The Journal of Immunology

Semaphorin CD100 from Activated T Lymphocytes Induces

Process Extension Collapse in Oligodendrocytes and Death of
Immature Neural Cells1

Pascale Giraudon,2,3* Peggy Vincent,2* Carine Vuaillat,2* Olivier Verlaeten,2* Luis Cartier,‡
Anne Marie-Cardine,† Mireille Mutin,* Armand Bensussan,† Marie-Françoise Belin,* and
Laurence Boumsell†
An inappropriate cross talk between activated T lymphocytes infiltrating the CNS and neural cells can sustain the onset and
progression of demyelination and axonal degeneration in neuroinflammatory diseases. To mimic this deleterious cross talk, we
designed an experimental paradigm consisting of transient cocultures of T lymphocytes chronically activated by retrovirus in-
fection (not virus productive) with human multipotent neural precursors or primary oligodendrocytes from rat brain. We showed
that activated T lymphocytes induced apoptotic death of multipotent neural progenitors and immature oligodendrocytes after a
progressive collapse of their process extensions. These effects were reminiscent of those induced by brain semaphorin on neural
cells. Blockade by specific Abs of soluble CD100 (sCD100)/semaphorin 4D released by activated T cells, or treatment with
rsCD100, demonstrated that this immune semaphorin has the ability to collapse oligodendrocyte process extensions and to trigger
neural cell apoptosis, most likely through receptors of the plexin family. The specific presence of sCD100 in the cerebrospinal fluid
and of CD100-expressing T lymphocytes in the spinal cord of patients suffering with neuroinflammatory demyelination pointed to
the potential pathological effect of sCD100 in the CNS. Thus, our results show that CD100 is a new important element in the
deleterious T cell-neural cell cross talk during neuroinflammation and suggest its role in demyelination or absence of remyelination
in neuroinflammatory diseases including multiple sclerosis and human T lymphotropic virus type 1-associated myelopathy. The
Journal of Immunology, 2004, 172: 1246 –1255.

I nteraction between the immune and the nervous systems may
trigger an inappropriate cross talk, as suggested by demyeli-
nation and axonal loss in neuroinflammatory diseases. In at-
tempting to understand this cross talk, two key issues need to be
resolved: the entry and survival of activated T lymphocytes in the
brain, and the identification of immune molecules leading to de-
myelination. A large and diverse molecular repertoire shared by
immune and CNS, such as cytokines, chemokines, the metallopro-
teinase/inhibitor, and Fas/Fas ligand systems, revealing remark-
able similarities between signaling molecules and cellular recep-
tors in both systems, could participate in this cross talk (1). It also
provides essential information reflecting important steps toward a
*Institut National de la Santé et de la Recherche Médicale Research Unit 433, Ex-
perimental Neurobiology and Physiopathology, Federative Institut of Neuroscience
19 Faculty of Medicine R Laennec, Lyon, France; †Institut National de la Santé et de
la Recherche Médicale Research Unit 448, Differentiation, Interaction, Activation,
and Migration of Human Immune Cells, Faculty of Medicine, Créteil, France; and
‡
Departement of Neuroscience, Faculty of Medicine, Hospidal del Salvador, San-
tiago, Chile
Received for publication May 19, 2003. Accepted for publication October 30, 2003.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by grants from French Agencies of Research on Multiple
Sclerosis and on HIV (Agence Recherche Selérose Plaques, Ligue Recherche Sclé-
rose Plaques, Association Francaise Contre les Myopathies, and Agence Nationale de
Recherches sur le SIDA) and Institut National de la Santé et de la Recherche Médicale
funds.
2
P.G., P.V., C.V., and O.V. contributed equally to this study.
3
Address correspondence and reprint requests to Dr. Pascale Giraudon, Unit 433
Institut National de la Santé et de la Recherche Médicale, Faculty of Medicine R
Laennec, rue G. Paradin 69372 Lyon CEDEX 08 France. E-mail address: giraudon@
lyon.inserm.fr
more complete understanding of the functional properties of di-
verse molecules either in normal or pathological conditions. It is
becoming clear that semaphorins, which are well known for their
role in axonal steering, synapse formation, and chemorepulsion in
the developing nervous system (2– 4), also have roles in the im-
mune system. In fact, CD100 (also known as semaphorin 4D
(SEMA-4D))4 and SEMA-4A, two immune semaphorins, are ex-
pressed constitutively in T cells (5, 6), function as soluble ligand
to regulate the humoral and cellular immune responses (7–9), and
are suspected to be involved in autoimmune diseases such as ex-
perimental autoimmune encephalitis (EAE) (6, 10). SEMA-3A
acts in axonal guidance, apoptosis of neural precursors or neurons,
and oligodendrocyte alteration (11–14), and inhibits the chemo-
kine-induced migration of human immune cells similarly to
CD100 (15). Neuropilin-1, a component of SEMA-3A receptor in
brain, is also expressed in immune cells and plays a role in the
establishment of contacts between naive T lymphocytes and den-
dritic cells (16). In this context, we propose that soluble CD100
(sCD100), which is produced upon T lymphocyte activation
through proteolysis by a metalloproteinase (17), could be respon-
sible for an inappropriate response in neural-immune interactions
during inflammation.
Neuroinflammatory diseases, including multiple sclerosis (MS)
and myelopathy associated with human T lymphotropic virus type
1 (HTLV-1) infection (TSP/HAM), are characterized by inflam-
mation associated with damage of the white matter and axonal
4
Abbreviations used in this paper: SEMA, semaphorin; CNPase, cyclic nucleotide
phosphodiesterase; CSF, cerebrospinal fluid; EAE, experimental autoimmune enceph-
alitis; GalCer, galactocerebroside; GFAP, glial acidic fibrillary protein; HTLV-1, hu-
man T lymphotropic virus type 1; MS, multiple sclerosis; sCD100, soluble CD100;
TSP/HAM, tropical spastic paraparesis/HTLV-1-associated myelopathy.

Copyright © 2004 by The American Association of Immunologists, Inc. 0022-1767/04/$02.00

The Journal of Immunology
degeneration in the brain and spinal cord (18 –20). Both infiltrated
T lymphocytes and inflammatory mediators are suspected to par-
ticipate in pathogenic mechanisms (21–25). The persistent demy-
elination in these diseases and the reported sensibility of neural
progenitors to inflammatory mediators suggest the dysfunction or
death of the precursors or myelinating oligodendrocytes required
for remyelination (26 –28). Axonal loss, detected early in the dis-
ease by magnetic resonance spectroscopy (29, 30), could result
from defects in remyelination (31) and abnormal levels of molec-
ular signals that regulate axon extension such as semaphorins (32).
Assuming that immune semaphorins produced by infiltrating T
lymphocytes may have a deleterious effect on neural cells, we
investigated the in vitro effect of activated T cells releasing
sCD100-SEMA-4D and rsCD100 protein on human pluripotent
neural precursors and on rat oligodendrocytes. These cellular con-
tacts mimic interactions occurring during neuroinflammation be-
tween infiltrating/activated T lymphocytes and oligodendrocytes
or pluripotent neural precursors still capable of generating glial
cells in adult brain (33). In respect to the effects of brain sema-
phorins on neural precursors and oligodendrocytes (12, 13), we
particularly focused on process extensions and cell survival. Next,
the in vivo functional relevance was examined by looking for: 1)
the presence of sCD100 in the cerebrospinal fluid (CSF), and 2) the
presence of cell surface CD100 on activated T lymphocytes in
postmortem spinal cords from patients suffering with neuroinflam-
matory demyelination (TSP/HAM).
Materials and Methods
Model of T lymphocyte-neural cell interaction
The following CD4⫹ T cells were used: 1) the human CD25⫹CD100⫹ T
cell line C8166, which is activated by chronic retroviral infection (HTLV-I,
no virus productive) (34) and released high level of sCD100 (3 ng/␮l from
20 ⫻ 106 cells in 1 ml compared with 1 ng/␮l from CD100-transfected
Jurkat T cells in same conditions), as detected by ELISA (5); 2) the non-
activated CD4⫹ T cell line CEM used as control; and 3) the primary culture
of T lymphocytes isolated from a patient infected with HTLV-1 (CIB,
CD25⫹, CD69⫹, CD100⫹). These T lymphocytes were transiently cocul-
tured, as previously described (35), with the following human and rat neu-
ral cells (ratio 1/10, respectively) growing on culture slide or in flask: 1) the
human pluripotent neural precursor cell line Dev, which has the ability to
differentiate into neurons, astrocytes, and oligodendrocytes (36, 37); 2)
primary culture of rat glial cells (38), which contained 35–54% oligoden-
drocytes, the remaining cells corresponding to glial acidic fibrillary protein
(GFAP)-positive astrocytes. The oligodendrocytes have distinct pheno-
typic stages identified with a panel of specific Abs by immunochemistry or
flow cytometry (see below): early oligodendrocyte precursor (pre-oligo-
dendrocyte) expressing the NG2 chondroitin sulfate (10 –15%), immature
oligodendrocyte expressing galactocerebroside (GalCer, 17–25%) and cy-
clic nucleotide phosphodiesterase (CNPase), mature oligodendrocyte ex-
pressing myelin-associated glycoprotein (3–15%) and myelin basic pro-
tein, and 3) human fetal neural cells cultivated from the subventricular zone
identified by immunodetection of ␤3-tubulin. Following transient coculture
(20 h) of C8166 or CEM T lymphocytes with human or rat neural cells, the
nonadherent T cells were eliminated by washing of neural cultures, and
their elimination was verified by the lack of CD4 Ag in flow cytometry. For
some experiments, these cocultures were treated with anti-CD100-purified
Abs, namely the blocking sCD100 BD16 mAb or the nonblocking
BB18 mAb.
Table I. Clinical and pathological characteristics of TSP/HAM patients
Case Age/Sex Duration of Illness Cause of Death
1 62 /F 15 years Pulmonary embolism
2 35 /M 4 years Mesenteric thrombosis
3 65 /F 8 years Pneumonia
1247
Alternatively, in the same set of experiments, the neural cells were
treated with rsCD100 from the supernatant of permanently transfected Ju-
rkat cells, used crude or after purification on anti-CD100 BB18-mAb col-
umn (1 ng/␮l concentration). Supernatant from Jurkat cells transfected to
produce CD27 was used in similar condition as control. Each experiment
was repeated at least three times.
Patients
The CNS tissue samples from three TSP/HAM patients and two nonin-
fected patients (Parkinson disease, car crash) were examined for CD100-
expressing T cells. Paraffin-embedded spinal cords were examined using
H&E-safran and Luxol Fast Blue for myelin detection. Clinical and patho-
logical characteristics of these TSP/HAM patients are demonstrated in Ta-
ble I. The CSF from patients suffering with TSP/HAM (9 patients), men-
ingitis (4 patients), or encephalomyelitis (3 patients) were examined for the
presence of sCD100 by a sandwich ELISA, as previously described (5). All
TSP/HAM patients tested were positive for HTLV-1 provirus.
Immunodetection
Oligodendrocytes were identified in the rat primary glial culture by immu-
nofluorescence on culture slide or by flow cytometry (5, 35), with anti-
CNPase (Sigma-Aldrich, St. Louis, MO), anti-GalCer, anti-NG2 (Chemi-
con International, Temecula, CA), anti-myelin-associated glycoprotein
(Boehringer Mannheim, Indianapolis, IN), and anti-myelin basic protein
(Serotec, Oxford, U.K.) mAbs. Astrocytes were identified in the same con-
ditions with a rabbit polyclonal Ab (anti-GFAP; DAKO, Carpenteria, CA).
Human fetal neural precursors were detected with anti-␤3-tubulin (T8660;
Sigma-Aldrich). Semaphorin receptors were detected with polyclonal anti-
human plexin-B1 (N18; SantaCruz-Tebu, Le Perray, France) and anti-
MAM neuropilin-1-blocking polyclonal Ab (12). Immune cells were de-
tected in spinal cord sections from TSP/HAM patients by
immunofluorescence with anti-CD4 (M0716; DAKO), anti-CD8 (M7103;
DAKO), anti-CD45RO (UCHL1; DAKO), and anti-fascin (M3567;
DAKO) mAbs. Membrane-bound CD100 was detected with an anti-CD100
polyclonal antiserum directed against the intracellular portion of the pro-
tein (aa 799 – 813). After dewaxing with toluene and ethanol, sections were
incubated in blocking solution (1% BSA, 0.3% Triton X-100, 1 h), then
with specific Abs (4°C/overnight). Alexa546-labeled anti-mouse or Al-
exa488-labeled anti-rabbit Ig Abs (Molecular Probes, Eugene, OR) were
then applied.
RNA detection
mRNA were detected by extraction, followed by RT-PCR and Southern
blotting using appropriate [33P]dATP 5⬘ end-labeled internal oligonucleo-
tide probes, as previously described (38). Oligonucleotide primers were
chosen from their mRNA sequences (GenBank access numbers HSU60800
for CD100, NM002663 for plexin-B1, NM012401 for plexin-B2,
AF149019 for plexin-B3, L26081 for SEMA-3A, NM01101 for ␤-actin,
used as control). One set of nucleotide primers (forward, TGGTGAAGC
CAAGTGATGAG; reverse, CTGCAGAAGTTCGTGGATGA) was se-
lected for amplification of a common 300-bp amplicon in the three
plexin-B mRNA.
Apoptosis analysis
In each experiment, apoptotic death was detected by three methods: 1) the
TUNEL method performed on culture slide (Promega, Madison, WI); 2)
immunodetection of the executer caspase, active caspase-3 (rabbit serum;
BD PharMingen, San Diego, CA); and 3) detection of apoptotic bodies
with DNA intercal 4⬘,6⬘-diamidino-2-phenylindole (1 ␮g/ml; Sigma-
Aldrich) staining of nucleus. Codetection of TUNEL, active caspase-3, and
oligodendrocyte or astrocyte markers was also performed to identify the
damaged cell population within the glial culture.
CNS Neuropathology
Inflammation Myelin/axonal loss Atrophy
⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹
⫹⫹ ⫹⫹⫹ ⫹⫹
⫹ ⫹ ⫹
1248 IMMUNE SEMA IN LYMPHOCYTE-NEURAL CELL INTERACTION

Statistical analysis enhanced. The number of TUNEL-positive cells increased from

The number of total cells (nucleus staining with 4⬘,6⬘-diamidino-2-phe-
nylindole), TUNEL, and active caspase-3-positive cells was counted in
neural precusors and primary glial cells grown in culture slide and tran-
siently cocultured with C8166 or CEM T cells (15–20 microscope fields/
800-1000 cells counted per experiment, 3 independent experiments) using
AnalySiS 3.2 software. The values were expressed as mean ⫾ SEM of
positive cells per field. Cell loss was calculated by counting the total cell
number per field in each experimental situation or by flow cytometry after
immunodetection of oligodendrocyte populations. Differences between
groups were calculated with the Student’s t test. Measure of number and
length of oligodendrocyte process was performed in the cocultured glial
culture by using the same software (3 independent experiments).
Results
CD100-producing T cells dramatically affect neural precursor
and oligodendrocyte integrity
The effect of immune semaphorin SEMA-4D/CD100 released
from chronically activated T lymphocytes was investigated on hu-
man pluripotent neural precursors (Dev cells) and on rat primary
oligodendrocytes within glial primoculture by analyzing neural
cell morphology and survival after contact. The T cell line C8166,
which is activated by chronic retroviral infection and produces
high level of sCD100, was transiently cocultured with these neural
cells. The non-sCD100-producing T cells, CEM, were used as con-
trol. Spontaneous apoptosis was detected in 0.41–5.96% of un-
treated Dev cells. Following contact with CD100-producing T
cells (48 h), their level of spontaneous apoptotic death was greatly
17.2 ⫾ 2.4 per field in C8166-treated neural precursors vs 7 ⫾ 2.2
in CEM-treated and 4.5 ⫾ 2.7 in untreated cells ( p ⬍ 0.001).
Apoptotic bodies in TUNEL-positive cells are shown in Fig. 1A. In
addition, the executer caspase, active caspase-3, was detected by
immunofluorescence. As shown in Fig. 1B (three independent ex-
periments gave similar results), active caspase-3 was detected in
25.5 ⫾ 8.8 cells per field following contact with C8166 T cells vs
11.3 ⫾ 3.7 in CEM-treated and 10.8 ⫾ 1.7 in untreated neural
precursors. Increase in cell apoptosis corroborated the decrease in
cell number (Fig. 1C). At 48 h postcontact with C8166 T cells,
there was 24 ⫾ 4.4% neural cell loss and 58.5 ⫾ 9.2% at 72 h, p ⬍
0.001. Interestingly, neural precursor death was observed at a same
extent following treatment with culture supernatant of CD100-pro-
ducing T cells, C8166, or coculture without contact (Transwell
chamber) with these T cells. Thus, in contrast to T cell control,
CD100-producing T cells dramatically enhanced the rate of natural
death in neural precursors, probably via a soluble factor.
The relevance to this observation was confirmed with additional
cellular models: 1) primary culture of human fetal neural cells
originating from the subventricular zone in contact with CD100-
producing C8166 cells; 2) neural precursor cell line Dev in contact
with primary T cells (CIB) activated by retroviral infection
(CD25⫹, CD69⫹, CD100⫹). Human fetal precursors did not sur-
vive following contact with C8166 T cells, while contact with
CEM T cell did not change their survival levels (data not shown).

FIGURE 1. CD100-induced death in human neural precursors. A–C, Apoptotic death detected at 48 h by the TUNEL method (A), and estimated by
counting the number of active caspase-3-positive cells (B) and the total cell numbers (C) in human neural precursor cells transiently cocultured (20 h) with
control or CD100-producing T lymphocytes (mean ⫾ SEM cell number per field, microscopy AnalySiS, Student’s t test, representative experiment). D–F,
Similar analysis on neural precursors following 48-h treatment with rsCD100 protein (0.5 ng/␮l rsCD100 purified on CD100 BB18-mAb column).
The Journal of Immunology
C8166 and primary T cells induced apoptosis in Dev cells at a
similar level (6.9, 10.3, and 7.1% of apoptotic cells detected at 27,
48, and 72 h, respectively, following contact with C8166 vs 2.9,
3.5, and 5.2% after contact with CIB).
The effect of CD100-producing T cells was also examined on rat
glial primary culture containing oligodendrocytes at various stages
of maturation and astrocytes. Transient coculture with C8166 T
cells induced cell damages of oligodendrocytes, but not of astro-
cytes, which remained unchanged in number and morphology. In
fact, a progressive collapse and loss of process extensions were
observed in glial cells identified as immature oligodendrocytes by
immunodetection of the specific marker, GalCer (Fig. 2). The
length and number of process extensions of these immature oligo-
dendrocytes were progressively reduced after 24- and 48-h contact
with CD100-producing T cells CEM (Fig. 2B) compared with cul-
ture treated with control T cell (Fig. 2A) or untreated culture (data
not shown). The relative measure of the length (1 ⫾ 0.2 ␮m vs
2.1 ⫾ 0.3 ␮m in CEM-treated glial culture at 48 h) and the count
of processes (1.3 ⫾ 0.2 process per cell vs 5.3 ⫾ 0.6 in CEM-
treated glial culture at 48 h) were estimated in three independent
experiments (Fig. 2D). Contact with CD100-producing T cells in-
duced collapse of cell process in immature oligodendrocytes,
while the control T cells had no effect. Interestingly, the T cell-
induced collapse of oligodendrocyte processes was followed by
a late apoptotic death detected in the glial culture. As observed
in three independent experiments, contact with CD100-produc-
ing T cells increased the number of TUNEL-positive cells
FIGURE 2. CD100-induced alteration of oligoden-
drocyte process. Oligodendrocytes detected in the rat
primary glial culture by GalCer immunodetection (A).
Morphological changes in GalCer-positive cells at 24
and 48 h following transient coculture with CD100⫹ T
cells (B) or treatment with rsCD100 protein (C). No
change after coculture with control T cells (A). D,
Number and length of GalCer-positive cell process ex-
tensions after 24- and 48-h coculture with T cells or
treatment with rsCD100 measured using microscopy
AnalySiS (mean ⫾ SEM of process number and
length, 10 –20 measures, 3 experiments).
1249
(13.3 ⫾ 0.3 per field vs 6.3 ⫾ 0.3 in CEM-treated culture and
6 ⫾ 0.86 in untreated culture; Fig. 3A) and active caspase-3-
positive cells (19.7 ⫾ 8.1 per field vs 7.3 ⫾ 5.5 in CEM-treated
culture; data not shown). As shown in Fig. 3B, apoptosis re-
sulted in a partial loss in oligodendrocyte population, evidenced
by the reduced number of oligodendrocytes per field (3.7 ⫾ 0.7
oligodendrocytes per field vs 6.9 ⫾ 0.5 in CEM-treated glial
culture and 6.7 ⫾ 0.8 in untreated culture) and the total oligo-
dendrocyte number (26.8 ⫾ 3.6% loss at 48 h following contact
with C8166, p ⬍ 0.01). The number of astrocytes in the same
treated cultures was not changed (10.7 ⫾ 0.4, 12.0 ⫾ 0.9, and
12.0 ⫾ 0.9 astrocytes per field, respectively) (Fig. 3B). In par-
allel experiments using astrocytes purified from rat glial culture
or established in cell line (C8S), CD100-producing T lympho-
cytes never induced astrocyte death (data not shown).
Interestingly, cytometry analysis performed on glial culture
following contact with CD100-producing T cells showed a dra-
matic decrease in the number of immature oligodendrocytes
(Fig. 3C) identified by immunodetection of GalCer (38 ⫾ 2.4%
of total oligodendrocytes vs 58.6 ⫾ 6.6% in coculture with
CEM), while population of early oligodendrocyte progenitors,
identified by NG2-specific marker, was not significantly mod-
ified (47.8 ⫾ 14.1% of total oligodendrocytes vs 30.6 ⫾ 1.3 in
coculture with CEM). In addition, double labeling of GalCer
and TUNEL identified immature oligodendrocytes as the dying
cells (Fig. 3D). Collectively, these effects are reminiscent of the
previously reported collapse of oligodendrocyte processes and
1250 IMMUNE SEMA IN LYMPHOCYTE-NEURAL CELL INTERACTION

FIGURE 3. CD100 induced the death of

immature oligodendrocytes. A, Count of ap-
optotic (TUNEL⫹) cells in cocultured or
rsCD100-treated glial culture (mean ⫾
SEM positive cell number per field). B,
Number of total oligodendrocytes and as-
trocytes in glial culture 48 h after coculture
with control and CD100-producing T cells
or treatment with rsCD100 (mean ⫾ SEM
cell number per field). C, Flow cytometry
analysis of oligodendrocyte populations
(percentage of total cell number) detected
in rat glial culture by immunodetection of
GalCer (immature oligodendrocytes) and
NG2 (early oligodendrocyte progenitors)
after coculture with CD100-producing T
cells. D, Double labeling of GalCer and
TUNEL identifying immature oligodendro-
cytes as dying cells.

death of neural precursors induced by secreted SEMA-3A, a apoptotic cells, as shown by active caspase-3 expression (15.0 ⫾
brain-derived semaphorin (12–14). 2.3 positive cells per field in culture treated with 0.5 ng/␮l
rsCD100 vs 6.0 ⫾ 1.9 positive cells in untreated culture; data not
sCD100 released from activated T lymphocytes causes the shown) and the number of TUNEL-positive cells (13.4 ⫾ 0.8 per
deleterious effect of T cell contact field vs 6.0 ⫾ 0.86 in untreated culture; Fig. 3A). Such an increase
We next looked at whether CD100 was involved in the T cell- in apoptosis marker expression corroborated the decreased number
induced neural cell damages. The fact that T cell supernatant re- of total oligodendrocytes under sCD100 treatment (3.6 ⫾ 0.6 oli-
produced the effect of T cell contact on neural cells led us to godendrocytes per field vs 6.7 ⫾ 0.8 in untreated culture; Fig. 3B)
suspect sCD100 as the deleterious factor. The direct effect of and resulted in 29 ⫾ 4% loss of oligodendrocytes at 48 h post-
CD100 was demonstrated by treating the neural precursor cells treatment. By contrast, there was no alteration of astrocyte survival
with rsCD100, released as a dimer from transfected Jurkat cells in the same cultures as shown in Fig. 3B. In addition, increased
(15). Similar to the contact with CD100-producing T cells (Fig. 1, doses of rsCD100 (0.1, 1, and 5 ng/␮l) induced apoptosis in a
D–F), treatment with rsCD100 induced apoptotic death of neural dose-dependent manner (7.5 ⫾ 0.7, 13.3 ⫾ 1.8, and 16.6 ⫾ 1.5
precursors. Increase in the number of active caspase-3-positive
cells was detected in rsCD100-treated neural precursors (25.3 ⫾
1.6 positive cells per field in culture treated with 0.5 ng/␮l
rsCD100 vs 10.8 ⫾ 1.8 in untreated culture; Fig. 1E) and was
associated with a decreased cell number per field (Fig. 1F). A
prominent cell loss (43.5 ⫾ 13.4%) was next observed at 72 h.
Treatment with increasing doses of rsCD100 (0.01, 0.1, and 0.5
ng/␮l) induced apoptosis of neural precursors in a dose-dependent
manner (7.8 ⫾ 1.2, 19.8 ⫾ 3, and 21.8 ⫾ 0.2 active caspase-3-
positive cells per field, respectively, vs 6.4 ⫾ 1.2 in culture treated
with control supernatant; Fig. 4A).
Treatment of glial primary culture with rsCD100 also resulted in
morphological evidence of cell damage in oligodendrocytes (Fig.
2). This treatment reduced the number of processes (1.4 ⫾ 0.2
FIGURE 4. Dose-dependent effect of CD100 on neural cells. Evaluation
processes per oligodendrocyte at 48 h vs 5.3 ⫾ 0.4 in untreated of apoptotic cell number expressing active caspase-3 in neural precursors
culture; Fig. 2D) and their relative length (1 ⫾ 0.2 ␮m at 48 h vs (A) or glial primary culture (B) following treatment by increasing doses of
2.1 ⫾ 0.3 ␮m in untreated culture) in immature oligodendrocytes rsCD100 (0.01, 0.1, and 0.5 ng/␮l) (mean ⫾ SEM active caspase-3 cells
identified by GalCer immunodetection (Fig. 2C). This morpholog- per field). rsCD100 was collected from CD100-transfected Jurkat cells and
ical deterioration was followed, at 48 h, by an increased number of control supernatant (sControl) from CD27-transfected Jurkat cells.
The Journal of Immunology 1251

active caspase-3-positive cells per field, respectively, vs 6.0 ⫾ 0.8
in untreated glial culture; Fig. 4B). Double labeling of the glial
culture with oligodendrocyte markers and TUNEL identified im-
mature oligodendrocytes (GalCer positive) as a cell population
sensitive to sCD100 treatment (data not shown). Thus, rsCD100
induced a deleterious effect on neural precursors and oligodendro-
cytes similarly to CD100-producing T cells, while no detectable
change was observed on astrocytes. Higher rsCD100 dose (1 ng/
␮l) induced the death of 64% neural precursors and 37% total
oligodendrocytes at 72 h. In control experiments, treatment of
these human and rat neural cells with a supernatant from Jurkat
stably transfected with an unrelated molecule, CD27, did not in-
duce any change (Fig. 4A), further demonstrating that this delete-
rious effect was attributable to sCD100.
Finally, involvement of CD100 in the T cell-mediated damage
on neural cells was confirmed by treatment of cocultures with
CD100-specific Abs. The anti-CD100 BD16 mAb, previously
shown to inhibit activity of sCD100 (15), was able to antagonize
the C8166 T cell-induced effects on neural precursors and imma-
ture oligodendrocytes (Fig. 5). In fact, BD16 mAb used at increas-
ing concentrations progressively decreased, in a dose-dependent
manner, the number of apoptotic neural precursors detected by the
TUNEL method at 48 h postcontact with CD100-producing T cells
(13.4 ⫾ 1.4, 9.9 ⫾ 0.2, 2.3 ⫾ 0.6, and 3.2 ⫾ 0.8 positive cells per
field, respectively, vs 16.5 ⫾ 0.9 in mAb-untreated coculture; Fig.
5A). In addition, BD16 treatment reduced the T cell-mediated cell
loss estimated at 72 h (41.5 ⫾ 0.7% cell loss vs 62.0 ⫾ 7.1% in
mAb-untreated coculture). In contrast, anti-CD100 BB18 mAb,
which has no ability to block sCD100 activity, did not reduce T
cell-mediated damage (data not shown). Similarly, treatment of the
glial primary cells with BD16 mAb along with the coculture of
CD100-producing T cells reduced the T cell-mediated loss of oli-
godendrocytes. As shown in Fig. 5B, BD16 treatment normalized
the number of oligodendrocytes per field. BD16 treatment also
decreased the number of TUNEL-positive cells compared with un-
treated coculture (Fig. 5, C3 vs C2). Thus, BD16 mAb exerted a
protective effect toward immature oligodendrocytes as exemplified
by the number of CNPase-positive cells higher in coculture under
Ab treatment (Fig. 5, C3 vs C2).
Receptors of the plexin family may be involved in the sCD100
effect on neural cells
Semaphorins may signal in neural cells through receptors of the
neuropilin and plexin families (39). Neuropilins act as coreceptors
with A plexins, while B plexins alone behave as fully functional
signal transducers for both transmembrane and secreted forms of
semaphorins. Our previous work had shown that neuropilin-1 is
present on human neural precursors and mediates SEMA-3A-in-
duced apoptosis of these cells (12). To eliminate the involvement
of neuropilin-1 and SEMA-3A in the T cell-induced apoptosis of
neural precursors, we added anti-MAM neuropilin-1 Ab in the T
neural cell coculture. This Ab, previously shown to block the
SEMA-3A-induced neural precursor death (12), had no significant
effect on the rate of death induced by CD100-producing T cells
(Fig. 6A). In addition, the remote possibility of an effect of anti-
CD100 BD16 mAb on SEMA-3A activity (15) was ruled out by
the absence of SEMA-3A expression in T cells, as shown by RT-
PCR analysis of SEMA-3A mRNA in neural and T cells (Fig. 6B).
These observations excluded the implication of neuropilin-1/
SEMA-3A in the T cell-mediated damages. Involvement of plex-
ins, in particular plexin-B1, identified as a receptor for sCD100 in
human cells (39), was next investigated. The presence of mRNA
coding for plexin-B1, -B2, or -B3 in human neural precursors and
human fetal cortex (used as positive control) was evidenced by
RT-PCR. Taking into account the high homology of RNA se-
quence between these three plexins, oligomers were selected for
their ability to amplify a common 300-bp amplicon. Amplicons
were further identified by restriction enzymes, PstI and Sau3AI,
which can generate 171- and 129-bp products in the plexin-B1 and
plexin-B3 amplicon, and 205- and 95-bp products in the plexin-B1
and plexin-B2 amplicon, respectively. PstI and Sau3AI generated the
expected products from a 300-bp amplicon (Fig. 6C), showing the
presence of plexin-B-coding mRNA in human neural precursors as in
human fetal cortex. The presence of plexin-B1 at the cell membrane
was confirmed by immunodetection on live neural precursors, and
flow cytometry detected 50 –54% positive cells (Fig. 6D). The pos-
sible involvement of plexin-B1 in the CD100-producing T cell-me-

FIGURE 5. Reduction of the T cell-mediated dam-

age by CD100-blocking BD16 mAb. Neural precursors
(A) and glial culture (B and C) were cocultured with
control T cells, or with CD100⫹ T cells and treated or
not treated with anti-CD100 BD16 mAb (0.1, 0.4, 1, 2
ng/␮l for neural precursors, 1 ng/␮l for glial culture).
Apoptotic cells were detected by the TUNEL method,
and positive cell number was evaluated (mean ⫾ SEM
positive cells per field, microscopy AnalySiS). A, Re-
duction in a dose-dependent manner of T cell-mediated
apoptosis in neural precursors by BD16 mAb. B, Count
of astrocytes and oligodendrocytes in glial culture
(mean ⫾ SEM cell number per field, microscopy Analy-
SiS): decrease in oligodendrocyte number after cocul-
ture with CD100-producing T cells (B2) and resettled
number under BD16 mAb treatment (B3). No modifi-
cation in astrocyte population. C, A view of apoptosis
detection by the TUNEL method (green) and of imma-
ture oligodendrocyte population by CNPase immunode-
tection (red) in glial primary culture. Increase in the
number of TUNEL-positive cells after coculture with
CD100-producing T cells (C2) compared with coculture
with control T cells (C1) and reduction under BD16
mAb treatment (C3). In parallel, decrease in the number
of CNPase-positive cells (C2) and limited reduction un-
der BD16 mAb treatment (C3).
1252 IMMUNE SEMA IN LYMPHOCYTE-NEURAL CELL INTERACTION

FIGURE 6. Involvement of semaphorin receptor plexin-B in CD100-mediated effect on neural cells. A, Number of apoptotic/active caspase-3-positive
neural precursor cells in the presence of CD100-producing T cells with or without anti-plexin-B1 and anti-neuropilin-1 Abs (mean ⫾ SEM active
caspase-3-positive cells per field, microscopy AnalySiS). Reduction of T cell-mediated apoptosis by anti-plexin-B1 Ab. B, Detection by RT-PCR and
Southern blotting using [33P]dATP 5⬘ end-labeled internal probes of mRNA coding for SEMA-3A and ␤-actin (as housekeeping gene) in: 1) glial primary
culture; 2) neural precursors; 3) neural precursors ⫹ CD100⫹ T cells; and 4) CD100⫹ T cells. T cells did not express SEMA-3A. C, Detection by RT-PCR
of mRNA coding for a 300-bp amplicon common to plexin-B1, plexin-B2, and plexin-B3 in human neural precursors and human fetal brain. Identification
of the subsequent generation of 171- and 129-bp products by PstI in plexin-B1 and -B3 amplicon, and of 205- and 95-bp products by Sau3AI in plexin-B1
and -B2 amplicon. mRNA coding for plexin-B was present in neural precursors as in fetal brain. D, Plexin-B1 detected in neural precursor cells by
immunofluorescence and flow cytometry analysis (54% positive).

diated apoptosis in neural precursors was suggested by results of treat-
ment with anti-plexin-B1 Ab. When added throughout the coculture,
anti-plexin-B1 Ab reduced the number of apoptotic neural cells (Fig.
6A) and the rate of cell loss (5 vs 25.4% in untreated coculture at 48 h)
induced by CD100-producing T cells. Treatment of rat oligodendro-
cytes cocultured with CD100-producing T cells did not modify the
rate of cell apoptosis (data not shown), probably due to the human
specificity of this anti-plexin Ab.
sCD100- and CD100-expressing T cells in patients with
neuroinflammatory disorder
The functional relevance of these experimental data was tested by
examining the presence of sCD100 in CSF and CD100-positive
infiltrating T lymphocytes in postmortem CNS from patients suf-
fering with demyelination associated with neuroinflammation,
TSP/HAM. CD100 was detected in spinal cord and CSF from
these patients, but not from patients with noninflammatory neuro-
logical injuries (Table II and Fig. 7). Three patients suffering with
TSP/HAM and exhibiting various levels of neuroinflammation ev-
idenced by immune infiltrates were chosen for the histological
study. Anatomopathology analysis of paraffin-embedded spinal
cords, using standard staining (H&E-safran), Luxol Fast Blue for
myelin detection, and immunofluorescence for cell identification,
indicated that spinal cords from these patients displayed demyeli-
nation (Fig. 7A) associated with moderate to marked meningial
(Fig. 7, A–C) and perivascular (Fig. 7, D and E) infiltrates of im-
mune cells. Level of neuroinflammation correlated with the extent
of atrophy in the thoracic level and degeneration of the lateral
corticospinal and spinocerebellar tracts, the diffuse loss of myelin
and axons, and the thickness of the leptomeninges and astrocyto-
sis, as previously observed (19) (also see Table I). Immunofluo-
rescence analysis of spinal cords with anti-CD4, anti-CD8, anti-
CD45RO, or anti-fascin Abs identified the infiltrating immune
cells as primarily CD45RO-positive cells and T lymphocytes with
a predominance of CD8 T cells (Fig. 7B, case 1). As BD16 and
BB18 anti-CD100 mAbs did not react with fixed cells, we devel-
oped a new polyclonal rabbit Ab recognizing an intracellular pep-
tide of the CD100 molecule to determine whether the membrane-
bound CD100 was detected on infiltrated immune cells. Double
labeling using anti-CD100 and anti-CD45RO revealed the coex-
pression of these molecules in cell from the hemopoietic lineage.
The highest density of double-labeled cells was found in meningia
(Fig. 7C) and around blood vessels (Fig. 7, E and F). Double-
labeled T lymphocytes were also observed in parenchyma (Fig.
7F) both in gray and white matters. Astrocytosis in the white mat-
ter and around blood vessels was revealed by GFAP immunostain-
ing (Fig. 7G) of spinal cord from patient with high inflammation
level (case 1). Interestingly, we had detected the matrix metallo-
proteinase-9 within astrocytosis in the spinal cord of this patient
(35). In contrast, the few CD45RO-positive cells present in spinal
cords of nonneuroinflammatory patients were all CD100 negative
(two cases studied; data not shown). Assuming that the expression
and release of sCD100 may be enhanced within the inflammatory
neural tissue and CSF by high levels of metalloproteinases in TSP/
HAM patients (40, 41), the expression of sCD100 was analyzed in
the CSF from patients with TSP/HAM (n ⫽ 9) or patients with
nonneuroinflammatory diseases (n ⫽ 7) by ELISA. This analysis
revealed the presence of sCD100 at a level of 97.7 ⫾ 23.1 ng/ml
in CSF from TSP/HAM patients (Table II), while levels were un-
detectable in the CSF from other groups of patients.
Discussion
The current pathogenesis sequence of inflammatory demyelinating
diseases, such as MS, starts with an inflammatory phase, which
The Journal of Immunology 1253

Table II. sCD100 detected by ELISA in the CSF from patients infected
with HTLV-1 and suffering with demyelination associated with virus-
induced neuroinflammation (TSP/HAM)a

TSP/HAM Patients CD100 (ng/ml)

1 132.6 ⫾ 29.9
2 66.6 ⫾ 14.2
3 158.3 ⫾ 17.2
4 79.6 ⫾ 36.3
5 123.9 ⫾ 42.7
6 60 ⫾ 9.9
7 62.9 ⫾ 14.2
8 57.9 ⫾ 16.3
9 75 ⫾ 27.6
a
Patients with other neurological diseases (n ⫽ 7) were negative for CD100
detection in CSF.

fulfills the criteria of an autoimmune disease, followed by a phase

of selective demyelination, and finally a neurodegenerative phase
(42– 44). The initial event of inflammation is the migration of ac-
tivated T lymphocytes of Th1 phenotype to the brain and spinal
cord, where they release deleterious proinflammatory cytokines.
There is indeed in vivo evidence that Th1-related cytokines such as
TNF-␣ and IFN-␥ are involved in lesion formation (22, 25, 45).
However, heterogeneity with respect to clinical course and re-
sponse to therapy has led to the concept of heterogeneous patho-
genic mechanisms of demyelination (46). Additional demyelinat-
ing amplification factors are probably required to produce the large
demyelinating lesions detected in patients. The present study
points out the deleterious effect of the immune semaphorin CD100
on oligodendrocyte and neural precursor integrity and proposes
that immune semaphorins are candidates in the pathogenic mech-
anism of demyelination.
We show that sCD100, reported to be highly expressed in ac-
tivated T lymphocytes and released from the T cell surface through
a metalloproteinase-mediated proteolytic cleavage (17), induced a
progressive decrease in process extensions of immature oligoden-
drocytes, followed by their death, and the death of human multi-
potent neural precursors. Thus, sCD100 of immune origin can ini-
tiate a signaling cascade impairing neural precursor and
oligodendrocyte homeostasis, similarly to the neural SEMA-3A
(12, 13, 47). Interestingly, sCD100 affected mainly the immature
oligodendrocytes (GalCer positive), while oligodendrocyte precur-
sors (NG2 positive) were preserved from T cell-mediated effect
and proliferate. This observation suggests the presence of a win-
dow of vulnerability to CD100 in immature oligodendrocytes and
not in precursors. In fact, NG2-positive oligodendrocyte precur-
sors are the principal dividing cell population within the perinatal
and adult brain (48), but after a period of perinatal proliferation,
GalCer-positive differentiating oligodendrocytes send a signal
back to their precursors preventing their differentiation. The alter-
ation of this feedback mechanism is thought to cause the rapid
proliferation of NG2-positive cells during demyelinating disease.
In our model, the selective loss of GalCer-positive oligodendro-
cytes, the negative proliferation signal, following contact with
sCD100-producing T lymphocytes, could explain the sustained
presence of NG2-positive oligodendrocytes in the culture. The dif-
ferential susceptibility of astrocytes and oligodendrocytes to
CD100-induced damage is intriguing, as both cells express plexin-
B1. However, apoptosis in neural cells is strictly controlled by
sequestration of active caspase, regulation of death receptor activ-
ity, and expression of apoptosis-inhibitory proteins (49). Cell type-
specific regulations at these various levels could explain the dif-
ferential susceptibility to CD100. The capacity of sCD100-
FIGURE 7. Detection of CD100-expressing T cells in the spinal cord of
patients. Examination of spinal cords from three patients infected with
HTLV-1 and suffering with demyelination associated with virus-induced
neuroinflammation (TSP/HAM). A and D, H&E-safran staining and Luxol
Fast Blue for myelin detection (histology) showed demyelination (A, open
areas in blue staining, open arrow) and immune cell infiltration (filled
arrow) in meningia (A) and around blood vessels (D). B, Immunodetection
of the T cell markers CD4 and CD8 in meningia. E, C, and F, Immuno-
detection of CD100 (green) and CD45RO (red) in meningia (C), around
blood vessel (E), and in parenchyma (F). Arrow triangle ⫽ coexpression
(orange); arrow square ⫽ monoexpression. Moderate to marked infiltration
is seen in F: F1, case 1; F2, case 2; F3, case 3. Astrocytosis identified by
GFAP immunodetection (G, case 1).
blocking mAb, BD16, to reduce the damage to neural cells
mediated by activated T lymphocytes, in contrast to the nonblock-
ing BB18 mAb, confirms the physiological role of sCD100. In
addition, detection of sCD100 in the CSF of patients suffering with
neuroinflammatory demyelination (TSP/HAM) and the presence
of numerous infiltrating CD100/CD45RO-positive cells in their
spinal cord, in contrast to patients suffering with noninflammatory
neurological injury, support the idea of a correlation between
CD100 release and demyelination. The collapse of process exten-
sions in the immature/premyelinating oligodendrocyte population
and their death induced by sCD100 would dramatically compro-
mise the capacity of remyelination in inflamed brain. The present
data together with 1) the abundant expression of CD100 by acti-
vated T cells (7, 10), 2) the elevated expression of metalloprotein-
ases within the CNS of patients suffering neuroinflammatory de-
myelination (23, 40), and 3) the gradual reduction in the size of the
oligodendrocyte population, but the sustained presence of NG2-
positive cells observed in brains of patients suffering neuroinflam-
matory demyelination (27, 50), strongly suggest that infiltrated/
1254 IMMUNE SEMA IN LYMPHOCYTE-NEURAL CELL INTERACTION
activated T cells affect myelination through release of factors toxic
for neural cells, including semaphorin CD100.
In addition to its deleterious effects on neural cells, sCD100
could participate in the autoimmune response within the brain of
patients suffering with neuroinflammatory demyelination (21, 51).
In fact, the two murine immune semaphorins, CD100 and SEMA-
4A, are expressed constitutively in T cells and function as soluble
ligands to CD72 and Tim2, respectively, to regulate the humoral
and cellular immune response (7–9). They are suspected to be
involved in autoimmune diseases (6, 10, 52). sCD100 produced
after lymphocyte activation has a potent costimulatory function to
induce proliferation of B cells and to enhance the maturation of
professional APCs (8, 53). This is reflected by the presence of
significant levels of sCD100 in the serum of MLR/lpr mice devel-
oping autoantibodies (10). In addition, mice carrying a truncated
CD100 transgene encoding an easily released sCD100 develop
EAE more rapidly than normal mice (52). The relation between
this autoimmune response to the CD100 transgene overexpression
was proved by enhanced concentration of sCD100 in body fluids
and, conversely, by the fact that the CD100⫺/⫺ mice are resistant
to EAE. A direct role for sCD100 in oligodendrocyte pathogenesis
remains to be investigated. More recently, the implication of
SEMA-4A in the differentiation and activation of T cells upon
interaction with its receptor Tim2 was reported (6). Interestingly,
treating mice with anti-SEMA-4A mAb blocked the development
of EAE induced by the antigenic peptide derived from myelin
oligodendrocyte glycoprotein. Although the mAb effect was evi-
dent when injected at an early phase of T cell responses against
myelin oligodendrocyte glycoprotein, it would be interesting to
look for a direct effect of SEMA-4A on oligodendrocytes. The fact
that SEMA-3A and sCD100 can inhibit the migration of immune
cells (15) also suggests that these semaphorins may affect migra-
tory T lymphocytes within the CNS. Taken together, these works
and our findings in humans indicate that in neuroinflammatory
situation, sCD100 and SEMA-3A could participate, through bind-
ing to immune and neural cells, in a close partnership, both in the
sequestration and stimulation of immune cells within the CNS and
in the collapse of oligodendrocyte processes and neural precursor
death.
The presence of neuropilin-1 in neural precursors and oligoden-
drocytes and its involvement in the class 3 semaphorin-mediated
apoptosis of neural precursors and changes in oligodendrocytes
were previously reported (12, 13, 16). Our present data show that
neuropilin-1 is not the signaling receptor of sCD100 in neural
cells, as blocking anti-neuropilin-1 Ab failed to prevent CD100-
mediated apoptosis. As B plexins fully function as signal trans-
ducers for both transmembrane and secreted forms of class 4 sema-
phorins (39), members of this plexin family could participate in
sCD100 signaling. The presence of plexin-B1 in neural precursors
and the capacity of anti-plexin-B1 Ab to antagonize the T cell-
induced apoptosis of neural precursors may support this hypothe-
sis. Thus, sCD100 and SEMA-3A can exert a similar paralytic
effect on immune cell migration via an identical cell surface re-
ceptor, while their deleterious effects leading to neural cell alter-
ation and death are mediated by different receptors.
In conclusion, this original paradigm of activated T lympho-
cytes/neural cell interaction and the presence of sCD100- and
CD100-positive infiltrating T cells in CNS of patients suffering of
neuroinflammatory demyelination point to the role of the immune
semaphorin CD100/SEMA-4D in the cross talk between the im-
mune system and the CNS. Immune semaphorins could be crucial
in demyelinating diseases, including MS and TSP/HAM, in which
a causal relationship among inflammation, oligodendrocyte loss,
axonal damage, and irreversible neurological disability is sus-
pected (19, 25, 42, 54).
Acknowledgment
We thank Isabelle Chabert de Ponnat for FACS analysis.
References
1. Boulanger, L. M., G. S. Huh, and C. J. Shatz. 2001. Neuronal plasticity and
cellular immunity: shared molecular mechanisms. Curr. Opin. Neurobiol.
11:568.
2. Liu, B. P., and S. M. Strittmatter. 2001. Semaphorin-mediated axonal guidance
via Rho-related G proteins. Curr. Opin. Cell Biol. 13:619.
3. Kolodkin, A. L., D. J. Matthes, T. P. O’Connor, N. H. Patel, A. Admon,
D. Bentley, and C. S. Goodman. 1992. Fasciclin IV: sequence, expression, and
function during growth cone guidance in the grasshopper embryo. Neuron 9:831.
4. Chisholm, A., and M. Tessier-Lavigne. 1999. Conservation and divergence of
axon guidance mechanisms. Curr. Opin. Neurobiol. 9:603.
5. Hall, K. T., L. Boumsell, J. L. Schultze, V. A. Boussiotis, D. M. Dorfman,
A. A. Cardoso, A. Bensussan, L. M. Nadler, and G. J. Freeman. 1996. Human
CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and dif-
ferentiation. Proc. Natl. Acad. Sci. USA 93:11780.
6. Kumanogoh, A., S. Marukawa, K. Suzuki, N. Takegahara, C. Watanabe, E.
Ch’ng, I. Ishida, H. Fujimura, S. Sakoda, K. Yoshida, and H. Kikutani. 2002.
Class IV semaphorin Sema4A enhances T-cell activation and interacts with
Tim-2. Nature 419:629.
7. Bismuth, G., and L. Boumsell. 2002. Controlling the immune system through
semaphorins. Sci. STKE 2002:RE4.
8. Suzuki, K., A. Kumanogoh, and H. Kikutani. 2003. CD100/Sema4D, a lympho-
cyte semaphorin involved in the regulation of humoral and cellular immune re-
sponses. Cytokine Growth Factor Rev. 14:17.
9. Kumanogoh, A., and H. Kikutani. 2001. The CD100-CD72 interaction: a novel
mechanism of immune regulation. Trends Immunol. 22:670.
10. Wang, X., A. Kumanogoh, C. Watanabe, W. Shi, K. Yoshida, and H. Kikutani.
2001. Functional soluble CD100/Sema4D released from activated lymphocytes:
possible role in normal and pathologic immune responses. Blood 97:3498.
11. Goshima, Y., T. Ito, Y. Sasaki, and F. Nakamura. 2002. Semaphorins as signals
for cell repulsion and invasion. J. Clin. Invest. 109:993.
12. Bagnard, D., C. Vaillant, S. T. Khuth, N. Dufay, M. Lohrum, A. W. Puschel,
M. F. Belin, J. Bolz, and N. Thomasset. 2001. Semaphorin 3A-vascular endo-
thelial growth factor-165 balance mediates migration and apoptosis of neural
progenitor cells by the recruitment of shared receptor. J. Neurosci. 21:3332.
13. Ricard, D., V. Rogemond, E. Charrier, M. Aguera, D. Bagnard, M. F. Belin,
N. Thomasset, and J. Honnorat. 2001. Isolation and expression pattern of human
Unc-33-like phosphoprotein 6/collapsin response mediator protein 5 (Ulip6/
CRMP5): coexistence with Ulip2/CRMP2 in Sema3a-sensitive oligodendrocytes.
J. Neurosci. 21:7203.
14. Shirvan, A., R. Shina, I. Ziv, E. Melamed, and A. Barzilai. 2000. Induction of
neuronal apoptosis by Semaphorin3A-derived peptide. Brain Res. Mol. Brain
Res. 83:81.
15. Delaire, S., C. Billard, R. Tordjman, A. Chedotal, A. Elhabazi, A. Bensussan, and
L. Boumsell. 2001. Biological activity of soluble CD100. II. Soluble CD100,
similarly to H-SemaIII, inhibits immune cell migration. J. Immunol. 166:4348.
16. Tordjman, R., Y. Lepelletier, V. Lemarchandel, M. Cambot, P. Gaulard,
O. Hermine, and P. H. Romeo. 2002. A neuronal receptor, neuropilin-1, is es-
sential for the initiation of the primary immune response. Nat. Immun. 3:477.
17. Elhabazi, A., S. Delaire, A. Bensussan, L. Boumsell, and G. Bismuth. 2001.
Biological activity of soluble CD100. I. The extracellular region of CD100 is
released from the surface of T lymphocytes by regulated proteolysis. J. Immunol.
166:4341.
18. Prineas, J. W., R. O. Barnard, T. Revesz, E. E. Kwon, L. Sharer, and E. S. Cho.
1993. Multiple sclerosis: pathology of recurrent lesions. Brain 116:681.
19. Cartier, L. M., J. G. Cea, C. Vergara, F. Araya, and P. Born. 1997. Clinical and
neuropathological study of six patients with spastic paraparesis associated with
HTLV-I: an axomyelinic degeneration of the central nervous system. J. Neuro-
pathol. Exp. Neurol. 56:403.
20. Osame, M., K. Arimura, M. Nakagawa, F. Umehara, K. Usuku, and S. Ijichi.
1997. HTLV-I associated myelopathy (HAM): review and recent studies. Leu-
kemia 11(Suppl. 3):63.
21. t Hart, B. A., H. P. Brok, S. Amor, and R. E. Bontrop. 2001. The major histo-
compatibility complex influences the ethiopathogenesis of MS-like disease in
primates at multiple levels. Hum. Immunol. 62:1371.
22. Jacobson, S. 2002. Immunopathogenesis of human T cell lymphotropic virus type
I-associated neurologic disease. J. Infect. Dis. 186(Suppl. 2):S187.
23. Cuzner, M. L., D. Gveric, C. Strand, A. J. Loughlin, L. Paemen, G. Opdenakker,
and J. Newcombe. 1996. The expression of tissue-type plasminogen activator,
matrix metalloproteases and endogenous inhibitors in the central nervous system
in multiple sclerosis: comparison of stages in lesion evolution. J. Neuropathol.
Exp. Neurol. 55:1194.
24. Yamano, Y., M. Nagai, M. Brennan, C. A. Mora, S. S. Soldan, U. Tomaru,
N. Takenouchi, S. Izumo, M. Osame, and S. Jacobson. 2002. Correlation of
human T-cell lymphotropic virus type 1 (HTLV-1) mRNA with proviral DNA
load, virus-specific CD8⫹ T cells, and disease severity in HTLV-1-associated
myelopathy (HAM/TSP). Blood 99:88.
25. Grant, C., K. Barmak, T. Alefantis, J. Yao, S. Jacobson, and B. Wigdahl. 2002.
Human T cell leukemia virus type I and neurological disease: events in bone
The Journal of Immunology
marrow, peripheral blood, and central nervous system during normal immune
surveillance and neuroinflammation. J. Cell. Physiol. 190:133.
26. Blakemore, W. F., and R. J. Franklin. 2000. Transplantation options for thera-
peutic central nervous system remyelination. Cell Transplant. 9:289.
27. Chang, A., W. W. Tourtellotte, R. Rudick, and B. D. Trapp. 2002. Premyelinating
oligodendrocytes in chronic lesions of multiple sclerosis. N. Engl. J. Med.
346:165.
28. Horner, P. J., A. E. Power, G. Kempermann, H. G. Kuhn, T. D. Palmer,
J. Winkler, L. J. Thal, and F. H. Gage. 2000. Proliferation and differentiation of
progenitor cells throughout the intact adult rat spinal cord. J. Neurosci. 20:2218.
29. Narayanan, S., L. Fu, E. Pioro, N. De Stefano, D. L. Collins, G. S. Francis,
J. P. Antel, P. M. Matthews, and D. L. Arnold. 1997. Imaging of axonal damage
in multiple sclerosis: spatial distribution of magnetic resonance imaging lesions.
Ann. Neurol. 41:385.
30. Howard, A. K., D. K. Li, and J. Oger. 2003. MRI contributes to the differentiation
between MS and HTLV-I associated myelopathy in British Columbian coastal
natives. Can. J. Neurol. Sci. 30:41.
31. Coleman, M. P., and V. H. Perry. 2002. Axon pathology in neurological disease:
a neglected therapeutic target. Trends Neurosci. 25:532.
32. De Winter, F., M. Oudega, A. J. Lankhorst, F. P. Hamers, B. Blits,
M. J. Ruitenberg, R. J. Pasterkamp, W. H. Gispen, and J. Verhaagen. 2002.
Injury-induced class 3 semaphorin expression in the rat spinal cord. Exp. Neurol.
175:61.
33. Zhang, S. C., B. Ge, and I. D. Duncan. 1999. Adult brain retains the potential to
generate oligodendroglial progenitors with extensive myelination capacity. Proc.
Natl. Acad. Sci. USA 96:4089.
34. Popovic, M., G. Lange-Wantzin, P. S. Sarin, D. Mann, and R. C. Gallo. 1983.
Transformation of human umbilical cord blood T cells by human T-cell leukemia/
lymphoma virus. Proc. Natl. Acad. Sci. USA 80:5402.
35. Giraudon, P., R. Szymocha, S. Buart, A. Bernard, L. Cartier, M. F. Belin, and
H. Akaoka. 2000. T lymphocytes activated by persistent viral infection differen-
tially modify the expression of metalloproteinases and their endogenous inhibi-
tors, TIMPs, in human astrocytes: relevance to HTLV-I-induced neurological
disease. J. Immunol. 164:2718.
36. Derrington, E. A., N. Dufay, B. B. Rudkin, and M. F. Belin. 1998. Human prim-
itive neuroectodermal tumor cells behave as multipotent neural precursors in
response to FGF2. Oncogene 17:1663.
37. Buzanska, L., N. Spassky, M. F. Belin, A. Giangrande, F. Guillemot, C. Klambt,
M. Labouesse, J. L. Thomas, K. Domanska-Janik, and B. Zalc. 2001. Human
medulloblastoma cell line DEV is a potent tool to screen for factors influencing
differentiation of neural stem cells. J. Neurosci. Res. 65:17.
38. Szymocha, R., H. Akaoka, M. Dutuit, C. Malcus, M. Didier-Bazes, M. F. Belin,
and P. Giraudon. 2000. Human T-cell lymphotropic virus type 1-infected T lym-
phocytes impair catabolism and uptake of glutamate by astrocytes via Tax-1 and
tumor necrosis factor ␣. J. Virol. 74:6433.
1255
39. Tamagnone, L., S. Artigiani, H. Chen, Z. He, G. I. Ming, H. Song, A. Chedotal,
M. L. Winberg, C. S. Goodman, M. Poo, et al. 1999. Plexins are a large family
of receptors for transmembrane, secreted, and GPI-anchored semaphorins in ver-
tebrates. Cell 99:71.
40. Giraudon, P., S. Buart, A. Bernard, N. Thomasset, and M. F. Belin. 1996. Ex-
tracellular matrix-remodeling metalloproteinases and infection of the central ner-
vous system with retrovirus human T-lymphotropic virus type I (HTLV-I). Prog.
Neurobiol. 49:169.
41. Umehara, F., Y. Okada, N. Fujimoto, M. Abe, S. Izumo, and M. Osame. 1998.
Expression of matrix metalloproteinases and tissue inhibitors of metalloprotein-
ases in HTLV-I-associated myelopathy. J. Neuropathol. Exp. Neurol. 57:839.
42. Neuhaus, O., J. J. Archelos, and H. P. Hartung. 2003. Immunomodulation in
multiple sclerosis: from immunosuppression to neuroprotection. Trends Pharma-
col. Sci. 24:131.
43. Steinman, L. 2001. Multiple sclerosis: a two-stage disease. Nat. Immun. 2:762.
44. Bjartmar, C., and B. D. Trapp. 2001. Axonal and neuronal degeneration in mul-
tiple sclerosis: mechanisms and functional consequences. Curr. Opin. Neurol.
14:271.
45. Zhang, J., S. Markovic-Plese, B. Lacet, J. Raus, H. L. Weiner, and D. A. Hafler.
1994. Increased frequency of interleukin 2-responsive T cells specific for myelin
basic protein and proteolipid protein in peripheral blood and cerebrospinal fluid
of patients with multiple sclerosis. J. Exp. Med. 179:973.
46. Lassmann, H. 2002. Mechanisms of demyelination and tissue destruction in mul-
tiple sclerosis. Clin. Neurol. Neurosurg. 104:168.
47. Pasterkamp, R. J., and J. Verhaagen. 2001. Emerging roles for semaphorins in
neural regeneration. Brain Res. Brain Res. Rev. 35:36.
48. Levine, J. M., R. Reynolds, and J. W. Fawcett. 2001. The oligodendrocyte pre-
cursor cell in health and disease. Trends Neurosci. 24:39.
49. Leist, M., and M. Jaattela. 2001. Four deaths and a funeral: from caspases to
alternative mechanisms. Nat. Rev. Mol. Cell Biol. 2:589.
50. Wolswijk, G. 2002. Oligodendrocyte precursor cells in the demyelinated multiple
sclerosis spinal cord. Brain 125:338.
51. Levin, M. C., M. Krichavsky, J. Berk, S. Foley, M. Rosenfeld, J. Dalmau,
G. Chang, J. B. Posner, and S. Jacobson. 1998. Neuronal molecular mimicry in
immune-mediated neurologic disease. Ann. Neurol. 44:87.
52. Shi, W., A. Kumanogoh, C. Watanabe, J. Uchida, X. Wang, T. Yasui,
K. Yukawa, M. Ikawa, M. Okabe, J. R. Parnes, et al. 2000. The class IV sema-
phorin CD100 plays nonredundant roles in the immune system: defective B and
T cell activation in CD100-deficient mice. Immunity 13:633.
53. Kikutani, H., and A. Kumanogoh. 2003. Semaphorins in interactions between T
cells and antigen-presenting cells. Nat. Rev. Immunol. 3:159.
54. Versijpt, J., K. Van Laere, R. A. Dierckx, F. Dumont, P. P. De Deyn, G. Slegers,
and J. Korf. 2003. Scintigraphic visualization of inflammation in neurodegenera-
tive disorders. Nucl. Med. Commun. 24:209.