Available online at www.sciencedirect.

com

ScienceDirect
Journal of Nutritional Biochemistry 60 (2018) 16 – 23

Effects of intermittent dietary supplementation with conjugated linoleic acid and fish
oil (EPA/DHA) on body metabolism and mitochondrial energetics in mice

Camila P. Rossignoli, Carlos R.P. Dechandt, Anderson O. Souza, Igor H. Sampaio, Tatiane M. Vicentini,
Bruno G. Teodoro, Marinaldo Pacífico Cavalcanti Neto, Gustavo Duarte Ferrari,
Carlos A. Couto-Lima, Luciane C. Alberici⁎
Departamento de Física e Química, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, USP, Av. Café s/n, 14040-903, Ribeirão Preto, SP, Brazil

Received 12 February 2018; received in revised form 26 June 2018; accepted 2 July 2018

Abstract

Understanding the mitochondrial processes that contribute to body energy metabolism may provide an attractive therapeutic target for obesity and co-
morbidities. Here we investigated whether intermittent dietary supplementation with conjugated linoleic (CLA, 18:2n-6), docosahexaenoic (22:6n-3, DHA) and
eicosapentaenoic (20:5n-3, EPA) acids, either alone or in combination, changes body metabolism associated with mitochondrial functions in the brain, liver,
skeletal muscle and brown adipose tissue (BAT). Male C57Bl/6 mice were divided into groups: CLA (50% cis-9, trans-11; 50% trans-10, cis-12), EPA/DHA (64%
EPA; 28% DHA), CLA plus EPA/DHA or control (linoleic acid). Each mouse received 3 g/kg b.w. of the stated oil by gavage on alternating days for 60 days. Dietary
supplementation with CLA or EPA/DHA increased body VO2 consumption, VCO2 production and energy expenditure, being fish oil (FO) the most potent even in
combination with CLA. Individually, both oils reduced mitochondrial density in BAT. CLA supplementation alone also a) elevated the expression of uncoupling
proteins in soleus, liver and hippocampus and the uncoupling activity in the last two, ad this effect was associated with reduced hydrogen peroxide production in
hippocampus; b) increased proteins related to mitochondrial fission in liver. EPA/DHA supplementation alone also a) induced mitochondrial biogenesis in liver,
soleus and hippocampus associated with increased expression of PGC1-α; b) induced proteins related to mitochondrial fusion in the liver, and fission and fusion
in the hippocampus. Therefore, this study shows changes on mitochondrial mechanisms induced by CLA and/or EPA/DHA that can be associated with elevated
body energy expenditure.
© 2018 Elsevier Inc. All rights reserved.

Keywords: Conjugated linoleic acid; Eicosapentaenoic acid; Docosapentaenoic acid; Uncoupling protein; Body metabolism; Mitochondrial biogenesis; Omega-3
polyunsaturated fatty acids

1. Introduction
Understanding the mitochondrial processes that lead to mild
uncoupling and contribute to body energy metabolism may provide an
attractive therapeutic target for metabolic diseases, including obesity
(for a review see [39]). During uncoupling some of the proton gradient
generated by the respiratory chain in order to phosphorylate ADP by
ATP synthase is dissipated through the mitochondrial inner mem-
brane. This way, a part of the energy liberated from the oxidation of
dietary carbohydrates, lipids, and proteins is lost as heat instead of
being converted into ATP.
Daily intake of either conjugated linoleic acids (CLA, 18:2 n-6) or
omega-3 polyunsaturated fatty acids (PUFA, docosahexaenoic acid —
C22:6 n-3, DHA and eicosapentaenoic acid — C20:5 n-3, EPA) are
alternative dietary therapies that have healthy effects by improving
clinical conditions related to overweight. CLA are isomers of linoleic
acid (LA) with a conjugated double-bound system. The most common
⁎ Corresponding author. Tel.: +55 16 33154435; fax: +55 16 33154161.
E-mail address: alberici@fcfrp.usp.br (L.C. Alberici).
effect associated with CLA intake, especially of its trans-10, cis-12
isomer, is the prevention of body fat mass accumulation in animals and
humans [1, 2], mediated by arrest of adipocyte differentiation/
development [3–5] and attenuation of the expression and activity of
adipogenic transcription factors such as the peroxisome proliferator-
activated receptor-gamma (PPAR-γ). Recently we have shown that
CLA reduce white adipose tissue (WAT) gain and increase body energy
expenditure, involving elevated uncoupling protein (UCP)-2 expres-
sion and evidences of UCPs activity in liver [6, 7]. UCPs are
mitochondrial inner membrane proteins capable of dissipating the
proton gradient, promoting mild uncoupling and accelerating the use
of energetic substrates.
Dietary supplementation with omega-3 PUFA has multiple
benefits. It acts by incorporating into membrane phospholipids,
modifying the permeability and fluidity of the membrane, increasing
rates of membrane-associated processes, which are key components
for body metabolic rate control (for a review, see [8]). For example,
there is a high positive correlation between the molecular activity of
Na+/K+ ATPase and DHA content in the surrounding membrane
bilayer [40]; DHA supplementation decreases the efficiency of the

https://doi.org/10.1016/j.jnutbio.2018.07.001
0955-2863/© 2018 Elsevier Inc. All rights reserved.
 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23
sarcoplasmic reticulum Ca2+ ATPase (SERCA) [9] and increases
mitochondrial proton leak [41]. In addition, EPA and/or DHA
supplementation augment muscle proteins anabolic response to
hyperinsulinaemia-hyperaminoacidaemia [10], promotes intramyo-
cellular triacylglycerol lowering associated with suppression of
lipogenesis and enhanced β-oxidation in myocytes [11–13]. DHA is
incorporated from dietary fish oil in the hippocampus, where it
controls the expression of genes implicated in the prevention of
neurological diseases [14] and can slow the age-related cognitive
decline (for a review see [15]). EPA and DHA are predominantly found
in fish from salt cold water and are the major constituents of fish oil.
Since their synthesis from α-linolenic acid barely occurs in the human
body, they are classified as essential fatty acids and must be obtained
from diet [16].
Therefore, the aim of the study was to determine whether 8-week
intermittent dietary supplementation with CLA and/or EPA/DHA (Fish
Oil, FO) - two potent activators of energy metabolism -affects body
metabolism associated with changes on mitochondrial bioenergetics,
biogenesis and reactive oxygen species production (ROS) in high
metabolic tissues such as brain, liver, skeletal muscle and brow
adipose tissue (BAT).
2. Material and methods
2.1. Animals and experimental protocol
Male C57BL/6 J mice, weighing approximately 15 g (5 weeks old), were obtained
from a breeding colony at the University of São Paulo, Ribeirão Preto campus. The mice
had ad libitum access to water and standard laboratory rodent chow (6003 Nuvilab CR1,
Curitiba, PR, Brazil), containing 40% carbohydrates, 22% protein and 4% fat; and were
housed at 23 °C±2 °C on a 12-h light:dark cycle. After the adaptation period, the mice
were divided into four groups, and each mouse received 0.1 ml of oil by gavage, as
described in Table 1. Each dose of oil administered corresponded to approximately 3 g/
kg b.w. or 2.2% of the dietary daily intake. Body weights were measured once a week.
After 60 days, the mice were euthanized, and the white adipose tissue (WAT) and BAT,
muscles (soleus and gastrocnemius) and liver were quickly removed and weighed. The
study was approved by the University's Ethics Committee for Animals Use (protocol no.
14.1.239.53.0.). After 4 week receiving oil, 3–4 mice of each group were placed into a
hermetic chamber connected to an indirect calorimetry system (Oxylet, Pan Lab, Spain),
with ad libitum access to water and food. Oxygen consumption (VO2) and CO2 release
(VCO2), and horizontal and vertical (rearing) movements were recorded for 48 h.
2.2. Biopsy preparation
Tissue biopsy were chopped into 1 mm cubes and placed in ice-cold BIOPS solution
[2.7 mM EGTA, 20 mM imidazole, 20 mM taurine, 50 mM acid 2-(N-morfolino)
ethanesulfonic potassium, 0.5 mM dithiothreitol, 6.5 mM MgCl2, 15 mM phosphocre-
atine, 0.57 mM ATP, pH 7.1]. For plasma membrane permeabilization, biopsies were
placed into ice-cold BIOPS solution containing saponin (0.01%) during 5 min (liver) or
20 min (other tissues), at 37 °C and 300 rpm stirring.
2.3. Respiratory rate
Respiratory rates were determined by oxygen consumption monitored in a high-
resolution respirometer Oxygraph-2 k (Oroboros, Innsbruk, Austria) containing 2.1 mL
of air saturated MiR05 (0.5 mM EGTA, 3 mM MgCl2, 60 mM K-lactobionate, 20 mM
taurine, 10 mM KH2PO4, 20 mM HEPES, 110 mM sucrose, 1 g/L albumin, pH 7.1).
Respiration was supported by 10 mM succinate (liver and BAT), 9 mM glutamate, 5 mM
malate, and 9 mM pyruvate (soleus) or 5 mM malate and 9 mM glutamate (brain). The
respiratory rates were determined after addition of ATP synthase inhibitor oligomycin
Table 1
Experimental design of dietary supplementation with CLA and/or FO
Day Groups
Control CLA FO CLA + FO
Pair LA CLA LA CLA
Odd LA LA FO FO
LA, linoleic acid (corn oil; 60% of LA); CLA, conjugated linoleic acid (cis-9, trans-11 and
trans-10, cis-12; 40% of each isomer); FO, fish oil (64% EPA; 28% DHA; 7% other ω-3 fatty
acid).
17
(1 μg/mL) (non-phosphorylating or LEAK state) and mitochondrial uncoupler carbonyl
cyanide m-chlorophenylhydrazone (CCCP, 1–2 μM) (state of maximal capacity of
electron transport system or ETS) [17]. After the oxygen consumption, the reaction
mixture was completely removed from the oxygraph chamber and submitted to protein
quantification using the Bradford method [18].
2.4. Hydrogen peroxide (H2O2)
H2O2 generation was monitored spectrofluorimetrically using 2 μM Amplex Red in
the presence of horseradish peroxidase (1 U/mL) [19] at 563/587 nm excitation/
emission wavelength pairs and slit widths of 5 nm.
2.5. Citrate synthase activity
Fifty mg of tissue homogenized in 1 mL of sucrose (250 μg/mL), EGTA (1 μg/mL) and
HEPES (10 μg/mL) pH 7.2, centrifuged (12,000 g), for 10 min at 4 °C. Citrate synthase
activity was measured in the supernatant after protein quantification [18]. Fifty
microliters were incubated with 1 mL of reaction medium containing acetyl-CoA (1 μg/
mL), DTNB (0.1 μg/mL), Triton X-100 (0.10%), oxaloacetate (0.2-μg/mL), Tris (0.1 M) pH
8.0, at 25 °C and monitored at 412 nm for 2 min [20].
2.6. Analysis of mRNA expression
Total RNA was isolated using the TRIzol reagent (Invitrogen, Grand Island, NY, USA),
solubilized in RNase-free H2O, and quantified by measuring the optical density (OD) at
260 nm (NanoDrop spectrophotometer; Thermo Fisher Scientific, USA). For cDNA
synthesis, 1.5 μg of RNA was used. The mRNA transcript levels were quantified using the
Eppendorf Realplex4 Mastercycler Instrument (Eppendorf) and SsOFast EvaGreen
(BioRad), according to the manufacturer's instructions. PCR cycling conditions included
10 min at 95 °C, followed by 40 cycles at 95 °C for 15 s, 60 °C for 1 min and 72 °C for 60 s.
Dissociation curve analysis confirmed that signals corresponded to unique amplicons.
After normalization with β-actin, the relative expression of mRNAs was determined by
the ΔΔCt method [21]. The design of the primers is expressed in Table 2.
2.7. Confocal microscopy
Tissues were rinsed with PBS and immediately frozen in Tissue Tek (Sacura
Finetek). Frozen tissue sections were placed on glass slides (Starfrost, Kinittel glass) and
fixed with 4% paraformaldehyde and permeabilized for 10 min with precooled
methanol. Tissues were washed with PBS and incubated in blocking buffer (PBS,
0.25% (v/v) Tween-20, 5% (v/w) BSA) for 1 h at room temperature. Next was the
incubation with anti-FIS1 (SC-376469; Santa Cruz Biotechnologies) and anti-Mfn2
(CST#9482 Cell Signaling Technologies) primary antibody, diluted in blocking buffer at
a ratio of 1: 100 (v/v), at 4 °C overnight. Tissues were washed with PBS and incubated
with fluorochrome-conjugated secondary antibodies Dylight+680 or Dylight+446
(KPL) diluted in blocking buffer at a ratio of 1: 1000 (v/v) for 1 h at room temperature.
The nuclear counter-staining was performed with DAPI (4′,6-diamidino-2-phenylin-
dole, stock solution 10 μg/mL, Thermo Fischer Scientific), diluted in PBS (1:1000 v/v) for
10 min at 37 °C. The samples were visualized using a confocal Microscope Leica SP8
(Leica).
2.8. Data analysis
All data are expressed as mean ± standard error of mean (SEM). Statistical analysis
was performed using the GraphPad Prism program (version 5.01). Comparisons
between groups were performed using one-way analysis of variance (ANOVA) with
Newman–Keuls post hoc analysis, with the significance level set at Pb.05. N indicates
the number of mice used of each group. Experiments were done in triplicates at least.
3. Results
3.1. In vivo
First, we assessed whether dietary supplementation with CLA and
FO, either alone or in combination, affects the body metabolism or
Table 2
Primer sequences used for analysis of mRNA expression
Gene Forward Reverse
UCP-1 GCATTCAGAGGCAAATCAGC GCCCCACACCTCCAGTCATTAAG
UCP-2 TCCTGAAAGCCAACCTCATG GGCAGAGTTCATGTATCTCGTC
UCP-3 GACTATGGATGCCTACAGAACC ACTCCAGCAACTTCTCCTTG
UCP-5 AACTGGCTTCGACTTGGAC ATCAGGAACACAAAGAGGACCC
PGC-1α CAAGCCAAACCAACAACTTTATCTCT CACACTTAAGGTTCGCTCAATAGTC
β-actin CACTTTCTACAATGAGCTGCG CTGGATGGCTACGTACATGG
18 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23

ab ab CLA FO CLA+FO
A 25
a B
Control

VO2(mL/min/kg^0.75)
Rest Awake
20
40

VO2(ml/min/kg^0.75)
15
30
10
20
5
10
0
Control CLA FO CLA+FO 0
6h 12h 18h 0h 6h

C 25 ab ab
D
VCO2 (mL/min/kg^0.75)

a 40

VCO2 (ml/min/kg^0.75)
20

15 30

10 20

5 10

0 0
Control CLA FO CLA+FO 6h 12h 18h 0h 6h

E 1.5
RQ (VCO2/ VO2)

1.0

0.5

0.0
Control CLA FO CLA+FO

F 200
ab ab
EE (kcal/day/kg^0.75)

a
150

100

50

0
Control CLA FO CLA+FO

Fig. 1. Calorimetric parameters of mice fed a diet supplemented with CLA and/or FO. (A and B) Volume of oxygen consumed (VO2). (C and D) Volume of carbon dioxide produced (VCO2).
(E) Respiratory quotient (RQ). (F) Energy expenditure (EE). Mean ± SEM. a Pb.05 vs. control; b Pb.05 vs. CLA (N=7).

weight gain in mice. Compared with the control group, mice fed CLA,
FO or CLA + FO-supplemented diet exhibited higher levels of VO2,
VCO2 (Fig. 1A, B, C, D) and EE (Fig. 1F). Compared to CLA mice, FO or Table 3
CLA + FO mice exhibited the highest values. RQ values, an index of Weights of body, white (WAT) and brown (BAT) adipose tissues, soleus and
body fat burn, were not significantly different between groups (Fig. gastrocnemius (gastro) muscles, brain and liver in mice fed a diet supplemented with
1E). Moreover, CLA and/or FO supplementation did not alter mice's CLA and/or FO

body weight gain within a 60-day period (Table 3). Factors such as Weight Control CLA FO CLA + FO
changes in food intake probably influenced this effect. Body gain (g) 6.0±0.4 6.9±0.4 6.7±0.4 6.7±0.3
Next, we assessed whether dietary supplementation with CLA and/ WAT 1.13±0.05 0.86±0.06 a 1.07±0.06 0.91±0.07 a
or FO alters behavior. For this, rearing and lateral movements BAT 0.39±0.02 0.29±0.02 0.35±0.02 0.25±0.03 a
Soleus 0.063±0.005 0.072±0.003 0.067±0.005 0.069±0.003
(locomotor) of mice were monitored and counted for 24 h. Fig. 2 Gastro 1.16±0.037 1.19±0.045 1.11±0.057 1.15±0.056
shows that mice fed CLA-supplemented diet exhibited augmented Brain 1.79±0.02 1.77±0.05 1.74±0.02 1.83±0.04
locomotor (Fig. 2A, B) and rearing (Fig. 2C, D) activities compared to Liver 4.92±0.1 5.31±0.09 a 5.14±0.07 5.50±0.12a,b
control group. Instead, mice fed FO and CLA + FO supplemented diet Values in as a percentage of body weight (% b.w.). Mean ± SEM.
exhibited reduced lateral movement, but similar rearing compared to a
pb.05 vs. control;
b
control group. Pb.05 vs. FO (n=4–20).
 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23 19

A B 100 Rest Awake

Lateral movement/min
4000
a
80

Units/mouse/24h
3000 60

40
2000
a,b a,b 20
1000
0
6h 12h 18h 0h 6h
0
Control CLA FO CLA+FO Control CLA FO CLA+FO

C D 50 Rest Awake
2000 a
40
rearing/mouse/24h

Rearing/min
1500 30
b
b
20
1000
10
500
0
6h 12h 18h 0h 6h
0 Control CLA FO CLA+FO
Control CLA FO CLA+FO

Fig. 2. Motor activity parameters of mice fed a diet supplemented with CLA and/or FO. (A and B) Horizontal movements. (C and D) Rearing or vertical movement. Mean ± SEM. a Pb.05
vs. control; b Pb.05 vs. CLA (N=5).

At the end of the weight gain period, the animals were euthanized,
and their visceral white adipose tissue (WAT), BAT, soleus and
gastrocnemius muscles, brain and liver were weighed (Table 3). The
liver weight (relative to body weight) increased while WAT and BAT
weights decreased in mice fed CLA and CLA + FO supplemented diet.
No significant changes were found in other tissues among the groups
during the experimental period. Changes in liver, WAT and BAT weights
were well described in previous studies with CLA ingestion [6, 7].
3.2. In vitro
To examine whether the elevation of body metabolism induced by
CLA and/or FO is related to an increase in mitochondrial metabolism in
the liver, muscle, adipose and brain tissues, citrate synthase activity
were measured in these tissues -a classical marker of mitochondrial
amount. Furthermore, O2 consumption rates in non-phosphorylating
state (LEAK, in the presence of oligomycin, when occurs proton leak)
relative to maximum respiratory capacity (ETS, in the presence of
uncoupler CCCP) were monitored to determine the degree of
mitochondrial uncoupling per mitochondria, avoiding the interfer-
ence of mitochondrial content.
In the liver, mice fed FO or CLA + FO supplemented diet exhibited
augmented citrate synthase activity, thus indicating high mitochon-
drial density (Fig. 3), with similar degree of coupling (Fig. 4) compared
to the control group. Instead, mice fed CLA-supplemented diet
presented similar mitochondrial content with high degree of mito-
chondrial uncoupling compared with control group. Uncoupling of
oxidative phosphorylation was also found in isolated liver mitochon-
dria from these mice who demonstrated large variation on ADP/O ratio
(Δ ADP/O) in the presence of free fatty acids (substrates for UCPs
activity) or absence (in BSA presence, UCP inactive) (Fig. 5). As the last
result denotes an increased UCP activity in mice fed CLA- supple-
mented diet, we measured the UCP2 mRNA expression level, the
predominant UCP isoform in the liver. As expected, the UCP2
expression in mice fed CLA-supplemented diet was significantly
greater than the UCP2 expression in the other three mice groups (Fig.
6). The elevated biogenesis in mice fed FO or CLA + FO was indicated
by raised peroxisome proliferator-activated receptor gamma co-
activator 1-alpha (PGC1-α) mRNA expression level, the master
regulator of mitochondrial biogenesis (Fig. 6).
In the soleus muscle, only mice fed FO-supplemented diet
exhibited augmented mitochondrial density (Fig. 3), followed by
higher PGC1-α mRNA expression level (Fig. 6). All supplemented
groups presented similar degree of mitochondrial coupling compared
with the control group (Fig. 4), but UCP-2 and UCP-3 mRNA expression
levels were found elevated in mice fed CLA-supplemented diet (Fig. 6).
In the hippocampus, mice fed FO-supplemented diet also exhibited
augmented citrate synthase activity (Fig. 3), but only mice fed CLA or
CLA + FO-supplemented diet also presented elevated levels of
uncoupling (Fig. 4). These results were reinforced by mRNA

150 Control FO
Citrate synthase activity

130
CLA CLA+FO b
(nmol/mg/min)

110
90 a
70 a
50
30 a,b a,b a,b
a,b c
20 c
10
0
Liver Soleus Hippocampus BAT

Fig. 3. Citrate synthase activity in liver, soleus, hippocampus and BAT mice fed CLA and/or FO-supplemented diet. Mean ± SEM. a Pb.05 vs. control; b Pb.05 vs. CLA; c Pb.05 vs. FO (N=7).
20 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23

1.2 Control FO
CLA CLA+FO

R LEAK / R ETS
0.8

a
0.4 b b a a,c
b

0.0
Liver Soleus Hippocampus BAT

Fig. 4. Ratio between rates of O2 consumption in states of non-phosphorylation (R LEAK) and maximal respiratory capacity (R ETS) in liver, soleus, hippocampus and BAT of mice fed CLA
and/or FO-supplemented diet. Mean ± SEM. a Pb.05 vs. control; b Pb.05 vs. CLA; c Pb.05 vs. FO (N=7).

0.5 prevents ROS production in this tissue. In liver, only mice fed
a CLA + FO-supplemented diet presented reduced H2O2 production,
0.4 which was not associated to mitochondrial uncoupling.
Among the tissues evaluated, liver and brain undergo the major
ADP/O

0.3
changes in biogenesis and coupling after CLA and/or FO supplemen-
0.2 tation. In these tissues we investigated whether these changes are
associated with mitochondrial dynamics and cellular biogenesis, using
0.1 immunofluorescent staining to mitofusin 2 (Mfn 2) and fission (Fis1),
and nuclei (4′,6-diamidino-2-phenylindole dihydrochloride, DAPI),
0.0 respectively. Fig. 8A illustrates a confocal imaging of the liver showing
Control CLA FO CLA+FO a slight increase in FIS 1 staining in mice fed CLA or CLA + FO-
supplemented diet, indicating a shift towards fission process, in
Fig. 5. ADP/O ratio in isolated liver mitochondria (0.5 mg protein/mL) of mice fed CLA
contrast to a strong Mfn 2 staining in mice fed FO or CLA + FO
and/or FO-supplemented diet. (A) Variations on ADP/O ratio (Δ ADP/O): values of ADP/
O in the presence of free fatty acids (with 0.2 μM linoleic acid) minus ADP/O values in supplemented diet indicating a shift towards fusion. In the brain
absence of free fatty acids (with 0.01% BSA). ADP/O was determined monitoring oxygen (Fig. 8B) confocal images show a strong increase in Fis 1, Mfn 2 and
consumption during phosphorylating state after addition of 200 μM ADP in Mir05 DAPI staining in mice fed FO or CLA + FO-supplemented diet
medium containing 10 mM succinate, at 30 °C. Liver mitochondria were isolated using indicating improved fission, fusion and increased cell number,
differential centrifugation method in the presence of 0.01% BSA [38]. Mean ± SEM. a
respectively.
Pb.05 vs. control (n=7).

4. Discussion

expression levels of PGC1-α and UCP-5 (the predominant UCP isoform
in the brain) (Fig. 6), respectively.
In BAT, mice fed CLA or FO-supplemented diet surprisingly
presented reduced mitochondrial density (Fig. 3), but reduced
PGC1-α mRNA content was found only CLA-fed group (Fig. 6). Despite
the increased UCP-1 transcription (predominant UCP isoform in BAT),
mice fed CLA-supplemented diet, all groups presented similar pattern
of mitochondrial coupling (Fig. 4).
Higher mitochondrial density can increase the reactive oxygen
species (ROS) generation as a normal consequence of respiratory
activity [22]. Regardless, with elevated UCP levels, faster respiratory
rates can be obtained, accompanied by lower ROS release [23].
Thereupon, we investigated the H2O2 release in the previously
mentioned tissues (Fig. 7). Soleus muscle and BAT from mice fed
CLA, FO or CLA + FO-supplemented diet presented H2O2 production
rates similar to control mice. On the other hand, in the brain, these
rates are reduced in mice fed CLA or CLA + FO-supplemented diet,
thus indicating that uncoupling activity, probably related to UCP-5,
mRNA Relative Expression
Here we show that feeding mice a low-fat (4%) diet supplemented
with ~2% CLA or FO on alternating days increase body metabolism,
being FO the strongest even in combination with CLA. This is a known
CLA effect previously described by us and others [6, 42, 43]; however,
only two studies have described the effects of FO on energy
expenditure, one showing 14% increase in resting metabolic rate
(Logan and Spriet, 2015), and the other showing lack of effect [44] in
humans.
Diet supplemented with CLA alone incremented rearing and lateral
movements in mice, while diet supplemented with FO promoted an
opposite effect, even in combination with CLA. Animals that travel a
greater distance and raise more frequently are considered less
anxious, therefore, more anxious animals tend to explore less the
environment [24]. In agreement, Soares et al. [25] reported reduction
in anxiety in pregnant female rats that received CLA and in their
progeny. However, dietary supplementation with EPA/DHA has been
shown to promote no significant change in anxiety related behaviors
as assessed by the elevated-plus maze test [45]. Our discrepant result

6 Control FO
CLA CLA+FO a
a
(Gene: -actin)

4 a,b
a a a
a a
2 b b
b

0
PGC1 UCP-2 PGC1 UCP-2 UCP-3 PGC1 UCP-5 PGC1 UCP-1
Liver Soleus Hippocampus BAT

Fig. 6. Relative mRNA quantification of PGC1-α and UCP-2, UCP-3 or UCP -5 in liver, soleus, hippocampus and BAT of mice fed CLA and/or FO-supplemented diet. Mean ± SEM. a Pb.05 vs.
control; b Pb.05 vs. CLA (n=7).
 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23
80
H2O2 (pmol/mg/min)
60
40 a
20
0
Liver
Fig. 7. H2O2 generation in liver, soleus, hippocampus and BAT of mice fed a diet supplemented with CLA and/or FO. Mean ± SEM. a Pb.05 vs. control; b Pb.05 vs. CLA (n=7).
may be attributed to the different in vivo tests used, with elevated-plus
maze test being more appropriate to evaluate the anxiety level.
Nonetheless, locomotor activity can influence the energy expenditure
positively in CLA and negatively in FO-supplemented mice groups.
Dietary supplementation with CLA diminished WAT, BAT while
enhanced liver weight as previously described by us and others (for a
review, see [26]). CLA exerts its effects primarily through the
suppression of adipogenesis/lipogenesis and stimulation of lipolysis
[46] by reducing the transcription levels of genes encoding proteins
involved in glucose and fatty acid import [27] in WAT, providing fatty
acids and glucose to oxidation or storage in liver and other tissues. In
the liver, CLA supplementation induced enhancements in fission
machinery, indicating a shift towards fission. Mitochondrial fragmen-
tation has been reported after treatment with high glucose and/or
high free fatty acids in cell (rat liver, adipocytes and pancreatic islets)
and animal (skeletal muscle and liver) models. Under these condi-
tions, many small organelles represent a high surface area which could
increase the accessibility of metabolic substrate to carrier proteins,
improving mitochondrial intake and oxidation of energy substrates
(for a review, see [47]). Dietary supplementation with FO had no
opposite effect on CLA modulation in WAT and liver weights and
dynamics, although it had shifted towards fusion in the liver.
Mitochondrial fusion and enhancements of fusion machinery in the
liver have been reported after FO feeding in rats [47], and represents a
Fig. 8. Immunofluorescence analysis of mitochondrial dynamics-related proteins, Fis1 and Mnf 2, and nuclear staining with DAPI in liver and brain of mice fed CLA and/or FO-
supplemented diet. (A) represents the liver (10 × the original magnification); (B) represents the hippocampus (10 × the original magnification).
21
Control FO
CLA CLA+FO
b
a
a
a
Soleus Hippocampus BAT
condition required to ensure maximum oxidative metabolism [28].
Unlike in humans, rats feed with CLA (1%) plus n-3 long chain- PUFA
(1%) - in standard chow – WAT reduction and no significant changes in
liver weight was found [48].
Markedly CLA supplementation induced the mRNA of the main
UCP isoform of each tissue studied here, being liver and brain the only
ones to demonstrate evidences of increased UCP activity (uncoupled
respiration and low ROS production). It is important to note that 70% of
the basal metabolic rate of humans is contributed by internal organs
[49]. Studies have shown UCPs overexpression induced by CLA in a
variety of tissues, such as liver [7, 29–31], muscles [27, 29] and
adipocytes [27, 32], but they fail to demonstrate that these proteins are
really active in the tissues.
Moreover, no previous study has shown CLA-induced UCPs
activity, and it's associated ROS lowering effect in the brain. In this
tissue, UCP-2 overexpression or mild uncoupling induced by 2,4-
dinitrophenol (DNP) correlates with neuronal survival [33]. By
regulating several mitochondrial functions — such as ROS production
— neuronal UCPs can directly influence neurotransmission, synaptic
plasticity and neurodegenerative processes (for a review, see [34]).
On the other hand, orally administered FO, clearly induced
mitochondrial biogenesis in liver, soleus and hippocampus. Several
reports show that, in vitro and in vivo, these long chain omega-3
polyunsaturated fatty acids improve mitochondrial energetic
22 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23
functions, such as preventing ATP depletion, ROS increments and
suppression of Mfn 2 expression in a steatotic hepatocyte model [35];
restoring the age-related decrease in respiration and improving ATP
production in dissociated brain cells [36]; inducing overexpression of
genes encoding oxidative phosphorylation system enzymes, and ATP
synthase in the hippocampus [50]. Despite this, few studies investi-
gated if improvements in mitochondrial function are associated to its
biogenesis. For example, JOHNSON et al. [37] demonstrated that, in
skeletal muscle, 10-week EPA supplementation in mice partially
attenuated the age-related decline in mitochondrial function in the
absence of any changes in mitochondrial density or biogenesis [37].
Here, in healthy animals, EPA/DHA stimulated mitochondrial biogen-
esis by mechanism involving PGC1-alpha expression, which can be
indirectly modulated by intracellular ATP/ADP through AMPK activa-
tion [51]. As mitochondrial number is not associated to body metabolic
rates, we suggest that the stimulated mitochondrial biogenesis is an
adaptive response to ATP supply, since EPA/DHA increases the rates of
membrane-associated processes, which consume ATP. In mammals,
the high mass-specific basal metabolic rate is associated with more
polyunsaturated membranes (for a review, see [8]). Moreover, in the
hippocampus EPA/DHA induced the expression of proteins related to
mitochondrial fission and fusion, indicating improved organelle
dynamics. Dysfunctions in these processes affect neuronal survival
and are implicated in both inherited and age-dependent neurode-
generative diseases (for a review, see [52]).
Lastly, in dietary supplementation with CLA + FO, some effects of
each oil were maintained, such as improved mitochondrial biogenesis
and fusion (attributed to EPA/DHA) and fission (attributed to CLA) in
the liver, and uncoupling (attributed to CLA) and dynamics (attributed
to EPA/DHA) in hippocampus. Moreover, this combination preserved
mitochondrial density in BAT with a slight UCP-1 increase. In rats,
CLA + FO supplementation increased BAT mass and UCP-1 mRNA
expression, augmented food intake without affecting body weight
[48], suggesting an elevated metabolic rate in these animals.
In conclusion, 8-week intermittent dietary supplementation with
CLA and/or FO increase body metabolism and alters mitochondrial
energy metabolism. While CLA acts directly uncoupling oxidative
phosphorylation, EPA/DHA induces biogenesis as an adaptive mech-
anism to energy supply. Together they induce uncoupling associated
to UCP-5 mRNA expression levels, reduce ROS release and improve
mitochondrial dynamics in the hippocampus.
Duality of Interest
The authors declare that there is no duality of interest associated
with this manuscript.
Acknowledgments
This study was funded by the Fundação de Amparo à Pesquisa do
Estado de São Paulo (FAPESP – 2010/17259-9). The authors thank Ieda
M. R. Prado from Faculdade de Ciências Farmacêuticas de Ribeirão
Preto for technical support.
References
[1] Park Y. Conjugated linoléic acid (CLA): good or bad trans fat? J Food Compos Anal
2009;10:1–9.
[2] Park Y, Albright K, Liu W, Storkson J, Cook M, Pariza M. Effect of conjugated linoleic
acid on body composition in mice. Lipids 1997;32:853–8.
[3] Brown JM, McIntosh MK. Conjugated linoleic acid in humans: regulation of
adiposity and insulin sensitivity. J Nutr 2003;133(10):3041–6.
[4] Nagao K, Yanagita T. Bioactive lipids in metabolic syndrome. Prog Lipid Res 2008;
47(2):127–46.
[5] Wahle KWJ, Heys SD, Rotondo D. Conjugated linoleic acids: are they beneficial or
detrimental to health? Prog Lipid Res 2004;43(6):553–87.
[6] Baraldi FG, Vicentini TM, Teodoro BG, Dalalio FM, Dechandt CRP, Prado IMR, et al.
The combination of conjugated linoleic acid (CLA) and extra virgin olive oil
increases mitochondrial and body metabolism and prevents CLA-associated
insulin resistance and liver hypertrophy in C57Bl/6 mice. J Nutr Biochem 2016;28:
147–54.
[7] Pereira AF, Sá LL, Reis FHZ, Cardoso FC, Alberici RM, Prado IMR, et al.
Administration of a murine diet supplemented with conjugated linoleic acid
increases the expression and activity of hepatic uncoupling proteins. J Bioenerg
Biomembr 2012;44(5):587–96.
[8] Hulbert AJ, Pamplona R, Buffenstein R, Buttemer WA. Life and death: metabolic
rate, membrane composition, and life span of animals. Physiol Rev 2007;87(4):
1175–213.
[9] Fajardo VA, Bombardier E, Irvine T, Metherel AH, Stark KD, Duhamel T, et al.
Dietary docosahexaenoic acid supplementation reduces SERCA Ca2+ transport
efficiency in rat skeletal muscle. Chem Phys Lipids 2015;187:56–61.
[10] Smith GI, Atherton P, Reeds DN, Mohammed BS, Rankin D, Rennie MJ, et al.
Omega-3 polyunsaturated fatty acids augment the muscle protein anabolic
response to hyperinsulinaemia–hyperaminoacidaemia in healthy young and
middle-aged men and women. Clin Sci 2011;121(6):267–78.
[11] Pérez-Echarri N, Pérez-Matute P, Marcos-Gómez B, Marti A, Martínez JA, Moreno-
Aliaga MJ. Down-regulation in muscle and liver lipogenic genes: EPA ethyl ester
treatment in lean and overweight (high-fat-fed) rats. J Nutr Biochem 2009;20(9):
705–14.
[12] Rossmeisl M, Jelenik T, Jilkova Z, Slamova K, Kus V, Hensler M, et al. Prevention
and reversal of obesity and glucose intolerance in mice by DHA derivatives.
Obesity 2009;17(5):1023–31.
[13] Yu YH, Wu SC, Cheng WTK, Mersmann HJ, Shen TL, Ding ST. The function of
porcine PPAR?? And dietary fish oil effect on the expression of lipid and glucose
metabolism related genes. J Nutr Biochem 2011;22(2):179–86.
[14] Puskás LG, Kitajka K, Nyakas C, Barcelo-Coblijn G, Farkas T. Short-term
administration of omega 3 fatty acids from fish oil results in increased
transthyretin transcription in old rat hippocampus. Proc Natl Acad Sci U S A
2003;100(4):1580–5.
[15] Denis I, Potier B, Vancassel S, Heberden C, Lavialle M. Omega-3 fatty acids and
brain resistance to ageing and stress: body of evidence and possible mechanisms.
Ageing Res Rev 2013;12(2):579–94.
[16] Hull MA. Omega-3 polyunsaturated fatty acids. Best Pract Res Clin Gastroenterol
2011;25(4–5):547–54.
[17] Pesta D, Gnaiger E. High-resolution respirometry: OXPHOS protocols for human
cells and permeabilized fibers from small biopsies of human muscle. Mitochon-
drial bioenergetics: Methods and protocols, vol. 810. ; 2012. p. 25–58.
[18] Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding reproduction.
Anal Biochem 1976;254:248–54.
[19] Zhou M, Diwu Z, Panchuk-Voloshina N, Haugland RP. A stable nonfluorescent
derivative of resorufin for the fluorometric determination of trace hydrogen
peroxide: applications in detecting the activity of phagocyte NADPH oxidase and
other oxidases. Anal Biochem 1997;253(2):162–8.
[20] Eigentler A, Draxl A, Wiethüchter A, Kuznetsov A, Lassing B, Gnaiger E. Laboratory
protocol: citrate synthase a mitochondrial marker enzyme. Mitochondrial Physiol
Netw 2012;4(3):1–11.
[21] Seale P, Conroe HM, Estall J, Kajimura S, Frontini A, Ishibashi J, et al. Prdm16
determines the thermogenic program of subcutaneous white adipose tissue in
mice. J Clin Investig 2011;121(1):96–105.
[22] Takahashi Y, Kushiro M, Shinohara K, Ide T. Dietary conjugated linoleic acid
reduces body fat mass and affects gene expression of proteins regulating energy
metabolism in mice. Comp Biochem Physiol B Biochem Mol Biol 2002;133(3):
395–404.
[23] Skulachev VP. Uncoupling: new approaches to an old problem of bioenergetics.
Biochim Biophys Acta 1998;1363(2):100–24.
[24] Choleris E. A detailed ethological analysis of the mouse open field test: effects of
diazepam, chlordiazepoxide and an extremely low frequency pulsed magnetic
field. Neurosci Biobehav Rev 2001;25(3):235–60.
[25] Soares JKB, de Melo APR, Medeiros MC, Queiroga RCRE, Bomfim MAD, Santiago
ECA, et al. Anxiety behavior is reduced, and physical growth is improved in the
progeny of rat dams that consumed lipids from goat milk: an elevated plus maze
analysis. Neurosci Lett 2013;552:25–9.
[26] Whigham LD, Watras AC, Schoeller DA. Efficacy of conjugated linoleic acid for
reducing fat mass: a meta-analysis in humans. Am J Clin Nutr 2007;
85(1203–1211):1203–11.
[27] Takahashi M, Tsuboyama-Kasaoka N, Nakatani T, Ishii M, Tsutsumi S, Aburatani H,
et al. Fish oil feeding alters liver gene expressions to defend against PPARalpha
activation and ROS production. Am J Physiol Gastrointest Liver Physiol 2002;
282(2):G338–48.
[28] Rambold AS, Cohen S, Lippincott-schwartz J. Fatty acid trafficking in starved cells:
regulation by lipid droplet lipolysis, autophagy and mitochondrial fusion
dynamics. Dev Cell 2016;32(6):678–92.
[29] Choi JS, Koh I-U, Jung MH, Song J. Effects of three different conjugated linoleic acid
preparations on insulin signalling, fat oxidation and mitochondrial function in rats
fed a high-fat diet. Br J Nutr 2007;98(2):264–75.
[30] Tsuboyama-Kasaoka N, Takahashi M, Tanemura K, Kim HJ, Tange T, Okuyama H,
et al. Conjugated linoleic acid supplementation reduces adipose tissue by
apoptosis and develops lipodystrophy in mice. Diabetes 2000;49(9):1534–42.
[31] Wang Y, Jones P. Conjugated linoleic acid and obesity control: efficacy and
mechanisms. Int J Obes Relat Metab Disord 2004;28(8):941–55.
 C.P. Rossignoli et al. / Journal of Nutritional Biochemistry 60 (2018) 16–23
[32] Ribot J, Portillo MP, Picó C, Macarulla MT, Palou A. Effects of trans-10, cis-12
conjugated linoleic acid on the expression of uncoupling proteins in hamsters fed
an atherogenic diet. Br J Nutr 2007;97(6):1074–82.
[33] Mattiasson G, Shamloo M, Gido G, Mathi K, Tomasevic G, Yi S, et al. Uncoupling
protein-2 prevents neuronal death and diminishes brain dysfunction after stroke
and brain trauma. Nat Med 2003;9(8):1062–8.
[34] Andrews ZB, Diano S, Horvath TL. Mitochondrial uncoupling proteins in the
CNS: in support of function and survival. Nat Rev Neurosci 2005;6(11):
829–40.
[35] Zhang Y, Jiang L, Hu W, Zheng Q, Xiang W. Mitochondrial dysfunction during in
vitro hepatocyte steatosis is reversed by omega-3 fatty acid-induced up-
regulation of mitofusin 2. Metabolism 2011;60(6):767–75.
[36] Afshordel S, Hagl S, Werner D, Röhner N, Kögel D, Bazan NG, et al. Omega-3
polyunsaturated fatty acids improve mitochondrial dysfunction in brain aging -
impact of Bcl-2 and NPD-1 like metabolites. Prostaglandins Leukot Essent Fatty
Acids 2015;92:23–31.
[37] Johnson ML, Lalia AZ, Dasari S, Pallauf M, Fitch M, Hellerstein MK, et al.
Eicosapentaenoic acid but not docosahexaenoic acid restores skeletal muscle
mitochondrial oxidative capacity in old mice. Aging Cell 2015;14(5):734–43.
[38] Alberici LC, Oliveira HC, Patrício PR, Kowaltowski AJ, Vercesi AE. Hyperlipidemic
mice present enhanced catabolism and higher mitochondrial ATP-sensitive K+
channel activity. Gastroenterology 2006;131(4):1228–34.
[39] Busiello RA, Savarese S, Lombardi A. Mitochondrial uncoupling proteins and
energy metabolism. Front Physiol 2015;6:36. https://doi.org/10.3389/fphys.2015.
00036 (eCollection 2015. Review).
[40] Turner N, Else PL, Hulbert AJ. Docosahexaenoic acid (DHA) content of membranes
determines molecular activity of the sodium pump: implications for disease states
and metabolism. Naturwissenschaften 2003;90(11):521–3.
[41] Stillwell W, Jenski LJ, Crump FT, Ehringer W. Effect of docosahexaenoic acid on
mouse mitochondrial membrane properties. Lipids 1997;32:497–506.
[42] Peters JM, Park Y, Gonzalez FJ, Pariza MW. Influence of conjugated linoleic acid on
body composition and target gene expression in peroxisome proliferatoractivated
receptor α-null mice. BBA-Mol Cell Biol L 2001;1533:233–42.
23
[43] Ohnuki K, Haramizu S, Ishihara K, Fushiki T. Increased energy metabolism and
suppressed body fat accumulation in mice by a low concentration of conjugated
linoleic acid. Biosci Biotechnol Biochem 2001;65:2200–4.
[44] Jannas-Vela S, Roke K, Boville S, Mutch DM, Spriet LL. Lack of effects of fish oil
supplementation for 12 weeks on resting metabolic rate and substrate oxidation
in healthy young men: a randomized controlled trial. PLoS One 2017;
12(2):e0172576.
[45] Ross BM, Malik I, Babay S. Dietary omega-3 polyunsaturated fatty acid
supplementation in an animal model of anxiety. Prostaglandins Leukot Essent
Fatty Acids 2016;114:17–20.
[46] Kennedy A, Martinez K, Schmidt S, Mandrup S, LaPoint K, McIntosh M. Antiobesity
mechanisms of action of conjugated linoleic acid. J Nutr Biochem 2010;21:171–9.
[47] Lionetti L, Mollica MP, Donizzetti I, Gifuni G, Sica R, Pignalosa A, Cavaliere G, Gaita
M, De Filippo C, Zorzano A, Putti R. High-lard and high-fish-oil diets differ in their
effects on function and dynamic behaviour of rat hepatic mitochondria. PLoS One
2014;9(3):e92753.
[48] Sneddon AA, Rayner DV, Mitchell SE, Bashir S, Ha JH, Wahle KW, Morris AC,
Williams LM. Dietary supplementation with conjugated linoleic acid plus n-3
polyunsaturated fatty acid increases food intake and brown adipose tissue in rats.
Nutrients 2009;1(2):178–96.
[49] Schmidt-Nielsen K. Animal Physiology: Adaptation and Environment. 4th ed.
Cambridge Univ. Press: Cambridge, UK; 1990.
[50] Harbeby E, Jouin M, Alessandri JM, Lallemand MS, Linard A, Lavialle M, Huertas A,
Cunnane SC. Guesnet P. n-3 PUFA status affects expression of genes involved in
neuroenergetics differently in the fronto-parietal cortex compared to the CA1
area of the hippocampus: effect of rest and neuronal activation in the rat.
Prostaglandins Leukot Essent Fatty Acids 2012;86(6):211–20.
[51] Lee WJ, Kim M, Park HS, Kim HS, Jeon MJ, Oh KS, Koh EH, Won JC, Kim MS, Oh GT,
Yoon M, Lee KU, Park JY. AMPK activation increases fatty acid oxidation in skeletal
muscle by activating PPARalpha and PGC-1. Biochem Biophys Res Commun 2006;
340:291–5.
[52] Khacho M, Slack RS. Mitochondrial dynamics in the regulation of neurogenesis:
from development to the adult brain. Dev Dyn 2018;247(1):47–53.