Vous êtes sur la page 1sur 14

3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Descargar Compartir Exportar


Revistas y libros Crear cuenta Iniciar sesión

Diario de los métodos virológicos


Volumen 260 , octubre de 2018 , páginas 82-87

Tecnología de secuenciación basada en Sanger para el control de calidad


genética de la vacuna contra la fiebre amarilla.
Cristiane Pinheiro Pestana , Rafael Lawson-Ferreira 1, Carolina Lessa-Aquino , María da Luz Fernandes Leal , Marcos da Silva Freire , Akira
Homma , Marco Alberto Medeiros
Mostrar más

https://doi.org/10.1016/j.jviromet.2018.07.006 Obtenga derechos y contenido

Reflejos
• Desarrollamos un sólido enfoque de secuenciación RT-PCR para el monitoreo
genético de la vacuna contra la FA.

• Todos los lotes de vacunas brasileñas tenían una identidad del 100% entre sí y con los
lotes de semillas.

• La detección de posiciones heterogéneos mostró una cuasiespecie diversidad de cepa


17DD.

• El método también se aplicó con éxito a las cepas de vacunas 17D-204 y 17D-213 .

Resumen
La fiebre amarilla (FA) es una enfermedad hemorrágica viral aguda que prevalece principalmente en África y
América, con una tasa de mortalidad del 20 al 60% en formas graves. Actualmente, los medicamentos antivirales
para la infección no están disponibles, lo que refuerza la importancia de la vacunación en poblaciones residentes y
viajeros. Fabricada en 7 países diferentes, la vacuna YF se creó por primera vez en 1937 y se utilizan dos sub-líneas
para la producción, 17DD y 17D-204. La vacuna producida en Bio-Manguinhos / Brasil utiliza la subtrofina 17DD
y se han exportado más de 160 millones de dosis a más de 74 países. La Organización Mundial de la Salud (OMS)
recomienda que los nuevos lotes de semillas y de trabajo tengan el genoma viral secuenciado para verificar la
estabilidad genética de la vacuna. El objetivo de este estudio fue desarrollar y estandarizar un protocolo de
secuenciación basado en Sanger para el monitoreo genético de la vacuna brasileña 17DD. Diseñamos 54 oligos
https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 1/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

para acceder al genoma completo de la vacuna YF mediante RT-PCR y enfoque de secuenciación. Después de la
Descargar
estandarización del protocolo, Compartir
probamos 45 lotes deExportar
vacunas y los lotes de semillas secundarios y de trabajo
correspondientes. Todos los 45 lotes presentaron una identidad de 100% de nucleótidos entre sí y con los lotes de
semillas. También detectamos 2 posiciones heterogéneas en los nucleótidos 4523 (C / T) y 6673 (C / T) que pueden
indicar una diversidad de quasispecies de la cepa YF 17DD. Cuando se comparó con la secuencia de GenBank de
Brasil YFU17066, la vacuna 17DD de Brasil presentó 6 mutaciones silenciosas. Al aplicar la metodología de
secuenciación a dos cepas YF 17D-204, demostramos que nuestro método también se puede usar para secuenciar
diferentes virus de la vacuna YF. En resumen, hemos desarrollado un método robusto para el monitoreo genético
de las vacunas contra la FA, que se ha aplicado con éxito en Bio-Manguinhos desde 2009 y que también podrían
ser utilizados por otros fabricantes para las vacunas basadas en la YF17D. No hubo variación genética en los lotes
probados de Brasil, lo que destaca la seguridad, la consistencia de la producción y, lo que es más importante, la
estabilidad genética de la vacuna contra la FA de Bio-Manguinhos en las últimas 3 décadas.

anterior Siguiente

Abreviaciones
YF, Fiebre amarilla; YFV, Virus de la fiebre amarilla

Palabras clave
Vacuna 17DD fiebre amarilla; Estabilidad genetica; Control de calidad

1 . Introducción
La fiebre amarilla (FA) es una enfermedad hemorrágica viral aguda endémica en las regiones tropicales y
subtropicales de África y América, que afecta principalmente a humanos y primates no humanos . El agente
etiológico es el virus de la fiebre amarilla(YFV, por sus siglas en inglés), un miembro prototípico de la
familiaFlaviviridae,que comprende aproximadamente 75 virus, en su mayoríaarbovirus , incluidos los agentes
causantes del dengue , la encefalitis japonesa , la fiebre del Nilo Occidental y la Zika ( Monath, 2012). . La
transmisión se produce a través de lapicadura delosmosquitos,en particular Aedes yHaemagogus.géneros (
Monath, 2001 ). La Organización Mundial de la Salud (OMS) estima que, en períodos sin epidemia, cada año se
producen 200,000 casos de fiebre aftosa con 30,000 muertes cada año. Aproximadamente, el 20–60% de las formas
graves de YF son fatales debido al shock hemorrágico resultante de la falla de múltiples órganos ( Monath y
Vasconcelos, 2015 ). No hay medicamentos antivirales aprobados para la infección por FA y la accesibilidad de las
vacunas es importante tanto para las poblaciones residentes como para los viajeros ( OMS, 2010 ).

Actualmente disponible de siete proveedores ( Monath, 2012 ), la vacuna 17D YF se derivó de la cepa de tipo salvaje
Asibi, aislada en 1927 en África Occidental de la sangre de un paciente de Ghana ( Lloyd et al., 1936 ). Se considera
una de las vacunas atenuadas más efectivas y más seguras jamás producidas: el 99% de los individuos desarrolla
anticuerpos neutralizantes 30 días después de la vacunación ( Domingo y Niedrig, 2009 ) y se identifican eventos
adversos graves neurotrópicos y viscerotrópicos raros, con 0.05–1.5 casos por 100.000 vacunaciones ( Monath,
2012). Dos subprocesos clave se utilizan para la producción de vacunas, 17DD y 17D-204, derivados de los pasajes
195 y 204, respectivamente, del virus 17D original. También se usa otro subfreno, 17D-213/77, derivado de 17D-

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 2/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

204, para la producción de vacunas. No hay diferencias significativas en la seguridad y la inmunogenicidad de


estas cepas de vacunas Descargar Compartir 2015Exportar
( Monath y Vasconcelos, ).

La vacuna producida en Brasil es fabricada por Bio-Manguinhos / Fiocruz y utiliza la subtrofina 17DD, mientras
que la vacuna 17D-204 se emplea en otros países. Desde su precalificación por la OMS en 2001, Bio-Manguinhos
ha desempeñado un papel importante en el escenario de salud pública en todo el mundo, no solo mediante la
exportación de la vacuna contra la fiebre aftosa a más de 74 países, sino también al satisfacer las demandas
mundiales de emergencia. En septiembre de 2012, Darfur (Sudán) se vio afectada por una epidemia de fiebre
aftosa que mató a 200 personas y recibió 2,2 millones de dosis de la vacuna Bio-Manguinhos YF. Un mes después,
nuestro instituto envió 6 millones de dosis a Costa de Marfil para apoyar su campaña de vacunación masiva (Bio-
manguinos, 2018). Un brote de FA afectó a Angola en 2015 y se notificaron casi 4306 casos sospechosos y 376
muertes ( Verde, 2016). Junto con los esfuerzos de varios países, la OMS proporcionó aproximadamente 19
millones de dosis de vacunas, de las cuales 5 millones fueron proporcionadas por Bio-Manguinhos.

Más recientemente, Bio-Manguinhos también hizo contribuciones fundamentales para el control de un selvático
brote de fiebre amarilla en el sureste de Brasil. Según el Ministerio de Salud de Brasil, a partir de diciembre el año
2016 al 23 de enero rd 2018 hubo 907 casos confirmados con 314 muertes. Con el fin de reforzar las estrategias de
vacunación, el gobierno brasileño distribuyó casi 30 millones de dosis de la vacuna 17DD de la fiebre amarilla de
Bio-Manguinhos durante este período. La vacuna se produce en embriones de pollo libres de patógenos
específicos y se ha utilizado un sistema de lote de semillas desde 1941 para garantizar la estabilidad genética y la
seguridad de los lotes de vacunas ( Post et al., 2001 ).

Las recomendaciones de la OMS para la producción y control de vacunas contra la FA se elaboraron por primera
vez en 1957. Desde la última revisión en 1995, todas las vacunas aprobadas para uso internacional deben
producirse de acuerdo con las buenas prácticas de fabricación y cumplir con los siguientes estándares básicos:
virus primario y secundario las semillas deben someterse a pruebas de detección de bacterias, hongos ,
micoplasmas y virus adventicios, y deben someterse a pruebas estándar de seguridad y de monos para determinar
su inmunogenicidad, viscerotropismo, neurotropismo (OMS, 2010). En 2009, un informe de la reunión del Grupo
de trabajo de la OMS sobre especificaciones técnicas para la fabricación y evaluación de vacunas contra la fiebre
amarilladestacó la importancia de determinar la secuencia genómica de lotes de semillas de vacunas y recomendó
encarecidamente que todos los lotes de semillas maestras y de trabajo deberían secuenciarse ( Ferguson et al., 2010
). En este contexto, el objetivo de este estudio fue establecer un enfoque de monitoreo genético mediante la
secuenciación del genoma de la vacuna 17DD de 10,862 kb, satisfaciendo las pautas requeridas y reforzando la
seguridad de la vacuna de YF producida por Bio-Manguinhos.

2 . materiales y métodos

2.1 . Lotes de vacunas contra la fiebre amarilla.


En este estudio, utilizamos el lote de semillas secundarias de Brasil: 102/84, el lote de semillas de trabajo:
993FB013Z y los lotes de vacunas producidos de 2000 a 2013 como se muestra en la Tabla 1 . También
secuenciamos otros dos virus de vacuna YF : de una vacuna 17D-204 disponible comercialmente utilizada en
Brasil y 17D-213/77 (un derivado 17D-204), proporcionada por la OMS a Bio-Manguinhos.

Tabla 1 . Descripción de las muestras de vacuna YF 17DD secuenciadas en este estudio.

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 3/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Mucho Año Dosis por SC /


Descargar Compartir Exportar productivo ampolla EP *
vial.

102/84 1984 Lote 285/42


secundario
de
semillas

993FB013Z 1999 Lote de 286/43


semillas
de trabajo

005FB003Z 2000 50 286/43

117VFA045Z 2011 5 287/44

127VFC034Z, 127VFC035Z, 127VFC045Z, 128VFC046Z, 128VFC047Z, 128VFC048Z, 2012 10 287/44


129VFC049Z, 129VFC050Z, 129VFC051Z, 129VFC052Z, 12OVFC053Z, 12OVFC054Z,
12OVFC055Z, 12OVFC056Z, 12OVFC058Z, 12OVFC059Z, 12OVFC060Z, 12OVFC062Z,
12OVFC063Z, 12OVFC064Z, 12OVFC066Z, 12OVFC067Z, 12OVFC068Z, 12OVFC069Z,
12OVFC070Z, 12OVFC072Z, 12OVFC074Z

133VFA013Z, 134VFA014Z, 134VFA015Z, 134VFA016Z, 134VFA017Z, 135VFA018Z, 2013 5 287/44


136VFA020Z, 136VFA022Z, 137VFA023z, 137VFAVVVVVVV1VFA025Z, 137VFA023Z,
137VFAV24VVVV1VFA024Z, 137VFA025Z, 137VFA026Z, 137VFA023z, 137VFAV

*
SC: subcultura; EP: pasaje de huevos.

2.2 . Diseño de imprimación


Los cebadores se diseñaron según la secuencia de la plantilla YFU17066_17DD ( dos Santos et al., 1995 , código de
acceso de GenBank : U17066.1 ). Se utilizaron los programas Primer Select v5.05 (DNAStar Inc.) y Primer3web (
Untergasser, 2012 ) para el diseño genérico de cebadores. Los oligos generados para los primeros 1–30 nucleótidos
y luego para cada intervalo de 600 pb se seleccionaron y se analizaron para determinar la presencia de estructuras
de horquilla y palíndromos con el software Vector NTI v8 (Invitrogen). Se priorizaron los oligos con G o C en el
extremo 3 '. La temperatura de fusión se evaluó con OligoAnalyzer Tool v3.1 (IDT) y solo se seleccionaron
cebadores con Tm entre 57 ° C y 63 ° C.

2.3 . Síntesis de cDNA y amplificación por PCR.


Los viales de vacuna liofilizados se abrieron en gabinetes de bioseguridad y se resuspendieron en 2,5 (ampolla de
10 dosis) o 1,5 ml (ampolla de 5 dosis) de agua tratada con DEPC (Life Technologies) para la extracción de ARN . El
ARN viral se extrajo de 140 µl de suspensión de vacuna con QIAamp Viral RNA Kit (Qiagen) de acuerdo con las
instrucciones del fabricante. La síntesis de cDNA y la PCR se realizaron con 1 μL de RNA viral y 0.2 μM de cada
cebador, utilizando el kit de qRT-PCR SuperScript III Platinum One Step (Life Technologies) con los siguientes
ciclos: 55 ° C-30 min, 94 ° C 2 min, 40 ciclos de 94 ° C-15seg, 55 ° C-30seg, 68 ° C-3 min y una extensión final de 68
° C-7 min. Los pares de cebadores utilizados se ilustran en laFig. 1 . Todos los productos de PCR se analizaron en
gel de agarosa al 1%.luego purificado con el kit de purificación PCR PureLink (Life Technologies). Los amplicones

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 4/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

purificados se cuantificaron con elkit de ensayodsDNAQubitDNA HS (Life Technologies) antes dela secuenciación
del ADN. Descargar Compartir Exportar

Descargar imagen de alta resolución (138KB) Descargar imagen a tamaño completo

Fig. 1 . Representación esquemática de la estrategia de secuenciación RT-PCR. Los amplicones 1–9 están
numerados y se muestran en barras grises, con el par correspondiente de cebadores mostrados en flechas.
Las líneas discontinuas indican la región amplificada en el genoma de YFV. Los amplicones tienen una
superposición de al menos 130 pb en ambos extremos, a excepción de los amplicones 1 y 9, que
corresponden a los extremos del genoma 5 'y 3'.

2.4 . Secuenciación y alineamientos de secuencias.


Los productos de PCR se secuenciaron mediante el método de Sanger ( Sanger et al., 1977 ) con el kit de
secuenciación de ciclos Big Dye Terminator v3.1 (Life Technologies) en reacciones de 10 μL y se purificaron
mediante precipitación con etanol / EDTA , según lo descrito por el fabricante. Las reacciones LF3_R y LF53_F se
realizaron por triplicado y LF1_F y LF54_R por duplicado para garantizar una cobertura completa de las regiones
UTR 5 'y 3' . Las reacciones se ejecutaron en el Analizador Genético 3500XL (Applied Biosystems), que atribuye
valores de calidad (QV) a cada base de ADN generada . Para el análisis de datos en nuestro laboratorio, solo se
consideran las bases con QV por encima de 20 (<1% de probabilidad de que la base sea incorrecta). Todo en
silicoLos análisis se realizaron con el software DNASTAR v5.05. Para este estudio, solo se consideraron las
secuencias de consenso obtenidas de ambas cadenas de ADN en más del 95% del genoma viral .

3 . Resultados
La estrategia utilizada aquí para el diseño de cebadores generó 54 oligos, que cubren ambas cadenas del genoma
completo de YF, con intervalos de b600 pb. La justificación inicial fue amplificar 13 productos que iban de 800 a
1200 pb y un producto adicional de ∼500 pb. Todos los productos se secuenciarían con los oligos utilizados para
la PCR y 2 cebadores internos, excepto el más pequeño, que no necesitaba cebadores internos. Sin embargo,
algunos PCR no amplificaron y otros presentaron amplificaciones inespecíficas sustanciales. La estrategia se
ajustó luego a 9 fragmentos que iban de 500 pb a 2.0 kb, como se muestra en la Fig. 1 . En la Fig. 2 se muestran
todos los lotes de vacunas probados utilizados que presentan perfiles de amplificación similares y 3 lotes
representativos . Los cebadores utilizados para la secuenciación de los 9 fragmentos se describen en la Tabla 2.

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 5/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Descargar Compartir Exportar

Descargar imagen de alta resolución (628KB) Descargar imagen a tamaño completo

Fig. 2 . Amplificación por RT-PCR de 3 lotes de vacunas YF representativos. Geles de agarosa de reacciones
de control negativo (arriba) y 9 amplicones obtenidos de 3 lotes de vacunas (abajo). Las bandas de tamaño
de 1 kb de escalera de ADN (Invitrogen) se muestran en pb en el gel superior.

Tabla 2 . Lista de oligos diseñados para el enfoque de monitoreo genético de la vacuna YF.

Primer ID Posición del genoma YF Secuencia 5'- 3 ' Amplicon

comienzo Fin

RG66_20 1 20 AGTAAATCCTGTGTGCTAAT 1

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 6/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Primer ID Posición del genoma YF Secuencia 5'- 3 ' Amplicon


Descargar Compartir Exportar
comienzo Fin

LF1_F 1 25 AGTAAATCCTGTGTGCTAATTGAGG 1

LF2_F 459 479 GAATGCTGTTGATGACGGGTG 1

LF3_R 459 479 CACCCGTCATCAACAGCATTC 1

LF4_R 939 958 AACAGCCAAGACCAGTAGGG 1

LF5_F 810 830 CTGGAAGAATGGGTGAAAGGC 1

LF6_F 1220 1239 GCTGAAGAGAACGAAGGGGA 1

LF7_R 1220 1239 TCCCCTTCGTTCTCTTCAGC 1

LF8_R 1754 1776 GTGTCCTTTGTAACCCTCATTGC 1

LF9_F 1638 1654 GCGGGGTGTGGAGAGAG 2

LF10_F 2242 2261 TGGAGGGTTCTTCACTTCGG 2

LF11_R 2242 2261 CCGAAGTGAAGAACCCTCCA 2

LF12_R 2653 2670 TCTGCCCTGCTTCTCCAC 2

LF13_F 2304 2323 GGCTATTTGGCGGCTTGAAC 2

LF14_F 2912 2933 CAGATAGAGGAGTTTGGGACGG 2

LF15_R 2912 2933 CCGTCCCAAACTCCTCTATCTG 2

LF16_R 3522 3542 TCACCAAACCAAAAGGGACAG 2

LF17_F 3132 3155 CACTGACACATACGATTGGAACAT 3

LF18_F 3700 3720 GATGAACAATGGAGGAGACGC 3

LF19_R 3700 3720 GCGTCTCCTCCATTGTTCATC 3

LF20_R 4095 4116 AGGTAAGATGTGAGTGTGAGGG 3

RG56 4270 4287 CTCCAACTGCAATCGGAC 3

LF21_F 4011 4028 TGCTCTTTTGTGCCGTGG 4

LF22_F 4502 4520 GCCCTCCATCCATTTGCTC 4

LF23_R 4502 4520 GAGCAAATGGATGGAGGGC 4

LF24_R 5007 5024 GCCCAATCACCTCTCCGT 4

RG183 5054 5072 GGCGGACACGAAGGAGTTG 4

LF25_F 4835 4853 GGCAGATGGGATGGAGAGG 5

LF26_F 5313 5331 ACACACAGGCTTTTTCCGC 5

LF27_R 5313 5331 GCGGAAAAAGCCTGTGTGT 5

LF28_R 5887 5906 CCACCTTCCTCCCTTCATCC 5

LF29_F 5754 5777 TTGAGAGAGAATACCCCACGATAA 5

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 7/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Primer ID Posición del genoma YF Secuencia 5'- 3 ' Amplicon


Descargar Compartir Exportar
comienzo Fin

LF30_F 6141 6163 CTGGTGAAATGAGACTGAGGGAT 5

LF31_R 6141 6163 ATCCCTCAGTCTCATTTCACCAG 5

LF32_R 6731 6748 GTGAGTGGGTTTTGACGCC 5

LF33_F 6298 6320 CTTGAATGACAGCGGTGAAACAG 6

LF34_F 6955 6973 TGCTTCACCCTGGAGTTGG 6

LF35_R 6955 6973 CCAACTCCAGGGTGAAGCA 6

LF36_R 7569 7587 GCATAGTGATTCCCCCGCA 6

LF37_F 7098 7115 CCCAGTCAGCCTCAGTCC 6

LF38_F 7750 7764 TACGGCACGCAGGCA 6

LF39_R 7750 7764 TGCCTGCGTGCCGTA 6

LF40N_R 8339 8356 CAGGAGGCGGGATGTTTG 6

LF41_F 8079 8101 GAGAGTCATCATCGTCATCGGTC 7

LF42_F 8466 8489 CCATAGAAGAAAGGGTTGAGAGGA 7

LF43_R 8466 8489 TCCTCTCAACCCTTTCTTCTATGG 7

RG187 8849 8869 CCAATGGCTGCATGACTTCGG 7

LF44_R 8932 8952 TCTTCATCCACCAGTTCCCAG 8

LF45_F 8662 8681 GGCAATGACTGACACAACCC 8

LF46_F 9238 9254 TGACACCGCTGGATGGG 8

LF47_R 9238 9254 CCCATCCAGCGGTGTCA 8

LF48_R 9801 9820 AATCCTCCTGCCATCCTTCA 8

LF49_F 9617 9633 AGGATGGCGGTGAGTGG 8

LF50_F 10229 10251 TCCCACATCCATTTAGTCATCCA 8

LF51_R 10229 10251 TGGATGACTAAATGGATGTGGGA 8

LF52_R 10643 10664 CCGTTCTTTTTACTCTGGGGTG 8

LF53_F 10354 10378 AAACACCATCTAACAGGAATAACCG 9

LF54_R 10840 10862 AGTGGTTTTGTGTTTGTCATCCA 9

Con el fin de minimizar la pérdida de secuencia inicial de los cebadores y asegurar una cobertura satisfactoria,
todos los amplicones tuvieron al menos 130 pb superpuestos con los fragmentos adyacentes, excepto los
amplicones 1 y 9, que correspondían a los extremos 5 'y 3' del genoma de YF, respectivamente. La secuenciación de
los extremos 5 'y 3' de un cDNA lineal en ambas cadenas es una limitación que generalmente se resuelve al
secuenciar una de las cadenas en múltiples repeticiones. Aquí, realizamos las reacciones de LF3_R y LF53_F por

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 8/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

triplicado y LF1_F y LF54_R por duplicado y obtuvimos una cobertura promedio de 98.94% en ambas cadenas y
Descargar
1.03% en una sola cadena para todos Compartir Exportar
los lotes probados.

Todos los 45 lotes de vacunas brasileñas presentaron una identidad del 100% entre sí y también con los lotes de
semillas secundarios y de trabajo, lo que fortaleció la estabilidad genética de la vacuna Bio-Manguinhos YF. Dos
posiciones heterogéneas ( Fig. 3 ), en los nucleótidos 4523 (C / T) y 6673 (C / T), fueron identificadas
consistentemente en todos los lotes analizados. Sin embargo, en ambos casos, el interruptor C / T no cambiaría el
aminoácido en la poliproteína viral . Comparando nuestros resultados con la secuencia 17DD YFU17066 ,
depositada en GenBank con el número de acceso U17066.1 , identificamos 5 mutaciones silenciosas en las
siguientes posiciones: 2110 (A / G), 2356 (T / C), 2677 (C / T), 5362 (A / C), 10,243 (A / G) y 3 ′ UTR 10,367 (C / T).

Descargar imagen de alta resolución (105KB) Descargar imagen a tamaño completo

Fig. 3 . Posición heterogénea en lotes de vacunas brasileñas de YF. El electroferograma representativo del
lote de semillas en funcionamiento 993FB013Z en la posición 6662–6679 muestra la heterogeneidad C / T
en la posición 6673 (flecha roja) (Para la interpretación de las referencias al color en esta figura, se remite al
lector a la versión web de este artículo ).

También aplicamos nuestro protocolo de secuenciación RT-PCR Sanger a diferentes virus de vacuna YF , por
ejemplo, YF 17D-204 e YF 17D-213/77 y amplificamos con éxito los 9 productos de PCR de ambas cepas ( Fig. 4 ).
Presentaron una identidad del 100% con las secuencias publicadas anteriormente ( Stock et al., 2012 ) y tuvieron
una cobertura promedio de 98.7% en ambas cadenas y 1.3% en una sola línea.

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 9/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Descargar Compartir Exportar

Descargar imagen de alta resolución (366KB) Descargar imagen a tamaño completo

Fig. 4 . Amplificación por RT-PCR de subrelaciones 17D-204 y 17D-213/77. Los geles de agarosa de los 9
amplicones obtenidos de YF 17D-213/77 (arriba) y YF 17D-204 (abajo) Tamaño de las bandas de la escalera
de ADN de 1 kb (Invitrogen) se muestran en pb en la parte superior del gel.

4 . Discusión
El virus de la vacuna Bio-Manguinhos YF se propaga en embriones de pollo y luego se purifica antes de
embotellar en viales de 5, 10 o 50 dosis. Incluso después de la purificación , las dosis de vacunas pueden contener
trazas variables de componentes de embriones de pollo, como el ácido nucleico y las proteínas. Dado que el kit
comercial utilizado para la extracción de ARN no está diseñado para separar el ARN viral del celular, es posible
que una proporción sustancial de la plantillaEl ARN utilizado en nuestro protocolo de RT-PCR correspondió a
material no viral. Por esta razón, no encontramos necesario cuantificar el ARN de la plantilla antes de la
amplificación. Además, la potencia de la vacuna de Bio-Manguinhos varía, con un límite de potencia mínimo de
3.0 log10 UI (Unidad Internacional), según lo establecido por la OMS ( OMS, 2010 ). Por lo tanto, aunque no se
cuantificó, el ARN viral extraído correspondió a no menos de 10 3 UI.

Aquí, optamos por eliminar la amplificación no específica mediante la adaptación de la estrategia al uso de
diferentes pares de cebadores, lo que nos llevó a obtener productos de PCR más grandes. Alternativamente,
podríamos haber probado diferentes aditivos como glicerol, DMSO y detergentes no iónicos , que generalmente
mejoran la especificidad y la eficiencia ( Varadaraj y Skinner, 1994 ). Como la amplificación inespecífica restante
no afectó la reacción o el análisis de secuenciación y el uso de aditivos no solo representa un costo adicional, sino
también variables adicionales en la reacción de PCR, no se realizó ninguna optimización adicional. Por lo tanto, el

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 10/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

protocolo de secuenciación RT-PCR presentado aquí demostró ser un método rápido y consistente para
Descargar
monitorear la variabilidad genética deCompartir Exportar
la vacuna Bio-Manguinhos YF 17DD.

Hasta la fecha, pocos estudios han dilucidado el genoma completo de las cepas de la vacuna contra la fiebre
amarilla 17D utilizando una metodología similar ( Moulin et al., 2013 ; Li et al., 2009 ; Pugachev et al., 2002 ). Stock
et al. (2012) , en un estudio más completo, han utilizado un enfoque de 20 amplicones para la secuenciación de
varias cepas 17D-204, que son utilizadas por todos los fabricantes globales, excepto Brasil. Sin embargo, estos
estudios compararon un pequeño número de virus o se enfocaron en la filogenia para obtener la historia evolutiva
de la vacuna contra la YF. Ninguno de ellos se centró en confirmar la identidad y la consistencia de la producción
de la vacuna. En este contexto, Barban et al. (2007)aplicó un conjunto de 12 reacciones de RT-PCR superpuestas
para analizar diferentes bultos de vacuna 17D-204 producidos durante 12 años para demostrar la estabilidad
genética de la cepa . Sin embargo, nuestro método utiliza solo 9 amplicones y se aplicó con éxito a la
secuenciación no solo de las cepas YF 17D, sino también del virus 17DD de 3 décadas de producción a gran escala
.

Los 45 virus de la vacuna 17DD analizados en este estudio presentaron un 100% de identidad de nucleótidos en
comparación con el virus del lote de semillas. El análisis genético de estos lotes YF Brazilian 17DD refuerza que
nuestra vacuna es segura y tiene una alta estabilidad genética durante el proceso de producción. Las 2 posiciones
heterogéneas en los nucleótidos 4523 (C / T) y 6673 (C / T) en la vacuna brasileña pueden representar la presencia
de diferentes poblaciones virales en la vacuna YF. Todas las vacunas vivas atenuadas en uso hoy en día se derivaron
empíricamente y, por lo tanto, su producción nunca involucró la purificación del clon viral de la vacuna. Por lo
tanto, se presume que la vacuna contiene quasispecies , una población altamente diversa de genotipos relacionados
que se generan duranteReplicación viral como resultado de la alta tasa de mutación de las ARN polimerasas
virales.

Hasta hace poco, la única forma de acceder a la diversidad genética de una población viral era mediante la
clonación de cADN de virus individuales, seguidos de la secuenciación capilar de Sanger . Sin embargo, esta es
una técnica costosa, laboriosa y que requiere mucho tiempo y el número de clones secuenciados es limitado, lo
que da como resultado la recuperación de una pequeña fracción de las variantes de quasispecies completas (
Beerenwinkel y Zagordi, 2011).). Aunque la secuenciación directa de Sanger de los amplicones de RT-PCR no
puede inferir fácilmente mutaciones de baja frecuencia, pudimos encontrar cierta diversidad poblacional
probablemente porque eran variantes de alta frecuencia. Sin embargo, la limitación de la secuenciación de Sanger
se puede superar mediante una secuenciación ultradápida y los próximos estudios deben aplicar tecnologías de
próxima generación (NGS) para investigar más a fondo el perfil de la especie de la vacuna 17DD . Además, cuando
analizamos un nuevo lote de trabajo de NGS y confirmamos su identidad con la semilla correspondiente, es
probable que los resultados de las nuevas pruebas de neurovirulencia por lotes también sean similares. Así, otra
perspectiva práctica de aplicar la secuenciación de próxima generación.Las técnicas podrían ser abrir los
precedentes para la reducción de las pruebas en animales disminuyendo los ensayos de neurovirulencia en
primates no humanos .

En resumen, describimos un protocolo práctico y eficaz para monitorear la estabilidad genética de la vacuna YF
17DD durante la producción de lotes de semilla y de trabajo. El protocolo se ha aplicado con éxito en el control de
calidad genética de la vacuna Bio-Manguinhos 17DD YF desde 2009, cumpliendo así las recomendaciones de la
OMS para la producción de la vacuna YF. Más recientemente, nuestro grupo también ha aplicado de manera
efectiva esta metodología en muestras de vacunados que tuvieron un evento adverso grave para verificar la
reversión viral (no se muestran los datos). Reafirmamos la importancia de verificar la secuencia del genoma de la
vacuna YF junto con los requisitos existentes y creemos que ya no es una recomendación, sino un paso obligatorio
en la producción de la vacuna YF en un futuro próximo.

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 11/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Fondos
Descargar Compartir Exportar
Esta investigación no recibió ninguna subvención específica de agencias de financiamiento en los sectores
público, comercial o sin fines de lucro.

Artículos recomendados Citando artículos (0)

Referencias
Barban et al., 2007 V. Barban , Y. Girerd , M. Aguirre , S. Gulia , F. Pétiard , P. Riou , B. Barrere , J. Lang
Alta estabilidad de la vacuna contra la fiebre amarilla 17D-204: un análisis retrospectivo de 12 años de
producción a escala
Vaccine , 25 ( abril ) ( 2007 ) , pp. 2941 - 2950
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Beerenwinkel y Zagordi, 2011 N. Beerenwinkel , O. Zagordi Secuenciación


ultra profunda para el análisis de poblaciones virales
Curr. Opin. Virol , 1 ( noviembre (5) ) ( 2011 ) , pp. 413 - 418
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Domingo y Niedrig, 2009 C. Domingo , M. Niedrig


Seguridad de las vacunas contra la fiebre amarilla derivadas de la 17D
Opinión de los expertos. Drug Saf. , 8 ( marzo (2) ) ( 2009 ) , pp. 211 - 221
Ver registro de CrossRef en Scopus Google Scholar

dos santos et al., 1995 CN dos Santos , PR Post , R. Carvalho , II Ferreira , CM Rice , R. Galler
Secuencia de nucleótidos completa de las cepas de vacuna del virus de la fiebre amarilla 17DD y 17D-213
Virus Res. , 35 ( enero ) ( 1995 ) , pp. 35 - 41.
Google Académico

Ferguson et al., 2010 M. Ferguson , J. Shin , I. Knezevic , P. Minor , A. Barrett , Grupo de


trabajo de la OMS del
Grupo WW
sobre especificaciones técnicas para la fabricación y evaluación de vacunas contra la fiebre amarilla,
Ginebra, Suiza, 13–14 de mayo de 2009
Vaccine , 28 ( December (52) ) ( 2010 ) , pp. 8236 - 8245
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Verde, 2016 A.
La fiebre amarilla
verde
continúa propagándose en Angola
Lancet , 387 ( junio (10037) ) ( 2016 ) , pág. 2493
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Li et al., 2009 J.1 Li , YX Yu , GM Dong


. Análisis de secuencias completadas en la cepa de vacuna 17D atenuada de fiebre amarilla china y la cepa
de vacuna 17D de fiebre amarilla estándar de la OMS.
Zhongguo Yi Miao He Mian Yi , 15 ( 2 de abril ) ( 2009 ) , pp. 145 - 151

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 12/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Ver registro en Scopus Google Scholar


Descargar Compartir Exportar
Lloyd et al., 1936 W. Lloyd , M. Theiler , NI Ricci
Modificación de la virulencia del virus de la fiebre amarilla mediante el cultivo en tejidos in vitro
Trans. R. Soc. Trop. Medicina. Hyg. , 29 ( febrero ) ( 1936 ) , pp. 481 - 529
Artículo Descargar PDF CrossRef View Record en Scopus Google Scholar

Monath, 2001 TP Monath


Fiebre amarilla: una actualización
Lanceta Infect. Dis. , 1 ( agosto (1) ) ( 2001 ) , pp. 11 - 20
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Monath, 2012 TP Monath


Revisión de los riesgos y beneficios de la vacunación contra la fiebre amarilla, incluidos algunos análisis
nuevos
Perito Rev. Vacc. , 11 ( abril (4) ) ( 2012 ) , pp. 427 - 448
Ver registro de CrossRef en Scopus Google Scholar

Monath y Vasconcelos, 2015 TP Monath , PF Vasconcelos


Fiebre Amarilla
J. Clin. Virol , 64 ( marzo ) ( 2015 ) , pp. 160 - 173.
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Moulin et al., 2013 JC Moulin , J. Sivano , V. Barban , P. Riou , C.


Vacuna contra la fiebre amarilla de
Allain
: comparación de la neurovirulencia de los nuevos lotes de semillas de Stamaril 17D-204 y la cepa RK 168-
73
Bilogicals , 41 ( abril ) ( 2013 ) , pp. 238 - 246
Artículo Descargar PDF Ver registro en Scopus Google Scholar

Post et al., 2001 P. Post, R.R. Carvalho, M.S. Freire, R. Galler


The early use of yellow fever virus strain 17D for vaccine production in Brazil--a review
Mem. Inst. Oswaldo Cruz, 96 (August (6)) (2001), pp. 849-857
CrossRef View Record in Scopus Google Scholar

Pugachev et al., 2002 K.V. Pugachev, S.W. Ocran, F. Guirakhoo, D. Furby, T.P. Monath
Heterogeneous nature of the genome of the ARILVAX yellow fever 17D vaccine revealed by consensus
sequencing
Vaccine, 20 (January) (2002), pp. 996-999
Article Download PDF View Record in Scopus Google Scholar

Sanger et al., 1977 F. Sanger, S. Nicklen, A.R. Coulson


DNA sequencing with chain-terminating inhibitors
Proc. Natl. Acad. Sci. U. S. A., 74 (December (12)) (1977), pp. 5463-5467
CrossRef View Record in Scopus Google Scholar

Stock et al., 2012 N.K. Stock, N. Boschetti, C. Herzog, M.S. Appelhans, M. Niedrig
The phylogeny of yellow fever virus 17D vaccines
Vaccine, 30 (February) (2012), pp. 989-994
https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 13/14
3/4/2019 Tecnología de secuenciación basada en Sanger para el control de calidad genética de la vacuna contra la fiebre amarilla - ScienceDirect

Article Download PDF View Record in Scopus Google Scholar


Descargar Compartir Exportar
Untergasser, 2012 A. Untergasser
Primer3--new capabilities and interfaces
Nucleic Acids Res., 40 (August (15)) (2012), p. e115
CrossRef View Record in Scopus Google Scholar

Varadaraj and Skinner, 1994 K. Varadaraj, D.M. Skinner


Denaturants or cosolvents improve the specificity of PCR amplification of a G + C-rich DNA using
genetically engineered DNA polymerases
Gene, 140 (March (1)) (1994), pp. 1-5
Article Download PDF View Record in Scopus Google Scholar

WHO, 2010 WHO


World Health Organization, Recommendations to Assure the Quality, Safety and Efficacy of Live
Attenuated Yellow Fever Vaccines, TRS872
WHO, Geneva (2010), pp. 1-73
View Record in Scopus Google Scholar

1
Permanent address: Fiocruz, National Institute for Quality Control in Health, Brazilian Ministry of Health, Avenida Brasil 4365,
Manguinhos, Rio de Janeiro, RJ 21040-900, Brazil.

© 2018 Elsevier BV Todos los derechos reservados.

Acerca de ScienceDirect Acceso remoto Carrito de compras Anunciar Contacto y soporte Términos y Condiciones
Política de privacidad

Utilizamos cookies para ayudar a proporcionar y mejorar nuestro servicio y adaptar el contenido y los anuncios. Al
continuar aceptas el uso de cookies .
Copyright © 2019 Elsevier BV o sus licenciantes o colaboradores. ScienceDirect ® es una marca registrada de Elsevier
BV

https://www.sciencedirect.com/science/article/pii/S0166093418301514?via%3Dihub#kwd0005 14/14