Biotechnology & Biotechnological Equipment

ISSN: 1310-2818 (Print) 1314-3530 (Online) Journal homepage: http://www.tandfonline.com/loi/tbeq20

Isolation and Characterization of Terminal Flower1

Homolog Promoter from Precocious Trifoliata
Mutant (Poncirus Trifoliata L. Raf.) in Transgenic
Arabidopsis

L. Mei, J.Z. Zhang, Z. Li, J. Liu & C. Hu

To cite this article: L. Mei, J.Z. Zhang, Z. Li, J. Liu & C. Hu (2009) Isolation and Characterization of
Terminal Flower1 Homolog Promoter from Precocious Trifoliata Mutant (Poncirus Trifoliata L. Raf.)
in Transgenic Arabidopsis, Biotechnology & Biotechnological Equipment, 23:4, 1485-1488, DOI:
10.2478/V10133-009-0016-4

To link to this article: http://dx.doi.org/10.2478/V10133-009-0016-4

© 2009 Taylor and Francis Group, LLC

Published online: 15 Apr 2014.

Submit your article to this journal

Article views: 69

View related articles

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=tbeq20

Download by: [103.255.5.115] Date: 17 February 2017, At: 19:25

 Article DOI: 10.2478/v10133-009-0016-4 A&EB

ISOLATION AND CHARACTERIZATION OF TERMINAL FLOWER1

HOMOLOG PROMOTER FROM PRECOCIOUS TRIFOLIATA MUTANT
(PONCIRUS TRIFOLIATA L. RAF.) IN TRANSGENIC ARABIDOPSIS
L. Mei1, J.Z. Zhang1, Z. Li1, J. Liu2, C. Hu1
1
Huazhong Agricultural University, College of Horticulture and Forestry Science, Wuhan, P. R. China
2
Huazhong Agricultural University, National Key Laboratory of Crop Genetic Improvement,
Wuhan, P. R. China
Correspondence to: Chungen Hu
E-mail: chungen@mail.hzau.edu.cn

ABSTRACT
The long juvenile phase in woody plants is a serious constraint for traditional or transgenic breeding practices. TERMINAL
FLOWER 1 (TFL1) delayed flowering and regulated plant growth through the maintenance of indeterminacy of the shoot apex. To
reveal the regulatory mechanism of TFL homolog in poncirus trifoliata L. Raf mutant (PtTFL), a 5’upstream promoter fragment
(1 287 bp) was isolated and PtTFL: GUS was constructed and introduced into Arabidopsis thaliana. The result indicated that
PtTFL promoter expression showed shoot meristem identity and the activity was positively related with juvenile Arabidopsis
before and during plant differentiation phase. Exogenous gibberellins had a complex regulation on the promoter activity. Abscisic
acid decreased the promoter activity to 75%, and an ABRE negative regulator “ttaggACGTcagtg” was identified. The behavior
of PtTFL promoter activity in short day indicated its correlation with plant development growth. These results may potentially
provide a shoot meristem identity promoter in certain developmental stage for genetic engineering.

Keyword: Abscisic Acid, Arabidopsis thaliana, gibberellins,
TERMINAL FLOWER, promoter
Abbreviations: ABRE: Abscisic acid responsive element;
GARE: GA-regulated elements; TFL TERMINAL FLOWER
Biotechnol. & Biotechnol. Eq. 2009, 23(4), 1485-1488
Introduction
The long juvenile phase in woody plants is a serious
constraint for traditional or transgenic breeding practices
(13). TERMINAL FLOWER 1 (TFL1) delayed flowering
and regulated plant growth through the maintenance of
indeterminacy of the shoot apex in Arabidopsis and other
plants (14). TFL homologue (CsTFL) in Washington navel
orange (Citrus sinensis L. Osbeck) encoded a 19-kD protein
that shared 65% identity to the Arabidopsis TFL1 protein and
AmCEN proteins (12). Ectopic expression of CsTFL caused
a significant delay in flowering and increase in inflorescence
production in both wild-type and tfl1-2 plants (17). Antisense
expression of MdTFL1, a TFL 1-like gene, reduces the juvenile
phase in apples (10).
Precocious trifoliate orange was a spontaneous mutant
with a short juvenile phase derived from Poncirus trifoliata (L.
Raf.). Twenty percent of the seedlings flowered in the first year
after germination and then flowered twice or three times per year,
whereas wild-type trifoliate orange usually has a juvenile period
of 5 to 8 years (11). It is speculated to be a direct variant of the
wild-type (16). A two-dimensional suppressive subtractive
hybridization (SSH) library in a previous study in our laboratory
Biotechnol. & Biotechnol. Eq. 23/2009/4
have found a total of 274 different expressed sequence tags
(ESTs) between precocious trifoliate orange and wild-type
trifoliate orange, including the FT, TFL and other flowering-
related homologue genes with expression patterns showing
flowering-related features (25). In the present investigation,
we reported the isolation of the promoter region of the PtTFL
and made an investigation on the promoter structure and
expression pattern in shoot meristem identity, as well as assay
in responding to exogenous gibberellins and Abscisic Acid
treatment via transformation in Arabidopsis.
Materials and Methods
PtTFL promoter isolation and bioinformatics analysis
Precocious trifoliate orange samples were collected in the
fields of the National Citrus Breeding Center at Huazhong
Agricultural University. High quality DNA was extracted
according to Cheng (5). The 5’-upstream sequence of PtTFL
was isolated by BD Universal Genome Walker kit (Clontech,
USA), with two pairs of primers tfl1 & tfl2, tfl3 & tfl4 designed
based on CsTFL (accession no. AY344244)
tfl1: TTCAATCACATCTCCAATGACTCCTCCAACAGC;
tfl2: CTGCCATTTGAGATGTATGTATAGAGGGAGGAA;
tfl3: GCGATGGAACTCAGGGGTAATCAGACG;
tfl4: AAGATTGGCAAGACGAAGATGCTGGAT.
Promoter element and motif search of the PtTFL promoter
was carried out to define basic elements and putative cis-
elements with PLACE programs (8) and MatInspector (4, 18).
1485
Construction of binary vectors, Arabidopsis
transformation and exogenous treatments
PtTFL promoter was ligated to pCAMBIA1391z and
verified by sequencing. The construct was then introduced
into Agrobacterium tumefaciens GV3101 and transferred
into Arabidopsis thaliana Columbia-0 by the floral dip (6).
Transformed plants were selected on 1/2 MS, containing 25
µg/ml hygromycine (Sigma) and 100 µg/ml carbenicillin
(Sigma). Over ten-day-old T1 seedlings were transferred to
growth chamber at 220C in long day growth condition (16 h
day/8 h night). Of these, four independent T2 transgenic lines
were planted for phenotype assay.
For gibberellins treatment, 1 mg/ml GA3 (Sigma) was
added to the 1/2 MS medium for germination of T2 seedlings.
Application of exogenous GA3 on soil-grown plant was
achieved by spraying soil-grown plants twice weekly with a
solution of 100 µM GA3 and 0.02% Tween-20 (Bio-Rad) both
in long day and short day (9 h day/ 15 h night) in a growth
chamber (2). For Abscisic Acid treatment, 30 µM Abscisic
Acid (ABA) (Sigma) was implied to T2 plants in long day
with the same interval. Samples were collected the day after
spaying.
Histochemical localization and fluorometric measurement
of GUS activity
GUS staining was carried out as described by Jefferson
(9) with some modifications. Young seedlings at different
developmental stages and different parts of transgenic plants
were immersed in X-gluc solution (Sigma) (1 mg/ml X-gluc,
100 mM sodium phosphate buffer [pH 7.0], 10 mM EDTA,
1 mM potassium ferricyanide, 1 mM potassium ferrocyanide,
1% TritonX-100, 100 µg/ml chloramphenicol, 20% methanol)
and incubated for 16-24 h at 370C, and then immersed in
70% ethanol for 3~4 times. The samples were observed and
photographed under microscope.
For fluorometric measurement of GUS activity, seedlings,
shoots or leaves were ground to a fine powder using liquid
nitrogen, and then suspended in 1ml GUS extraction buffer
(50 mM sodium phosphate, pH 7.0; 0.1% Triton X-100; 10
mM β-mercaptoethanol; 10 mM EDTA and 0.1% sarcosyl,
v/v). The supernatant, after being centrifuged at 12 000 g for
20 min at 40C, was assayed for GUS activity with 4-methyl
umbelliferyl glucuronide (4-MUG) (Sigma) substrate using
a F-4500 fluorescence spectrophotometer (Hitachi, Tokyo) at
the excitation/emission wavelengths of 365nm/455nm. The
protein concentrations were quantified according to Bradford
(3) and the GUS enzyme activity was expressed as nmol
of 4-methylumbelliferone (MU) produced per mg protein
per min.
Results and Discussion
Sequence characterization of PtTFL promoter
A 5’ upstream fragment of PtTFL of 1287 bp was amplified.
Promoter motif search indicated two putative basic elements:
TATA box and CAAT box in -31 bp and -290 bp upstream
1486
transcription start site T (TSS, +1) (4, 8, 18) (Fig. 1). Cis-
regulatory elements included two copies of light inducibility
(-923~-907 bp, -602~-588 bp), two copies of GA-regulated
elements (GARE) (-582~-566 bp, -1017~-1001 bp) (Fig. 1),
together with several cis-elements in response to drought-
inducibility and defense signaling (data not shown). The fact
that many cis-elements related to various signals were present
in the promoter region suggested that the PtTFL gene must be
controlled by a complicated regulatory mechanism.
Fig. 1. Schematic representation of constructs containing the PtTFL promoter
gene (GUS) and the transcriptional terminator of the nopaline synthase
gene (NOS). PtTFL promoter ends (-1142~+145 bp) and cis-elements were
annotated. GA-regulated elements (-1017~-1001 bp, -582~-566 bp); light
inducible element (-923~-907bp, -602~-588bp); ABRE-like (Abscisic acid
responsive like element) (-744~-737 bp) and promoter basic elements CAAT
box (-290 bp), TATA box (-31 bp), TSS (transcription start site, +1) and
translation start codon (ATG, +101bp) were indicated
Temporal and tissue specific expression pattern of PtTFL
promoter in Arabidopsis
Due to the active role of PtTFL in maintaining the undetermined
bud in juvenile phage in citrus, we detected the PtTFL promoter
activity from juvenile to adult phage for 30 days in transgenic
Arabidopsis. As shown in Fig. 2, PtTFL promoter activity was
detected in cotyledon, shoot apical meristem in 7-day and 10-
day seedling, but no expression in radical and hypocotyls (Fig.
2a, 2b). This expression pattern was then mainly concentrated
in central part of 15- and 20-day seedlings (Fig. 2c, 2d). PtTFL
promoter was also detected in cutting sites of rosette and
cauline leaves in 25-day plant beside apex, which indicated that
PtTFL promoter was also inducible by wounding (Fig. 2e, 2f,
2g). Quantitative assay indicated that PtTFL promoter activity
was positively related with plant vegetative development and
was highlighted in 25-day plant, when floral bud was about
to be visible and then declined onwards (Fig. 3). These may
indicated that PtTFL expression becomes more specific with
the developmental process and may function more intensively
with the plant growth in transgenic Arabidopsis thaliana.
In reproductive phage, GUS staining was comparatively
weaker, detectable in incision of rosette leave and stems of
inflorescence (Fig. 2h, 2i, 2j), but not in any floral organ or
sillique in adult plant (Fig. 2k, 2l). Contrasted to TFL homolog
expression floral organs in citrus (17, 22), PtTFL promoter
expression was more consistent with the expression of AtTFL1.
It was detected only clearly at the switch to inflorescence
identity at about day 12 onwards and then strong and found
throughout upper axillary shoot meristems in the wild type
Biotechnol. & Biotechnol. Eq. 23/2009/4
were documented (20). This discrepancy with TFL homolog
expression in citrus may be due to different tissue systems
and different regulatory mechanisms in perennial precocious
trifoliate and annual Arabidopsis plants. These results
indicated that PtTFL promoter expression modulated precise
transcriptional regulation of specific and developmental of the
transgenic Arabidopsis, and may potentially provide an apex
identity promoter in certain developmental stage.
Fig. 2. Histochemical localization of GUS activity in long day. (a to d)
seedling at day 7, 10, 15 and 20; (e to g) leaves of 25-day plant; (e, f) young
and old rosette leave; (g) cauline leaf; (h) rosette leave in 30-day plant; (i to
k) flower organ and stem, (i) floral buds; (j) fully-expanded flower; (k) flower
organ; (l) silique. Bar: 1 mm
PtTFL promoter activity responding to photoperiod
Arabidopsis is a facultative long day plant. In short day, when
CO expression was shut down, and FT cannot be transferred
to plant apex and initiate flowering, LFY expression was also
largely decreased (19, 22, 23). Therefore, plant growth was
severely retarded. GUS quantitative assay (Fig. 3) showed
PtTFL promoter activity in LD climbed its peak at 25th day
and then declined in accompany with anthesis of the transgenic
plant. In contrast, the promoter activity remained moderately
increasing in SD and the plant maintained undetermined
stage. This result indicated the PtTFL promoter activity
was positively related with the development stage and the
decreasing of promoter activity was closely correlated with
flowering in Arabidopsis.
PtTFL promoter expression in response to gibberellins
and abscisic acid
Two GA-regulated elements were identified in PtTFL promoter
according to bioinformatic analysis (Fig. 1), thus, GA3 was
implemented to transgenic Arabidopsis. The result indicated
Biotechnol. & Biotechnol. Eq. 23/2009/4
that GA3 speed up the plant cell elongation and accelerated
flowering (5±0.3 ahead of time) and the promoter activity was
not severely changed. On the whole, PtTFL promoter activity
with GA3 treatment was complexly regulated, lower in 17-day
than 7-day plant, and then increased with the plant growth
throughout plant phase change. That is to say, GA3 maintained
the promoter activity in a high level in 30-day plant, when
expression was about to decline in non-treatment (Fig. 4). In
comparison to the non-treatment, the promoter activity was
first higher than non-treatment at day 7, and then became
lower later on until day 25, when floral differentiation initiated.
The GARE was ever identified in myb gene (7) and wheat
α-amylase promoter (24), in which GARE is essential for high
level expression for these promoters. On the other hand, in
Arabidopsis thiliana, TFL1 was reciprocally regulated by LFY,
while LFY was obviously regulated by exogenous GA3 on its
promoter in short day (2, 12). Thus, it was speculated that
PtTFL was reciprocally regulated by LFY’s response to GA3.
Fig. 3. Quantification assay of GUS activity responding to photoperiod in
transgenic Arabidopsis. SD: short day; LD: long day. Arrowhead means the
time of plant anthesis. Error bars represent standard error
Fig. 4. Quantification assay of GUS activity responding to GA3 and ABA
treatment in transgenic Arabidopsis in long day (LD) (water is use as a
control). Arrowhead pointed to the time of plant anthesis. Error bars represent
standard error
Conversely, ABA treatment delayed the plant growth,
thus 3±0.4 days lag behind that of a normal plant to flower.
Implement of ABA delayed the plant growth, made leaves
thicker and generally decreased the promoter activity to 75%
1487
on average (Fig. 4). ABRE, consisting of an ACGT core-
containing element (ACGT box) and a coupling element (CE)
were necessary and sufficient for ABA induction of gene
expression in cereal plants (21) and ABR1, an APETALA2-
domain transcription factor that functions as a repressor of ABA
response in Arabidopsis (15). In PtTFL promoter, the sequence
“ttaggACGTcagtg” at -745 bp and CE1, 29 bp upstream the
ACGT-like box, designated as ABRE-like sequence, might act
as a negative regulator in response to ABA. Besides, Fleshy
organs due to retardance of plant growth may attribute to
decrease of the promoter activity in response to ABA.
Conclusions
All these results demonstrated that PtTFL was strongly
regulated by the various environmental signals, both by short
day growth and exogenous GA3 and ABA. The promoter is
the core regulation element for DNA specific expression.
Precise regulation will facilitate the gene expression and
plant development. It is expected that this work will provide
a framework into the regions that control the temporal- and
spatial-specific expression and exogenous responses of the
PtTFL gene. The specificity in shoot meristem in a specific
developmental stage of this promoter is promising for its
application for engineering into a range of plants, so it is
expected to be a good candidate for expression or accumulation
of foreign genes of interest who are preferentially required in
shoot meristem in a certain developmental stage.
Acknowledgements
This work was supported by grants from the National Natural
Science Foundation of China (No. 30370996) and the 863
project of China (No. 2007AA10Z188).
REFERENCES
1. Blazquez M.A. (1997) Development, 124, 3835-3844.
2. Blazquez M.A., Green R., Nilsson O., Sussman M.R.,
Weigel D. (1998) The Plant Cell, 10, 791-798.
3. Bradford M.M. (1976) Anal. Biochem., 72, 248-254.
4. Cartharius K., Frech K., Grote K., Klocke B., Haltmeier
M., Klingenhoff A., Frisch M., Bayerlein M. and Werner
T. (2005) Bioinformatics, 21, 2933-2942.
5. Cheng Y.J., Guo W.W., Yi H.L., Pang X.M., Deng X.
(2003) Plant Mol. Biol. Rep., 21, 177-178.
1488
6. Clough S.J. and Bent A.F. (1998) The Plant J., l16, 735-
743.
7. Gubler F., Kalla R., Roberts J.K., Jacobsen J.V. (1995)
The Plant Cell Online, 7, 1879-1891.
8. Higo K., Ugawa Y., Iwamoto M., Korenaga T. (1999)
Nucleic Acids Res., 27, 297-300.
9. Jefferson R.A., Kavanagh T.A., Bevan M.W. (1987)
EMBO J., 6, 3901-3907.
10. Kotoda N., Iwanami H., Takahashi S., Abe K. (2006) J.
Am. Soc. Hort. Sci., 131, 74-81.
11. Liang S.Q., Zhu W.X., Xiang W.T. (1999) Zhe Jiang
Citrus, 16, 2-4. (in Chinese)
12. Liljegren S.J., Gustafson-Brown C., Pinyopich A., Ditta
G.S., Yanofsky M.F. (1999) The Plant Cell Online, 11,
1007-1018.
13. Meilan R. (1997) New Forests, 14, 179-202.
14. Nakagawa M., Shimamoto K., Kyozuka J. (2002) The
Plant J., 29, 743-750.
15. Pandey G.K., Grant J.J., Cheong Y.H., Kim B.G., Li L.,
Luan S. (2005) Plant Physiol., 139, 1185-1193.
16. Pang X.M. and Wen X.P. (2006) J. Horti. Sci. Bio., 81(2),
269.
17. Pillitteri L.J., Lovatt C.J., Walling L.L. (2004) Plant
Physiol., 135, 1540-1551.
18. Prestridge D.S. (1991) Comput. Appl. in the Biosci., 7,
203-206.
19. Putterill J., Robson F., Lee K., Simon R., Coupland G.
(1995) Cell, 80, 847-857.
20. Ratcliffe O.J. (1999) Development, 126, 1109-1120.
21. Shen Q.J., Casaretto J.A., Zhang P., Ho T.H.D. (2004)
Plant Mol. Bio., 54, 111-124.
22. Suarez-Lopez P., Wheatley K., Robson F., Onouchi H.,
Valverde F., Coupland G. (2001) Nature, 410, 1116-1120.
23. Teper-Bamnolker P. and Samach A. (2005) The Plant
Cell Online, 17, 2661-2675.
24. Tregear J.W., Primavesi L.F., Huttly A.K. (1995) Plant
Mol. Bio., 29, 749-758.
25. Zhang J.Z., Li Z.M., Liu L., Mei L., Yao J.L., Hu C.G.
(2008) Tree Physiol., 28, 1449-1457.
Biotechnol. & Biotechnol. Eq. 23/2009/4