Vous êtes sur la page 1sur 11

CRISPR Provides Acquired Resistance Against

Viruses in Prokaryotes
Rodolphe Barrangou, et al.
Science 315, 1709 (2007);
DOI: 10.1126/science.1138140

The following resources related to this article are available online at


www.sciencemag.org (this information is current as of April 13, 2007 ):

Updated information and services, including high-resolution figures, can be found in the online
version of this article at:
http://www.sciencemag.org/cgi/content/full/315/5819/1709

Supporting Online Material can be found at:


http://www.sciencemag.org/cgi/content/full/315/5819/1709/DC1

Downloaded from www.sciencemag.org on April 13, 2007


A list of selected additional articles on the Science Web sites related to this article can be
found at:
http://www.sciencemag.org/cgi/content/full/315/5819/1709#related-content
This article cites 20 articles, 9 of which can be accessed for free:
http://www.sciencemag.org/cgi/content/full/315/5819/1709#otherarticles

This article appears in the following subject collections:


Microbiology
http://www.sciencemag.org/cgi/collection/microbio

Information about obtaining reprints of this article or about obtaining permission to reproduce
this article in whole or in part can be found at:
http://www.sciencemag.org/about/permissions.dtl

Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by the
American Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. Copyright
c 2007 by the American Association for the Advancement of Science; all rights reserved. The title SCIENCE is a
registered trademark of AAAS.
REPORTS
Fig. 3. Drag coefficient as x 10
−3 4. M. D. Powell, P. J. Vickery, T. A. Reinhold, Nature 422,
4 279 (2003).
a function of wind speed. CD
5. E. D. Fernandez et al., J. Geophys. Res. 111, C08013
is shown for an observation- 10.1029/2005JC003048 (2006).
based resistance coefficient, 6. I. J. Moon, I. Ginis, T. Hara, J. Atmos. Sci. 61, 2334 (2004).
r = 0.02 cm s−1. The red 7. J. A. T. Bye, A. D. Jenkins, J. Geophys. Res. 111, C03024
open circles are the eval- 3 10.1029/2005JC003114 (2006).
uated CD from the current 8. K. Emanuel, J. Atmos. Sci. 60, 1420 (2003).
and wind observations, the 9. D. A. Mitchell, W. J. Teague, E. Jarosz, D. W. Wang,

Drag Coefficient (C )
D
Geophys. Res. Lett. 32, L11610 10.1029/2005GL023014
solid red line is a fitted (2005).
quadratic curve to the CD 10. D. W. Wang, D. A. Mitchell, W. J. Teague, E. Jarosz,
2
estimates, and the red M. S. Hulbert, Science 309, 896 (2005).
dashed lines are the 95% 11. W. J. Teague, E. Jarosz, D. W. Wang, D. A. Mitchell,
confidence limits for this J. Phys. Oceanogr., in press.
12. W. J. Teague, E. Jarosz, M. R. Carnes, D. A. Mitchell,
quadratic curve. The black
P. J. Hogan, Cont. Shelf Res. 26, 2559 (2006).
dotted lines represent the 1
13. J. F. Price, T. B. Sanford, G. Z. Forristall, J. Phys.
window for CD reported in Oceanogr. 24, 233 (1994).
(6), whereas the blue dots 14. Materials and methods are available as supporting
represent CD reported in (4). material on Science Online.
15. G. T. Mitchum, W. Sturges, J. Phys. Oceanogr. 12, 1310
0 (1982).

Downloaded from www.sciencemag.org on April 13, 2007


20 25 30 35 40 45 50 55
−1 16. S. T. Lentz, J. Phys. Oceanogr. 24, 2461 (1994).
Wind Speed (W , m s )
10 17. S. J. Lentz, J. Phys. Oceanogr. 31, 2749 (2001).
18. J. M. Pringle, J. Phys. Oceanogr. 32, 3101 (2002).
19. E. L. Andreas, J. Phys. Oceanogr. 34, 1429 (2004).
speeds below 30 m s−1, are somewhat noisy as a then steadily decreases as the wind speed 20. We thank M. S. Hulbert, A. J. Quaid, and W. A. Goode
for mooring support. We also thank the crews of the
result of measurement uncertainty and the need continues to rise. Our values for CD are in a research vessels Seward Johnson I and II. This work was
to calculate a velocity derivative, which tends to range of CD values found using meteorological supported by the Office of Naval Research as a part of
enhance noise. However, they consistently observations (4) for wind speeds greater than the Naval Research Laboratory’s basic research project
show a decreasing trend of CD for wind speeds 32 m s−1 but are higher for lower wind speeds. “Slope to Shelf Energetics and Exchange Dynamics
greater than 32 m s−1, the lower threshold for a These differences may be attributed to uncertain- (SEED)” under program element 0601153N, through the
Minerals Management Service Environmental Studies
category 1 hurricane on the Saffir-Simpson Scale. ties in the wind measurements and the applica- Program Technology, and by the Minerals Management
It is also apparent that the CD values are weakly bility of the simplified ocean dynamics at the Service Technology Assessment and Research Program on
dependent on the choice of the resistance co- lower wind speeds. Hurricane Ivan.
efficient and are larger for increasing values Supporting Online Material
of r. The drag coefficient estimates evaluated References and Notes www.sciencemag.org/cgi/content/full/315/5819/1707/DC1
for r = 0.1 cm s−1 are, on average, 20% greater 1. K. Emanuel, Nature 436, 686 (2005). SOM Text
than those calculated for r = 0.001 cm s−1 from 2. S. E. Larsen et al., in Wind Stress Over the Ocean, Fig. S1
I. S. F. Jones,Y. Toba, Eds. (Cambridge Univ. Press, References
Eq. 3. New York, 2001), chap. 7.
To produce the best representation of CD for 3. M. A. Donelan et al., Geophys. Res. Lett. 31, L18306 18 October 2006; accepted 14 February 2007
each r, a second-order curve (a function of the 10.1029/2004GL019460 (2004). 10.1126/science.1136466
wind speed) was fitted by a least-squares
technique to all estimated values of CD. The
curves are displayed in Figs. 2 and 3. Addition-
ally, the 95% confidence limits for the fitted
curve are shown in Fig. 3. The pattern of the
CRISPR Provides Acquired Resistance
relationship between CD and the wind speed is
robust, but the curve coefficients are determined
Against Viruses in Prokaryotes
by the value chosen for r in Eq. 3. However, all
Rodolphe Barrangou,1 Christophe Fremaux,2 Hélène Deveau,3 Melissa Richards,1
curves clearly show an initial increase of the drag
Patrick Boyaval,2 Sylvain Moineau,3 Dennis A. Romero,1 Philippe Horvath2*
coefficient and monotonic decrease as found by
recent studies (3–8) after reaching a maximum
Clustered regularly interspaced short palindromic repeats (CRISPR) are a distinctive feature of the
value at ~32 m s−1. Some of these studies (3, 19)
genomes of most Bacteria and Archaea and are thought to be involved in resistance to bacteriophages.
imply that the decreasing drag at high winds
We found that, after viral challenge, bacteria integrated new spacers derived from phage genomic
seems to be related to the spray, foam, and
sequences. Removal or addition of particular spacers modified the phage-resistance phenotype of the
bubbles from breaking waves that reduce the
cell. Thus, CRISPR, together with associated cas genes, provided resistance against phages, and
drag and allow the hurricane to slip over the sea.
resistance specificity is determined by spacer-phage sequence similarity.
With the nearly full water-column ocean cur-
rent measurements, the only unknown term left
in the simplified equation of motion is the wind acteriophages are arguably the most injection, restricting the incoming DNA, and
stress. Thus, the behavior of the drag coefficient
(CD) can easily be estimated for a range of strong
winds. Despite the fact that the drag coefficient is
B abundant biological entity on the planet
(1). Their ubiquitous distribution and
abundance have an important impact on micro-
abortive infection systems. These antiviral bar-
riers can also be engineered and manipulated to
better control phage populations (2, 3).
evaluated differently here, estimates of CD bial ecology and the evolution of bacterial Numerous bacteria have been selected by
determined “bottom-up” reasonably replicate genomes (2). Consequently, bacteria have devel- humans and used extensively for fermentation
the values determined “top-down” in recent oped a variety of natural defense mechanisms and biotechnology processes. Unfortunately, do-
studies (3–7). Results from our research show that target diverse steps of the phage life cycle, mesticated bacteria used in industrial applications
that CD peaks at a wind speed near 32 m s−1 and notably blocking adsorption, preventing DNA are often susceptible to phage attack, including

www.sciencemag.org SCIENCE VOL 315 23 MARCH 2007 1709


REPORTS
genera and species widely used as dairy cultures Nine phage-resistant mutants were generated in the CRISPR1 locus of the various phage-
(4). Accordingly, the industry has devised various independently by challenging the WT strain with resistant mutants revealed similarity to sequences
strategies to combat phage based on strain di- phage 858, phage 2972, or simultaneously with found within the genomes of the phages used in
versity, bacteriophage-insensitive mutants, and both (12), and their CRISPR loci were analyzed. the challenge (Fig. 2 and fig. S2). Interestingly,
plasmids bearing phage-resistance mechanisms. Differences were consistently observed at the similarities were observed throughout the phage
Streptococcus thermophilus is a low G+C CRISPR1 locus, where 1 to 4 additional spacers genomes, in most functional modules, both on the
Gram-positive bacterium and a key species ex- were inserted next to the 32 spacers present in coding and noncoding strands. No particular se-
ploited in the formulation of dairy culture sys- the WT strain (Fig. 1). The addition of new quence, gene, or functional group seemed to be
tems for the production of yogurt and cheese. spacers in response to phage infection seemed to targeted specifically. These results reveal that, on
Comparative genomics analyses of closely be polarized toward one end of the CRISPR1 lo- becoming resistant to bacteriophages, the CRISPR1
related S. thermophilus strains have previously cus. This is consistent with previous observations locus was modified by the integration of novel
revealed that genetic polymorphism primarily of spacer hypervariability at the leader end of the spacers, apparently derived from phage DNA.
occurs at hypervariable loci, such as the eps and CRISPR locus in various strains (9, 13). Se- Surprisingly, we observed that some strains
rps operons, as well as two clustered regularly quence analysis of the additional spacers inserted were resistant to both phages, whereas others
interspaced short palindromic repeats (CRISPR)
loci (5–7). CRISPR loci typically consist of sev-
eral noncontiguous direct repeats separated by cas5 cas1 cas6 cas7 repeat/spacer region ORF
stretches of variable sequences called spacers and
are oftentimes adjacent to cas genes (CRISPR-

Downloaded from www.sciencemag.org on April 13, 2007


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32
L
associated). Although the function of CRISPR T
loci has not been established biologically, in
silico analyses of the spacers have revealed se- Sensitivity to Φ858 Sensitivity to Φ2972
10-7 10-6 10-5 10-4 10-3 10-2 10-1 1 10-7 10-6 10-5 10-4 10-3 10-2 10-1 1
quence homology with foreign elements, includ-
ing bacteriophage and plasmid sequences (7–9). L 1 2 WT
Based exclusively on in silico analyses, several
S1

S2

L 1 2 WTΦ858+S1S2
hypotheses have been put forward proposing
roles for CRISPR and cas genes, which include
S3

L 1 2 WTΦ858+S3
providing immunity against foreign genetic ele-
S4

ments via a mechanism based on RNA inter- L 1 2 WTΦ2972+S4


ference (10).
S5

L 1 2 WTΦ2972+S5
We analyzed the CRISPR sequences of vari-
S6

ous S. thermophilus strains, including closely L 1 2 WTΦ2972+S6


related industrial strains and phage-resistant var-
S7

L 1 2 WTΦ2972+S7
iants (fig. S1). Differences in the number and
type of spacers were observed primarily at the
S8

L 1 2 WTΦ2972+S8
CRISPR1 locus. Notably, phage sensitivity ap-
S11
S10

S12
S9

peared to be correlated with CRISPR1 spacer L 1 2 WTΦ858Φ2972+S9S10S11S12


content. Specifically, spacer content was nearly
S13

S14

L 1 2 WTΦ858Φ2972+S13S14
identical between parental strains and phage-
resistant derivatives, except for additional spacers Fig. 1. Streptococcus thermophilus CRISPR1 locus overview, newly acquired spacers in phage-
present in the latter. These findings therefore resistant mutants, and corresponding phage sensitivity. The CRISPR1 locus of DGCC7710 (WT) is at
suggest a potential relation between the presence the top. The repeat-spacer region of WT is in the middle: repeats (black diamonds), spacers
of additional spacers and the differences ob- (numbered gray boxes), leader (L, white box), and terminal repeat (T, black diamond). (Bottom left)
served in the phage sensitivity of a given strain. The spacer content on the leader side of the locus in phage-resistant mutants is detailed, with
This observation prompted us to investigate the newly acquired spacers (white boxes, S1 to S14). (Bottom right) The sensitivity of each strain to
origin and function of additional spacers present phages 858 and 2972 is represented as a histogram of the efficiency of plaquing (EOP), which is
in phage-resistant mutants. the plaque count ratio of a mutant strain to that of the wild-type.
First, we tested the hypothesis that CRISPR
loci are altered during the natural generation S9 S11 S3 S12 S5* S1 S4* S13
of phage-resistant mutants. A phage-host model
system was selected, consisting of a phage- Φ858 12 3 4 5 6 7 8 9 10 11
12131415161718 19 20 21 22 23225
426
272829303132
33435
3 36 37 38 39 40 4142
43444546

sensitive wild-type S. thermophilus strain widely S14 S7 S10 S2* S8* S6


used in the dairy industry, DGCC7710 [wild capsid host transcription
packaging tail morphogenesis replication
type (WT)] and two distinct but closely related morphogenesis lysis regulation
virulent bacteriophages isolated from industrial S9 S11 S3 S12 S5 S1* S4 S13
yogurt samples, phage 858 and phage 2972 (11).
Φ2972 1 2 3 4 5 6 7 8 9 10
11121314151617 18 19 20 21 2222
34252627
28
293033233
1 34 35 36 37 38 39441
0 424344

1
Danisco USA Inc., 3329 Agriculture Drive, Madison, WI S14 S7 S10 S2* S8 S6
1 kb
53716, USA. 2Danisco France SAS, Boîte Postale 10, F-86220
Dangé-Saint-Romain, France. 3Département de Biochimie et
Fig. 2. S. thermophilus phage genome maps with the position of sequences similar to the acquired
de Microbiologie, Faculté des Sciences et de Génie, Groupe
de Recherche en Ecologie Buccale, Faculté de Médecine CRISPR1 spacers of the phage-resistant mutants. Spacers shown above and below the genome maps
Dentaire, Félix d’Hérelle Reference Center for Bacterial indicate that the spacer matches a sequence on the (+) and on the (–) strand, respectively. An
Viruses, Université Laval, G1K 7P4 Québec, Canada. asterisk indicates the existence of a SNP between the spacer sequence and that of the phage
*To whom correspondence should be addressed. E-mail: genome (fig. S1). The genome sequences of phage 2972 (accession number AY699705) and phage
philippe.horvath@danisco.com 858 are 93% identical.

1710 23 MARCH 2007 VOL 315 SCIENCE www.sciencemag.org


REPORTS
were resistant only to the phage used in the chal- To determine whether CRISPR spacer con- these observed modifications establish the link
lenge (Fig. 1). The phage-resistance profile tent defines phage resistance, we altered the between the CRISPR spacer content and phage
seemed correlated to the spacer content, such CRISPR1 locus by adding and deleting spacers resistance.
that strains with spacers showing 100% identity (12) and tested subsequent strain sensitivity to In the process of generating strain
to sequences conserved in both phages were phages. All constructs were generated and inte- W T Ф 8 5 8 + S 1 S 2 ∆CRISPR1, we created
resistant to both phages, such as spacers S3, S6, grated into the S. thermophilus chromosome with WTФ858+S1S2::pR, a variant that contains the inte-
and S7. In contrast, when nucleotide polymor- the system developed by Russell and Klaenhammer gration vector with a single repeat inserted be-
phisms were observed between the spacer and the (14). We removed the spacers and repeats in the tween the cas genes and the native CRISPR1 locus
phage sequence [from 1 to 15 single-nucleotide CRISPR1 locus of strain WTФ858+S1S2 and replaced (Fig. 3). Unexpectedly, strain WTФ858+S1S2::pR
polymorphisms (SNPs) over 29 or 30 nucleo- them with a single repeat without any spacer (12). was sensitive to phage 858, although spacers
tides], the spacer did not seem to provide re- The resulting strain WTФ858+S1S2∆CRISPR1 was S1 and S2 remained on the chromosome (Fig. 3).
sistance, such as spacers S1, S2, S4, S5, and S8 sensitive to phage 858, which indicated that the Similarly, the WTФ2972+S4::pS1S2 construct lost
(Fig. 1 and fig. S2). In addition, when several phage resistance of the original phage-resistant the resistance to phage 2972, although spacer
spacers were inserted (S9 to S14), phage re- mutant (WTФ858+S1S2) was probably linked to S4 is present in the chromosome (Fig. 3). These
sistance levels were higher. These findings indi- the presence of S1 and S2 (Fig. 3). results indicated that spacers alone did not
cate that the CRISPR1 locus is subject to dynamic Further, to address the critical question of provide resistance, and perhaps, that they have
and rapid evolutionary changes driven by phage whether adding spacers provides novel phage to be in a particular genetic context to be
exposure. Altogether, these results reveal that resistance, we replaced the CRISPR1 locus of effective.
CRISPR loci can indeed be altered during the strain WTФ2972+S4 with a version containing only Although initial work suggested involvement

Downloaded from www.sciencemag.org on April 13, 2007


generation of phage-resistant mutants and also spacers S1 and S2 (12) and tested whether the in DNA repair (15), the current hypothesis is that
establish a link between CRISPR content and phage sensitivity was affected. Remarkably, the cas genes (5, 16) are involved in CRISPR-
phage sensitivity. These findings suggest that the resulting strain WTФ2972+S4::pS1S2 gained re- mediated immunity (10). Consequently, we in-
presence of a CRISPR spacer identical to a phage sistance to phage 858, which suggested that activated two cas genes in strain WTФ858+S1S2
sequence provides resistance against phages these two spacers have the ability to provide (12): cas5 (COG3513) and cas7, which are equiv-
containing this particular sequence. phage resistance de novo (Fig. 3). Altogether, alent to str0657/stu0657 and str0660/stu0660,
respectively (6, 7). The cas5 inactivation re-
sulted in loss of the phage resistance (Fig. 3),
S2

and perhaps Cas5 acts as a nuclease, because it


S1

L 1 2

cas5 cas1 cas6 cas7 ORF


1 kb contains an HNH-type nuclease motif. In con-
I. trast, inactivating cas7 did not alter the resist-
L T ance to phage 858 (Fig. 3). Interestingly, we
cas5 cas1 cas6 cas7 ORF were repeatedly unable to generate CRISPR1
II. phage-resistant mutants from the cas7 knock-
out, perhaps because Cas7 is involved in the
S1

S2

L T L 1 2
synthesis and/or insertion of new spacers and
cas5 cas1 cas6 cas7 pORI ORF
III. additional repeats.
When we tested the sensitivity of the phage-
S1

S2

S4

L T L 1 2 resistant mutants, we found that plaque formation


cas5 cas1 cas6 cas7 pORI ORF was dramatically reduced, but that a relatively
IV.
small population of bacteriophage retained the
ability to infect the mutants. We further analyzed
S1

S2

L 1 2

pORI cas1 cas6 cas7 ORF phage variants derived from phage 858 that
V. retained the ability to infect WTФ858+S1S2. In par-
ticular, we investigated the sequence of the ge-
S2
S1

L 1 2
nome region corresponding to additional spacers
cas5 cas1 cas6 pORI ORF
VI. S1 and S2 in two virulent phage variants. In both
cases, the genome sequence of the phage var-
Sensitivity to Φ858 Sensitivity to Φ2972 iant had mutated, and two distinct SNPs were
10-7 10-6 10-5 10-4 10-3 10-2 10-1 1 10-7 10-6 10-5 10-4 10-3 10-2 10-1 1
identified in the sequence corresponding to
I. WTΦ858+S1S2 spacer S1 (fig. S3).
II. WTΦ858+S1S2∆CRISPR1 Overall, prokaryotes appear to have evolved
a nucleic acid–based “immunity” system where-
III. WTΦ858+S1S2::pR
by specificity is dictated by the CRISPR spacer
IV. WTΦ2972+S4::pS1S2 content, while the resistance is provided by the
V. WTΦ858+S1S2::pcas5– Cas enzymatic machinery. Additionally, we spec-
ulate that some of the cas genes not directly
VI. WTΦ858+S1S2::pcas7–
providing resistance are actually involved in the
Fig. 3. CRISPR spacer engineering, cas gene inactivation, and corresponding phage sensi- insertion of additional CRISPR spacers and re-
tivity. I, mutant WT F858+S1S2; II, mutant WT F858+S1S2DCRISPR1 in which CRISPR1 was deleted; peats, as part of an adaptive “immune” response.
III, mutant WTF858+S1S2::pR in which CRISPR1 was displaced and replaced with a unique repeat; Further studies are desired to better characterize
IV, WTF2972+S4::pS1S2, mutant of strain WTF2972+S4 in which CRISPR1 was displaced and re- the mechanism of action and to identify the
placed with a version containing S1 and S2; V, WTF858+S1S2::pcas5– with cas5 inactivated; VI, specific function of the various cas genes. This
WTF858+S1S2::pcas7– with cas7 inactivated. pORI indicates the integrated plasmid (12). The phage nucleic acid–based system contrasts with amino
sensitivity of each strain to phages 858 and 2972 is represented at the bottom as a histogram of acid–based counterparts in eukaryotes through
the efficiency of plaquing (EOP). which adaptative immunity is not inheritable.

www.sciencemag.org SCIENCE VOL 315 23 MARCH 2007 1711


REPORTS
The inheritable nature of CRISPR spacers sup- References and Notes 16. D. H. Haft, J. Selengut, E. F. Mongodin, K. E. Nelson,
ports the use of CRISPR loci as targets for evo- 1. M. Breitbart, F. Rohwer, Trends Microbiol. 13, 278 PloS Comput. Biol. 1, e60 (2005).
(2005). 17. P. M. A. Groenen, A. E. Bunschoten, D. van Soolingen,
lutionary, typing, and comparative genomic studies 2. S. Chibani-Chennoufi, A. Bruttin, M.-L. Dillmann, H. Brüssow, J. D. A. van Embden, Mol. Microbiol. 10, 1057 (1993).
(9, 17–19). Because this system is reactive to J. Bacteriol. 186, 3677 (2004). 18. E. F. Mongodin et al., J. Bacteriol. 187, 4935 (2005).
the phage environment, it likely plays a sig- 3. J. M. Sturino, T. R. Klaenhammer, Nat. Rev. Microbiol. 4, 19. R. T. DeBoy, E. F. Mongodin, J. B. Emerson, K. E. Nelson,
nificant role in prokaryotic evolution and ecol- 395 (2006). J. Bacteriol. 188, 2364 (2006).
4. H. Brüssow, Annu. Rev. Microbiol. 55, 283 (2001). 20. R. W. Hendrix et al., Proc. Natl. Acad. Sci. U.S.A. 96,
ogy and provides a historical perspective of 5. R. Jansen, J. D. A. van Embden, W. Gaastra, L. M. Schouls, 2192 (1999).
phage exposure, as well as a predictive tool for Mol. Microbiol. 43, 1565 (2002). 21. J. S. Godde, A. Bickerton, J. Mol. Evol. 62, 718
phage sensitivity. The CRISPR-cas system may 6. A. Bolotin et al., Nat. Biotechnol. 22, 1554 (2004). (2006).
7. A. Bolotin, B. Quinquis, A. Sorokin, S. D. Ehrlich, 22. We thank L. Bayer, C. Vos, and A.-C. Coûté-Monvoisin
accordingly be exploited as a virus defense mech- Microbiology 151, 2551 (2005). of Danisco Innovation, as well as J. Labonté and
anism and also potentially used to reduce the 8. F. J. M. Mojica, C. Díez-Villaseñor, J. García-Martínez, D. Tremblay of Université Laval for technical support, and
dissemination of mobile genetic elements and E. Soria, J. Mol. Evol. 60, 174 (2005). E. Bech Hansen for discussions and critical review of
the acquisition of undesirable traits such as anti- 9. C. Pourcel, G. Salvignol, G. Vergnaud, Microbiology 151, the manuscript. Also, we thank T. R. Klaenhammer for
biotic resistance genes and virulence markers. 653 (2005). providing the integration system. This work was
10. K. S. Makarova, N. V. Grishin, S. A. Shabalina, Y. I. Wolf, supported by funding from Danisco A/S. Also, S. M. would
From a phage evolution perspective, the inte- E. V. Koonin, Biol. Direct 1, 7 (2006). like to acknowledge support from the Natural Sciences
grated phage sequences within CRISPR loci may 11. C. Lévesque et al., Appl. Environ. Microbiol. 71, 4057 and Engineering Research Council of Canada (NSERC)
also provide additional anchor points to facilitate (2005). Discovery Program. Sequences were deposited in
recombination during subsequent phage infec- 12. Information on materials and methods for the generation GenBank, accession numbers EF434458 to EF434504.
of phage-resistant mutants, engineering of CRISPR
tions, thus increasing the gene pool to which Supporting Online Material

Downloaded from www.sciencemag.org on April 13, 2007


spacers (Figs. S4 and S5), and inactivation of cas genes is
phages have access (20). Because CRISPR loci available on Science Online. www.sciencemag.org/cgi/content/full/315/5819/1709/DC1
are found in the majority of bacterial genera and 13. R. K Lillestøl, P. Redder, R. A. Garrett, K. Brügger, Materials and Methods
are ubiquitous in Archaea (5, 13, 21), their study Archaea 2, 59 (2006). Figs. S1 to S5
14. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. References and Notes
will provide new insights into the relation and 67, 4361 (2001).
codirected evolution between prokaryotes and 15. K. S. Makarova, L. Aravind, N. V. Grishin, I. B. Rogozin, 29 November 2006; accepted 16 February 2007
their predators. E. V. Koonin, Nucleic Acids Res. 30, 482 (2002). 10.1126/science.1138140

A G Protein–Coupled Receptor Is a Arabidopsis putative GPCR protein (GCR1) has


been characterized in plants (17–20), and no
ligand has been defined for any plant GPCR.
Plasma Membrane Receptor for the To identify previously unrecognized GPCR
proteins in Arabidopsis, we started by searching
Plant Hormone Abscisic Acid the Arabidopsis genome and found a gene
(GCR2, GenBank accession code At1g52920)
encoding a putative GPCR. Transmembrane
Xigang Liu,1,2 Yanling Yue,1 Bin Li,3 Yanli Nie,1 Wei Li,2 Wei-Hua Wu,3 Ligeng Ma1,2* structure prediction suggests that GCR2 is a
membrane protein with seven transmembrane
The plant hormone abscisic acid (ABA) regulates many physiological and developmental processes helices (fig. S1, A and B). The subsequent cel-
in plants. The mechanism of ABA perception at the cell surface is not understood. Here, we lular localization analysis confirmed its plasma
report that a G protein–coupled receptor genetically and physically interacts with the G protein membrane localization in the transgenic plant
a subunit GPA1 to mediate all known ABA responses in Arabidopsis. Overexpressing this receptor root (fig. S1C). GCR2–yellow fluorescent pro-
results in an ABA-hypersensitive phenotype. This receptor binds ABA with high affinity at tein (YFP) is detected in the membrane fraction
physiological concentration with expected kinetics and stereospecificity. The binding of ABA to the isolated from the GCR2-YFP transgenic plant.
receptor leads to the dissociation of the receptor-GPA1 complex in yeast. Our results demonstrate Similar to GCR1 (19), GCR2 is mostly asso-
that this G protein–coupled receptor is a plasma membrane ABA receptor. ciated with the membrane fraction (fig. S1D).
Furthermore, even after washing with detergent
bscisic acid (ABA) is an important In contrast, several earlier experiments had sug- or a higher pH buffer, GCR2 is retained with the

A hormone that mediates many aspects of


plant growth and development, particu-
larly in response to the environmental stresses
gested that extracellular perception is critical for
ABA to achieve its functions (7–9). Thus, other
ABA receptors, especially plasma membrane–
membrane fraction, suggesting that GCR2 is an
integral membrane protein (fig. S1D).
One feature of the GPCR is its ability to
(1–3). Several components involved in the ABA localized receptors, may be the major players for interact with G protein to form a complex. To
signaling pathway have been identified (4). Two perceiving extracellular ABA and mediating the confirm the physical interaction between GCR2
recent reports have shown that the nuclear RNA classic ABA signaling responses. and Ga, we used four different approaches to
binding protein flowering time control protein Ligand-mediated signaling through G protein– detect their interaction. We first used surface
(FCA) (5) and the chloroplast protein Mg coupled receptors (GPCRs) is a conserved plasmon resonance spectroscopy to investigate
chelatase H subunit (6) are ABA receptors (6). mechanism for the extracellular signal percep- the interaction between GCR2 and GPA1. For
tion at the plasma membrane in eukaryotic this purpose, we expressed and purified recom-
1
National Institute of Biological Sciences, 7 Science Park Road, organisms (10). The GPCR-mediated signaling binant GCR2 and GPA1 proteins in bacteria
Zhongguancun Life Science Park, Beijing 102206, China. pathway plays a central role in vital processes (fig. S2). This in vitro assay clearly indicated
2
Laboratory of Molecular and Cellular Biology, Hebei Normal such as vision, taste, and olfaction in animals that GPA1 is capable of binding to GCR2, where-
University, Shijiazhuang, Hebei 050016, China. 3State Key (11). However, the higher plant Arabidopsis as no binding activity was detected between
Laboratory of Plant Physiology and Biochemistry, College of
Biological Sciences, China Agricultural University, Beijing thaliana has only one canonical Ga (GPA1) GPA1 and bovine serum albumin (BSA) (fig.
100094, China. subunit, one Gb subunit, and two Gg subunits S3, A and B). The dissociation binding con-
*To whom correspondence should be addressed. E-mail: (12–16). The significance of these subunits in stant (Kd) for GCR2 and GPA1 is 2.1 × 10−9 M
maligeng@nibs.ac.cn plant systems is poorly understood; only one (fig. S3C).

1712 23 MARCH 2007 VOL 315 SCIENCE www.sciencemag.org


MATERIALS AND METHODS

Isolation of phage-resistant mutants and confirmation of CRISPR sequences


Streptococcus thermophilus phage-resistant mutants were obtained by challenging the wild-type
host strain DGCC7710 (also called RD534) with phage 2972 and/or phage 858 (1). The host strain was
grown at 42ºC in 10 ml of M17 broth supplemented with 0.5% lactose (LM17). When the optical
density (600 nm) reached 0.3, phages and calcium chloride 10mM were added at a final concentration
of 107 pfu/ml and 50 mM, respectively. The phage-containing culture was incubated at 42ºC for 24
hours and monitored for lysis. Then, 100 µl of the lysate were inoculated into 10 ml of fresh LM17.
The remaining lysate was centrifuged and the pellet was inoculated into another tube containing 10 ml
of fresh LM17. These two cultures were incubated at 42ºC for 16 hours. Finally, these cultures were
diluted and plated on LM17. Isolated colonies were tested for phage sensitivity as previously described
(2). The CRISPR loci of the resistant isolates were verified by sequencing PCR products, and using
relevant phage genome information (1).

CRISPR spacer engineering


Enzymes used to carry out restriction digests and PCR were purchased from Invitrogen and
used according to the manufacturer’s instructions. PCRs were carried out on an Eppendorf
Mastercycler Gradient thermocycler.
Gene inactivation and site-specific plasmid insertion via homologous recombination in the
S. thermophilus chromosome were carried out by sub-cloning into the pCR2.1-TOPO system
(Invitrogen), by subsequent cloning in the pORI system using Escherichia coli as a host, and the
constructs were ultimately purified and transformed into S. thermophilus as previously described (3).
DNA from mutant WTΦ858+S1S2 was used as a template to amplify two distinct PCR fragments
using P1 (5'-acaaacaacagagaagtatctcattg-3') and P2 (5'-aacgagtacactcactatttgtacg-3') in one reaction,
and P3 (5'-tccactcacgtacaaatagtgagtgtactcgtttttgtattctcaagatttaagtaactgtacagtttgattcaacataaaaag-3') and
P4 (5'-ctttccttcatcctcgctttggtt-3') in another reaction. Both PCR products were subsequently used as
templates in another PCR reaction using primers P1 and P4 to generate the S1S2 construct (fig. S4).
The S1S2 construct was sub-cloned into the Invitrogen pCR2.1-TOPO system. This construct
was digested with NotI and HindIII and subsequently cloned into pORI at the NotI and HindIII sites,
providing the pS1S2 construct. Integration of pS1S2 into the CRISPR1 locus of strain WTΦ2972+S4
occurred via homologous recombination at the 3' end of cas7, to generate WTΦ2972+S4::pS1S2.
The pR construct was generated using the pS1S2 construct as a template. Specifically, the S1S2
construct sub-cloned into pCR2.1-TOPO was digested using BsrGI, which cuts within the CRISPR
repeat. Then, the digest was religated and a plasmid containing a single repeat and no spacer was used
subsequently for cloning into pORI using NotI and HindIII, generating pR. Integration of pR into the
chromosome of strain WTΦ858+S1S2 at the 3' end of cas7 via homologous recombination generated
WTΦ858+S1S2::pR, a mutant where the CRISPR1 locus is displaced and a unique repeat is inserted in its
place.
The mutant WTΦ858+S1S2::pR was subsequently grown in the absence of erythromycin, and
antibiotic-sensitive variants were analyzed to find a mutant that had a complete deletion of the
CRISPR1 locus. The deletion was derived from homologous recombination occurring at the 3' end of
ORF (as opposed to a recombination event occurring at the 3' end of cas7, which would have resulted
in restoration of the strain WTΦ858+S1S2), generating WTΦ858+S1S2∆CRISPR1, a mutant where the
CRISPR1 locus is deleted (fig. S5).

Inactivation of cas genes


For cas5 inactivation, a 801-bp internal piece of cas5 was amplified by PCR using primers
5'-caaatggatagagaaacgc-3' and 5'-ctgataaggtgttcgttgtcc-3' and sub-cloned into Escherichia coli pCR2.1-
TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into
pORI at the EcoRV and HindIII sites. Integration of this construct into the cas5 gene of strain
WTΦ858+S1S2 occurred via homologous recombination of the internal piece of the gene, resulting into
WTΦ858+S1S2::pcas5-.
Similarly, a 672-bp internal piece of cas7 was amplified by PCR using primers
5'-ggagcagatggaatacaagaaagg-3' and 5'-gagagactaggttgtctcagca-3' and sub-cloned into Escherichia coli
pCR2.1-TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently
cloned into pORI at the EcoRV and HindIII sites. Integration of this construct into the cas7 gene of
strain WTΦ858+S1S2 occurred via homologous recombination of the internal piece of the gene, resulting
into WTΦ858+S1S2::pcas7-.
SUPPORTING FIGURES
GenBank
Strain Lysotype Comment

10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
1
2
3
4
5
6
7
8
9
Accession
LMD-9 CP000419 A L l u u u u u u n u u n u u u u u
DGCC7689 EF434458 A L l u u u u u u n u u n u u u u u
DGCC778 EF434459 A1 BIM of LMD-9 L u l u u u u u u n u u n u u u u u
120-9 EF434460 A2 BIM of LMD-9 L u u l u u u u u u n u u n u u u u u
DGCC8769 EF434461 A3 BIM of LMD-9 L u u l u u u u u u n u u n u u u u u
DGCC1086 EF434462 A L u u u u u u u n u u n u u u u u
¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦
SMQ-301 EF434463 B L u l u u l u u n u u n u u u u u
DGCC855 EF434464 B1 L u u u l u u l u u n u u n u u u u u
DGCC1443 EF434465 B2 L u u l u u u u u l u u l u u n u u n u u u u u
¦ ¦ ¦
DGCC8234 EF434466 C L u u l u u u l u u n u u u u u l u u u u l u u l
DGCC7973 EF434467 C1 L u u u u u l u u x x xx x x u u u u u l u u l

CNRZ703 DQ072990 n.d. L u u l u u u u u u l u u u u u u u u u u u l n u u l u u u u


DGCC7796 EF434468 E L u u l u u u u u u l u u u u u u u u u u u l n u u l u u u u
¦ ¦ ¦
DGCC7710 EF434469 F L u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ858+S1S2 (= DGCC7778) EF434470 F1 BIM of DGCC7710 L u u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ858+S3 EF434471 F2 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ2972+S4 EF434472 F3 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ2972+S5 EF434473 F4 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ2972+S6 EF434474 F5 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ2972+S7 EF434475 F6 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ2972+S8 EF434476 F7 BIM of DGCC7710 L l u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ858Φ2972+S9S10S11S12 EF434477 F8 BIM of DGCC7710 L u u u u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u
WTΦ858Φ2972+S13S14 EF434478 F9 BIM of DGCC7710 L u u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u

DGCC7699 EF434479 G L u u u u u u u u l u x u u u u
DGCC86 EF434480 G1 L u x u u u u l u x u u u u
DGCC8170 EF434481 G2 L u u u u u u u u u x u u u u u u u
DGCC8168 EF434482 G3 L u u u u u l u u u u u u u
DGCC48 EF434483 G3 L u u u u l u u u u u u u

JIM1518 DQ073008 n.d. L l u u u u u u u u u u u


JIM1560 DQ072996 n.d. L l u u u u u u u u u u u
JIM1575 DQ072997 n.d. L l u u u u u u u u u u u
JIM1588 DQ072999 n.d. L l u u u u u u u u u u u
4035 DQ073006 n.d. L l u u u u u u u u u u u
DGCC7790 EF434484 H L l u u u u u u u u u u u
DGCC7852 EF434485 H L l u u u u u u u u u u u
DGCC7873 EF434486 H L l u u u x x x x x x x u

CNRZ385 DQ072992 n.d. L u u u u u u u u u u u u u u u u l u u l


DGCC7809 EF434487 J L u u u u u u u u u u u u u u u u l u u l

DGCC103 EF434488 K L u u u u l u u u u u u x x x x u u u u u x
CNRZ1202 DQ072989 n.d. L u u u u u l u u u u u u u u x u u u u u u u x x u £
1205.3 DQ073005 n.d. L u u u u u l u u u u u u u u x x x x x x u x x x x £
CNRZ1205 DQ073004 n.d. L u u u u u l u u u u u u u u x x x x x x u x x x x £
¦
DGCC7842 EF434489 M L u u u u l u u u u u u

JIM1567 DQ072995 n.d. L u u u u u n u u u u u u u u u u l u u u u u u u u


JIM76 DQ073003 n.d. L u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n u u u u u u u u u u u u u u u u
CNRZ1066 CP000024 N L u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u u
DGCC6297 EF434490 N L u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u u
DGCC944 EF434491 N L u u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u u
DGCC766 EF434492 N L u u u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u u

DGCC7967 EF434493 Q L u u u u u u u u x l u u x u n u u l
DGCC938 EF434494 Q1 L l n u u u u u u u u u u u u u x n u l u u x u n u u l
CNRZ389 DQ072987 n.d. L u u u u u u u u l u u u u u u u u u u l n u u x u
LMG18311 CP000023 n.d. L u u u u u u u u u n u u u u u l u x x x x u u u u u u u l u u u u n x x x x x x x u u l
CNRZ1100 DQ072988 n.d. L u u u u l n u u u u u u u u u l u u u u n u l u u x u n u u l
DGCC7785 EF434495 Q2 L u u u x x x x x x x x x x x x x x x x u n u l u u x u n u u l
CNRZ388 DQ072986 n.d. L u u n u u u u u l u n u u l u u u u u l n u u u u u u u u x x x u u u n u l u u x u n u u l
DGCC292 EF434496 Q3 L l u u u x x u u u u u u u u £ u l u u u u u u u u u u u x x x x x x x x x x x l
¦ ¦ ¦ ¦ ¦ ¦
DGCC47 EF434497 R L u u u u u u u u u u u u l u u u u u u u u u u u l u u x x n u u l
DGCC7806 EF434498 R L u u u u u u x x u u u u l u u u u u u u u u u u l u u x x n u u l
JIM70 DQ073000 n.d. L u u l u l x x u u u u l u u u u u u u u u u u l u u x u n u u l
DGCC7981 EF434499 R1 L u u l u l x x u u u u x u u u u u u u u u u u l u u x u n u u l
DGCC66 EF434500 R2 L u u l u l x x u u u u l u u u u u u u u u u u l u u x u n u u l
JIM72 DQ073002 n.d. L u u l u l x x u u u u l u u u u u u u u u u u l u u l u n u u l

DGCC7984 EF434501 S L u u u u u u u u u u u u n u n u u u u u u u u

DGCC8191 EF434502 T L u u u u u u u u u u
DGCC5472 EF434503 T L u u u u u u u u u

DGCC3367 EF434504 U L u u

JIM71 DQ073001 n.d. L u u u l u u u u u u u u u u u u u u u


JIM1584 DQ072998 n.d. L u u u l u u u u u u u u u u u u u u u

CNRZ302 DQ072985 n.d. L n u u u u u u u l l u u u u l u u u u u u u u u


JIM1293 DQ073007 n.d. L n u u u u u u u l l u x u u l u u x x x u u u u

CNRZ1575 DQ072997 n.d. L u u u u u u u u u u u u u u u u u u u l u l u l u n u u u u u

Fig. S1. Graphic representation of CRISPR1 spacers across a variety of S. thermophilus strains.
Repeats are not included, only spacers are represented. Each spacer is represented by a combination of
one select character in a particular font color, on a particular background color. The color combination
allows unique representation of a particular spacer, whereby squares with similar color schemes
(combination of character color and background color) represent identical spacers, whereas different
color combinations represent distinguishable spacers. Missing spacers are represented by crossed
squares. L (blue): CRISPR leader sequence. In the third column, a letter indicates strain lysotype,
whereby the lysotype is defined as the spectrum of sensitivity of the strain to a set of phages; lysotypes
that show minor differences for specific phages are distinguished by an additional number. n.d.: not
determined. BIM: bacteriophage insensitive mutant.
S1 CAACACATTCAACAGATTAATGAAGAATAC
Φ858 .............................. 31381 - 31410 (+)
Φ2972 ....GAT.GATTTC.....T.AC...GA.. 30702 - 30731 (+)

S2 TCCACTCACGTACAAATAGTGAGTGTACTC
Φ858 .......................C...... 25442 - 25471 (-)
Φ2972 .......................C...... 25432 - 25461 (-)

S3 TTACGTTTGAAAAGAATATCAAATCAATGA
Φ858 .............................. 17215 - 17244 (+)
Φ2972 .............................. 17202 - 17231 (+)

S4 CTCAGTCGTTACTGGTGAACCAGTTTCAAT
Φ858 ......T..............T..G.TGG. 32292 - 32321 (+)
Φ2972 .............................. 31582 - 31611 (+)

S5 AGTTTCTTTGTCAGACTCTAACACAGCCGC
Φ858 G..............T.............. 22124 - 22153 (+)
Φ2972 .............................. 22075 - 22104 (+)

S6 GCCCTTCTAATTGGATTACCTTCCGAGGTG
Φ858 .............................. 35334 - 35363 (-)
Φ2972 .............................. 34492 - 34521 (-)

S7 AAGCAAGTTGATATATTTCTCTTTCTTTAT
Φ858 .............................. 10280 - 10309 (-)
Φ2972 .............................. 10270 - 10299 (-)

S8 CGTTTTCAGTCATTGGTGGTTTGTCAGCG
Φ858 .T.C...CTCAC.AAA..T......TTTA 30680 - 30708 (-)
Φ2972 ............................. 29988 - 30016 (-)

S9 TTACTAGAGCGTGTCGTTAACCACTTTAAA
Φ858 .............................. 7882 - 7911 (+)
Φ2972 .............................. 7874 - 7903 (+)

S10 TTCGTTAAAGTCACCTCGTGCTAGCGTTGC
Φ858 .............................. 20670 - 20699 (-)
Φ2972 .............................. 20621 - 20650 (-)

S11 ATAACGGTAGCAAATATAAACCTGTTACTG
Φ858 .............................. 8368 - 8397 (+)
Φ2972 .............................. 8360 - 8389 (+)

S12 GAAGTAGCCATACAAGAAGATGGATCAGCA
Φ858 .............................. 19047 - 19076 (+)
Φ2972 .............................. 18998 - 19027 (+)

S13 GATGTCACTGAGTGTCTAAGCATTGCGTAC
Φ858 .............................. 34444 - 34473 (+)
Φ2972 .............................. 33602 - 33631 (+)

S14 TGAATAAGCAGTTCTTGACGACCAACCGAC
Φ858 .............................. 4809 - 4838 (-)
Φ2972 .............................. 4801 - 4830 (-)

Fig. S2. Alignment of the acquired CRISPR spacers with the corresponding genomic region of phage
858 and phage 2972. Identical bases are indicated by a dot, whereas nucleotide polymorphisms are
specified. Positions (bp) and DNA strand relative to the phage genomes are indicated on the right.
S1 CAACACATTCAACAGATTAATGAAGAATAC
Φ858 ..............................
Φ858-A ............A.................
Φ858-B ............................C.

Fig. S3. Alignment of CRISPR spacer S1 with the corresponding genomic region of phage 858 and the
two mutant phages that have circumvented the CRISPR resistance of strain WTΦ858+S1S2.

WTΦ858+S1S2 cas5 cas1 cas6 cas7 repeat/spacer region ORF

S1

S2

S2
T

P1 P2 P3 P4

S1

S2
S2
T

P1 P4

S1S2 construct: L
S1

S2

Fig. S4. Schematic representation of the PCR strategy followed to generate the S1S2 construct.
Genomic DNA of strain WTΦ858+S1S2 was used as a template in two distinct PCR reactions with primer
pairs P1-P2, and P3-P4, respectively. The two PCR products were mixed and subjected to a third PCR
reaction in the presence of primers P1 and P4.
WTΦ858+S1S2
cas5 cas1 cas6 cas7 repeat/spacer region ORF

Integration of the pR plasmid


via homologous recombination
pORI

WTΦ858+S1S2::pR
cas5 cas1 cas6 cas7 pORI repeat/spacer region ORF

cas5 cas1 cas6 cas7

Plasmid excision
pORI repeat/spacer region with deletion
of CRISPR1

WTΦ858+S1S2∆CRISPR1
cas5 cas1 cas6 cas7 ORF

Fig. S5. Diagram representing the homologous recombination events that led to mutants
WTΦ858+S1S2::pR and WTΦ858+S1S2∆CRISPR1. Strain WTΦ858+S1S2::pR was generated through integration
of the pR plasmid into cas7. Subsequently strain WTΦ858+S1S2∆CRISPR1 was obtained after plasmid
excision via homologous recombination at the 3' end of ORF.

SUPPORTING REFERENCES
1. C. Lévesque et al., Appl. Environ. Microbiol. 71, 4057 (2005).
2. S. Moineau, J. Fortier, H.-W. Ackermann, S. Pandian. Can J. Microbiol. 38, 875 (1992).
3. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. 67, 4361 (2001).

Supporting Online Material


www.sciencemag.org
Materials and Methods
Figs. S1 to S5
References and Notes

Vous aimerez peut-être aussi