Indian Journal of Biotechnology

Vol 15, January 2016, pp 25-33

Allelic diversity for salt stress responsive candidate genes among

Indian rice landraces
Deepika Singh1*, Balwant Singh1, Shefali Mishra1, Ashok Kumar Singh2, Tilak Raj Sharma1 and Nagendra Kumar Singh1*
1
National Research Centre on Plant Biotechnology, Indian Agriculture Research Institute (IARI), New Delhi 110 012, India
2
Division of Genetics, IARI, New Delhi 110 012, India

Received 8 April 2015; revised 5 May 2015; accepted 20 July 2015

Salt stress adversely affects growth and productivity of crops. Rice is one of the most important food crops, which has
contributed to the Green Revolution through semi-dwarf, high yielding varieties but these varieties are rated as salt-
sensitive. Landraces of rice are known to possess greater genetic variation for the trait and hence are being exploited for
enhancing salt tolerance in the high yielding rice varieties. Here we analyzed, allelic diversity of 13 different candidate
genes for salt tolerance by targeted re-sequencing in 69 diverse landraces and varieties of rice. Multiple sequence alignment
revealed in total 43 SNPs. Nucleotide diversity ranged from 0.00007 to 0.01430, number of haplotypes varies from 1 to 9
and haplotype diversity ranged from 0.000 to 0.350. The SOS1 and SKC1 genes revealed the highest haplotype diversity
among the tested genotypes. This haplotype variability may be used for trait-association analysis to identify useful
functional markers for enhancing salt stress tolerance in rice through molecular breeding.

Keywords: Allelic diversity, haplotypes, Indian rice landraces, salinity tolerance

Introduction must increase correspondingly to meet the growing

World agriculture faces a challenging task of
producing 70% more food for an additional 2.3 billion
people by 20501. The lower crop productivity in the
rain fed agro-ecosystems is mostly attributed to
various abiotic stresses, such as, high salinity,
drought, cold, and high temperature2-4. Soil salinity is
one of the most brutal environmental factors,
imposing ionic imbalance, disrupting the overall
metabolic activities, thus limiting the productivity
of crop plants worldwide5. Moreover, more than
80 million hectares representing about 40% of the
total irrigated land have already been damaged by
excess salt, which is further estimated to go up to 50%
by 20506,7.
Rice (Oryza sativa L.) is the world’s most
important food crop and primary source of food for
more than half of the human population. More than
ninety per cent of the world’s rice is produced and
consumed in Asia, where sixty percent of the human
population lives8. The world population is projected to
reach 9.2-10 billion by 2050; hence rice production
——————
*Authors for correspondence:
nksingh4@gmail.com; dipikasingh.iari@gmail.com
ψ
For Supplementry Data, see website: www.nopr.niscair.res.in,
or www.niscair.res.in
demand1. The available crop germplasm and genetic
diversity will play crucial role in enhancing crop
productivity9,10. Many of the traditionally cultivated
rice varieties are well adapted to the extreme
environmental conditions and have high genetic
diversity that could play important role in crop
improvement for salt tolerance11. There are examples
of cloned rice genes and quantitative trait loci (QTLs)
for salt tolerance, viz., SKC112 and qSNC-713,
identified from Indian rice landrace Nona Bokra.
The most widely exploited QTL for salt tolerance
‘Saltol’ was also identified from an Indian rice
landrace Pokkali14.
Salt tolerance is a complex trait with multiple
tolerance mechanisms, each governed by different
gene families. The major gene families involved in
salt tolerance include metal ion transporters,
transcription factors and genes involved in
intermediate metabolic pathways for oxidative
damage control5. Among the transporters, HKT
family of genes and cation chloride transporters are
major genes regulating ionic balance of the cell12,15.
Further the HKT family members are classified into
two sub-groups based on their transport selectivity,
Group 1 proteins (OsHKT1;1, OsHKT1;3, OsHKT1;4,
OsHKT1;5) are described as Na+ uniporters, while
26 INDIAN J BIOTECHNOL, JANUARY 2016
group 2 proteins (OsHKT2;1, OsHKT2;3, OsHKT2;4)
are thought to allow both Na+ and K+ transport
and Na+ uniport at high Na+ concentrations16,17. Salt
overly sensitive 1 (SOS1) transporter controls Na+
concentrations in the xylem sap influencing long-
distance Na+ transport from roots to shoots18,19,
whereas cation chloride co-transporter (CCC) family
of proteins are secondary active transporters that
mediate the movement of Cl- ion tightly coupled to
that of K+ and/or Na+ across the plasma membrane20,21.
Moreover, genes involved in intermediary metabolic
pathways like calcium/calmodulin dependent protein
kinases (CDMK) are unique Ca2+ sensors in higher
plants that regulate the down-stream gene
expression22. A serine hydroxymethyltransferase
(SHMT) enzyme functions mainly in the
mitochondria and required for efficient functioning of
photorespiratory system of the plant23-25. A newly
identified partially characterized gene family of
unknown function, domain of unknown function
(DUF) is a large set of genes in the Pfam database that
do not include any protein of known function26. An
integral membrane protein DUF6, identified by
analysis of differentially expressed genes under salt
stress in tolerant recombinant inbred lines (RILs) of
rice, is a potential candidate gene associated with salt
tolerance27. Transcription factors are master regulator
of the expression of their target gene through binding
to the cognate cis-elements in the promoters of
the stress-related genes. Some well characterized
stress-related transcription factors are dehydration-
responsive element binding (DREB1F)28-30, basic
leucine zipper (bZIP)31-33, NAC34,35. In the present
study, we explored the extent of nucleotide sequence
haplotype diversity in 13 such genes associated
with salt tolerance.
Materials and Methods
Plant Material and Phenotyping for Salt-Stress Tolerance
A set of 69 genotypes representing diverse Indian
rice varieties and landraces obtained from different
sources were studied (ΨSuppl Table S1). The selected
genotypes were evaluated for salinity tolerance at
seedling stage according to IRRI (International Rice
Research Institute, Manila, Philippine) standard
evaluation system (SES) score14. The phenotyping
was performed under controlled condition at the
National Phytotron facility, IARI, New Delhi, with
approx 29°C/22°C day/night temperature and 70%
relative humidity. The experiment included a control
and a salt-stress treatment, with presence of three
checks: VSR 156 as sensitive; IR74 as moderately
tolerant and FL 478 as tolerant genotype in all the
trays. The experimental design included 10 genotypes
per tray with 8 plants per genotype in single rows. In
the control trays, no salt was added and plants were
maintained at 0 dS/m of electrical conductivity (EC).
Salt-stress was imposed for 15 d after sowing by
supplementing the control Hoagland`s solution with
6 g/L of NaCl (EC=12 dS/m). Test entries were rated
visually for injury symptoms on 10th and 15th d after
initial salinization using IRRI scale of 1-9 (ΨSuppl
Table S2).
DNA Extraction and PCR Amplification of Candidate Genes
Genomic DNA was extracted from fresh leaves
using a modified cetyltrimethyl ammonium bromide
(CTAB) method of DNA isolation36. In this study, 13
different candidate genes for salt tolerance were
selected on the basis of published literature. These
were: OsHKT1;1, OsHKT1;3, OsHKT1;5 (SKC1),
OsHKT 2;3, OsHKT2;4, SOS1, CCC, SHMT1,
SHMT2, DUF6, CDMK, and transcription factors
SNAC1 and DREB1F.
Nucleotide sequences of the above salt responsive
genes were retrieved from the NCBI database
(http://www.ncbi.nlm.nih.gov/) and PCR primers were
designed using Primer3 software (www.genome.wi.
mit.edu) to amplify the entire genes (promoter, coding
and noncoding regions). The details of primers
designed and used for PCR amplification of the genes
are given in Table 1. The PCR reactions were carried
out in a 20 µL volume including 10 µL of
PrimeSTAR HS Premix (Takara Biosciences), 1.0 µL
of each primer (10 pmol each), 2.5 µL (90 ng) of
DNA template and 5.5 µL of milli-Q water for each
sample. The PCR included initial denaturation at
95°C for 4 min, followed by 35 cycles of denaturation
at 98°C for 20 sec, annealing at 53-57°C for 30 sec,
and extension at 72°C for 1 min, followed by final
extension at 72°C for 10 min. The PCR amplicons
were analyzed by electrophoresis in 1% agarose gel in
1× TBE buffer.
Sequencing of PCR Amplicons and Sequence Analysis
For sequencing, PCR amplicons of all 13 genes
were pooled in equimolar amounts and purified by
Agencourt AMPure XP reagent and sequenced in Ion
PGMTM system. A single library was prepared for
every genotype having amplicons of all 13 genes with
the Ion Fragment Library Kit (Life Technologies,
 SINGH et al: SALT STRESS RESPONSIVE CANDIDATE GENES IN INDIAN RICE LANDRACES 27

Table 1—List of salt stress responsive genes and respective primers used for their PCR amplification
No. Locus Gene Putative function Primer sequence Amplicon size
(5′-3′) (bp)
1 LOC_Os04g51820 OsHKT1;1 Na+ transporter F:AATCAAGTGGTTGGCAGAGG 4034
R: GCCGGTGAATCTATCCTTGA
2 LOC_Os02g07830 OsHKT1;3 Na+ transporter F:TTGCCACAATCGCAGTAGAG 2830
R: GCGAGTCGTTTCGAATTCTC
3 LOC_Os01g20160 OsHKT1;5 Na+ transporter F:TGCTCACAGCACCTGGTAAC 4051
R: CTTGAGCCTGCCGTAGAACA
4 LOC_Os01g34850 OsHKT2;3 Na+ transporter F:TGGCTGCTAGAGGAACGATT 2305
R: CAGCTGTAGCCAGTGGACAA
5 LOC_Os06g48800 OsHKT2;4 Na+ transporter F:TCTTCCCTTTTGCTTGCAGT 2384
R: CTTGGTTTTGTTGCCTTGGT
6 LOC_Os01g73770 DREB1F Dehydration-responsive F:TCATGTTGACCTGATTCTTACG 2071
element-binding protein, R: AAAAGTGCCACATGTTTGGAG
putative
7 LOC_Os03g60080 SNAC1 NAC domain-containing F:CCTAATCAACTTGCAACCTAAG 2409
protein 67, putative R: TCTCGAAGGATTCATCTAGTCT
8 LOC_Os07g06740 CDMK Calcium/calmodulin F:AAAATCCTCCTCCGATCCAAAT 3647
depedent protein kinases R: ACTCTTTGAAGAAACCCAAGTACG
9 LOC_Os01g19290 DUF6 Integral membrane protein F:GTCGAGAAGTAAGGGAGTTGAGAG 4092
DUF6 containing protein R:TAGGCCTACTCTTATGCGATTTCT
10 LOC_Os01g19860 CCC Expressed protein F:TACGTGTTGTGAGGTGGTTTGT 1739
R:TCAATTAGAAGCAGAGCCATAAAA
11 LOC_Os12g44360 SOS1 Sodium/hydrogen F:TCGCACATCAGCTCCATTAC 10841
exchanger 7, putative R:AGATAGGGAGGCCCGAAATA
12 LOC_Os01g65410 SHMT1 Serine hydroxylmethyl F:TCTCAGATTCCACCCAATCC 4145
transferase, mitochondrial R:GATCCTTACGCATGGAGGAA
precursor, putative
13 LOC_Os03g52840 SHMT2 Serine hydroxymethyl F:TGGGGCTGATCACTGCAGATAAA 4092
transferase, mitochondrial R:CAGGACAATACCTTGCTGTTCC
precursor, putative

Invitrogen) according to manufacturer’s protocol. A Nucleotide polymorphisms were analyzed in each

unique barcode was added to each sample library.
Further, all barcoded libraries were pooled and size
selection was done using E-gel Size Select in 2%
agarose gel (Invitrogen). Template preparation was
carried out using Ion XpressTM Template Kit according
to the guidelines in the user guide with a modified
protocol for Ion Sphere recovery. Emulsified Ion Sphere
particles were collected by centrifugation. The Ion
Sequencing Kit (Life Technologies) was used in the Ion
Torrent PGMTM sequencer as described in Ion
Sequencing Kit manual. Samples were loaded on an Ion
316 chip and sequenced using sequencer for65 cycles.
The average sequencing coverage of amplicons
was > 250× and Phred quality score (Q) of >20 was
used for base calling accuracy. SAM tools mpileup
was used for generation of consensus sequence for
each variety37. Assembled sequences were aligned
with the Nipponbare reference sequence of genes
(IRGSP 2005) using ClustalW38 in BioEdit software39.
gene using DnaSP software version 5.1040 and this
software was used for combined analysis of inter
specific comparisons for estimating the synonymous
(ka) and non-synonymous substitution rate (ka/ks
ratio) and for determining deviations from neutral
evolution. Nucleotide polymorphism in all the genes
in all accessions was analyzed using sliding window
analysis in DnaSP software. Statistical tests of
neutrality, such as, Tajima's D, Fu and Li’s D and F
were calculated to examine the evolutionary force on
this gene41. A haplotype network was constructed for
comparison of genealogical relationships among
different haplotypes using NETWORK software v 4.642.
Results
Phenotypic Variation for Salinity Tolerance Among Rice
Cultivars
The 69 genotypes of rice were phenotyped for
seedling stage salt stress tolerance under controlled
28 INDIAN J BIOTECHNOL, JANUARY 2016

condition and rated on a scale of 1-9. The observed
plant population in the non-salinized condition had
normal seedling growth. In salinized trays, the
seedling growth was suppressed and showed different
visual symptoms of salt injury (Fig. 1). The symptoms
were prominent on the first and second leaves
and were visualized by leaf rolling, formation of
new leaf, brownish and whitish leaf tip, drying
of leaves and also by reduction in root growth,
stunted growth and stem thickness, leading to
complete cessation of growth and dying of
seedlings. The genotypes Vellela Dhan, Rajendra
Bhagawati, IR4727-2B-2-2, IR71895-3B-60-3,
FL 478, CSR C (5)-52-1-1, IR-1499-2B-29-2R-1-1,
IR-71929-3R-89-5-1 and IR-1499-2B-29-2R-1-1 were
identified as salinity tolerant; while 35 genotypes
were identified as moderately tolerant. About 16
genotypes were susceptible, whereas 8 genotypes
including Kalanamak, Jaldi Dhan 6, PR113, Kalama,
Nagarsati, IR-28, Bundi, Karaikal-1 were identified as
highly susceptible (Fig. 2).
Sequence Diversity in Candidate Genes for Salt Tolerance
To determine the nucleotide sequence diversity in
the 13 selected candidate genes for salt stress
tolerance among the Indian rice landraces and
varieties, the genes were PCR amplified and
sequenced as described above. Multiple sequence
alignment was performed for each gene using
ClustalW and positions of SNPs were identified
(Fig. 3). The highest number of SNP was observed for
the DUF6 gene with 18 polymorphic sites, in which
14 and 4 sites belonged to singleton variable sites and
parsimony informative sites, respectively. The SOS1
gene showed 10 polymorphic sites, in which 8 sites

Fig. 1—Variable level of salt tolerance among Indian varieties

and land races of rice at 150 mM NaCl after 15 d of treatment in
hydroponics. [Each row represent different genotypes and their Fig. 2—Frequency distribution of rice genotypes for salt stress
score are given in bracket.] tolerance at seedling stage.

Fig. 3—Nucleotide sequence alignment showing presence of SNP in a part of the SOS1 gene among Indian rice landraces. [Nucleotides
differing from the Nipponbare reference sequence are indicated by single letter code.]
 SINGH et al: SALT STRESS RESPONSIVE CANDIDATE GENES IN INDIAN RICE LANDRACES 29

were singleton variable and 2 sites were parsimony
informative sites (Table 2). The OsHKT1;5 gene
showed 5 polymorphic sites, of which 3 were
singleton variable sites and 2 were parsimony
informative sites; while OsHKT1;1 gene showed only
one polymorphic site. The CCC gene has 4
polymorphic sites with 2 each of singleton variable
sites and parsimony informative sites. The SNAC1
gene showed 5 singleton variable sites. Sequences of
the remaining seven genes, namely, OsHKT1;3,
OsHKT2;3, OsHKT2;4, DREB1F, CDMK, SHMT1
and SHMT2 were highly conserved across all the
69 genotypes with no SNPs. The nucleotide diversity
in genes ranged from 0.00007 for OsHKT1;1 to
0.01430 for SNAC transcription factor, whereas
haplotype diversity ranged from 0.559 for SOS1
to 0.029 for SNAC and OsHKT1;1. In total, 7
non-synonymous SNPs were found for HKT1;1 gene,
5 for SKC1, 3 for SNAC1, 2 for DUF6 and 1 for SOS1
gene, hence probable changes may be observed in the
protein structure. The potential changes observed in
protein structure for HKT1;1 was S981 (Leu94 to
Phe94), S990 (Leu97 to Phe97), S789 (Leu30 to Pro30),
S1473 (Ser258 to Asn258), S1236 (Ser179 to Phe179),
S2861 (Asp515 to Val515), and S1248 (Ala183 to Gly183);
for SKC1 gene was S506 (Asp128 to Asn128), S545
(Ala140 to Pro140), S677 (Arg184 to His184), S1310
(Val395 to Leu395), S3059 (Glu429 to Lys429), and S1121
(Asp332 to His332); for SNAC1 was S537 (Gly2 to
Arg2), S894 (Trp109 to Gly109), and S1450 (Arg254 to
His254); for DUF6 gene was S2487 (Val254 to Met254)
and S2442 (Ser239 to Thr254); and for SOS1 gene was
S7094 (Val784 to Met784). To study the evolutionary
dynamics of the 6 candidate genes showing sequence
polymorphism, patterns of nucleotide diversity in the
Table 2—Over all sequence diversity and haplotypes analysis of 6 salt responsive candidate genes showing sequence polymorphism in
Indian rice varieties and landraces
Candidate genes OsHKT1;1 OsHKT1;5
population were examined using three statistical
parameters, viz., D statistics (Tajima’s D test), D* and
F* statistics (Fu and Li’s test). All the values of
Tajima’s D statistics in the present study were
statistically non-significant, illustrating no significant
selection existing in these genes. In addition, Fu and
Li’s D* and F* were also not significant.
Haplotype Networks of Candidate Genes for Salt Tolerance
Based on the re-sequencing of candidate genes in
69 rice genotypes, variable numbers of haplotypes
were detected for different genes. Maximum 9
haplotypes were detected for SOS1 gene with a
haplotype diversity (Hd) value of 0.559, followed by
7 haplotypes for OsHKT1;5 with Hd value 0.355,
8 haplotypes for DUF6 with a Hd value 0.138, and for
CCC gene 3 haplotypes with Hd value 0.138. SNAC1
and OsHKT1;1 showed 2 haplotypes each with Hd
value of 0.029, as a result haplotype network diagram
could not be drawn for these two genes. While in case
of 7 genes, OsHKT1;3, OsHKT2;3, OsHKT2;4,
DREB1F, CDMK, SHMT1 and SHMT2, all have a
single haplotype. Based on the sequence information,
haplotype networks were drawn for 4 genes with
more than 2 haplotypes using the NETWORK
software (Fig. 4). The Network diagrams show the
number of haplotypes observed for each of the four
genes and the SNP positions, which separate one
haplotype from the other. The colour code is given as
per the salinity injury score of the genotypes. Based
on network analysis, a linear relationship between the
3 haplotypes of CCC gene was observed, while a
informative network was generated for DUF6, SOS1
and OsHKT1;5 genes. No clear association between
salinity injury score of the genotypes and the
SNAC DUF6 CCC SOS1

Observations
Variable (polymorphic) sites 1 5 5 18 4 10
Singleton variable sites 1 3 5 14 2 8
Parsimony informative sites 0 2 0 4 2 2
Nucleotide diversity (Pi) 0.00007 0.00355 0.01430 0.00106 0.00091 0.00132
No. of haplotypes 2 7 2 8 3 9
Haplotype diversity 0.029 0.355 0.029 0.193 0.138 0.559
Av. no. of nucleotide differences 0.028 0.401 3.275 0.950 0.331 0.891
Sequence conservation 0.993 0.972 0.789 0.988 0.988 0.991
Tajima test -1.06891 -1.39640 -2.95666 -2.23686 -1.27951 -1.54773
Fu and Li's D* test statistic -1.93247 -1.96675 -8.50 -4.47204 -1.27951 -3.87096
Fu and Li's F* test statistic -1.94763 -2.09508 -7.54513 -4.36937 -1.27951 -3.87096
30 INDIAN J BIOTECHNOL, JANUARY 2016

Fig. 4—Haplotype network of candidate genes based on SES score at seedling stage: (A) SOS1; (B) DUF6; (C) HKT1:5; & (D) CCC.
[Each circle represents a haplotype with size of a circle representing the varietal frequency of that haplotype. Colour coding represents
seedling salt injury score phenotype of genotypes. Each branch represents a mutational event and numbers in red represent the mutation
sites.]

haplotype information was observed. Network
analysis for SOS1 gene showed 9 haplotypes, 2 major
haplotypes, H1 (with 13 genotypes) and H2 (with 44
genotypes), which were connected with a single SNP
(Fig. 4A). Haplotype H9 was represented by 2 genotypes,
while H4 by 5 genotypes. H1 was connected with H3,
H4 and H8 with single SNP, while H1 and H5 were
connected with 3 SNPs and H2, H9, H4 and H6 were
connected by 1 SNP. The DUF6 gene exhibited a
complex haplotype network owing the presence of
8 different haplotypes (Fig. 4B). The major haplotype
H1 represented 62 genotypes, while the remaining
7 haplotypes were represented by single genotype
each. The H5 was connected to H2 with 7 SNPs,
whereas H6 and H 7 were connected with 6 SNPs.
Analysis of OsHKT1;5 gene revealed a total 7 haplotypes.
Two major haplotypes H1 (55 genotypes) and H3
(8 genotypes) were connected to each other by single
SNP, while the remaining five haplotypes were also
connected by 1 SNP (Fig. 4C). Haplotype network
analysis for CCC gene reported 3 haplotypes,
including one major (H1) and two minor haplotypes
(H2 & H3) (Fig. 4D). The H1 haplotype was
represented by 64 genotypes, while H2 by 4
genotypes and H3 by a single genotype. Further, H1
and H3 haplotypes were connected to H2 with two
SNPs. None of the haplotypes were clearly associated
with the seedling salt injury score of the genotypes.
The major haplotypes of the 4 genes had
representations from all categories of genotypes
starting from highly sensitive to tolerant (Fig. 4).
Discussion
Rice landraces have been the most important
genetic resource exploited by the rice breeders and
had a significant impact on rice improvement. Soil
salinity limits crop production and considered as one
of the major abiotic stress factors, which is further
aggravated by current agricultural practices7. In
addition, global climate change and increasing
concern for food security further emphasizes the need
for novel allelic variants of known stress tolerance
 SINGH et al: SALT STRESS RESPONSIVE CANDIDATE GENES IN INDIAN RICE LANDRACES
genes, which could be used in future breeding
programme. In order to find novel allelic variants
among Indian rice landraces, 13 candidate genes for
salt tolerance were re-sequenced. Phenotyping of the
accessions for seedling stage salt tolerance revealed
different levels of tolerance among the genotypes. A
significant proportion of the genotypes were
comparable with the existing sources of salt tolerance,
such as, Pokkali and Nona Bokra landraces. However,
a higher number of genotypes were moderately
tolerant, hence indicating a considerable level of
phenotypic variability for salt tolerance among the
studied genotypes. Wide variation in phenotypes from
tolerant (score 3) to highly susceptible (score 9) lines
using modified SES of IRRI standard protocol was
seen. The natural genetic variation has been measured
by SNPs or indels, hence the candidate gene based
re-sequencing was used to identify these variations.
Moreover, candidate gene based SNPs may dissect
agronomically suitable alleles, which enable the
plants to endure the stress conditions43. Total number
of SNPs found in six genes was 43. There were six
nucleotide substitutions in the tolerant allele of SKC1
in Nona Bokra, which may be responsible for the
functional differences with the susceptible alleles12.
The identification of a specific allele through
genetic diversity assessment of stress responsive
candidate gene sequences is key to performing
association analysis for corresponding abiotic stress.
Our study found exceptionally high polymorphic sites
and nucleotides diversity (=0.01430) though with only
two haplotypes. Moreover, all the sites belong
to singleton variable site and not to Persimony
informative site, hence no haplotypic group formed.
No allelic diversity was observed for transcription
factor DREB1F among the Indian rice landraces.
However, a substantial level of haplotype diversity
with clear association has been reported for Indian
wild rice accessions44. Our results with DREB1F
further indicate that landraces are far less diverse than
wild rice and hence there is ample scope to transfer
useful alleles for stress tolerance from the wild rice
species.
SOS1 gene codes for a Na+/H+ antiporter and is
the only characterized Na+ efflux protein at the
plasma membrane18. Our study revealed a total of
9 haplotypes but comparatively lower nucleotide
diversity (0.00132) for the SOS1 gene. Further, three
major haplogroups (a major haplogroup contains four
or more SOS1 genotypes) and six minor haplogroups
31
indicated that a high level of haplotypic diversity
was present for SOS1 gene. Similar high haplotype
diversity was observed for SKC1 gene with 7
haplogroups. In addition comparable level of allelic
variants have already been reported for HKT1;5
gene12. Other HKT transporter gene family members
(OsHKT1;1, OsHKT1;3, OsHKT2;3, OsHKT2;4) and
intermediate signaling and metabolic pathways genes
(CDMK, SHMT1, SHMT2) showed no Parsimony
informative sites, which signifies the conserved nature
of these genes among the studied landraces.
Moreover, conserved nature of genes involved in
intermediate signaling and metabolic pathways,
for instance CDMK, SHMT1 and SHMT2, have
reported45. Further, allelic variability for two genes
DUF6 and CCC were studied first time in the present
study and 8 haplotypes were generated for DUF6
and 3 for CCC gene. However, linear haplotype
networks were found for CCC gene and from
8 haplogroups of DUF6 gene only one major
haplogroup H1 was found; rest 7 haplogroups
comprised of only single genotype. These two genes
can be potential candidate genes for further
exploitation for research and breeding purpose.
Another interesting observation from our study was
that we could not cluster all the major salt-tolerant
accessions into any one group. This supports the fact
that different rice genotypes have different
mechanisms to cope with salt stress and that no
accession carries all the favorable alleles for
all the target loci.
Further, all the genes having higher Parsimony
informative sites have higher number of haplotypes.
This indicated that having more number of variable
sites or nucleotide diversity dose not assure the
presence of higher number haplotypes. From the
13 candidate genes analyzed here, SOS1 and SKC1
showed higher allelic variability among the Indian
landraces, hence may offer potential source of tolerant
alleles for future breeding programme. This study
identified genic SNPs and allelic variants of important
candidate genes related to salt tolerance, which can be
further used for marker development and may
contribute towards varietal improvement for salt
tolerance.
Acknowledgement
DS is grateful for the fellowship support from the
Council of Scientific and Industrial Research, New
Delhi. Financial assistance from Indian Council for
32 INDIAN J BIOTECHNOL, JANUARY 2016
Agricultural Research under ‘‘Network Project on
Transgenic Crops’’ is also gratefully acknowledged.
References
1 FAO, High level expert forum—How to feed the world in
2050 (Economic and Social Development Department,
Food and Agricultural Organization of the United Nations,
Rome, Italy) 2009.
2 Mahajan S & Tuteja N, Cold, salinity and drought stresses:
An overview, Arch Biochem Biophys, 444 (2005) 139-158.
3 Thakur P, Kumar S, Malik J A, Berger J D & Nayyar H,
Cold stress effects on reproductive development in grain
crops: An overview, Environ Exp Bot, 67 (2010) 429-443.
4 Mantri N, Patade V, Penna S, Ford R & Pang E, Abiotic
stress responses in plants: Present and future, in Abiotic
stress responses in plants: Metabolism, productivity and
sustainability, edited by P Ahmad & M N V Prasad
(Springer, New York ) 2012, 1-19.
5 Munns R & Tester M, Mechanisms of salinity tolerance,
Annu Rev Plant Biol, 59 (2008) 651-681.
6 Xiong L & Zhu J K, Abiotic stress signal transduction in
plants: Molecular and genetic perspectives, Physiol Plant,
112 (2001) 152-166.
7 Wang W, Vinocur B & Altman A, Plant responses to
drought, salinity and extreme temperatures: Towards genetic
engineering for stress tolerance, Planta, 218 (2003) 1-14.
8 Khush G S & Virk P S, Rice breeding: Achievements and
future strategies, Crop Improv, 27 (2000) 115-144.
9 Fu Y B & Somers D J, Genome-wide reduction of genetic
diversity in wheat breeding, Crop Sci, 49 (2009) 161-168.
10 Cavatassi R, Hopkins J & Lipper L, Crop genetic diversity,
food security and farm household well-being during shocks,
Select Paper, American Agricultural Economics Association
Annual Meeting, Providence, Rhode Island, USA, July
24-27, 2005.
11 Zeven, A C, Landraces: A review of definition and
classification, Euphytica, 104 (1998) 127-139.
12 Ren Z H, Gao J P, Li LG, Cai X L, Huang W et al, A rice
quantitative trait locus for salt tolerance encodes a sodium
transporter, Nat Genet, 37 (2005) 1141-1146.
13 Lin H X, Zhu M Z, Yano M, Gao J P, Liang Z W et al, QTLs
for Na+ and K+ uptake of the shoots and roots controlling rice
salt tolerance, Theor Appl Genet, 108 (2004) 253-260.
14 Gregorio G B, Senadhira D &. Mendoza R D, Screening rice
for salinity tolerance, IRRI, Discussion Paper Series no. 22
(International Rice Research Institute, Manila Philippines)
1997, 1-30.
15 Cotsaftis O, Plett D, Shirley N, Tester M & Hrmova M, A
two-staged model of Na+ exclusion in rice explained by 3D
modeling of HKT transporters and alternative splicing, PLoS
One, 10 (2012) 39865-39878.
16 Garciadeblas B, Senn M E, Banuelos M A & Rodriguez-
Navarro A, Sodium transport and HKT transporters: The rice
model, Plant J, 34 (2003) 788-801.
17 Rengasamy P, World salinization with emphasis on
Australia, J Exp Bot, 57 (2006) 1017-1023.
18 Shi H, Quintero F J, Pardo J M & Zhu J K, The putative
plasma membrane Na+/H+ antiporter SOS1 controls
long-distance Na+ transport in plants, Plant Cell, 14 (2002)
465-477.
19 Shabala L, Cuin TA, Newman IA & Shabala S,
Salinity-induced ion flux pattern from the excised roots of
Arabidopsis sos mutants, Planta, 222 (2005) 1041-1050.
20 Kader M A, Seidel T, Golldack D & Lindberg S, Expressions
of OsHKT1, OsHKT2, and OsVHA are differentially
regulated under NaCl stress in salt-sensitive and salt-tolerant
rice (Oryza sativa L.) cultivars, J Exp Bot, 57 (2006)
4257-4268.
21 Ardie S W, Xie L, Takahashi R, Liu S K & Takano T,
Cloning of a high-affinity K+ transporter gene PutHKT2;1
from Puccinellia tenuiflora and its functional comparison
with OsHKT2;1 from rice in yeast and Arabidopsis,
J Exp Bot, 60 (2009) 3491-3502.
22 Wan B, Lin Y & Mou T, Expression of rice Ca2+-dependent
protein kinases (CDPKs) genes under different
environmental stresses, FEBS Lett, 581 (2007) 1179-1189.
23 Moreno J I, Martín R & Castresana C, Arabidopsis SHMT1,
a serine hydroxymethyltransferase that functions in the
photorespiratory pathway influences resistance to biotic and
abiotic stress, Plant J, 41 (2005) 451-463.
24 Jamai A, Salome P A, Schilling S H, Weber A P M &
McClung C R, Arabidopsis photorespiratory serine
hydroxymethyltransferase activity requires the mitochondrial
accumulation of ferredoxin-dependent glutamate synthase,
Plant Cell, 21 (2009) 595-606.
25 Engel N, Ewald R, Gupta K J, Zrenner R, Hagemann M et al,
The presequence of Arabidopsis serine hydroxymethyl-
transferase SHM2 selectively prevents import into mesophyll
mitochondria, Plant Physiol, 157 (2011) 1711-1720.
26 Schultz J, Milpetz F, Bork P & Ponting C P, SMART,
a simple modular architecture research tool: Identification
of signaling domains, Proc Natl Acad Sci USA, 95 (1998)
5857-5864.
27 Pandit A, Rai V, Bal S, Shinha S, Kumar V et al, Combining
QTL mapping and transcriptome profiling of bulked RILs for
identification of functional polymorphism for salt tolerance
genes in rice (Oryza sativa L.), Mol Genet Genomics,
284 (2010) 121-136.
28 Yamaguchi-Shinozaki K & Shinozaki K, A novel cis acting
element in an Arabidopsis gene is involved in responsiveness
to drought, low temperature, or high salt stress, Plant Cell,
6 (1994) 251-264.
29 Lata C & Prasad M, Role of DREBs in regulation of abiotic
stress responses in plants, J Exp Bot, 62 (2011) 4731-4748.
30 Wang Q, Guan Y, Chen H, Chen F & Chu C, Overexpression
of a rice OsDREB1F gene increases salt, drought, and low
temperature tolerance in both Arabidopsis and rice, Plant
Mol Biol, 67 (2008) 589-602.
31 Oeda K, Salinas J & Chua N H, A tobacco bZip transcription
activator (TAF-1) binds to a G-box-like motif conserved in
plant genes, EMBO J, 10 (1991) 1793-1802.
32 Choi H, Hong J, Ha J, Kang J & Kim Y, ABFs, a family
of ABA-responsive element binding factors, J Biol Chem,
275 (2000) 1723-1730.
33 Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K et al,
Arabidopsis basic leucine zipper transcription factors
involved in an abscisic acid-dependent signal transduction
pathway under drought and high-salinity conditions, Proc
Natl Acad Sci USA, 97 (2000) 11632-11637.
34 Fang Y, You J, Xie K, Xie W & Xiong L, Systematic
sequence analysis and identification of tissue-specific or
 SINGH et al: SALT STRESS RESPONSIVE CANDIDATE GENES IN INDIAN RICE LANDRACES
stress-responsive genes of NAC transcription factor family in
rice, Mol Genet Genomics, 280 (2008) 547-563.
35 Hu H, Dai M, Yao J, Xiao B, Li X et al, Overexpressing a
NAM, ATAF, and CUC (NAC) transcription factor enhances
drought resistance and salt tolerance in rice, Proc Natl Acad
Sci USA, 103 (2006) 12987-12992.
36 Murray M G & Thompson W F, Rapid isolation of
high molecular weight DNA, Nucleic Acids Res, 8 (1980)
4321-4325.
37 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J et al;
1000 Genome Project Data Processing Subgroup, The
Sequence Alignment/Map format and SAMtools,
Bioinformatics, 25 (2009) 2078-2079.
38 Thompson J D, Higgins D G & Gibson T J, CLUSTAL W:
Improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice, Nucleic Acids Res, 22
(1994) 4673-4680.
39 Hall T A, BioEdit: A user-friendly biological sequence
alignment editor and analysis program for Windows
95/98/NT Nucleic Acids Symp Ser, 41 (1999) 95-98.
33
40 Rozas J, Sánchez D, Barrio J C, Messeguer X & Rozas R,
DnaSP, DNA polymorphism analyses by the coalescent and
other methods, Bioinformatics, 19 (2003) 2496-2497.
41 Tajima F, Statistical method for testing the neutral mutation
hypothesis by DNA polymorphism, Genetics, 123 (1989)
585-595.
42 Bandelt H, Forster P & Rohl A, Median-joining networks for
inferring intra specific phylogenies, Mol Biol Evol, 16 (1999)
37-48.
43 Lyu J, Zhang S, Dong Y, He W, Zhang J et al, Analysis of elite
variety tag SNPs reveals an important allele in upland rice, Nat
Commun, 4 (2013) 2138.
44 Singh B P, Jayaswal P K, Singh B, Singh P K,
Kumar V et al, Natural allelic diversity in OsDREB1F gene
in the Indian wild rice germplasm led to ascertain its
association with drought tolerance, Plant Cell Rep, 34 (2015)
993-1004.
45 Negrão S, Almadanim M C, Pires I S, Abreu I A, Maroco J
et al, New allelic variants found in key rice salt-tolerance
genes: An association study, Plant Biotechnol J, 11 (2013)
87-100.