BIOL1XX7 SAMPLE QUESTIONS WITH ANSWERS

MULTIPLE CHOICE QUESTIONS

1. Consider muscle cells and liver cells from the same individual. Liver cells produce a
protein, albumin, which is NOT synthesized in muscle cells. Which of the following
statements about the comparison between these two cell types is CORRECT?

A. There are more copies of the albumin sequence in the liver cell genome.
B. Only the number of copies of the albumin protein changes between the two cell types
C. There are more copies of albumin mRNA in the liver cell
D. The genome, the transcriptome and the proteome are all different between the two
cell types
E. The albumin sequence is not present in the muscle cell DNA.

2. Replication is:

A. the synthesis of RNA from a DNA template

B. the synthesis of DNA from a DNA template
C. the synthesis of DNA from an RNA template
D. the synthesis of DNA from a protein template
E. the synthesis of protein from an RNA template

3. A fragment of E. coli DNA contains 1 000 base pairs. Analysis reveals a composition of 40
% (G + C) content. Which of the following statements is CORRECT?

A. There are 1 000 purine bases.

B. There are 1 000 phosphodiester bonds
C. There are 1 000 hydrogen bonds holding the two strands together.
D. There are 1 000 N-glycosidic bonds
E. There will be 200 guanine bases

4. Which of the following would allow you to monitor the activity of reverse transcriptase?

A. Measure 32P NTP incorporation into RNA, using a DNA template

B. Measure 32P dNTP incorporation into DNA, using a DNA template
C. Measure 32P dNTP incorporation into RNA, using a DNA template
D. Measure 32P dNTP incorporation into DNA, using an RNA template
E. Measure 32P NTP incorporation into RNA, using a protein template
Use the diagram below to answer questions 5 to 6. The amino acids are presented in their
predominant ionic form at pH 7
A. O B. O
- -
H3N+ CH C O H3N+ CH C O

CH CH3 CH2

CH2 CH2

CH3 CH2

CH2

C. O +NH
3

H2N CH C OH

D.
O
CH2 -
H3N+ CH C O
C O
- CH2
O
CH2

C O

E O NH2
-
H 3N + CH C O

CH OH

CH3

5. Which amino acid side chain is most likely to interact with the sugar phosphate
backbone of DNA? Amino acid B

6. If the amino acids above joined to form a pentapeptide how many charged groups
would this pentapeptide have at pH 7?

A. 12
B. 10
C. 5
D. 4
E. 2
Use the diagram below to answer question 7. Consider an enzyme-catalysed reaction, in
which substrate S is converted to product P. The concentration units on the y-axis are
arbitrary.

7. Which graph below shows the change in the concentration of the enzyme during the
reaction? Graph D

100 100
B
80 80
A

[Enzyme]
[Enzyme]

60 60

40 40

20 20

0 0
0 0.5 1 1.5 2 2.5 3 0 0.5 1 1.5 2 2.5 3

Time (min) Time (min)

100 100
C D
80 80
[Enzyme]

[Enzyme]

60 60

40 40

20 20

0 0
0 0.5 1 1.5 2 2.5 3 0 0.5 1 1.5 2 2.5 3

Time (min) Time (min)

100
E
80
[Enzyme]

60

40

20

0
0 0.5 1 1.5 2 2.5 3

Time (min)
8. What is the most likely explanation for the “plateau” in the graph below?

A. The enzyme is running out

B. The enzyme is saturated
C. The substrate concentration has decreased
D. The reaction has reached Vmax
E. There was not enough enzyme in the reaction to start with

100

80
[product]

60

40

20

0
0 2 4 6 8 10

Time (min)

9. Which of the following is a property of ALL RNA and DNA polymerases?

A. They all need a primer to initiate synthesis

B. They all work to make a new strand 5’ to 3’
C. They all need a DNA template
D. They all have 3’ to 5’ exonuclease activity to proof read
E. All of the above properties are properties of all polymerases

10. The removal of the –OH group from carbon 2′ of ribose in DNA:

A. Prevents the oxidation of the bases

B. Allows the two strands to base pair more efficiently
C. Prevents the formation of a cyclic phosphate complex
D. Stabilises the N-glycosidic bond
E. Excludes water molecules from the middle of the double helix
11. You have synthesized a new compound, a potential antibiotic, which inhibits cell division
in E. coli. Upon further investigation into the mechanism, you find that when the E. coli
cell is treated with this inhibitor there are lots of small fragments of DNA after DNA
synthesis has finished. Which DNA replicative enzyme/protein is the most likely target
for this inhibitor?

A. DNA polymerase III

B. Helicase
C. Primase
D. Ligase
E. Topoisomerase

12. You have a bacterial cell which has 100 times more copies of protein W than protein V;
both are enzymes. Protein W is encoded in the DNA by gene w and protein V is encoded
by gene v. Which statement is the most likely explanation of the disparity between the
amount of protein W and protein V?

A. There are many more copies of gene w in the genome (DNA) than gene v
B. The promoter sequence for gene w is closer to the consensus sequence than that of
gene v
C. RNA polymerase works faster at copying gene w than gene v
D. The mRNA for gene w is shorter than gene v so it is translated faster
E. A repressor is masking the promoter of gene w

13. Here is an RNA sequence that codes for a small peptide. How many amino acids would
the peptide contain?

5’ AGGACCUUGUAUGCUAAGGUGUCACCAUUAGGG 3’

A. 33
B. 11
C. 7
D. 6
E. 5

14. Peptide bonds (the bonds between amino acids in proteins) are formed by:

A. ribosomal RNA
B. DNA polymerase
C. RNA polymerase
D. Protein polymerase
E. tRNA
15. You are measuring the activity of an enzyme in serum samples, under Vmax conditions,
as part of a set of diagnostic tests. The reaction is linear for 5 min. Which of the
following changes to the assay method would change the VALUE of the reaction rate in
µmol/min/mL serum?

A. Taking absorbance measurements for 2 min instead of 1min

B. Doubling the concentration of the substrate
C. Adding twice the volume of serum to the assay
D. Measuring the activity at 37o instead of 25oC
E. All of the actions will change the activity measurement

16. Imagine a cell in an animal tissue under ‘normal’ conditions. It is only oxidising fuels at a
low rate. What change will make the cell oxidise fuel the FASTEST?

A. Decreasing the amount of FAD and NAD

B. Increasing oxygen supply
C. Increasing fuel supply
D. Increasing the rate of ATP usage
E. Stopping the pumping of protons across the inner mitochondria membrane

17. Glucose is an important fuel for the generation of ATP. It is stored as glycogen. Which
statement is CORRECT?

A. Per gram, more ATP is produced from glucose than any other fuel
B. When glucose is oxidised to carbon dioxide, most of the production of ATP occurs during
the glycolysis phase
C. In the human body, more energy is stored as glycogen than any other fuel
D. Glycolysis can occur in cells that have NO mitochondria
E. The brain can NOT use glucose

18. The plasma membrane of an animal cell contains _________________ and the
________________ of this/these molecule(s) slot in adjacent to the ________________
of ______________

A. cholesterol / carbon rings / fatty acids / phospholipids

B. carbohydrates / polar regions / fatty acids / phospholipids
C. Cholesterol / non-polar regions / glycocalyx / the basal lamina
D. carbohydrates / carbon rings / glycocalyx / the basal lamina
E. Carbohydrates / carbon rings / glycocalyx / phospholipids
19. In the anterior pituitary cell, ACTH is synthesised and packed into ______________
which are transported along __________________ to the plasma membrane.

A. vesicles / microtubules
B. micelles / intermediate filaments
C. vesicles / micro filaments
D. micelles / desmosomes
E. michelles / microtubles

20. _________________ are attached at one end to ____________________

A. actin filaments / an organising centre

B. microtubules / an organising centre
C. intermediate filaments / motor protein
D. desmosomes / actin filaments
E. actin filaments / motor protein

21. The hormone ___________________ is made in the ___________________ and

stimulates the ___________________.

A. ACTH / anterior pituitary / hypothalamus

B. CRH / hypothalamus / anterior pitiuitary
C. cortisol / hypothalamus / anterior pituitary
D. pregnenolone / anterior pituitary / adrenal cortex
E. ACTH / hypothalamus / adrenal cortex

22. An enzyme that phosphorylates a protein is called a

A. kinase
B. ATPase
C. phosphatase
D. lipase
E. G protein
23. Neurotransmitters bind to __________________ which causes a(n)
__________________

A. a receptor in the cytoplasm / ion channel to open

B. the glycocalyx / transfer of cholesterol to move from the outer mitochondrial membrane
to the inner
C. a gtp binding protein / transfer of cholesterol to move from the outer mitochondrial
membrane to the inner
D. the glycocalyx / ion channel to open
E. a receptor on the plasma membrane / ion channel to open

24. The role of ATP in photosynthesis is

A. negligible
B. to provide energy for the light reactions
C. to provide energy for the Calvin cycle
D. to reduce carbon or sulphur or nitrogen oxides
E. to produce pyruvate acid

25. The outside of the ___________________ is composed of a _________________ and

this organelle imports molecules that have been transported from the blood to the
cytoplasma via __________________ .

A. lysosome / bilayer phospholipid membrane / endocytosis

B. smooth endoplasmic reticulum / micelle arrangement of phospholipids / endocytosis
C. lysosome / micelle arrangement of phospholipids / exocytosis
D. smooth endoplasmic reticulum / bilayer phospholipid membrane / exocytosis
E. smooth endoplasmic reticulum / micelle arrangement of phospholipids / exocytosis

26. Which of the following statements is true?

A. Anabolism is the synthesis of molecules, results in a decrease in entropy and involves

NADPH
B. Anabolism is the breakdown of larger molecules, results in a decrease in entropy and
involves NADPH
C. Catabolism is the synthesis of molecules, results in an increase in entropy and involves
NADH
D. Catabolism is the breakdown of larger molecules, results in an increase in in entropy and
involves NADPH
E. Catabolism is the synthesis of molecules, results in a decrease in entropy and involves
NADH
27. C4 photosynthesis ________________, and evolved ______

A. produces a 4-carbon molecule, when O2 concentrations were low.

B. concentrates CO2 in bundle sheath cells, when O2 concentrations were low.
C. concentrates CO2 in bundle sheath cells, when CO2 concentrations were low.
D. produces a 4-carbon molecule, when plants colonised the land.
E. produces a 4-carbon molecule, via endosymbiosis

28. The three phases of the Calvin cycle are:

A. carbon fixation, reduction, regeneration of Rubisco

B. carbon fixation, reduction, glycolysis
C. splitting water, production of 3-phosphyglycerate, phosphorylation of ADP
D. splitting water, synthesis of ATP, carbon fixation
E. carbon fixation, reduction, and regeneration of RuBP

29. If A and B are two compartments filled with aqueous solutions and separated by a semi
permeable membrane, __________________ will move from A to B if
____________________ .

A. water / the solution in b has a higher concentration of nacl

B. water / the solution in a has a higher concentration of nacl
C. positive charge / the solution in b has a higher concentration of nacl
D. positive charge / the solution in a has a higher concentration of nacl
E. water / the solution in b has a lower concentration of nacl

30. 30. Which of the following graphs best describes the response of photosynthesis to
light?

A B C D E
31. Why are plasmids useful as vectors for cloning genes?

A. They typically integrate into the chromosome of bacteria

B. They exist in all bacterial species
C. They are easily extracted from bacterial cells
D. They are easily inserted into bacterial cells
E. Both (c) and (d) are important features

32. What is a problem with using E.coli as a host organism for biotechnology?

A. It is not generally recognised as safe (i.e. not GRAS)

B. It is difficult to get DNA in and out of this bacterium
C. There is a lack of genetic tools for manipulating E.coli
D. It is difficult to grow and handle in the lab
E. It can be part of the normal human microflora

33. What is an example of a thermostable product manufactured in a GMO microbe?

A. Insulin
B. B. DNA ligase
C. C. Restriction endonuclease
D. D. Smallpox vaccine
E. E. Taq polymerase

34. Which of the following are considered disease vectors?

A. Fleas
B. Contaminated door handles
C. Contaminated food
D. Contaminated water
E. All of the above are disease vectors

35. Photoautotrophic bacteria:

A. Use complex organic molecules as their primary carbon and energy source
B. Use CO2 as their carbon source and light as their energy source
C. Use light as their carbon source and CO2 as their energy source
D. Use atmospheric nitrogen as their energy source
E. Use nitrate or ammonia as their energy source
36. Regarding microbes in the nitrogen cycle, which of the following is correct?

A. Nitrogen-fixers are only found as symbionts in animals

B. Nitrogen-fixers reduce ammonium ions to nitrogen gas
C. Denitrifiers release molecular nitrogen into the atmosphere
D. Only Archaea are capable of fixing atmospheric nitrogen
E. Denitrifying bacteria are also photoautotrophic

37. What is the role of methanogens in the carbon cycle?

A. Consuming methane
B. Producing methane
C. Reducing methane
D. Oxidising methane
E. Hydrolysing methane

38. Which method would give the highest measure of biodiversity in a soil sample?

A. Culturing on nutrient agar

B. Culturing in nutrient broth
C. Microscopic examination via Gram stain
D. Microscopic examination via phase-contrast imaging
E. Sequencing of DNA

39. What is the most accurate definition of a heterotroph?

A. It uses organic compounds as carbon sources

B. It uses CO2 as a carbon source
C. It uses CO2 as an energy source
D. It uses light as an energy source
E. It uses inorganic compounds as an energy source

40. What is the key molecular event that generates a recombinant piece of DNA?

A. Amplification
B. Restriction digestion
C. Ligation
D. Transformation
E. Sequencing
41. In the food production industry, koji mould is

A. Brewing yeast
B. A mix of micro-organisms used in the production of chocolate
C. Certain Aspergillus species
D. Saccharomyces
E. A toxic food contaminant

42. Why are GMO microbes especially useful for biotechnology?

A. They are safer to handle compared to wild-type microbes

B. The legal complexities are easier to manage than for wild-type microbes
C. They allow production of large amounts of useful proteins
D. They survive well in the environment e.g. for bioremediation
E. They typically grow more rapidly than the corresponding wild-type strain

43. Germ-free cows would not be able to survive because

A. They would be very vulnerable to pathogens

B. They would quickly get mastitis
C. They would not be able to digest cellulose
D. They would suffer from severe tooth decay
E. They would rapidly fill up with methane

44. Which of the following statements regarding our normal microbiota is NOT true

A. They can be highly specialised for different body sites

B. They are acquired at birth and from the environment
C. They are limited to a small number of highly specialised species
D. They are mostly bacteria
E. They can cause disease if they build up in numbers or get into the wrong site

45. Transient microbes associated with our body:

A. Are always human-associated

B. Never cause disease
C. Do not normally cause disease
D. Are always bacterial microbes
E. Are always viruses
46. Fire is a common and periodic event in the Australian landscape. Like other
disturbances, fire

A. has little impact on the structure of the plant and animal community in most landscapes
B. does not influence the community of organisms found in soil
C. influences the species composition of communities
D. enhances species richness and diversity
E. does not influence ecosystems

47. Which of the following statements best describes all the possible ways in which animals
cope with their environment? They use:

A. flexible behaviours and physiology on a conserved morphological framework

B. an interlinked set of behavioural, physiological and morphological characteristics
C. highly adaptive physiological and morphological characteristics
D. behaviours that minimise abiotic stress
E. inflexible and non-adaptive physiological characteristics

48. Which of the following gases is the most important contributor to the Greenhouse
Effect?

A. Hydrogen sulfide
B. Nitrogen
C. Methane
D. Mercury vapour
E. Sulphur

49. The biological species concept defines a species based on:

A. morphological similarity
B. being potentially reproductively compatible
C. genetic similarity
D. classification into arbitrary units
E. food web interactions
50. What is the “evil quartet” of extinction forces threatening global biodiversity?

A. Habitat loss, alien species, overhunting, chains of extinction

B. Climate change, urban development, genetic inbreeding, fire
C. Genetic inbreeding, fire, floods, habitat loss
D. Humans, habitat loss, domestic cats, reduction of food resources
E. Foxes, cats, dingoes, crown of thorns starfish

51. Optimal foraging theory considers that animals forage:

A. in a depleting environment
B. to minimise net rate of energy expenditure
C. to compete with other species
D. to optimise energy intake against predation risk
E. while ignoring costs of predation

52. An example of what a community ecologist would study is _____.

A. how male and female clown fish differ in their response to changing environmental
conditions in a coral reef habitat
B. the interactions between individual clown fish in a coral reef habitat
C. competition between clown fish and angel fish in the same coral reef habitat
D. the interactions among several species of fish, the aquatic vegetation, and other animal
species in a coral reef habitat
E. how several species of fish and the surrounding aquatic vegetation react to changing
abiotic features in a coral reef habitat

53. What determines the carrying capacity of an environment?

A. the number of organisms that immigrate into the environment

B. the climate
C. rate of death
D. the rate at which disease spreads through the population
E. the availability of resources in the environment
54. Which of the following is an example of a trophic cascade?

A. A plant is consumed by an herbivore, which is consumed by a carnivore.

B. A dolphin gains only 10% of the energy of 10 kilograms of fish that it has eaten.
C. Trees are removed from a forest and a shrub species takes over.
D. A mountain lion population migrates upwards toward the peak of a mountain in
response to climate change.
E. A mass mortality of a species of bird results in increased numbers of herbivorous
insects and decreased biomass of grass.

55. The composition of ecosystems:

A. is determined by the primary productivity of the system

B. may be highly dynamic because of the food webs that link the components
C. may be explained by the structure of the food webs
D. indicates the trophic linkages between assemblages of species
E. is none of the above

56. When a habitat becomes fragmented, the probability that species will go extinct in
patches is likely to be highest when:

A. patches are small

B. patches are long broad strips on roadsides
C. species in patches hybridise
D. patches are large but geographically isolated
E. intraspecific competition in patches is high

57. What is the importance of endemic hotspots to biodiversity conservation?

A. Endemic hotspots have the highest species diversity, so their conservation will protect
the most species
B. Endemic hotspots contain many species found nowhere else, so the conservation of a
small amount of area will protect many species
C. Endemic hotspots are where speciation rates are the greatest, so the conservation of
those areas will likely lead to the formation of many species in the future
D. Endemic hotspots have very low ecosystem stability, and therefore require more
protection to avoid extinctions
E. Endemic hotspots are those that contain species vital to human existence, such as
medicinal species, and therefore humans rely on these areas the most
58. In a hypothetical situation, a bacterium lives on the surface of a leaf where it obtains
nutrients from the leaf's nonliving waxy covering, which the leaf continually produces.
The plant is not hurt or harmed by this feeding. Once the number of bacteria reaches a
critical mass, they inhibit the growth of other microbes that damage the plant.
Occasionally, these bacteria can gain access to the interior of the leaf, for example, if
there is weather-related leaf breakage the exposes the plant's interior tissues. If this
occurs, the bacteria feed on the plant's living tissue, causing minor damage. What
sequences best describes the ecological roles played by the bacterium in this situation?

A. commensalism→ mutualism→ parasitism

B. mutualism→ parasitism→ commensalism
C. mutualism→ commensalism→ parasitism
D. commensalism→ parasitism→ mutualism
E. parasitism→ commensalism→ mutualism

59. How is it possible that a community could have low species diversity, but high species
richness?

A. If most of the individuals belonged to a single species

B. If the individuals had a perfectly even distribution among the species
C. If there was one or two rare species
D. If there were low numbers of individuals in each species
E. If there were high numbers of multiple species

60. A group of organisms of the same species living in a geographically distinct area is
defined as a:

A. subspecies
B. biome
C. ecosystem
D. community
E. population