Vous êtes sur la page 1sur 2

ABSTRAK

Penisilin merupakan antibiotik yang mengalami resistensi terhadap bakteri


Staphylococcus aureus. Kasus resistensi antibiotik golongan Penisilin terhadap
Staphylococcus aureus disebut dengan MRSA yang merupakan penyebab utama
infeksi nosokomial di berbagai rumah sakit di dunia, termasuk Indonesia.
Resistensi ini diperantarai oleh gen yang mengkode beta laktamase yaitu gen
blaZ. Sekresi Enzim ß-Laktamase menginaktivasi antibiotik dengan hidrolisis
cincin ß-Laktam sehingga bakteri menjadi resisten. Pendeteksian resistensi dapat
dilakukan dengan metode PCR yang membutuhkan primer berupa sederet sekuens
DNA pendek sebagai pengenal DNA target. Pengujian secara in silico merupakan
salah satu metode yang paling efektif dan efisien dalam merancang suatu primer.
Metode yang digunakan dalam desain primer secara in silico berbasis
bioinformatika adalah dengan menggunakan situs NCBI, Primer3Plus, dan
OligoAnalyzer. Hasil perancangan primer gen blaZ Staphylococcus aureus
diperoleh 10 kandidat primer dari suhu leleh (Tm) optimum 55°C dan 60°C.
Primer yang memiliki kriteria primer terbaik untuk deteksi gen blaZ
Staphylococcus aureus adalah primer 1 yang memiliki urutan basa primer forward
ATTTGCCTATGCTTCGACTT dan urutan basa primer reverse
GCTTGACCACTTTTATCAGC. Kriteria rancangan primer yang dihasilkan yaitu
memiliki panjang basa 20 bp, Tm 55,4°C dan 55°C, %GC sebesar 40% dan 45%,
hairpin dengan nilai ΔG -0,75 dan 1,23 kcal/mol, self dimer dengan nilai ΔG -
3,14 kcal/mol, serta hetero dimer dengan nilai ΔG -4,74 kcal/mol.
Kata kunci : Desain primer, gen blaZ, resistensi, Penisilin, S.aureus, in silico

xvii
ABSTRACT
Penicillin is an antibiotic that has resistance to Staphylococcus aureus
bacteria. Cases of Penicillin-class antibiotic resistance to Staphylococcus aureus
called MRSA which is a major cause of nosocomial infections in various hospitals
in the world, including Indonesia. This resistance mediated by a gene that
encodes beta lactamase is blaZ gene. ß-lactamase enzyme secretion inactivates
antibiotics by hydrolysis of ß-lactam rings so that bacteria become resistant.
Detection of resistance can be done by PCR method which requires a primer in
the form of a short DNA sequences as target DNA identifiers. In silico testing is
one method that is effective and efficient in designing a primer. The method used
in primary design in silico based bioinformatics is to use the site of NCBI,
Primer3Plus, and OligoAnalyzer. The results primary design of the
Staphylococcus aureus blaZ gene obtained 10 primary candidates from the
optimum melting temperature (Tm) of 55 ° C and 60 ° C. The best primary criteria
for blaZ gene detection Staphylococcus aureus is primary 1 which has a forward
primary base sequence ATTTGCCTATGCTTCGACTT and reverse primary base
sequence GCTTGACCACTTTTATCAGC. The primary design criteria produced
are having a base length of 20 bp, Tm 55.4 ° C and 55 ° C,% GC of 40% and
45%, hairpin with a value of ΔG -0.75 and 1.23 kcal / mol, self dimer with a value
of ΔG -3.14 kcal / mol, and hetero dimer with a value of ΔG -4.74 kcal / mol.
Keyword: Primary design, blaZ gene, resistance, S.aureus, in silico

xviii