David Liao

Mr. Zhang
Biology Section 2
3/7/11

Section 1
 Frederick Griffith
o British Officer
o Studied streptococcus pneumonia
o Smooth = virulent; Rough = harmless
 Used both strains for the experiment
o Showed that DNA was the one that affected bacteria
 Experiment 1: Injected R strain into mice, the Mice was unharmed
 Experiment 2: Injected
S strain into mice, the
Mice died
 Experiment 3: Injected
heat killed S strain and
the mice survived
 Experiment 4: Injected
live R strain with heat
killed R strain, the
mice died
 Griffith proposed that this was due to
Transformation
o Transfer of genetic material
from one cell to another cell
 Oswald Avery tried to find out
whether or not the thing that changed the bacteria exchanged DNA, RNA, or proteins
o They used enzymes to separate the DNA, RNA and proteins
o For each experiment, they followed Griffiths, but removed each factor to see
which still worked
o Cells without RNA and protein did not affect the mice
o Cells with DNA killed the mice
 Martha Chase and Hershey tested whether protein or DNA was the transferred hereditary
material for viruses
 o Used bacteriophages
 Used radioactive Phosphorus for one experiment and used Radioactive
Sulfur for another
 Allowed for infection in E. Coli
 Blended it to remove the phage coats
 Used centrifugation to find out that most of the radioactive DNA had
entered the cells

Section 2
 Watson & Crick
o Tried to determine the structure of DNA
o Made a model
o Used the x-ray photographs made by Rosalind Franklin
 DNA
o Made of two long strands of monomers
 Nucleotides
 Consists of Nitrogenous Base, 5-Carbon Sugar, and a phosphate
group
o Similar to a spiral staircase
o Bases form hydrogen bonds with each base
o Every one turn = 10 base pairs
o All bases are consistent in molecular structure
 Exists in 4 different bases
 Thymine
 Guanine
 Adenine
 Cytosine
o Purine = Adenine Guanine
o Pyrimidine = Thymine Cytosine

 Bases pair following specific rules
o Adenine makes hydrogen bonds with the complementary pair Thymine
o Cytosine makes hydrogen bonds with Guanine
 DNA models created are usually in a ladder shape
o First letter of each base pair is used in the notation
o ATAATATTATCCCGCGATACGATGAGCGAGT
o TATTATAATAGGGCGCTATGCTACTCGCTCT
Section 3

 DNA Replication

o Process by which DNA is copied in a cell

o Makes 2 identical double stranded DNA

 Steps of DNA Replication:

o Helicases separate DNA strands

 Creates a Y shaped region called replication fork

o DNA polymerase then adds complementary nucleotides floating inside the nucleus

o This is semi-conservative

 Each of the new DNA contains one or two of the original DNA strands

 DNA synthesis occurs in 2 directions

o DNA polymerase moves in one direction with the helicase on the leading strand

o DNA polymerase moves in the opposite direction on the lagging strand

 Gaps are filled by DNA ligase

  DNA Replication errors

o DNA replication is very accurate

o It has proofreading proteins

o Only makes mistakes every billion base pairs

 Mutations occur with the errors

 Mutations can be bad → Cancer

 Mutations can be good → Genetic Variation

Section 4

 Flow of genetic Information

o DNA → RNA → Phenotype

o Transcription

 DNA acts as
template for RNA
creation

o Translation

 RNA directs the

assembly of proteins

 Protein
Synthesis or
Gene
Expression

o RNA vs DNA

 RNA contains sugar

called ribose

 RNA contains nitrogenous base called Uracil

 RNA is usually single stranded

 RNA is shorter than DNA

o Types of RNA

 mRNA

 carries instructions to make protein

 rRNA

 part of the structure of ribosome

 tRNA

 transfers amino acids to ribosome to make proteins

o Steps of Transcription

 RNA polymerase catalyzes the formation of RNA on a DNA template

 A promoter is attached where RNA polymerase binds to

 RNA polymerase adds free RNA nucleotides

 RNA polymerase ends when it reaches a termination signal

 A specific sequence of nucleotides that marks the end of a gene

o Genetic Code

 Genetic code is the term for the rules that relate to how a sequence of
nitrogenous bases in a nucleotide corresponds to a particular amino acid

 3 nucleotides that encodes an amino acid

  AUG starts

 UAA UAG UGA are stop codons

 Translation

o Protein structure

 Every protein is made by one+ polypeptides

 20 different known amino acids

o Steps of Translation

 Two ribosomal subunits tRNA and mRNA join together

 Enzymes first attach a specific amino acid to one end of each tRNA

 The tRNA contains the anticodon

 Polypeptide chain is put together

 The tRNA carrying the appropriate amino acid pairs is anticodon with the
second codon in the mRNA

 The ribosome detaches the amino acid and forms a peptide bond with
the next amino acid

 Polypeptide chain grows until the ribosome reaches stop codon

 The polypeptide falls off

 Human Genome

o Entire sequence is around 3.2 billion base pairs

o Analysis may help prevent disorders cancers and infectious diseases in the future
