Basic Research—Technology
Anti-inflammatory and Osteogenic Effects of
Calcium Silicate–based Root Canal Sealers
Bin-Na Lee, DDS, MSD, PhD,* Ji-Uk Hong, DDS, MSD,* Se-Min Kim, DDS, MSD, PhD,*
Ji-Hyun Jang, DDS, MSD, PhD,† Hoon-Sang Chang, DDS, MSD, PhD,*
Yun-Chan Hwang, DDS, MSD, PhD,*‡ In-Nam Hwang, DDS, MSD, PhD,* and
Won-Mann Oh, DDS, MSD, PhD*
Abstract
Introduction: An ideal root canal sealer creates a
bacteria-resistant seal and exhibits antimicrobial activ-
ity, biocompatibility, and osteoconductivity. The aim of
this study was to assess the effects of 3 root canal
sealers on cell viability, inflammatory response, and
osteogenic potential in MC3T3-E1 cells. Methods: AH
Plus (Dentsply Caulk, Milford, DE), MTA Fillapex
(Angelus Solucxoes Odontologicas, Londrina, Brazil),
and EndoSequence BC (Brasseler, Savannah, GA)
were mixed according to the manufacturer’s instruc-
tions, and samples were prepared as extraction media
(final dilution: 1/10). Lipopolysaccharide (LPS)
(100 ng/mL) treatment was used to induce an inflam-
matory response in this study. Cell viability was eval-
uated using the Water soluble tetrazolium-1 (WST-1)
assay. The levels of inflammatory mediators (inter-
leukin 6 and tumor necrosis factor alpha) and osteo-
genic marker genes (ALP and OCN) were measured
by reverse-transcription polymerase chain reaction
and real-time polymerase chain reaction. Osteogenic
potential was evaluated by alkaline phosphatase
staining and alizarin red staining. Results: Calcium
silicate–based sealers such as MTA Fillapex and Endo-
Sequence BC showed strong cell viability compared
with AH Plus. AH Plus, MTA Fillapex, and EndoSe-
quence BC decreased the levels of LPS-induced inflam-
matory mediators (P < .05). The expression of
osteogenic marker genes, alkaline phosphatase activ-
ity, and mineralized nodule formation decreased with
LPS treatment. However, AH Plus and calcium silicate–
based sealers increased the osteogenic potential
reduced by LPS treatment (P < .05). Conclusions: Cal-
cium silicate–based sealers exhibit anti-inflammatory
effects and induce osteogenic differentiation in
MC3T3-E1 cells. (J Endod 2019;45:73–78)
From the *Department of Conservative Dentistry, School of Dentistry, Dental Science Research Institute, Chonnam National University, Gwangju, Korea;
†
Department of Conservative Dentistry, School of Dentistry, Kyung Hee University, Seoul, Korea; and ‡Research Center for Biomineralization Disorders, Chonnam Na-
tional University, Gwangju, Korea.
Address requests for reprints to Dr Won-Mann Oh, Department of Conservative Dentistry, School of Dentistry, Chonnam National University, Young-bong ro 77,
Bukgu, Gwangju, Korea. E-mail address: wmoh@chonnam.ac.kr
0099-2399/$ - see front matter
Copyright ª 2018 American Association of Endodontists.
https://doi.org/10.1016/j.joen.2018.09.006
JOE — Volume 45, Number 1, January 2019
Key Words
Anti-inflammatory, biocompatibility, osteogenic differentiation, sealer
T he final step of end-
odontic treatment is
filling of the root canal sys-
Significance
Calcium silicate–based sealers have the ability to
reduce inflammation and induce osteogenic differ-
tem to prevent bacteria
entiation and mineralization in preosteoblasts.
and bacterial elements
Clinically, it will be a great help to use calcium
from the canal system
silicate–based sealers for healing of periapical tis-
entering the periapical
sues.
area, thereby ensuring
the success of root canal
treatment (1–3). Root canal sealer is essential to seal the space between the dentin
wall and root canal filling material and is also used as a lubricant to fill the root
canal (4). According to Grossman (4), the properties of an ideal root canal sealer
include slow setting, insolubility in tissue fluid, radiopacity, easy mixing, nonshrinkage,
bacteriostatic effect, lack of discoloration, and solubility in common solvents if neces-
sary to remove the root canal filling.
AH Plus (Dentsply Caulk, Milford, DE) is an epoxy/amine resin–based sealer con-
sisting of a paste-paste system, which is delivered in 2 tubes, epoxide paste and amine
paste. AH Plus shows excellent properties when compared with conventional sealers,
including radiopacity, limited polymerization shrinkage, insolubility, adhesion to
dentin, and adequate sealing ability (5). Therefore, AH Plus is considered as the
gold standard in dentistry (5).
Recently, new calcium silicate–based endodontic sealers have been introduced.
MTA Fillapex (Angelus Solucxoes Odontologicas, Londrina, Brazil) is a mineral trioxide
aggregate (MTA)-based root canal sealer and is composed of salicylates, diluting and
natural resins, nanoresins, bismuth trioxide, and MTA. MTA-based sealers are biocom-
patible and stimulate mineralization (6). A recent study suggested that the cytotoxicity of
MTA Fillapex decreases after setting, suggesting bioactivity to stimulate hydroxyapatite
crystal nucleation (7).
EndoSequence BC (Brasseler, Savannah, GA) is another newly developed sealer,
which is a type of calcium phosphate silicate–based bioceramic sealer. It contains tri-
calcium silicate, dicalcium silicate, calcium phosphates, colloidal silica, calcium hy-
droxide, and zirconium oxide as the radiopacifier (8, 9). According to recent
Calcium Silicate–based Root Canal Sealers 73
Basic Research—Technology
studies, EndoSequence BC shows good biocompatibility without any
cytotoxic effects and forms a chemical bond with dentin walls (10, 11).
Despite the several studies of root canal sealers to date, the
biocompatibility, anti-inflammatory, and osteogenic differentiation of
newly developed sealers is not fully known. The aim of this study was
to evaluate the in vitro cytotoxicity, inflammatory response, and osteo-
genic potential of AH Plus, MTA Fillapex, and EndoSequence BC in
mouse-derived preosteoblasts.
Materials and Methods
Cell Culture and Sample Preparation
MC3T3-E1 cells were cultured in a medium comprising alpha-
minimum essential medium (a-MEM; Gibco Invitrogen, Grand Island,
NY) with 10% fetal bovine serum (FBS, Gibco Invitrogen) and antibi-
otics (100 U/mL penicillin and 100 mg/mL streptomycin, Gibco Invitro-
gen) at 37
C in a humidified atmosphere containing 5% CO2. In this
study, untreated MC3T3-E1 (medium only) cells were used as a control.
AH Plus, MTA Fillapex, and EndoSequence BC were mixed accord-
ing to the manufacturers’ instructions under aseptic conditions. These
samples were fabricated as discs (total sample weight = 2 g, size = 5-
mm diameter and 3-mm height). Each sample was allowed to set for
24 hours at 37
C in a humidified atmosphere with 5% CO2. After setting,
the disc was sterilized by ultraviolet radiation for 1 hour on each sur-
face. The discs were transferred to conical centrifuge tubes containing
40 mL fresh a-MEM and antibiotics for 7 days in a humidified atmo-
sphere at 37
C and 5% CO2. Supernatant from this preparation was
filtered using 0.20-mm filters (Minisart; Sartorius Stedim Biotech, Goet-
tingen, Germany).
Cell Viability
The MC3T3-E1 cells were seeded in 96-well culture plates and
preincubated in a-MEM containing 10% FBS and antibiotics for
24 hours. The medium was replaced with the material extracts in the
experiment groups (AH Plus, MTA Fillapex, and EndoSequence BC).
To compare dose-response relationships, the material extracts were
gradually diluted with medium to obtain 5 dilutions (1, 1/5, 1/10, 1/
50, and 1/100). After 24 hours, cell viability was analyzed using the
EZ-Cytox–enhanced cell viability assay kit (Daeil Lab Service, Seoul, Ko-
rea). Briefly, 10 mL EZ-Cytox reagent was added to each well of the 96-
well plate and incubated at 37
C for 4 hours. Optical densities were
measured at 420 nm using a multiwell spectrophotometer (VERSAmax
Multiplate Reader; Molecular Devices, Sunnyvale, CA). The relative cell
viability was calculated for each test material as a percentage of the
mean of the control.
Reverse-transcription Polymerase Chain Reaction and
Real-time Polymerase Chain Reaction
The MC3T3-E1 cells were seeded in 6-well culture plates and pre-
incubated in a-MEM containing 10% FBS and antibiotics for 24 hours.
To induce the inflammatory response, we used Escherichia coli lipo-
polysaccharide (LPS) (InvivoGen, San Diego, CA). The cells were
treated with LPS (100 ng/mL) for 24 hours, and the medium was re-
placed by the material extract in the experiment groups for 0, 1, and
2 days. The cells from each group were collected, and the RNA was ex-
tracted using TRIzol reagent (Gibco Invitrogen) according to the man-
ufacturer’s protocol. Complementary DNA was synthesized using
random primers (Promega Biotech, Piscataway, NJ) and the Access-
QuickTM reverse-transcription polymerase chain reaction (RT-PCR)
system (Promega, Madison, WI). The thermal cycling conditions
were set as follows: 5 minutes at 95
C, denaturation at 95
C for 5 sec-
onds, annealing at a temperature optimized for each primer pair for
74 Lee et al.
30 seconds, and the final extension at 72
C for 20 seconds. The primer
sequences for polymerase chain reaction (PCR) were as listed in
Table 1. All the primers were synthesized from Bioneer Co (Taejeon,
Korea). PCR analysis was performed within 30 cycles with a relatively
high linearity. Each PCR product was loaded on 1.5% agarose gels by
electrophoresis and visualized by ethidium bromide staining.
Quantitative real-time PCR was conducted using the QuantiTect
SYBR Green PCR Kit (Qiagen, Valencia, CA) in triplicate with the
Rotor-Gene 6000 (Corbett Research, Sydney, Australia). The thermal
cycling conditions were as follows: 15 minutes at 95
C followed by
40 cycles of 95
C for 10 seconds, 58
C for 15 seconds, and 72
C for
20 seconds. All quantitation was normalized to an endogenous control
beta-actin. Relative gene expression values were analyzed using the 2^Ct
method (12).
Alkaline Phosphatase Staining
MC3T3-E1 cells were seeded in 24-well plates and preincubated in
a-MEM containing 10% FBS and antibiotics for 24 hours. First, the cells
were cultured in the presence of various concentrations of LPS (10, 50,
and 100 ng/mL) or without LPS for 24 hours. Furthermore, the cells
were treated with LPS (50 ng/mL) or without LPS for 24 hours in ma-
terial extracts (dilution 1/10). Determination of alkaline phosphatase
(ALP) activity was performed after 7 days of incubation, changing the
medium or material extracts every 3 days. After 7 days, the medium
was removed, and the cultured cells were fixed in 70% ethanol for
1 hour followed by rinsing with distilled water 3 times. Fixed cells
were treated with 300 mL ALP staining reagent (1-step NBT/BCIP solu-
tion; Thermo Fisher Scientific Inc, Rockford, IL) per well for 15 mi-
nutes. The staining reagent was removed and photographed using an
Officejet Pro L7580 scanner (HP, Palo Alto, CA). To quantitatively eval-
uate the staining results, the stain was treated with 10% cetylpyridinium
chloride (pH = 7.0) for 30 minutes followed by measuring the absor-
bance at 562 nm on a spectrophotometer (VERSAmax Multiplate
Reader).
Alizarin Red Staining
The MC3T3-E1 cells were seeded in 24-well culture plates and
preincubated in a-MEM containing 10% FBS and antibiotics for
24 hours. First, the cells were cultured in the presence of various con-
centrations of LPS (10, 50, 100, and 200 ng/mL) or without LPS for
24 hours. In addition, the cells were treated with LPS (200 ng/mL),
or without LPS for 24 hours in material extracts diluted 1/10. The deter-
mination of mineralization activity was performed after 14 days of incu-
bation, changing the medium or material extracts every 3 days. After
14 days, the cells were stained with 2% alizarin red stain solution (LIFE-
LINE Cell Tech, Frederick, MD) for 20 minutes and washed 5 times with
sterile water. Analysis of the results was repeated as in ALP staining.
TABLE 1. Sequences of the Primers Used for Reverse-transcription Polymerase
Chain Reaction and Real-time Polymerase Chain Reaction
Primer sequences (50 -30 )
Interleukin-6 Forward: GAGACTTCCATCCAGTTGCC
Reverse: TACTCCAGAAGACCAGAGG
Tumor necrosis Forward: GGGACAGTGACCTGGACTGT
factor alpha Reverse: GCAGAGGTTCAGTGATGTAG
Alkaline Forward: TACATTCCCCATGTGATGGC
phosphatase Reverse: ACCTCTCCCTTGAGTGTGGG
Osteocalcin Forward: CTCCTGAGTCTGACAAAGCC
Reverse: TTGCGCAGTTAGCAATAGCA
Beta-actin Forward: TGGATGGCTACGTACATGGCTGGG
Reverse: TTCTTTGCAGCTCCTTCGTTGCCG
JOE — Volume 45, Number 1, January 2019

Statistical Analysis
Each experiment contained independent samples in triplicate and
was repeated at least twice with qualitatively identical results. One-way
analysis of variance and the Tukey post hoc test were used to determine
the statistically significant differences in test materials. SPSS Version
34.0 (IBM, Armonk, NY) was used for the analysis, and differences
were considered significant at P < .05.
Results
Effect of LPS and Sealers on Cell Viability
The cytotoxicity of LPS and different sealers was determined by us-
ing the WST-1 assay. As shown in Figure 1D, LPS has no cytotoxic effect
at any concentration. AH Plus showed a statistically significant decrease
in cell viability compared with the control at all dilutions (P < .05)
(Fig. 1A). However, MTA Fillapex and EndoSequence BC sealer showed
a statistically significant decrease in cell viability compared with the con-
trol at high dilutions (P < .05, Fig. 1B and C).
Effect of LPS and Sealers on Inflammatory Response and
Osteogenic Differentiation
To investigate the effect of sealers on the inflammatory response,
the expression of inflammatory mediators including interleukin (IL)-6
and tumor necrosis factor alpha (TNF-a) was measured. Furthermore,
the expression of osteogenic genes including ALP and OCN was
measured to investigate the effect of different sealers on osteogenic dif-
ferentiation. RT-PCR showed that the expression of inflammatory medi-
ators such as IL-6 and TNF-a was increased by LPS and reduced by MTA
Fillapex and EndoSequence BC after 2 days (Fig. 2A). The expression of
osteogenic markers was decreased by LPS and increased in all sealer-
treated groups (Fig. 2D). Real-time PCR revealed a significantly
decreased messenger RNA (mRNA) level of IL-6 in the MTA Fillapex
and EndoSequence BC groups compared with the LPS-treated group
(P < .05) (Fig. 2B). The mRNA level of TNF-a was significantly
decreased in all sealer-treated groups compared with the LPS-treated
group (P < .05) (Fig. 2C). The mRNA level of ALP increased signifi-
cantly in the EndoSequence BC group (P < .05) (Fig. 2E). The
mRNA level of OCN increased significantly in the all sealer–treated
group (P < .05) (Fig. 2F). To summarize, the levels of inflammatory
mediators were significantly higher in the LPS-treated groups compared
with the groups without LPS treatment, and sealers decreased the levels
of LPS-induced inflammatory mediators. The levels of osteogenic
markers showed a tendency to increase in sealer-treated groups.
Effect of LPS and Sealers on ALP Activity
To investigate the effect of LPS and sealers on ALP activity, ALP
staining was performed. The ALP activity of MC3T3-E1 cells exposed
to LPS was significantly reduced in a dose-dependent manner compared
with the nontreated group (P < .05) (Fig. 1G and F). Based on these
data, MC3T3-E1 cells were treated with or without 50 ng/mL LPS for
24 hours followed by the 3 root sealers at 1/10 dilution. The MTA Fil-
lapex and EndoSequence BC groups showed significantly higher ALP ac-
tivity compared with the LPS-treated group (P < .05) (Fig. 3A and C).
Effect of LPS and Sealers on Mineralization
To investigate the effect of LPS and sealers on mineralization, aliz-
arin red staining was performed. Alizarin red staining of MC3T3-E1 cells
exposed to LPS was significantly reduced in a dose-dependent manner
compared with the nontreated group (P < .05) (Fig. 1F and H). Based
on these data, MC3T3-E1 cells were treated with or without 200 ng/mL
LPS for 24 hours and treated with the 3 root sealers at 1/10 dilution. The
JOE — Volume 45, Number 1, January 2019
Basic Research—Technology
results showed a significant increase in mineralization with the all root
sealer–treated group compared with the LPS-treated group (P < .05)
(Fig. 3B and D).
Discussion
Successful endodontic treatment outcome is achieved by the elim-
ination of bacteria from root canals followed by appropriate sealing with
the filling materials. However, several studies suggested that a few bac-
teria survive root canal treatment, which is major factor underlying initi-
ation, development, and persistence of apical periodontitis (13–15).
Apical periodontitis is characterized by inflammation and destruction
of periapical bone. Therefore, it is desirable that root canal sealers
display biocompatibility, an antibacterial effect, and osteogenic
potential.
In this study, the biocompatibility of AH Plus, MTA Fillapex, and
EndoSequence BC was analyzed using the WST-1 assay. The WST-1 assay
is similar to the 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium
Bromide (MTT) assay and is a colorimetric method for the determina-
tion of cell metabolic activity (16). In the present study, AH Plus showed
lower relative cell viability at all dilutions compared with the control,
whereas MTA Fillapex and EndoSequence BC showed lower cell viability
at high dilutions, which suggested that the cell viability of sealer extracts
was based on its composition. In the study investigating the physico-
chemical properties of sealers, MTA Fillapex and EndoSequence BC
showed a significantly higher pH level than AH Plus after 24 hours
(17). The lower cell viability at high dilutions of sealer extracts was
attributed to the alkalinity of sealers. Therefore, we selected the sealer
extracts at 1/10 dilution for the experiments. Bacterial toxins (eg, LPS
and lipoteichoic acid) and their metabolites released from the root ca-
nal system into the periradicular tissues induce an apical inflammatory
response, which results in apical periodontitis (18). In apical peri-
odontitis, the extension of the periodontal ligament space and bone
resorption is observed radiologically, and bone loss is mainly triggered
by activated osteoclasts (19). Many cytokines such as IL-6 and TNF-a
potentially induce osteoclast differentiation and increase osteoclast ac-
tivity (20). Therefore, the inhibition of cytokine expression is expected
to reduce bone resorption because of inflammation. Previous studies
reported that LPS, a component of the outer membranes of all gram-
negative bacteria, induces bone resorption and inhibits osteoblast dif-
ferentiation (21–23). Using RT-PCR and real-time PCR, we found that
LPS-treated groups exhibited a higher expression of inflammatory me-
diators including IL-6 and TNF-a and a lower expression of osteogenic
markers including ALP and OCN compared with groups without LPS
treatment. These results are consistent with previous studies.
In this study, the osteoblastic differentiation and mineralization
effect of sealers was determined using RT-PCR and real-time PCR to eval-
uate the mRNA expression of inflammatory mediators and osteogenic
markers, ALP staining to determine the phenotype expression of ALP,
and alizarin red staining to assess calcium nodule formation. We found
that AH Plus, MTA Fillapex, and EndoSequence BC decreased the expres-
sion of inflammatory mediators induced by LPS and enhanced osteogenic
differentiation decreased by LPS. In addition, ALP and alizarin red stain-
ing revealed that sealers increased ALP activity, and calcium nodule for-
mation decreased by LPS relative to the control. MTA Fillapex and
EndoSequence BC are calcium silicate–based sealers similar to MTA.
MTA is a well-known inducer of odontoblastic differentiation and miner-
alization via calcium release (24–27). Calcium ions play an important
role in the formation and mineralization of hard tissues. Calcium ions
stimulate the expression of bone-associated proteins (28) and are neces-
sary for the differentiation and mineralization of cells (29, 30). Calcium
ions are needed for the formation of apatite (31). Apatite formation may
Calcium Silicate–based Root Canal Sealers 75
Basic Research—Technology

Figure 1. The cell viability of sealers and LPS. The relative cell viability of (A) AH Plus, (B) MTA Fillapex, (C) EndoSequence BC, and (D) LPS (*P < .05). The
effects of LPS on (E and G) ALP activity and (F and H) mineralization. Different letters represent statistically significant differences between the test materials
(P < .05).
then induce osteoblasts to produce and mineralize the new bone via In conclusion, calcium silicate–based sealers such as MTA Filla-
deposition of apatite crystals (32). Thus, calcium release from MTA pex and EndoSequence BC exhibit anti-inflammatory activity and pro-
Fillapex and EndoSequence BC is thought to promote osteoblastic differ- mote osteogenic differentiation, suggesting that these sealers may be
entiation and calcium nodule formation. used for successful endodontic treatment. However, further studies

76 Lee et al. JOE — Volume 45, Number 1, January 2019

 Basic Research—Technology

Figure 2. The expression profiles of inflammatory mediators and osteogenic markers treated with LPS and sealer extracts assayed by RT-PCR and real-time PCR.
The mRNA expression of the following inflammatory mediators: (A) RT-PCR, (B) IL-6, and (C) TNF-a. The mRNA expression of the following osteogenic markers:
(D) RT-PCR, (E) ALP, and (F) OCN. #Statistically significant differences between the control and the LPS-only group (P < .05). *Statistically significant differences
comparing the LPS-only group with the experimental groups (P < .05).

JOE — Volume 45, Number 1, January 2019 Calcium Silicate–based Root Canal Sealers 77
Basic Research—Technology
Figure 3. The effects of sealers on (A and C) ALP activity and (B and D) mineralization. #Statistically significant differences comparing the control and the LPS-only
group (P < .05). *Statistically significant difference comparing the LPS-only group with the experimental groups (P < .05).
are needed to elucidate the mechanisms by which MTA Fillapex and En-
doSequence BC sealers manifest anti-inflammatory effects and induce
osteogenic differentiation.
Acknowledgments
Bin-Na Lee and Ji-Uk Hong contributed equally to this study.
Supported by a grant from Chonnam National University Hos-
pital Biomedical Research Institute, South Korea (no. CRI 18029-1)
and the National Research Foundation of Korea grant funded by the
Korean government, South Korea (no. 2016R1C1B1012703).
The authors deny any conflicts of interest related to this study.
References
1. Ng YL, Mann V, Rahbaran S, et al. Outcome of primary root canal treatment: system-
atic review of the literature–part 2. Influence of clinical factors. Int Endod J 2008;
41:6–31.
2. Grossman LI, Oliet S, Del Rio CE. Endodontic Practice. Philadelphia: Lea & Febiger;
1988.
3. Sundqvist G, Figdor D, Persson S, Sj€ogren U. Microbiologic analysis of teeth with
failed endodontic treatment and the outcome of conservative re-treatment. Oral
Surg Oral Med Oral Pathol Oral Radiol Endod 1998;85:86–93.
4. Grossman LI. An improved root canal cement. J Am Dent Assoc 1958;56:381–5.
5. Tyagi S, Mishra P, Tyagi P. Evolution of root canal sealers: an insight story. Eur J Gen
Dent 2013;2:199.
6. Gomes-Filho JE, Watanabe S, Bernabe PF, de Moraes Costa MT. A mineral trioxide
aggregate sealer stimulated mineralization. J Endod 2009;35:256–60.
7. Salles LP, Gomes-Cornelio AL, Guimaraes FC, et al. Mineral trioxide aggregate–
based endodontic sealer stimulates hydroxyapatite nucleation in human
osteoblast-like cell culture. J Endod 2012;38:971–6.
8. Takagi S, Chow LC, Hirayama S, Eichmiller FC. Properties of elastomeric calcium
phosphate cement–chitosan composites. Dent Mater 2003;19:797–804.
9. Yang Q, Lu D. Premixed biological hydraulic cement paste composition and using
the same. Google Patents; 2013. Available at: https://patents.google.com/patent/
US8475811B2/en. Accessed December 13, 2018.
10. De-Deus G, Canabarro A, Alves G, et al. Cytocompatibility of the ready-to-use bio-
ceramic putty repair cement iRoot BP Plus with primary human osteoblasts. Int En-
dod J 2012;45:508–13.
11. Zhang W, Li Z, Peng B. Assessment of a new root canal sealer’s apical sealing ability.
Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;107:e79–82.
12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time
quantitative PCR and the 2 DDCT method. Methods 2001;25:402–8.
78 Lee et al.
13. Ørstavik D, Pitt Ford T. Apical periodontitis: microbial infection and host responses.
In: Essential Endodontology: Prevention and Treatment of Apical Periodontitis.
Oxford: Blackwell Science; 1998:1–8.
14. Chavez De Paz L, Dahlen G, Molander A, et al. Bacteria recovered from teeth with
apical periodontitis after antimicrobial endodontic treatment. Int Endod J 2003;
36:500–8.
15. Gomes B, Pinheiro E, Gad^e-Neto C, et al. Microbiological examination of infected
dental root canals. Oral Microbiol Immunol 2004;19:71–6.
16. Berridge MV, Herst PM, Tan AS. Tetrazolium dyes as tools in cell biology: new in-
sights into their cellular reduction. Biotechnol Annu Rev 2005;11:127–52.
17. Lee JK, Kwak SW, Ha JH, et al. Physicochemical properties of epoxy resin-based and
bioceramic-based root canal sealers. Bioinorg Chem Appl 2017;2017:2582849.
18. Dahlen G, Magnusson BC, M€oller  A. Histological and histochemical study of the in-
fluence of lipopolysaccharide extracted from Fusobacterium nucleatum on the peri-
apical tissues in the monkey Macaca fascicularis. Arch Oral Biol 1981;26:591–8.
19. Listgarten MA. Pathogenesis of periodontitis. J Clin Periodontol 1986;13:418–25.
20. Bezerra MC, Carvalho JF, Prokopowitsch AS, Pereira RM. RANK, RANKL and osteo-
protegerin in arthritic bone loss. Braz J Med Biol Res 2005;38:161–70.
21. Kadono H, Kido J, Kataoka M, et al. Inhibition of osteoblastic cell differentiation by
lipopolysaccharide extract from Porphyromonas gingivalis. Infect Immun 1999;67:
2841–6.
22. Xing Q, Ye Q, Fan M, et al. Porphyromonas gingivalis lipopolysaccharide inhibits the
osteoblastic differentiation of preosteoblasts by activating Notch1 signaling. J Cell
Physiol 2010;225:106–14.
23. Guo C, Yuan L, Wang JG, et al. Lipopolysaccharide (LPS) induces the apoptosis and
inhibits osteoblast differentiation through JNK pathway in MC3T3-E1 cells. Inflam-
mation 2014;37:621–31.
24. Yasuda Y, Ogawa M, Arakawa T, et al. The effect of mineral trioxide aggregate on the
mineralization ability of rat dental pulp cells: an in vitro study. J Endod 2008;34:
1057–60.
25. Min KS, Yang SH, Kim EC. The combined effect of mineral trioxide aggregate and
enamel matrix derivative on odontoblastic differentiation in human dental pulp
cells. J Endod 2009;35:847–51.
26. Masuda-Murakami Y, Kobayashi M, Wang X, et al. Effects of mineral trioxide aggre-
gate on the differentiation of rat dental pulp cells. Acta Histochem 2010;112:452–8.
27. Peng W, Liu W, Zhai W, et al. Effect of tricalcium silicate on the proliferation and
odontogenic differentiation of human dental pulp cells. J Endod 2011;37:1240–6.
28. Jung GY, Park YJ, Han JS. Effects of HA released calcium ion on osteoblast differen-
tiation. J Mater Sci Mater Med 2010;21:1649–54.
29. Schr€oder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp
cell migration, proliferation, and differentiation. J Dent Res 1985;64:541–8.
30. Lopez-Cazaux S, Bluteau G, Magne D, et al. Culture medium modulates the behaviour
of human dental pulp-derived cells: technical note. Eur Cell Mater 2006;11:35–42.
31. Gandolfi M, Taddei P, Tinti A, Prati C. Apatite-forming ability (bioactivity) of ProRoot
MTA. Int Endod J 2010;43:917–29.
32. Tay FR, Pashley DH. Guided tissue remineralisation of partially demineralised hu-
man dentine. Biomaterials 2008;29:1127–37.
JOE — Volume 45, Number 1, January 2019