Vous êtes sur la page 1sur 56

Novembre 2009

La transgenèse végétale

Patrice Crété
Laboratoire de Génétique et de Biophysique des plantes
UMR6191,Faculté des Sciences de Luminy
crete@luminy.univ-mrs.fr
la transgenèse végétale 1

Biotechnologie

Ensemble de techniques biologiques, provenant de la recherche fondamentale,


qui sont appliquées à la recherche et au développement de produits.

La biotechnologie recouvre l'emploi de l'ADN recombinant, la fusion cellulaire


et les nouveaux procédés biotechnologiques.

La biotechnologie végétale est un domaine précis dans lequel des techniques


scientifiques servent à mettre au point de nouvelles variétés de plante.
la transgenèse végétale 2

Objectifs de la biotechnologie végétale

* Modifier le génotype d’une plante

-introduire un nouveau caractère


-supprimer un caractère préexistant

* Produire de la biomasse

cellules, tissus, organes, plantes

- Utilisations variables: bio production, multiplication

La plupart des expériences de transgenèse végétale nécessite la culture in vitro


la transgenèse végétale 3

La culture in vitro

1756: Henri Duhamel du Monceau, des bourgeons apparaissent entre le


bois et le cortex quand on enlève l’écorce

1839: Scleiden et Schwann: La théorie cellulaire: la cellule végétale est


capable d’autonomie et est totipotente

Totipotence: aptitude de la cellule végétale à exprimer la totalité des potentialités du génome pour
donner un organisme entier

Cette totipotentialité cellulaire s'accompagne d'une possibilité de multiplication indéfinie que l'on
peut observer dans les zones de croissance de la plante : les méristèmes, cellules restant dans un
état de dédifférenciation permanent.
la transgenèse végétale 4

La culture in vitro : les explants

Mise au point de la culture in vitro à partir :

- d’explant avec cellule méristématique (non différenciée, juvénile)

- de tout type de tissus sans cellule méristématiques ( dédifférenciation-redifférenciation)


Enchaînement de mitoses donne - une callogenèse

- une organogenèse

- une embryogenèse somatique


la transgenèse végétale 5

La culture in vitro : les régulateurs de croissance

Les AUXINES
dérive d’un acide aminé: le tryptophane, exp: l’acide indole acétique

tryptophane AIA
(photosensible)

Stimulation de l'élongation cellulaire, la division cellulaire et de l’organogenèse


(rhyzogenèse).
La synthèse de l'auxine s'effectue dans les apex des tiges, dans les méristèmes et dans les
jeunes feuilles des bourgeons terminaux.

Le transport de l'auxine s'effectue de façon polarisée, de l'apex vers la base dans la tige.
la transgenèse végétale 6

LES CYTOKININES

Dérivent d’une base de l’ADN: l’adénosine

Stimule la division cellulaire (nom en relation avec cytokinèse ) et


l’organogenèse (caulogenèse: bourgeon)

Synthèse dans les racines puis migrent dans la plante via la sève brute
la transgenèse végétale 7

Rôle des auxines et des cytokinines dans l’organogenèse


Le rapport auxines / cytokinines détermine le devenir des tissus en culture

En concentrations égales->division de cellules indifférenciées, callogenèse


Auxine -> formation de racines
Cytokinines -> bourgeons

Indole Butyric
Acid (IBA)
La transgenèse végétale
la transgenèse végétale 8

Certaines bactéries infectent les cellules végétales et provoquent


des tumeurs ou proliférations cellulaires chez les plantes infectées

La galle du collet (crown gall ou « cancer des plantes » )

Viticulture, sylviculture  problèmes


la transgenèse végétale 9

Propriétés des cellules de la tumeurs

Braun montre en 1943 que les cellules de la tumeur peuvent se multiplier


indéfiniment en absence de bactéries et en absence de substances de croissance
(auxines, cytokinines ).

Prélèvement de cellules Productions de cals


de la tumeurs et mise en
culture in vitro en absence
d’auxines et de cytokinines
la transgenèse végétale 10

Braun montre en 1943 que la tumeur peut croître indéfiniment en absence de


bactéries puis en absence de substances de croissance (auxines, cytokinines ).

2) Croissance indépendante d’ajout d’hormones


la transgenèse végétale 11
Organisation du plasmide Ti (Tumor inducing)
Les agrobactéries hébergent de très grands plasmides nécessaires à la formation des
tumeurs

ADN circulaire extrachromosomique, autonomie de réplication, plusieurs exemplaires/Cel

A. Tumefaciens -> plasmide Ti

Bordures, séquences consensus


la transgenèse végétale 12

Les plasmides Ti

-1 ou 2 ADN-T (ADN Transféré)

-L’ADN-T porte des gènes qui permettent la synthèse d’auxines et


de cytokinines et la synthèse et la sécrétion d’opines

Les cellules transformées (avec ADN-T) produisent des auxines et


des cytokinines d’où le développement de tumeurs
la transgenèse végétale 13

Les gènes nécessaires au transfert du T-DNA sont portés par la zone vir
(virulence) des plasmides Ti

Plasmide Ti à octopine
la transgenèse végétale 14

Dans le plasmide Ti, en dehors de la région de transfert et de la région vir

Gènes impliqués dans les fonctions de :

- réplication du plasmide (région ori)


- de transfert conjugatif (région tar)

Il y aurait 195 ORF:


- 20 gènes impliqués dans la conjugaison
- 3 gènes de réplication
- 7 gènes de modification du plasmide
- 22 gènes de pathogenèse
- 38 gènes assurant le transfert de l’ADN-T
- 24 gènes impliqués dans le métabolisme des opines
- 12 gènes assurant des fonctions diverses telles que le transport
de ribose, le chimiotactisme…
- 84 séquences non répertoriées
la transgenèse végétale 15

Les inducteurs des gènes de virulence


La transcription des gènes vir est induite par des composés phénoliques
émis par les cellules blessées ex: acétosyringone

Egalement induction par monosaccharides (arabinose, fucose, xylose constituants


de la paroi …)

Induction par pH extracellulaire très bas (5 - 5,5)  inhibition de la croissance


bactérienne donc favorise le transfert de l’ADN-T
la transgenèse végétale 16

Reconnaissance cellules végétales - bactéries

Blessure

composés phénoliques, monosaccharides

Chimiotactisme, déplacement de la bactérie via son flagelle

Fixation à la cellule végétale, récepteurs spécifiques à identifier


Synthèse de filaments de cellulose

Induction des gènes vir


la transgenèse végétale 17
Modèle d’activation des gènes de virulence

autophosphorylation

virA faible expression constitutive, chimiorécepteur membranaire et kinase


chvE nécessaire dans l’induction par les sucres monosaccharides
VirG, faible expression constitutive, interagit avec boites vir dans région promotrice des
opérons (12pb conservées), autorégulation de virG
Souche hypervirulente = forte quantité de virG (quand croissance libre, peu de virG)
la transgenèse végétale 18
Modèle de synthèse de l’ADN-T
Vir
D2
VIR D2

coupures

Vir Vir
D2
Ici coupure simple brin d’où
D2
intermédiaire ADN-T
simple brin, on peut avoir
des coupures double brin et
un intermédiaire ADN-T
Vir
D2
double brin, dépend des
souches

Vir
D2

VIR D2
Vir
D2
la transgenèse végétale 19
Modèle de synthèse de l’ADN-T

Transfert dans le cytoplasme Agrobactérie


de la cellule, apparenté à une
conjugaison de type bactérien

VirD2 et VirE2 contiennent Membrane cellulaire


un signal de localisation
nucléaire (NLS) cytosol Cellule végétale
la transgenèse végétale 20
Modèle d’intégration de l’ADN-T dans l’ADN végétal

Recombinaison non homologue !


3’

Utilise la machinerie cellulaire

3’

= délétion de l’ADN
génomique
la transgenèse végétale 21

Intégration aléatoire dans le génome, plutôt régions transcrites

Possibilité d’avoir plusieurs copies, nature des tissus, de la souche

Tout les gènes de l’agrobactérie possèdent les éléments de régulation


de la transcription, Pol II

En plus intégration de l’ADN-T dans génome de champignons, levure


et en 2002 dans cellules humaines en culture par contact avec des
agrobactéries
la transgenèse végétale 22
la transgenèse végétale 23

La transformation génétique comme outil de biotechnologie


Système de transformation binaire

Structure d’un transgène


BG BD
ADN-T pNos gène de sélection p35S gène à exprimer
la transgenèse végétale 24

Les étapes de la transformation génétique du tabac


BD BG
la transgenèse végétale 25

ion
at
rm
n sfo
tra

Cellules
Disques foliaires
ou OGM ou PGM

Transmission de l’ADN-T à la génération d’après

Intégration aléatoire dans le génome


la transgenèse végétale 26

Applications de la transgenèse végétale

Applications fondamentales

1) Etude des promoteurs

2) Etude de l’adressage des protéines

3) Recherche de la fonction des gènes

-par complémentation ou par modification de leur expression (sur-


expression ou sous-expression (RNAi) )
-Par étude de mutants ‘perte de fonction’, production de mutants d’insertion
la transgenèse végétale 27

1) Étude de l’activité d’un promoteur

Le gène marqueur de la B-glucuronidase de E.coli (GUS)

BLANC

BLEU
la transgenèse végétale 28

1) Étude de l’activité d’un promoteur

- Détails de la construction

- Observations

Promoteur A

Promoteur B
la transgenèse végétale 29

2) Etude de l’adressage des protéines


GFP; Green fluorescent protein (Aequora victoria), protéine avec chromophore
Absorbtion à 395 nm

Émission à 509 nm
Marquage des noyaux avec une fusion NLS-GFP
dans une plante transgénique
la transgenèse végétale 30

3) Production de banques de mutants d’Arabidopsis thaliana


par insertions d’ADN de Transfert
la transgenèse végétale 31

3) Production de banque de mutants d’insertion d’ADN de transfert

Plusieurs dizaines de milliers de


transformants indépendants, donc
d’insertions situées à différents
(0,1 à 3%) emplacements dans le génome

En général, obtention de mutants dits


perte de fonction, mutation récessive
la transgenèse végétale 32
la transgenèse végétale 33

Production de banque de mutants par insertion d’ADN de transfert


Exemple d’une insertion dans un gène

Gène X

Transgenèse,
insertion au hasard du T-DNA

Gene X T-DNA Gene X


BG BD

Séquençage de la région flanquant une des bordures du T-DNA

AATCGTAGTACTAGAT CTGCAGACTTGAGTACAAGGGTGATGATGCGGACATTCTATCTGCTTA……...
BD Gène X

Localisation du T-DNA dans le gène X grâce à la


connaissance de la séquence complète du génome
la transgenèse végétale 34

Séquençage des régions flanquantes de l’ADN de transfert

ADN génomique

FST : Flanking Sequence Tags

LB: Left Border


la transgenèse végétale 35
Recherche d’homologie entre la séquence flanquant la bordure du T-DNA (FST) et le
génome d’Arabidopsis
acaaatttct acagaggatg atattcaatc cacggttcac ccaaaccgat tttataaaat 61
ttattattaa atctttttta attgttaaat tggtttaaat ctgaactctg tttacttaca 121
ttgattaaaa ttctaaacca tcataagtaa aaaataatat gattaagact aataaatctt 181
aatagttaat actactcggt ttactacatg aaatttcata ccatcaattg ttttaataat 241
ctttaaaatt
aattaagaaa
gttaggaccg
ataaaaataa
gtaaaaccat
aaggaataaa
accaattaaa
ttgtcttatt
ccggagatcc atattaattt 301
taaacgctga cttcactgtc 361
gène X
ttcctccctc caaattatta gatataccaa accagagaaa acaaatacat aatcggagaa 421
atacagatta cagagagcga gagagatcga cggcgaagct ctttacccgg aaaccattga 481
aatcggacgg tttagtgaaa ATGGAGGATC AAGTTGGGTT TGGGTTCCGT CCGAACGACG 541
AGGAGCTCGT TGGTCACTAT CTCCGTAACA AAATCGAAGG AAACACTAGC CGCGACGTTG 601
AAGTAGCCAT CAGCGAGGTC AACATCTGTA GCTACGATCC TTGGAACTTG CGCTgtaagt 661
tccgaatttt ctgaatttca tttgcaagta atcgatttag
BD gtttttgatt ttagggtttt 721
tttttgtttt gaacagTCCA GTCAAAGTAC AAATCGAGAG
BG
ATGCTATGTG GTACTTCTTC 781
TCTCGTAGAG AAAACAACAA AGGGAATCGA T-DNA
CAGAGCAGGA CAACGGTTTC TGGTAAATGG 841
AAGCTTACCG GAGAATCTGT TGAGGTCAAG GACCAGTGGG GATTTTGTAG TGAGGGCTTT 901
CGTGGTAAGA TTGGTCATAA AAGGGTTTTG GTGTTCCTCG ATGGAAGATA CCCTGACAAA 961
ACCAAATCTG
ttcttctatt
ATTGGGTTAT
catatatata
CCACGAGTTC
tatatatata
CACTACGACC
tatgtggata
TCTTACCAGA ACATCAGgtt 1021
tatatatatg tggtttctgc 1081
FST
tgattcatag ttagaatttg agttatgcaa attagaaact atgtaatgta actctattta 1141
CTGCAGACTT GAGTACAAGG GTGATGATGC GGACATTCTA TCTGCTTA
ggttcagcag ctattttagg cttagcttac tctcaccaat gttttatact gatgaactta 1201
tgtgcttacc tccggaaatt ttacagAGGA CATATGTCAT CTGCAGACTT GAGTACAAGG 1261
GTGATGATGC GGACATTCTA TCTGCTTATG CAATAGATCC CACTCCCGCT TTTGTCCCCA 1321
ATATGACTAG TAGTGCAGGT TCTGTGgtga gtctttctcc atatacactt agctttgagt 1381
aggcagatca aaaaagagct tgtgtctact gatttgatgt tttcctaaac tgttgattcg 1441
tttcagGTCA ACCAATCACG TCAACGAAAT TCAGGATCTT ACAACACTTA CTCTGAGTAT 1501
GATTCAGCAA
CTTCAAGGAT
ATCATGGCCA
CATTCAACCC
GCAGTTTAAT
TCTCCTTGAG
GAAAACTCTA
TATGATTTTG
ACATTATGCA GCAGCAACCA 1561
CAAATCACGG CGGTCAGTGG 1621
localisation de l’insertion
CTGAGTGACT
TCGGAGATGA
ATATCGACCT
TTTGGAAGCA
GCAACAGCAA
TGTGATTGAA
GTTCCTTACT
GAAAATTTTG
TGGCACCTTA TGAAAATGAG 1681
AGTTTTTGGT AGATGAAAGG 1741 dans le génome
ACATCTATGC AACAGCATTA CAGTGATCAC CGGCCCAAAA AACCTGTGTC TGGGGTTTTG 1801
CCTGATGATA GCAGTGATAC TGAAACTGGA TCAATGgtaa gcttttttta ctcatatata 1861
atcacaacct atatcgcttc tatatctcac acgctgaatt ttggctttta acagATTTTC 1921
GAAGACACTT CGAGCTCCAC TGATAGTGTT GGTAGTTCAG ATGAACCGGG CCATACTCGT 1981
ATAGATGATA TTCCATCATT GAACATTATT GAGCCTTTGC ACAATTATAA GGCACAAGAG 2041
CAACCAAAGC AGCAGAGCAA AGAAAAGgtt taacactctc actgagaaac atgactttga 2101
tacgaaatct gaatcaacat ttcatcaaaa agatttagtc aaatgacctc taaattatga 2161
gctatgggtc tgctttcagG TGATAAGTTC GCAGAAAAGC GAATGCGAGT GGAAAATGGC 2221
TGAAGACTCG ATCAAGATAC CTCCATCCAC CAACACGGTG AAGCAGAGCT GGATTGTTTT 2281
GGAGAATGCA CAGTGGAACT ATCTCAAGAA CATGATCATT GGTGTCTTGT TGTTCATCTC 2341
CGTCATTAGT TGGATCATTC TTGTTGGTTA Agaggtcaaa tcggattctt gctcaaaatt 2401
tgtatttctt agaatgtgtg tttttttttg tttttttttc tttgctctgt tttctcgctc 2461
cggaaaagtt tgaagttata ttttattagt atgtaaagaa gagaaaaagg gggaaagaag 2521
agagaagaaa aatgcagaaa atcatatata tgaattggaa aaaagtatat gtaataataa 2581
ttagtgcatc gttttgtggt gtagtttata taaataaagt gatatatagt cttgtataag 2641
aaagggattt tacatgagac ccaaatatga gtaaagggtg ttggctcaaa gattcattta 2701
gcaaccaaag ttgcatttgc aaggaaatga aaaggtgtta acaatgtcac tgcgtaacat 2761
gacttcgata caaaatctca aacaatacat cttcaactgt ggattatgat ggacttgggg 2821
ttgcaggtga tatgtctata gaaaaacggg tgggaatgga aaatggctga a
la transgenèse végétale 36
Indentification d’un mutant d’insertion dans un gène d’intérêt
Recherche dans le gène At1g01010

AT1G01010 T-DNA AT1G01010


BG BD

Salk_074723

Dr. Jonas Salk, developer of the polio vaccine, established the Salk Institute for Biological Studies more than 40 years ago.
la transgenèse végétale 37

CLON SALK_074723.37.35.x[seq] [About & Citation] [analysis] [Order from ABRC] [Order from NASC]
TYPE SALK T-DNA
CHRO chr1
EVAL 1e-41
COOR C/4101-4298

HITS At1g01010[Seq] [Transcriptome] [RiceGE] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB] [KEGG]
TYPE Gene
TITL no apical meristem (NAM) family protein similar to NAC domain protein NAM GB: AAD17313 GI:4325282 from [Arabidopsis
thaliana]; go_function: transcription factor activity [goid 0003700]; go_process: development [goid 0007275]
LOCN Intron
COOR W/3760-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5630

>SALK_074723.37.35.x ATATATATGAATAGAAGAAAACCTGATGTTCTGGTAAGAGGTCGTAGTGGAACTCGTGGATAAC
CCAATCAGATTTGGTTTTGTCAGGGTATCTTCCATCGAGGAACACCAAAACCCTTTTATGACCA
ATCTTACCACGAAAGCCCTCACTACAAAATCCCCACTGGTCCTTGACCTCAACAGATTCTCCGG TAAGCT
la transgenèse végétale 38
The Arabidopsis Information Resource (TAIR)
la transgenèse végétale 39
la transgenèse végétale 40
1 acaaatttct acagaggatg atattcaatc cacggttcac ccaaaccgat tttataaaat
61 ttattattaa atctttttta attgttaaat tggtttaaat ctgaactctg tttacttaca
121 ttgattaaaa ttctaaacca tcataagtaa aaaataatat gattaagact aataaatctt
181 aatagttaat actactcggt ttactacatg aaatttcata ccatcaattg ttttaataat
241 ctttaaaatt gttaggaccg gtaaaaccat accaattaaa ccggagatcc atattaattt
301 aattaagaaa ataaaaataa aaggaataaa ttgtcttatt taaacgctga cttcactgtc
361 ttcctccctc caaattatta gatataccaa accagagaaa acaaatacat aatcggagaa
421 atacagatta cagagagcga gagagatcga cggcgaagct ctttacccgg aaaccattga
481 aatcggacgg tttagtgaaa ATGGAGGATC AAGTTGGGTT TGGGTTCCGT CCGAACGACG
541 AGGAGCTCGT TGGTCACTAT CTCCGTAACA AAATCGAAGG AAACACTAGC CGCGACGTTG
601 AAGTAGCCAT CAGCGAGGTC AACATCTGTA GCTACGATCC TTGGAACTTG CGCTgtaagt
661 tccgaatttt ctgaatttca tttgcaagta atcgatttag gtttttgatt ttagggtttt
721 tttttgtttt gaacagTCCA GTCAAAGTAC AAATCGAGAG ATGCTATGTG GTACTTCTTC
781 TCTCGTAGAG AAAACAACAA AGGGAATCGA CAGAGCAGGA CAACGGTTTC TGGTAAATGG
841 AAGCTTACCG GAGAATCTGT TGAGGTCAAG GACCAGTGGG GATTTTGTAG TGAGGGCTTT
901 CGTGGTAAGA TTGGTCATAA AAGGGTTTTG GTGTTCCTCG ATGGAAGATA CCCTGACAAA
961 ACCAAATCTG ATTGGGTTAT CCACGAGTTC CACTACGACC TCTTACCAGA ACATCAGgtt
1021 ttcttctatt c atatatata tatatatata tatgtggata tatatatatg tggtttctgc

1081 tgattcatag ttagaatttg agttatgcaa attagaaact atgtaatgta actctattta


1141 ggttcagcag ctattttagg cttagcttac tctcaccaat gttttatact gatgaactta
1201 tgtgcttacc T-DNAttacagAGGA CATATGTCAT CTGCAGACTT GAGTACAAGG
tccggaaatt
1261 GTGATGATGC GGACATTCTA TCTGCTTATG CAATAGATCC CACTCCCGCT TTTGTCCCCA
1321 ATATGACTAG BG BD
TAGTGCAGGT TCTGTGgtga gtctttctcc atatacactt agctttgagt
1381 aggcagatca aaaaagagct tgtgtctact gatttgatgt tttcctaaac tgttgattcg
1441 tttcagGTCA ACCAATCACG TCAACGAAAT TCAGGATCTT ACAACACTTA CTCTGAGTAT
1501 GATTCAGCAA ATCATGGCCA GCAGTTTAAT GAAAACTCTA ACATTATGCA GCAGCAACCA
1561 CTTCAAGGAT CATTCAACCC TCTCCTTGAG TATGATTTTG CAAATCACGG CGGTCAGTGG
1621 CTGAGTGACT ATATCGACCT GCAACAGCAA GTTCCTTACT TGGCACCTTA TGAAAATGAG
1681 TCGGAGATGA TTTGGAAGCA TGTGATTGAA GAAAATTTTG AGTTTTTGGT AGATGAAAGG
1741 ACATCTATGC AACAGCATTA CAGTGATCAC CGGCCCAAAA AACCTGTGTC TGGGGTTTTG
1801 CCTGATGATA GCAGTGATAC TGAAACTGGA TCAATGgtaa gcttttttta ctcatatata
1861 atcacaacct atatcgcttc tatatctcac acgctgaatt ttggctttta acagATTTTC
1921 GAAGACACTT CGAGCTCCAC TGATAGTGTT GGTAGTTCAG ATGAACCGGG CCATACTCGT
1981 ATAGATGATA TTCCATCATT GAACATTATT GAGCCTTTGC ACAATTATAA GGCACAAGAG
2041 CAACCAAAGC AGCAGAGCAA AGAAAAGgtt taacactctc actgagaaac atgactttga
2101 tacgaaatct gaatcaacat ttcatcaaaa agatttagtc aaatgacctc taaattatga
2161 gctatgggtc tgctttcagG TGATAAGTTC GCAGAAAAGC GAATGCGAGT GGAAAATGGC
2221 TGAAGACTCG ATCAAGATAC CTCCATCCAC CAACACGGTG AAGCAGAGCT GGATTGTTTT
2281 GGAGAATGCA CAGTGGAACT ATCTCAAGAA CATGATCATT GGTGTCTTGT TGTTCATCTC
2341 CGTCATTAGT TGGATCATTC TTGTTGGTTA Agaggtcaaa tcggattctt gctcaaaatt
la transgenèse végétale 41

T1 T2 T3

Sauvage Sauvage Sauvage

Hétérozygote (0,1 à 3%) Hétérozygotes Hétérozygotes

Homozygotes Homozygotes

Réception de graines de T3  Sélection des Homozygotes par PCR


la transgenèse végétale 42
Exemple de mutant perte de fonction ici affecté dans la croissance
la transgenèse végétale 43

Nombreux domaines d’application

Agriculture

Agroalimentaire

Industries

Environnement

Santé-pharmacie

Introduction de caractéristiques nouvelles et production de molécules d’intérêt

Le code génétique est universel, pas de barrière d’espèces


la transgenèse végétale 44

Agriculture
Résistance aux herbicides, aux insectes et contre certains virus et bactéries

Résistance à la pyrale

Par endotoxine (insecticide naturel) de Bacillus


thuriengensis (Bt) contre larve de lépidoptère
(Pyrale)

-protoxine clivée dans l’intestin de l’insecte par


protéase + pH alcalin
-Toxine active qui se fixe à des sites de l’intestin
-ulcération, perte d’appétit
-Rupture des cellules, mort des larves

Moins d’insecticides chimiques, maïs, tomate, pomme de terre, coton, laitue, peuplier,
la transgenèse végétale 45

Agriculture
Résistance aux stress (chaleur, froid, sécheresse et salinité)

Agroalimentaire
Introduction de caractères pour obtenir des avantages nutritionnels, gustatifs

Riz doré (golden rice)


carence en vitamine A (antioxydant), 400 millions de personnes (cécités,
sensibilité accrue aux infections)
Introduction de 4 gènes  synthèse de B-carotène (précurseur de la Vit A)
la transgenèse végétale 46

Quels aliments transgéniques trouve-t-on sur le marché international ?

Culture Caractéristique Territoires/pays où elle est homologuée

Maïs Résistance aux insectes, Tolérance aux herbicides (Afrique du Sud, Argentine,
Canada, Etats-Unis d'Amérique, Union européenne, Argentine, Canada, Etats-
Unis d'Amérique, Union européenne)

Soja Tolérance aux herbicides (Afrique du Sud, Argentine, Canada, Etats-Unis


d'Amérique,
Union européenne (pour la transformation seulement)

Colza Tolérance aux herbicides (Canada, Etats-Unis d'Amérique)

Chicorée Tolérance aux herbicides Union européenne

Courge Résistance aux virus Canada, Etats-Unis d'Amérique

Pomme de Terre
Résistance aux insectes / tolérance aux herbicides (Canada, Etats-Unis)
la transgenèse végétale 47

Industries

Industrie papetière, papier à partir de cellulose du bois,


Présence de lignine, imperméable et inextensible  très coûteux à
éliminer et source de pollution (utilisation de chlore et consomme une
très grande quantité d'eau)
Diminution du taux de lignine par transgenèse

Coton génétiquement modifiées pour obtenir des vêtements en fibres


naturelles moins froissables ou des cotons colorés qui éviteront
l'utilisation de teintures nécessitant de nombreux contrôles et des
systèmes d'épuration des eaux usées des teintureries lourds et coûteux
à mettre en place.
la transgenèse végétale 48

Industries

Biocarburants

Huile de Colza
De nouvelles variétés de colza ont été obtenues par transgenèse pour diminuer la
viscosité et augmenter l'indice d'octane du diester.

Actuellement les huiles représentent seulement 43 % de la masse des graines de colza.


Des recherches sont menées pour accroître ce rendement. Le gène qui code l'enzyme
intervenant dans la dernière synthèse de l'huile a été isolé. Des copies supplémentaires de
ce gène ont été introduites dans du colza. Certaines graines ont ainsi produit une quantité
d'huile correspondant à plus de 75 % de leur masse.
la transgenèse végétale 49

Santé-pharmacie

Production de vaccins, d’anticorps, de protéines (hémoglobine…)

Avantage des cellules végétales


Plante alternative intéressante comparée aux microorganismes ou aux cellules
des mammifères

Machinerie cellulaire complexe et sophistiquée

Les protéines humaines subissent des modifications post traductionnelles


(glycosylation, carboxylation, lipidation) nécessaire à leur activité biologique

Ces modifications possibles chez les plantes, difficiles voir impossible chez les
bactéries ou levures

Plantes non porteuses des agents pathogènes couramment associés aux infections
humaines (virus, bactéries)
la transgenèse végétale 50

Avantage des cellules végétales

Leur contenu cellulaire, hormis la protéine recombinante, connu de l’homme par son
utilisation dans l’alimentation, en cosmétique et en pharmacie.

- Stockage stable des protéines recombinées dans des endroits stratégiques


de la plante (tubercule, feuilles, graines, fruits…)
- Facilite l’extraction et la purification
-Si protéine recombinante administrée par voie orale, consommation
directe de la plante possible

Les plantes peuvent être propagées à l’infini

Leur production à grande échelle ou en conditions contrôlées fait partie du patrimoine


culturel de toutes les nations

Biomasse la moins onéreuse à produire à ce jour par unité de volume


la transgenèse végétale 51

Santé-pharmacie

Exemples de molécules obtenues

Molécules plasmatiques, albumine humaine (HSA) Remplacement


d'éléments sanguins (sang "artificiel"), coût de production 5 fois moins élevé
que si albumine purifiée à partir du plasma, pas de contaminations

Hémoglobine humaine produite à partir de tabac transgénique l'hémoglobine


(des biologistes français ont déposé une demande de brevet)

Lactoferrine Humaine: protéine multifonctionnelle du lait à activités anti-


bactérienne, anti-fongique et anti-virale. (attente d’autorisation de mise sur
le marché)
la transgenèse végétale 52

Santé-pharmacie
Exemples de molécules obtenues

Collagène, phase de développement, soigner l'arthrose et aider à la


réparation des tissus en cas de chirurgie ou traumatismes

Hirudine, puissant inhibiteur de la thrombine utilisée comme


anticoagulant, source naturelle la sangsue, production dans graines de
colza transgénique,

Production de vaccins

- Vaccins dit « comestibles »


Choléra, production de la sous unité de la toxine dans la pomme de terre

Rage: glycoprotéine du virus produit par la tomate


la transgenèse végétale 53

Santé-pharmacie
Exemples de molécules obtenues

Production de vaccins
La prochaine pandémie (épidémie planétaire) pourrait être d’origine aviaire
(si virus de la grippe aviaire H5N1 muté très contagieux pour l’homme)

Vaccin basé sur l’inoculation du virus de la grippe humaine dans des œufs
fertilisés ou embryonnés, puis purification du virus et inactivation

pour fabriquer 1,2 milliard de doses, il est nécessaire de disposer de... 4


milliards d’oeufs embryonnés et d’au moins six mois au minimum.

Il faut aussi des œufs exempts de virus

Une autre solution ?  la production chez les plantes


la transgenèse végétale 54

Production de ("VLP") Virus-Like Particle dans des plants de tabac pour faire un
vaccin contre le virus H5N1

Expression transitoire pour production à grande échelle en utilisant des


agrobactéries infiltrées dans les feuilles de tabac