Journal of Renin-Angiotensin-Aldosterone

System
http://jra.sagepub.com/

Simple renal cysts and hypertension are associated with angiotensinogen (AGT) gene variant in Shiraz
population (Iran)
SMB Tabei, A Nariman, K Daliri, J Roozbeh, A Khezri, HR Goodarzi, M Lotfi, S Sefidbakht and M Entezam
Journal of Renin-Angiotensin-Aldosterone System published online 1 August 2013
DOI: 10.1177/1470320313494941

The online version of this article can be found at:

http://jra.sagepub.com/content/early/2013/08/01/1470320313494941

Published by:

http://www.sagepublications.com

Additional services and information for Journal of Renin-Angiotensin-Aldosterone System can be found at:

Email Alerts: http://jra.sagepub.com/cgi/alerts

Subscriptions: http://jra.sagepub.com/subscriptions

Reprints: http://www.sagepub.com/journalsReprints.nav

Permissions: http://www.sagepub.com/journalsPermissions.nav

>> OnlineFirst Version of Record - Aug 1, 2013

What is This?

Downloaded from jra.sagepub.com by guest on December 4, 2013

494941
2013
JRA0010.1177/1470320313494941Journal of the Renin-Angiotensin-Aldosterone SystemTabei et al.

Article

Journal of the Renin-Angiotensin-

Simple renal cysts and hypertension are Aldosterone System

0(0) 1­–6
© The Author(s) 2013
associated with angiotensinogen (AGT) Reprints and permissions:
sagepub.co.uk/journalsPermissions.nav
gene variant in Shiraz population (Iran) DOI: 10.1177/1470320313494941
jra.sagepub.com

Tabei SMB1, Nariman A1, Daliri K1, Roozbeh J2, Khezri A3,
Goodarzi HR1, Lotfi M4, Sefidbakht S4 and Entezam M1

Abstract
Aim: To our knowledge, the relationship between simple renal cysts, hypertension and three significant genes of the
renin-angiotensin system (AGT, AT1R and ACE1) has not been studied. The present study was designed to search for
possible relationships between these significant polymorphic components, hypertension and simple renal cysts in Shiraz
province (Iran).
Methods: A total of 160 participants were recruited from the Motahari Clinic at Shiraz University of Medical Sciences.
The subjects were divided into four main groups. Detection of the ACE1 genotype was performed with a nested-poly-
merase chain reaction (PCR) protocol. Two separate restriction fragment length polymorphism-PCR assays were used
to identify AGT and AT1R genotypes.
Results: The allele frequency of AGT M235T differed significantly between group 1 (patients with simple renal cysts and
hypertension) and normal individuals (p <0.05). There were no significant differences in frequency for the other genes
(ACE1 and AT1R).
Conclusions: Our findings show a relationship between the AGT-TT genotype and hypertension in patients with both
hypertension and simple renal cysts. This finding suggests an additive role for the AGT gene of the renin-angiotensin
system in the process of hypertension and simple renal cysts formation. Future studies are needed to elucidate the
mechanisms through which this association is mediated.

Keywords
Hypertension, simple renal cyst, renin-angiotensin system, polymorphism, angiotensinogen

Introduction
Renal cysts are the most common space-occupying lesions
of the kidney.1 A classification of renal cysts on the basis of
their appearance on computed tomography was introduced
by Bosniak in 1986 and refined in 2003.2 Whether labeled
simple or complex, regardless of their radiologic character-
istics, the terms used are all descriptive. Simple cysts are
distinct lesions within the kidney that are typically cortical,
extending outside the parenchyma. They are commonly
considered as a harmless anomaly, while cases of compli-
cated renal cysts have been reported. The majority of com-
plications are spontaneous rupture, hemorrhage and
infections. The reported overall prevalence of simple cysts
is variable. Depending on the population and method of
study, the prevalence ranges from 2.38% in the second to
hematuria as a result of complications, or subsequent to an
enlarging cyst.3–7
Previous studies have noted the association between
simple renal cysts and hypertension, but the relationship
between these cysts and hypertension has not been studied
yet.8–10 Some case reports have described patients with sim-
ple renal cysts and hypertension in whom renin released
from the affected kidney was increased and blood pressure
normalized after surgical removal of the cysts.11
1Department of Medical Genetics
2Shiraz
Nephrology—Urology Research Center
3Department of Urology

35.29% in the seventh decade of life.3 Some potential risk 4Department of Radiology, Shiraz University of Medical Sciences, Iran

factors for the appearance of simple cysts are age, sex, renal
stone, serum creatinine, smoking and hypertension.
Sporadically, they become symptomatic and may present
with flank pain, abdominal discomfort, a palpable mass or
Corresponding author:
Seyed Mohammad Bagher Tabei, Department of Medical Genetics,
Shiraz University of Medical Sciences, Shiraz, Iran.
Email: tabeismb@sums.ac.ir

Downloaded from jra.sagepub.com by guest on December 4, 2013

2 Journal of the Renin-Angiotensin-Aldosterone System 0(0)

Table 1.  PCR cycling conditions of ACE1 are represented as temperature and time [minute (m), seconds (s) of denaturation,
annealing and extension, × number of cycles].

Gene polymorphism Forward primer (FP) size (bp) PCR cycling conditions PCR product (bp)
size (bp)
ACE1 FP: 94°C, 1 m (1 cycle), 94°C, 30 s 490, 190
  5CTGGAGACCACCCATCCTTTCT3 58°C, 30 s  
  RP: 72°C, 1 m  
  5GATGTGGCCATCACATTCGTCAGAT3 72°C, 8 m  
  (1 cycle) × 60  
  Nested PCR  
  FP: 94°C, 190, 335
  5TCGGACCACAGCGCCCGCCACTAC3 1m  
  RP: (1 cycle)  
  5CGCCAGCCCTCCCATGCCCATAA3 94°C,  
  30 s  
  58°C,  
  30 s  
  72°C,  
  1m  
  72°C, 8 m (1 cycle) × 60  

PCR: polymerase chain reaction; ACE1: angiotensin-converting enzyme gene; RP: reverse primer.

The renin-angiotensin system as a circulating or hor-
monal system regulates blood pressure, electrolyte and
fluid homeostasis and is mainly related to the short- and
long-term regulation of arterial blood pressure.12,13
Studies of the renin-angiotensin system in experimental
animal models have detected remarkable genetic poly-
morphisms chiefly involving the angiotensinogen gene
(AGT), AT1 receptor gene (AT1R) and angiotensin-con-
verting enzyme gene (ACE1). Studies that investigated
hypertension in relation with the renin-angiotensin sys-
tem have indicated that there are naturally occurring
genetic variations within the renin-angiotensin system in
animals as well as humans.13
In diverse genetic or environmental backgrounds, a
specific gene variant might be a sign of different patho-
physiological implications.14,15 As a result, the present
case-control study was designed as (to our knowledge)
the first attempt to identify possible associations between
polymorphisms of three significant genes of the renin-
angiotensin system (AGT, ACE1 and AT1R) and hyper-
tension in patients with simple renal cysts in a southern
population of Iran (Shiraz).
Methods
Study subjects
A total of 160 participants were recruited from Motahari
Clinic, affiliated with Shiraz University of Medical
Sciences. The subjects were divided into four groups:
patients with simple renal cysts and hypertension (group 1,
n = 40), simple renal cysts without hypertension (group 2,
n = 40) healthy individuals without any renal complications
(group 3, control, n = 40) and hypertension without simple
renal cysts (group 4, n = 40).
Informed consent was obtained from all participants.
The protocol for this project was approved by the ethics
committee of Shiraz University of Medical Sciences, Iran.
In this study hypertension was defined as 140 mmHg sys-
tolic blood pressure and 90 mmHg diastolic blood pres-
sures or the use of antihypertensive therapy. Blood pressure
was measured on the right arm with an automated blood
pressure monitor while the subject was seated and resting
for at least 10 minutes.
DNA preparation
Blood samples (5.0 ml) were drawn from a peripheral vein
into an ethylenediaminetetraacetic acid (EDTA) tube by a
qualified lab technician. Genomic DNA extraction was per-
formed with the standard salting-out protocol. The quality
and quantity of extracted DNA were evaluated with a
NanoDrop spectrophotometer at 260/280 nm.
Determination of ACE1, AGT and AT1R
genotypes
The ACE1 genotypes (insertions and deletions) were deter-
mined with a nested polymerase chain reaction (PCR) pro-
tocol. In this method the polymorphism status was first
assessed, and then to increase accuracy, another reaction
was performed. The second independent reaction was run
under the same PCR conditions except for annealing tem-
perature and primer sequence (Table 1).
PCR amplification of deletions (D) and insertions (I) of
ACE1 were evaluated in a 25 μl reaction mixture containing

Downloaded from jra.sagepub.com by guest on December 4, 2013

Tabei et al. 3

Table 2.  PCR cycling conditions of AGT and AT1R are represented as temperature and time [minute (m), seconds (s) of
denaturation, annealing and extension, × number of cycles].

Gene Primers PCR cycling Restriction Product size Restriction

enzyme size (bp)
AGT FP: 94°, 5 m Msp I 104 bp 31, 73
  5–TGACAGGATGGAAGACTGGCTGCTCCCTGC–3 (1 cycle)  
  RP: 94°C 30 s  
  5–AGCAGAGAGGTTTGCCTTACCTTG–3 60°C –45 s  
  68°C –1 m  
  72°C –  
  10 m  
  (1 cycle) × 30  
AT1R FP: 94 °C 5 m Dde I 540 bp 430, 110
  5–CTG GAGACCACTCCCATCCTTTCT–3 (1 cycle)  
  RP: 94°C 30 s  
  5–GATGTGGCCATCACATTCAGAT–3 55°C 30 s  
  72°C 60 s  
  72°C 10 m  
  (1 cycle) × 30  

PCR: polymerase chain reaction; AGT: angiotensinogen gene; AT1R: AT1 receptor gene; FP: forward primer; RP: reverse primer.

200 ng of the template DNA, 7.5 pmol/l of each primer, 0.2

mM of each dNTP, 1.5 mM MgCl2, 2.5 µL10× buffer and
1 U Taq DNA polymerase.
The PCR amplification included 30 cycles of denatura-
tion at 94°C (one minute), annealing at 58°C (one minute)
and extension at 72°C (two minutes). The amplification
reaction yielded a 335-bp product only in the presence of
the I allele (ID heterozygous) whereas no product was
found in DD-homozygous individuals.12,13
The PCR conditions for determining the genotype of
AGT were amplification of 200–300 ng of genomic DNA in Figure 1.  Genotype and allele distribution of AGT gene
a 25 μl reaction mixture consisting of 7.5 pmol of each polymorphisms in four groups.
primer, 0.5 mM of each dNTP, 2 mM MgCl2, 2.5 µL10× AGT: angiotensinogen.
buffer and 1.25 U Taq DNA polymerase.
The PCR amplification for AGT included 30 cycles at for the A allele and 110 bp for the C allele. A negative con-
94°C (30 seconds), 60°C (45 seconds) and 68°C (one min- trol containing no genomic DNA and a positive control of
ute). The amplified products were analyzed by electropho- known genotype were always used in the set of reactions.
resis in 1.5% agarose gel. To identify the AGT M235T The PCR cycling conditions for AT1R and AGT are shown
genotype, 104-bp PCR products were digested with an in Table 2.
MspI restriction enzyme. The 73-bp and 31-bp digestion
products were then analyzed by electrophoresis in 3% aga-
rose gel. AGT M235T heterozygotes showed three bands,
Statistical analyses
whereas the T-type variant was not digested and showed All statistical analyses were performed with SPSS software
only the 104-bp band. version 14.0 for Microsoft Windows. Group findings were
The AT1R A1166C genotype was identified by restric- compared with the chi squared test. P < 0.05 was consid-
tion fragment length polymorphism-PCR amplification ered statistically significant.
that was performed in a 25 μl reaction mixture containing
7.5 pmol forward primer, 7.5 pmol reverse primer, 0.2 mM
of each dNTP, 2 mM MgCl2, 2.5 µL10× buffer, 1 U Taq Results
DNA polymerase and 200 ng of the template DNA. The
initial denaturation was set up for five minutes at 94°C fol-
AGT genotyping
lowed by 35 cycles of denaturation for 30 seconds at 94°C, We studied 160 individuals with a mean age of 55 ± 10 years.
annealing for 30 seconds at 55°C, and extension for 60 The participants were divided into four groups. Figure 1
seconds at 72°C. The size of the PCR products was 540 bp shows the prevalence of the different genetic polymorphisms

Downloaded from jra.sagepub.com by guest on December 4, 2013

4 Journal of the Renin-Angiotensin-Aldosterone System 0(0)

Table 3.  Comparison of groups 1 and 3.

Genotypes and alleles Group 1 n (%) Group 3 n (%)

M 235 T Genotypes
MM 11 (27.5%) 16 (40.0%)
MT 14 (35%) 19 (47.5%)
TT 15 (37.5%) 5 (12.5%)
Total 40 (100.0) 40 (100.0)
P value (95% CI) 0.035∗  
OR 2.35  

OR: odds ratio; CI: confidence interval. Figure 3.  Genotype and allele distribution of AT1R gene
Significant difference*
polymorphisms in four groups. There were no statistically
significant differences.
AT1R: AT1 receptor.

Figure 2.  Gel electrophoresis of AGT gene (73 and 31 bp

MM genotype 104, 73 and 31 bp MT genotype and 104 bp TT
genotype).
AGT: angiotensinogen.

Figure 4.  Genotype and allele distribution of ACE1 gene

of AGT in the four groups. None of the genotype distribu- polymorphisms in four groups. No statistically significant
tions followed the Hardy-Weinberg equilibrium. The overall differences in genotype versus genotype distribution.
frequency of the M and T alleles was 52.5% and 47.5%, ACE1: angiotensin-converting enzyme.
respectively. Table 3 compares allele frequencies for AGT,
which was statistically significant between groups 1 and 2
(p value = 0.035) Table 4.  Statistical analysis of AT1R and ACE1.
Figure 2 shows the PCR products of the AGT gene Independent variant OR P value
detected with gel electrophoresis.
AT1R AA 1 0.421
  AC 0.838 0.760
AT1R genotyping   CC 1.348 0.627
Figure 3 shows the prevalence of the different genetic ACE1 II 1 0.856
polymorphisms of AT1R in the four groups. None of the   ID 1.215 0.697
  DD 1.240 0.582
genotype distributions followed the Hardy-Weinberg
equilibrium. The overall frequency of the A and C alleles AT1R: AT1 receptor gene; ACE1: angiotensin-converting enzyme gene; OR:
were 76.25% and 23.75%, respectively. odds ratio.

ACE1 genotyping Discussion

Figure 4 shows the prevalence of the different genetic poly-
morphisms of ACE1 in the four groups. None of the geno-
type distributions followed the Hardy-Weinberg equilibrium.
The overall frequency of the A and C alleles was 36.6% and
63.3%, respectively. Table 4 compares the different allele
frequencies for AT1R and ACE1; none of the differences
was statistically significant.
Recent advances in molecular biology have provided
the genes that are responsible for a number of renal
cystic diseases in adults. Some of these genes have
been characterized: PKD1 and PKD2 play an important
role in renal epithelial development; TSC2 and TSC1,
the genes implicated in the pathogenesis of tuberous
sclerosis.18

Downloaded from jra.sagepub.com by guest on December 4, 2013

Tabei et al. 5
In addition, genetic variants of the renin-angiotensin-
aldosterone system such as variants in the angiotensinogen
gene AGT have been intensively studied in different popula-
tions with conflicting results in relation to high blood pres-
sure.19-21 Several studies have demonstrated a significant
relationship between M235T genotype and hypertension in
different human populations. For example, Jeunemaitre et
al. found that the T allele was significantly more frequent in
patients with hypertension than in controls.20,21 To the best
of our knowledge, this is the first study in patients with
hypertension and simple renal cysts to show a significant
association between the AGT-TT genotype and these clini-
cal entities. This finding suggests an additive role for the
AGT gene in the renin-angiotensin-aldosterone system and
the process of hypertension and simple renal cysts forma-
tion. Moreover, no significant associations were found in
the present study between the risk of hypertension (without
simple cysts) and the variants of the renin-angiotensin sys-
tem genes AGT, AT1R and ACE1.
In a meta-analysis of 32 case-control studies,22 hyper-
tension or a history of hypertension was significantly asso-
ciated with the T allele.23 However, when different races
were studied separately, the association with hypertension
was significant only in Caucasians but not in Asians or
blacks.24–27 Because our study population is located in Asia,
our results confirm these findings. This variation in the
associations highlights the importance of studying these
polymorphisms in diverse populations.
Conclusion
Our results, in light of earlier research, show that AGT vari-
ants in patients who have both simple renal cysts and
hypertension have an important role in the pathophysiology
of these clinical entities. Furthermore, the TT variant of
AGT in the population of Shiraz (Iran) is an obvious genetic
marker for this status, which can be used in personalized
and molecular population-based medicine for both treat-
ment and prevention. Although our results comprise the
first evidence of an additive role for the TT genotype of the
AGT gene in the process of hypertension and simple renal
cyst formation in our study population, further studies are
needed in different populations.
Acknowledgments
We are grateful to all faculty members and staff of the
Medical Genetics Department at Shiraz University of
Medical Sciences for their sincere support. We also thank
K. Shashok (AuthorAID in the Eastern Mediterranean) for
improving the use of English in the manuscript.
Funding
This work was supported by a research grant from Shiraz
University of Medical Sciences. All funding resources in
Downloaded from jra.sagepub.com by guest on December 4, 2013
this project were provided by the University of Medical
Sciences, Shiraz, Iran.
Conflict of interest
None declared.
References
1. Eknoyan G. A clinical view of simple and complex renal
cysts. J Am Soc Nephrol 2009; 20: 1874–1876.
2. Israel GM and Bosniak MA. An update of the Bosniak renal
cyst classification system. Urology 2005; 66: 484—488.
3. Lüscher T, Wanner C, Siegenthaler W, et al. Simple renal cyst
and hypertension: Cause or coincidence? Clin Nephrol 1986;
26: 91–95.
4. Babka JC, Cohen MS and Sode J. Solitary intrarenal cyst
causing hypertension. N Eng J Med 1974; 291: 343–344.
5. Rockson S, Stone R and Gunnells Jr J. Solitary renal cyst with
segmental ischemia and hypertension. J Urol 1974; 112: 550–
552.
6. Pedersen J, Emamian S and Nielsen M. Simple renal cyst:
Relations to age and arterial blood pressure. Br J Radiol 1993;
66: 581–584.
7. Afsar B, Afsar RE, Sen ST, et al. Simple renal cysts and circa-
dian blood pressure: Are they related to each other in patients
with hypertension? Int Urol Nephrol 2011; 43: 157–165.
8. Pedersen J, Emamian S and Nielsen M. Significant associa-
tion between simple renal cysts and arterial blood pressure. Br
J Radiol 1997; 79: 688–691.
9. Chin H, Ro H, Lee H, et al. The clinical significances of sim-
ple renal cyst: Is it related to hypertension or renal dysfunc-
tion? Kidney Int 2006; 70: 1468–1473.
10. Higaki J, Baba S, Katsuya T, et al. Deletion allele of angioten-
sin-converting enzyme gene increases risk of essential hyper-
tension in Japanese men: The Suita Study. Circulation 2000;
101: 2060–2065.
11. Tsai CT, Lai LP, Lin JL, et al. Renin-angiotensin system gene
polymorphisms and atrial fibrillation. Circulation 2004; 109:
1640–1646.
12. Davis GK and Roberts DH. Molecular genetics of the renin-
angiotensin system: Implications for angiotensin II receptor
blockade. Pharmacol Ther 1997; 75: 43–50.
13. Corvol P, Soubrier F and Jeunemaitre X. Molecular genetics
of the renin-angiotensin-aldosterone system in human hyper-
tension. Pathol Biol (Paris) 1997; 45: 229–239.
14. Lovati E, Richard A, Frey BM, et al. Genetic polymorphisms
of the renin-angiotensin-aldosterone system in end-stage renal
disease. Kidney Int 2001; 60: 46–54.
15. Reis K, Arinsoy T, Derici U, et al. Angiotensinogen and plas-
minogen activator inhibitor-1 gene polymorphism in relation to
chronic allograft dysfunction. Clin Transplant 2005; 19: 10–14.
16. Zhu X, Chang YP, Yan D, et al. Associations between hyper-
tension and genes in the renin-angiotensin system. Hyperten-
sion 2003; 41: 1027–1034.
17. Jeunemaitre X, Inoue I, Williams C, et al. Haplotypes of
angiotensinogen in essential hypertension. Am J Hum Genet
1997; 60: 1448–1460.
18. Katabathina VS, Kota G, Dasyam AK, et al. Adult renal cys-
tic disease: A genetic, biological, and developmental primer.
Radiographics 2010; 30: 1509–1523.
6 Journal of the Renin-Angiotensin-Aldosterone System 0(0)

19. Jeunemaitre X, Soubrier F, Kotelevtsev YV, et al. Molecular
basis of human hypertension: Role of angiotensinogen. Cell
1992; 71: 169–180.
20. Staessen JA, Kuznetsova T, Wang JG, et al. M235T angioten-
sinogen gene polymorphism and cardiovascular renal risk. J
Hypertens 1999; 17: 9–17.
21. Nishiuma S, Kario K, Kayaba K, et al. Effect of the angio-
tensinogen gene Met235–> Thr variant on blood pressure and
other cardiovascular risk factors in two Japanese populations.
J Hypertens 1995; 13: 717–722.
22. Iwai N, Ohmichi N, Nakamura Y, et al. DD genotype of the
angiotensin-converting enzyme gene is a risk factor for left
ventricular hypertrophy. Circulation 1994; 90: 2622–2628.
23. Chiang FT, Hsu KL, Tseng CD, et al. Molecular variant M234T
of the angiotensinogen gene is associated with essential hyper-
tension in Taiwanese. J Hypertens 1997; 15: 607–611.
24. Sato N, Katsuya T, Rakugi H, et al. Association of variants in
critical core promoter element of angiotensinogen gene with
increased risk of essential hypertension in Japanese. Hyper-
tension 1997; 30: 321–325.
25. Rotimi C, Morrison L, Cooper R, et al. Angiotensinogen gene
in human hypertension. Lack of an association of the 235T
allele among African Americans. Hypertension 1994; 24:
591–594.
26. Rotimi C, Cooper R, Ogunbiyi O, et al. Hypertension,
serum angiotensinogen, and molecular variants of the
angiotensinogen gene among Nigerians. Circulation 1997;
95: 2348–2350.
27. Borecki I, Province M, Ludwig E, et al. Associations of candi-
date loci angiotensinogen and angiotensin-converting enzyme
with severe hypertension: The NHLBI Family Heart Study.
Ann Epidemiol 1997; 7: 13–21.

Downloaded from jra.sagepub.com by guest on December 4, 2013