A REPORT

ON

PATTERN ANALYSI S OF DOF AND BZIP CIS REGULAT ORY

ELEMENTS IN ARABIDOPSIS THALIANA GENOME

BY
SIDDHANT DANG, 2013B1A40263P
M.Sc. (Hons.) Biological Sciences
B.E. (Hons.) Mechanical Engineering

Prepared in partial fulfillment of the

Thesis (BITS F423T)

Under the Guidance of

Dr. Rajesh Mehrotra
Associate Professor, Biological Sciences Department
BITS-Pilani

AT

BIRLA INSTITUTE OF TECHNOLOGY AND SCIENCE, PILANI

PILANI CAMPUS
 CERTIFICATE

This is to certify that the Thesis entitled “Pattern Analysis of Dof and bZIP cis regulatory elements in
Arabidopsis thaliana genome” and submitted by ID No. 2013B1A40263P in partial fulfillment and
requirement of BITS F423T thesis embodies the work done by him under my supervision.

Date: 1st Dec ’17 Signature of Supervisor

Name:
Designation:
 Pattern Analysis of Dof and bZIP cis Regulatory
Elements in the Genome of Arabidopsis thaliana
Rajesh Mehrotraa, Siddhant Danga
a. Department of Biological Sciences
BITS Pilani, Pilani, India

Summary
Transcription factors bind to cis regulatory elements, present in promoter region of DNA, to upregulate or downregulate the
expression of genes associated with the promoter (Lewis, Doherty, and Clarke 2008). DNA-binding One Zinc Finger (Dof
(Shuichi 2002) – motif: AAAG (Mehrotra et al. 2014)) and basic leucine zipper (bZIP (Jakoby et al. 2002) – motif: ACGT (Foster,
Izawa, and Chua 1994)) are two such families of transcription factors, which are involved in several biotic and abiotic stress
responses (K. Singh 2002), (Nuruzzaman, Sharoni, and Kikuchi 2013). Moreover, Dof and bZIP play an intricate role in
controlling expression of various seed storage proteins (Mehrotra et al. 2009). In this study, we have analyzed the frequency of
occurrence of AAAG and ACGT motifs for different spacer lengths separating the two motifs in both possible orientations –
AAAG(N)ACGT and ACGT(N)AAAG, in the genome of Arabidopsis thaliana to determine biological and functional
significance of relevant conserved sequences. Transcription factor binding site analysis was done using ConSite to determine
relevance of the highly occurring conserved sequences (Sandelin, Wasserman, and Lenhard 2004). It was observed that one
orientation of motifs was preferred over the other across the entire genome and the promoter region. Also, it was observed that
several spacer frequencies and particular sequences were preferred more than the others. Further, microarray data analysis led
to some interesting findings in the promoter region of gene AT3G24430, which codes for Chloroplast HCF101 – a scaffold
protein for [4Fe-4S] cluster assembly (Schwenkert et al. 2010).

Keywords — Arabidopsis, Dof, bZIP, cis regulators, regulatory elements, transcription factor, promoter, iron-sulfur cluster

Introduction These motifs occur in tandem, separated by

Cis regulatory elements present in the promoter
region (Wray et al. 2003) of the gene, upstream
of the coding part, play a critical role in
expression of the gene downstream. Cis
regulatory elements are short, functional DNA
sequences, also called motifs, present in non-
coding region of genes. They provide sites for
transcription factor binding, which leads to
activation or repression of transcription of the
gene (Stormo 2000). One example of such a
motif is DNA-binding One Zinc Finger protein
domains (Shuichi 2002), it binds to the DNA
sequence AAAG (Mehrotra et al. 2014). Dof,
along with another such family – basic leucine
zipper (bZIP) (Jakoby et al. 2002) (Zhang
1995), are critical to the expression of some
seed storage proteins in plants (Mehrotra et al.
2009). bZIP family transcription factors bind to
ACGT DNA sequence (Foster, Izawa, and
Chua 1994).
varying number of nucleotides, in the upstream
non-coding region of several genes, thereby,
providing binding sites for transcription
factors, which regulate the expression of the
respective gene by various mechanisms (Gill
2001). Since, these motifs have functional
relevance and are essential for control of
several genes, their occurrence is much more
directed by evolution and natural selection than
occurring probabilistically, dispersed at
random through the genome (Mehrotra et al.
2012). Hence, in this research, we performed a
genome-wide and a promoter-wide analysis to
determine the occurrence frequencies and
prominent patterns of these motifs in tandem,
separated by 0-30 nucleotides, in both possible
orientations – AAAG(N)ACGT and
ACGT(N)AAAG, in the genome of
Arabidopsis thaliana. The inter-motif distance,
i.e. the number on nucleotides separating the
two motifs, is of particular importance as
promoter activation by ACGT is differently
regulated by the spacing between the two
motifs (Mehrotra and Mehrotra 2010).
Furthermore, transcription factor binding site
analysis was performed to determine the
binding sites for several transcription factors
using ConSite (Sandelin, Wasserman, and
Lenhard 2004). Following this microarray data
was analyzed for two major reasons – firstly, to
determine which stress responses are
responsible for genes containing sequences of
Dof and bZIP domains (Mehrotra et al. 2013),
and secondly, to look for more interesting
patterns by analyzing highly occurring spacer
lengths in different genes present in the
microarray data.
Methodology
Data Extraction
Analysis was performed on both Arabidopsis
thaliana genome and promoter region. Hence,
both – entire genome sequence and promoter
region sequences were required. Arabidopsis
thaliana DNA sequence for all chromosomes
was retrieved from the genome TAIR – The
Arabidopsis Information Resource, v. 10, 2012
(Huala 2001) (Lamesch et al. 2012). Further,
Python code (Additional File 1) was used to
extract 1kb upstream promoter region of all
Arabidopsis genes across all five
chromosomes. Python code was run on gene
data sets obtained from the database in form of
FASTA sequences. Another Python code
(Additional File 2) was executed on the
extracted sequences to determine occurrence
frequencies of Dof (AAAG) and bZIP (ACGT)
motifs in tandem, for varying spacer lengths
from 0 to 30, in both possible orientations, i.e.
AAAG(N)ACGT and ACGT(N)AAAG, where
0 <= N <= 30. Further, exact sequences, for all
spacer lengths, were also determined. In order
to test the significance of these sequences, we
used 12 combinations of the two sequence sets
– AAGA, AGAA, GAAA and CATG, GCAT,
GTAC, TCAG as controls. Using the PLACE
database, we ensured that these control
sequences are not conserved cis regulatory
elements (Higo et al. 1999). Spacer lengths
were restricted to 30 for our analysis as
cooperatively binding transcription factor sites
usually spaced within 25 nucleotides (Mehrotra
et al. 2013).
Spacer Sequence Analysis
As discussed above, using Python code
(Additional File 2), frequencies of occurrence
of exact sequences for all spacers 0-30 were
extracted, and consensus sequences for all
spacer lengths were constructed. Consensus
sequences are constructed by calculating
percentage A, C, G, T content at each position
in all spacers. After calculating percentage
content of the four nucleotides, thresholds on
percentage content are set for considering a
nucleotide at a particular position to be
relevant. Since, percentage G/C content of
Arabidopsis thaliana is about 36% (Mishra et
al. 2009), we have taken the thresholds as 25%
for G/C and 40% for A/T.
Transcription Factor Binding Site Analysis
Transcription factor binding site analysis was
performed, using ConSite (Sandelin,
Wasserman, and Lenhard 2004), to verify the
presence of transcription factor binding sites on
highly occurring sequences obtained as
discussed above. It was carried out by prefixing
a 139 nucleotide-long minimal promoter
sequence (MPS) before different highly
occurring sequences. Following MPS was used
(Kiran 2006):
TCACTATATATAGGAAGTTCATTTCATT
TGGAATGGACACGTGTTGTCATTTCTC
AACAATTACCAACAACAACAAACAAC
AAACAACATTATACAATTACTATTTAC
AATTACATCTAGATAAACAATGGCTTC
CTCC
Transcription factor binding sites present on
the highly occurring sequences and MPS were
compared and contrasted to check for binding
suitability of highly occurring spacer
sequences for transcription factors. Cut-off
score for binding specificity was set to 80%.
The analysis was conducted with 14
transcription factors – AGL3 (Huang et al.
1995), Athb-1 (Capella et al. 2015), Athb-5
(Johannesson et al. 2003), bZIP910, bZIP911
(Jakoby et al. 2002), Dof2, Dof3 (Shuichi
2002), GAMYB (Tsuji et al. 2006), HMG-1,
HMG I/Y (Webmaster et al. 1997), MNB1A
(Yanagisawa 1995), MYB.ph3 (González-
Verdejo et al. 2007), PBF (Marzábal et al.
2008), and SQUA (Shan et al. 2007).
Functional Analysis
Microarray data of upregulated and
downregulated genes under various stress
responses – heat stress, osmotic stress, salinity
stress, was retrieved from EBI Expression
Atlas (Kapushesky et al. 2009). Obtained data
was analyzed to determine per gene occurrence
of Dof and bZIP binding domains in tandem,
hence, pointing to the role of combination of
these two domains (Noguero et al. 2013).
Moreover, individual gene-level analysis of
gene AT3G24430 revealed some interesting
findings.
Melting Point Analysis
Melting point of highly occurring sequences
was calculated to compare ease of unwinding
of double helical DNA. A lower melting
temperature implies lower energy required to
unwind the DNA sequence and vice versa for
high melting temperature. Melting points of
DNA sequences were measured using TfReg
(Weber 2013), wherein a text file was supplied
as input in the specified format.
Results
AAAG(N)ACGT orientation is preferred
over ACGT(N)AAAG orientation
We extracted promoter regions 1kb upstream
of all the genes of Arabidopsis, and determined
frequency of occurrence of Dof and bZIP
domains in tandem with varying spacer lengths
of 0-30 nucleotides between them. It was
observed that AAAG(N)ACGT orientation is
preferred over ACGT(N)AAAG orientation,
based on occurrence frequency data, as shown
in Figure 1. At all spacer lengths, except N = 1,
occurrence frequency of AAAG(N)ACGT
orientation is more than ACGT(N)AAAG
orientation. Moreover, it can be interpreted
from Figure 1 that at certain spacer lengths,
there is a very high degree of correlation
between the occurrence of two orientations, i.e.
common peaks and dips can be observed.
Common peaks and dips are observed from
spacer lengths 6 to 11, showing very high
correlation between two orientations. Apart
from spacer lengths 6 to 11, common peaks are
observed at N = 15 and 24, and a common dip
is observed at N = 25. For the orientation
AAAG(N)ACGT, highest occurrence
frequency is at spacer lengths of N = 6,10, and
lowest for N = 1. Similarly, for
ACGT(N)AAAG orientation, highest
occurrence frequency is at a spacer length of N
= 10, and lowest at N = 0 (Figure 1)
Figure 1. Frequencies of occurrence of Dof and bZIP
motifs in tandem with varying spacer lengths in the
promoter region of genome of Arabidopsis thaliana.
Dark gray line exhibits occurrence frequencies for the
orientation AAAG(N)ACGT, while light gray line
exhibits the same for the orientation ACGT(N)AAAG.
Arrows exhibit common peaks and dips.
Low preference for Dof and bZIP motifs in
tandem as compared to other random motifs
in tandem
Spacer and occurrence frequency analysis were
also conducted for some control motifs in
tandem. Control motifs selected were AAGA,
AGAA, and GAAA for AAAG, and CATG,
GCAT, GTAC, and TCAG for ACGT. It was
ensured that control motifs are themselves not
cis regulatory elements and are completely
random 4-nucleotide long sequences.
Following charts (Figure 2) show comparison
of frequencies of occurrence for Dof and bZIP
motifs in tandem in both orientations with
control motifs in tandem, for spacer lengths 0-
30. AAAG(N)ACGT (Figure 2A) and
ACGT(N)AAAG (Figure 2B) both occur
moderately lesser number of times as compared
to control motifs, thereby, showing limited
preference for Dof and bZIP motifs in tandem.
Figure 2A. Occurrence Frequency for
AAAG(N)ACGT and several control motifs show
limited preference for Dof-bZIP motif domains as
compared to random domains. Red dots exhibit
AAAG(N)ACGT, while black dots represent various
control sequences.
Figure 2B. Occurrence Frequency for
ACGT(N)AAAG and several control motifs show
limited preference for bZIP-Dof motif domains as
compared to random domains. Red dots exhibit
ACGT(N)AAAG, while black dots represent various
control sequences.
‘A’ is the most conserved nucleotide in
spacer sequences
Exact spacer sequences were obtained for all 0-
30 spacer lengths for both orientations. Further,
consensus sequences, based on threshold
conditions for percentage A, T, G, C content
(Mishra et al. 2009), were drawn for all spacer
lengths for both possible orientations. It was
observed that nucleotide A occurred the most
number of times, highlighting the fact that A is
the most conserved element in the consensus
spacer sequences. In the orientation
AAAG(N)ACGT, A occurred at first position
in 14 spacer sequences (out of a possible 30),
third position in 4 spacer sequences, and at a
few other positions in several other sequences.
Whereas, the second most occurring nucleotide
in consensus spacer sequences was G (Table
1A). In the orientation ACGT(N)AAAG,
nucleotide G occurred at first position in 5
spacer sequences – 1, 3, 6, 25, 27, while,
nucleotide occurred the most – at 6 places, and
nucleotide 3 at 1 instance (Table 1B).
Table 1A. Conserved sites in consensus spacer
sequences for the orientation AAAG(N)ACGT.
Nucleotides A and T are marked in green color, while
nucleotides G and C are marked in red.

Table 1B. Conserved sites in consensus spacer
sequences for the orientation ACGT(N)AAAG.
Nucleotides A and T are marked in green color, while
nucleotides G and C are marked in red.
AAAG(24)ACGT has the most number of
transcription factor binding sites
Transcription factor binding sites on highly
occurring sequences, along with minimal
promoter cassette (MPS) were determined
using ConSite. 139-nucleotide long MPS was
observed to have 27 transcription factor
binding sites: AGL3 – 2, Athb-1 – 2, Athb-5 –
2, Dof3 – 1, GAMYB – 5, HMG-1 – 6, HMG-
I/Y – 6, MYB.ph3 – 1, and SQUA – 2.
24-nucleotide long spacer sequence –
AAAGTTGGGCTTTCAAAATTGTTAACT
CACGT, was reported to have 43 transcription
factor binding sites, a total of 16 more sites than
MPS: Athb-1 – 1, Dof2 – 2, Dof3 – 4, HMG-1
– 1, and 2 each of MNB1A, MYB.ph3, PBF,
and SQUA. In the other orientation, a 14-
nucleotide long spacer sequence,
ACGTGGATGCTATTATTAAAAG, was
reported to have the maximum number of
transcription factor binding sites at 39 sites, a
total of 12 more than MPS – 1 sites of SQUA,
and 1 site each for AGL3, Athb-1, Athb-5,
bZIP910, Dof2, Dof3, MNB1A, MYB.ph3,
and PBF. Many other sequences had
significantly more number of transcription
factor binding sites than MPS (Supplementary
File 1).
AAAG and ACGT motifs upregulate genes
under osmotic and salinity stresses, and
downregulate genes under heat stress
Functional analysis was carried out by
analyzing the microarray data, containing list
of Arabidopsis genes upregulated and
downregulated for three stress responses –
heat, osmotic, and salinity. Occurrence
frequencies were determined in promoters of
these genes, and the data was compared with
occurrence frequency in the entire promoter
range. Results showed a very high occurrence
of the motifs, in both orientations, in the
promoter region of genes being downregulated
by heat stress. Moreover, motifs in the
orientation ACGT(N)AAAG were present in
significantly high number in the promoter
region of genes being upregulated by osmotic
stress. In the promoter region of genes being
upregulated by salinity stress, motifs in both
orientations were found in high numbers (Table
2) (Figure 3).
Table 2. Occurrence frequency of the two motifs,
separated by 0-30 spacers, in different sets of
sequences. Results have been compiled for the entire
promoter region and genes being up or downregulated by
three types of stress responses – heat, osmotic, and
salinity, in both possible orientations. Orient. 1 denotes
AAAG(N)ACGT orientation, and Orient. 2 denotes
ACGT(N)AAAG orientation. Different sets of genes
have been numbered, from 1-12, in the orientation
column of the table (to be used for Figure 3).

Figure 3. Percentage difference in occurrence
frequencies in different sets of stress response genes
and the entire promoter region. Dark gray line
represents percentage difference between occurrence
frequencies in the corresponding sequence set, numbered
from 1-12 (see Table 2), and the entire promoter region.
Medium gray line at 50% level signifies cut-off
threshold, or minimum positive percentage difference
from the promoter region data set to be considered of
significance. Light gray line at 0% level represents
occurrence frequency in the entire promoter region.
ACGT(26)AAAG occurs four times
consecutively in the promoter region of gene
locus AT3G24430
Gene at locus AT3G24430 is downregulated by
osmotic stress, as observed from the
microarray data. It is a protein coding gene
which codes for HCF-101 chloroplast scaffold
protein for [4Fe-4S] cluster assembly
(Schwenkert et al. 2010). In the promoter
region of this gene, there were four occurrences
of 26 spacer-long sequences in
ACGT(N)AAAG orientation. On further
analysis, it was revealed that these are four
unique sequences occurring consecutively,
starting from 575th position and ending at 711th,
in the promoter (position numbers with
reference to the promoter, 1 being the first
nucleotide in the promoter sequence). The
exact sequences are
ACGTGTGTGATTTTTCATTTATCTCTAA
TTAAAG,
ACGTGTGTAAATTTTCATTTATCTCTAG
TCAAAG,
ACGTGTGTGAATTTTCATTTATCTGTAG
TCAAAG, and
ACGTGTGTGATTTTTCATTTATTTCTGG
TCAAAG. It can be observed that these
sequences are highly conserved.
Melting temperatures of highly occurring
spacer sequences show peaks and dips trend
in both orientations
Melting temperature of a DNA sequence is
inversely related to its ease of unwinding
(Lucius and Lohman 2004) (Morin et al. 2012).
Hence, we evaluated melting temperatures of
highly occurring spacer sequences using TfReg
(Weber 2013). This analysis has been
conducted for 0-25 spacer lengths because
TfReg is inaccurate for sequences longer than
25 base pairs. Melting temperatures keep on
increasing as the spacer length increases, also,
both orientations show a very clear peak and
dip trend. Dips highlight the fact that at a
certain spacer lengths, highly occurring
sequences are easier to unwind than others
(Figure 4). Further, no one orientation
consistently has lower or higher aggregate
melting temperatures, at some spacer lengths,
ACGT(N)AAAG has lower melting
temperature, while at others, AAAG(N)ACGT
has lower melting temperature (Figure 4).
Figure 4. Average melting temperature of highly
occurring sequences at 0-25 spacer lengths. Dark gray
line exhibits AAAG(N)ACGT orientation, and light gray
line exhibits ACGT(N)AAAG orientation.
Discussion
cis regulatory elemets Dof and bZip are to
known to play a vital role in regulating several
biotic and abiotic stresses responses (Le Hir
and Bellini 2013) (Kang and Singh 2000)
(Guedes Corrêa et al. 2008) (Alves et al. 2013)
(Orellana et al. 2010) (Mehrotra et al. 2013).
These two transcription factors families are
known to interact with each other
synergistically (K. B. Singh 1998) to regulate
the expression of certain genes in specific
stress conditions (Yamamoto et al. 2006).
Analyses performed on extracted data reveals
that preferred orientation of Dof and bZIP
motifs for transcription factor binding is
AAAG(N)ACGT, i.e. Dof transcription factors
have a tendency of binding upstream on the
promoter sequence (K. B. Singh 1998). Apart
from preference for motif orientation, data also
supported preference for specific spacer
lengths in both orientations. For instance,
spacer lengths 6 and 10 occur at maximum
number of sites in orientation
AAAG(N)ACGT, and spacer length 10
occurred maximum number of times in
ACGT(N)AAAG orientation. These sequences
occur more than the other spacer length
sequences, probably because these lengths
serve as optimal lengths for transcription factor
binding (Kim and Maniatis 1997), also,
observed from transcription factor binding site
analysis (Supplementary File 1). Further, two
orientations show correlation in peaks and dips
for certain consecutive spacer lengths, as
mentioned above, could point to reversibility of
transcription factor binding or co-evolution
because of high synergistic functionality of the
two motifs (Yamamoto et al. 2006). Also, a
probable reason for the dips could be that
certain lengths might cause steric hindrance in
binding of transcription factors, explaining the
reason for the lower preference for certain
specific sequences despite an optimal length
(Mehrotra et al. 2013) (Spitz and Furlong
2012). On comparing the occurrence of two
motifs – Dof and bZIP in tandem with
occurrence of other control sequences in
tandem in the promoter region, it was revealed
that these two motifs in tandem are preferred
lesser than most of the control cases
(Supplementary File 1). Although presence of
these two motifs, in tandem, in the promoter
region is significant, this analysis definitely
understates the functional relevance of Dof and
bZIP in synergy.
From spacer sequence analysis, consensus
sequences were drawn for each spacer length in
both possible orientations. Consensus
sequences showed high degree of conservation
of nucleotide A. In addition to this, A occurred
at first position in 14 spacer sequences in the
orientation AAAG(N)ACGT. Also, A was
found at last position in the spacer sequence in
4 spacer lengths. These observations are in
sync with the rest of the inferences as AAAGA
and AAAAG act as binding sites for several
Dof family transcription factors (Lijavetzky,
Carbonero, and Vicente-Carbajosa 2003).
Further, it was revealed that nucleotide G is
preferred at first position in 4 spacer sequences
in the orientation ACGT(N)AAAG. These
results are also in sync with the rest of the
analysis and further strengthen the claim that
Dof and bZIP are involved in regulation of seed
storage genes, as ACGTG acts as a binding site
for certain transcription factor involved in
regulation of a protein required during seed
development process (Giraud et al. 2009)
(Roschzttardtz et al. 2009).
Microarray analysis was carried out to
determine functionality of these motifs in
tandem. It could be deduced that these motifs
upregulate some genes (Supplementary File 2,
Supplementary File 3) in osmotic and saline
stress conditions, and downregulate some
genes in heat stress conditions (Uno et al. 2000)
(Guiltinan, Marcotte Jr., and Quatrano 1990)
(Delker et al. 2006).
Based on functional analysis, another very
interesting observation was made. The
promoter region of gene at locus AT3G24430
contains four consecutive repeats of
ACGT(26)AAAG sequences. A further in-
depth analysis of these sequences revealed
although four sequences were unique in
absolute sense, however, they shared base pairs
at most of the positions, i.e. base pairs in these
sequences are highly conserved. AT3G24430
codes for HCF-101, a chloroplast scaffold
protein for [4Fe-4S] cluster assembly
(Schwenkert et al. 2010).
In the wake of these observations, it could be
concluded that four 26 nucleotide long spacer
sequences in the orientation ACGT(N)AAAG,
along with other highly occurring spacer
lengths, such as spacer length 10 in both
orientations, are of importance in Arabidopsis
genome.
The results of this study can assist in the
promoter designing process, as spacer lengths
and specific sequences for binding are required
for triggering an artificial stress response
(Mehrotra et al. 2011). These promoters can
lead to formation of better genetically modified
crops. Conservation of spacer lengths and
sequences is vital for promoter design
(Mehrotra et al. 2013).
Conclusions
This study was aimed at analyzing interesting
patterns of ACGT and AAAG cis regulatory
elements in Arabidopsis thaliana genome. We
established preferences for specific orientation,
specific spacer lengths, and specific conserved
nucleotides in the promoter region for the
mentioned two motifs in tandem. Further, an
interplay of these two motifs was observed to
have an effect on upregulation of some genes
in osmotic and saline stress, and
downregulation of some other genes in heat
stress conditions. More so, four consecutive
repeats of ACGT(26)AAAG, in the promoter
of gene coding for protein HCF-101, might
play an integral role in expression of the protein
and introduces further scope for study.
Acknowledgment
We would like to thank Department of
Biological Sciences, Birla Institute of
Technology and Science Pilani, Pilani, India
for their constant support.
References
Alves, Murilo S., Silvana P. Dadalto, Amanda B.
Gon??alves, Gilza B. De Souza, Vanessa A. Barros,
and Luciano G. Fietto. 2013. “Plant bZIP
Transcription Factors Responsive to Pathogens: A
Review.” International Journal of Molecular
Sciences. https://doi.org/10.3390/ijms14047815.
Capella, Matías, Pamela A. Ribone, Agustín L. Arce, and
Raquel L. Chan. 2015. “Arabidopsis Thaliana
HomeoBox 1 (AtHB1), a Homedomain-Leucine
Zipper I (HD-Zip I) Transcription Factor, Is Regulated
by PHYTOCHROME-INTERACTING FACTOR 1 to
Promote Hypocotyl Elongation.” New Phytologist 207
(3):669–82. https://doi.org/10.1111/nph.13401.
Delker, C., I. Stenzel, B. Hause, O. Miersch, I. Feussner,
and C. Wasternack. 2006. “Jasmonate Biosynthesis in
Arabidopsis Thaliana - Enzymes, Products,
Regulation.” Plant Biology. https://doi.org/10.1055/s-
2006-923935.
Foster, R, T Izawa, and N H Chua. 1994. “Plant bZIP
Proteins Gather at ACGT Elements.” FASEB
Journal : Official Publication of the Federation of
American Societies for Experimental Biology 8
(2):192–200. https://doi.org/10.1105/tpc.6.9.1277.
Gill, G. 2001. “Regulation of the Initiation of Eukaryotic
Transcription.” Essays in Biochemistry 37:33–43.
https://doi.org/10.1042/bse0370033.
Giraud, E., O. Van Aken, L. H.M. Ho, and J. Whelan. 2009.
“The Transcription Factor ABI4 Is a Regulator of
Mitochondrial Retrograde Expression of
ALTERNATIVE OXIDASE1a.” PLANT
PHYSIOLOGY 150 (3):1286–96.
https://doi.org/10.1104/pp.109.139782.
González-Verdejo, C. I., M. A. Dita, A. Di Pietro, Ma T.
Moreno, X. Barandiarán, D. Rubiales, P. González-
Melendi, and A. Pérez-De-Luque. 2007.
“Identification and Expression Analysis of a MYB
Family Transcription Factor in the Parasitic Plant
Orobanche Ramosa: Research Article.” Annals of
Applied Biology 150 (2):123–30.
https://doi.org/10.1111/j.1744-7348.2006.00114.x.
Guedes Corrêa, Luiz Gustavo, Diego Mauricio Riaño-
Pachón, Carlos Guerra Schrago, Renato Vicentini dos
Santos, Bernd Mueller-Roeber, and Michel Vincentz.
2008. “The Role of bZIP Transcription Factors in
Green Plant Evolution: Adaptive Features Emerging
from Four Founder Genes.” PLoS ONE 3 (8).
https://doi.org/10.1371/journal.pone.0002944.
Guiltinan, M J, W R Marcotte Jr., and R S Quatrano. 1990.
 “A Plant Leucine Zipper Protein That Recognizes an
Abscisic Acid Response Element.” Science 250
(4978):267–71.
https://doi.org/10.1126/science.250.4981.612-a.
Higo, Kenichi, Yoshihiro Ugawa, Masao Iwamoto, and
Tomoko Korenaga. 1999. “Plant Cis-Acting
Regulatory DNA Elements (PLACE) Database:
1999.” Nucleic Acids Research.
https://doi.org/10.1093/nar/27.1.297.
Hir, Rozenn Le, and Catherine Bellini. 2013. “The Plant-
Specific Dof Transcription Factors Family: New
Players Involved in Vascular System Development
and Functioning in Arabidopsis.” Frontiers in Plant
Science 4. https://doi.org/10.3389/fpls.2013.00164.
Huala, E. 2001. “The Arabidopsis Information Resource
(TAIR): A Comprehensive Database and Web-Based
Information Retrieval, Analysis, and Visualization
System for a Model Plant.” Nucleic Acids Research
29 (1):102–5. https://doi.org/10.1093/nar/29.1.102.
Huang, Hai, Matthew Tudor, Catherine A. Weiss, Yi Hu,
and Hong Ma. 1995. “The Arabidopsis MADS-Box
Gene AGL3 Is Widely Expressed and Encodes a
Sequence-Specific DNA-Binding Protein.” Plant
Molecular Biology 28 (3):549–67.
https://doi.org/10.1007/BF00020401.
Jakoby, Marc, Bernd Weisshaar, Wolfgang Dröge-Laser,
Jesus Vicente-Carbajosa, Jens Tiedemann, Thomas
Kroj, and François Parcy. 2002. “bZIP Transcription
Factors in Arabidopsis.” Trends in Plant Science.
https://doi.org/10.1016/S1360-1385(01)02223-3.
Johannesson, Henrik, Yan Wang, Johannes Hanson, and
Peter Engström. 2003. “The Arabidopsis Thaliana
Homeobox Gene ATHB5 Is a Potential Regulator of
Abscisic Acid Responsiveness in Developing
Seedlings.” Plant Molecular Biology 51 (5):719–29.
https://doi.org/10.1023/A:1022567625228.
Kang, Hong G., and Karam B. Singh. 2000.
“Characterization of Salicylic Acid-Responsive,
Arabidopsis Dof Domain Proteins: Overexpression of
OBP3 Leads to Growth Defects.” Plant Journal 21
(4):329–39. https://doi.org/10.1046/j.1365-
313X.2000.00678.x.
Kapushesky, Misha, Ibrahim Emam, Ele Holloway, Pavel
Kurnosov, Andrey Zorin, James Malone, Gabriella
Rustici, Eleanor Williams, Helen Parkinson, and Alvis
Brazma. 2009. “Gene Expression Atlas at the
European Bioinformatics Institute.” Nucleic Acids
Research 38 (SUPPL.1).
https://doi.org/10.1093/nar/gkp936.
Kim, T K, and T Maniatis. 1997. “The Mechanism of
Transcriptional Synergy of an in Vitro Assembled
Interferon-Beta Enhanceosome.” Mol Cell 1 (1):119–
29. https://doi.org/S1097-2765(00)80013-1 [pii].
Kiran, K. 2006. “The TATA-Box Sequence in the Basal
Promoter Contributes to Determining Light-
Dependent Gene Expression in Plants.” PLANT
PHYSIOLOGY 142 (1):364–76.
https://doi.org/10.1104/pp.106.084319.
Lamesch, Philippe, Tanya Z. Berardini, Donghui Li, David
Swarbreck, Christopher Wilks, Rajkumar Sasidharan,
Robert Muller, et al. 2012. “The Arabidopsis
Information Resource (TAIR): Improved Gene
Annotation and New Tools.” Nucleic Acids Research
40 (D1). https://doi.org/10.1093/nar/gkr1090.
Lewis, Peter J., G. P. Doherty, and J. Clarke. 2008.
“Transcription Factor Dynamics.” Microbiology.
https://doi.org/10.1099/mic.0.2008/018549-0.
Lijavetzky, Diego, Pilar Carbonero, and Jesús Vicente-
Carbajosa. 2003. “Genome-Wide Comparative
Phylogenetic Analysis of the Rice and Arabidopsis
Dof Gene Families.” BMC Evolutionary Biology 3:17.
https://doi.org/10.1186/1471-2148-3-17.
Lucius, Aaron L., and Timothy M. Lohman. 2004. “Effects
of Temperature and ATP on the Kinetic Mechanism
and Kinetic Step-Size for E. Coli RecBCD Helicase-
Catalyzed DNA Unwinding.” Journal of Molecular
Biology 339 (4):751–71.
https://doi.org/10.1016/j.jmb.2004.04.010.
Marzábal, Pau, Elisabet Gas, Pilar Fontanet, Jesús Vicente-
Carbajosa, Margarita Torrent, and M Dolores
Ludevid. 2008. “The Maize Dof Protein PBF
Activates Transcription of Gamma-Zein during Maize
Seed Development.” Plant Molecular Biology 67
(5):441–54. https://doi.org/10.1007/s11103-008-9325-
5.
Mehrotra, Rajesh, Gauri Gupta, Riccha Sethi, Purva
Bhalothia, Narayan Kumar, and Sandhya Mehrotra.
2011. “Designer Promoter: An Artwork of Cis
Engineering.” Plant Molecular Biology.
https://doi.org/10.1007/s11103-011-9755-3.
Mehrotra, Rajesh, Vishesh Jain, Chandra Shekhar, and
Sandhya Mehrotra. 2014. “Genome Wide Analysis of
Arabidopsis Thaliana Reveals High Frequency of
AAAGN7CTTT Motif.” Meta Gene 2:606–15.
https://doi.org/10.1016/j.mgene.2014.05.003.
Mehrotra, Rajesh, Sanjeev Kumar, Sandhya Mehrotra, and
B. D. Singh. 2009. “Seed Storage Protein Gene
Regulation - A Jig-Saw Puzzle.” Indian Journal of
Biotechnology.
Mehrotra, Rajesh, and Sandhya Mehrotra. 2010. “Promoter
Activation by ACGT in Response to Salicylic and
Abscisic Acids Is Differentially Regulated by the
Spacing between Two Copies of the Motif.” Journal
of Plant Physiology 167 (14):1214–18.
https://doi.org/10.1016/j.jplph.2010.04.005.
Mehrotra, Rajesh, Sachin Sethi, Ipshita Zutshi, Purva
Bhalothia, and Sandhya Mehrotra. 2013. “Patterns and
Evolution of ACGT Repeat Cis-Element Landscape
across Four Plant Genomes.” BMC Genomics 14
(1):203. https://doi.org/10.1186/1471-2164-14-203.
Mehrotra, Rajesh, Amit Yadav, Purva Bhalothia, Ratna
Karan, and Sandhya Mehrotra. 2012. “Evidence for
Directed Evolution of Larger Size Motif in
Arabidopsis Thaliana Genome.” The Scientific World
Journal 2012:1–5.
https://doi.org/10.1100/2012/983528.
Mishra, Akaash Kumar, Seep Agarwal, Chakresh Kumar
Jain, and Vibha Rani. 2009. “High GC Content:
Critical Parameter for Predicting Stress Regulated
miRNAs in Arabidopsis Thaliana.” Bioinformation 4
(4):151–54. https://doi.org/10.6026/97320630004151.
Morin, J. a., F. J. Cao, J. M. Lazaro, J. R. Arias-Gonzalez, J.
M. Valpuesta, J. L. Carrascosa, M. Salas, and B.
Ibarra. 2012. “Active DNA Unwinding Dynamics
during Processive DNA Replication.” Proceedings of
the National Academy of Sciences 109 (21):8115–20.
https://doi.org/10.1073/pnas.1204759109.
Noguero, Mélanie, Rana Muhammad Atif, Sergio Ochatt,
and Richard D. Thompson. 2013. “The Role of the
DNA-Binding One Zinc Finger (DOF) Transcription
Factor Family in Plants.” Plant Science.
https://doi.org/10.1016/j.plantsci.2013.03.016.
Nuruzzaman, Mohammed, Akhter M. Sharoni, and Shoshi
Kikuchi. 2013. “Roles of NAC Transcription Factors
in the Regulation of Biotic and Abiotic Stress
Responses in Plants.” Frontiers in Microbiology.
https://doi.org/10.3389/fmicb.2013.00248.
Orellana, Sandra, M??nica Ya??ez, Anal??a Espinoza,
Isabel Verdugo, Enrique Gonz??lez, Sim??n Ruiz-
Lara, and Jos?? A. Casaretto. 2010. “The
Transcription Factor SlAREB1 Confers Drought, Salt
Stress Tolerance and Regulates Biotic and Abiotic
Stress-Related Genes in Tomato.” Plant, Cell and
Environment 33 (12):2191–2208.
https://doi.org/10.1111/j.1365-3040.2010.02220.x.
Roschzttardtz, Hannetz, Ignacia Fuentes, Marcos Vásquez,
Claudia Corvalán, Gabriel León, Isabel Gómez,
Alejandro Araya, Loreto Holuigue, Jesús Vicente-
Carbajosa, and Xavier Jordana. 2009. “A Nuclear
Gene Encoding the Iron-Sulfur Subunit of
Mitochondrial Complex II Is Regulated by B3
Domain Transcription Factors during Seed
Development in Arabidopsis. SUPPLEMENTAL.”
Plant Physiology.
https://doi.org/10.1104/pp.109.136531.
Sandelin, Albin, Wyeth W. Wasserman, and Boris Lenhard.
2004. “ConSite: Web-Based Prediction of Regulatory
Elements Using Cross-Species Comparison.” Nucleic
Acids Research 32 (WEB SERVER ISS.).
https://doi.org/10.1093/nar/gkh372.
Schwenkert, Serena, Daili J. A. Netz, Jeverson Frazzon,
Antonio J. Pierik, Eckhard Bill, Jeferson Gross,
Roland Lill, and Jörg Meurer. 2010. “Chloroplast
HCF101 Is a Scaffold Protein for [4Fe-4S] Cluster
Assembly.” Biochemical Journal 425 (1):207–18.
https://doi.org/10.1042/BJ20091290.
Shan, Hongyan, Ning Zhang, Cuijing Liu, Guixia Xu, Jian
Zhang, Zhiduan Chen, and Hongzhi Kong. 2007.
“Patterns of Gene Duplication and Functional
Diversification during the Evolution of the
AP1/SQUA Subfamily of Plant MADS-Box Genes.”
Molecular Phylogenetics and Evolution 44 (1):26–41.
https://doi.org/10.1016/j.ympev.2007.02.016.
Shuichi, Yanagisawa. 2002. “The Dof Family of Plant
Transcription Factors.” Trends in Plant Science, 2002,
7:12:555-560 7 (12):555–60.
https://doi.org/10.1016/S1360-1385(02)02362-2.
Singh, K. 2002. “Transcription Factors in Plant Defense and
Stress Responses.” Current Opinion in Plant Biology
5 (5):430–36. https://doi.org/10.1016/S1369-
5266(02)00289-3.
Singh, Karam B. 1998. “Transcriptional Regulation in
Plants: The Importance of Combinatorial Control.”
Plant Physiology 118 (4):1111–20.
https://doi.org/10.1104/pp.118.4.1111.
Spitz, François, and Eileen E M Furlong. 2012.
“Transcription Factors: From Enhancer Binding to
Developmental Control.” Nature Reviews Genetics.
https://doi.org/10.1038/nrg3207.
Stormo, G. D. 2000. “DNA Binding Sites: Representation
and Discovery.” Bioinformatics 16 (1):16–23.
https://doi.org/10.1093/bioinformatics/16.1.16.
Tsuji, Hiroyuki, Koichiro Aya, Miyako Ueguchi-Tanaka,
Yukihisa Shimada, Mikio Nakazono, Ryosuke
Watanabe, Naoko K. Nishizawa, et al. 2006.
“GAMYB Controls Different Sets of Genes and Is
Differentially Regulated by microRNA in Aleurone
Cells and Anthers.” Plant Journal 47 (3):427–44.
https://doi.org/10.1111/j.1365-313X.2006.02795.x.
Uno, Y, T Furihata, H Abe, R Yoshida, K Shinozaki, and K
Yamaguchi-Shinozaki. 2000. “Arabidopsis Basic
Leucine Zipper Transcription Factors Involved in an
Abscisic Acid-Dependent Signal Transduction
Pathway under Drought and High-Salinity
Conditions.” Proceedings of the National Academy of
Sciences of the United States of America 97
(21):11632–37.
https://doi.org/10.1073/pnas.190309197.
Weber, Gerald. 2013. “TfReg: Calculating DNA and RNA
Melting Temperatures and Opening Profiles with
Mesoscopic Models.” Bioinformatics 29 (10):1345–
47. https://doi.org/10.1093/bioinformatics/btt133.
Webmaster, Carl I., Leonard C. Packman, Keng-Rock Pwee,
and Jhon C. Gray. 1997. “High Mobility Group
Proteins HMG-1 and HMG-I/Y Bind to a Positive
Regulatory Region of the Pea Plastocyanin Gene
Promoter.” The Plant Journal 11 (4):703–7015.
https://doi.org/10.1046/j.1365-
313X.1997.11040703.x/epdf.
Wray, Gregory A., Matthew W. Hahn, Ehab Abouheif,
James P. Balhoff, Margaret Pizer, Matthew V.
Rockman, and Laura A. Romano. 2003. “The
Evolution of Transcriptional Regulation in
Eukaryotes.” Molecular Biology and Evolution.
https://doi.org/10.1093/molbev/msg140.
Yamamoto, Masayuki P, Yasuyuki Onodera, Satoru M
Touno, and Fumio Takaiwa. 2006. “Synergism
between RPBF Dof and RISBZ1 bZIP Activators in
the Regulation of Rice Seed Expression Genes 1 [ W
].” Plant Physiology 141 (August):1694–1707.
https://doi.org/10.1104/pp.106.082826.cereals.
Yanagisawa, Shuichi. 1995. “A Novel DNA-Binding
Domain That May Form a Single Zinc Finger Motif.”
Nucleic Acids Research 23 (17):3403–10.
https://doi.org/10.1093/nar/23.17.3403.
Zhang, B. 1995. “Interactions between Distinct Types of
DNA Binding Proteins Enhance Binding to Ocs
Element Promoter Sequences.” THE PLANT CELL
ONLINE 7 (12):2241–52.
https://doi.org/10.1105/tpc.7.12.2241.