Research Dimensions January 2011

EFFECT OF LIGHT, NITRATE, AND TUNGSTATE ON THE ACTIVITY

OF NITRATE REDUCTASE IN RICE

A Ali1*, S Sivakami2, N Raghruam3

1
Department of Biotechnology, National Institute of Pharmaceutical Education &
Research, Hajipur, Bihar, INDIA
2
Department of Life Sciences, University of Mumbai, Mumbai, Maharashtra, INDIA
3
School of Biotechnology, GGS Indraprastha University, Delhi, INDIA
*Corresponding author – ahmadali95@gmail.com (Mob: - +91 9939176001)

ABSTRACT an excessive and inadequate use of nitrogen

Several approaches such as molecular
genetics, functional genomics, recombinant
DNA technology etc. have been used to
elucidate the regulation of nitrate assimilation
in plants and microbes. In the present study a
combination of enzyme inducers and
inhibitors were used to examine the
modulation of nitrate reductase in the shoots
of 12-days hydroponically (nutrient starved
for 10-12 days) grown rice seedlings. First
the effect of nitrate and light was checked on
the activity of nitrate reductase (NR). Nitrate
caused an increase in the NR activity by
several fold in both light and dark Light
augmented the effect of nitrate. However
there was no change in the level of NR
mRNA after withdrawal of light signals.
Tungstate, an analog of molybdate, caused a
severe decrease in the activity of nitrate-
induced nitrate reductase even at a very low
concentration (0.1mM). These results
indicate that the nitrate reductase is regulated
in a co-ordinated manner by light and nitrate
in rice.
Keywords: nitrate assimilation, enzyme
inhibitors, Tungstate
Introduction
Nitrogen is often considered to be one of the
most important factors limiting plant growth
in natural ecosystems and in most agricultural
soils. Since last few decades there has been
fertilizers to meet the requirement of
increasing demand of nitrogen for crops. This
has lead to an increase in the nitrogen related
environmental problems, such as nitrate loss
in the environment (Lawlor et al, 2001).
Plants can use various nitrogenous forms,
nitrate, ammonium, urea, amino acids, and
nitrous oxides to meet their nitrogen
requirement and this varies from species to
species (Forde and Clarkson, 1999). Nitrate,
the most preferred source of nitrogen for
many plants, is uptaken by energy dependent
specific transporters present in the root cells.
The nitrate can converted to ammonium in
the roots or leaves or transported to the leaves
where it is stored in the vacuoles. This
conversion of nitrate to ammonium is two-
step process catalysed by cytosolic nitrate
reductase (NR) and chloroplastic nitrite
reductase (NiR). The reduced nitrogen,
ammonium, is assimilated into the carbon
skeleton by the coordinated action of
GS/GOGAT in a cyclic manner. The genes
and enzymes of nitrate assimilation have been
well characterized in many plant species
(Forde and Clarkson, 1999).
The pathway of nitrate assimilation is highly
regulated and the genes and enzymes of this
pathway are coordinately regulated with
respect to the nitrogen source, the
intracellular amounts of reduced nitrogen
compounds, lights, hormones, and carbon
status (Stitt et al, 2002). Various approaches
have been used to characterize the regulation

of nitrate assimilation. These include
pharmacological, immunological, molecular
genetics (identification of regulatory genes
and mutants), functional genomics,
recombinant DNA technology, transgenic
plants, as well as use of specific enzyme
inhibitors (Stitt, 1999). In the present study
one inhibitor, tungstate has been used to
study the regulation of nitrate reductase and
nitrite reductase in the excised leaves of
nutrient-starved rice seedlings. Rice (Oryza
sativa ssp. indica var. Panvel I) was a
selected to study the regulation of nitrate
assimilation because of paucity of the
available literature in this field. Rice is also
known to be very poor in nitrogen use
efficiency; as it uses only ~33% of nitrogen
fertilizer applied to the crop resulting in
heavy loss of nitrogen. This, in turn, results in
drinking water pollution due to leaching of
nitrate.
Sodium tungstate, an analog of
molybdenum, inhibits nitrate reductase and
methionine sulfoximine inhibits glutamine
synthetase. Tungstate can be substituted for
molybdenum in the molybdenum cofactor of
nitrate reductase, resulting in inactive enzyme
(Deng et al., 1989). Because of its broad
biological spectrum of action, tungstate may
be used to selectively prevent nitrate
reduction. It will be possible to examine the
regulation of nitrate uptake and of other steps
of the nitrate assimilation pathway in higher
plants without the complications introduced
by the functioning of the pathway. The results
indicate that even a very low concentration of
tungstate (0.1mM) is enough to cause severe
loss in the activity of nitrate reductase and the
extent of inhibition did not increase with
increasing concentrations. The findings of the
present study clearly indicate that light and
nitrate play a significant role in the regulation
of nitrate reductase and the regulation of
nitrate assimilatory enzymes in rice is similar
Research Dimensions January 2011
to other organisms which use nitrate as the
major source of nitrogen nutrient.
Materials and Methods
Growth Conditions
Rice seeds Oryza sativa var. Panvel I) were
washed thoroughly with tap and single distilled
water (sd/w), soaked for 10 minutes in 5% v/v
sodium hypochlorite (NaOCl) and were washed
several times with tap water. The seeds were
again washed and soaked in sd/w and kept in dark
for two days. Imbibed seeds were plated on wet
germination paper in a plastic tray and incubated
at 25+2 °C under white light illumination derived
from 2 Osram 36 W fluorescent lamps. The light
intensity at the plant level was 1 Klux. The
seedlings were watered daily with sd/w for 10-12
days. To prevent interferences by nitrate uptake
and long distance transport processes with nitrate
reduction, most of the experiments were carried
out with detached leaves.
Induction of NR by nitrate
Induction is defined as an increase in enzyme
activity above the endogenous level (Aslam et al.,
1973). 10-12 days old seedlings were selected for
studying the induction of the enzymes by nitrate
as maximum NR activity was observed in this
period as well as there were no phenotypical
stress symptoms like wilting and chlorosis. The
seedlings were grown hydroponically (nutrient
starved) in order to avoid any kind of metabolic
changes contributed by nutrient molecules in the
system. Excised leaves were floated on different
concentration of nitrate (20-100 mM) in a Petri
dish. After 4 hours, leaves were washed to
prevent carry over of chemicals, blotted on a
tissue paper, wrapped in foil, frozen in liquid N
2
and used immediately or stored at –70° C.
Treatment of Tungsate
To study the behavioral pattern of enzymes from
nutrient starved seedlings, excised leaves were
treated with specific enzyme, inhibitors Sodium
tungstate (0.5 and 1.0 mM) with or without nitrate
and downstream metabolites. After appropriate
time intervals leaves were washed, blotted on
tissue paper, wrapped in foil, frozen in liquid N2
and used immediately or stored at –70° C.

Enzyme Assays
The potassium phosphate buffer (100 mM, pH
7.5) used for preparation of crude extracts
contained magnesium acetate (5 mM), glycerol
(10% v/v), polyvinylpyrollidone (10% w/v),
Triton X-100 (0.1% v/v), Leupeptin (3 mg/l),
EDTA (1 mM), DTT (1 mM), PMSF (1 mM),
benzamidine (1 mM), and 6-aminocaproic acid
(1mM). Benzamidine was prepared fresh before
use. DTT and PMSF were added to the rest of the
components just before extraction. The leaf tissue
(0.25 g) was ground into a fine powder in a
mortar and pestle using liquid nitrogen. The
extraction buffer was added soon after liquid
nitrogen evaporated, but before thawing set in.
The tissue to buffer ratio was maintained at 1:3
(w/v) and the mixture was homogenised
thoroughly. The extract was filtered through
nylon net (80 µm) and centrifuged at 14,000 rpm
for 15 minutes. The clear supernatant was
transferred into a fresh, pre-cooled microfuge
tube and used immediately for the measurement
of enzyme activities. Same extract was used for
assaying all the enzymes and protein estimation.
Nitrate Reductase Assay
The assay was performed as described by
Hageman (1979) and the nitrite formed was
estimated by Snell and Snell method (1949). The
reaction mixture consisted of 100 mM potassium
phosphate buffer (pH 7.5), 5 mM EDTA, 5 mM
KNO and an appropriate amount of crude extract
3
in a total volume of 0.4 ml. The blanks contained
all the assay components except NADH. The
reactions were set up in triplicate and carried out
at RT (25° C) and stopped after 20 minutes by the
adding 0.6 ml of 1:1 (v/v) mixture of
sulphanilamide (1% w/v in 3 N HCl) and NED
(0.1% w/v). The reaction was incubated for a
further 15 min at RT and the pink colour
developed was measured at 540 nm. The amount
of nitrite formed was calculated from a standard
graph plotted using the A values obtained from
540
known amounts of nitrite. NR activity was
defined as nmoles of nitrite produced per ml
extract per hour. The specific activity was
expressed as enzyme activity per mg protein, and
represented a mean of triplicate samples. Each
such experiment was repeated thrice and the
Research Dimensions January 2011
mean data was plotted as relative specific activity
(%) along with standard errors.
Protein Estimation
Protein content was estimated according to the
method of Bradford using BSA as standard
(Bradford, 1976).
RNA isolation
RNAwas isolated according to the method of
Chomczynski and Sachhi [10] using commercial
TRIZOL from GIBCO. Excised leaves were
treated with different metabolites and signaling
agents either alone and/or with KNO3 up to 2 h.
Treated excised leaves were ground thoroughly to
a powder using a mortar and pestle in the
presence of liquid nitrogen. One millilitre
TRIZOL was added immediately, homogenized
thoroughly and left for thawing. The tissue to
buffer ratio was 1:10 (w/v). The homogenate was
left for 5 min at room temperature and
centrifuged at 8500 rpm for 15 min at 4 ºC.
Chloroform (0.2 ml) was added in the supernatant
and the tube was shaken vigorously for 15 s,
incubated for 3–5 min at RT and centrifuged at
8500 rpm for 15 min at 4 ºC. The upper aqueous
phase containing RNA was transferred to another
tube. 0.5 ml isopropyl alcohol was added, left
overnight at -20 ºC and again centrifuged at 8500
rpm for 15 min at 4 ºC. The pellet obtained was
washed twice with 75% ethanol, dried and
resuspended in 50 ml RNase-free (DEPC-treated)
distilled water, aliquoted in several tubes and
stored at -20 ºC. The quantity of RNAwas
measured by taking absorbance at 260 nm and
purity checked by measuring the absorbance at
230, 260, 280 and 310 nm. Only that RNA
sample was used as template for the RT-PCR
which gave a 260/280 ratio of ~2. The integrity of
RNA was checked, before performing RTPCR,
by agarose gel electrophoresis (0.8%). The gel
was stained with ethidium bromide and visualised
on an UV transilluminator.
RT-PCR and gel analysis
RT-PCR was performed in a Techne Progene
(UK) thermal cycler fitted with a heated lid. Gene
specific primers for NR and tubulin were
designed in-house and were also evaluated for
various other parameters like melting
temperature, presence of secondary structure like
 Research Dimensions January 2011

hairpin and dimer formation using software distilled water as a control in light. After 6
available on the internet hrs, the leaves were frozen and processed for
(www.premierbiosoft.com). The sense and extraction and NR assays. The data presented
antisense primer sequences of NR: in Fig. 1 show that 40 mM KNO3 was the
AGGGGATGATGAACAACTGC and
optimum nitrate concentration for maximum
GAGTTGTCGGAGCTGTACCC. Tubulin sense
and antisense primer sequences are
NR induction in excised leaves. This
TGAGGTTTGATGGTGCTCTG and concentration of nitrate was used for all
GTAGTTGATGCCGCACTTGA. The target subsequent experiments.
gene transcript was amplified using one-step RT- When NR activity was measured from
PCR kit supplied by QIAGEN (Germany), dark-adapted leaves treated with nitrate (40
according to the supplier’s instructions. One mM) in dark for 6 hrs, it decreased to 15%
microgram template and 0.6 mM each of both the compared to that in presence of light (Fig. 2).
primers (forward and reverse) were added into a It can also be seen from the Fig. 2 that in the
50 ml reaction mixture containing 5_ RT-PCR absence of nitrate, there was no difference in
buffer, 5X Q solution, dNTPs and enzyme mix. the levels of NR activities between light and
RNase inhibitor (4 units/reaction) was also added
dark conditions.
into the reaction mixture. Tubulin was used as a 60
housekeeping control. Cycling conditions were
50
optimised to give a linear relationship between
Specific Activity
the template used and product formed. Reverse 40

transcription and amplification of the genes were 30

done simultaneously as follows: (1)RT step (50 20

8C, 30 min, 1 cycle), (2) PCR activation step (95
10
8C, 15 min, 1 cycle), (3) three-step PCR cycling
for 30 cycles involving: (a) denaturation - 94 ºC, 0
0 20 40 60 80 100 120
30 s, (b) annealing - 58 ºC, 30 s, (c) extension - Conc. of Nitrate (mM)
72 ºC, 60 s and (4) final extension (72 ºC, 10 min,
1 cycle). PCR products were run on 2% agarose Figure 1: Effect of Nitrate Concentrations
gel and visualized under UV light after staining
on NR activity in Light.
with ethidium bromide.
Excised leaves were floated on different
Image analysis of RT-PCR products concentrations of KNO3 under white light.
The RT-PCR gels were photographed with a Tissue samples were collected at 6 hours
Canon G2 Digital Camera (Japan) using a yellow following nitrate treatments and processed
filter and gel images were downloaded on a for enzyme assay. The mean data from three
computer. A 100-bp ladder was used to identify different experiments are shown along with
the band size of the products. The intensity of the standard error bars.
bands was quantified using the image analysis 120

software of Scion Corporation, USA

(www.scioncorp.com). The numerical values 100

obtained for different treatments were plotted in

R elative Sp. A c. (% )

80
the form of Histogram.
60

Results 40

Nitrate induction
20

Effect of Nitrate Concentration

Excised leaves were floated on different 0
W (Light) W (Dark) PN (Light) PN (Dark)

concentrations of KNO3 (20-100 mM), with

 Research Dimensions January 2011

Figure 2: Effect of Nitrate on NR activity in Excised leaves were floated on 40 mM

Light and Dark. KNO3 in the dark and samples were collected
Excised leaves were floated on 40 mM KNO3 and frozen after every 12 hrs for 2 days. The
and samples were collected after 6 houra data presented in Table 1 shows that NR
processed for enzyme assays. The mean data activity reached a basal level at the end of 12
from three different experiments are shown hrs and remained at that level for the next 48
along with standard error bars. hrs. A dark-adaptation for 48 hrs was
W: Water PN: Potassium therefore used for further studies.
Nitrate (40 mM)
Table 1: Effect of duration of Nitrate Treatment on
Duration of Nitrate Treatment NR Activity in Dark.
Excised leaves were floated on 40 mM KNO3 (Concentration of Nitrate – 40 mM)
and samples were collected and frozen at
various intervals (0-10 hrs) for extraction and Duration of Specific activity
NR assays. The data presented in Fig. 3 Nitrate (nmoles
shows that incubation of leaves for 4-6 hrs Treatment nitrite/mg
gave maximum induction of NR by nitrate. (hrs.) protein/hr)
This duration of nitrate treatment was 0 hr 3.67
maintained for all subsequent experiments. 12 hrs (Dark) 6.79
12 hrs (Light) 29.7
60 24 hrs (Dark) 9.56
50 24 hrs (Light) 15.71
36 hrs (Dark) 7.97
Specific Activity

40
36 hrs (Light) 27.57
30 48 hrs (Dark) 6.84
48 hrs (Light) 33.9
20

10 Effect of Nitrate on NR mRNA in Light and

Dark
0
0 2 4 6 8 10 12
The effect of nitrate was checked on NR
Duration of Nitrate Treatment (hrs) transcript levels in light and the dark. As seen
from Figs. 4 (A, B & C), the steady state
Figure 3: Effect of Duration of Nitrate
level of NR mRNA showed a significant
Treatment on NR activity in Light.
increase in the presence of nitrate compared
Excised leaves were floated on 40 mM KNO3
to water treated leaves both in the light and
and samples were collected at 2 hour
dark. However there was no difference
intervals and processed for enzyme assays.
between the extent of induction in light and
The mean data from three different
dark (Figs. 4B & C).
experiments are shown along with standard
error bars.
 Research Dimensions January 2011

(A) Lane 1. Control

120 Lane 3. Control
Lane 2. KNO3 (40 mM)
100 Lane 4. KNO3 (40 mM)
)
%
(l
e Lane M. Marker
e80
v
L
t (B) & (C) – Image Analysis using Scion
ip
rc
s60
n
Image. Transcript level in the presence of 40
a
r
T
e
mM KNO3 was considered as 100% control.
v
tia40
le
R
20 Effect of Tungstate
0 Excised leaves were floated on 0.1 and 0.5
Contr ol Nitrate mM tungstate and combinations of tungstate
and potassium nitrate (40 mM) with controls
120 using distilled water and 40 mM KNO3. After
6 hrs, the leaves were frozen and processed
)
100 for extraction and enzyme assays. The data
%
(
le presented in Figure 5 show that tungstate
v 80
e
L inhibited NR activity by more than 80%. It
t
ip
rc 60 can be also seen from the data as low as 0.1
s
n
a
r
T
mM tungstate was sufficient for inhibition
e
v
it
40 and this did not increase with increasing the
la
e
R tungstate concentration (0.5 mM).
20

120
0
Control Nitrate
100
(B) (C)
R e la tiv e S p . A c . (% )

Figure 4: Effect of Nitrate on NR mRNA in 80

Light and Dark.

60
(A) – Agarose Gel Electrophoresis of RT-
PCR products from Total RNA isolated using
40
TRIZOL. The gels were stained with Ethidium
Bromide and photographed using Canon 20
Camera. Each experiment was carried out in
replicates. 0
W PN 0.1 mM T 0.5 mM T 0.1 mM T + 0.5 mM T +
Lane 1 & 2 – Light PN PN
Lane 3 & 4 – Dark

Figure 5: Effect of Tungstate on NR
activity.
Excised leaves from 11-day old rice seedlings
were floated on Tungstae (0.1 and 0.5 mM) in
combination with 40 mM KNO3 (PN) in the
light. Activity in the presence of 40 mM KNO3
was considered as 100% control. The mean
data from three different experiments are
shown as relative specific activity (%) along
with standard error bars.
PN – Potassium Nitrate (40 mM) W–
Water T - Tungstate (0.1 and 0.5mM)
Discussion
Nitrate reductase is one of the most studied
enzymes, since it is considered as a
controlling step in nitrate assimilation. It is a
structurally and functionally complex enzyme
and its regulation involves a number of
different processes. NR was isolated from
plant tissues by Evans and Nason as early as
1953. Since then a lot of studies have been
done and an impressive number of papers
devoted to its studies.
The fact that nitrate is required for the
induction of nitrate reductase in rice was first
demonstrated by Tang and Wu (1957). Since
then considerable progress has been made in
the understanding of physiology,
biochemistry and molecular biology of nitrate
assimilation in plants, fungi and algae. The
expression of the components of this
pathway, namely, nitrate transporters, nitrate
reductase and nitrite reductase, is known to
be regulated by the end products of nitrate
assimilation pathway in addition to
environmental signals like sugars, light, and
hormones (Sivasankar et al., 1997; Vincentz
et al., 1993). Although the biochemistry and
molecular biology of nitrate and nitrite
reduction are well documented, the regulation
of these processes at the levels of
transcription and enzyme activity are not
fully understood. Control of NR gene
Research Dimensions January 2011
transcription facilitates long-term responses
to the nitrate signal (hrs to days), whereas
post-translational regulation allows rapid
changes in NR activity (mins to hrs).
In the present study, attempts were
made to examine the induction of nitrate
assimilation enzymes by nitrate and light. As
there have been no reports on the regulation
of the enzymes of nitrate assimilation for this
variety of rice, O. sativa ssp indica var.
Panvel I, the first set of experiments was
carried out to standardize the induction
pattern, i.e., the amount of nitrate required
and the induction time for the optimum
activity of nitrate reductase. All the
experiments were carried out with excised
leaves as the major site of nitrate assimilation
is leaf in most of the crops.
From a range of potassium nitrate tested, 40
mM was found to be the optimum
concentration for the induction of the enzyme
in excised leaves. NR activity declined when
higher concentrations of nitrate were supplied
to the leaves. The exact reason for this
decline is not known but it may be due to
accumulation of inhibitory concentrations of
downstream metabolites.
NR activity was induced several fold
by nitrate in the presence of light whereas
only trace amounts were detected when the
induction was carried out in the dark using
dark-adapted leaves. When the leaves were
treated in the presence of light with 40 mM
nitrate for different time intervals (2-10 hrs),
optimum enzyme activity was obtained
between 4-6 hrs which began to decrease
after 6 hours. Several mechanisms may
contribute to this decline in the activity of
NR. These include a dramatic decrease of the
transcript level which commences soon after
illumination (Matt et al., 2001; Scheible et
al., 1997b, 2000) and results in a decline of
NR protein as well as activity during the
second part of the light period (Scheible et
al., 1997b) and post-translational inactivation

of NR in the dark (Kaiser and Huber, 1994;
MacKintosh, 1998; Scheible et al., 1997b).
As a result, the rate of nitrate reduction falls
several folds in the second part of the light
period, and is negligible during the night
(Matt et al., 2001). Changes of the cytosolic
NADH concentration might also affect in vivo
NR activity (Kaiser et al., 2000).
When plants are grown in day/night
conditions, the increase in total NR activity
during the first 3 h of the photoperiod
indicates that the translation of NR is
stimulated by light. The possibility that the
activity increased in the light due to higher
stability of the NR protein has previously
been ruled out for N. plumbaginifolia (Lillo et
al., 2003). Light stimulation of the
translational process is therefore the most
likely explanation.
It has been shown earlier that in plants grown
in light and in the presence of nitrate, the
levels of mRNA, proteins and NR and NiR
activities decreases slowly after 2 days in
darkness. When such plants are returned to
light, the mRNAs of NR and NiR are rapidly
reinduced to their maximum level after 4 to 6
hrs. This process is independent of
phytochrome (Faure et al., 2001). In the
present study NR activity reached to the basal
level after 12 hrs in darkness probably
because plants were not supplied with
nitrogen source as well as any other nutrient.
When nitrate was supplied to these dark-
adapted leaves in the presence of light, NR
and NiR activities increased to 20 and 3-fold
respectively.
A comparison of steady state NR
mRNA levels revealed statistically significant
increases in mRNA both in the light and dark.
The extent of increase in the mRNA level
(~40 %) in the presence of nitrate as
compared to water control was similar in
light and dark. However, when NR activities
were compared, it was found that difference
between water control and nitrate treated
Research Dimensions January 2011
leaves was much higher in the light than in
the dark. Besides, NR transcript was detected
from the dark-adapted leaves even in the
absence of nitrate and light under conditions
when no NR activity could be detected.
Hence it appears that though NR transcription
was not dependent on the presence of light,
NR activity was stimulated to a far greater
extent by light. It has been reported by other
groups of workers in other plants that light
and nitrate had cumulative effects on NR
mRNA levels (Vincentz et al., 1993).
However in the present study, it was observed
that light did not further enhance the NR
mRNA expression already induced by nitrate.
This difference can be attributed to the nitrate
starved conditions in which the rice seedlings
were grown. It appears that post-
transcriptional effect of light is a major factor
in controlling the level of NR. A similar kind
of NR regulation has been shown in N.
plumbaginifolia transgenic plants expressing
NR gene under the control of a constitutive
35S promoter (35S-NR) (Vincentz et al.,
1993). There was a significant reduction in
both protein and NR activity in the dark
whereas the level of mRNA remained
comparable to that observed for plants
exposed to light. Both protein level and NR
activity were reinduced totally when the
plants were reexposed to light and partially
when the plants remained in the dark and
received sucrose. This post-transcriptional
effect can be explained by modifications in
the capability of mRNA to be translated, in
the stability of protein, or in the inactivation
of the enzyme by phosphorylation.
Tungstate can be substituted for
molybdenum in the molybdenum cofactor of
nitrate reductase, resulting in inactive enzyme
(Deng et al., 1989). In the presence of
tungstate, NR protein is still synthesized, but
the NADH‐nitrate reducing activity is
defective. Since treatment of plants with
tungstate inhibits the formation of new active

NR, the decrease in NR activity in
tungstate‐treated plants reflects the actual rate
of NR degradation. This is a method of
studying NR degradation per se with no, or
little, interference from de novo synthesis of
the enzyme. Because of its broad biological
spectrum of action, tungstate may be used to
selectively prevent nitrate reduction. It will
be possible to examine the regulation of
nitrate uptake and of other steps of the nitrate
assimilation pathway in higher plants without
the complications introduced by the
functioning of the pathway. In the present
study rice NR decreased severely and reached
to almost level after 6 hrs of treatment with
tungstate. In another study when Nicotiana
tabacum plants were supplied with tungstate,
NR activity declined, whereas NR protein
accumulated. NR mRNA level normally
exhibited a day-night fluctuation; in tungstate
fed plants, this day-night fluctuation was
abolished and NR mRNA level remained
high (Deng et al., 1989). Lillo et al (2004)
has also reported that when plants were
treated with tungstate, NR activity decreased
almost as rapidly in light as in darkness.
There are very few reports in the literature
related to the studies on the nitrate
assimilation pathway in the rice. This plant
has been assumed to use ammonia preferably
as the nitrogen source. Therefore this study
was undertaken to understand the role of
nitrate and light in the regulation of nitrate
reductase in rice. It can be concluded from
the results presented in this paper that rice has
almost similar kinds of regulatory patterns
observed with other known nitrate
assimilating plants.
Reference
Aslam, M., Huffaker, R.C., Travis, R. L. 1973.
The interaction of respiration and photosynthesis
in induction of nitrate reductase activity. Plant
Physiol. 52: 137-141.
Research Dimensions January 2011
Bradford, M. M. 1976. A rapid and sensitive
method for the quantitation of microgram
quantities of proteins utilising the principle of
protein dye binding. Anal. Biochem. 72: 248-254.
Chomczynski, P., Sacchi, N. 1987. Single-step
method of RNA isolation by acid guanidium
thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 9: 167-172.
Deng, M. D., Moureaux, T., Caboche, M. 1989.
Tungstate, a molybdate analog inactivating nitrate
reductase, deregulates the expression of the
nitrate reductase structural gene. Plant Physiol.
91: 304-309.
Evans, H. J., Nason, A. 1953. Pyridine nucleotide
- nitrate reductase from extracts of higher plants.
Plant Physiol. 28: 233-254.
Faure, J. D., Meyer, C., Caboche, M. 2001.
Nitrate assimilation: nitrate and nitrite reductases.
In: Nitrogen assimilation by plants. (Morot-
Gaudry, J. F., Ed.). Science Publishers Inc.
Enfield. pp: 33–52.
Forde, B.G., Clarkson, D.T. 1999. Nitrate and
ammonium nutrition of plants: physiological and
molecular perspectives. Adv. Bot. Res. 30: 1–90.
Hageman, R.H., 1979. Integration of nitrogen
assimilation in relation to yield. In: Nitrogen
Assimilation of Plants. (Hewitt, E. J., Cutting,
C.V. Eds.). Academic Press, New York. pp: 591-
611.
Kaiser W. M., Huber, S. C. 1994.
Posttranslational regulation of nitrate reductase in
higher plants. Plant Physiol. 106: 817-821.
Kaiser, W. M., Kandlbinder, A., Stoimenova, M.,
Glaab, J. 2000. Discrepancy between nitrate
reduction rates in intact leaves and nitrate
reductase activity in leaf extracts: what limits
nitrate reduction in situ? Planta. 210: 801–807.
Lawlor, D. W., Gastal, F., Lemaire, G. 2001.
Nitrogen, plant growth and crop yield. In: Lea PJ,
Morot-Gaudry J-F, eds. Plant nitrogen. Berlin:
Springer-Verlag, 343–367.
Lillo, C., Lea, U. S., Leydecker, M.-T., Meyer, C.
2003. Mutation of the regulatory phosphorylation
site of tobacco nitrate reductase results in
constitutive activation of the enzyme in vivo and
nitrite accumulation. Plant J. 35: 566–573.
Lillo, C., Meyer, C., Lea, U. S., Provan, F.,
Oltedal, S. 2004
Mechanism and importance of post-translational
regulation of nitrate reductase
J. Exp. Bot. 55(401): 1275 - 1282.