Vous êtes sur la page 1sur 45

Faculté des Sciences de Montpellier

Master Sciences et Technologies

Mention bgae — Biologie, Géosciences, Agro-ressources, Environnement

Spécialité bimp – Biodiversité et Interactions Microbiennes et Parasitaires


Parcours eep – Écologie et Épidémiologie des Parasites

Année 2007–2008

Rapport de stage M2
Soutenance 9 – 10 juin 2008

Spéciation en cours chez


Lamellodiscus (Monogenea, Diplectanidae) ?
Par Timothée Poisot

Directeurs de stage : Yves Desdevises (1) & Olivier Verneau (2)


Laboratoires d’accueil : (1) Université Pierre et Marie Curie, Laboratoire Arago, umr cnrs 7628 “Modèles en
Biologie Cellulaire et Évolutive” & (2) Université de Perpignan Via Domitia, umr cnrs 5244 “Centre de Biologie
et d’Écologie Tropicale et Méditerranéenne”
Remerciements

Avant que vous ne commenciez la lecture de ce travail, je me dois d’attirer votre attention sur
toutes les personnes qui se sont impliquées, et ont donné de leur temps, pour que je sois en mesure
de le conduire à son terme.
Yves Desdevises, avec qui j’ai eu la chance de travailler depuis juillet 2007, qui a été un maître
de stage toujours disponible, et particulièrement impliqué dans mes activités. Dire que je lui dois
beaucoup est très en dessous de la réalité, et la liste des raisons que j’ai de le remercier est bien
trop longue pour figurer ici. Si je devais n’en retenir qu’une, ce serait sans hésitation son souci du
détail, sans lequel la qualité de ce mémoire serait bien moindre.
Olivier Verneau, qui m’a patiemment accompagné pendant la mise au point des protocoles de
biologie moléculaire, et sans qui ce projet n’aurait pu voir le jour.
Pascal Romans, pour son aide lors de la capture et du maintien en captivité des poissons.
Gwenael Piganeau, pour son enthousiasme lors de l’étude des données moléculaires.
Hervé Moreau, pour avoir mis à notre disposition les moyens matériels et financiers de son
équipe.
Marcus Vinicius Domingues, pour nous avoir communiqué son travail sur la classification des
Diplectanidae.
Graham Kearns, pour m’avoir transmis une infime fraction de ce qu’il savait sur le dévelop-
pement de certains monogènes.
Daniel Borcard, pour avoir accepté de nous offrir le code R pour effectuer le test de Bartlett
par permutations.
Pierre Legendre, pour son aide sur certains points de statistiques.
Emmanuel Paradis, pour ses recommandations sur l’utilisation du package ape en général, et
son aide sur l’application du bootstrap aux arbres upgma en particulier.
Louis Euzet, pour notre discussion sur les Lamellodiscus, et ses précisions sur l’identification
de certaines espèces.
Jean-François Guégan et Bernard Godelle pour leurs critiques (en duo) intenses mais construc-
tives aux débuts de ce travail.
Serge Morand, pour son soutien, son implication, son incroyable capacité de trouver du positif
quand “nothing does not work ”, et pour bien d’autres choses encore. . .

Ce mémoire a été soumis à de nombreuses relectures attentives, aussi je ne prend pas de grands risques
en attirant votre attention sur le fait que je suis seul responsable des erreurs qui resteraient.

i
Résumé

Contexte : En dépit de leur faible temps de génération, de leur cycle de vie direct, et de leur
spécificité importante, la plupart des espèces de monogènes ne montrent pas de profil de cospé-
ciation avec leurs hôtes. On peut conséquemment émettre l’hypothèse que les monogènes ont la
capacité de réaliser des transferts d’hôtes fréquents (augmentant leur spectre d’hôte), rapidement
suivis par des événements de spéciation, qui maintiennent le haut niveau de spécificité observé.
Cette question est étudiée dans le système formé par les Lamellodiscus et leur hôtes sparidés,
en raison de l’existence au sein du genre Lamellodiscus d’espèces particulièrement généralistes
possédant jusqu’à 6 hôtes. Sur sept espèces d’hôtes, nous avons échantillonné 200 individus d’es-
pèces généralistes, et réalisé une étude morphométrique sur l’organe d’attachement postérieur,
appelé hapteur. Les parasites ont été génotypés en séquençant 300 pb du gène Cox1 , le fragment
5’ de l’adn ribosomal 18S, et l’Its1. Enfin, suite à la description récente de nouvelles espèces de
Lamellodiscus, nous nous sommes intéressés à leur statut taxonomique, en cherchant à déterminer
si elles pouvaient être issues de spéciations intra-hôtes.
Objectifs : Nous avons cherché, en comparant les données moléculaires et morphométriques, à
discriminer entre les vrais généralistes (espèces ne montrant pas de différenciation entre les hôtes),
les espèces montrant de la plasticité phénotypique (variation morphométrique sans variation mo-
léculaire), et les espèces en voie de spéciation. D’éventuels événements de spéciation intra-hôte
ont été recherchés en utilisant les données moléculaires.
Résultats : Malgré le fait que nous n’ayons pu réunir assez de séquences pour trancher sur
l’occurrence d’évènements de spéciation chez les Lamellodiscus généralistes, nous avons obtenu
durant ce stage plusieurs résultats nouveaux. (i) Il existe des groupes morphométriques distincts
au sein des espèces de parasites généralistes, selon les différents hôtes. (ii) Sur Diplodus sargus,
la variabilité morphométrique est très importante, et pour certaines espèces, notamment Lamel-
lodiscus elegans, il est possible de différencier deux populations. (iii) La variabilité génétique des
Lamellodiscus est extrêmement élevée, notamment au regard des séquences obtenues sur le gène
Cox1 . (iv) Plusieurs espèces récemment décrites à partir de Lamellodiscus ignoratus ne sont pas
distinguables moléculairement, et voient leur validité remise en question. (v) Toujours au sein du
groupe L. ignoratus, certaines espèces sont en train d’émerger, indiquant que l’espèce L. igno-
ratus pourrait être paraphylétique, en tout cas qu’une évaluation de la biodiversité réelle des
Lamellodiscus sur des critères génétiques est nécessaire. (vi) Plus généralement, nous insistons
sur le fait que la spéciation intra-hôte, au sein de groupes morphologiques bien définis, est très
probablement un mécanisme important de la radiation évolutive des Lamellodiscus.

Mot-clés: Monogènes, sparidés, spéciation, spéciation intra-hôte, variabilité morphométrique,


plasticité phénotypique, adaptation

ii
Table des matières

1 Introduction 1
1.1 Problématique : spécificité et spéciation . . . . . . . . . . . . . . . . . . . . . . . . 1
1.2 Le système étudié : les Lamellodiscus parasites de sparidés . . . . . . . . . . . . . 2
1.2.1 Biologie des monogènes monopisthocotylés . . . . . . . . . . . . . . . . . . 2
1.2.2 Profil de coévolution entre les monogènes et leurs hôtes . . . . . . . . . . . 3
1.2.3 Particularités du système Lamellodiscus — sparidés . . . . . . . . . . . . . 3
1.3 Objectifs du travail . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.3.1 Objectif principal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.3.2 Objectifs secondaires . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

2 Matériels et méthodes 6
2.1 Échantillonnage et collecte des parasites . . . . . . . . . . . . . . . . . . . . . . . 6
2.2 Morphométrie . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
2.2.1 Mesures sur les hôtes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
2.2.2 Mesures sur les parasites . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2.3 Génotypage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2.3.1 Extraction d’adn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2.3.2 Amplification des marqueurs . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2.3.3 Purification et séquençage . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
2.4 Analyse . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
2.4.1 Recherche de groupes morphométriques . . . . . . . . . . . . . . . . . . . . 8
2.4.2 Alignement des séquences et analyses phylogénétiques . . . . . . . . . . . . 9

3 Résultats 11
3.1 Morphométrie . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
3.1.1 Choix des groupes de parasites . . . . . . . . . . . . . . . . . . . . . . . . 11
3.1.2 Des différences morphométriques existent selon les hôtes . . . . . . . . . . 11
3.1.3 Des différences morphométriques existent au sein des hôtes . . . . . . . . . 12
3.2 Données moléculaires . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
3.2.1 Variabilité génétique dans le genre Lamellodiscus . . . . . . . . . . . . . . 13
3.2.2 Variabilité du gène Cox1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
3.2.3 Arbres phylogénétiques . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

4 Discussion 19
4.1 Qu’est-ce qu’une espèce chez les parasites ? . . . . . . . . . . . . . . . . . . . . . . 19
4.2 Cox1 : un bon marqueur pour l’identification des espèces ? . . . . . . . . . . . . . 20
4.3 Statut taxonomique du groupe ignoratus . . . . . . . . . . . . . . . . . . . . . . . 21
4.3.1 Un probable complexe d’espèces . . . . . . . . . . . . . . . . . . . . . . . . 21
4.3.2 Lamellodiscus neifari est-il en voie de spéciation ? . . . . . . . . . . . . . . 22
4.3.3 Lamellodiscus ignoratus est-il paraphylétique ? . . . . . . . . . . . . . . . . 23
4.4 Morphométrie : quels apports, et quelles limites ? . . . . . . . . . . . . . . . . . . 24
4.5 Conclusion & perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
4.5.1 Des événements de spéciation au sein des groupes morphologiques ? . . . . 25

iii
TABLE DES MATIÈRES | iv

4.5.2 Ce qui reste à faire . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

Bibliographie 29

A Diagnose des Lamellodiscus 30


A.1 Caractéristiques générales . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
A.2 Caractéristiques des morphotypes étudiés . . . . . . . . . . . . . . . . . . . . . . . 31
A.2.1 Morphotypes et caractères . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
A.2.2 Type ignoratus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
A.2.3 Type ergensi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
A.2.4 L. elegans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

B Associations retenues 34

C Protocoles de biologie moléculaire et analyses 36


C.1 Tampons de pcr . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
C.2 Cycles de pcr . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
C.3 Analyses statistiques . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
C.3.1 Test t (de Student) par permutation . . . . . . . . . . . . . . . . . . . . . 37

TABLE DES MATIÈRES


Table des figures

1.1 Lamellodiscus fixé sur un filament branchial de son hôte (schéma) . . . . . . . . . 4

2.1 Distances relevées sur les pièces sclérifiées du corps des Lamellodiscus, et morpho-
logie générale du hapteur . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2.2 Amorces utilisées pour l’amplification de l’Its1 et du gène Cox1 . . . . . . . . . . 8

3.1 Différences de morphométrie des parasites selon les hôtes . . . . . . . . . . . . . . 12


3.2 Distances morphométriques entre les individus de l’espèce Lamellodiscus kechemirae 13
3.3 Morphométrie de Lamellodiscus elegans et variations sur Diplodus sargus . . . . . 14
3.4 Distances TV contre TI dans le gène Cox1 . . . . . . . . . . . . . . . . . . . . . . 15
3.5 Arbres phylogénétiques obtenus pour le marqueur Cox1 , à partir des séquences en
adn et en acides aminés, et pour le marqueur 18S. . . . . . . . . . . . . . . . . . 17
3.6 Arbres phylogénétiques avec les 3 marqueurs pour le groupe Lamellodiscus ignoratus 18

4.1 Détails des hapteurs de Lamellodiscus ignoratus, Lamellodiscus confusus et L. igno-


ratus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
4.2 3 hypothèses pour le statut taxonomique du groupe Lamellodiscus ignoratus . . . 23
4.3 Distribution des Lamellodiscus selon le gbif . . . . . . . . . . . . . . . . . . . . . 27

A.1 Clés pour la diagnose . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

B.1 Cophylogènie des Lamellodiscus et de leurs hôtes sparidés . . . . . . . . . . . . . . 34

C.1 Code R de la fonction StudentPerm, réalisant le test de Student par permutations 38

v
Liste des tableaux

3.1 Variabilité génétique au sein du genre Lamellodiscus . . . . . . . . . . . . . . . . . 14

B.1 Espèces d’hôtes retenues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34


B.2 Associations étudiées . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

C.1 Composition du mix de pcr . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36


C.2 Cycles de pcr utilisé pour l’amplification des cibles . . . . . . . . . . . . . . . . . 36

vi
Introduction

1.1 Problématique : spécificité et spéciation

Le parasitisme est sans doute le mode de vie le plus répandu, puisqu’on considère qu’il pour-
rait concerner jusqu’à 50% des espèces connues. Certains auteurs (Brooks et McLennan, 1993)
estiment à 67 le nombre de transitions indépendantes depuis la vie libre vers le parasitisme. À ce
jour, aucun exemple de retour à la vie libre depuis le parasitisme n’est encore connu.
Ce mode de vie a été résumé par de Meeûs et coll. (1998) comme “the conquest of life by life”,
dans la mesure où le parasite exploite, pour sa survie, un autre être vivant. L’hôte est une res-
source pour le parasite, ressource sur laquelle il peut se spécialiser. De fait, on ne connaît pas
de “super-organisme” parasite, capable d’exploiter toutes les espèces existantes (Timms et Read,
1999). Il se pose donc la question de savoir quels facteurs limitent le nombre d’hôtes d’un pa-
rasite, et de pouvoir mesurer à quel point il est inféodé à une ressource particulière (spécialiste
— pour une discussion plus approfondie de ces questions, cf. Poulin (2007), et références). Pour
certains auteurs, la spécificité correspond au type de tissu qu’un parasite habite, c’est-à-dire à
son microhabitat au sein de l’hôte. Une autre définition, plus couramment utilisée, est basée sur
le nombre d’espèces d’hôtes qu’un parasite est capable d’exploiter. Dans cette approche, la spéci-
ficité est directement reliée au spectre d’hôte : plus un parasite possède un spectre d’hôte réduit,
plus sa spécificité est importante. Lous Euzet et Claude Combes ont proposé une séparation
des parasites en trois groupes selon leur spectre d’hôte. Les parasites oïoxènes sont inféodés à une
espèce d’hôte unique (spécialistes sensu stricto). Les sténoxènes infestent un petit nombre d’es-
pèces, phylogénétiquement proches. Enfin, les parasites euryxènes infestent un nombre important
d’espèces, dont la ressemblance est plus écologique que phylogénétique.
Un parasite généraliste voit sa population fragmentée sur différentes espèces d’hôtes, qui consti-
tuent un environnement changeant. D’une part, les hôtes évoluent, et leurs populations peuvent
être fragmentées. D’autre part, les parasites sont des agresseurs, contre lesquels les hôtes se
défendent, entraînant une “course aux armements” (Van Valen, 1973). Le fait que ces défenses
puissent être différentes selon les espèces d’hôtes — mobilisation de mécanismes immunitaires dif-
férents, stratégies d’éviction des parasites,. . . — peut avoir des conséquences évolutives différentes
pour les populations de parasites, en les contraignant à adapter leur réponse à leur hôte. L’hôte
peut aussi entraîner une sélection de certains génotypes (“assortative survival ”), phénomène sus-
ceptible d’isoler reproductivement les différentes populations de parasites. Ces considérations se

1
1. INTRODUCTION | 2

rapprochent du critère d’espèce biologique avancé par Theodosius Dobzhansky et Ernst Mayr
(“groups of actually or potentially interbreeding natural populations, which are reproductively iso-
lated from other such groups”).
Renaud et coll. (1996) ont d’autre part mis en évidence que chez les parasites, l’évolution des
gènes dits “host-choice” est accélérée par les interactions mutuelles, conduisant à une diversifica-
tion importante des parasites au cours du temps évolutif. De fait, une population de parasites
ayant colonisé un nouvel hôte se trouve rapidement isolée de sa population-mère, conduisant à des
événements de spéciation, l’évolution des parasites sur chacun de ses hôtes étant indépendante.
On considère que les parasites sont plus enclins à la spéciation (notamment sympatrique, cf. Mc-
Coy, 2003) que les organismes libres (de Meeûs et coll., 1998), ce qui est aussi lié à leur temps
de génération plus faible que celui de leurs hôtes (Marzluff et Dial, 1991). De fait, on assiste a
une radiation évolutive importante des parasites, y compris au sein d’une espèce d’hôte (spécia-
tion sympatrique), 48% des espèces de poissons étant infestés par des monogènes congénériques
(Rohde, 1989).

1.2 Le système étudié : les Lamellodiscus parasites de spa-


ridés

1.2.1 Biologie des monogènes monopisthocotylés

Les Lamellodiscus font partie du groupe des Monopisthocotylea (cf. partie A.1), parasites d’or-
ganismes aquatiques, principalement des agnathes, chondrychthyens, et téléostéens, mais aussi
d’“invertébrés”. Leurs habitats sont variés, et comprennent notamment les branchies, les nageoires,
la peau, le crâne, et la cavité buccale. Leur taille est relativement faible (de 300 µm à 3 cm).
La pathogénicité des monopisthocotylés en milieu naturel est supposée faible. Une hypothèse
avancée pour expliquer ce fait est que les monogènes ancestraux étaient parasites de poissons
primitifs, il y a 400 millions d’années, et que la longue histoire de coévolution des monogènes et
de leurs hôtes a abouti à un équilibre de l’interaction, diminuant la pathogénicité (Rohde, 2005).
Le cycle de vie des monogènes est direct. L’adulte, fixé sur l’hôte, émet dans le milieu un nombre
d’œufs, de forme tétraédrique, important, qui éclosent pour donner des larves (oncomiracidium).
Ces larves sont ensuite capables de chercher activement leur hôte, grâce à des stimuli chimiques
dont la nature est toujours débattue (Buchmann et Lindenstrøm, 2002). Cette recherche active
de l’hôte est susceptible de contribuer à la forte spécificité des monogènes, notamment dans le
cas où les larves seraient attirées en priorité par les hôtes avec lesquelles elles sont compatibles.

1.2. LE SYSTÈME ÉTUDIÉ : LES LAMELLODISCUS PARASITES DE SPARIDÉS


1. INTRODUCTION | 3

1.2.2 Profil de coévolution entre les monogènes et leurs hôtes

Les monogènes sont caractérisés par leur cycle de vie direct, plus court que celui de leur hôte, et
leur forte spécificité. Ces caractéristiques font qu’on s’attend à observer une cospéciation entre les
parasites et leurs hôtes (Nieberding et Olivieri, 2007). Pourtant, différentes études, sur différentes
associations monogènes–poissons, ont montré qu’il était impossible de mettre en évidence un profil
de cospéciation (Desdevises et coll. (2002); Šimková et coll. (2004); Huyse et Volckaert (2005), cf.
figure B.1). L’une des hypothèses qui revient le plus souvent pour expliquer l’absence d’un tel profil
est que les monogènes ont la capacité d’acquérir fréquemment de nouveaux hôtes. Cette acquisition
de nouveaux hôtes représente un accroissement du spectre d’hôtes ; pour maintenir le fort degré
de spécificité observé, il est donc présumé que ces acquisitions sont suivies de spéciations rapides,
et que les monogènes infestant plusieurs hôtes soient dans un état de transition entre l’acquisition
d’un nouvel hôte et une spéciation. D’autre part, les spéciations intra-hôtes — autre mécanisme
important de radiation évolutive chez les parasites — suivies d’extinctions différentielles sont de
nature à perturber le profil de cospéciation (Šimková et coll., 2004).
Les hôtes des monogènes vivent le plus souvent en sympatrie. Cela ne doit pas pour autant
signifier que les éventuelles spéciations consécutives au transfert seraient sympatriques (McCoy,
2003). La spéciation serait sympatrique si les larves émises par les parasites adultes allaient se
fixer indifféremment sur l’ensemble des hôtes que le parasite peut exploiter. Dans le cas contraire
— si les larves s’attachent préférentiellement sur un hôte de la même espèce que celui habité par
la génération précédente — les populations de parasites sont isolées, et la spéciation doit être
considérée comme allopatrique (McCoy, 2003).

1.2.3 Particularités du système Lamellodiscus — sparidés

L’hypothèse formulée dans la partie précédente — le fait que les monogènes généralistes soient
dans un état transitoire, entre l’acquisition d’un nouvel hôte et la spéciation — demande pour
être testée un modèle répondant à plusieurs critères. Le genre de parasites choisi doit (i) compor-
ter principalement des spécialistes, afin de s’inscrire clairement dans la tendance habituelle des
monogènes, (ii) on doit pouvoir trouver certaines espèces généralistes, avec des spectres d’hôtes
importants, (iii) l’association hôtes-parasites doit avoir été bien étudiée, afin de pouvoir connaître
avec le maximum de précision possible le spectre d’hôtes de chaque espèce, et la diversité spéci-
fique de chaque espèce hôte pour le genre considéré (afin que l’échantillonnage des hôtes soit le
plus adapté possible à la problématique, mais aussi pour limiter au maximum les biais d’échan-
tillonnage).
Les Lamellodiscus (Plathelminthes, Monogenea, Monopisthocotylea/Heteronchoinea, Dactylo-
gyroidea, Diplectanidae) répondent à ces critères. Environ 60 % des espèces sont oïoxènes — une
unique espèce d’hôte –, et trois espèces ont un spectre d’hôte supérieur à 4 (Lamellodiscus ele-
gans, Lamellodiscus ergensi et Lamellodiscus ignoratus). D’autre part, de nombreux travaux ont

1.2. LE SYSTÈME ÉTUDIÉ : LES LAMELLODISCUS PARASITES DE SPARIDÉS


1. INTRODUCTION | 4

Figure 1.1 – Lamellodiscus fixé sur un fi-


lament branchial de son hôte (schéma). Le
hapteur est fixé dans le filament branchial,
et la ventouse antérieure permet au parasite
de s’accrocher de manière plus efficace à son
hôte. Schéma réalisé à partir d’observations à
la loupe binoculaire

conduit à un échantillonnage important dans la région de Banyuls-sur-Mer où nous avons réalisé


ce travail.

1.3 Objectifs du travail

1.3.1 Objectif principal

Durant cette étude, nous allons tenter de déterminer si les Lamellodiscus généralistes sont en
voie de spéciation sur leurs différents hôtes. Pour cela, nous allons déterminer s’il existe, sur
les différents hôtes des parasites généralistes, des groupes selon des critères morphométriques et
moléculaires, et le cas échéant, comparer ces groupes. D’autre part, nous chercherons à déterminer
si, comme Šimková et coll. (2004) l’ont montré pour les Dactylogyrus, la spéciation intra-hôte peut
être considérée comme un moteur important dans la radiation évolutive du genre Lamellodiscus.
Nous étudions donc deux types de mécanismes générant de la spéciation au sein du genre La-
mellodiscus : (i) la spécialisation de parasites généralistes sur leurs différents hôtes, en nous
intéressant à la formation de groupes morphométriques et moléculaires au sein d’espèces suppo-
sées “homogènes”, et (ii) la spéciation intra-hôte, en centrant notre analyse sur la situation de
variants morphologiques décrits récemment comme de nouvelles espèces, et qui sont susceptibles
d’être en train d’émerger suite à de tels événements de spéciation.
Pour notre étude morphométrique, nous avons choisi de mesurer différents caractères de l’opis-
tohapteur, pour deux raisons. D’une part les mesures sont reproductibles sur toutes les espèces de
Lamellodiscus, contrairement à celles prises sur des organes de formes très variables, notamment
les pièces copulatoires mâles (qui sont en revanche des critères essentiels de discrimination des
espèces lors de l’identification des individus collectés) ; d’autre part, le hapteur possède un rôle
adaptatif évident, dans la mesure où il est utilisé par le Lamellodiscus pour se fixer à la bran-
chie de son hôte (figure 1.1). Nous émettons donc l’hypothèse que dans le cas d’une spéciation
adaptative, il fera partie des premiers caractères à montrer des changements.

1.3. OBJECTIFS DU TRAVAIL


1. INTRODUCTION | 5

Les données moléculaires ont été obtenues en séquençant trois marqueurs : l’Its1, 18S, et Cox1
(les deux derniers n’étant que partiellement séquencés). Cox1 est un gène mitochondrial, codant
la sous-unité 1 de la cytochrome oxydase. 18S est un arn ribosomique, et l’Its1 un espaceur
intergénique, situé en 3’ du 18S. Ils ont été choisis en raison de leur caractère neutre — “neutre”
signifiant ici que les pressions de sélection auxquelles ils sont soumis ne sont pas une conséquence
de la relation hôte-parasite — , et permettent, en analysant ensemble les informations qu’ils ap-
portent, d’être résolutifs à la fois aux niveaux intra- et interspécifique. Le marqueur 18S, bien
conservé au cours de l’évolution du genre Lamellodiscus permet de déterminer à quelle espèce
appartient un individu, et d’aligner les séquences pour extraire les parties correspondant à lIts1.
Il a été utilisé pour produire la seule phylogénie moléculaire des Lamellodiscus disponible (Des-
devises et coll., 2002). L’Its1 est très variable au niveau intraspécifique, et ne s’aligne pas d’une
espèce à l’autre (Desdevises et coll., 2002; Kaci-Chaouch et coll., 2008). Les propriétés de Cox1 ,
dont nous avons obtenu les premières séquences pour des Lamellodiscus, sont discutées dans ce
mémoire. Il présente une très forte variabilité, y compris au niveau intraspécifique.

1.3.2 Objectifs secondaires

Notre jeu de données nous permet de nous intéresser à différentes questions annexes. (i) Quel est
le statut taxonomique précis d’espèces décrites récemment sur la base de variations morphomé-
triques faibles, sans analyses moléculaires (cf. Amine et coll. (2007), et références) ? (ii) Quelles
informations peut-on retirer de ce travail sur l’adaptation morphologique à l’hôte, et la plasti-
cité phénotypique (phénomène très mal connu chez les plathelminthes, comme mis en avant par
Matejusová et coll., 2002) ? (iii) Enfin, que peut-on savoir sur la recombinaison dans le génome
mitochondrial des monogènes ?

1.3. OBJECTIFS DU TRAVAIL


Matériels et méthodes

L’échantillonage, la collecte, l’identification des parasites et les analyses moléculaires ont été
effectués au Laboratoire Arago de l’université Paris 6 (umr cnrs 7628). Les analyses moléculaires
ont été mises au point au Centre de Biologie et d’Écologie Tropicale et Méditerranéenne de
l’université de Perpignan (umr cnrs 5244).

2.1 Échantillonnage et collecte des parasites

Les hôtes sélectionnés (Diplodus sargus, Diplodus vulgaris, Diplodus annularis, Diplodus pun-
tazzo, Oblada melanura, Lithognatus mormyrus, et Salpa salpa) font partie de la famille des
sparidés (téléostéens). Les associations hôtes–parasites retenues sont données dans le tableau B.2
en annexe.
Les hôtes ont été collectés individuellement par pêche sous-marine dans la baie de Banyuls-sur-
Mer (42o 28’47”N, 3o 08’10”E), puis disséqués immédiatement après la capture pour identifier les
parasites. Les arcs branchiaux ont été prélevés, puis séparés dans de l’eau de mer, et observés à
la loupe binoculaire (Olympus SZ61).
Les Lamellodiscus trouvés ont été immédiatement retirés des branchies, puis placés sur une lame
dans une goutte d’alcool à 96 % pour observation microscopique (Olympus CX41). L’identification
est faite sur la base des parties sclérifiées du corps (hapteur et organe copulatoire mâle, cf.
annexe A). Après mesure (cf. partie 2.2.2), les parasites sont placés individuellement dans un
faible volume d’alcool à 96 %, en prévision de l’extraction d’adn.

2.2 Morphométrie

2.2.1 Mesures sur les hôtes

Chaque hôte a été pesé (poids total, kg) et mesuré (longueur totale, de la pointe de la nageoire
caudale à la pointe du museau, cm). Quatre mesures ont été prises sur le premier arc branchial :
longueur interne de l’arc, longueur totale de l’arc, longueur maximale des filaments, largeur de
l’arc à la base du plus long filament.

6
2. MATÉRIELS ET MÉTHODES | 7

Figure 2.1 – Distances relevées sur les pièces scléri-


fiées du corps des Lamellodiscus, et morphologie gé-
nérale du hapteur. BMV, taille de la barre médiane
ventrale. BLD, taille des barres latérales dorsales. a,
a’, longueur des hamuli. b, b’, longueur à la pointe.
c, c’, ouverture de la lame. d, ouverture de la garde.
f, longueur du manche. g, longueur de la garde

2.2.2 Mesures sur les parasites

La méthode d’analyse morphométrique par landmarks (mesure de distances entre deux points
sur un organe) a été utilisée. Le hapteur et l’organe copulatoire mâle de chaque individu ont été
photographiés au grossissement 40 (Olympus CX41 et caméra Sony ExwaveHAD). Les mesures
morphométriques indiquées dans la figure 2.1 ont été prises avec le logiciel ImageJ1 .

2.3 Génotypage

Les protocoles détaillés pour la biologie moléculaire sont décrits dans l’annexe C.

2.3.1 Extraction d’adn

Les parasites ont été placés dans un très faible volume d’alcool à 96 %, puis séchés 20 à 25
minutes au SpeedVac (Savant DNA 120). L’adn a été extrait en utilisant une solution à base de
Chelex (70 µL à 100 mg/ml) dilué dans de la protéinase K (15 µL à 10 mg/ml), selon la méthode
décrite par Kaci-Chaouch et coll. (2008). L’ensemble adn plus Chelex a été chauffé une heure
à 55 ˚C, puis 15 minutes à 100 ˚C. Les adn ont été conservés à 4 ˚C avant amplification des
marqueurs.

2.3.2 Amplification des marqueurs

L’amplification des cibles Its1 et Cox1 (figures 2.2(a) et 2.2(b), respectivement) a été effectuée
par pcr (pour le contenu du mélange, se reporter au tableau C.1, pour les cycles, se reporter
au tableau C.2). L’Its1 présente l’avantage de ne s’aligner qu’à l’intérieur d’une espèce (Kaci-
Chaouch et coll., 2008), permettant d’identifier avec précision l’espèce de l’individu considéré, alors
que Cox1 est susceptible de posséder une diversité intraspécifique importante (Hansen et coll.,
2007).
1
http ://rsb.info.nih.gov/ij/

2.3. GÉNOTYPAGE
2. MATÉRIELS ET MÉTHODES | 8

(a) Amorces utilisées pour l’amplification du marqueur Its1.


Fragment attendu d’environ 0.9 kb.

(b) Amorces utilisées pour l’am-


plification du marqueur Cox1 .
Fragment attendu d’environ 0.3
kb.

Figure 2.2 – Emplacement des amorces L7 (5’–TGATTTGTCTGGTTTATTCCGAT–3’) et IR8


(5’–GCTAGCTGCGTTCTTCATCGA–3’), utilisés pour amplifier l’Its1, d’après Kaci-Chaouch et coll. (2008), ainsi que
des primers LCO1P (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’) et HCOX1P 2 ( 5’–TAAAGAAAGAACATAATGAAAATG–3’)
utilisés pour amplifier le gène Cox1 , d’après Littlewood et coll. (1997)

Révélation des produits de pcr

Les produits de pcr ont été déposés sur un gel d’agarose à 1 %, puis déposés à migrer (100 V)
dans du tbe 0.5x. Les gels ont été révélés aux uv après ≈ 30 min de migration.

2.3.3 Purification et séquençage

Pour chaque individu, la bande correspondant au poids moléculaire attendu (≈ 900pb pour
Its1 et ≈ 500 pb pour Cox1 ) a été découpée, puis placée dans un microtube conservé à 4˚C en
attendant la purification.
Les adn ainsi collectés ont été purifiés en utilisant le kit Nucleospin Extract II – Gel extraction
(Macherey–Nagel), puis envoyés à la société Macrogen Inc. pour le séquençage.

2.4 Analyse

Les analyses statistiques ont été effectuées avec le logiciel R 2 . Sauf mention contraire, le seuil de
significativité pour les différents tests a été fixé à 5 %.

2.4.1 Recherche de groupes morphométriques

Analyse exploratoire

Deux méthodes ont été utilisée pour détecter des groupes de parasites sur la base de la mor-
phométrie. La distance (morphométrique) Euclidienne standardisée entre tous les individus a été
calculée, puis un groupement a été effectué sur la base de cette matrice (méthode upgma). D’autre
2
http ://www.r-project.org/

2.4. ANALYSE
2. MATÉRIELS ET MÉTHODES | 9

part, les variables morphométriques ont été utilisées pour une acp (analyse en composantes prin-
cipales), réalisée sur l’ensemble des individus d’un type (Lamellodiscus kechemirae, L. elegans,
L. ergensi -like & L. ignoratus-like, cf. annexe A). Le pourcentage de la variance expliqué par le
premier axe étant fort, la valeur sur cet axe pour chaque individu a été choisie pour résumer sa
morphométrie, et utilisé pour les tests de quantification des différences morphométriques entre
les groupes.

Quantification de la différence entre les groupes

La moyenne des valeurs du premier axe pour chaque groupe de parasites, sur ses différents hôtes,
a été calculée, puis comparée entre les différents hôtes par le test de Kruskal-Wallis (après avoir
constaté par le test de Bartlett par permutation que les variances n’étaient pas homogènes).

2.4.2 Alignement des séquences et analyses phylogénétiques

Alignement des séquences

Les chromatogrammes obtenus ont été examinés avec les logiciels FinchTV3 et 4Peaks4 . Les
séquences ont été, avant toute correction, extraites et blastées5 contre GenBank, en utilisant
blastn, afin de vérifier qu’elles correspondaient bien à des séquences de Lamellodiscus.
Pour les deux fragments obtenus (un pour l’amorce sens, l’autre pour l’amorce anti-sens), les
positions indéterminées ont été, selon la qualité du chromatogramme, résolues. Les deux fragments
ont été alignés manuellement (fragment sens, et brin complémentaire du fragment anti-sens), en
se servant des séquences déjà connues comme repère, à l’aide du logiciel Se-Al6 . Une séquence
complète pour chaque marqueur a été extraite en combinant les données des deux fragments.
Pour les marqueurs Its1 et Cox1 , l’alignement a été réalisé par le logiciel ClustalW27 .

Analyses phylogénétiques

Les séquences corrigées et alignées (18S et Cox1 pour l’ensemble des individus, Its1 en intraspé-
cifique) ont été analysées via PAUP*4b108 afin de déterminer le modèle d’évolution qui correspon-
dait le mieux aux données. Au préalable, les distances TI et TV entre paires de séquences pour le
gène Cox1 ont été calculées, pour estimer le niveau de saturation pour ce marqueur. Le modèle
d’évolution ayant la meilleure vraisemblance pour chaque jeu de données a été déterminé par
ModelTest9 , en utilisant l’Akaike Information Criterion. Les alignements ont ensuite été analysés
3
http ://www.geospiza.com/finchtv/
4
http ://mekentosj.com/4peaks/
5
http ://www.ncbi.nlm.nih.gov/blast/Blast.cgi
6
http ://tree.bio.ed.ac.uk/software/seal/
7
http ://www.ebi.ac.uk/Tools/clustalw2/index.html
8
http ://paup.csit.fsu.edu/
9
http ://darwin.uvigo.es/software/modeltest.html

2.4. ANALYSE
2. MATÉRIELS ET MÉTHODES | 10

en utilisant une approche probabiliste et une validation par bootstrap non paramétrique (PhyML10 ,
avec le modèle proposé par ModelTest) et l’inférence Bayesienne (MrBayes11 ).

10
http ://atgc.lirmm.fr/phyml/
11
http ://mrbayes.csit.fsu.edu/, version on-line : http ://cbsuapps.tc.cornell.edu/mrbayes.aspx

2.4. ANALYSE
Résultats

3.1 Morphométrie

3.1.1 Choix des groupes de parasites

Le statut taxonomique de certains Lamellodiscus est peu clair ; dans les 4 dernières années, 10
nouvelles espèces ont été décrites, uniquement sur la base de variations dans la morphologie, sans
analyses moléculaires. Nous avons donc défini 4 groupes parmi les parasites généralistes étudiés
ici, basés sur la proximité morphologique et morphométrique entre les individus des différentes
espèces. Le groupe des L. ignoratus sl. (sensu lato, c.-à-d. l’espèce L. ignoratus, et les espèces
qui ont été décrites par splitting) se compose de L. ignoratus ss. (sensu stricto, c.-à-d. l’espèce
“canonique”), Lamellodiscus falcus, Lamellodiscus confusus, Lamellodiscus diplodi , Lamellodis-
cus mormyri et Lamellodiscus neifari . Le groupe des L. ergensi -like se compose de L. ergensi ,
Lamellodiscus theroni et Lamellodiscus tomentosus. Enfin, les espèces L. elegans et L. kechemirae
sont considérées indépendamment.
Les espèces composant le groupe L. ignoratus sl. ont été décrites au cours des dernières années,
sur la base de variations minimes par rapport à L. ignoratus ss., l’espèce d’origine. Le même
raisonnement a été appliqué à L. ergensi, aboutissant à la description de nouvelles espèces. Il
est important de clarifier le statut taxonomique de ces espèces, pour plusieurs raisons. (i) Le
profil de spécificité des Lamellodiscus est modifié, les espèces décrites étant majoritairement des
spécialistes. (ii) L’augmentation du nombre d’espèces peut masquer le fait que des processus de
spéciation soient en cours, en nous faisant considérer comme deux espèces distinctes des individus
qui appartiennent en réalité à la même unité taxonomique.

3.1.2 Des différences morphométriques existent selon les hôtes

Au sein de chaque groupe, la première composante principale (premier axe de l’acp sur les valeurs
morphométriques) de chaque individu a été utilisée comme valeur résumant sa morphométrie
(valeurs propres du premier axe, en % : L. elegans = 74.5 ; L. kechemirae = 54.5 ; L. ignoratus
sl. = 71.1 ; L. ergensi = 66.7). Les données sont représentées figure 3.1. Les moyennes sur chaque
espèce d’hôte ont été calculées, et comparées par le test de Kruskal-Wallis. Il est possible de
mettre en évidence que la morphométrie des individus de l’espèce L. elegans est significativement
différente selon les hôtes (p = 7.10−3 ), de même pour L. kechemirae (p = 0.02) et les parasites du

11
3. RÉSULTATS | 12

4
4

2
2
0

0
−2

−2
−4

−4
−6

−6
D. puntazzo D. sargus D. vulgaris L. mormyrus S. salpa D. annularis D. sargus D. vulgaris O. melanura

(a) L. ignoratus – like (b) L. elegans


2

4
0

2
−2

0
−4

−2
−6

−4
−8

D. puntazzo D. sargus D. vulgaris D. sargus D. vulgaris

(c) L. ergensi – like (d) L. kechemirae

Figure 3.1 – Distribution des valeurs de la première composante principale pour les quatre groupes de Lamello-
discus étudiés, en fonction des hôtes

groupe L. ergensi (p = 3.10−3 ). En revanche, au sein des L. ignoratus sl., le test de Kruskal-Wallis
ne permet pas de se prononcer en faveur d’une différence significative de la morphométrie entre
les différents hôtes (p = 0.19). Nous avons décidé de comparer par le test de Mann-Whitney les
deux groupes les plus différents selon la figure 3.1(a), (L. mormyrus et D. puntazzo). La différence
obtenue entre ces deux groupes est significative (p = 0.03). Pour éviter des tests multiples et une
inflation de l’erreur de type 1, nous n’avons pas répété ces comparaisons entre les autres groupes ;
cependant, sur la base du résultat précédent, nous pouvons supposer que des différences existent
entre les moyennes de certains groupes de L. ignoratus sl. sur leurs différents hôtes.
Le résultat obtenu pour L. kechemirae est intéressant. En plus d’une différence significative de
morphométrie selon les hôtes, cette espèce montre une ségrégation claire des parasites, sur la base
de leur morphométrie, selon l’espèce sur laquelle ils ont été prélevés (figure 3.2). On observe que
les individus prélevés sur D. sargus et ceux prélevés sur D. vulgaris, à de rares exceptions près,
sont distinguables d’un point de vue morphométrique.

3.1.3 Des différences morphométriques existent au sein des hôtes

En plus des différences existant entre les hôtes au sein d’une même espèce de parasite, nous
avons mis en évidence des différences de morphométrie au sein des hôtes, pour certaines espèces
de parasites. L’exemple le plus flagrant est celui de L. elegans sur D. sargus, exposé figure 3.3(a).
On observe clairement deux groupes de L. elegans, correspondant respectivement à trois (D. sargus

3.1. MORPHOMÉTRIE
3. RÉSULTATS | 13

D. vulgaris
D. vulgaris
D. vulgaris
D. vulgaris
D. vulgaris D. vulgaris
D. vulgaris

D. vulgaris
D. vulgaris
D. vulgaris

Figure 3.2 – Distances morphométriques entre les


D. vulgaris
D. sargus individus de l’espèce L. kechemirae. Chaque parasite
est identifié par l’espèce d’hôte sur laquelle il a été
D. vulgaris
collecté. À l’exception de quelques individus, on re-
marque que les parasites prélevés sur D. sargus et
D. sargus ceux prélevés sur D. vulgaris forment deux groupes
D. sargus
D. sargus
aux morphométries différentes (cf. figure 3.1(d))
D. sargus

D. vulgaris

D. sargus
D. vulgaris
D. vulgaris
D. vulgaris

1, 8, 9) et quatre (D. sargus 2, 3, 6, 7) hôtes. La distribution des valeurs sur le premier axe, est,
de même, différente pour ces parasites (figure 3.3(b)).

3.2 Données moléculaires

Les données pour le 18S ont été en partie issues du travail de Desdevises et coll. (2002), celles
pour l’Its1 de Kaci-Chaouch et coll. (2008). Au cours de ce travail, nous avons obtenu 9 séquences
pour le 18S, autant pour l’Its1, et 11 séquences pour Cox1 .

3.2.1 Variabilité génétique dans le genre Lamellodiscus

Pour chaque marqueur, nous avons calculé le pourcentage de sites polymorphes au sein d’une
espèce, ou d’un morphotype, ainsi que pour l’ensemble des séquences de Lamellodiscus disponibles.
Les résultats sont présentés tableau 3.1. Le genre Lamellodiscus est caractérisé par un taux
de variabilité très élevé, avec de nombreux sites fortement polymorphes, y compris au niveau
intraspécifique et pour des marqueurs bien conservés comme le 18S.
Les distances génétiques entre individus sont variables entre les marqueurs : faibles pour 18S,
indiquant une conservation relativement importante de cette région, très importantes pour Its1,
y compris en intraspéficique, et moyennes pour Cox1 . Les distances entre individus de l’espèce
L. neifari sont les plus faibles au sein de L. ignoratus sl., pour l’ensemble des séquences. La
moyenne des distances entre L. ignoratus ss. est plus importante que la distance moyenne au sein
des L. ignoratus sl., ce qui est discuté dans la partie 4.3.
Les taux de variabilité observés au niveau intraspécifique pour le genre Lamellodiscus, selon les
critères habituels (cf. Piganeau et coll. (2004), et références), ne sont compatibles qu’avec une
observation entre individus d’espèces différentes, et sont en tout cas bien plus élevés que ce qui

3.2. DONNÉES MOLÉCULAIRES


3. RÉSULTATS | 14

2.0
1.5

0.15
1.0
0.5
Axe 2: 9.28 %

Distribution
0.10
−0.5
−1.5

0.05
−2.5

0.00
−6 −5 −4 −3 −2 −1 0 1 2 3 4 −6 −4 −2 0 2 4
Axe 1: 74.5 % Valeur sur le premier axe

(a) acp sur les variables morphomé- (b) Distribution de la valeur moyenne
triques pour les individus de l’espèce du premier axe de l’acp sur les va-
L. elegans riables morphométriques pour L. elegans
sur D. sargus

Figure 3.3 – Morphométrie de L. elegans. On remarque que les individus de cette espèce forment deux groupes
(encadrés) sur D. sargus. Chaque groupe correspond aux parasites de différents hôtes, indiquant la coexistence
de différentes populations dans notre zone d’étude. Légende : ◦ D. annularis, + D. sargus, × D. vulgaris, 5
O. melanura

est attendu entre individus de la même espèce. Ce résultat est pris comme une indication du fait
que la diversité des Lamellodiscus— et des monogènes en général — est probablement largement
sous-estimée, ce que nous étudions dans la partie 4.

3.2.2 Variabilité du gène Cox1

Au cours de ce travail, nous avons obtenu 11 séquences partielles (≈ 300pb) du gène mito-
chondrial Cox1 des Lamellodiscus (3 pour Lamellodiscus furcosus, 2 pour L. neifari, 1 pour
L. confusus, 2 pour L. ignoratus, 1 pour L. kechemirae, 1 pour L. ergensi, et 1 pour L. diplodi).
Afin de déterminer si le fragment retenu porte un signal phylogénétique exploitable, et si la varia-
bilité de la séquence permet d’être résolutif entre et à l’intérieur des espèces, nous avons calculé,
pour chaque paire de séquences, les distances TI et TV , soit sur l’ensemble de la séquence, soit
sur les deux premières bases de chaque codon (le cadre de lecture a été déterminé en alignant
notre séquence sur les séquences Cox1 d’autres monogènes), soit sur la troisième base, afin de

Marqueur 18S Its1 Cox1


T N D P T N D P T N D P
L. ignoratus 493 3 6.08 0,043±2,16.10−7 355 12 11.8 0,147±0,057 290 2 7.58 0,246±0,06
Groupe L. ignoratus 493 8 6.73 0,027±0,019 299 17 13.7 0,155±0,07 290 2 9.31 0,214±0,076
L. neifari 493 3 0 2,6.10−3 ±2,3.10−3 334 3 7.48 0,143±0,25 0,09±0
Ensemble 493 51 8.9 0,054±0,021 290 8 13.1 0,207±0,066

Tableau 3.1 – Variabilité génétique au sein du genre Lamellodiscus. T : taille du marqueur, N : nombre de
séquences disponibles, D : pourcentage de sites polymorphes (hors singletons) dans le marqueur, P : moyenne des
pairwise distances ± écarts-types. “Ensemble” correspond aux valeurs pour toutes les séquences de Lamellodiscus
disponibles à ce jour

3.2. DONNÉES MOLÉCULAIRES


3. RÉSULTATS | 15

0.4

0.4

0.4
● ●

● ●
● ● ● ●● ●
0.3 ● ● ●● ● ●

0.3

0.3
● ●●● ●
●●● ●
●● ●
● ● ●●●
● ●
● ● ●
● ● ●
0.2

0.2

0.2
Tv

Tv

Tv
● ●
●● ● ●● ●
● ●● ●
● ●
● ● ●
● ●● ●● ● ● ●
● ● ●
● ●
●●●●● ● ●
●● ● ●
●●
●●
●●● ●● ● ●

0.1

0.1

0.1
● ●
● ●●● ●● ●
● ●●
● ●
● ● ●●●● ●
●● ●
● ●● ● ●●● ●
●●●●●
●● ●
●● ●●●● ● ●● ●●
● ● ● ●
0.0

0.0

0.0
0.00 0.05 0.10 0.15 0.20 0.25 0.00 0.05 0.10 0.15 0.20 0.25 0.00 0.05 0.10 0.15 0.20 0.25
Ti Ti Ti

(a) Distances TV contre TI (b) Distances TV contre TI (c) Distances TV contre TI


pour l’ensemble de la séquence pour les deux premières bases pour la troisième position de
de chaque codon chaque codon

Figure 3.4 – Distances TV contre TI dans le gène Cox1 . La relation linéaire entre TI et TV si l’on considère
l’ensemble du codon ou les deux premières positions montre que dans l’ensemble, il n’existe pas de saturation pour
la séquence étudiée (≈ 300pb). En revanche, l’absence de relation entre TI et TV pour la troisième position de
chaque codon indique un niveau relativement élevé de saturation entre les individus étudiés

déterminer la saturation. Les résultats sont présentés figure 3.4.


Le fragment du gène Cox1 que nous avons séquencé est dans l’ensemble non saturé (relation
linéaire entre TI et TV ), ce qui lui confère un signal phylogénétique important. En revanche, le
résultat obtenu en considérant uniquement la troisième position de chaque codon indique qu’une
saturation existe à cette position (due au fait que le code génétique est redondant). La variabilité
dans Cox1 est extrêmement élevée au sein des Lamellodiscus (cf. tableau 3.1), une caractéristique
discutée dans la partie 4.2.

3.2.3 Arbres phylogénétiques

À partir des données moléculaires collectées lors de ce travail, et des données déjà disponibles
pour le genre Lamellodiscus, nous avons pu placer les individus collectés dans la phylogénie
produite par Desdevises et coll. (2002). Deux séries d’arbres (consensus majoritaires) ont été
reconstruites : une série avec l’ensemble des données disponibles, pour les marqueurs 18S et Cox1
(séquences adn et acides aminés, figure 3.5), et une série avec uniquement les données pour le
groupe L. ignoratus, afin de clarifier son statut taxonomique, avec les marqueurs 18S, Cox1 , et
Its1 (figure 3.6). Les topologies obtenues par inférence Bayesienne et maximum de vraisemblance
sont similaires. Les arbres présentés dans ce travail sont les consensus majoritaires. Dans le cas
ou un nœud n’était pas obtenu dans plus de 50 % des réplicats, il n’apparaît pas, et n’a donc pas
de valeur de soutien. Par convention, nous avons placé les probabilités postérieures en premier,
et les valeurs de soutien bootstrap entre parenthèses.
Ces arbres nous permettent de clarifier la position de certaines espèces décrites récemment,
notamment L. neifari , L. falcus, L. confusus, L. diplodi , et L. kechemirae. Il apparaît que les
quatre premières, décrites par splitting à partir de L. ignoratus, lui sont étroitement apparentées,
comme on le voit figure 3.5(c). Lamellodiscus kechemirae et L. ergensi sont très proches, mais

3.2. DONNÉES MOLÉCULAIRES


3. RÉSULTATS | 16

le faible nombre de séquences obtenues ne permet pas d’en apprendre plus sur le statut de ces
espèces.
La proximité entre les L. ignoratus sl. est de même soutenue par l’arbre inféré à partir des données
de la séquence en acides aminés de Cox1 (figure 3.5(b)). Quoique la probabilité postérieure du
nœud portant l’ensemble des L. ignoratus soit assez faible (52), les différentes espèces apparaissent
groupées. Obtenir un plus grand nombre de séquences — ou augmenter le nombre de caractères
— permettrait de clarifier davantage le statut de ce groupe.
On remarque que sur l’ensemble des arbres, les L. ignoratus ss. ne sont pas groupés, mais
que les individus des autres espèces (L. confusus, L. diplodi, L. falcus, L. neifari) viennent se
“brancher” entre eux. Cette tendance est particulièrement visible pour l’arbre obtenu à partir
des séquences d’Its1. Nous proposons dans la partie 4.3.3 plusieurs hypothèses pour expliquer
cette observation : la coexistence de différents morphes au sein d’une unique espèce L. ignoratus,
l’émergence de différentes espèces rendant L. ignoratus ss. paraphylétique, et la sous-estimation
de la diversité du genre Lamellodiscus, qui, sur la base de critères moléculaires, comporterait
beaucoup plus d’espèces que celles que l’on reconnaît actuellement. Des résultats semblables
obtenus sur Gyrodactylus (Hansen et coll., 2007) nous font penser que cette sous-estimation est
peut-être vraie pour l’ensemble des monogènes.

3.2. DONNÉES MOLÉCULAIRES


3. RÉSULTATS | 17

(a) Arbre pour le marqueur Cox1 (adn) (b) Arbre pour le marqueur Cox1 (acides aminés)

(c) Arbre pour le marqueur 18S

Figure 3.5 – Arbres phylogénétiques (consensus majoritaires) obtenus pour le marqueur Cox1 , à partir des
séquences en adn et en acides aminés, et pour le marqueur 18S. Les probabilités postérieures et les valeurs de
soutien bootstrap (entre parenthèses) sont indiquées sur les branches

3.2. DONNÉES MOLÉCULAIRES


3. RÉSULTATS | 18

(a) Arbre réalisé avec le marqueur 18S (b) Arbre réalisé avec le marqueur Its1

(c) Arbre réalisé avec le marqueur Cox1

Figure 3.6 – Arbres phylogénétiques (consensus majoritaires) obtenus pour les 3 marqueurs utilisés (Cox1 , Its1,
18S), sur le groupe L. ignoratus sl.. Les topologies obtenues par inférence Bayesienne et maximum de vraisemblance
sont similaires. Les espèces d’hôtes sont indiquées à la suite des espèces de parasites, entre parenthèses. Ds :
D. sargus, Dv : D. vulgaris, S : S. salpa. Les valeurs de bootstrap (en pourcentage, entre parenthèses) et les
probabilités postérieures de chaque branche sont indiquées sur les arbres

3.2. DONNÉES MOLÉCULAIRES


Discussion

4.1 Qu’est-ce qu’une espèce chez les parasites ?

Kunz (2002) a mis en avant le fait que le concept d’espèce biologique s’appliquait mal aux
parasites, du fait de leurs modes de reproduction particuliers. Dans une étude sur la spéciation
chez les parasites, il est primordial de s’entendre sur ce que nous appelons “espèce”. Dans un
but d’identification, chez les monogènes en général — et les Lamellodiscus en particulier –, la
morphologie est encore le principal outil (à de rares exceptions près : Huyse et Volckaert (2002)
ont par exemple utilisé la morphométrie pour Gyrodactylus, et des études plus récentes donnent
des exemple d’utilisation du génotypage (Hansen et coll., 2007)). Cependant, sa pertinence est
discutable : quel est le degré de différence nécessaire pour considérer deux individus comme
appartenant à des espèces différentes ? Quel est le degré de similarité requis pour considérer qu’ils
font partie d’un même taxon ? D’autre part, comment séparer la ressemblance phénotypique liée
à la phylogénie, et celle issue d’une homoplasie, provoquée par l’adaptation à des environnements
similaires ?
Dans le cadre de ce travail, nous avons considéré que les individus appartenant à une même espèce
devaient (i) être morphométriquement similaires, (ii) génétiquement proches, et (iii) capables de
s’échanger des gènes (le flux de gènes n’est pas interrompu) ; cette dernière condition nous permet
de considérer que deux populations génétiquement distinctes sont en voie de spéciation.
Nous avons observé des taux de variabilité génétique extrêmement importants, même au sein de
groupes considérés comme des espèces. D’après les critères habituels pour les animaux (Piganeau
et coll., 2004), de tels niveaux de variabilité n’étaient pas compatibles avec une observation au
niveau intraspécifique, remettant en question la fait que nous observions effectivement une espèce.
Il est possible que la diversité génétique des Lamellodiscus aie été très largement sous-estimée,
et que la divergence entre deux populations soit très rapide, rendant le concept d’“espèce” peu
adapté à la situation observée. Ce point sera discuté pour le groupe L. ignoratus.

19
4. DISCUSSION | 20

4.2 Cox1 : un bon marqueur pour l’identification des es-


pèces ?

Au cours de ce travail, nous avons obtenu les premières séquences du gène mitochondrial Cox1
pour le genre Lamellodiscus. La région que nous avons étudiée est caractérisée par un taux de
divergence entre les individus très important, y compris à un niveau intraspécifique. Ce résultat
était inattendu, dans la mesure où la pression de sélection exercée sur ce gène est considérée comme
étant importante (il peut cependant être expliqué par le fait que Cox1 est un gène à évolution
rapide, qui peut présenter des niveaux de divergence entre individus importants). Au lieu des
séquences bien conservées mais fortement polymorphes que nous attendions (c.-à-d. peu de sites
variables, mais montrant une importante variabilité), nous avons obtenu un taux de variation très
élevé, avec notamment des cas fréquents de tri-allèlisme pour le groupe L. ignoratus. Plusieurs
hypothèses peuvent être émises pour expliquer cette observation.
L’impossibilité d’aligner l’Its1 entre espèces est une preuve d’évolution rapide (ou de grande
ancienneté) du genre Lamellodiscus (Kaci-Chaouch et coll., 2008). On peut supposer que le taux
de mutation est important pour le gène Cox1 , aboutissant à une divergence rapide des séquences,
et a un taux de polymorphisme très important au sein des espèces. Cette divergence rapide
aboutirait à la situation rencontrée actuellement par les équipes travaillant sur la systématique des
monogènes du genre Gyrodactylus spp. : la diversité mitochondriale est beaucoup plus importante
que ce qui avait été estimé, et les modèles les plus récents prévoient l’existence de près de 25000
espèces potentielles, faisant de Gyrodactylus le genre du monde vivant comportant le plus d’espèces
(Hansen et coll., 2007).
Cependant, il existe une autre hypothèse pour expliquer le fort polymorphisme de Cox1 chez
Lamellodiscus, et notamment le rapport PN /PS 1 intraspécifique très élevé (2.85 pour le groupe
L. ignoratus), a priori incompatible avec une pression de sélection s’appliquant sur la séquence
en acides aminés. Les fragments que nous avons amplifiés au cours de cette étude pourraient
ne pas être le gène Cox1 mitochondrial, mais un numt2 , c.-à-d. un gène mitochondrial ayant
transféré vers le génome nucléaire, et devenu un pseudo-gène, donc n’étant plus soumis à la
sélection (Piganeau et coll., 2004). S’opposent à cet argument le fait que nous n’ayons pas trouvé
de codon stop dans les séquences obtenues, et l’absence de mutations décalant le cadre de lecture,
deux événements permettant de détecter les numt.
1
Rapport entre le nombre de sites polymorphes non-synonymes et le nombre de sites polymorphes synonymes
dans un jeu de séquence
2
Nuclear mitochondrial dna

4.2. COX1 : UN BON MARQUEUR POUR L’IDENTIFICATION DES ESPÈCES ?


4. DISCUSSION | 21

4.3 Statut taxonomique du groupe L. ignoratus

4.3.1 Un probable complexe d’espèces

À ce jour, le seul marqueur génétique dont on dispose pour évaluer le statut taxonomique des
Lamellodiscus est l’Its1 ; il est possible d’aligner les séquences entre individus d’une même espèce,
mais pas entre deux espèces différentes (Kaci-Chaouch et coll., 2008). Les différentes séquences
que nous avons obtenues pour ce marqueur au cours de ce travail s’alignent pour l’ensemble
des individus du groupe L. ignoratus. Ce résultat suggère que les différentes “espèces” décrites
récemment (L. falcus, L. diplodi , L. confusus, L. neifari ) sont des L. ignoratus, mais qu’il existe au
sein de cette espèce une variabilité morphologique importante, se traduisant par la coexistence de
plusieurs états morphologiques “discrets”, sans que ces différences morphologies ne correspondent
à différentes espèces.
Les distances totales entre individus nous permettent de clarifier la position taxonomique de
ces morphes. Le fait que la distance entre individus L. ignoratus ss. soit du même ordre de
grandeur que celle entre individus de L. ignoratus sl., et qu’entre individus de L. ignoratus sl.
et L. ignoratus ss. considérés simultanément (c.-à-d., que tous ces individus sont à des distances
similaires), suggère que L. ignoratus sl. est un complexe d’espèces pas nécessairement différenciées,
et non un assemblage d’espèces avec des origines différentes.
Cette hypothèse est soutenue par les arbres reconstruits selon deux méthodes (maximum de
vraisemblance et inférence Bayesienne, figure 3.6). Étant donné que nous disposions d’un nombre
important de données pour le groupe L. ignoratus, nous avons inféré des arbres à partir des sé-
quences dont nous disposions. Il apparaît que L. neifari forme un groupe au sein des L. ignoratus,
pour les marqueurs Cox1 (figure 3.6(c)) et 18S (figure 3.6(a)). Les individus de l’espèce L. neifari
ne sont pas groupés sur l’arbre obtenu à partir des séquences de Its1 (figure 3.6(b)), indiquant
que ce morphe est sans doute en train de diverger à partir de L. ignoratus.
Les L. ignoratus ne semblent pas former de groupes, d’un point de vue moléculaire, sur leurs
différents hôtes (figure 3.6(b)), et les individus des morphes L. confusus, L. diplodi et L. falcus
se positionnent avec les L. ignoratus, même pour des nœuds bien soutenus. On peut interpréter
cette situation de deux manières. En considérant les données moléculaires uniquement, il semble
acquis que L. ignoratus, L. neifari , L. diplodi , L. falcus et L. confusus sont apparentés, les
derniers étant selon toute vraisemblance issus de L. ignoratus. Cependant, si l’on s’intéresse
aux caractéristiques morphologiques de ces groupes, il apparaît qu’il existe des différences entre
eux (L. neifari présente notamment une barre médiane discernable à la loupe binoculaire, cf.
figure 4.1). L’impact de cette dernière observation doit cependant être pondéré par le fait que la
description de nouvelles espèces de Lamellodiscus se fait précisément par observation d’un grand
nombre d’individus, et recherche de variations morphologiques “discrètes” (c.-à-d. entre lesquelles
on n’a pas observé d’état intermédiaire), et non par analyse moléculaire.

4.3. STATUT TAXONOMIQUE DU GROUPE IGNORATUS


4. DISCUSSION | 22

(a) L. ignoratus, vue d’en- (b) L. confusus, vue d’en- (c) L. neifari , détail de la
semble du hapteur semble du hapteur barre médiane ventrale

Figure 4.1 – Détails des hapteurs de L. ignoratus, L. confusus et L. neifari , montrant la différence dans la
morphologie de la barre médiane, critère d’identification de L. neifari .

4.3.2 L. neifari est-il en voie de spéciation ?

Dans une communication personnelle, Louis Euzet nous confiait que L. neifari n’avait été,
malgré un échantillonnage soutenu depuis près de 50 ans dans le Golfe du Lion et dans le sud de
la Méditerranée, et malgré sa morphologie caractéristique (figure 4.1), observé pour la première
fois il y a seulement quelques années. Il est intéressant de chercher dans les données génétiques
des indices confortant l’hypothèse d’une émergence récente et rapide de cette espèce, hypothèse
que nous avions formulée à cette occasion.
Concernant l’Its1, les distances génétiques entre individus au sein de l’espèce L. neifari (tableau
3.1) sont relativement faibles (en moyenne 0.143) au regard des distances entre individus au sein
du groupe L. ignoratus (en moyenne 0.155). Les distances entre L. neifari et les autres individus
du groupe L. ignoratus (en moyenne 0.174) sont compatibles avec le fait que L. neifari soit un
groupe au sein de L. ignoratus, les distances entre L. ignoratus (au sens strict) sur un hôte
atteignant au maximum 0.147 (sur D. vulgaris).
Trancher sur le fait que L. neifari représente ou non une espèce sur la base de ces distances est
une question difficile à résoudre. La comparaison statistique de ces distances ne fait pas sens, dans
la mesure où elles ne sont pas indépendantes. On considère donc la plupart du temps une distance
limite, fixée de manière arbitraire, au-dessus de laquelle on considère deux entités taxonomiques
comme étant distinctes. Dans la mesure où les distances entre L. neifari ne sont pas supérieures
aux distances entre L. ignoratus, ni aux distances au sein du groupe L. ignoratus, nous considérons
que L. neifari appartient au groupe L. ignoratus.
Quoique les distances génétiques entre les individus de l’espèce L. neifari et les L. ignoratus
nous amènent à penser que L. neifari fait partie du groupe L. ignoratus, les L. neifari sont
regroupés sur les différents arbres produits (figure 3.6). On peut considérer que, bien qu’étant
des L. ignoratus (possibilité d’aligner l’Its1, distances génétiques entre individus inférieures aux
distances entre individus du groupe L. ignoratus), les individus décrits comme L. neifari sont en
train de subir une divergence par rapport à leur espèce d’origine. Selon ce résultat, L. ignoratus
serait une espèce paraphylétique, dans la mesure où certaines lignées seraient en train de connaître

4.3. STATUT TAXONOMIQUE DU GROUPE IGNORATUS


4. DISCUSSION | 23

(a) Hypothèse 1 (b) Hypothèse 2 (c) Hypothèse 3

Figure 4.2 – 3 hypothèses pour le statut taxonomique du groupe L. ignoratus. Dans le premier cas, on considère
que L. ignoratus est une espèce unique, au sein de laquelle on peut distinguer différents morphes. Dans le second
cas, on reconnaît l’existence au sein du groupe L. ignoratus de plusieurs espèces, qui font de L. ignoratus au
sens strict une espèce paraphylétique. Dans le dernier cas, on suppose que la diversité des Lamellodiscus a été
sous-estimée, et qu’il existe un nombre très important d’espèces au sein du groupe L. ignoratus, comme il a été
avancé pour les Gyrodactylus par Hansen et coll. (2007)

une différenciation génétique, pouvant à terme aboutir à une spéciation.


Un autre argument en faveur d’une divergence de L. neifari est que pour les arbres construits
à partir des séquences du gène Cox1 (figure 3.6(c)), les individus de cette espèce sont isolés
des autres L. ignoratus. Cependant, sur les arbres reconstruits à partir de la séquence en acides
aminés, il est impossible de mettre en évidence un groupe constitué uniquement de L. neifari .
Nous proposons que, bien que L. neifari ait commencé à diverger des autres L. ignoratus, les
pressions de sélection agissant sur le gène Cox1 poussent à une conservation plus importante
de la séquence en acides aminés, rendant son signal phylogénétique moins clair (les séquences
en acides aminés sont, du fait de la redondance du code génétique, moins divergentes que les
séquences en adn).
Nous proposons que L. neifari , bien que n’étant pas moléculairement distinct de L. ignoratus
pour les marqueurs utilisés, est actuellement en train de diverger au sein du groupe L. ignoratus.

4.3.3 L. ignoratus est-il paraphylétique ?

L. ignoratus est très probablement un complexe d’espèces, avec des caractères morphologiques
et moléculaires très proches. L’étude des arbres obtenus met en avant le fait que les individus des
espèces L. confusus, L. diplodi, L. falcus et L. neifari sont répartis dans le groupe L. ignoratus,
c.-à-d. que l’espèce L. ignoratus au sens strict n’est pas monophylétique.
Ce résultat implique de choisir entre trois approches : (i) soit on considère que, malgré les
différences moléculaires et morphologiques existantes, les individus des différents morphes du
groupe L. ignoratus ne sont pas suffisamment différenciés pour que l’on considère des espèces
distinctes ; (ii) soit on considère que L. ignoratus ss. est une espèce paraphylétique ; (iii) soit on
considère que la diversité des Lamellodiscus (et des monogènes, voire même de différents groupes
à une échelle taxonomique beaucoup plus large) a été largement sous-estimée, et que le recours
systématique aux outils moléculaires est nécessaire pour avoir une image la plus précise possible
de la taxonomie de ce groupe.

4.3. STATUT TAXONOMIQUE DU GROUPE IGNORATUS


4. DISCUSSION | 24

Ces hypothèses sont reprises dans la figure 4.2. Pour déterminer laquelle est la plus proche de
la réalité biologique, il est nécessaire de passer par un travail d’échantillonnage important, pour
capturer le maximum de la diversité potentielle du groupe L. ignoratus, et pour obtenir le plus
grand nombre de séquences possible. De tels travaux ont été menés sur des Gyrodactylus, qui
provoquent des dommages conséquents en aquaculture, et qui représentent un enjeu économique
important (Zietara et Lumme, 2002; Bakke et coll., 2007). Cependant, sur des associations hôtes-
parasites ne suscitant pas cet intérêt du fait de leur faible risque pour les activités humaines, le
manque de données reste le principal obstacle à la compréhension des mécanismes évolutifs.

4.4 Morphométrie : quels apports, et quelles limites ?

Nous avons observé, au cours de ce travail, des différences significatives de morphométrie des
parasites entre les différentes espèces d’hôtes. Ce résultat suggère que les populations de La-
mellodiscus ne sont pas homogènes, et que l’hôte est un facteur influant sur les caractéristiques
morphométriques, et potentiellement sur le développement des parasites, quoique des études sur
ce point précis soient requises, la croissance des Lamellodiscus (et, à plus grande échelle, des
monogènes) restant largement inconnue (exception faite de quelques travaux, p. ex. sur Para-
diplozoon homoion par Pecinkova et coll. (2007) ou Diplectanum aequans par Cecchini et coll.
(1998)).
Au vu de nos résultats, il apparaît que la morphométrie est un outil plus résolutif que la simple
morphologie pour caractériser les parasites étudiés. Shinn et coll. (2001), par exemple, ont appliqué
des études morphométriques dans un but de diagnose sur les Gyrodactylus. De telles méthodes
pourraient être amenées à être considérées sur Lamellodiscus, si l’élevage de Sparidés se développe
dans le Golfe du Lion, comme il est en train de le faire en Croatie notamment.
Cependant, quoique nos résultats indiquent des différences dans la morphométrie selon les hôtes,
ils ne permettent pas nécessairement d’être résolutifs, c.-à-d. de déterminer, au vu de la morpho-
métrie, à quelle espèce un parasite appartient. Comme l’ont montré Kaci-Chaouch et coll. (2008),
le fait que les parasites généralistes soient plus variables que les spécialistes (à la fois génétique-
ment et morphométriquement) peut expliquer cette impossibilité. Desdevises et coll. (2002) ont
avancé que cette importante variabilité intraspécifique pouvait être considérée comme un facteur
favorisant la colonisation de nouveaux hôtes.
Pour le groupe L. ignoratus sl., nous n’avons pas mis en évidence de différence significative dans
la morphométrie selon les hôtes. Ce résultat ne signifie pas que les L. ignoratus sl. ne sont pas en
train de se différencier : il est possible que la méthode par landmarks utilisée ici ne nous permette
pas de mettre en évidence une différenciation — qui se ferait sur la forme des pièces sclérifiées
plutôt que sur leurs dimensions —, ou simplement que la différenciation sur les hôtes soit trop
récente pour se traduire par une différence dans la morphométrie. Si la morphométrie d’une espèce
varie de manière significative sur ses différents hôtes, cela indique qu’une différenciation existe ;

4.4. MORPHOMÉTRIE : QUELS APPORTS, ET QUELLES LIMITES ?


4. DISCUSSION | 25

un résultat non significatif n’implique pas, en revanche, une absence de différenciation.


Une autre utilisation de la morphométrie est la détection de variations au sein d’une espèce
d’hôte. Dans notre échantillon, nous avons obtenu un résultat très significatif pour les parasites
de D. sargus, notamment L. elegans. Pour expliquer cette observation, on peut avancer l’hypothèse
que la population de D. sargus dans notre zone d’étude n’est pas homogène (d’un point de vue
génétique, puisque la taille des hôtes seule n’explique pas la formation des deux groupes observés),
et qu’en conséquence, les populations de L. elegans sont différentes. Un travail sur les populations
hôtes, afin notamment de déterminer leur structure génétique, et les potentielles relations entre
cette structure et la formation de groupes morphométriques chez les parasites, était trop lourd à
mettre en place dans le cadre de ce travail, mais se révèle nécessaire à la lumière de ces nouvelles
observations. Cet exemple illustre le fait que la morphométrie soit plus résolutive que la simple
morphologie, qui ne permet pas de mettre en évidence deux populations distinctes de L. elegans
sur D. sargus.
La morphométrie, une fois les protocoles mis au point pour obtenir un nombre important de
données moléculaires (le manque d’efficacité de ces protocoles étant le principal obstacle à l’étude
des Lamellodiscus, comme il est discuté partie 4.5.2) pourra permettre de détecter de la plasticité
phénotypique chez les Lamellodiscus (comme l’ont fait Matejusová et coll. (2002)par exemple),
et de mettre en évidence une adaptation morphométrique des parasites à leurs hôtes. Des études
fonctionnelles sur les différentes pièces du hapteur (études in situ, structures musculaires,. . .) sont
nécessaires pour compléter nos connaissances dans ce domaine.

4.5 Conclusion & perspectives

4.5.1 Des événements de spéciation au sein des groupes morpholo-


giques ?

De nos résultats, nous pouvons tirer les informations suivantes. (i) La variabilité génétique
des Lamellodiscus est très importante, et mérite d’être réexaminée en utilisant un échantillon
de grande taille, et le nouveau marqueur (Cox1 ) disponible. (ii) La variabilité morphométrique
des espèces généralistes, comme l’ont montré Kaci-Chaouch et coll. (2008), est importante, mais
il existe des différences significatives entre les hôtes, suggérant que le développement du para-
site peut être influencé par l’hôte qu’il colonise. Des différences au sein des hôtes ont aussi été
observées, suggérant que l’adaptation morphométrique ne se fait pas au niveau d’une espèce
d’hôte, mais sur une population. Deux hypothèses peuvent être émises : soit les Lamellodiscus
sont fortement plastiques, soit des événements de spéciation rapides se produisent, y compris
entre deux populations d’hôtes, entraînant une adaptation locale. (iii) Enfin, nous avons montré
que L. ignoratus sl. est très probablement un complexe d’espèces, au sein duquel certains lignées
décrites récemment (notamment L. neifari ) sont en train de diverger, renforçant l’idée que les

4.5. CONCLUSION & PERSPECTIVES


4. DISCUSSION | 26

Lamellodiscus ont une évolution rapide.


Les données collectées lors de ce travail ne nous permettent pas de déterminer si les parasites
généralistes sont en voie de spéciation sur leurs différents hôtes. En revanche, nous avons pu mon-
trer que même au sein de groupes morphologiques bien identifiées, nous assistions à la divergence
rapide de certaines lignées. Desdevises et coll. (2002) ont proposé que la grande variabilité mor-
phométrique des Lamellodiscus leur permettait de coloniser fréquemment de nouveaux hôtes, et
que la spéciation rapide sur ces nouveaux hôtes était le principal moteur de la radiation évolutive
de ce genre, d’une manière similaire à ce qui est observé chez Gyrodactylus (p. ex. Zietara et
Lumme, 2002).
Šimková et coll. (2004) proposaient que, pour le genre Dactylogyrus, la spéciation intrahôte soit
un mécanisme de radiation évolutive important ; cette spéciation se ferait par la colonisation
de niches distinctes au sein du même hôte. Nos résultats indiquent que les Lamellodiscus, en
plus de leur radiation par transfert d’hôte suivi d’une spéciation, pourraient être enclins à la
spéciation intrahôte (cf. figure 3.6(a), où l’on voit que les L. neifari parasites de D. sargus ont
très probablement divergé à partir des L. ignoratus ss. sur ce même hôte).
Deux cas au moins de ce type de spéciation semblent exister dans le système Lamellodiscus–
sparidés (figure B.1). Le marbré (Lithognathus mormyrus) est parasité par deux espèces sœurs,
L. verberis et L. mormyri. De même, le sar à museau pointu (D. puntazzo) est infesté par Lamel-
lodiscus bidens et Lamellodiscus hilii, elles aussi espèces sœurs. Un travail plus exhaustif, portant
notamment sur l’emplacement de chaque individu sur la branchie, tel que réalisé par Šimková
et coll. (2004), permettrait de comparer la situation dans le genre Gyrodactylus à celle dans le
genre Lamellodiscus. Quoiqu’il en soit, nos résultats suggèrent que l’importance de la spéciation
intrahôte dans l’évolution du genre Lamellodiscus ne doit pas être sous-estimée.

4.5.2 Ce qui reste à faire

Au cours de ce travail, nous avons collecté une quantité importante de données morphométriques
et moléculaires, qui pourront par la suite être mises en relation avec d’autres jeux de données
sur des associations monogènes–poissons. Il sera par exemple possible de chercher a caractériser
les profils d’évolution morphométrique du hapteur, en relation avec la phylogénie et le niveau
de spécificité, afin de déterminer si cette évolution est adaptative, ou si elle résulte d’une inertie
phylogénétique.
Nombreux sont ceux qui s’accordent sur le fait que les monogènes sont un modèle particu-
lièrement adapté pour étudier une large gamme de questions en écologie évolutive (p. ex. Mc-
Coy, 2003). Parmi les monogènes, l’association Lamellodiscus–sparidés est un système de choix.
D’une part, des espèces généralistes et des spécialistes coexistent, différents modes de spéciations
semblent être à l’œuvre, et l’évolution du genre est rapide. D’autre part, nous disposons d’un
jeu de données conséquent, et d’un bon suivi dans le temps de cette association. Cependant, de
nombreux obstacles existent encore.

4.5. CONCLUSION & PERSPECTIVES


4. DISCUSSION | 27

Figure 4.3 – Distribution des Lamellodiscus selon le gbif. Une seule occurrence ce genre est répertoriée, sur les
côtes indiennes, malgré le fait que cette espèce soit présente partout à l’échelle mondiale

Premièrement, nous ne connaissons que peu de choses de la biologie des Lamellodiscus. Leur
cycle de vie n’est connu que de manière qualitative. On ne connaît que très mal la modification
de la morphologie (sans parler de la morphométrie) au cours du développement, le mode exact de
reproduction, ou le temps de génération. Les études portant sur les interactions chimiques entre les
Lamellodiscus et leurs hôtes sont, à notre connaissance, inexistantes. Un récent travail de Faliex
et coll. (2008) s’est intéressé à ces questions dans le système D. aequans–Dicentrarchus labrax ,
ouvrant de nouvelles pistes de recherche intéressantes, notamment concernant les modulations la
réponse immune de l’hôte au cours de l’infestation.
Deuxièmement, les protocoles de biologie moléculaire demandent un travail important de mise
au point. Le taux de réussite lors de l’amplification des marqueurs reste relativement faible, et
empêche l’obtention d’un nombre important de séquences. Une exploration du niveau de diver-
sité génétique des Lamellodiscus est pourtant requise pour comprendre l’évolution de ce genre,
d’autant plus que nos résultats soulignent qu’elle a probablement été très sous-estimée.
Enfin, il existe des Lamellodiscus hors du Golfe du Lion, et hors de la Méditerranée. On trouve
des espèces dans l’Adriatique, en Inde, en Asie du Sud-Est, en Nouvelle Calédonie 3 , et en Australie
(quoique la distribution des Lamellodiscus soit encore mal connue, parce que le genre reste peu
étudié, comme en atteste le figure 4.3). Ce genre est présent en de nombreux endroits à la surface
du globe, et une étude biogéographique pourrait apporter des informations intéressantes : les
niveaux de variabilité génétique observés sont-ils une règle, ou une exception locale ? Quelle est le
niveau de divergence entre les Lamellodiscus méditerranéens et les autres populations ? Un travail
sur cet axe devra être envisagé dans les prochaines années, afin de compléter nos connaissances
sur le genre Lamellodiscus, qui est un modèle très prometteur pour apporter des réponses à de
grandes questions en écologie évolutive.

3
Jean-Lou Justine, communication personnelle

4.5. CONCLUSION & PERSPECTIVES


Bibliographie
Amine, F., Euzet, L. et Kechemir-Issad, N. (2007), ‘La- Huyse, T. et Volckaert, F. (2005), ‘Comparing host
mellodiscus theroni sp. nov.(Monogenea, Diplectani- and parasite phylogenies : Gyrodactylus flatworms
dae), a gill parasite from Diplodus puntazzo (Teleos- jumping from goby to goby’, Systematic Biology
tei, Sparidae) from the Mediterranean Sea’, Acta Pa- 54(5), 710–718.
rasitologica 52(4), 305–309.
Justine, J. (1998), ‘Non-monophyly of the mono-
Bakke, T., Cable, J. et Harris, P. (2007), ‘The biology geneans ?’, International Journal for Parasitology
of Gyrodactylid Monogeneans : The "Russian-doll 28(10), 1653–1657.
killers"’, Advances in Parasitology .
Kaci-Chaouch, T., Verneau, O. et Desdevises, Y. (2008),
Brooks, D. et McLennan, D. (1993), Parascript : Para- ‘Host specificity is linked to intraspecific variability in
sites and the language of evolution, Smithsonian Ins- the genus Lamellodiscus (Monogenea)’, Parasitology
titution Press Washington, DC. 135(5), 607–616.

Buchmann, K. et Lindenstrøm, T. (2002), ‘Interactions Kunz, W. (2002), ‘When is a parasite species a species ?’,
between monogenean parasites and their fish hosts’, Trends in Parasitology 18(3), 121–124.
International Journal for Parasitology 32(3), 309–
Littlewood, D. T., Rohde, K. et Clough, K. A. (1997),
319.
‘Parasite speciation within or between host species ?
Cecchini, S., Saroglia, M., Berni, P. et Cognetti-Varriale, – phylogenetic evidence from site-specific polystome
A. (1998), ‘Influence of temperature on the life cycle monogeneans.’, International Journal for Parasito-
of Diplectanum aequans (Monogenea, Diplectanidae), logy 27(11), 1289–1297.
parasitic on sea bass, Dicentrarchus labrax (L.)’,
Marzluff, J. et Dial, K. (1991), ‘Life History Correlates
Journal of Fish Diseases 21, 73–75.
of Taxonomic Diversity’, Ecology 72(2), 428–439.
de Meeûs, T., Michalakis, Y. et Renaud, F. (1998),
Matejusová, I., Koubková, B., Gelnar, M. et Cunnin-
‘Santa Rosalia Revisited : or Why Are There So Many
gham, C. (2002), ‘Paradiplozoon homoion Bychowsky
Kinds of Parasites in The Garden of Earthly De-
& Nagibina, 1959 versus P. gracile Reichenbach-
lights’ ?’, Parasitology Today 14(1), 10–13.
Klinke, 1961 (Monogenea) : two species or phenotypic
Desdevises, Y., Morand, S., Jousson, O. et Legendre, P. plasticity ?’, Systematic Parasitology 53(1), 39–47.
(2002), ‘Coevolution between Lamellodiscus (Mono- McCoy, K. D. (2003), ‘Sympatric speciation in para-
genea : Diplectanidae) and Sparidae (Teleostei) : the sites – what is sympatry ?’, Trends in Parasitology
study of a complex host-parasite system.’, Evolution 19(9), 400–404.
56(12), 2459–2471.
Nieberding, C. M. et Olivieri, I. (2007), ‘Parasites :
Faliex, E., Da Silva, C., Simon, G. et Sasal, P. (2008), proxies for host genealogy and ecology ?’, Trends in
‘Dynamic expression of immune response genes in the Ecology & Evolution 22(3), 156–165.
sea bass, Dicentrarchus labrax, experimentally infec-
ted with the monogenean Diplectanum aequans’, Fish Pecinkova, M., Matejusova, I., Koubkova, B. et Gel-
and Shellfish Immunology 24(6), 759–767. nar, M. (2007), ‘Investigation of Paradiplozoon ho-
moion (monogenea, diplozoidae) life cycle under ex-
Hansen, H., Bakke, T. et Bachmann, L. (2007), ‘DNA perimental conditions.’, Parasitology International
taxonomy and barcoding of monogenean parasites : 56(3), 179–183.
lessons from Gyrodactylus’, Trends in Parasitology
23(8), 363–367. Piganeau, G., Gardner, M. et Eyre-Walker, A. (2004), ‘A
Broad Survey of Recombination in Animal Mitochon-
Huyse, T. et Volckaert, F. (2002), ‘Identification of dria’, Molecular Biology and Evolution 21(12), 2319–
a host-associated species complex using molecular 2325.
and morphometric analyses, with the description
of Gyrodactylus rugiensoides n. sp.(Gyrodactylidae, Poulin, R. (2007), Evolutionary Ecology of Parasites, 2nd
Monogenea)’, International Journal for Parasitology edn, Princeton University Press.
32(7), 907–919.
Renaud, F., Clayton, D. et Meeüs, T. (1996), ‘Biodi-
versity and evolution in host-parasite associations’,
Biodiversity and Conservation 5(8), 963–974.

28
4. DISCUSSION | 29

Rohde, K. (1989), ‘Simple ecological systems, simple so-


lutions to complex problems ?’, Evolutionary Theory
8, 305–350.

Rohde, K. (2005), Marine Parasitology, CSIRO Publi-


shing.

Shinn, A. P., Gibson, D. I. et Sommerville, C. (2001),


‘Morphometric discrimination of Gyrodactylus salaris
malmberg (monogenea) from species of Gyrodactylus
parasiting british salmonids using novel parameters’,
Journal of Fish Biology 24, 83–97.

Šimková, A., Morand, S., Jobet, E., Gelnar, M. et Ver-


neau, O. (2004), ‘Molecular phylogeny of congeneric
monogenean parasites (Dactylogyrus) : a case of in-
trahost speciation.’, Evolution 58(5), 1001–1018.

Timms, R. et Read, A. (1999), ‘What makes a specialist


special ?’, Trends in Ecology & Evolution 14(9), 333–
334.

Van Valen, L. (1973), ‘A new evolutionary law’, Evolu-


tionary Theory 1(1), 1–30.

Zietara, M. et Lumme, J. (2002), ‘Speciation by host


switch and adaptive radiation in a fish parasite ge-
nus Gyrodactilus (Monogenea, Gyrodactylidae)’, Evo-
lution 56(12), 2445–2458.

BIBLIOGRAPHIE
Diagnose des Lamellodiscus

A.1 Caractéristiques générales

Il n’existe pas de synapomorphie pour soutenir la monophylie des monogènes (cf. Justine (1998),
reprenant les références qui ont été consultées pour la rédaction de cette partie). Cependant, les
différentes phylogénies établies sur la base de la morphologie des adultes soutiennent l’hypo-
thèse d’une séparation des monogènes entre Monopisthocotylea et Polyopisthocotylea, et c’est la
séparation à laquelle nous nous sommes conformés au cours de ce travail. Les Monopisthocoty-
lea, auxquels appartiennent les Diplectanidae, présentent un hapteur composé de hamuli (grands
crochets) et d’uncinuli (crochetons), ne subissant pas de profonde métamorphose au cours du
développement post-larvaire.
La famille des Diplectanidae, comprenant environ 250 espèces principalement parasites bran-
chiaux de perciformes marins et à laquelle appartient le genre Lamellodiscus, est caractérisée par
(i) la présence d’organes d’attachement accessoires (lamellodisques ou squamodisques), (ii) la
composition du hapteur, avec trois barres transversales connectées à deux paires d’ancres (com-
posées d’un hamuli ventral et d’un hamuli dorsal), ainsi que (iii) la présence d’un germarium
prétesticulaire, entourant le cæcum intestinal par la droite.
Les Lamellodiscus sont le genre type pour la sous-famille des Lamellodiscinae (contenant, outre
Lamellodiscus, les genres Calydiscoides, Protolamellodiscus, Telegamatrix et Furnestinia). Cette
famille est caractérisée par une ouverture du pore génital antérieure à l’organe copulatoire mâle
(ocm). L’ocm est tubulaire, et présente dans certains genres une pièce accessoire “en Y”. Les œufs
sont ovales ou tétraédriques. La partie antérieure présente des organes d’attachement (ventouses).
On dénombre un ou deux lamellodisques.
Les Lamellodiscus sont caractérisés par la présence de deux paires de tâches oculaires en position
antérieure, non fonctionnelles chez l’adulte (et vestigiales chez certaines espèces). Ils présentent
deux lamellodisques, sur les faces ventrales et dorsales. L’ocm est simple et présente des sclérifica-
tions. Les œufs sont tétraédriques. Les lamelles intermédiaires du lamellodisque sont partiellement
fusionnées, ou libres. L’espèce type est Lamellodiscus typicus Johnston & Tieggs 1922.

30
ANNEXE A. DIAGNOSE DES LAMELLODISCUS | 31

(a) bmv (b) ocm type “en lyre”

(c) bld type ignoratus (d) bld type ergensi

(e) Lamellodisque

Figure A.1 – Caractères utilisés pour la diagnose. P : proximal. D : distal. A : antérieur. Po : postérieur. Pi : pièce
impaire. Pp : pièce paire. La notion de “palette” correspond a un aplatissement des bld en position proximale. Le
lamellodisque de gauche a des lamelles intermédiaires unies, celui de droite présente des lamelles intermédiaires
libres, avec la dernière incurvée

A.2 Caractéristiques des morphotypes étudiés

A.2.1 Morphotypes et caractères

Nous séparons les Lamellodiscus généralistes présents sur la zone d’étude en trois groupes, L. ele-
gans, ignoratus, et ergensi, les deux derniers comprenant plusieurs morphotypes pour lesquelles
une diagnose est proposée ici. Les morphotypes sont définis pour la forme adulte du parasite. Les
caractères les plus importants sont la fragmentation ou non des barres latérales dorsales (bld), la
structure globale du lamellodisque (lamelles intermédiaires réunies où libres), et le type d’organe
copulatoire (cf. figure A.1)
Á l’intérieur des types principaux, la discrimination se fait sur la base de détails : longueurs
relatives des pièces de l’appareil copulatoire, motifs de la barre médiane ventrale (bmv), présence
d’encoches sur les bld.
La diagnose proposée ici s’appuie sur la forme générale des parties sclérifiées. Les crochetons
marginaux n’étant visibles qu’après coloration au jaune de Malmberg, protocole incompatible
avec les analyses conduites, ils n’ont pas été examinés.

A.2. CARACTÉRISTIQUES DES MORPHOTYPES ÉTUDIÉS


ANNEXE A. DIAGNOSE DES LAMELLODISCUS | 32

A.2.2 Type ignoratus

Le type ignoratus est caractérisé par des bld non segmentées. L’espèce type de ce groupe mor-
phologique est L. ignoratus. Des confusions sont possibles entre les types L. ignoratus, L. diplodi,
L. confusus, et L. falcus notamment.

L. ignoratus

L. ignoratus présente une bmv longue, avec deux renflements importants en position distale. Les
bld sont légèrement coudées, avec une palette importante en position proximale, portant une en-
coche légère. L’ocm est de type “en lyre”, avec un jupe peu prononcée. Les lamelles intermédiaires
sont libres.

L. diplodi

L. diplodi est caractérisé par une barre médiane ventrale (bmv) fine et longue, des bld faible-
ment coudées, en palette, présentant une encoche dans la partie proximale (la plus proche de la
bmv). Les lamelles intermédiaires sont libres. L’ocm est de type “en lyre”, sans jupe.

L. falcus

L. falcus est caractérisé par un ocm avec une pièce impaire en forme de faux, présentant une
jupe. La bmv, légèrement plus courte que celle de L. ignoratus, présente une encoche, et des
renflements assez marqués dans les parties distales. Les lamelles sont libres. Les bld sont courtes
et présentent un motif en palette très prononcé, avec une encoche dans la partie proximale.

L. mormyri

L. mormyri possède un ocm caractéristique avec deux pièces complexes ; l’une en forme de
pince, l’autre en rectiligne avec deux fins diverticules en son milieu. Les bld sont longues et
fines, et présentent une coudure dans leur partie distale. On observe une légère palette en partie
proximale, avec une excroissance fine caractéristique du côté postérieur (pouvant correspondre à
une encoche très marquée). La bmv présente deux renflements légers en partie distale.

L. neifari

L. neifari présente une bmv caractéristique, très courte avec une encoche très nette dans la
partie antérieure. Les bld sont courtes, très peu courbées, avec une palette légère en position
proximale. L’ocm est de type “en lyre”, avec jupe, avec une pièce impaire relativement rectiligne.
Les lamelles intermédiaires sont libres.

A.2. CARACTÉRISTIQUES DES MORPHOTYPES ÉTUDIÉS


ANNEXE A. DIAGNOSE DES LAMELLODISCUS | 33

L. confusus

L. confusus est principalement caractérisé par son hôte (S. salpa). Il présente une bmv courte,
présentant peu de renflements, et des bld avec un motif en palette en position proximale. L’ocm
est de type “en lyre”, avec une jupe, et les deux branches de la pièce paire sont de taille similaire.
Les lamelles intermédiaires sont libres.

A.2.3 Type ergensi

Le type ergensi est caractérisé par des barres latérales dorsales segmentées. L’espèce type de ce
groupe morphologique est L. ergensi (seule espèce de ce groupe à ne pas présenter de segmentation
claire des bld, selon les descriptions).

L. ergensi

L. ergensi présente des bld pas ou peu coudées, en une pièce, avec des crénelures nombreuses.
La bmv est épaisse, avec une faible encoche. Les lamelles intermédiaires sont libres. L’ocm, de
type “en lyre”, ne présente pas de jupe.

L. tomentosus

L. tomentosus présente une bmv en forme de “V”, trappue en son centre et s’affinant vers
les parties distales. L’ocm est de type “en lyre”, sans jupe, avec une pièce impaire relativement
rectiligne. Les bld sont épaisses et fragmentées, avec de nombreux diverticules.

L. kechemirae

L. kechemirae présente une bmv courte, avec une encoche dans la partie antérieure peu profonde
mais très marquée. Les bld sont courtes, avec de nombreux diverticules. L’ocm est de type “en
lyre”.

A.2.4 L. elegans

L. elegans est caractérisé par la forme de son ocm, composé de deux pièces, l’une droite, l’autre
en croissant. Ses bld sont non segmentées. Les lamelles intermédiaires sont libres, la dernière est
incurvée. La bmv présente deux légers renflements sur les parties distales. Les bld sont longues
et peu courbées, et peuvent présenter un léger aplatissement en palette sur la partie proximale.

A.2. CARACTÉRISTIQUES DES MORPHOTYPES ÉTUDIÉS


Associations retenues

Nom
Scientifique Vernaculaire Régime alimentaire Taille max. (cm) Poids max. (g) Bathymétrie (m)
Diplodus vulgaris Sar à tête noire carnivorie 45 1300 0–160
Diplodus annularis Sparaillon broutage d’invertébrés 24 0–90
Diplodus puntazzo Sar à museau pointu carnivorie 60 1680 0–150
Diplodus sargus Sar commun carnivorie 45 1670 0–50
Lithognathus mormyrus Marbré carnivorie 55
Sarpa salpa Saupe herbivorie 51 0–70
Olbada melanura Oblade omnivorie 34 0–30

Tableau B.1 – Espèces d’hôtes retenues au cours de cette étude, et quelques caractéristiques écologiques. Les
données ont été obtenues via FishBase

Figure B.1 – Cophylogènie des Lamellodiscus et de leurs hôtes sparidés, telle qu’obtenue par Desdevises et coll.
(2002). Les associations marquées par des traits plus épais sont celles qui pourraient résulter d’une spéciation
intrahôte

34
D. sargus (7) D. vulgaris (6) D. puntazzo (1) D. annularis (3) O. melanura (1) L. mormyrus (1) S. salpa (1)
L. ignoratus 15 6 2 1 10 3
L. diplodi 1 •
L. falcus 2 4
L. elegans 33 10 2 5
L. neifari 4 1
L. confusus 1 1
L. mormyri ? •
L. furcosus 7 •
L. ergensi 12 2 •
L. kechemirae 6 16
L. tomentosus • 3

Tableau B.2 – Associations entre hôtes et parasites étudiés. Les nombres représentent le nombre de fois ou cette association a été observée. • : association reportée
dans la littérature, mais pas dans notre échantillon. ? : première observation du parasite sur l’hôte. En plus des parasites généralistes, nous avons inclus dans notre
échantillon certaines espèces ayant été décrites récemment à partir de variations morphologiques par rapport à une espèce déjà existante, ainsi que des espèces observées
sur des hôtes sur lesquels elles ne sont pas décrites dans la littérature. Le nombre d’individus de chaque espèce hôte est indiqué entre parenthèses dans la première
ligne
ANNEXE B. ASSOCIATIONS RETENUES | 35
Protocoles de biologie moléculaire et
analyses

C.1 Tampons de pcr

Produit Concentration Volume par tube (µL)


Buffer 5X 5
Amorce sens 5pmol/µL 4
Amorce antisens 5pmol/µL 4
dNTP 5pmol/µL 2
MgCl2 25mM 1,5
H2 O miliQ 5,35
GoTaq 0,15
adn 3

Tableau C.1 – Composition du mélange utilisé pour l’amplification des cibles. Les pcr ont été effectuées avec un
kit Promega “GoTaq Flexidna Polymerase, ref. M8301”

C.2 Cycles de pcr

Étape Temps Durée


Hot-start 95˚C
Dénaturation initiale 6 min. 95˚C
Cycles principaux (×35) 1 min. 95˚C
1 min. 48˚C
2 min. 72˚C
Élongation finale 10 min. 72˚C

Tableau C.2 – Cycles de pcr utilisé pour l’amplification des cibles

36
ANNEXE C. PROTOCOLES DE BIOLOGIE MOLÉCULAIRE ET ANALYSES | 37

C.3 Analyses statistiques

C.3.1 Test t (de Student) par permutation

Le test T de Student par permutations a été implémenté pour le langage R au cours de ce


travail. Le code de la fonction StudentPerm est fourni ici (figure C.1).

C.3. ANALYSES STATISTIQUES


ANNEXE C. PROTOCOLES DE BIOLOGIE MOLÉCULAIRE ET ANALYSES | 38

StudentPerm <- function(sample1,sample2,nperm=999){


# StudentPerm
# -----------------------------------------------------------
# A R function to perform Students’ t-test by permutation
# Arguments to pass when calling the function are :
# sample1, sample2 (mandatory - R objects)
# the two samples to be compared
# nperm (optional - Positive integer)
# the number of permutations to perform
# default value is set to 999
# For any informations contact timothee.poisot@obs-banyuls.fr
# -----------------------------------------------------------
require(car)
stu<-t.test(sample1,sample2)
stu.p<-stu$p.value
stu.t<-stu$statistic
stu.df<-stu$parameter
count <- 1
result <- matrix(rep(0,3),1)
colnames(result)=c("T statistic (Df)","Parametric p-value", "Permutations p-value")
for(i in 1:nperm){
SAMPLE<-sample(c(sample1,sample2))
RS1<-SAMPLE[1:length(sample1)]
RS2<-SAMPLE[length(sample1)+1:length(SAMPLE)]
stu.perm<-t.test(RS1,RS2)
stu.perm.p<-stu.perm$p.value
stu.perm.t<-stu.perm$statistic
if(abs(stu.perm.t) >= abs(stu.t)) {count <- count+1}
}
result[1,1]=paste(round(stu.t,4),’(’,round(stu.df,4),’)’,collapse=’’)
result[1,2]=round(stu.p,6)
result[1,3]=count/(nperm+1)
return(result)
}

Figure C.1 – Code R de la fonction StudentPerm, réalisant le test de Student par permutations. Cette fonction
prend 3 arguments ; sample1 et sample2 sont obligatoires, et correspondent aux deux jeux de données à comparer ;
nperm est fixé par défaut à 999 et correspond au nombre de permutations à réaliser

C.3. ANALYSES STATISTIQUES