risk of embryo transfer cancellation is high due
to the aneuploidies of translocation-unrelated chromosomes (Fiorentino et al.,
2011; Tan et al., 2013; Xiong et al., 2014).
According to meiotic segregation analysis of embryos from reciprocal
translocation carriers, 2:2 segregation is the most prevalent segregation mode.
The 2:2 segregation is identified in more than half of the embryos from
reciprocal translocation carriers (Scriven et al., 2000; Lim et al., 2008a; Ko et
al., 2010). Among 2:2 segregation modes, the incidence of alternate
segregation is similar that of adjacent-1 segregation and the incidence of
adjacent-2 segregation is lower than that of alternate or adjacent-1 segregation.
The incidence of 3:1 segregation mode is similar to that of alternate or
adjacent-1 segregation and 4:0 segregation is observed although the frequency
is low. And meiotic segregation cannot be determined in about 15% of
diagnosed embryos. Meiotic segregation can be affected by gender of carrier,
translocation-related chromosomes or the location of breakpoint. The
frequency of normal or balanced embryos is not different between male and
female carriers. However, the incidences of each segregation mode are
significantly different between male and female carriers. The incidence of 2:2
segregation, especially adjacent-1 segregation, is higher in male carriers

(60.8% vs. 52.7%, P < 0.05) and the incidences of 3:1 segregation or 4:0
segregation are significantly higher (P < 0.05) in female carriers (28.4% vs.
20.5% and 3.2% vs. 1.6%, respectively) (Ko et al., 2010). The incidence of
alternate segregation is low when acrocentric chromosomes (chromosome 13,
14, 15, 21 or 22) are involved in translocation (Lim et al., 2008; Ye et al.,
2012). And the incidence of normal or balanced embryos is lower in
translocation carriers who have terminal breakpoint than carriers whose
breakpoint is not terminal (Ye et al., 2012). It is known that the acrocentric
chromosomes are less stable during meiosis or mitosis than metacentric or
submetacentric chromosomes. During meiosis, translocated acrocentric
chromosomes may not form a typical quadrivalent as observed in reciprocal
translocations between metacentric and/or submetacentric chromosomes. This
phenomenon may be related to predisposing of adjacent-2 or 3:1 segregation
(Jalbert and Sele, 1979).
PGD FOR ROBERTSONIAN TRANSLOCATION

Centric fusion of two acrocentric chromosomes results in Robertsonian
translocation, which is one of the most common chromosomal rearrangements
(Nielsen and Wohlert, 1991). Like balanced reciprocal translocation carriers,
Robertsonian translocation carriers are phenotypically normal but they are also
at an increased risk of chromosomally abnormal pregnancies (Scriven et al.,
1998). Robertsonian translocation carriers who experienced repeated abortions
or birth of babies with congenital anomalies or mental retardations can achieve
normal pregnancy by PGD (Munne et al., 1998; Fischer et al., 2010). During
meiosis of Robertsonian translocation carriers, trivalent is formed and gametes
with eight different chromosomal complements are produced. Only two
gametes produced by alternate segregation have normal or balanced
chromosomal complements and the others have unbalanced chromosomal
complements.
Pregnancy outcome of Robertsonian translocation carriers is similar to
that of balanced reciprocal translocation carriers. More than 90% of biopsied
embryos are diagnosed successfully and about 30 ~ 50% of diagnosed
embryos are available to embryo transfer (Table 2). The rate of transferable
embryos is higher in male carriers than in female carriers (Ko et al., 2013; De
Rycke et al., 2015). Embryo transfer is cancelled due to the absence of normal
or balanced embryos in 10~30% of oocyte retrieval cycles. Similar to

178 Chun Kyu Lim
reciprocal translocation carriers, several pregnancies after PGD are aborted

within the first trimester of gestation. However, miscarriage rate is
significantly lower after PGD than before PGD. Various karyotypes are
observed in the cytogenetic analysis results of the abortuses: normal, balanced
karyotype or aneuploidies of translocation-unrelated chromosomes.
Table 2. PGD outcomes of Robertsonian translocation carriers
References Biopsy stage % of normal % of % of % of PGD

or balanced clinical abnormal ET techniques
embryos pregnancy pregnancy* cancel**
Gianaroli et Cleavage 23.4 (26/111) 61.5 43.5 FISH
al. (2002) stage
Lim et al. Cleavage 22.3 (29/135) 10.0 0 9.1 FISH
(2004) stage
Fiorentino Cleavage 27.5 (14/51) 83.3 0 40 aCGH
et al. (2011) stage
Ko et al. Cleavage 26.5 28.3 7.1 5.8 FISH
(2013) stage (331/1,247)
Tan et al. Cleavage 36.1 38.4 6.4 16..1 FISH
(2013) stage (435/1,204)
Blastocyst 57.8 69.4 8.3 9.6 SNP array
stage (126/218)
Xiong et al. Blastocyst 57.8 9.6 SNP array
(2014) stage (126/218)
Tan et al. Blastocyst 53.5 (31/58) NGS
(2014) stage 52.4 SNP array
(120/229)
Idowu et al. Cleavage 37.0 55.6 3.7 19.0 SNP array
(2015) stage +
Blastocyst
stage
*
**
Alternate or adjacent segregation are the dominant segregation modes

according to meiotic segregation analysis of embryos from PGD for
Robertsonian translocation carriers. There are some differences in segregation
patterns between female and male carriers (Munne et al., 2000b; Ko et al.,
2013). The rate of embryos from alternate segregation is significantly higher in
male than in female carriers (43.9% vs. 29.9%, P < 0.01) and the rate of

embryos whose meiotic segregation cannot be determined is significantly

higher in female than male carriers (15.8% vs. 8.9%, P < 0.01). In (13;14)
translocation carriers, the most common Robertsonian translocation, the rate of
embryos from alternate embryos is significantly higher in male than in female
carriers (44.0% vs. 29.2%, P < 0.01) and the rate of embryos from adjacent
segregation is significantly higher in female than male carriers (47.9% vs.
37.1%, P < 0.01). However, the information on meiotic segregation of
Robertsonian translocation carriers, especially female carriers, is insufficient.
More studies are needed. Aneuploidies of translocation-unrelated
chromosomes might increase in unbalanced embryos. In Robertsonian
translocation carriers, aneuploidies of chromosome 18 is significantly higher
(P < 0.001) in embryos from 3:0 segregation or embryos whose meiotic
segregation cannot be determined (chaotic segregation) than in embryos from
2:1 segregation (alternate segregation or adjacent segregation) (Ko et al.,
2013). Among embryos whose translocation-related chromosomes are
diagnosed as normal or balanced, several embryos cannot be transferred due to
aneuploidies of chromosome 18. It is not known what cause the increase of
chromosome 18 aneuploidy in embryos from 3:0 or chaotic segregation.
However, in those embryos, factors that cause malsegregation of translocation-
related chromosomes seem to increase aneuploidy of chromosome 18 and
these factors need to be identified. Nowadays, aneuploidies of translocation-
unrelated chromosomes can be diagnosed concurrently together with
abnormalities of translocation-related chromosomes. In PGD cycles of
Robertsonian translocation carriers where 24 chromosomes are diagnosed, a
high clinical pregnancy rate (83.3%) and implantation rate (66.7%) are
achieved in carriers of Robertsonian translocation (Fiorentino et al., 2011).
However, aneuploidies of translocation-unrelated chromosomes are observed
in more than half of the normal or balanced embryos (Fiorentino et al., 2011;
Rius et al., 2011). Therefore, the number of transferable embryos might be
decreased in those PGD cycles.
PGD FOR COMPLEX CHROMOSOME

REARRANGEMENT (CCR)
Complex chromosome rearrangements (CCRs) are very rare events in
human. CCRs are generally defined as balanced or unbalanced structural
chromosomal abnormalities involving more than two breakpoints and a simple

180 Chun Kyu Lim
exchange of genetic material between two chromosomes (Pai et al., 1980).

Most familial CCRs are of maternal origin (Batista et al., 1994; Madan et al.,
1997) and most de novo CCRs are of paternal origin (Batista et al., 1993,
1994). There are few studies on the incidence of CCRs in the general
population. However, the incidence of CCRs has been estimated to be around
0.1% among infertile individuals (Mau-Holzmann, 2005). Like other
chromosome rearrangement carriers, CCR carriers are also phenotypically
normal. However, they are estimated to have a 50% risk of miscarriage and a
20% risk of having a child with an unbalanced karyotype (Gorski et al., 1988;
Madan et al., 1997). However, these figures cannot be applied to individual
CCR carriers as a wide variety of gametes can be produced depending on the
number of chromosomes and the number of breakpoints in involved in CCRs
(Kausch et al., 1988; Loup et al., 2010). The risk of phenotype abnormality
increases with the number of chromosomes and the number of breakpoints
involved in CCRs (Ruiz et al., 1996; Madan et al., 1997; Giardino et al.,
2006). Estimating risk for spontaneous abortions or phenotypic abnormalities
of CCR carriers is very difficult and remain empirical, ranging from 50 to
100% for spontaneous abortion (Batista et al., 1994) and from 20 to 90% for
phenotypic abnormalities (Gorski et al., 1988). Analyses of meiotic
segregation of CCRs are also very difficult due to the nature of CCRs and the
number of chromosomes involved in CCRs. An abnormal configuration of
chromosomes is formed during meiosis I of CCR carriers. The abnormal
configuration causes either malsegregation of derivative chromosomes or
generation of a recombinant chromosome (Pellestor et al., 2011b). For
example, a hexavalent configuration is formed to allow full synapses of
homologous segments during meiosis of three-way translocation, the most
common type of CCR (Saadallah and Hulten, 1985). Theoretically, 64
different chromosomal combinations can be formed at the end of meiosis I and
only two combinations are balanced. And empirically, the incidence of
balanced embryos is very low in CCR carriers, ranging from 9.1 to 16.2%
(Escudero et al., 2008; Lim et al., 2008b; Scriven et al., 2014). Since its
introduction, PGD has contributed to the achievement of pregnancy and
prevention of miscarriage in IVF-ET program of chromosome rearrangement
carriers and it has been applied to IVF-ET program of CCR carriers.
Compared to PGD cycles of other chromosome rearrangement such as
reciprocal translocation, Robertsonian translocation or inversion, the
cancellation rate of embryo replacement is higher (25.0 ~ 64.7%) due to the
absence of normal or balanced embryos in PGD cycle of CCR carriers (Table

3). The incidence of normal or balanced embryos is very low (4.9 ~ 5.6%) and
therefore, the average number of transferred embryos is also small (1.7 ± 1.1.
per embryo replacement, unpublished data).
As mentioned above, meiotic segregation analysis of CCRs is very
difficult due to the nature of CCR and its rarity. Although few studies have
been conducted, meiotic segregation of three-way translocation, the most
common CCR, is analyzed in several studies. The 3:3, 4:2 and 5:1
segregations are observed in embryos from three-way translocation carriers
(34.1%, 20.7% and 2.2%, respectively). Among 3:3 segregations, the rates of
alternate, adjacent 1 and adjacent 2 segregation are 16.4%, 52.5% and 31.1%,
respectively. Cross-over between sister chromatids is observed in 7.3% of
embryos. The 6:0 segregation is not observed and the meiotic segregation
could not be determined in 43.0% of embryos (unpublished data). The
incidence of embryos whose meiotic segregation mode cannot be determined
is significantly higher (P < 0.001) in three-way translocation carriers (43.0%,
unpublished data) than reciprocal translocation (16.8%) or Robertsonian
translocation (14.4%) carriers (Ko et al., 2010, 2013).
Table 3. PGD outcomes of complex chromosome rearrangement carriers
References Biopsy % of % of % of % of PGD

stage normal clinical abnormal ET techniques
* **
or pregnancy pregnancy cancel
balanced
embryos
Lim et al. Cleavage 7.4 33.3 0 25.0 FISH
(2008) stage (4/54)
Escudero et Cleavage 6.4 50.0 69.2 FISH
al. (2008) stage (9/140)
Scriven et al. Cleavage 16.2 100 66.7 FISH
(2014) stage (6/37)
Ko et al. Cleavage 5.0 33.3 66.7 64.7 FISH
(Unpublished) stage (22/444)
*
**
Various genomic, genetic and non-genetic factors can influence the

meiotic segregation of translocation configurations (Jalbert et al., 1980). The

182 Chun Kyu Lim
number of chromosomes involved in a translocation is included in the factors.

Also, the occurrence of double interstitial chiasma may affect the meiotic
segregation of three-way translocation (Cifuentes et al., 1998). Therefore, in
three-way translocation carriers, chaotic segregation may occur in at a higher
incidence than two-way translocation carriers due to the involvement of three
chromosomes and the occurrence of double interstitial chiasma although more
extensive studies are needed to solve this problem.
Couples in whom one partner is a carrier of two different chromosome
rearrangements has underwent PGD cycles. The incidence of embryos
available to embryo replacement is low (4.9%, unpublished data) in those
PGD cycles. Normal or balanced embryos for two different chromosome
rearrangements are rare. Therefore, cancellation of embryo replacement due to
the absence of normal or balanced embryos is high (about 77.8%, unpublished
data). The two different chromosome rearrangements form two separate
chromosomal configurations and undergo meiosis independently (Miller and
Flatz, 1984; Zahed et al., 1998). In these PGD cycles, the meiotic segregation
analysis is difficult as the number of analyzed embryos is very small and
various chromosomes are involved in CCRs.
In some couples, both partners are carriers of chromosome
rearrangements. Those couples can benefit from PGD. In PGD cycles of those
couples, the incidence of normal or balanced is also very low (5.6%,
unpublished data). The cancellation rate of embryo replacements is also very
high. Similar to couples in whom one partner is a carrier of two different
chromosome rearrangements, most of embryos that are normal or balanced in
one chromosome rearrangement are unbalanced in the other chromosome
rearrangement. The couples in whom both partners are carriers of chromosome
rearrangements seem to have more reproductive risks than couples in whom
one partner is a carrier of a chromosome rearrangement (Beyazyurek et al.,
2010). Instead, the reproductive risks of those couples appear to be similar to
those of couples in whom one partner is a carrier of two different chromosome
rearrangements. The rate of normal or balanced embryos is similar between
couples in whom both partners are carriers of chromosome rearrangements and
couples in whom one partner is a carrier of two different chromosome
rearrangements (5.6% vs. 4.9%, unpublished data). Strictly speaking, couples
in whom both partners are carriers of chromosome rearrangements are not
CCR carriers. However, the respective chromosome rearrangements of both
partners seem to have a similar effect on pregnancy outcomes of PGD cycles
to that of CCR carriers.

APPLICATION OF COMPREHENSIVE CHROMOSOME

SCREENING (CCS) INTO PGD FOR BALANCED
CHROMOSOME REARRANGEMENTS
With the development of PGD techniques, comprehensive chromosome
screening using array CGH, SNP array or NGS is currently applied to PGD for
balanced chromosome rearrangement carriers. In 2000s, FISH was the main
technique of PGD for chromosome rearrangement. However, the techniques
that can diagnose 24 chromosomes are currently applied to PGD for
chromosome rearrangement carriers (Alfarawati et al., 2011; Fiorentino et al.,
2011; Treff et al., 2011; Colls et al., 2012; van Uum et al., 2012; Huang et al.,
2013; Tan et al., 2013). PGD for chromosome rearrangements is possible
using these techniques and single blastomere biopsied from cleavage stage
embryo, but recently 24-chromosome PGD combined with trophectoderm
biopsy are expanding and gradually replacing the polar body or blastomere
biopsy.
Compared to FISH-PGD using blastomere biopsied at day 3, array-based
PGD combined with trophectoderm biopsy (day 5 or 6) results in higher
clinical pregnancy rate and implantation rate (Tan et al. 2013). The number of
embryos available for PGD is significantly higher in FISH-PGD than in array-
based PGD. Only translocation-related chromosomes are diagnosed in FISH-
PGD but 24 all chromosomes are diagnosed in array-based PGD. Therefore,
the number of transferable embryos might decrease in array-based PGD.
However, the average number of transferable embryos per embryo transfer is
not significant different between FISH-PGD and array-based PGD (Tan et al.,
2013). Instead, the rate of transferable embryos is higher in array-based PGD
than in FISH-PGD. The higher rate of transferable embryos in array-based
PGD might result from the small number of embryos available for PGD. And
developmental potential of unbalanced embryos seems to be lower than that of
normal or balanced embryos since the rate of transferable embryos is higher in
array-based PGD than in FISH-PGD although the number of embryos
available for PGD is larger in FISH-PGD than array-based PGD. In addition,
miscarriage rate is higher in FISH-PGD than in array-based PGD although
there is no significant difference (Tan et al., 2013). Abnormalities of
chromosome rearrangement-unrelated chromosomes are observed in aborted
tissues of FISH-PGD but not in aborted tissues of array-based PGD. Overall,
array- or NGS-based PGD combined with trophectoderm biopsy can improve

184 Chun Kyu Lim
the clinical outcomes compared to FISH-PGD in PGD for chromosome

rearrangement carriers. In the near future, array- or NGS-based PGD will be
the major PGD technique for chromosome rearrangement carriers since its use
is expanding.
CONCLUSION
Chromosome rearrangement carriers have achieved pregnancies by PGD
after its introduction into human IVF-ET programs. In 2000s, FISH was
widely used to PGD for chromosome rearrangement carriers and healthy
babies were born. However, some of pregnancies achieved by PGD resulted in
miscarriages that might be caused by abnormalities of chromosome
rearrangement-unrelated chromosomes. PGD techniques for chromosome
rearrangements have developed from diagnosis for only rearranged
chromosomes to diagnosis for all chromosomes, from FISH to CCS using
array CGH or NGS. With the development of PGD techniques, miscarriages
due to abnormalities of chromosome rearrangement-unrelated chromosomes
will decrease and clinical outcomes of chromosome rearrangement carriers are
expected to be improved. And although PGD techniques are developed,
distinguishment between chromosomally normal embryos and balanced
embryos is impossible with the PGD techniques we have today. Therefore, the
techniques that can distinguish chromosomally normal embryos from balanced
embryos have to be developed in the near future.
Lastly, though there are some exceptions, the possibility of obtaining
normal or balanced embryos is higher in cycles that a large number of
embryos are available for PGD than in cycles that a small number of embryos
are available. Therefore, PGD might be performed by using as many embryos
as possible. And also, the possibility of obtaining normal or balanced embryos
is higher in cycles where a large number of embryos are obtained in one cycle
compared to cycles where embryos are collected over several cycles.
However, care should be taken to avoid excessive stimulation that may be
harmful to patients and cause other side effects. With the development of PGD
techniques, elaborate care for chromosome rearrangement carriers enable them
to have healthy babies and will make possible the improvement of clinical
outcomes of chromosome rearrangement carriers.

REFERENCES
Alfarawati S, Fragouli E, Colls P, Wells D. First births after preimplantation
genetic diagnosis of structural chromosome abnormalities using
comparative genomic hybridization and microarray analysis. Hum.
Reprod., 2011, 26, 1560-1574.
Batista DAS, Tuck-Muller CM, Martinez JE, Kearns WG, Pearson PL, Stetten
G. A complex chromosomal rearrangement detected prenatally and
studied by fluorescence in situ hybridization. Hum. Genet., 1993, 92, 117-
121.
Batista DAS, Pai GS, Stetten G. Molecular analysis of a complex
chromosomal rearrangement and a review of familial cases. Am. J. Med.
Genet., 1994, 53, 255-263.
Bernicot I, Schneider A, Mace A, Hamamah S, Hedon B, Pellestor F, Anahory
T. Analysis using fish of sperm and embryos from two carriers of rare rob
(13;21) and rob(15;22) robertsonian translocation undergoing PGD. Eur.
J. Med. Genet., 2012, 55, 245-251.
Beyazyurek C, Ekmekci CG, Sağlam Y, Cinar C, Kahraman S.
Preimplantation genetic diagnosis (PGD) for extremes-successful birth
after PGD for a consanguineous couple carrying an identical balanced
reciprocal translocation. Fertil. Steril., 2010, 93, 2413.e1-5.
Bielanska M, Tan SL, Ao A. Chromosomal mosaicism throughout human
preimplantation development in vitro: incidence, type, and relevance to
embryo outcome. Hum. Reprod., 2002, 17, 413-419.
Blanco J, Egozcue J, Vidal F. Interchromosomal effects for chromosome 21 in
carriers of structural chromosome reorganizations determined by
fluorescence in situ hybridization on sperm nuclei. Hum. Genet. 2000,
106, 500-505.
Capalbo A, Rienzi L, Cimadomo D, Maggiulli R, Elliott T, Wright G, Nagy
ZP, Ubaldi FM. Correlation between standard blastocyst morphology,
euploidy and implantation: an observational study in two centers
involving 956 screened blastocysts. Hum. Reprod., 2014, 29, 1173-1181.
Capalbo A, Ubaldi FM, Cimadomo D, Maggiulli R, Patassini C, Dusi L,
Sanges F, Buffo L, Venturella R, Rienzi L. Consistent and reproducible
outcomes of blastocyst biopsy and aneuploidy screening across different
biopsy practitioners: a multicentre study involving 2586 embryo biopsies.
Hum. Reprod., 2015, 31, 199-208.

186 Chun Kyu Lim
Chang EM, Han JE, Kwak IP, Lee WS, Yoon TK, Shim SH. Preimplantation
genetic diagnosis for couples with a Robertsonian translocation: practical
information for genetic counseling. J. Assist. Reprod. Genet., 2012, 29,
67-75.
Cimadomo D, Capalbo A, Ubaldi FM, Scarica C, Palagiano A, Canipari R,
Rienzi L. The impact of biopsy on human embryo developmental potential
during preimplantation genetic diagnosis. Biomed. Res. Int., 2016, 2016,
7193075.
Cifuentes P, Navarro J, Míguez L, Egozcue J, Benet J. Sperm segregation
analysis of a complex chromosome rearrangement, 2;22;11, by whole
chromosome painting. Cytogenet. Cell Genet. 1998, 82, 204-209.
Cohen J, Wells D, Munne S. Removal of 2 cells from cleavage stage embryos
is likely to reduce the efficacy of chromosomal tests that are used to
enhance implantationrates. Fertil. Steril., 2007, 87, 496-503.
Colls P, Escudero T, Fischer J, Cekleniak NA, Ben-Ozer S, Meyer B, Damien
M, Grifo JA, Hershlag A, Munne S. Validation of array comparative
genome hybridization for diagnosis of translocations in preimplantation
human embryos. Reprod. Biomed. Online, 2012, 24, 621-629.
De Rycke M, Belva F, Goossens V, Moutou C, SenGupta SB, Traeger-
Synodinos J, Coonen E. ESHRE PGD Consortium data collection XIII:
cycles from January to December 2010 with pregnancy follow-up to
October 2011. Hum. Reprod. 2015, 30, 1763-1789.
De Vos A and Van Steirteghem A. Aspects of biopsy procedures prior to
preimplantation genetic diagnosis. Prenat. Diag., 2001, 21, 767-780.
Dumoulin JC, Bras M, Coonen E, Dreesen J, Geraedts JP, Evers JL. Effect of
Ca2+/Mg2+-free medium on the biopsy procedure for preimplantation
genetic diagnosis and further development of human embryos. Hum.
Reprod., 1998, 13, 2880-2883.
Eldar-Geva T, Srebnik N, Altarescu G, Varshaver I, Brooks B, Levy-Lahad E,
Bromiker R, Schimmel MS. Neonatal outcome after preimplantation
genetic diagnosis. Fertil. Steril., 2014, 102, 1016-1021.
Escudero T, Estop A, Fischer J, Munne S. Preimplantation genetic diagnosis
for complex chromosome rearrangements. Am. J. Med. Genet. A, 2008,
146A:1662-1669.
Fischer J, Colls P, Escudero T, Munne S. Preimplantation genetic diagnosis
(PGD) improves pregnancy outcome for translocation carriers with a
history of recurrent losses. Fertil. Steril., 2010, 94, 283-289.

Fiorentino, F, Spizzichino L, Bono S, Biricik A, Kokkali G, Rienzi L, Ubaldi

FM, Iammarrone E, Gordon A, Pantos A. PGD for reciprocal and
Robertsonian translocations using array comparative genomic
hybridization. Hum. Reprod., 2011, 26, 1925-1935.
Fiorentino F, Biricik A, Bono S, Spizzichino L, Cotroneo E, Cottone G,
Kokocinski F, Michel CE. Development and validation of a next-
generation sequencing-based protocol for 24-chromosome aneuploidy
screening of embryos. Fertil. Steril., 2014a, 101, 1375-1382.
Fiorentino F, Bono S, Biricik A, Nuccitelli A, Cotroneo E, Cottone G,
Kokocinski F, Michel CE, Minasi MG, Greco G. Application of next-
generation sequencing technology for comprehensive aneuploidy
screening of blastocysts in clinical preimplantation genetic screening
cycles. Hum. Reprod., 2014b, 29, 2802-2813.
Geber S, Bossi R, Lisboa CB, Valle M, Sampaio M. Laser confers less embryo
exposure than acid tyrode for embryo biopsy in preimplantation genetic
diagnosis cycles: a randomized study. Reprod. Biol. Endocrinol., 2011,
28, 58.
Giardino D, Corti C, Ballarati L, Finelli P, Valtorta C, Botta G, Giudici M,
Grosso E, Larizza L. Prenatal diagnosis of a de novo complex
chromosome rearrangement (CCR) mediated by six breakpoints, and a
review of 20 prenatally ascertained CCRs. Prenat. Diagn., 2006, 26, 565-
570.
Goldman AS and Hulten MA. Meiotic analysis by FISH of a human male
46,XY,t(15;20)(q11.2;q11.2) translocation heterozygote: quadrivalent
configuration, orientation and first meiotic segregation. Chromosoma,
1993, 102, 102-111.
Goossens V, De Rycke M, De Vos A, Staessen C, Michiels A, Verpoest W,
Van Steirteghem A, Bertrand C, Liebaers I, Devroey P, Sermon K.
Diagnostic efficiency, embryonic development and clinical outcome after
the biopsy of one or two blastomeres for preimplantation genetic
diagnosis. Hum. Reprod., 2008, 23, 481-492.
Gorski JL, Kistenmacher ML, Punnett HH, Zackai EH, Emanuel BS.
Reproductive risks for carriers of complex chromosome rearrangements:
analysis of 25 families. Am. J. Med. Genet., 1988, 29, 247-261.
Grace J, El-Toukhy T, Scriven P, Ogilvie C, Pickering S, Lashwood A, Flinter
F, Khalaf Y, Braude P. Three hundred and thirty cycles of preimplantation
genetic diagnosis for serious genetic disease: clinical considerations
affecting outcome. BJOG, 2006, 113, 1393-1401.

188 Chun Kyu Lim
Gui B, Yao Z, Li Y, Liu D, Liu N, Xia Y, Huang Y, Mei L, Ma R, Lu S, Liang

D, Wu L. Chromosomal analysis of blastocysts from balanced
chromosomal rearrangement carriers. Reprod., 2016, 151, 455-464.
Hamerton JL, Canning N, Ray M, Smith S. A cytogenetic survey of 14,069
newborn infants. I. Incidence of chromosome abnormalities. Clin. Genet.,
1975, 8, 223-243.
Handyside AH, Kontogianni EH, Hardy K, Winston RML. Pregnancies from
biopsied human preimplantation embryos sexed by Y-specific DNA
amplification. Nature, 1990, 344, 768-770.
Huang CC, Chang LJ, Tsai YY, Hung CC, Fang MY, Su YN, Chen HF, Chen
SU. A feasible strategy of preimplantation genetic diagnosis for carriers
with chromosomal translocation: Using blastocyst biopsy and array
comparative genomic hybridization. J. Formos. Med. Assoc., 2013, 112,
537-544.
Huang J, Yan L, Fan W, Zhao N, Zhang Y, Tang F, Xie XS, Qiao J.
Validation of multiple annealing and looping-based amplification cycle
sequencing for 24-chromosome aneuploidy screening of cleavage stage
embryos. Fertil. Steril. 2014, 102, 1685-1691.
Idowu D, Merrion K, Wemmer N, Mash JG, Pettersen B, Kijacic D, Lathi RB.
Pregnancy outcomes following 24-chromosome preimplantation genetic
diagnosis in couples with balanced reciprocal or Robertsonian
translocations. Fertil. Steril. 2015, 103, 1037-1042.
Jacobs PA, Melville M, Ratcliffe S, Keay AJ, Syme J. A cytogenetic survey of
11,680 newborn infants. Ann. Hum. Genet., 1974, 37, 359-376.
Jalbert P and Sele B. Factors predisposing to adjacent 2 and 3:1 disjunctions:
study of 161 human reciprocal translocations. Med. Genet., 1979, 16, 467-
478.
Jalbert P, Se’le B, Jalbert H. Reciprocal translocations: a way to predict the
mode of imbalanced segregation by pachytene-diagram drawing. A study
of 151 human translocations. Hum. Genet., 1980, 55, 209-222.
Jones AE, Wright G, Kort HI, Straub RJ, Nagy ZP. Comparison of laser-
assisted hatching and acidified Tyrode’s hatching by evaluation of
blastocyst development rates in sibling embryos: a prospective
randomized trial. Fertil. Steril., 2006, 85, 487-491.
Kausch K, Haaf T, Köhler J, Schmid M. Complex chromosomal
rearrangement in a woman with multiple miscarriages. Am. J. Med.
Genet., 1988, 31, 415-420.

Keymolen K, Staessen C, Verpoest W, Liebaers I, Bonduelle M.

Preimplantation genetic diagnosis in female and male carriers of
reciprocal translocations: clinical outcome until delivery of 312 cycles.
Eur. J. Hum. Genet., 2012, 20, 376-380.
Ko DS, Cho JW, Park SY, Kim JY, Koong MK, Song IO, Kang IS, Lim CK.
Clinical outcomes of preimplantation genetic diagnosis (PGD) and
analysis of meiotic segregation modes in reciprocal translocation carriers.
Am. J. Med. Genet. A. 2010, 152A, 1428-1433.
Ko, DS, JW Cho, HS Lee, JY Kim, IS Kang, KM Yang, CK Lim.
Preimplantation genetic diagnosis outcomes and meiotic segregation
analysis of robertsonian translocation carriers. Fertil. Steril., 2013, 99,
1369-1376.
Liao Y, Wang L, Zhang D, Liu C. Identification of a balanced complex
chromosomal rearrangement involving chromosomes 3, 18 and 21 with
recurrent abortion: case report. Mol. Cytogenet., 2014, 7, 39.
Lim CK, Jun JH, Min DM, Lee HS, Kim JY, Koong MK, Kang IS. Efficacy
and clinical outcome of preimplantation genetic diagnosis using FISH for
couples of reciprocal and Robertsonian translocations: the Korean
experience. Prenat. Diagn., 2004, 24, 556-561.
Lim CK, Cho JW, Song IO, Kang IS, Yoon YD, Jun JH. Estimation of
chromosomal imbalances in preimplantation embryos from
preimplantation genetic diagnosis cycles of reciprocal translocations with
or without acrocentric chromosomes. Fertil. Steril., 2008a, 90, 2144-2151.
Lim CK, Cho JW, Kim JY, Kang IS, Shim SH, Jun JH. A healthy live birth
after successful preimplantation genetic diagnosis for carriers of complex
chromosome rearrangements. Fertil. Steril., 2008b, 90, 1680-1684.
Loup V, Bernicot I, Janssens P, Hedon B, Hamamah S, Pellestor F, Anahory
T. Combined FISH and PRINS sperm analysis of complex chromosome
rearrangement t(1;19;13): an approach facilitating PGD. Mol. Hum.
Reprod., 2010, 16, 111-116.
Lukaszuk K, Pukszta S, Ochman K, Cybulska C, Liss J, Pastuszek E,
Zabielska J, Woclawek-Potocka I. Healthy Baby Born to a Robertsonian
Translocation Carrier following Next-Generation Sequencing-Based
Preimplantation Genetic Diagnosis: A Case Report. AJP Rep. 2015, 5,
e172-5.
Madan K, Nieuwint AWM, Van Bever Y. Recombination in a balanced
complex translocation of a mother leading to a balanced reciprocal
translocation in the child. Review of 60 cases of balanced complex
translocations. Hum. Genet., 1997, 99, 806-815.

190 Chun Kyu Lim
Martin RH and Hulten M. Chromosome complements in 695 sperm from three

men heterozygous for reciprocal translocations, and a review of the
literature. Hereditas, 1993, 118, 165-175.
Mau-Holzmann UA. Somatic chromosomal abnormalities in infertile men and
women. Cytogenet. Genome Res., 2005, 111, 317-336.
McArthur SJ, Leigh D, Marshall JT, DeBoer KA, Jansen RPS. Pregnancies
and live births after trophectodermbiopsy and preimplantation genetic
testing of human blastocysts. Fertil. Steril., 2005, 84, 1628-1636.
Miller K and Flatz SD. Segregation of two independent chromosome
translocations in one family. Hum. Genet., 1984, 68, 93-95.
Morel F, Roux C, Bresson JL. FISH analysis of the chromosomal status of
spermatozoa from three men with 45,XY,der(13;14)(q10;q10) karyotype.
Mol. Hum. Reprod. 2001, 7, 483-488.
Moutou C, Goossens V, Coonen E, De Rycke M, Kokkali G, Renwick P,
SenGupta SB, Vesela K, Traeger-Synodinos J. ESHRE PGD Consortium
data collection XII: cycles from January to December 2009 with
pregnancy follow-up to October 2010. Hum. Reprod., 2014, 29, 880-903.
Munne S, Morrison L, Fung J, Marquez C, Weier U, Bahce M, Sable D,
Grundfeld L, Schoolcraft B, Scott R, Cohen J. Spontaneous abortions are
reduced after preconception diagnosis of translocations. J. Assist. Reprod.
Genet. 1998, 15, 290-296.
Munne S, Sandalinas M, Escudero T, Fung J, Gianaroli L, Cohen J. Outcome
of preimplantation genetic diagnosis of translocations. Fertil. Steril.,
2000a, 73,1209-1218.
Munne S, Escudero T, Sandalinas M, Sable D, Cohen J. Gamete segregation in
female carriers of Robertsonian translocations. Cytogenet. Cell Genet.
2000b, 90, 303-308.
Munne S. Preimplantation genetic diagnosis of numerical and structural
chromosome abnormalities. Reprod. Biomed. Online, 2002, 4, 183-196.
Nielsen J and Wohlert M. Chromosome abnormalities found among 34,910
newborn children: results from a 13-year incidence study in Arhus,
Denmark. Hum. Genet., 1991, 87, 81-83.
Nussbaum RL, McInnes RR, Willard HF. (2016) Principles of Clinical
Cytogenetics and Genome Analysis. In: Nussbaum RL, McInnes RR,
Willard HF (8th Ed.). Thompson and Thompson genetics in medicine (57-
74), Philadelphia: Elsevier.

Oliver-Bonet M, Navarro J, Codina-Pascual M, Carrera M, Egozcue J, Benet

J. Meiotic segregation analysis in a t(4;8) carrier: Comparison of FISH
methods on sperm chromosome metaphases and interphase sperm nuclei.
Eur. J. Hum. Genet. 2001, 9, 395-403.
Otani T, Roche M, Mizuike M, Colls P, Escudero T, Munne S.
Preimplantation genetic diagnosis significantly improves the pregnancy
outcome of translocation carriers with a history of recurrent miscarriage
and unsuccessful pregnancies. Reprod. Biomed. Online, 2006, 13, 869-
874.
Pai GS, Thomas GH, Mahoney W, Migeon BR. Complex chromosome
rearrangements. Report of a new case and literature review. Clin. Genet.,
1980, 18, 436-444.
Pellestor F, Puechberty J, Weise A, Lefort G, Anahory T, Liehr T, Sarda P.
Meiotic segregation of complex reciprocal translocations: direct analysis
of the spermatozoa of a t(5;13;14) carrier. Fertil. Steril. 2011b, 95, 2433.
e17-22.
Pey R, Vial C, Schatten G, Hafner M. Increase of intracellular Ca2+ and
relocation of E-cadherin during experimental decompaction of mouse
embryos. Proc. Natl. Acad. Sci. US, 1998, 95, 12977-12982.
Pujol A, Benet J, Staessen C, Van Assche E, Campillo M, Egozcue J, Navarro
J. The importance of aneuploidy screening in reciprocal translocation
carriers. Reproduction 2006, 131, 1025-1035.
Rius M, Obradors A, Daina G, Ramos L, Pujol A, Martínez-Passarell O,
Marquès L, Oliver-Bonet M, Benet J, Navarro J. Detection of unbalanced
chromosome segregations in preimplantation genetic diagnosis of
translocations by short comparative genomic hibridization. Fertil. Steril.,
2011, 96, 134-142.
Ruiz C, Grubs RE, Jewett T, Cox-Jones K, Abruzzese E, Pettenati MJ, Rao
PN. Prenatally diagnosed de novo apparently balanced complex
chromosome rearrangements: two new cases and review of the literature.
Am. J. Med. Genet., 1996, 64, 478-484.
Saadallah N and Hulten M. A complex three breakpoint translocation
involving chromosome 2,4 and 9 identified by meiotic investigations of a
human male ascertained for subfertility. Hum. Genet., 1985, 71, 312-320.
Scriven PN, Handyside AH, Ogilvie CM. Chromosome translocations:
segregation modes and strategies for preimplantation genetic diagnosis.
Prenat. Diagn., 1998, 18, 1437-1449.

192 Chun Kyu Lim
Scriven PN, O’Mahony F, Bickerstaff H, Yeong CT, Braude P, Mackie

Ogilvie C. Clinical pregnancy following blastomere biopsy and PGD for a
reciprocal translocation carrier: analysis of meiotic outcomes and embryo
quality in two IVF cycles. Prenat. Diagn., 2000, 20, 587-592.
Scriven PN, Bint SM, Davies AF, Ogilvie CM. Meiotic outcomes of three-way
translocations ascertained in cleavage-stage embryos: refinement of
reproductive risks and implications for PGD. Eur. J. Hum. Genet., 2014,
22, 748-753.
Sefton M, Johnson MH, Clayton L, McConnell JM. Experimental
manipulations of compaction and their effects on the phosphorylation of
uvomorulin. Mol. Reprod. Dev., 1996, 44, 77-87.
Tan YQ, Tan K, Zhang SP, Gong F, Cheng DH, Xiong B, Lu CF, Tang XC,
Luo KL, Lin G, Lu GX. Single-nucleotide polymorphism microarray-
based preimplantation genetic diagnosis is likely to improve the clinical
outcome for translocation carriers. Hum. Reprod., 2013, 28, 2581-2592.
Tan Y, Yin X, Zhang S, Jiang H, Tan K, Li J, Xiong B, Gong F, Zhang C, Pan
X, Chen F, Chen S, Gong C, Lu C, Luo K, Gu Y, Zhang X, Wang W, Xu
X, Vajta G, Bolund L, Yang H, Lu G, Du Y, Lin G. Clinical outcome of
preimplantation genetic diagnosis and screening using next generation
sequencing. Gigascience, 2014, 4, 30.
Tobler KJ, Brezina PR, Benner AT, Du L, Xu X, Kearns WG. Two different
microarray technologies for preimplantation genetic diagnosis and
screening, due to reciprocal translocation imbalances, demonstrate
equivalent euploidy and clinical pregnancy rates. J. Assist. Reprod.
Genet., 2014, 31, 843-850.
Treff NR, Northrop LE, Kasabwala K, Su J, Levy B, Scott RT Jr. Single
nucleotide polymorphism microarray-based concurrent screening of 24-
chromosome aneuploidy and unbalanced translocations in preimplantation
human embryos. Fertil. Steril. 2011, 95, 1606-12.e1-2.
Van Assche E, Staessen C, Vegetti W, Bonduelle M, Vandervorst M, Van
Steirteghem A, Liebaers I. Preimplantation genetic diagnosis and sperm
analysis by fluorescence in-situ hybridization for the most common
reciprocal translocation t(11;22). Mol. Hum. Reprod., 1999, 5, 682-690.
Van Dyke DL, Weiss L, Roberson JR, Babu VR. The frequency and mutation
rate of balanced autosomal rearrangements in man estimated from prenatal
genetic studies for advanced maternal age. Am. J. Hum. Genet., 1983, 35,
301-308.

van Uum CM, Stevens SJ, Dreesen JC, Drüsedau M, Smeets HJ, Hollanders-
Crombach B, Die-Smulders CE, Geraedts JP, Engelen JJ, Coonen E. SNP
array-based copy number and genotype analyses for preimplantation
genetic diagnosis of human unbalanced translocations. Eur. J. Hum.
Genet. 2012, 20, 938-944.
Wells D and Delhanty JD. Comprehensive chromosomal analysis of human
preimplantation embryos using whole genome amplification and single
cell comparative genomic hybridization. Mol. Hum. Reprod., 2000, 6,
1055-1062.
Wells D, Kaur K, Grifo J, Glassner M, Taylor JC, Fragouli E, Munne S.
Clinical utilisation of a rapid low-pass whole genome sequencing
technique for the diagnosis of aneuploidy in human embryos prior to
implantation. J. Med. Genet., 2014, 51 553-562.
Xiong B, Tan K, Tan YQ, Gong F, Zhang SP, Lu CF, Luo KL, Lu GX, Lin G.
Using SNP array to identify aneuploidy and segmental imbalance in
translocation carriers. Genomics Data, 2014, 2, 92-95.
Ye Y, Qian Y, Xu C, Jin F. Meiotic segregation analysis of embryos from
reciprocal translocation carriers in PGD cycles. Reprod. Biomed. Online.
2012, 24, 83-90.
Zahed L, Der Kaloustian V, Batanian JR. Familial complex chromosome
rearrangement giving rise to balanced and unbalanced recombination
products. Am. J. Med. Genet., 1998, 79, 30-34.
BIOGRAPHICAL SKETCH
Lim, Chun Kyu
Affiliation: Laboratory of Reproductive Medicine, Cheil General Hospital

and Women’s Healthcare Center, Dankook University College of Medicine,
South Korea
Position Title: Associate Professor
Email: seungzzang@paran.com
Education:
Hanyang University, B.S., 1992, Biology

194 Chun Kyu Lim
Hanyang University, M.S., 1997, Reproductive Endocrinology

Hanyang University, Ph.D., 2008, Reproductive Endocrinology
Research and Professional Experience:
1995-2010 - Researcher, MIT, Lab. of Reproductive Medicine, Cheil General

Hospital and Women’s Healthcare Center
2010-2014 - Assistant Professor, Cheil General Hospital and Women’s
Healthcare Center, Kwandong University College of Medicine
2014-2015 - Associate Professor, Cheil General Hospital and Women’s
Healthcare Center, Catholic Kwandong University College of Medicine
2015-present - Associate Professor, Cheil General Hospital and Women’s
Healthcare Center, Dankook University College of Medicine
Publications:
[1] Lim CK, Jun JH, Min DM, Lee HS, Kim JY, Koong MK, Kang IS.
(2004) Efficacy and clinical outcome of preimplantation genetic
diagnosis using FISH for couples of reciprocal and Robertsonian
translocations: the Korean experience. Prenat. Diagn. 24(7), 556-561.
[2] Lee HS1, Choi HW, Lim CK, Koong MK, Kang IS, Yoo HW, Choi JH,
Jun JH. (2006) Identification of a novel single nucleotide polymorphism
of HADHA gene at a referred primer-binding site during pre-diagnostic
tests for preimplantation genetic diagnosis. J. Korean Med. Sci. 21(5),
794-799.
[3] Lee HS, Jun JH, Choi HW, Lim CK, Yoo HW, Koong MK, Kang IS.
(2007) Preimplantation genetic diagnosis for ornithine transcarbamylase
deficiency by simultaneous analysis of duplex-nested PCR and
fluorescence in situ hybridization: a case report. J. Korean Med. Sci. 22
(3), 572-576.
[4] Lim CK, Cho JW, Kim JY, Kang IS, Shim SH, Jun JH. (2008) A healthy
live birth after successful preimplantation genetic diagnosis for carriers
of complex chromosome rearrangements, Fertil. Steril. 90(5), 1680-
1684.
[5] Lim CK, Cho JW, Song IO, Kang IS, Yoon YD, Jun JH. (2008)
Estimation of chromosomal imbalances in preimplantation embryos
from preimplantation genetic diagnosis cycles of reciprocal
translocations with or without acrocentric chromosomes. Fertil. Steril.
90(6), 2144-2151.

[6] Lim CK, Kim SK, Ko DS, Cho JW, Jun JH, An SY, Han JH, Kim JH,
Yoon YD. (2009) Differential cytotoxic effects of mono-(2-ethylhexyl)
phthalate on blastomere-derived embryonic stem cells and
differentiating neurons. Toxicology 264(3), 145-154.
[7] Ko DS, Cho JW, Park SY, Kim JY, Koong MK, Song IO, Kang IS, Lim
CK. (2010) Clinical outcomes of preimplantation genetic diagnosis
(PGD) and analysis of meiotic segregation modes in reciprocal
translocation carriers. Am. J. Med. Genet. A. 152A(6), 1428-1433.
[8] Ko DS, Cho JW, Lee HS, Kim JY, Kang IS, Yang KM, Lim CK. (2013)
Preimplantation genetic diagnosis outcomes and meiotic segregation
analysis of robertsonian translocation carriers. Fertil. Steril. 99(5), 1369-
1376.
[9] Park YS, Kim MK, Lim CK, Lee SH, Park DW, Seo JT, Yang KM.
(2014) Efficacy of cryopreservation of embryos generated by
intracytoplasmic sperm injection with spermatozoa from frozen
testicular tissue. J. Assist. Reprod. Genet. 31(10), 1331-1336.
[10] Park YS, Lee SH, Lim CK, Cho JW, Yang KM, Seo JT. (2015) Effect of
testicular spermatozoa on embryo quality and pregnancy in patients with
non-obstructive azoospermia. Syst. Biol. Reprod. Med., 61(5), 300-306.

Chapter 6
A FAMILY-BASED ASSOCIATION STUDY

BETWEEN THE BDNF GENE
AND ATTENTION DEFICIT
HYPERACTIVITY DISORDER IN
MEXICAN CHILDREN
AND ADOLESCENTS
Alan López-López1, Miriam Margot Rivera-Angles1,

Carlos Alfonso Tovilla-Zárate2,, Roberto Molina-Solís1,
Araceli Valencia-Hernández1, Luis Gómez-Valencia1,
Thelma Beatriz González-Castro3, Isela E Juárez-Rojop4,
María Lilia López-Narváez5, Ana Fresan6
and Yazmin Hernández-Díaz3
*
Corresponding Author: Dr. Carlos Alfonso Tovilla Zárate, Universidad Juárez Autónoma de
Tabasco. División Académica Multidisciplinaria de Comalcalco, Ranchería Sur, Cuarta
Sección, C.P. 86650, Comalcalco, Tabasco, México. Phone 52 9933581500 ext. 6901,
Email: alfonso_tovillaz@yahoo.com.mx.

198 A. López-López, M. M. Rivera-Angles, C. A. Tovilla-Zárate et al.
1
Servicio de Citogenética, Hospital Regional de Alta Especialidad
“Dr. Rodolfo Nieto Padrón”. Villahermosa,
Tabasco, México
2
Universidad Juárez Autónoma de Tabasco, División Académica
Multidisciplinaria de Comalcalco, Comalcalco, Tabasco, México
3
División Académica Multidisciplinaria de Jalpa de Méndez;
Universidad Juárez Autónoma de Tabasco;
Jalpa de Méndez, Tabasco
4
Universidad Juárez Autónoma de Tabasco, División Académica de
Ciencias de la Salud, Villahermosa,
Tabasco, México
5
Hospital General de Yajalón. Secretaría de Salud, Yajalón,
Chiapas, México
6
Subdirección de Investigaciones Clínicas, Instituto Nacional de Psiquiatría
Ramón de la Fuente Muñiz, México, D. F., México
ABSTRACT
Aims: Attention deficit hyperactivity disorder (ADHD) is a
multifactorial psychiatric and neurobehavioral disorder. The brain-
derived neurotrophic factor gene (BDNF) has been proposed as a strong
candidate for this pathology. The aim of this study was to determine a
family-based association between three polymorphisms of the BDNF
gene and the ADHD in a Tabascan-Mexican population.
Methods: We analyzed the rs6265, rs12273363 and rs11030119
polymorphism of the BDNF gene through a family-based association
study. A total of 105 individuals grouped in family-trios (mother, father
and ADHD patient) were studied. Allelic and haplotypic transmission
were assessed through transmission disequilibrium test (TDT), using
HaploView software.
Results: No statistically significant association was observed
between the BDNF gene polymorphisms and the ADHD etiology in
Tabascan-Mexican families: rs6265 (χ2 = 1.33; p = 0.24); rs12273363 (χ2
= 1.33; p = 0.24); rs11030119 (χ2 = 0.66; p = 0.41). Furthermore, no
preference of transmission was observed for any of the haplotypes.
Conclusions: It was not possible to prove any association between
the BDNF gene polymorphic variants and ADHD in a Mexican
population. Future studies comprising larger samples are necessary to
determine the potential role of the BDNF gene in ADHD.

A Family-Based Association Study … 199
Keywords: gene; Brain Derived Neurotrophic Factor (BDNF); Mexican

population; Attention Deficit Hyperactivity Disorder (ADHD)
INTRODUCTION
Attention deficit hyperactivity disorder (ADHD) is one of the most
common neuropsychiatric diseases in infancy and adolescence, with a higher
frequency in men than women [1, 2]. Its world prevalence in the general
population is high 3.4% (IC del 95%, 2.6-4.5) [3] and affects between 2 to
10% children in school age [4], of whom according to recent reports [5, 6],
80% continue showing ADHD symptoms through ought their lives. The
frequency of its symptoms are catalogued as warning signs of this pathology
as they highly affect the social, educational and working contexts of these
individuals [7, 8]. There is genetic evidence that consistently supports the
polygenic nature of ADHD with a heritability estimated between 75% and
91% [9, 10]. In this context, different alterations in neurotransmission
pathways such as the dopaminergic [11], glutamatergic [12] and serotonergic
[13] have been associated to the etiology of ADHD [14, 15]. Due to its
contribution on the neural development, its role on the pharmacological action
and its function on the dopaminergic pathway, literature proposes that the
Brain Derived Neurotrophic Factor (BDNF) is a candidate gene that
participates in the ADHD pathogenesis [16]. The BDNF gene is located on
chromosome 11 at 11p14.1; at least 122 known polymorphisms have been
studied for this gene (snpper.chip.org/bio/find-gene). One of the most studied
polymorphisms is the Val66Met (G196A) [17], which has functional effects
over the intracellular traffic and the pro-BDNF protein secretion when a Val66
is substituted by Met66 (18). However, the relation between the Val66Met of
the BDNF and ADHD remains controversial because studies have shown
positive and negative associations [19-31]. It should be noted that the majority
of the studies about the BDNF as a candidate gene have been case-control
studies [23, 29-33]; only a few have evaluated the allele transmission in
families [27, 29, 34], which we consider is the main reason for the
inconclusive results obtained so far. Therefore, we decided to perform a
family-based association study with the aim of comparing the allele and
haplotypes transmission of the Val66Met BDNF polymorphism (rs6265) and
the presence of ADHD. The rs12273363 and rs11030119 polymorphisms were
also evaluated.

MATERIAL AND METHODS
Patients and Participants
The study comprised a total of 105 individuals of a Tabascan-Mexican

population, grouped in 35 family-trios. Of the 35 probands, 32 were men and 3
were women (average age 7.7 years; age range 4-14 years).
Ethic Considerations
Patients were recruited from the outpatient clinic of the Children High
Speciality Regional Hospital “Dr. Rodolfo Nieto Padrón” and the High
Speciality Regional Hospital “Dr. Gustavo A. Rovirosa Pérez” in
Villahermosa City of Tabasco State, Mexico. After receiving a verbal and
written explanation of the study objectives, all participants voluntarily
accepted to participate and their parents or legal guardians signed an informed
consent to authorize the research. The study was approved by the research and
bioethics committee of the Children High Speciality Regional Hospital “Dr.
Rodolfo Nieto Padrón”.
Clinical Evaluation
ADHD diagnosis was engaged by a child psychiatrist using diagnostic

criteria from the Diagnostic and Statistical Manual of Mental Disorders-Fifth
Edition (DSM-V), [35]. All individuals were assessed based on their
symptomatology and the information provided by the semi-structured
interviews with parents and teachers; only patients that met the DSM-V
criteria for ADHD were included in the study. Patients with another comorbid
psychiatric condition, patients whose parents belong to different ethnicities
and patients who refused the blood sample taking were excluded.
Genotyping Tests
The genomic DNA was obtained via the leukocytes extraction from
peripheral blood using the Qiagen N. V. protocol of DNA extraction and
purification (Puregene Blood Core Kit C, No. Cat. 15838). Three BDNF gene

polymorphisms were genotyped (rs6265 (Val66Met), rs12273363 and

rs11030119) through the PCR amplifying technique using TacMan® 5’ probe
assays of Applied Biosystems®. The primer sequences and their characteristics
to amplify the three polymorphisms (rs6265, rs12273363 and rs11030119) are
shown in Table 1. The fluorescence intensity was measured with the Applied
Biosystems® Fast Real-Time PCR Systems 7900HT equipment and the
genotypes were determined through allelic discrimination using the algorithm
provided by the manufacturer along with the ABI PRISM® 7900HT SDS
software version 2.4. A complete standardization was set following the
standards of the Laboratory of Psychiatric and Neurodegenerative Diseases at
the National Institute of Genomic Medicine (INMEGEN in Spanish) in
Mexico City. The genotyping was performed blind to the clinical condition of
the individuals.
Table 1. Main characteristics of the BDNF gene polymorphism

SNPs rs6265, rs12273363 and rs11030119
(Data obtained from Applied Biosystems®)
SNP ID Gene Location Sequence [VIC®/FAMTM] Polymorphism [VIC®/FAMTM]
TCCTCATCCAACAGCTCTTCTAT
BDNF- Chr.11:27 G/A Transition VIC: C
rs6265 CA[G/A]GTGTTCGAAAGTGTCA
AS 679916 and substitution FAM: T
GCCAATGAT
TTAAGTCACCACTCAGACTTTTC
rs110301 Chr.11:27 A/G Transition VIC: A
BDNF TC[A/G]TAGCAAAAGATCAGAT
19 728102 and substitution FAM: G
CTCACAACC
rs122733 TGAGGCACAGCGATGCTGCAGA
Chr.11:27 C/T Transition VIC: C
63 BNDF AGA[C/T]GGTGGATAGCTCTTAA
744859 and substitution FAM: T
GTTTCAGAC
Statistical Analysis
The Hardy-Weinberg equilibrium was ascertained using the Pearson’s Chi

square (χ2); all the genetic markers of parents and children genotyped were
verified using the same test. The family-based association analysis was
established using the Transmission Disequilibrium Test (TDT) [36], included
in the HaploView Statistic Program version 4.2 (available on:
www.broad.mit.edu/mpg/haploview) [37]; where the haplotypes were built for
all the markers and the linkage disequilibrium values were examined with a

Lewontin’s D’ minimum selected value of 0.08. The significance level was set
as p <0.05 with a 95% confidence interval (CI).
RESULTS
The TDT analysis results are shown in Table 2. No statistical significance
was observed for the Val(G) allele transmission (χ2 = 1.33; p = 0.24). Similar
results were seen for the other polymorphisms: rs11030119 (χ2 = 0.66; p =
0.41) and rs12273363 (χ2 = 1.33; p = 0.24). When the haplotypes analysis were
performed, five common haplotypes were observed; however, no statistically
significant differences were detected for any of the haplotype-blocks
transmission (Table 3).
Table 2. Allelic frequency and TDT analysis of the SNPs in

the BDNF gene
Lower
Transmitted
Polymorphism Alleles HW frequency T:NT Χ2 p value
allele
allele
Val66Met (rs6265) G: A 1.0 0.12 C 8: 4 1.33 0.24
rs11030119 G: A 0.3 0.17 G 4: 2 0.66 0.41
rs12273363 T: C 1.0 0.12 T 8: 4 1.33 0.24
T – Transmitted allele; NT – Non-Transmitted allele; HW – Hardy – Weinberg equilibrium;
p value – Probalilyty value for the hypothesis tes (level of significance p ˂0.05).
Table 3. Transmission haplotypes for the BDNF gene

in AHDH families
Haplotypes block 1 Frequency T:NT χ2 p value

CGT 0.700 17.0: 8.0 3.214 0.073
TGT 0.131 3.8: 8.5 1.826 0.176
CAC 0.112 3.0: 7.8 2.149 0.142
CAT 0.041 2.5: 2.7 0.009 0.922
CGC 0.011 0.3: 0.2 0.017 0.896
DISCUSSION
The objective of the present study was to evaluate the family-based
association between the rs6265, rs12273363 and rs11030119 polymorphisms

of the BDNF gene and attention deficit hyperactivity disorder in a Mexican

population. Initially, the allelic transmission analysis was performed and the
haplotypes analysis subsequently. In our population, no family-based
association was observed, as none of the alleles (of the three polymorphisms
studied) appeared to be over-transmitted from parents to probands. The result
of no association based on families was also observed when haplotypes were
analyzed. To our knowledge, this is the first study conducted in a Mexican
population that analyses the genetic association between the BDNF gene and
attention deficit hyperactivity disorder utilizing the transmission
disequilibrium test (TDT).
Previous family-based association studies show that there is correlation
between the BDNF gene and ADHD [23, 26, 30]; however, our results do not
evidence a family transmission of the Val66Met (rs6265) polymorphism.
Nevertheless, our results are similar to other studies [24, 25, 27-29, 31];
therefore, the rs6265 polymorphism role remains controversial. Furthermore,
there are at least four meta-analysis that have evaluated the relation between
the BDNF rs6265 polymorphism and ADHD and their evidence shows no
association [16, 18, 19, 38], two of them specifically evaluated cases and
controls [16, 18], while the other two included family-based studies as well as
case-control studies [19, 38].
Some differences can explain the wide variation of the results. First,
population ethnicities; so far, studies have been conducted on European and
Asian populations (Caucasian and Mongoloid); as a consequence, there is high
heterogeneity among the populations studied. As an example, the G/A alleles
frequency in the Mexican population has been described as 79% for the “G”
allele and 20% for the “A” allele. In the present study, the prevalence observed
for the “A” allele was lower than the previously reported (www.hapmam.org).
When other populations have been analyzed, the frequency for the “A” allele
can increased up to 61% as seen in Asian population; while the European
population shows this allele as the least frequent in a range around 19%.
Second, sample sizes of the studies that have used the TDT to analyze patients
with ADHD have been very different; for instance, our analysis included 35
families, another study with significant values used a sample of 64 families
[23], while reports with the largest samples have included 342 and 454
families [26, 29], respectively.
Finally, our “no association” observation was also seen in the haplotypes
analysis. Likewise, Lee et. at., (2007) did not observe any correlation of the
polymorphic variants rs2049046, rs6265 and rs11030104 in their sample (24);
however, they found the A-G-G haplotype as the most frequent in relation

with ADHD. On the other hand, Cho et. al., (2010) studied the re6265
polymorphisms and other molecular markers (rs11030101 and rs16917204)
and did not observe any possible risk related haplotype [31]. Overall, the
results of the aforementioned studies (including ours), do not show a group of
haplotypes involved in the ADHD pathogenesis.
Furthermore, there are just a few reports that have analyzed the
rs12273363 and rs11030119 polymorphisms in other neuropsychiatric diseases
[39-42]. To our knowledge, the present study is the first one to search for an
association between the BDNF polymorphisms and ADHD
(www.ncbi.nlm.nih.gov) in a Mexican population, though no association was
found with any of the three SNPs proposed.
We acknowledge some limitations in our research. First, the small sample
size made impossible to perform a sub-analysis by gender and also limits the
statistical power of our analyses. Second, we did not evaluate other variables
such as the severity of dominant-symptoms of the disorder. Therefore, the
negative results found in our study, are not necessarily a refutation of the
possible association between the BDNF gene and ADHD; the SNPs rs6265,
rs12273363 and rs11030119 should still be important for future analyses,
maybe for individual associations with ADHD symptoms.
There are also some strengths in our research: First, children with ADHD
were evaluated and diagnosed by a child psychiatrist. Second, the association
technique used in this research is more robust than the used in case-control
studies; family-based association gives more information and one of the
features of the transmission disequilibrium test is that it prevents possible
spurious associations [43, 44]. Finally, only individuals from Tabasco State
were included, which discards possible heterogeneity in the studied
population.
CONCLUSION
Our findings suggest no association between the BDNF gene polymorphic
variants and attention deficit hyperactivity disorder in a Mexican population.
However, to determine the potential role of the BDNF gene and the
development of ADHD we suggest that future studies comprise larger
samples.

ACKNOWLEDGMENTS
The authors thank to the outpatient clinic of the Children High Speciality
Regional Hospital “Dr. Rodolfo Nieto Padrón” and the High Speciality
Regional Hospital “Dr. Gustavo A. Rovirosa Pérez” who collaborated in the
recruitment of the patients.
FINANCIAL SUPPORT
None.
STATEMENT OF INTEREST
None.
ETHICAL STANDARDS
The authors assert that all procedures contributing to this work comply
with the ethical standards of the relevant national and institutional committees
on human experimentation and with the Helsinki Declaration of 1975 revised
in 2008.
REFERENCES
[1] Zulauf C. A., Sprich S. E., Safren S. A., Wilens T. E. The complicated
relationship between attention deficit/hyperactivity disorder and
substance use disorders. Current psychiatry reports. 2014;16(3):436.
[2] Thapar A., Cooper M. Attention deficit hyperactivity disorder. Lancet
(London, England). 2016;387(10024):1240-50.

[3] Polanczyk G. V., Salum G. A., Sugaya L. S., Caye A., Rohde L. A.
Annual research review: A meta-analysis of the worldwide prevalence of
mental disorders in children and adolescents. Journal of child
psychology and psychiatry, and allied disciplines. 2015;56(3):345-65.
[4] Hawi Z., Cummins T. D., Tong J., Johnson B., Lau R., Samarrai W., et
al. The molecular genetic architecture of attention deficit hyperactivity
disorder. Molecular psychiatry. 2015;20(3):289-97.
[5] Cheung C. H., Rijdijk F., McLoughlin G., Faraone S. V., Asherson P.,
Kuntsi J. Childhood predictors of adolescent and young adult outcome in
ADHD. Journal of psychiatric research. 2015;62:92-100.
[6] van Lieshout M., Luman M., Twisk J. W., van Ewijk H., Groenman A.
P., Thissen A. J., et al. A 6-year follow-up of a large European cohort of
children with attention-deficit/hyperactivity disorder-combined subtype:
outcomes in late adolescence and young adulthood. European child &
adolescent psychiatry. 2016.
[7] Cunill R., Castells X. [Attention deficit hyperactivity disorder].
Medicina clinica. 2015;144(8):370-5.
[8] Thapar A., Cooper M., Eyre O., Langley K. What have we learnt about
the causes of ADHD? Journal of child psychology and psychiatry, and
allied disciplines. 2013;54(1):3-16.
[9] Zhang L., Chang S., Li Z., Zhang K., Du Y., Ott J., et al. ADHDgene: a
genetic database for attention deficit hyperactivity disorder. Nucleic
acids research. 2012;40(Database issue):D1003-9.
[10] Akutagava-Martins G. C., Rohde L. A., Hutz M. H. Genetics of
attention-deficit/hyperactivity disorder: an update. Expert review of
neurotherapeutics. 2016;16(2):145-56.
[11] Hasler R., Salzmann A., Bolzan T., Zimmermann J., Baud P.,
Giannakopoulos P., et al. DAT1 and DRD4 genes involved in key
dimensions of adult ADHD. Neurological sciences : official journal of
the Italian Neurological Society and of the Italian Society of Clinical
Neurophysiology. 2015;36(6):861-9.
[12] Naaijen J., Bralten J., Faraone S., Glennon J., Franke B., Buitelaar J. P.
3.002 Glutamatergic and GABAergic gene-sets in ADHD: association to
overlapping traits in ADHD and autism. European
Neuropsychopharmacology. 2016;26:S47-S8.

[13] Thissen A. J., Bralten J., Rommelse N. N., Arias-Vasquez A., Greven C.
U., Heslenfeld D., et al. The role of age in association analyses of
ADHD and related neurocognitive functioning: A proof of concept for
dopaminergic and serotonergic genes. American journal of medical
genetics Part B, Neuropsychiatric genetics : the official publication of
the International Society of Psychiatric Genetics. 2015.
[14] Liu D. Y., Shen X. M., Yuan F. F., Guo O. Y., Zhong Y., Chen J. G., et
al. The Physiology of BDNF and Its Relationship with ADHD.
Molecular neurobiology. 2015;52(3):1467-76.
[15] Li Z., Chang S. H., Zhang L. Y., Gao L., Wang J. Molecular genetic
studies of ADHD and its candidate genes: a review. Psychiatry research.
2014;219(1):10-24.
[16] Lee Y. H., Song G. G. BDNF 196 G/A and COMT Val158Met
Polymorphisms and Susceptibility to ADHD: A Meta-Analysis. Journal
of attention disorders. 2015.
[17] Park S., Kim B. N., Kim J. W., Jung Y. K., Lee J., Shin M. S., et al. The
role of the brain-derived neurotrophic factor genotype and parenting in
early life in predicting externalizing and internalizing symptoms in
children with attention-deficit hyperactivity disorder. Behavioral and
brain functions: BBF. 2014;10:43.
[18] Sanchez-Mora C., Ribases M., Ramos-Quiroga J. A., Casas M., Bosch
R., Boreatti-Hummer A., et al. Meta-analysis of brain-derived
neurotrophic factor p.Val66Met in adult ADHD in four European
populations. American journal of medical genetics Part B,
Neuropsychiatric genetics : the official publication of the International
Society of Psychiatric Genetics. 2010;153b(2):512-23.
[19] Forero D. A., Arboleda G. H., Vasquez R., Arboleda H. Candidate genes
involved in neural plasticity and the risk for attention-deficit
hyperactivity disorder: a meta-analysis of 8 common variants. Journal of
psychiatry & neuroscience : JPN. 2009;34(5):361-6.
[20] Ribases M., Hervas A., Ramos-Quiroga J. A., Bosch R., Bielsa A.,
Gastaminza X., et al. Association study of 10 genes encoding
neurotrophic factors and their receptors in adult and child attention-
deficit/hyperactivity disorder. Biological psychiatry. 2008;63(10): 935-
45.

[21] Brookes K., Xu X., Chen W., Zhou K., Neale B., Lowe N., et al. The
analysis of 51 genes in DSM-IV combined type attention deficit
hyperactivity disorder: association signals in DRD4, DAT1 and 16 other
genes. Molecular psychiatry. 2006;11(10):934-53.
[22] Oades R. D., Lasky-Su J., Christiansen H., Faraone S. V., Sonuga-Barke
E. J., Banaschewski T., et al. The influence of serotonin- and other genes
on impulsive behavioral aggression and cognitive impulsivity in children
with attention-deficit/hyperactivity disorder (ADHD): Findings from a
family-based association test (FBAT) analysis. Behavioral and brain
functions : BBF. 2008;4:48.
[23] Lanktree M., Squassina A., Krinsky M., Strauss J., Jain U., Macciardi F,
et al. Association study of brain-derived neurotrophic factor (BDNF) and
LIN-7 homolog (LIN-7) genes with adult attention-deficit/hyperactivity
disorder. American journal of medical genetics Part B, Neuropsychiatric
genetics: the official publication of the International Society of
Psychiatric Genetics. 2008;147b(6):945-51.
[24] Lee J., Laurin N., Crosbie J., Ickowicz A., Pathare T., Malone M., et al.
Association study of the brain-derived neurotropic factor (BDNF) gene
in attention deficit hyperactivity disorder. American journal of medical
genetics Part B, Neuropsychiatric genetics: the official publication of
the International Society of Psychiatric Genetics. 2007;144b(8):976-81.
[25] Xu X., Mill J., Zhou K., Brookes K., Chen C. K., Asherson P. Family-
based association study between brain-derived neurotrophic factor gene
polymorphisms and attention deficit hyperactivity disorder in UK and
Taiwanese samples. American journal of medical genetics Part B,
Neuropsychiatric genetics : the official publication of the International
Society of Psychiatric Genetics. 2007;144b (1):83-6.
[26] Kent L., Green E., Hawi Z., Kirley A., Dudbridge F., Lowe N., et al.
Association of the paternally transmitted copy of common Valine allele
of the Val66Met polymorphism of the brain-derived neurotrophic factor
(BDNF) gene with susceptibility to ADHD. Molecular psychiatry.
2005;10(10):939-43.
[27] Tzang R. F., Hsu C. D., Liou Y. J., Hong C. J., Tsai S. J. Family-based
association of the brain-derived neurotrophic factor gene in attention-
deficit hyperactivity disorder. Psychiatric genetics. 2013;23(4):177-8.

[28] Schimmelmann B. G., Friedel S., Dempfle A., Warnke A., Lesch K. P.,
Walitza S., et al. No evidence for preferential transmission of common
valine allele of the Val66Met polymorphism of the brain-derived
neurotrophic factor gene (BDNF) in ADHD. Journal of neural
transmission (Vienna, Austria : 1996). 2007;114(4):523-6.
[29] Thakur G. A., Sengupta S. M., Grizenko N., Choudhry Z., Joober R.
Family-based association study of ADHD and genes increasing the risk
for smoking behaviours. Archives of disease in childhood.
2012;97(12):1027-33.
[30] Lanktree M., Muglia P., Squassina A., Krinsky M., Jain U., Macciardi F,
et al., editors. A potential role for brain derived neurotrophic factor
(BDNF) in adult ADHD. American Journal Of Medical Genetics Part B-
Neuropsychiatric Genetics; 2004: Wiley-Liss Div John Wiley & Sons
Inc, 111 River St, Hoboken, Nj 07030 Usa.
[31] Cho S. C., Kim H. W., Kim B. N., Kim J. W., Shin M. S., Chung S., et
al. Gender-specific association of the brain-derived neurotrophic factor
gene with attention-deficit/hyperactivity disorder. Psychiatry
investigation. 2010;7(4):285-90.
[32] Aureli A., Del Beato T., Sebastiani P., Marimpietri A., Melillo C. V.,
Sechi E., et al. Attention-deficit hyperactivity disorder and intellectual
disability: a study of association with brain-derived neurotrophic factor
gene polymorphisms. International journal of immunopathology and
pharmacology. 2010;23(3):873-80.
[33] Friedel S., Horro F. F., Wermter A. K., Geller F., Dempfle A.,
Reichwald K., et al. Mutation screen of the brain derived neurotrophic
factor gene (BDNF): identification of several genetic variants and
association studies in patients with obesity, eating disorders, and
attention-deficit/hyperactivity disorder. American journal of medical
genetics Part B, Neuropsychiatric genetics: the official publication of
the International Society of Psychiatric Genetics. 2005;132b(1):96-9.
[34] Mick E., Wozniak J., Wilens T. E., Biederman J., Faraone S. V. Family-
based association study of the BDNF, COMT and serotonin transporter
genes and DSM-IV bipolar-I disorder in children. BMC psychiatry.
2009;9:2.

[35] Association A. P., Association A. P. Diagnostic and statistical manual of

mental disorders (DSM). Washington, DC: American psychiatric
association. 1994:143-7.
[36] Spielman R. S., McGinnis R. E., Ewens W. J. Transmission test for
linkage disequilibrium: the insulin gene region and insulin-dependent
diabetes mellitus (IDDM). American journal of human genetics.
1993;52(3):506-16.
[37] Barrett J. C., Fry B., Maller J., Daly M. J. Haploview: analysis and
visualization of LD and haplotype maps. Bioinformatics.
2005;21(2):263-5.
[38] Gizer I. R., Ficks C., Waldman I. D. Candidate gene studies of ADHD: a
meta-analytic review. Human genetics. 2009;126(1):51-90.
[39] Ropret S., Zupanc T., Komel R., Videtic Paska A. Single nucleotide
polymorphisms in the BDNF gene and suicide in the Slovenian sample.
Neuroscience letters. 2015;602:12-6.
[40] Gao Y., Galante M., El-Mallakh J., Nurnberger J. I., Jr., Delamere N. A.,
Lei Z., et al. BDNF expression in lymphoblastoid cell lines carrying
BDNF SNPs associated with bipolar disorder. Psychiatric genetics.
2012;22(5):253-5.
[41] Mercader J. M., Ribases M., Gratacos M., Gonzalez J. R., Bayes M., de
Cid R., et al. Altered brain-derived neurotrophic factor blood levels and
gene variability are associated with anorexia and bulimia. Genes, brain,
and behavior. 2007;6(8):706-16.
[42] Driscoll I., Martin B., An Y., Maudsley S., Ferrucci L., Mattson M. P., et
al. Plasma BDNF is associated with age-related white matter atrophy but
not with cognitive function in older, non-demented adults. PloS one.
2012;7(4):e35217.
[43] Balding D. J., Bishop M., Cannings C. Handbook of statistical genetics:
John Wiley & Sons; 2008.
[44] Kapelski P., Skibinska M., Maciukiewicz M., Pawlak J., Permoda-Osip
A., Twarowska-Hauser J. Family-based association study of interleukin
6 (IL6) and its receptor (IL6R) functional polymorphisms in
schizophrenia in the Polish population. Journal of neuroimmunology.
2015;285:62-7.

INDEX
A B
acetylcholine, 122, 135 bacteria, 52, 54, 55, 57

acid, 20, 56, 57, 60, 187 biodegradation, 52, 56, 61
acrocentric chromosome, 177, 189, 194 bioethics, 200
adenocarcinoma, 132, 135 bioinformatics, 100
adhesion, 6, 8, 19, 20, 21, 34, 36, 49, 55 biological activities, 25
adolescents, 158, 161, 206 biological control, 3, 4, 6, 8, 15, 19, 23, 32,
adults, 17, 21, 40, 141, 146, 147, 152, 158, 42, 44, 45, 47
159, 161, 162, 166, 210 biomarkers, 111, 114, 115
age, 11, 92, 121, 123, 126, 134, 141, 143, biomass, 91
145, 146, 147, 148, 150, 151, 152, 154, biopsy, 172, 173, 174, 183, 185, 186, 187,
155, 156, 157, 166, 168, 192, 199, 200, 188, 192
207, 210 biosynthesis, 48
allele, 16, 89, 199, 202, 203, 208, 209 biotechnology, 57, 61
amino acid, 20, 21, 22, 28, 55, 70 biotic, 23, 27, 105
ancestors, viii, 64, 71, 74, 83, 93 bipolar disorder, 210
aneuploidy, 174, 176, 179, 185, 187, 188, births, x, 139, 140, 173, 185, 190
191, 192, 193 blood, 112, 200, 210
antioxidant, 52, 53, 54, 57, 58, 60 Bolivia, viii, 64, 66, 68, 74, 88, 90, 95
Argentina, viii, 64, 65, 66, 68, 74, 83, 88, bones, 66, 69
90, 95, 96, 98 BRAF, 118, 120, 126, 127, 133
arithmetic, 141, 142, 153 brain, vii, xiii, 141, 143, 156, 159, 163, 198,
at-risk populations, ix, x, 108, 109, 113 207, 208, 209, 210
attention deficit hyperactivity disorder brain derived neurotrophic factor (BDNF),
(ADHD), vi, xiii, 197, 198, 199, 200, vi, xiii, 197, 198, 199, 200, 201, 202,
203, 204, 205, 206, 207, 208, 209, 210 203, 204, 207, 208, 209, 210
autism, 159, 165, 206 brain functions, 207, 208
brain structure, 143

212 Index
Brazil, viii, 16, 64, 65, 66, 88, 95 cognitive development, 157
BRCA1/2, ix, 108, 121, 124, 125, 128, 130, cognitive function, 153, 210
136 cognitive level, x, 140, 153
breast cancer, 109, 114, 115, 116, 117, 119, cognitive process, 142, 144, 153
123, 124, 125, 130, 133, 134, 136 cognitive profile, x, 140, 141, 155, 163
cognitive science, 160
C cognitive skills, x, 139, 140, 141, 142, 145,
149
Ca2+, 172, 186, 191
cognitive slowing, 152
cancer, vii, ix, 108, 112, 113, 114, 115, 116,
collaboration, 121
117, 119, 120, 121, 122, 123, 124, 125,
Colombia, viii, 36, 63, 64, 65, 66, 67, 73,
126, 128, 129, 130, 131, 132, 133, 134,
74, 82, 83, 88, 90, 95, 98, 105
135, 136
colonization, 19, 21, 22, 29, 33, 34, 103
cancer care, 112, 120
colorectal cancer, ix, 108, 109, 113, 115,
cancer death, 115, 117
117, 119, 121, 126, 127, 128, 130, 133,
cancer screening, 123, 134, 135
134, 137, 138
carnivores, 87, 88, 91, 95, 97
community, 15, 24, 26, 47, 104, 110, 131
cascade screening, ix, x, 108, 109, 125
companion diagnostic, ix, 108, 115, 117,
CCR, xi, 170, 179, 180, 181, 182, 187
118, 119, 129, 130
CDC, 109, 116, 124, 125, 129, 134
complexity, x, 40, 114, 140, 141, 146, 167
cell line, 210
composition, 19, 44, 53, 58, 60
cell surface, 20
compounds, 7, 32, 61
cellulose, 28
consensus, 70, 118, 127, 137, 148
centromere, 174
conservation, 44, 45, 95, 100, 101
chemical, 31, 58, 112
correlation, 16, 21, 66, 103, 203
chemoprevention, x, 108
cost, ix, 108, 109, 110, 111, 112, 113, 114,
chemotherapeutic agent, 118
115, 116, 117, 118, 119, 120, 123, 125,
chemotherapy, 115, 117, 130, 134
127, 128, 129, 130, 133, 134, 136, 137
children, 141, 146, 153, 155, 156, 157, 158,
Costa Rica, 51, 98
159, 161, 162, 164, 166, 168, 190, 199,
cost-effectiveness, 109, 110, 111, 113, 114,
201, 204, 206, 207, 208, 209
115, 116, 117, 118, 119, 120, 123, 125,
China, 12, 18, 43, 92, 101
127, 128, 129, 130, 132, 133, 134, 136
chitin, 20, 28, 32, 38
counseling, 121, 124, 125, 136, 186
chitinase, 19, 20, 32, 33, 38
cryopreservation, 173, 195
chromosomal abnormalities, 179, 190
Cuba, 12
chromosome, vii, xi, xii, 112, 122, 123, 169,
culture, 9, 11, 16, 25, 34, 43, 56, 173
171, 173, 174, 176, 177, 179, 180, 181,
culture conditions, 43
182, 183, 184, 185, 186, 187, 188, 189,
culture medium, 9, 11, 34
190, 191, 192, 193, 194, 199
cuticle, 3, 6, 7, 19, 20, 21, 22, 29, 30, 31,
chromosome 7, x, 139, 140
32, 33, 34, 45
chromosome rearrangement, v, 169, 173,
cycles, xi, 69, 91, 170, 175, 177, 179, 180,
183
182, 184, 186, 187, 189, 190, 192, 193,
classification, 14, 23, 25, 37
194
clinical trials, ix, 108, 112, 113, 130
cystic fibrosis, ix, 100, 108
clusters, 11, 12, 26, 74, 77, 80, 83
cytochrome, 28, 32, 99, 103
cognitive abilities, 140, 141, 156, 161, 167

Index 213
D E
database, 14, 136, 206 eating disorders, 209

deficiency, 141, 153, 155, 156, 194 E-cadherin, 191
deficit, vii, xiii, 143, 144, 145, 149, 150, ecology, 5, 33, 37, 38, 42, 48
151, 152, 153, 165, 198, 199, 203, 204, ecosystem, 18, 24, 26
205, 206, 207, 208, 209 Ecuador, viii, 64, 66, 67, 74, 83, 88, 90, 95,
degradation, 7, 19, 20, 21, 33, 34 100
demographic change, 72, 85, 87 EGAPP Working Group, 117, 118, 126,
Denmark, 16, 18, 24, 26, 190 127, 133, 137
Department of Agriculture, 50 EGFR, 114, 115, 118, 119, 120, 121, 130,
Department of Health and Human Services, 133
126 Eira barbara, v, viii, 63, 64, 67, 69, 73, 77,
detection, ix, 14, 36, 45, 50, 108, 115 80, 81, 82, 83, 84, 85, 86, 91, 97, 98,
developmental disorder, 155, 156, 160 101, 102
diet, 65, 88 El Salvador, 51
dietary fiber, 53 electronic health record, 113, 126
disability, 158, 160, 161, 163, 168, 209 embryonic stem cells, 195
discrimination, 26, 143, 201 encoding, 21, 22, 25, 32, 55, 57, 148, 207
disease progression, 118 England, 96, 205
diseases, 3, 136, 199, 204 environmental factors, 131
disequilibrium, xiii, 198, 201, 203, 204, 210 environments, 2, 15, 16, 18, 26, 30, 34, 46,
disorder, vii, x, xiii, 125, 139, 155, 165, 91
198, 199, 203, 204, 205, 206, 207, 208, enzymatic activity, 21
209 enzymes, 3, 7, 14, 21, 25, 28, 48, 57
dispersion, 89 epidemiology, 134
dissociation, x, 139, 140, 141, 143, 145, epidermis, 6, 31
148, 149, 150, 151, 156, 162, 168 equilibrium, 201, 202
distribution, viii, 2, 17, 26, 42, 44, 71, 72, equipment, 31, 201
81, 86, 90, 102, 105 estrogen, 116, 124
divergence, 14, 41, 71, 74, 82, 83, 89, 90, ethical standards, 205
91, 94, 103 ethnicity, 109
diversification, 29, 31, 66, 90, 92, 94 etiology, xiii, 155, 168, 198, 199
diversity, vii, viii, 2, 15, 16, 17, 18, 19, 23, Eurasia, 91, 94
25, 26, 37, 39, 40, 43, 44, 45, 46, 47, 64, Europe, 95, 98, 102
66, 70, 73, 87, 88, 101, 102 European population, 100, 203, 207
DNA, 14, 15, 16, 24, 45, 46, 47, 66, 69, 70, evolution, v, vii, viii, 1, 2, 28, 29, 30, 31,
71, 99, 100, 104, 105, 137, 188, 200 37, 49, 66, 72, 96, 97, 98, 99, 100, 101,
DNA testing, 137 102, 103, 104, 105, 116
DOI, 35, 36, 38, 39, 40, 42, 43, 45, 46, 47, executive function, 141, 142, 145, 151, 152,
48, 49, 50, 52, 53, 54, 55, 57, 58, 59, 60, 153, 158, 161, 165
103 executive functions, 141, 142, 145, 152,
down syndrome, 155, 157, 158, 160, 161, 153, 158, 165
163, 165, 167 exposure, 114, 123, 187
DRD4 gene, 206 extraction, 52, 55, 60, 105, 200

214 Index
extrusion, 19, 20, 34 gene expression, 43, 116, 133

eye movement, 145, 159 gene transfer, 30
genetic alteration, 114
F genetic association, 114, 122, 132, 203
genetic disease, 140, 187
family history, ix, 108, 115, 121, 123, 124,
genetic diversity, vii, viii, 15, 16, 17, 18, 25,
125, 127, 135
26, 39, 46, 64, 66, 70, 73, 87, 88, 102
family members, 124, 125, 127
genetic engineering, 32
family-based association study, xiii, 198,
genetic factors, 181
199
genetic marker, 15, 19, 201
fauna, 95, 97, 101, 104
genetic screening, 127, 136, 173, 187
FDA, 115, 118
genetic syndrome, 140, 168
fermentation, 52, 54, 55, 56, 57, 60, 61
genetic testing, viii, ix, x, 107, 108, 109,
fertilization, xii, 171
118, 121, 124, 125, 126, 127, 129, 130,
fluorescence, xii, 20, 116, 171, 185, 192,
136, 137, 190
194, 201
genome, 28, 30, 32, 34, 49, 88, 110, 122,
fMRI, 162
135, 186, 193
food, 5, 32, 48, 54, 56, 57, 59, 100
genomics, 131, 132, 135, 136, 137, 138
food habits, 100
genotype, 18, 26, 45, 111, 160, 193, 207
food industry, 56
genotyping, ix, 16, 26, 54, 108, 118, 119,
food products, 57
133, 201
formation, 3, 7, 21, 90, 92, 93, 94, 100, 123,
genus, 23, 47, 92, 94, 95, 103
142
geographical origin, 16, 27, 39, 74
fragments, 15, 19, 25, 70, 105
Germany, 118, 133
France, 3, 35, 139
germination, 6, 7, 8, 19, 20, 34, 49
frontal lobe, 145, 152
germline mutations, 123, 127, 130
fungal infection, 3, 4, 6, 7, 9, 10
gestation, 176, 178
fungi, vii, 2, 3, 4, 5, 6, 8, 9, 10, 14, 15, 16,
19, 20, 21, 22, 23, 24, 25, 27, 28, 29, 30, H
31, 33, 34, 35, 36, 37, 40, 41, 42, 44, 45,
46, 47, 48, 49, 50, 55, 61 habitats, 25, 44, 65, 88, 91
fungus, viii, 2, 3, 6, 7, 9, 10, 11, 12, 13, 16, haplotypes, viii, xiii, 17, 64, 71, 73, 81, 82,
17, 21, 22, 23, 25, 27, 28, 30, 32, 35, 36, 83, 89, 94, 198, 199, 201, 202, 203
38, 39, 42, 43, 44, 45, 46, 47, 48, 49, 50 health, ix, x, 108, 109, 110, 112, 113, 121,
fusion, 20, 32, 33, 38, 112, 114, 132, 177 123, 124, 125, 126, 128, 130, 131, 133,
134, 135, 136
G HER2, 114, 116, 119, 124, 133
hereditary breast and ovarian cancer, ix,
gene, vii, viii, xiii, 14, 15, 16, 17, 18, 19, 20,
108, 121, 124, 137
21, 22, 23, 24, 25, 27, 28, 29, 30, 31, 32,
hereditary nonpolyposis colorectal cancer,
33, 34, 41, 43, 46, 49, 55, 57, 64, 66, 67,
ix, 108, 121, 126
69, 71, 72, 73, 82, 84, 85, 86, 88, 89, 91,
heterogeneity, vii, x, 72, 83, 84, 88, 140,
98, 101, 102, 104, 112, 114, 116, 118,
141, 142, 153, 154, 155, 162, 165, 203,
119, 122, 126, 127, 128, 130, 133, 158,
204
194, 198, 199, 200, 201, 202, 203, 204,
heterozygote, 187
206, 208, 209, 210

Index 215
history, 30, 66, 87, 99, 100, 104, 121, 123,

124, 125, 126, 128, 135, 136, 173, 186,
K
191
karyotype, 174, 178, 180, 190
homologous chromosomes, xi, xii, 169, 171,
KRAS, 115, 118, 119, 120, 121, 130, 133,
174
134
host, 2, 3, 5, 7, 8, 12, 16, 18, 19, 21, 22, 25,
27, 29, 30, 31, 34, 36, 39, 41, 42, 43, 44, L
48, 49, 130
HPC, 104 language development, 145, 147, 162, 164
human, 42, 65, 109, 114, 131, 144, 176, language skills, 141, 143, 145, 148
179, 184, 185, 186, 187, 188, 190, 191, larvae, 10, 17, 20, 21, 22, 23, 30, 32, 39
192, 193, 205, 210 Latin America, 104
human body, 109 lead, 33, 118, 123, 125, 129, 150
human genome, 109, 131 learning, x, 140, 142, 148, 150, 153, 155,
humidity, 8, 17, 95 156, 160, 164, 166
hybridization, xii, 90, 171, 185, 186, 187, learning behavior, 142
188, 192, 193 learning difficulties, 150, 153
hyperactivity, vii, xiii, 152, 155, 165, 198, Lepidoptera, 9, 11, 12
199, 203, 204, 205, 206, 207, 208, 209 leukemia, 111, 132
hypersensitivity, 154, 155 leukocytes, 200
hypothesis, 104, 166, 202 light, 11, 12, 13, 81
lipases, 7, 30, 31
I
localization, 21, 36, 144, 149
loci, 16, 17, 18, 45, 46, 54
identification, viii, 2, 35, 40, 47, 96, 125,
longitudinal study, 142, 162, 167
127, 146, 149, 209
long-term memory, 148, 150
imbalances, 189, 192, 194
lung cancer, 109, 113, 114, 115, 119, 122,
immune response, 19, 22, 34, 43
123, 124, 128, 130, 132, 135
immune system, vii, viii, 2
Luo, 21, 38, 43, 45, 192, 193
immunohistochemistry, 116, 134
Lynch syndrome, ix, 108, 109, 120, 121,
immunotherapy, 132
126, 128, 137, 138
impairments, 159, 165
in situ hybridization, xii, 116, 171, 185, 194 M
in transition, 116
in vitro, xii, 31, 33, 40, 58, 60, 171, 185 mammals, 98, 99, 100, 105
in vivo, 22, 31 mathematics, 153, 158
India, 16, 45, 62 medical, ix, 108, 109, 110, 111, 112, 113,
infection, 3, 6, 7, 8, 19, 21, 22, 28, 31, 34, 121, 126, 127, 129, 130, 159, 162, 207,
39, 43 208, 209
inhibition, x, 52, 115, 140, 151, 152, 153, medicine, ix, 108, 109, 110, 111, 112, 113,
158, 159, 162 114, 116, 119, 120, 121, 123, 131, 132,
insects, vii, 2, 4, 6, 7, 9, 10, 12, 16, 20, 21, 134, 135, 166, 167, 168, 190
22, 23, 29, 30, 31, 32, 37, 40, 44, 48, 49, Mediterranean, 39, 102
65, 88 meiosis, xi, xii, 169, 171, 174, 177, 180,
intellectual disabilities, 157, 161, 166 182
isolation, 2, 8, 9, 30, 90

216 Index
memory, x, 140, 141, 142, 148, 149, 150, neuroscience, 157, 160, 162, 163, 164, 165,
151, 152, 153, 154, 155, 157, 158, 160, 167, 207
164, 166, 168 nicotine, 122, 123, 135
memory performance, 150 non-small cell lung cancer, 113
mental ability, 149 North America, 44, 91, 92, 93, 95, 96, 99,
mental age, 143, 144, 145, 146, 147, 148, 105
149, 150, 151, 152, 155 nuclear genome, 70, 96
mental disorder, 206, 210 nuclei, 13, 185, 191
meta-analysis, 116, 203, 206, 207 nucleotide sequence, 99, 103
metabolites, 22, 25, 28, 30, 31, 56, 112
metastatic lung cancer, 115
O
methodology, 111, 120, 126
Oncotype DX, 116, 117, 133
Mexican population, xiii, 198, 199, 203, 204
ovarian cancer, ix, 108, 121, 124, 125, 126,
Mexico, 1, 13, 34, 51, 55, 62, 65, 95, 200,
128, 136, 137
201
Mg2+, 172, 186 P
microorganisms, 2, 3, 14, 53, 112
MINDACT trial, 117 Panama, viii, 64, 66, 67, 73, 93, 95
Miocene, viii, 64, 74, 83, 89, 90, 91, 93, 94, Paraguay, viii, 64, 66, 68, 88, 95
96, 98, 99, 100, 105 parietal lobe, 141, 151, 153
miscarriage, 173, 178, 180, 183, 191 participants, 112, 122, 123, 130, 142, 152,
mitochondrial DNA, 24, 70, 97 156, 200
mitochondrial ND5 gene, 64, 69, 77, 80, 81, pathogenesis, 29, 31, 32, 33, 43, 50, 199,
86, 87 204
MLT, 70, 73, 74 pathogenicity, 2, 21, 28, 29, 30, 32, 40, 42,
molecular biology, 42 47, 49
molecular mass, 20, 22 pathogens, 8, 28, 30, 33, 46
morphology, 23, 26, 158, 166, 185 pathology, xiii, 5, 48, 198, 199
mortality, ix, 17, 21, 22, 107, 110, 133, 137 pathway, 20, 61, 133, 199
MRI, 125, 165 PCR, 14, 22, 24, 25, 27, 36, 43, 46, 49, 54,
mtDNA, 70, 105 69, 105, 115, 201
mutation, 21, 70, 71, 100, 104, 115, 118, personalized medicine, 112, 120
121, 124, 125, 127, 136, 192 Peru, viii, 64, 65, 66, 68, 74, 82, 83, 88, 90,
mutation rate, 71, 192 91, 94, 95
mutational analysis, 133 pests, 3, 8, 23, 31, 32, 47
mycelium, 5, 7, 10, 11, 12 PGD, v, xi, xii, 169, 170, 171, 172, 173,
174, 175, 177, 178, 179, 180, 181, 182,
N
183, 184, 185, 186, 187, 189, 190, 192,
193, 195
neurodevelopmental disorders, 156, 166
pharmacogenomics, 109, 110, 113, 114,
neuroimaging, 144, 145, 152, 158
115, 116, 119, 122, 132
neuropsychological profile, vii, x, 139, 140,
phenotype, 152, 153, 157, 160, 162, 163,
141, 153, 164, 165, 168
167, 180
neuropsychology, 158, 159, 161, 163, 165,
phosphate, 20, 21, 36, 55
167, 168
phylogenetic tree, 19, 73, 81, 85

Index 217
phylogeny, viii, 2, 25, 26, 33, 35, 36, 46, 57, putative geographical subspecies, 64, 81
98, 100, 104
phylogeography, 64, 103
Q
physicians, 126
quality-adjusted life-year, 114, 120, 128
plants, viii, 2, 4, 14, 49, 52, 55
quantification, 54
Pliocene, viii, 64, 83, 89, 90, 91, 93, 94, 105
questionnaire, 155
polar body, 172, 173, 183
polymorphism, xiii, 15, 17, 19, 100, 104, R
192, 194, 198, 199, 201, 203, 208, 209
population, vii, viii, ix, x, xiii, 15, 17, 19, race, 109, 136
23, 38, 39, 64, 66, 72, 83, 85, 86, 87, 89, radiation, 8, 99, 105, 117
95, 96, 98, 99, 101, 102, 103, 104, 108, rain forest, 65, 88, 98
109, 110, 113, 121, 122, 124, 125, 126, reading, 142, 153, 157, 158, 161
127, 128, 131, 132, 136, 180, 198, 199, reading skills, 142
200, 203, 204, 210 receptor, 114, 116, 122, 130, 135, 210
population control, 122 reciprocal translocation, xi, 170, 174, 175,
population expansion during the 176, 177, 180, 181, 185, 188, 189, 190,
Pleistocene, 64, 86, 87 191, 192, 193, 194, 195
population growth, 98, 101 recognition, 143, 144, 148, 149, 150, 161,
population health, 113 164
population size, 23, 72, 87, 125 relatives, x, 108, 121, 123, 124, 125, 126,
population structure, 15, 19, 39, 96 127, 137
precision medicine, ix, 108, 109, 110, 111, researchers, 111, 113, 123
112, 113, 114, 116, 119, 120, 121, 123, resolution, 19, 24, 26, 165
131, 132, 134 resources, x, 26, 109, 129
precision public health, ix, 108, 121, 126, response, 4, 21, 22, 27, 30, 32, 44, 49, 118,
129 162
pregnancy, xi, 170, 173, 174, 175, 177, 178, restriction fragment length polymorphis, 24
179, 180, 181, 182, 183, 186, 190, 191, Rhizopus, 3, 4
192, 195 ribosomal RNA, 24, 27, 49
preimplantation genetic diagnosis (PGD), v, risk, x, xi, xii, 108, 116, 117, 118, 122, 123,
xi, xii, 169, 170, 171, 172, 173, 174, 175, 124, 125, 126, 127, 129, 130, 135, 136,
177, 178, 179, 180, 181, 182, 183, 184, 164, 169, 171, 174, 176, 177, 180, 204,
185, 186, 187, 189, 190, 192, 193, 195 207, 209
prevention, ix, x, 108, 109, 113, 122, 124, risk assessment, 123, 124, 125, 126, 127,
129, 130, 131, 135, 136, 180 129, 136
proteins, 28, 30, 31, 32, 34, 37, 49, 59 RNA, 14
psychiatry, 159, 160, 162, 163, 165, 167, Robertsonian translocation, xi, 170, 177,
168, 205, 206, 207, 208, 209 178, 180, 181, 186, 187, 188, 189, 190,
psychology, 159, 160, 162, 163, 164, 165, 194
167, 206
psychopathology, 157 S
public health, ix, 108, 109, 110, 113, 116,
121, 123, 124, 126, 127, 128, 129, 130, science, 157, 159, 161, 164, 166
131, 134, 135, 136, 137 secondary prevention, ix, 108, 113

218 Index
segregation, xi, 170, 174, 176, 177, 178, 143, 144, 145, 146, 147, 148, 149, 150,
180, 181, 182, 186, 187, 188, 189, 190, 151, 152, 153, 154, 155, 156, 157, 158,
191, 193, 195 159, 160, 161, 162, 163, 164, 165, 166,
selective estrogen receptor modulator, 116 167, 168, 186
semantics, 146, 147, 154, 161 synthesis, 120
sequencing, xiii, 24, 27, 49, 132, 171, 187,
188, 192, 193
T
serotonin, 208, 209
Tabascan-Mexican population, vii, xiii, 198,
sex, 52
200
sexuality, 29
taxa, viii, 14, 23, 35, 64, 71, 73, 83, 85, 89,
short-term memory, x, 139, 148, 149, 150,
90, 91, 103, 104
153, 156, 160, 161, 162
taxonomy, 23, 26, 41, 42
sickle cell, ix, 108
Tayra, v, 63, 64, 65, 85, 88, 90, 94, 98
side effects, ix, 108, 184
techniques, 14, 15, 24, 122, 173, 175, 178,
smoking, 122, 130, 135, 209
181, 183, 184
SNP, xii, 122, 170, 175, 178, 183, 193, 201
technologies, 116, 131, 192
software, xiii, 70, 71, 72, 100, 101, 198, 201
temperature, 8, 15, 94
South America, viii, 64, 65, 66, 70, 73, 81,
temporal lobe, 145, 152, 155
82, 83, 84, 85, 88, 89, 90, 92, 93, 94, 97,
tertiary prevention, ix, 108, 113, 130
98, 101, 102, 104, 105
testing, ix, x, 41, 104, 108, 114, 115, 117,
South Korea, 169, 193
118, 120, 121, 124, 125, 126, 127, 128,
species, vii, viii, 2, 3, 5, 8, 11, 12, 13, 14,
130, 132, 133, 134, 136, 137
15, 16, 17, 18, 19, 23, 24, 26, 27, 28, 29,
therapy, 110, 115, 116, 117, 118, 120, 130,
30, 31, 34, 35, 39, 41, 42, 43, 44, 45, 64,
133, 134
65, 66, 82, 86, 87, 88, 90, 91, 93, 94, 95,
toddlers, 161, 163, 164, 166
96, 100, 102, 103
toxicity, 118, 119
speech, x, 140, 142, 145, 146, 157, 161,
toxin, 20, 31, 42, 43
164, 166, 167
training, 50, 51, 126
speech perception, 167
trajectory, 145, 156, 167
speech sounds, x, 140, 142, 145, 157, 166
translational research, x, 109, 110
spelling, 142, 153
translocation, xi, xii, 111, 170, 171, 174,
sperm, 185, 189, 190, 191, 192, 195
176, 177, 178, 179, 180, 181, 183, 185,
spontaneous abortion, 180
186, 187, 188, 189, 191, 192, 193, 195
spore, 7, 8, 20, 21, 45, 50
transmission, xiii, 8, 198, 199, 202, 203,
standard deviation, 84, 85
204, 209
statistics, 70, 72, 84, 85, 132, 133
treatment, vii, 22, 111, 112, 114, 115, 116,
substance use disorders, 205
119, 120, 121, 131, 132, 133, 156
subtropical forests, 65, 88
trial, ix, 108, 117, 121, 188
surveillance, ix, 108, 136
Trinidad, 66, 67, 95
survival rate, 112, 114
Trinidad and Tobago, 66
susceptibility, 7, 122, 124, 135, 208
tumor, ix, 108, 116, 119, 125, 133
Switzerland, 25, 44
tumor growth, 116
symptoms, 7, 9, 10, 199, 204, 207
tyrosine, 112, 114, 119
syndrome, v, vii, ix, x, 108, 109, 120, 121,
126, 128, 137, 138, 139, 140, 141, 142,

Index 219
warfarin, 111, 112, 121

U Williams syndrome (WS), v, vii, x, 139,
140, 141, 142, 143, 144, 145, 146, 147,
United States, 12, 50, 101, 133
148, 149, 150, 151, 152, 153, 154, 155,
V 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168, 186
Val66Met BDNF polymorphism, 199 working memory, x, 140, 148, 149, 153,
Valencia, vi, vii, 100, 197 155, 156, 157, 165, 166, 168
validation, 46, 133, 187 worldwide, xii, 6, 23, 25, 31, 32, 37, 170,
Venezuela, viii, 64, 88 171, 206
vertebrates, 65, 88
Y
virulence, viii, 2, 17, 19, 20, 21, 22, 28, 29,
30, 31, 32, 33, 34, 38, 40, 45, 46, 47, 48,
Yale University, 104, 105
49
vocabulary, 145, 146, 147, 154, 155, 160, Z
163
vulnerability, 156 zoology, 41
WAIS, 142

Advances in Genetics Research Vol 17

Transféré par

Informations du document

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Advances in Genetics Research Vol 17

Transféré par

Droits d'auteur :

Formats disponibles

Complimentary Contributor Copy

Complimentary Contributor Copy

Additional books in this series can be found on Nova’s website

Additional e-books in this series can be found on Nova’s website

Complimentary Contributor Copy

Complimentary Contributor Copy

NOTICE TO THE READER

Library of Congress Cataloging-in-Publication Data

Published by Nova Science Publishers, Inc. † New York

Complimentary Contributor Copy

Complimentary Contributor Copy

Chapter 6 A Family-Based Association Study Between the BDNF

Complimentary Contributor Copy

A.Garcia, M. Michel, S. Villarreal, F. Castillo, E. Osorio, M.T. García-

Complimentary Contributor Copy

Complimentary Contributor Copy

mortality have accrued to individuals tested for more prevalent genetic

Complimentary Contributor Copy

from predictive testing and cancer monitoring of the at-risk population, to

Complimentary Contributor Copy

Chapter 5 - Chromosome rearrangements are the most common genetic

Complimentary Contributor Copy

balanced. At present, PGD that diagnose all 24 chromosomes using array-

Complimentary Contributor Copy

generation sequencing (NGS) is widely applied nowadays. The only

Complimentary Contributor Copy

GENETICS AND EVOLUTION

A. Garcia2, M. Michel1, S. Villarreal1, F. Castillo3,

Complimentary Contributor Copy

Keywords: isolation, identification, diversity, virulence, pathogenicity,

ENTOMOPATHOGENS ROLE IN NATURE

Complimentary Contributor Copy

susceptible guests, rather than having to be ingested to initiate infection (Cory

Entomopathogenic fungi are a large group of microorganisms which

Complimentary Contributor Copy

entomopathogenic fungi as biopesticide (Visalakshy et al., 2005). Several

Table 1. Entomopathogenic fungi used in biological control

Plants Manipulate Fungal Entomopathogens

There is scientific evidence that plants can influence behavior of certain

Complimentary Contributor Copy

The Ecology of Fungal Entomopathogens in the

The ecology of fungal entomopathogens in the rhizosphere is an

ENTOMOPATHOGENIC FUNGI AND THEIR

According to Tellez et al., (1999), more than 750 species of

Complimentary Contributor Copy

worldwide for biological control of insects are, Metarhizium anisopliae

Entomopathogenic fungi act by contact through the cuticle, as they are

Figure 1. Scheme of entomopathogenic fungal infection procces to a suceptible insect.

Adhesion and Germination

The adhesin is a molecule produced by the fungus with adherent property

Complimentary Contributor Copy

recognized by specific receptors of glycoprotein nature. Once bound to the

This process is achieved through the penetration tube (hyphae) by

Reproduction and Replication

Complimentary Contributor Copy

ISOLATION OF ENTOMOPATHOGENIC FUNGI

Isolation by Serial Dilution

This method involves placing a mycosed insect in a vessel containing 10

Complimentary Contributor Copy

to be stirred for 1 minute to release conidia insect body. As a result, there is

Direct Isolation of Entomopathogenic Fungi from

For direct isolation, it is necessary to monitor the culture of interest. For

Isolation of Entomopathogenic Fungi from Soil

Insect trap technique which use in most cases Galleria mellonella