Journal of Helminthology (2007) 81, 67–73 DOI: 10.

1017/S0022149X07214129

Specific status and pathogenicity

of syngamid nematodes in bird species
(Ciconiformes, Falconiformes, Gruiformes)
from Germany
O. Krone*, D. Friedrich and M. Honisch
Leibniz-Institute for Zoo and Wildlife Research, PO Box 601103,
D-10252 Berlin, Germany

Abstract

A total of 549 birds from four orders were examined for nematodes in their
respiratory system from 1995 to 2000. Twelve individuals of Falconiformes
(n ¼ 503), one of Gruiformes (n ¼ 22) and one of Ciconiformes (n ¼ 1), but no
bird of the order Strigiformes (n ¼ 23) were infected with syngamids. The
syngamid species included Hovorkonema variegatum, Syngamus trachea and
Cyathostoma trifurcatum from the trachea, bronchi and air sacs, with H. variegatum
being the most prevalent. Cyathostoma trifurcatum from a black stork Ciconia nigra
is a new record for Germany. The marsh harrier Circus aeruginosus and the
white-tailed sea eagle Haliaeetus albicilla are new hosts for H. variegatum.
Morphological characters such as the dorsal rays of the bursa copulatrix, length
of the spicules and the mouth capsule are used to differentiate species of the
family Syngamidae. Egg size is different between S. trachea and H. variegatum.
In addition to morphological characters, the nucleotide sequence of the SSU
ribosomal gene was determined for H. variegatum. Pairwise comparisons with
the SSU sequence of S. trachea (AF036606) revealed sequence difference of 2.6%.
The nucleotide sequence of the second internal transcribed spacer of ribosomal
DNA for different populations of H. variegatum was also determined. Pairwise
comparisons revealed two separate strains with a sequence difference of 14.0% to
14.5% suggesting the existence of a cryptic species. Pathological findings
associated with H. variegatum were found in 7 of 12 cases and consisted of
thickened air sac walls and lesions or granuloma at the site of attachment of the
worm, which occasionally involved the underlaying tissues. Lymphoplasmocy-
tic air sacculitis was the most prominent histological lesion found.

Introduction classification the Syngamidae comprises the Stephanur-

The family Syngamidae belongs to the parasitic
superfamily Strongyloidea. In the literature gapeworms
(Syngamidae) are often confused within their genus level
(Carpenter & Derrickson, 1987; Spalding et al., 1996) and
identification. Classification of syngamids has changed
several times (Lengy, 1969; Ali, 1970). In the most recent
*Fax: þ49 30 5126 104
E-mail: krone@izw-berlin.de
inae, Syngaminae and Archeostrongylinae (Lichtenfels,
1980; Hartwich, 1994). The Syngaminae consist of
Syngamus, Cyathostoma and Hovorkonema which occur
only in birds (Baruš & Tenora, 1972; Hartwich, 1994).
Species of the genus Hovorkonema are found worldwide
and have a broad host range among birds (Baruš &
Tenora, 1972). Hovorkonema variegatum has been reported
in Europe, Asia and North America (Rysavý & Ryshikov,
1978; Okulewicz, 1984). Definitive hosts are Casuarii-
formes (Casuarius sp., Dromaius sp.) Galliformes (Gallus
gallus, Pavo cristatus) and Gruiformes. The life cycle is
68 O. Krone et al.
probably indirect via ingestion of earthworms infected
with third stage larvae (Hartwich, 1994).
The gapeworm Syngamus trachea has a cosmopolitan
distribution and is a parasite of Galliformes and Passer-
iformes, but also recorded from species of Anseriformes,
Ardeiformes, Pelecaniformes, Otidiformes, Piciformes and
Cypseliformes (Yamaguti, 1961). Syngamus spp. are found
mainly in the trachea of land birds. Syngamus trachea can
infect its hosts directly, when the definitive host ingests eggs
or third stage larvae, or indirectly via transport hosts such as
earthworms or insects (Hartwich, 1994; Anderson, 2000).
Cyathostoma spp. have been reported from the nasal
or infraorbital cavities or the trachea of at least 10
bird families but mainly from waterbirds (Ali, 1970).
Simpson & Harris (1992) recorded Cyathostoma lari from
the orbital cavity and the lower eyelid of birds of prey.
Cyathostoma trifurcatum infects the trachea of black
storks Ciconia nigra in Poland (Okulewicz, 1984), and in
Latvia and Slovakia (Hartwich, 1994).
In addition to morphological features, molecular
markers are most useful either for species identification
(Gasser, 2001), in the search for cryptic species (Chilton
et al., 1995; Blouin, 2002) or for phylogenetic analysis
(Blaxter, 2001). DNA technology provides an alternative
approach to morphology for the identification of closely
related parasites (Hung et al., 1997). Ribosomal DNA has
been most extensively studied because of its presence in
multiple tandemly arrayed copies and thus provides a
large molar excess of target in polymerase chain reactions
(PCR) (Blaxter, 2001). Within ribosomal DNA there are
coding regions (small subunit (SSU) or 18S, 5.8S gene and
large subunit (LSU) or 28S) which evolve relatively slow
and non-coding regions like the internal transcribed
spacer 1 and 2 (ITS-1, ITS-2) which change more rapidly
in evolution (Blaxter, 2001). The rapidly evolving internal
transcript spacer regions ITS-1 and ITS-2 have in
particular been used to distinguish between species of the
order Strongylida (Chilton et al., 1995; Stevenson et al., 1995;
Hung et al., 1997; Blouin, 2002; Samson-Himmelstjerna et al.,
2002). In the present study, we compared DNA sequences
of the SSU gene within the order Strongylida of the species
S. trachea and H. variegatum and the ITS-2 region of H.
variegatum and C. verrucosum to distinguish between these
closely related species.
The aims are to examine the epidemiology of
syngamids in wild birds in Germany, to investigate the
pathological alterations and to demonstrate methods for
species identification based on morphological differences
and the sequence of 18.S and ITS-2 rDNA.
Materials and methods
Sampling techniques
A total of 549 birds of four orders (503 Falconiformes,
22 Gruiformes, 1 Ciconiformes, 23 Strigiformes) were
examined for nematodes in their respiratory system.
Dead birds were obtained from rehabilitation stations
from June 1995 to June 2000. Birds originated mainly from
three different locations in Germany: Baden-Württemberg
(478500 to 498250 N, 88500 to 98750 E), Lower Saxony (528000 to
538000 N, 98500 to 118000 E) and Berlin-Brandenburg (528000
to 538250 N, 118500 to 148500 E). All carcasses were sent to the
Leibniz-Institute for Zoo and Wildlife Research, Berlin, for
routine post-mortem examination for parasites (Ritchie
et al., 1994; Doster & Goater, 1997; Krone & Cooper, 2002).
The organs of the respiratory tract were opened and tissues
as well as contents were examined. Nematodes were
removed, cleaned in isotonic NaCl solution and stored in a
solution of 70% ethanol and 5% glycerol. Specimens were
cleared in lactophenol and examined, measured, and
photographed using a microscope (Zeiss Axioskope).
Nematodes were identified using the keys of Lichtenfels
(1980) and Hartwich (1994). A t-test was used to compare
measurements of the eggs (Sokal & Rohlf, 1997).
DNA extraction
Genomic DNA was prepared from single worms by
proteinase K treatment. Each nematode was incubated
overnight at 558C in 100 ml proteinase K buffer(100 mM
Tris (pH 8), 100 mM NaCl, 50 mM DTT, 10 mM EDTA), 1 ml
proteinase K (50 mg ml21) and 10 ml sodium dodecyl
sulphate (SDS) 10%. DNA was purified using QIAGEN
DNeasy Tissue Kit (Qiagen GmbH, Hilden, Germany)
and eluated in 100 ml elution buffer.
PCR amplification
The SSU region of the rDNA was amplified by
forward primer UNI50 (GCTTGTCTCAAGATTAAGCC),
situated at the 50 end, and the reverse primer UNI30
(TGATCC(AT)(GT)C(CT)GCAGGTTCAC), situated at the
30 end of the SSU region. The ITS-2 region was amplified
with forward primer 2a1 (ACGTCTGGTTCAGGGTTG)
situated at the 30 end of the 5.8S gene, and the reverse primer
2r (TTAGTTTCTTTCCTCCGCT) situated at the 50 end of
the 28S gene. Primers were designed following Blaxter lab
nematode genomics (http://www.nematodes.org) and
were partially modified.
PCR was performed in a total volume of 50 ml using
1 £ buffer, 2 mM MgCl2, 40 mM of each dNTP, 10 pmol
of each primer, 1 U of GenTherm DNA polymerase
(Rapidozym, Berlin, Germany) and 1 – 10 ml of the
extracted genomic DNA under the following conditions:
958C, 30 s (denaturation); 458C, 1 min (annealing) for ITS-2
or 538C, 1 min for SSU, respectively; 728C, 1 min
(extension) for 35 cycles. PCR products were detected
on 1.5% agarose gel containing 0.004% ethidium bromide.
Cloning and sequencing
The PCR products were purified with NucleoSpinw
Extract Kit (Macherey-Nagel, Düren, Germany), ligated
into the plasmid vector pGEMw-T Easy (Promega,
Mannheim, Germany) and transformed into TOP 10
competent cells. Transformants (white colonies) were
selected from LB plates, containing x-gal (40 mg ml21),
IPTG (0.4 mM ) and ampicillin (100 mg ml21), grown
overnight in 5 ml LB medium containing ampicillin
(100 mg ml21). Plasmids were isolated from 3 ml over-
night culture with NucleoSpinw Plasmid (Macherey-
Nagel, Düren, Germany) and were confirmed to contain
the insert by EcoR I restriction enzyme analyses. Inserts
were sequenced by GATC Biotech AG (Konstanz,
Germany).
 Taxonomy and pathogenicity of syngamids
Sequences were aligned using ClustalW (Thompson, J.D.;
Higgins, D.G. & Gibson, T.J.; version 1.4) and then corrected
visually using BioEdit (Hall, T.; version 6.0.6). P-Distances
were calculated using MEGA 3.0 (Kumar et al., 2004).
Results
Recovery of syngamid nematodes
Syngamid nematodes infected the order Falconiformes
(2.4%), the Gruiformes (4.5%) and one of the Ciconi-
formes (table 1). This is the first record for C. trifurcatum in
Germany. Hovorkonema variegatum was the parasite most
often diagnosed. This nematode was found in the air sacs
and trachea in nearly equal numbers (table 1). This study
reveals the marsh harrier Circus aeruginosus and the
white-tailed sea eagle Haliaeetus albicilla as new host
records for H. variegatum. All specimens of S. trachea were
found in the trachea of a common kestrel. No syngamid
was observed in birds of the order Strigiformes: Asio
flammeus (n ¼ 1), A. otus (n ¼ 8), Athene noctua (n ¼ 1),
Bubo bubo (n ¼ 2), Glaucidium passerinum (n ¼ 1), Strix
aluco (n ¼ 4), Tyto alba (n ¼ 5); nor in the following birds
of the order Falconiformes: Buteo lagopus (n ¼ 4), Falco
columbarius (n ¼ 1), F. peregrinus (n ¼ 47), F. subbuteo
(n ¼ 6), Milvus migrans (n ¼ 4), M. milvus (n ¼ 25),
Pandion haliaetus (n ¼ 31), Pernis apivorus (n ¼ 14); nor in
Otis tarda (n ¼ 1) of the order Gruiformes.
Morphological features
Characteristics which differentiate syngamids include
the dorsal rays of the bursa copulatrix, spicula length
(fig. 1b,d,h) and the mouth capsule (fig. 1a,c,f,g). Male and
female worms were found in copulation and showed a
y-shaped appearance.
Measurements of the morpohological characteristics of
H. variegatum, e.g. length, width, mouth capsule, number
of teeth, oesophagus, spicule, vulva and tail are similar to
those described by Hartwich (1994) (table 2).
Both the egg length and width of H. variegatum
and S. trachea were different (P , 0.0001, t-test, n ¼ 10).
Eggs of H. variegatum measured 82.4 (^ 3.8) £ 43.2 (^0.9,
n ¼ 10) and eggs of S. trachea 91.9 (^ 4.4) £ 48.5 (^1.4,
n ¼ 10).
Table 1. The occurrence of three species of syngamid nematodes in the trachea, bronchi or air sacs of eight bird
species.
Number of birds infected with syngamid nematodes
Bird species (number Hovorkonema
examined) variegatum
Accipiter gentilis (47) 4 (2 T, 2AS)
A. nisus (66) 2 (1T,1 AS)
Buteo buteo (28) 4 (2T, 3AS)
Circus aeruginosus (9) 1 (T, AS)
Haliaeetus albicilla (56) 1 (AS)
Falco tinnunculus (55) – 1 (T)
Ciconia nigra (1) – –
Grus grus (22) 1 (T)
AS, air sacs; T, trachea or bronchi.
69
Pathological findings associated with worms were
found in 7 of 12 cases infected with H. variegatum.
Alterations consisted of thickened air sac walls (fig. 1e),
lesions or granulomata at the site of worm attachment,
sometimes involving underlying tissues. Lymphoplas-
mocytic air sacculitis were the most prominent
histological lesions found. Only a small irritation of
the mucosal layer in the trachea of the infected common
kestrel from Berlin could be attributed to infection with
S. trachea.
Molecular analysis
The length of the SSU sequence of H. variegatum
(AY702705) was 1687 nucleotides with a G þ C content of
47.18%. Syngamus trachea (AF036606) has a similar SSU
length of 1717 nucleotides and a G þ G content of 47.82%.
Pairwise comparisons revealed a sequence difference of
2.9% and occurred in 51 alignment positions.
The ITS-2 PCR products of H. variegatum were
223–227 bp in size with a G þ C content of 41.15–41.59%.
Pairwise comparisons revealed two groups (fig. 2).
Isolates of HV1 (DQ679967) and HV2 (AY702698) (group
1) differ in 1% (2 nucleotide positions). HV3 (AY702699)
and HV4 (DQ679968) (group 2) also show similarity
with 2% nucleotide differences. The comparison between
these two groups showed differences from 14.0%
to 14.5%, which are 41 and 42 nucleotide positions,
respectively. In addition, the ITS-2 gene sequence of the
closely related C. verrucosum (AY702700) was compared
pairwise to group 1 and group 2 of H. variegatum revealing
a difference of 22% and 21%, respectively. The length
of the ITS-2 sequence of C. verrucosum was 254 nucleotides
with a G þ C content of 36.62%.
Discussion
Bernard & Biesemans (1978) reported a high prevalence
of 21% of S. trachea in the carrion crow Corvus corone
(n ¼ 62) and a low prevalence of 2.4% in the common
kestrel Falco tinnunculus (n ¼ 42) among specimens from
five bird families from Belgium. In one of 30 common
kestrels from Austria S. trachea was recorded (Kutzer et al.,
1980). A similar prevalence of 2% in the common kestrel
Syngamus Cyathostoma Number/range
trachea trifurcatum of worms
– – 1–5
– – 1
– – 1–4
– – 5
– – 4
– 18
1 (T) 1
– – 3
70 O. Krone et al.

Fig. 1. a–b. Cyathostoma trifurcatum. a. Mouth capsule and oesophagus. b. Bursa copulatrix with rays. c –e. Hovorkonema variegatum.
c. Mouth capsule and oesophagus. d. Spicules and bursa copulatrix with rays. e. Air sacculitis of a goshawk (Accipiter gentilis) with eggs of
H. variegatum. f. H. variegatum in situ in the thoracal-caudal air sac of an Eurasian buzzard Buteo buteo with thickening of the air sac wall
(arrow) and worm on the surface of the cranial kidney pole (asterix). g–j. Syngamus trachea. g. Mouth capsule and oesophagus of a male.
h. Spicules and bursa copulatrix with rays. i. Collar surrounding anterior end of mouth capsule in adult female. j. Y-shaped appearance of
a pair of S. trachea in permanent copulation. Scale bars: a, c, g, i, 250 mm; b, 50 mm; h, j, 500 mm; d, f, 100 mm.
 Taxonomy and pathogenicity of syngamids 71

Table 2. Measurements of Hovorkonema variegatum specimens recovered from eight bird species (see table 1).

Present study (mean) Hartwich (1994)

a b
Characteristics Male Female Male Female

Length (mm) 12.9 29.3 4–14 4.9–46

Maximum width (mm) 409.3 1041.5 250–600 550–1000
Mouth capsule (mm) 201 £ 184 525 £ 371 65–170 £ 55– 166 110–560 £ 80 –368
Number of teeth 6– 7 6– 7 6–7 6–7
Oesophagus (mm) 728.1 935.0 350–780 550–1250
Spicule length (mm) 521.9 – 320–870 –
Vulva (mm) – 1694 – 1400–1600
Tail (mm) – 467 – 160–450
a
n ¼ 8; bn ¼ 13.

Fig. 2. Alignment of the ITS-2 sequences of Hovorkonema variegatum isolates.

was also shown in the present study. In contrast to
Forrester et al. (1974), who reported S. trachea as the third
most prevalent nematode occurring in small numbers
(mean: 3, range: 1 – 4) in 7 of 74 sandhill cranes Grus
canadensis tabida from Florida, Syngamus trachea was not
present in cranes in this study. Schuster et al. (2002)
diagnosed a prevalence of 1.8% (n ¼ 120) for S. palustris in
white storks from Germany.
According to our data, the prevalence of H. variegatum
in raptors is 3% with the highest prevalence of 9% in
goshawks. Cranes showed a prevalence of 5%. A similar
prevalence of 4% in raptors was recorded by Furmaga
(1957), who identified Cyathostoma sp. in three rough-
legged buzzards (n ¼ 83) and two barn owls (n ¼ 18).
Hovorkonema variegatum (Cyathostoma variegatum) has
caused mortalities of captive whooping cranes Grus
americana and sandhill cranes (Carpenter & Derrickson,
1987). Spalding et al. (1996) reported H. variegatum in the
oral cavity of one whooping crane (n ¼ 27) introduced
to Florida.
Cyathostoma trifurcatum was found in the black stork,
and this is a new record for Germany, but no specimen
was found in raptors or cranes. Fatal infections in four of
12 raptors caused by Cyathostoma spp. were reported by
Lavoie et al. (1999) who conducted a survey in Canada on
394 specimens of Falconiformes and Strigiformes from
1993 to 1996.
Unlike the study of Frank (1977), who found
pathological alterations of the mucosal layer and
haemorrhages in the trachea of white storks infected
with S. trachea we diagnosed only slight lesions of the
mucosa in the common kestrel. Lierz et al. (1998)
described H. variegatum from a juvenile goshawk Accipiter
gentilis with an aerosacculitis and a nephritis of the cranial
lobe of the kidney caused by the parasite. Clinical signs
were identical with those described for S. trachea
infections. We also diagnosed lymphoplasmocytic air
sacculitis caused by H. variegatum. No pathological
findings were associated with C. trifurcatum, but Lavoie
et al. (1999) recorded a diffuse pyogranulomatous air
72 O. Krone et al.
sacculitis, pneumonia, and bronchitis due to Cyathostoma
spp. Fatal parasitic pneumonia caused by Cyathostoma in
three injured wild North American owls and four juvenile
burrowing owls Athene cunicularia bred in captivity were
described by Hunter et al. (1993). Lesions were most
severe in air sacs, rather than in lung tissues. Host
reactions were more intensive against parasite eggs than
adult or larval worms.
For species differentiation, primary characteristics such
as the bursa copulatrix, mouth capsule, spicules and egg
measurements can be used. In addition, sequence
differences were used for rapid species identification,
independent of development stage or sex. The high
intraspecific difference of the ITS-2 sequence between the
two groups of H. variegatum might indicate either a
subspecies or a cryptic species, which are morphologically
indistinguishable. Currently there are no models which
define the level of nucleotide differences required to
distinguish between closely related parasite species
(Stevenson et al., 1995). Blouin (2002) found intraspecific
variations of at least 1% between different species of the
order Strongylida. This corresponds with variations in
group 1, which includes isolates HV1 and HV2 with an
intraspecific nucleotide difference of 1% and group 2
(isolates HV2 and HV3) with a 2% nucleotide difference,
respectively. Variations between these two groups fall
within the range of closely related species belonging to the
same genus observed by Chilton et al. (1995) and Chilton &
Gasser (1999) (0.9% to 28.3%). Stevenson et al. (1995)
found differences in the ITS-2 sequence between two
morphologically well defined Haemonchus species (order
Strongylida, family Trichostrongylidae) of 1.3%. The
sequence difference of 21% and 22% respectively of the
morphologically well defined species C. verrucosum and
H. variegatum indicates that the ITS-2 sequence provides a
powerful diagnostic marker for species identification.
Intraspecific variation in the highly conserved coding
SSU region is very low. Therefore a difference of 2.9%
between H. variegatum and S. trachea indicates that these
are clearly separate species as confirmed by morphologi-
cal characters. The highest variation is observed between
the nucleotide positions 30 to 210 and 540 to 700. These
regions provide a diagnostic marker to distinguish
S. trachea from H. variegatum as the eggs, larval stages or
adult females are difficult to distinguish. Furthermore on
the base of these regions the implementation of a
restriction enzyme analyse (RFLP) can provide a fast
tool for species diagnostics Gasser, (2001).
The present study has shown that sequences are useful
diagnostic markers for species identification independent
of developmental stages. The new determined sequences
can be used either directly as diagnostic markers or as
basis for further approaches like RFLP or the develop-
ment of species-specific primers.
Acknowledgements
The authors are grateful to J. Schurath for technical
assistance and to R. Altenkamp, D. Haas, O. Lessow,
K. Mueller, D. Schmidt, P. Sömmer and L. Wölfel
for submitting the birds. R. Tscherner provided the
specimens of C. verrucosum.
References
Ali, M.M. (1970) A review and revision of the subfamily
Cyathostomatinae Nicoll, 1927 (Nematoda, Syngami-
dae). Acta Parasitologica Polonica 17, 237– 246.
Anderson, R.C. (2000) Nematode parasites of vertebrates:
their development and transmission. 2nd edn. 672 pp.
Wallingford, Oxon, CAB International.
Baruš, V. & Tenora, F. (1972) Notes on the systematics and
taxonomy of the nematodes belonging to the family
Syngamidae Leiper, 1912. Acta Universitatis Agricul-
turae Brno 10, 275– 286.
Bernard, J. & Biesemans, W. (1978) À propos de la
présence abondante de Syngamus trachea Montagu
1811 chez des oiseaux sauvages maintenus an
captivité. Parasitica 34, 49– 52 (in French).
Blaxter, M.L. (2001) Molecular analysis of nematode
evolution. pp. 1 – 24 in Kennedy, M. & Harnett, W. (Eds)
Parasitic nematodes: molecular biology, biochemistry and
immunology. , Wallingford, Oxon, CAB International.
Blouin, M.S. (2002) Molecular prospecting for cryptic
species of nematodes: mitochondrial DNA versus
internal transcript spacer. International Journal for
Parasitology 32, 527– 531.
Carpenter, J.W. & Derrickson, S.R. (1987) Infectious and
parasitic diseases of cranes: principles of treatment
and prevention. pp. 539– 553 in Archibald, G.W. &
Pasquier, R.F. (Eds) Proceedings of the 1993 International
Crane Workshop. Baraboo, Wisconsin, International
Crane Foundation.
Chilton, N.B. & Gasser, R.B. (1999) Sequence differences
in the internal transcribed spacers of DNA among four
species of hookworm (Ancylostomatoidea: Ancylos-
toma). International Journal for Parasitoloy 29,
1971– 1977.
Chilton, N.B., Gasser, R.B. & Beveridge, I. (1995)
Differences in a ribosomal DNA sequence of morpho-
logically indistinguishable species within the Hypo-
dontus macropi complex (Nematoda: Strongyloidea).
International Journal for Parasitology 25, 647– 651.
Doster, G.L. & Goater, C.P. (1997) Collection and
quantification of avian helminths and protozoa.
pp. 396– 418 in Clayton, D.H. & Moore, J. (Eds) Host –
parasite evolution. New York, Oxford University Press.
Forrester, D.J., Bush, A.O., Williams, L.E. & Weiner, D.J.
(1974) Parasites of greater sandhill cranes (Grus
canadensis tabida) on their wintering grounds in
Florida. Proceedings of the Helminthological Society of
Washington 41, 55 – 59.
Frank, C. (1977) Zur Helminthenfauna verschiedener
Großvögel aus Österreich. Zeitschrift für Angewandte
Zoologie 64, 409– 439 (in German).
Furmaga, S. (1957) Helmintofauna ptaków drapieżnych
(Accipitres et Striges) okolic Lublina. Acta Parasitolgica
Polonica 5, 215– 297 (in Polish).
Gasser, R.B. (2001) Identification of parasitic nematodes
and study of genetic variability using PCR approaches.
pp. 53 – 82 in Kennedy, M. & Harnett, W. (Eds) Parasitic
nematodes: molecular biology, biochemistry and immu-
nology. Wallingford, Oxon, CAB International.
Hartwich, G. (1994) Die Tierwelt Deutschlands. 68. Teil.
Schlauchwürmer, Nemathelminthes, Rund- oder Fadenwür-
mer, Nematoda. Parasitische Rundwürmer von Wirbeltieren.
 Taxonomy and pathogenicity of syngamids
Strongylida: Strongyloidea und Ancylostomatoidea. 157 pp.
Jena, Stuttgart, Gustav Fischer Verlag (in German).
Hung, G.C., Chilton, N.B., Beveridge, I., McDonnell, A.,
Lichtenfels, J.R. & Gasser, R.B. (1997) Molecular
delineation of Cylicocyclus nassatus and C. ashworthi
(Nematoda: Strongylidae). International Journal for
Parasitology 27, 601– 605.
Hunter, D.B., McKeever, K. & Bartlett, C. (1993)
Cyathostoma infections in screech owls, saw-wet owls,
and burrowing owls in southern Ontario. pp. 54 – 56
in Redig, P.T., Cooper, J.E., Remple, J.D. & Hunter, D.B.
(Eds) Raptor biomedicine. Minneapolis, University of
Minnesota Press.
Krone, O. & Cooper, J.E. (2002) Parasitic diseases.
pp. 105– 120 in Cooper, J.E. (Ed.) Birds of prey. Health
and diseases. Oxford, Blackwell Science Ltd.
Kumar, S., Tamera, K. & Nei, M. (2004) MEGA 3:
integrated software molecular evolutionary genetics
analysis and sequence alignment. Briefings in Bioinfor-
matics 5, 150– 163.
Kutzer, E., Frey, H. & Kotremba, J. (1980) Zur
Parasitenfauna österreichischer Greifvögel. Ange-
wandte Parasitolgie 21, 183– 205 (in German).
Lavoie, M., Mikaelian, I., Sterner, M., Villeneuve, A.,
Fitzgerald, G., McLaughlin, J.D., Lair, S. &
Martineau, D. (1999) Respiratory nematodiasis in
raptors in Quebec. Journal of Wildlife Diseases 35,
375– 380.
Lengy, J. (1969) Notes on the classification of Syngamidae
(Nematoda) with new data on some of the species.
Israel Journal of Zoology 18, 9– 23.
Lichtenfels, J.R. (1980) Keys to the genera of the
subfamily Strongyloidea. pp. 1 – 41 in Anderson, R.C.,
Chabaud, A.G. & Willmott, S. (Eds) CIH keys to the
nematode parasites of vertebrates, No. 7. Slough, Bucks,
Commonwealth Agricultural Bureaux.
Lierz, M., Schuster, R., Ehrlein, J. & Göbel, T. (1998)
Nachweis von Hovorkonema variegatum bei einem
Habicht (Accipiter gentilis). Kleintierpraxis 43, 43 – 46
(in German).
73
Okulewicz, A. (1984) Cyathostoma variegatum (Creplin,
1849) Chapin, 1925 i Cyathostoma lari Blanchard, 1849
(Nematoda, Syngamidae) w Polsce. Wiadomosci Para-
zytologiczne 30, 53 – 56 (in Polish).
Ritchie, B.W., Harrison, G.J. & Harrison, L.R. (1994)
Avian medicine: principles and application. 1384 pp. Lake
Worth, Florida, Wingers Pub. Inc.
Rysavý, B. & Ryshikov, K.M. (1978) Helminths of fish-
eating birds of the palaearctic. 318 pp. Moscow, Prague,
USSR Academy of Sciences, Helminthological Labora-
tory, Czechoslovak Academy of Sciences, Institute of
Parasitology.
Samson-Himmelstjerna, G., von Harder, A. &
Schnieder, T. (2002) Quantitative analysis of ITS-2
sequences in trichostrongyle parasites. International
Journal for Parasitology 32, 1529– 1535.
Schuster, R., Schaffer, T. & Shimalov, V. (2002) Die
Helmithenfauna einheimischer Weißstörche (Ciconia
ciconia). Berliner und Münchener Tierärztliche Wochens-
chrift 115, 435– 439 (in German).
Simpson, V.R. & Harris, E.A. (1992) Cyathostoma lari
(Nematoda) infection in birds of prey. Journal of the
Zoological. Society of London 227, 655– 659.
Sokal, R.R. & Rohlf, F.J. (1997) Biometry. 887 pp.
New York, W.H. Freeman and Company.
Spalding, M.G., Kinsella, J.M., Nesbitt, S.A., Folk, M.J.
& Foster, G.W. (1996) Helminth and arthropod
parasites of experimentally introduced whooping
cranes in Florida. Journal of Wildlife Diseases 32, 44 – 50.
Stevenson, L.A., Chilton, N.B. & Gasser, R.B. (1995)
Differentiation of Haemonchus placei from H. contortus
(Nematoda: Trichostrongyloidea) by the ribosomal
DNA second internal transcript spacer. International
Journal for Parasitology 25, 483– 488.
Yamaguti, S. (1961) Systema Helminthum. Vol. III. The
nematodes of vertebrates. Part 1. pp. 207– 209. New York,
London, Interscience Publishers, Inc.
(Accepted 29 June 2006)
q 2007 Cambridge University Press