European Journal of Soil Biology 56 (2013) 72e83

Contents lists available at SciVerse ScienceDirect

European Journal of Soil Biology

journal homepage: http://www.elsevier.com/locate/ejsobi

Original article

Chromium reducing and plant growth promoting novel strain

Pseudomonas aeruginosa OSG41 enhance chickpea growth
in chromium amended soils
Mohammad Oves*, Mohammad Saghir Khan, Almas Zaidi
Department of Agricultural Microbiology, Faculty of Agricultural Sciences, Aligarh Muslim University, Aligarh 202002, Uttar Pradesh, India

a r t i c l e i n f o a b s t r a c t

Article history: Pseudomonas aeruginosa strain OSG41, isolated from the heavy metal contaminated water irrigated to
Received 14 October 2012 rhizospheric soil of mustard crop, tolerated chromium up to the concentration of 1800 mg ml
1 and
Received in revised form reduced it by 100% at pH 6e8 after 120 h incubation at 30e40  C. P. aeruginosa produced plant growth-
9 January 2013
promoting substances, both in the presence and absence of chromium; it produced 32 mg ml
1 indole
Accepted 15 February 2013
Available online 16 March 2013
acetic acid ml
1, in Luria Bertani broth with 100 mg tryptophan ml
1, solubilized tri-calcium phosphate
Handling editor: Kristina Lindström (417 mg ml
1) and secreted 20.8 mg ml
1 exopolysaccharides (EPS) which decreased with increasing
concentration of chromium added to growth medium. While investigating the impact of hexavalent
Keywords:
chromium on chickpea, chromium application to soil had a phytotoxic effect. The application of P. aer-
Pseudomonas aeruginosa uginosa strain OSG41 even with three times concentration of chromium increased the dry matter
Chromium bioreduction accumulation, symbiotic attributes (like nodule formation), grain yield and protein of chickpea compared
EPS to non-inoculated plants. The bio-inoculant decreased the uptake of chromium by 36, 38 and 40% in
Proline roots, shoots and grains, respectively. The present finding suggests that the bioinoculant effectively
PGP activities reduced the toxicity of hexavalent chromium to chickpea plants and concurrently enhanced the bio-
logical and chemical characteristics of chickpea, when grown in chromium treated soils.
Ó 2013 Elsevier Masson SAS. All rights reserved.

1. Introduction through the membrane transport channels and following accu-

Chromium is one of the major environmental pollutants which
enter the agro-ecosystem from different sources like, metal fin-
ishing, leather tanning, chromate preparation, and cooling tower of
nuclear reactor. Of the various forms of chromium, hexavalent
chromium (Cr6þ) is mutagenic and carcinogenic [1]. After accu-
mulation, the elevated concentration of chromium in soil severely
affects the composition and metabolic activities of microbes [2e4]
leading to losses in soil fertility [5] and also adversely affects the
physiological process of plants [6].
In this context, the toxicity of chromium to various plant growth
promoting rhizobacteria (PGPR) for example Bacillus spp. [7,8];
Pseudomonas aeruginosa [9], asymbiotic bacteria such as Azoto-
bacter and symbiotic organism, Rhizobium [6,10] are reported.
Mechanistically, when microbes are exposed to chromium polluted
environment, hexavalent chromium enters the microbial cells
* Corresponding author. Tel./fax: þ91 571203516, þ91 9808688081 (mobile).
E-mail addresses: owais.micro@gmail.com, owais01m@gmail.com (M. Oves),
khanms17@rediffmail.com (M.S. Khan), alma29@rediffmail.com (A. Zaidi).
mulation inside, Cr(vi) is reported to oxidatively damage bio-
molecules like, DNA and other cellular components [11]. More-
over, the other intermediate species of chromium produced from
hexavalent chromium like Crþ5 and Crþ4, have also been found to
exhibit mutagenic and carcinogenic effects on many biological
systems including microbial populations [12,13]. Besides these ef-
fects, the high concentration of different forms of chromium has
also been observed to have negative impact on microbial enzymes
[14] such as nitrate reductase in anaerobic soil microcosms [15].
Soil enzymes in general act as a biological catalyst to facilitate
different reactions and physiological processes involved in the
decomposition of various soil constituents including certain
organic pollutants and ultimately affect the soil fertility [16]. While
acting on enzymes, chromium interacts with the enzyme substrate
complexes, binds with the enzyme active sites and consequently
denatures enzyme functions [17]. Additionally, at high concentra-
tion, chromium inhibits the oxygen uptake and induces petite
mutation in microbes [18]. Conclusively, these studies suggest that
chromium disrupts the electron transport system of cell and hence,
affect the metabolic process of microorganisms. As a result of
altered soil fertility, the deposited chromium in soil can indirectly

1164-5563/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved.
http://dx.doi.org/10.1016/j.ejsobi.2013.02.002
 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
(by reducing soil fertility) restrict the growth of plants. Thus, apart
from their effect on various metabolic activities of microbes,
chromium has also been reported to inhibit different important
physiological processes of plants. The uptake and transport of
chromium to various organs of plants, may cause direct adverse
impact such as it may- (i) alter mineral nutrition (ii) impair
photosynthesis in legumes for example greengram [Vigna radiata
(L.) wilczek] [19] and consequently decrease chlorophyll content
[3,20] (iii) inactivate enzymes by interacting with sulfhydryl groups
of proteins [21] and (iv) decrease plant growth and seed yield
[22,23]. These and other associated data thus clearly suggests that
the toxicity of chromium to variable agro-ecological environments
including soil requires an inexpensive and effective strategy to
clean up the contaminated sites. In this context, certain physico-
chemical approaches like, electrochemical treatment, ion ex-
change, precipitation, evaporation, reverse osmosis and sedimen-
tation have been used for detoxifying chromium polluted
environment [24,25]. However, due to difficulty in (i) operation at
larger scale (ii) negative impact on the environment and (iii) pro-
hibitive cost of operation, these physicochemical methods [26]
have not been widely practiced for chromium removal. Consid-
ering these factors, focus has been shifted on to find some low-cost
option for removing/reducing chromium toxicity from the
contaminated regions. In this regard, the use of bacterial cultures
especially the plant growth promoting rhizobacteria has provided
an attractive and economical alternative for biological reduction of
Cr6þ from contaminated environments [27,28]. Mechanistically,
PGPR reduce the metal toxicity by different mechanisms such as
biosorption, mobilizing metals through the excretion of organic
acids or bioleaching, immobilization or bio-mineralization, intra-
cellular accumulation, and enzyme-catalyzed transformation
[24,28]. Apart from metal removal/detoxification, metal-tolerant
microbes provide hugely important nutrients to plants [29], pro-
tect plants from nuisance of phytopathogens by synthesizing
antimicrobial compounds, cyanogenic compounds and side-
rophores and accelerate the availability of phytohormones such as
indole acetic acid (IAA) etc. when applied to seed and soil [30]. As a
result of these multifaceted activities, PGPR enhance the overall
growth, and yield of plants even when grown in soils already
contaminated with heavy metals or soils deliberately designed for
testing the toxicity of metals or bioremediation potential of
microbes.
Compared to the vast and varied inherent functional properties
of PGPR, there is little information available on the role of metal
tolerant PGPR on the growth and development of legumes espe-
cially chickpea when grown intentionally in metal contaminated
soils or in soils already polluted with heavy metals like chromium.
Considering these applied and extremely important agronomic
gaps, the present study was designed to search for a suitable hex-
avalent chromium reducing PGPR and to determine its proline
stress reducing ability and plant growth-promoting activity both in
the presence and absence of chromium. The growth promoting
potentials of the selected metal tolerant bacterial culture was
assessed further in a pot trial experiment using chickpea (Cicer
arietinum L.) as a test crop.
2. Materials and methods
2.1. Heavy metal concentration in soil
The alluvial sandy clay loam soil samples for total heavy metals
were collected from the cultivated fields near industrial area of
Ghaziabad (S1), located at 28 400 N 77 250 E 28.67 N 77.42 E, Uttar
Pradesh, India and also from the cultivated but unpolluted sandy
clay loam soil from the fields of Faculty of Agricultural Sciences (S2),
73
Aligarh Muslim University, Aligarh, located at 27 530 N 78 050 E 27.
88 N 78.08 E, Uttar Pradesh, India. There was consistent use of
industrial sewage water, discharged from Hindan River, at site S1.
The heavy metals in soil samples were determined following the
method of McGrath and Cunliffe [31] using flame atomic absorption
spectrophotometer (Model GBC 932B Plus atomic absorption
spectrophotometer). All chemicals used for heavy metal analysis
were of Analytical grade and solutions were prepared in double
distilled water.
2.2. Bacterial strains and evaluation of metal tolerance
In this study, a total of 20 bacterial cultures were isolated from
the rhizosphere of mustard (Brassica campestris) grown at the edge
of Hindan River near Ghaziabad. The polluted waste water of Hindan
River near Ghaziabad was used to irrigate the mustard field as and
when required. For enumerating bacterial cultures, King’s B agar
medium was used, and the selected cultures were maintained on
this medium until use. Preliminary test to identify bacterial isolates
included colony morphology, and cultural and biochemical charac-
teristics using standard methods [15]. The bacterial strains were
tested further to determine resistance/sensitivity against hexavalent
chromium (Cr6þ) by the chromium amended nutrient agar plate
dilution method. After sterility check, nutrient agar plates were
treated separately with increasing concentrations (0e2000 mg ml
1)
of Cr6þ (used as K2Cr2O7), and were spot inoculated with loopful
culture of overnight grown bacterial strain. Plates were incubated at
28  2  C for 48 h. The highest concentration of Cr6þ supporting
bacterial growth was defined as the maximum tolerance level (MTL).
Of the total 20 bacterial strains, strain OSG41 showing highest
tolerance to hexavalent chromium was selected for further studies.
2.3. Strain identification and phylogenetic tree construction
Heavy metal resistant bacteria isolate was characterized both
biochemically and molecularly. The biochemical tests conducted for
presumptive identification of strain OSG41 included, citrate utili-
zation, indole production, methyl red, nitrate reduction, Voges
Proskauer, catalase and oxidase test, gelatine liquefaction, carbo-
hydrates such as dextrose, mannitol and sucrose, utilization and
starch hydrolysis following standard methods [32]. Sequencing of
the 16S rRNA of strain OSG41 was done commercially by a DNA
sequencing service (Macrogen, Seoul, South Korea) using universal
primers, 518 F (50 CCAGCAGCCGCGGTAATACG30 ) and 800R (50
TACCAGGGTATCTAATCC30 ). Nucleotide sequence data was depos-
ited in the GenBank sequence database. The online programme
BLASTn was used to find related sequences with known taxonomic
information in the databank at the NCBI website (http://www.ncbi.
nlm.nih.gov/BLAST) to accurately identify strain OSG41. Further, the
16S rRNA gene sequence of the selected strains was characterized
using universal primer 518 F and 800 R. The sequence (1466 bp) so
obtained were analyzed using BLASTn programme at NCBI server
(http://www.ncbi.nlm.nih.gov/BLAST) to identify and compare the
isolate with the nearest neighbour sequence available in the NCBI
database [33]. All the sequence were aligned using Clustal W 1.6
programme at (www.ebi.ac.uk/clustalW), BLASTn alignment tools
used bootstrapped neighbour-joining relationship were estimated
with MEGA4 software [33].
2.4. Chromium reduction
The effect of pH values on Cr6þ reduction was assessed using
nutrient broth (NB) treated with varying concentrations (0, 50, 100,
200 and 400 mg ml
1) of Cr6þand the autoclaved medium was
adjusted to pH 4, 5, 6, 7, 8, 9 and 10 with 1 M HCL or 1 M NaOH. A
74 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
100 ml of exponentially grown culture of P. aeruginosa OSG41, was
inoculated into NB medium containing different concentrations of
hexavalent chromium and incubated at varying temperatures such
as 20, 25, 30 and 40  C for different time intervals (upto 120 h) in
order to assess the impact of temperatures on chromium reduction
by strain OSG41. For Cr6þ reduction, one ml culture from each flask
was centrifuged (6000 rpm) for 10 min at 10  C, and Cr6þ in the
supernatant was determined by the 1,5-diphenyl carbazide method
[34,35].
2.5. Bioassay of plant growth promoting (PGP) activities under
chromium stress
2.5.1. Phosphate solubilization and siderophore production
Various PGP activities such as, P-solubilization, indole acetic
acid (IAA), siderophores, and hydrogen cyanide (HCN) of the
bacterial strains were assayed both in the presence and absence
of the selected chromium salt under in vitro conditions. The
phosphate solubilization activity was quantitatively assayed us-
ing liquid culture medium containing tri-calcium phosphate
(TCP) amended with 0, 50, 100, 200 and 400 mg Cr ml
1. The
amount of water-soluble P was estimated by a chlorostannous
reduced molybdophosphoric acid blue method [36,37]. The pro-
ductions of siderophores by the P. aeruginosa OSG41 strain was
detected using the Chrome Azurol S (CAS) method [38] using the
four concentrations (50, 100, 200 and 400 mg ml
1) of chromium,
added to CAS agar plates. For quantitative estimation of side-
rophore, the P. aeruginosa OSG41 strain was grown in Modi me-
dium (K2HPO4 0.05%; MgSO4 0.04%; NaCl 0.01%; mannitol 1%;
glutamine 0.1%; NH4NO3 0.1%) treated with 0 50, 100, 200 and
400 mg Cr ml
1 for 5 days and Catechol-type phenolates was
measured [39]. For the assay, one volume of the Hathway’s re-
agent was added to one volume of sample, and absorbance was
determined at 560 nm for salicylates with sodium salicylate as a
standard and at 700 nm for dihydroxy phenols with 2,3-DHBA as
a standard.
2.5.2. Bioassay of indole acetic acid and cyanogenic compounds
Indole-3-acetic acid synthesized by P. aeruginosa OSG41 strain
was quantitatively evaluated by the method of Gordon and Weber
[40], later modified by Bric et al. [41]. For this activity, the P. aeru-
ginosa OSG41 strain was grown in Luria Bertani (LB) broth (g l
1:
tryptone 10; yeast extract 5; NaCl 10 and pH 7.5). A 100 ml of LB
having a fixed concentration (100 mg ml
1) of tryptophan as an
inducer (Glickmann and Dessaux, 1955) [42] and supplemented
with 0, 50, 100, 200 and 400 mg ml
1 of hexavalent chromium was
inoculated with 100 ml culture (108 cells ml
1) of P. aeruginosa
OSG41 strain and incubated for 7 days at 28  2  C with shaking at
120 rpm. After seven days, a 5 ml culture from each treatment was
centrifuged (8000 r/min) for 15 min and an aliquot of 2 ml super-
natant was mixed with 100 ml of orthophosphoric acid and 4 ml of
Salkowsky reagent (2% 0.5 M FeCl3 in 35% per-chloric acid) and
incubated at 28  2  C in darkness for 1 h. The absorbance of
developed pink colour was read at 530 nm. The IAA concentration
in the supernatant was determined using a calibration curve of
pure IAA as a standard. Hydrogen cyanide production by
P. aeruginosa OSG41 strain was detected by the method of Bakker
and Schipper [43]. For HCN production, P. aeruginosa OSG41 strain
was grown on an HCN induction medium (g l
1: tryptic soy broth
30; glycine 4.4 and agar 15) supplemented with 0, 50, 100, 200 and
400 mg ml
1 of hexavalent chromium at 28  2  C for 4 days.
Further, a loopful culture of strain OSG41 was placed in the centre
of the Petri plates, amended with selected concentration of hex-
avalent chromium. A disk of Whatman filter paper No. 1 dipped in
0.5% picric acid and 2% Na2CO3 was placed at the lid of the Petri
plates. Plates were sealed with parafilm. After 4 days incubation at
28  2  C, an orange brown colour of the paper indicating HCN
production was observed.
2.5.3. Ammonia and exo-polysaccharide synthesis
For ammonia (NH3) detection, P. aeruginosa OSG41 strain was
grown in peptone water with 0, 50, 100, 200 and 400 mg ml
1 of
hexavalent chromium and incubated at 28  2  C for 4 days. One
millilitre of Nessler reagent was added to each tube and the
development of yellow colour indicating ammonia production
was recorded following the method of Dye [44]. The exo-
polysaccharide (EPS) produced by the P. aeruginosa OSG41 was
determined as suggested by Mody et al. [45]. For this, the bacterial
strain was grown in 100 ml capacity flasks containing basal me-
dium supplemented with 5% sucrose and treated with 0, 50, 100,
200 and 400 of hexavalent chromium. Inoculated flasks were
incubated for 5 days at 28  2  C on a rotary shaker. Culture broth
was spun (8000 r/min) for 30 min and EPS was extracted by adding
three volumes of chilled acetone (CH3COCH3) to one volume of
supernatant. The precipitated EPS was repeatedly washed three
times alternately with distilled water and acetone, transferred to
a filter paper and weighed after overnight drying at room
temperature.
2.5.4. Plant growth and metal uptake
Seeds of chickpea var. Avrodhi were surface sterilized with 70%
ethanol, 3 min followed by 3% sodium hypochlorite, 3 min, rinsed
six times with sterile water and shade dried. The sterilized seeds
were bacterized with P. aeruginosa OSG41, grown in nutrient broth,
by dipping the seeds in liquid culture medium for 2 h using 10%
gum Arabic as adhesive to deliver approximately 108 cells seed
1.
The non-coated sterilized seeds soaked in sterile water served as
control. The non-inoculated and inoculated chickpea seeds (8 seeds
per pot) were sown in clay pots (25 cm high, 22 cm internal
diameter) using 3 kg unsterilized soils from agricultural field of
Aligarh Muslim University Aligarh (sandy clay loam, organic carbon
0.4%, Kjeldahl N 0.75 g kg
1, Olsen P 16 mg kg
1, pH 7.2 and WHC
0.45 ml g
1, Cr 6.5 mg g
1, Cu 18 mg g
1, Ni 14.7 mg g
1, Zn 25 mg g
1,
Pb 9.5 mg g
1 and Cd 0.4 mg g
1) with control (without chromium)
and four treatments each with 50, 100, 200, and 400 mg g
1 hex-
avalent chromium in soil used in this study. Six pots used for each
treatment were arranged in a complete randomized block design.
Three weeks after emergence, plants in each pot were thinned to
three plants. The pots were watered with tap water and were
maintained in an open field condition. The experiments were
conducted for two consecutive years to ascertain the reproduc-
ibility of data.
2.5.5. Measurement of biological characteristics, symbiotic efficiency,
seed yield and metal uptake
All plants in three pots for each treatment were removed at
80 days and remaining three pots at 130 days after seeding (DAS),
and were observed for growth and symbiotic attributes. Plants
uprooted at 80 and 130 DAS were oven-dried at 80  C and dry
matter was measured. Total chlorophyll content in fresh foliage of
inoculated chickpea plants grown in chromium stressed and
metal free (control) soil was measured at 80 DAS by the method of
Arnon [46]. The leghaemoglobin (Lb) content in fresh nodules
recovered from the root system of chickpea plants maintained
under metal stressed and metal free soils (control) was assessed at
80 DAS [47]. Seed yield and grain protein was estimated [48] at
130 DAS (harvest). Chromium content in roots and shoots of
chickpea plants was measured both at 80 and 130 DAS where as in
grains, it was determined at harvest by the method of Ouzounidou
et al. [49].
 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
2.5.6. Bioassay of proline
The proline content in roots and shoots of chickpea plants was
determined at 80 DAS while in seed it was assayed at 130 DAS. A
500 mg fresh weight of chickpea plant materials prepared sepa-
rately was homogenized with 10 ml of 3% aqueous sulfosalicylic
acid. The resulting homogenate was filtered through Whatman No.
2 filter paper. The filtrates were made upto 20 ml with 3% sulfo-
salicylic acid and used for the estimation of proline following the
method of Bates et al. [50].
2.6. Statistical analysis
The experiment was conducted for two consecutive years under
the identical environmental conditions and each treatment was
repeated three times. Since the data of the measured parameters
obtained were homogeneous, they were pooled and subjected to
analysis of variance. The difference among treatment means was
compared by high range statistical domain (HSD) using two-way
ANOVA at 5% probability level.
3. Results
3.1. Total heavy metal concentration in soils
Heavy metals in polluted soils of Ghaziabad near Hindon River
and non polluted soils of Faculty of Agricultural Sciences, AMU,
Aligarh was determined by atomic absorption spectrophotometer
and presented in Table 1. Heavy metal concentrations in polluted
soils of Ghaziabad (S1) were (mg g
1): cadmium 16.4, chromium
108.5, copper 745, lead 230.5, Nickel 318.5 and Zinc 4580. While
Heavy metal concentration in conventional cultivated soils of Fac-
ulty of Agricultural Science (S2) were (mg g
1): cadmium 0.4,
chromium 6.5, copper 18, lead 9.5, nickel 14.7 and zinc 25.5.
3.2. Characterization and molecular identification of the strain OSG41
The bacterial strain OSG41 recovered from mustard rhizosphere
was found as Gram negative and showed positive reaction for cit-
rate utilization, nitrate reduction, and oxidase test, and could hy-
drolyze starch and gelatin. Strain OSG41, however, showed a
variable carbohydrate utilization property. Based on these and
negative results obtained for some other biochemical parameters
(data not shown), the bacterial strain OSG41 was presumptively
identified to genus level as Pseudomonas. To further identify the
strain to species level, 16S rRNA gene sequence analysis was per-
formed. The nucleotide sequence of 16S rRNA of OSG41 was found
to be approximately 1466 bp in size. The sequence of the 16S rRNA
of this strain was submitted to GenBank (accession number
HM222648). A similar search was performed by using the BLASTn
programme that indicated that strain OSG41 shared a close rela-
tionship with the rRNA gene sequence of P. aeruginosa EU037096
(16S: 99% similarity with the reference strain EU037096). Such high
similarity values confirmed it as P. aeruginosa. A phylogenetic tree
Table 1
Heavy metal content in polluted and conventional soils.
Collection site Heavy metal (mg g
1)
Cadmium Chromium Copper Lead Nickel Zinc
S1 16.4 108.5 745 230.5 318.5 4580
S2 0.4 6.5 18 9.5 14.7 25.5
Here, S1 represents the cultivated field of Ghaziabad, irrigated by polluted water of
Hindon River and S2 indicates the conventional cultivated soils irrigated by fresh
water of Faculty of Agricultural Science, Aligarh Muslim University, Aligarh.
75
constructed by MEGA4 software, based on 16S rRNA partial gene
sequence is presented in Fig. 1.
3.3. Chromium tolerance
In this study, bacterial strain P. aeruginosa OSG41 isolated from
the rhizosphere of mustard, grown at the outskirts of Ghaziabad,
India was tested against a range of heavy metals that included Crþ6,
Cd2þ, Cu2þ, Ni2þ and Zn2þ in order to establish it as a metal tolerant
bacterial strain. Bacterial strain in general showed a variable
response to each metal but even the lower concentrations of all
tested metals were inhibitory to all bacterial strains except strain
P. aeruginosa OSG41, which tolerated a considerable amount of
heavy metals such as Crþ6, Cd2þ, Cu2þ, Ni2þ and Zn2, when grown
on nutrient agar plates amended with the graded concentrations
(0e2000 mg ml
1) of each metal. The tolerance level of P. aeruginosa
OSG41 strain against heavy metals ranged over 1200 mg ml
1 for Ni,
Cu, and Zn and 1800 mg ml
1 for Cr. Among the selected heavy
metals, P. aeruginosa OSG41 strain displayed the maximum toler-
ance against Cr6þ. The MTL values of the strain OSG41 against each
metal were, however, remarkably high. Other bacterial strains
(N ¼ 19) however, showed a remarkably low level (1000 mg ml
1)
of tolerance to Ni (OSG1, OSG2 OSG5, OSG10, OSG17), Cu (OSG3,
OSG22, OSG35, OSG40), Pb (OSG4, OSG6, OSG7, OSG15, OSG33,
OSG44, OSG50) and Zn while for Cr it was 1500 mg ml
1 (OSG 13,
OSG 16, OSG19).
3.4. Chromium reduction influenced by environmental variables
3.4.1. Effect of pH on Cr6þ reduction
The effect of different pH values on P. aeruginosa OSG41 medi-
ated reduction of Cr6þ was variable (Fig. 2a). Generally, strain
OSG41 was found to significantly reduce chromium at pH values
ranging from 6 to 8 when culture was grown at 35  2  C in the
presence of 100 mg Cr ml
1 added to NB medium. The maximum
reduction (100%) of Cr6þ was however, observed at pH from 6 to 8
after 120 h incubation by P. aeruginosa OSG41, which was followed
by pH 5 (88%) and pH 10 (79%). While comparing the effect of
different pH values on chromium reduction by strain OSG41,
incubated for variable time periods, a maximum of 3.4 times
greater reduction was observed at pH 8 relative to pH 4 after 10 h
bacterial growth. Chromium reduction increased significantly with
increasing pH and incubation period; 40% reduction at pH 6
(80 mg ml
1) and 55% reduction at pH 8 (110 mg ml
1) after 40 h of
bacterial growth which increased substantially by 81% at pH 6
(162 mg ml
1) and 83% at pH 8 (166 mg ml
1) after 80 h incubation of
P. aeruginosa OSG41 in the presence of 200 mg Cr ml
1 added to NB
medium.
3.4.2. Effect of temperature on Cr6þ reduction
Temperature is yet another important factor, which directly af-
fects the growth of bacterial populations and their associated ac-
tivities including the bio-reduction of hexavalent chromium.
Generally, the chromium reduction by the test bacterial strain
increased consistently upto 35  C which however, decreased
considerably at 40  C. For example, P. aeruginosa OSG41 signifi-
cantly increased the hexavalent chromium reduction by approxi-
mately 20% each at 30  C and 35  C compared to those observed at
25  C which however decreased by about 25% at 40  C relative to
those determined at 30  C and 35  C after 120 h at 50 mg Cr ml
1
(Fig. 2b).
3.4.3. Effect of chromate concentration on Cr6þ reduction
Chromium reduction monitored at different initial concentra-
tion ranging from 50 to 400 mg ml
1 was greatly influenced by
76 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
Fig. 1. Phylogenetic tree constructed from the 16S rRNA gene sequence (1466 bp) of Pseudomonas aeruginosa OSG41 (GenBank accession no. HM222648) and related organisms by
using Clustal W and MEGA 4 software.
P. aeruginosa OSG41 (Fig. 2c). Chromium reduction by the strain
P. aeruginosa OSG41 was comparatively maximum at lowest con-
centration of 50 mg ml
1; complete reduction was observed after
60 h at 100 mg Cr ml
1 where as 200 mg ml
1 of hexavalent chro-
mium was completely reduced after 120 h of bacterial growth.
3.5. Plant growth promoting activities
Hexavalent chromium tolerant bacterial strain OSG41 used in
this study revealed considerable production of PGP substances
when grown both with and without hexavalent chromium
(Table 2). The effect of four concentrations (50, 100, 200 and
400 mg ml
1) of hexavalent chromium on plant growth promoting
traits like IAA, P solubilization, exo-polysaccharide (EPS) produc-
tion, siderophores production (salicylic acid, 2,3-dihydroxybenzoic
acid), HCN and ammonia production by P. aeruginosa OSG41 was
variable (Table 2). Generally, the measured traits of strain OSG41
like, EPS production increased with 100 mg Cr ml
1 and then
decreased constantly with increasing metal concentrations. Like-
wise, phosphate solubilization, IAA and siderophores activities
progressively decreased with increasing dose of metal, HCN and
ammonia production were however, not affected by increasing
metal concentration. At 400 mg Cr ml
1 the PGP activities such as
IAA and phosphate solubilizing activity and production of EPS, SA
and 2,3-dihydroxybenzoic acid by strain P. aeruginosa OSG41 was
decreased by 67, 81, 12, 58 and 53% compared to those observed
under metal free medium.
3.5.1. Plant growth and symbiotic traits
In this study, we analyzed the chromium toxicity to chickpea
plants and determined the effect of bioinoculant on crop perfor-
mance in metal treated soil. Chickpea seeds inoculated with plant
growth promoting rhizobacterium, P. aeruginosa OSG41 grown in
sandy loam soils amended with different concentration of Crþ6
applied separately, had better growth compared to uninoculated
plants (Table 3). P. aeruginosa OSG41 strain used as a bioinoculant
with 108 mg g
1 of Crþ6, increased the dry biomass of roots, and
shoots, nodule numbers, nodule biomass and whole plant biomass
by 68, 52, 27, 23, and 58% at 80 DAS and 53, 41, 50, 49 and 52 at 130
DAS, respectively compared to the uninoculated control plants.
Grain yields recorded for the inoculated plants were increased by
40%, compared to uninoculated control plants. While comparing the
effect of bioinoculant (strain OSG41) applied at 216 mg g
1 of Crþ6
concentrations to those of only chromium amended soil, a
 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 77

Fig. 2. Effect of pH (a), temperature (b) and initial metal ion concentration (c) on Crþ6 reduction by strain Pseudomonas aeroginosa OSG41 at different time of incubation in nutrient
medium in presence of Crþ6.

maximum increase of 63, 67, 50 and 48%, in root dry mass, shoot dry
mass, number of nodules per plant and nodule dry mass at 80 DAS,
and root dry mass, shoot dry mass, total dry mass, nodule mass and
nodule numbers increased by 71, 60, 62, 36 and 33%, respectively at
130 DAS compared to chromium untreated and uninoculated con-
trol plants. The two way ANOVA revealed that the effects of inocu-
lation and chromium was significant (P  0.05) for the measured
parameters. The interactive effect of inoculation and chromium was
significant for all measured parameter (Table 3) at 80 DAS and 130
DAS except total dry weight (chromium  inoculated ¼ 118.15;
df ¼ 3) at 80 DAS.
3.5.2. Chlorophyll and leghaemoglobin content
In the absence of bacterial inoculant (P. aeruginosa OSG41),
chlorophyll and leghaemoglobin content of chickpea plants
measured at 80 DAS decreased consistently with increasing
78 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83

Table 2
Plant growth promoting (PGP) activities of strain P. aeroginosa OSG41 in the absence and presence of different dose of Crþ6.

IAAa (mg ml
1) Phosphate solubilization EPSb (mg ml
1) Siderophores HCNg NH3
(mg ml
1)
Phenolates (mg ml
1) CASe Agar (mm) FeCl3 testf

SAc 2,3-DHBAd
32.0  1.5 417.5  2.0 20.8  1.5 37.7  2.0 24.1  1.3 15.6  1.5 þ þ þ
27.4  1.6 417.5  2.3 22.2  2.4 37.2  1.7 23.6  0.9 15.0  2.6 þ þ þ
24.2  1.0 391.7  3.9 27.4  1.2 32.0  1.5 20.5  1.5 12.2  2.0 þ þ þ
20.7  2.0 185.6  3.2 20.3  1.7 25.8  1.9 18.2  1.2 10.0  1.5 þ þ þ
10.6  1.7 77.7  2.4 18.4  1.4 15.8  1.2 11.4  1.4 08.3  1.5 þ þ þ
LSD 1.09 4.61 2.62 3.41 2.11 3.19

Value indicates the means  S.D. of three independent replicates.

a
Indole acetic acid.
b
Exo-polysaccharide.
c
Salicylic acid.
d
2, 3-Dihydroxybenzoic acid.
e
Chrome Azurol S agar.
f
Ferric chloride test.
g
Hydrogen cyanide.

concentration of Crþ6 (Table 4). Chromium at 216 mg g
1 decreased
the total chlorophyll and leghaemoglobin contents by 50 and 33%
respectively, relative to those observed for uninoculated chickpea
plants. In contrast, the bioinoculant increased the chlorophyll
content by 30% and leghaemoglobin content by 27% at 108 mg Cr g
1
soil compared to un-inoculated plants. While comparing the effect
of 216 mg Cr g
1 on inoculated and un-inoculated plants, a
maximum increase of 32, 38, 35, 15, 31, 35 and 38% in total chlo-
rophyll content, leghaemoglobin, N content in roots and shoots, P
content in roots and shoots, and seed protein, respectively was
observed over chromium untreated and uninoculated control
plants. Two factor ANOVA revealed that the individual effect of
inoculation and their interaction (inoculation  Crþ6) were signif-
icant (P  0.05) for the measured parameters.
3.5.3. Seed yield and grain protein
Seed yield and grain protein assayed at harvest (130 DAS)
progressively decreased with increasing concentration of chro-
mium (Table 4). Seed yield and grain protein of inoculated
chickpeas increased by 19 and 21%, respectively, relative to un-
inoculated control plants. In comparison, the chromium reducing
strain P. aeruginosa OSG41 increased the seed yield and grain
protein by 39 and 30% respectively, at 108 mg Cr g
1 soil,
compared to uninoculated chickpea plants grown in soil treated
with similar concentration of chromium. While chromium
reducing P. aeruginosa (OSG41) enhanced the seed yield and grain
protein by 15 and 9% respectively, at 108 mg Cr g
1 soil, compared
to inoculated but metal free control chickpea plants. Two way
ANOVA revealed that the individual effect of inoculation and Crþ6
and their interaction (inoculation  Crþ6) were significant for the
measured parameters.
3.5.4. Chromium uptake
Chromium accumulation in roots and shoots of chickpea plants
observed at 80 and 130 DAS, increased with increasing concentration
of Crþ6, added to soil. Maximum chromium uptake of 46.9 mg Cr g
1
and 26.8 mg Cr g
1 was determined at 80 DAS in roots and shoots of
uninoculated plants while 25.5 mg Cr g
1 and 17.5 mg Cr g
1 accu-
mulated in the roots and shoots of inoculated chickpea plants,
respectively. Application of bioinoculant (P. aeruginosa OSG41)
however, reduced the level of chromium in roots and shoots by 46.6
and 35%, respectively, measured at 80 DAS (Fig. 3) compared to those
observed for chickpea plants grown solely in chromium treated soils.
At 130 DAS, chromium accumulated in roots and shoots of uninoc-
ulated plants were: 72.5 mg g
1 and 33.6 mg g
1 (Fig. 3) while it was
45 mg g
1 (roots) and 20.5 mg g
1 (shoots) of P. aeruginosa inoculated
chickpea plants. Interestingly, the inoculant bacterial strain (OSG41)
decreased the concentration of chromium in roots and shoots by 37

Table 3
Effect of different dose of hexavalent chromium on growth and nodulation of chickpea grown in soil inoculated with strain OSG41 and without bioinoculant.

Treatment Dose rate (mg/g soil) Dry biomass (g/plant) Nodulation Total dry biomass
(g/plant)
Root Shoot No./plant Nodule biomass
(mg/plant)

80 DAS 130 DAS 80 DAS 130 DAS 80 DAS 130 DAS 80 DAS 130 DAS 80 DAS 130 DAS
Un-inoculated Control 0.74d 0.88e 2.81d 3.71e 28c 19d 112d 80d 3.66e 4.67d
1  (54) 0.55c 0.78c 2.49c 3.04d 26c 14c 104d 55c 3.14d 3.87d
2  (108) 0.30b 0.52b 1.20b 1.88b 19b 10b 80c 41b 1.58b 2.44b
3  (216) 0.16a 0.29a 0.68a 0.80a 10a 06a 39a 24a 0.87a 1.11a
Inoculated Control 1.20f 1.37 3.51f 4.71h 34d 26e 135e 102f 4.85h 6.18e
1  (54) 1.10e 1.28 3.20e 4.37f 32d 24e 129e 97e 4.42g 5.74f
2  (108) 0.94d 1.10f 2.74d 3.87f 26c 20d 104d 80d 3.78f 5.05e
3  (216) 0.55c 0.78c 1.70b 2.46c 15a 12b 61b 46b 2.29c 2.28c
LSD 0.07 0.07 0.10 0.13 3.45 3.17 8.91 10.47 0.083 0.372
F value Un-inoculated (df ¼ 1) 874.58* 880.99* 1625.63* 2375.45* 58.43* 121.57* 4289.57* 165.35* 6841.25* 484.86*
Inoculated (df ¼ 3) 242.07* 200.98* 1310.95* 1356.14* 103.45* 62.43* 2927.54* 97.23* 4136.17* 315.75*
Un-inoculate  inoculated 10.22* 1.67* 64.07* 48.53* 0.07* 2.08* 151.32* 4.81* 118.15 13.38*
(df ¼ 3)

Each value is a mean of three replicates where each replicate constituted tree plants/pot. Mean values with star are significant at P  0.05. Mean values with different letters are
significantly different from each other’s according to post hoc Tukey’s HSD (P  0.05).
 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 79

Table 4
Effect of different dose of hexavalent chromium on chlorophyll, leghaemoglobin, N and P content and seed protein in chickpea plants grown in soil inoculated with and without
stain P. aeroginosa OSG41.

Treatment Dose rate (mg/g soil) Chlorophyll content (mg mg
1) Leghaemoglobin N content mg P content Seed yield Seed
content mg
1) (mg mg
1) g/plant protein
[mM/(gf.m.)] (mg/g)
a b Total Root Shoot Root Shoot
Uninoculated Control 0.81g 0.75f 1.56f 0.22a 18c 24b 0.18d 0.21b 2.86e 256d
1  (54) 0.67d 0.59d 1.26d 0.21a 17b 23b 0.15c 0.20b 2.36d 221c
2  (108) 0.56b 0.43b 0.98b 0.16a 15b 20a 0.13b 0.16a 1.69c 204b
3  (216) 0.41a 0.37a 0.78a 0.08a 11a 17a 0.11a 0.13a 0.79a 155a
Inoculated Control 0.84h 0.79 1.64g 0.29a 24d 28c 0.25e 0.27c 3.52g 272f
1  (54) 0.80f 0.72e 1.52f 0.27a 24d 27c 0.19d 0.26c 3.11f 245f
2  (108) 0.71e 0.68e 1.40e 0.22a 20c 22b 0.18d 0.23b 2.80e 220e
3  (216) 0.63c 0.51c 1.15c 0.13a 17b 20a 0.16c 0.20b 1.33b 208d
LSD 0.00 0.03 0.03 0.28 2.71 3.46 0.01 0.03 0.117 8.17
F value Un-inoculated (df ¼ 1) 6308.13* 293.57* 971.06* 0.00 87.56* 17.91* 137.70* 56.79* 781.07* 2505.3*
Inoculated (df ¼ 3) 5956.40* 294.83* 893.21* 0.18 27.72* 13.76* 65.79* 17.62* 1118.86* 373.78*
Un-inoculate  inoculated 549.38* 27.58* 68.23* 1.13 0.25* 1.20 3.37* 0.26 19.91* 12.78*
(df ¼ 3)

Each value is a mean of three replicates where each replicate constituted tree plants/pot. Mean values are significant at P  0.05. Means followed by similar alphabets are not
significantly different from each other according to post hoc Turkey’s HSD.

and 63%, respectively at 130 DAS when chickpea was grown with
216 mg g
1 soil compared to those observed for uninoculated plants.
A maximum decrease of 36% in chromium uptake was recorded for
chickpea seeds compared to uninoculated chickpeas. While
comparing the accumulation of chromium in different plant organs,
seeds in general, accumulated more chromium compared to other
tested parts of chickpea plants.
3.5.5. Proline accumulation
Proline accumulation in the plant roots and shoots measured at
80 DAS and grains at 130 DAS increased with increasing concen-
tration of Crþ6, added to soil. A maximum uptake of 46 and
42 mg g
1 fresh weight was recorded in roots and shoots after
80 DAS when plants were grown without bioinoculant while in
the presence of bioinoculant, it was 37.5 and 34.50 mg g
1 fresh
weight proline in roots and shoots, respectively, at 216 mg kg
1
chromium amended soil. The application of bioinoculant substan-
tially declined the proline concentration in roots and shoots of
chickpea plants by 35 and 18% respectively, at 80 DAS compared to
the plants grown in chromium treated soils (Fig. 4). Maximum
proline (63.3 mg g
1 fresh weight) accumulation was recorded in
grains collected from uninoculated plants while it was 48.2 mg g
1
fresh weight in grains of inoculated chickpea plants.
4.2. Hexavalent chromium reduction
The ability to reduce the toxicity of hexavalent chromium has
been found in many bacterial species including PGPR such as
Pseudomonas fluorescence [56], Enterobacter cloacae [57], Bacillus sp.
[2,54] and Staphylococcus capitis [58] under both aerobic and
anaerobic conditions. The chromium reduction is however, influ-
enced both by varying pH and temperature [59,60]. Considering the
importance of these environmental variables in chromium reduc-
tion, we used a bacterial strain P. aeruginosa OSG41 to assess its
chromium reducing ability under changing factors. Interestingly,
this strain was able to reduce Crþ6 at a wide range of pH (4e10) and
temperature (20e40  C), as also reported by others [2,58].
Furthermore, the growth of P. aeruginosa OSG41 and its reduction
ability was assessed at varied Crþ6concentration; the overall rate of
Crþ6 reduction decreased with increasing concentration of Crþ6.
However, the rate of Crþ6 reduction was not inhibited by high levels
of chromium during early phase of reduction process. Similar trend
was observed by Rahman et al. [61] for Pseudomonas sp. C-171
against different concentration of Crþ6. However, among bacteria,
Arthrobacter sp. has been found more efficient chromium reducing
organism than Bacillus sp. [62] while the Arthrobacter oxydans was
affected even at a very low (35 mg ml
1) concentration of Crþ6 [63].

4.3. Effect of chromium tolerant strain (OSG41) on chickpea grown

4. Discussion
4.1. Identification and characterization
The effluents discharged from different industries are reported
to contain variable heavy metals including chromium to an extent
of toxicity level [51]. When used intentionally in agronomic prac-
tices, such effluents are known to cause shifts in microbial com-
munities leading even to the emergence of pollutant (e.g., metal)
resistance among bacterial population [52]. Considering the wide
spread resistant/reducing traits among bacteria, metal reducing for
example chromium reducing plant growth promoting rhizobacteria
such as Bacillus sp. [20,53] and Pseudomonas sp. [54,55] have been
isolated and characterized from metal contaminated environment.
In this study, we isolated metal tolerant bacteria from soil receiving
metal containing effluent. Metal tolerant bacterial strain (OSG41)
was later on identified as P. aeruginosa (Acc no. HM222648) using
biochemical tests and 16S rRNA gene sequence characterization
and phylogenetic analysis.
in chromium treated soils
Application of bacterial inoculant as biofertilizer has been re-
ported to result in better growth and increased yield of different
crops [64,65]. Considering both the growth promoting efficiency
and metal tolerant ability of the P. aeruginosa OSG41, we designed
an experiment to assess the performance of inoculated chickpea in
chromium amended soils. The results are discussed in the following
section.
4.4. Plant growth and nodulation
Generally, the chickpea growth expressed both in terms of dry
matter and symbiotic attributes, was higher for inoculated chickpea
than for uninoculated ones even when grown in the presence of the
varying level of Crþ6. Like any conventional PGPR, chromium
tolerant P. aeruginosa OSG41 used as inoculant in this study caused
a substantial increase in the overall performance of chickpea
80 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83

50
Metal
Metal+Bioinoculant
A

Fig. 3. Chromium uptake by chickpea plants 80 days after sowing- roots (A) and shoots (B) and at 130 Days in roots (C), shoots (D) and grains (E), in the presence and absence of bio-inoculant P. aeruginosa OSG41.

Proline content (mg/g fw)

40

30

20

10

40
B

Proline content (mg/g fw)

30

20

10

0
60 C
50
Proline content (mg/g fw)

40

30

20

10

0
0 50 100 150 200
-1
Chromium in soil (µgg )

Fig. 4. Proline accumulation in roots (A), shoot (B) at 80 DAS and grains (C) at 130 DAS
chickpea in the absence and presence of bio inoculants (P. aeroginosa OSG41) with
different dose of chromium amended in soil. The values indicate the mean  SD of
three replicates.

probably due to the synthesis of plant growth regulating sub-

stances [3], which are reported to promote root growth directly by
stimulating plant cell elongation or cell division [66]. Furthermore,
the HCN, and siderophores producing ability of this stain might also
have enhanced the root growth and uptake of soil minerals by the
host plant as also observed by others [2,3,64]. Taking into consid-
eration the importance of EPS in biological nitrogen fixation (BNF),
adaptation of PGPR including rhizobia to environmental stressors
and in the process of soil aggregation [67], the strain OSG41 was
further tested for its ability to synthesize EPS under in vitro con-
dition. Interestingly, this strain produced a substantial amount of
heteropolysaccharides which could directly and/or indirectly affect
the growth of plants growing in differentially stressed environ-
ment. For example, EPS synthesized by PGPR indirectly stimulate
the plant growth by- (i) accelerating microbial activity in the
rhizosphere and (ii) enhancing the soil organic content and provide
soil aggregate stability with plant roots, and thereby to soil. While
directly, EPS has been found to play some key roles in the
 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
physiological processes of plants. For example, EPS has been re-
ported to play important functions in the invasion process, infec-
tion thread formation, bacteroid and nodule development during
BNF [67]. Other benefits of EPS to bacteria could be protection from
pathogens, desiccation, phagocytosis and phage attack [68]. Also,
by secreting excess amounts of EPS, PGPR could protect itself from
the toxicity of pollutants for example heavy metals by masking the
effects of such pollutants [69] and hence, the surviving bacteria
inside the polymeric network of EPS could show a considerable
metal reducing/accumulating ability. And therefore, by trapping
the metals inside the EPS, the PGPR capable of synthesizing EPS are
likely to restrict the mobility of metals towards various plants
growing in the contaminated soils and, hence, the toxicity of such
metals to plants could be avoided.
The growth characteristics, the nodules formed on the root
system of inoculated chickpea plants raised in soil amended with
chromium, was significantly higher compared to those observed for
uninoculated plants. Also, the leghaemoglobin content in fresh
nodules collected from inoculated chickpea was greater. The
improved symbiotic relationship measured as nodule numbers and
leghaemoglobin in bacterized legumes host grown in chromium
amended soil is a clear suggestive of the rhizobial establishment
and survival within chromium polluted soil which despite chro-
mium continued to express its full growth promoting abilities even
in the presence of chromium. Similar, increase in the growth of
inoculated legumes grown in the presence of metals has been re-
ported by Pajuelo et al. [5] and Wani and Khan [20].
4.5. Chlorophyll, seed yield and grain protein
In the absence of bacterial culture, there was a progressive
decrease in the chlorophyll content in fresh foliage measured at 80
DAS and seed yield and grain protein after harvest. In comparison,
P. aeruginosa OSG41 increased the measured parameter when
chickpea was grown with different concentration of chromium
added intentionally to sandy clay loam soils. In a similar study,
Tripathi et al. [70] has reported a comparable increase in the
chlorophyll content of greengram plants inoculated with side-
rophore producing and lead and cadmium resistant Pseudomonas
putida KNP9 under metal stressed condition. Seed yield and protein
of chickpea was increased in presence of bioinoculant strain
P. aeruginosa OSG41 under influence of chromium in soil. However,
severe adverse effects were recorded when chickpea was grown
with sole application of chromium. In a study similar to the present
investigation, Chaudhri et al. [71] observed an increase in seed yield
of pea (Pisum sativum) when grown in the presence of bioinoculant
under the influence of heavy metals for example zinc and copper.
While increase in the seed protein content of mustard plant inoc-
ulated with Kluyvera ascorbata SUD165 and grown in Zn, Ni and Pb
contaminated soil, was observed by Burd et al. [72].
4.6. Chromium accumulation
The uptake of chromium in different organs such as roots and
shoots and grains of chickpea plants, grown in variously metal
treated soils increased gradually with increase in the concentration
of chromium added to soil. Interestingly, plant growth promoting
and chromium reducing bacterial strain used as a bioinoculant,
however caused a substantial decrease in the concentration of
chromium in roots, shoots and seed compared to uninoculated
crop. The reduction in chromium concentration in chickpea organs
thus exhibited the ability of this strain to protect legume crop
against the inhibitory effect of high concentration of hexavalent
chromium. Faisal and Hasnain [73] in a similar study have also
observed a lesser accumulation of chromium in Ochrobacteriam
81
intermedium inoculated Helianthus annus while Wani et al. [3] re-
ported a reduced uptake of chromium by Mesorhizobium inoculated
chickpea plants and concomitantly a significant increase in
the overall performance. Similar effects were found on the Bacillus
sp. inoculated chickpea plants when grown in chromium stressed
soils [20].
4.7. Proline accumulation
The enhanced synthesis of free cellular proteins during various
abiotic and abiotic stresses has been found to provide a multi-
functional protective role in most plant species [74,75]. For
example, Schat et al. [76] reported heavy metal-induced accumu-
lation of free proline in a metal-tolerant and a nontolerant ecotype
of Silene vulgaris. After synthesis and accumulation within plants,
proline is reported to play adaptive roles for example in plant stress
tolerance [77]. Moreover, it also acts as a compatible osmolyte and
hence, help to store C and N. Besides these, proline can be a ROS
scavenger [78], function as molecular chaperone stabilizing the
structure of proteins and help to maintain cytosolic pH and to
balance cell redox status. In our study, we also observed a signifi-
cant accumulation of proline in chickpea plant organs like, roots,
shoots and seeds due to high concentration of hexavalent chro-
mium present in soils. The concentration of proline in plant tissues
and grains consistently increased with increasing chromium con-
centration suggesting that the stressor for example chromium here
probably has an inducible effect on proline synthesis. A similar
increase in the proline level in plants such as lemongrass (Cymbo-
pogon flexuosus) grown in the presence of heavy metals such as
lead, mercury and cadmium has been reported [79]. Proline accu-
mulation however, decreased significantly in bacterized chickpea
plants grown in soils treated even with higher concentration of
chromium (Fig. 4). The decline in proline concentration in various
organs/grain of inoculated chickpea plants grown in chromium
amended soil could possibly be due to the detoxifying/bioreducing
effect of strain OSG41 on hexavalent chromium accumulated inside
the plant tissues. However, to the best of our information, there are
no reports on how and why proline concentration diminishes even
in inoculated plants including chromium tolerant P. aeruginosa
OSG41 inoculated chickpeas, when grown in soils treated inten-
tionally with heavy metals (including chromium) or soils already
polluted with heavy metals. However, whatever may be reason, the
decrease in proline level in OSG41 inoculated chickpea plants as
observed in this study is likely to act as an indicator for determining
the effect of bioinoculant and consequently to assess the impact of
chromium stress on chickpea plants, grown in chromium polluted
environment. This study further opens up new vistas to better
understand the mechanistic basis of proline decline in inoculated
plants grown in polluted environment.
5. Conclusion
In the present study, we demonstrate the phytotoxic effect of
hexavalent chromium on the performance of chickpea plants,
grown in hexavalent chromium treated sandy loam soils. Hex-
avalent chromium tolerant P. aeruginosa OSG41 when used as seed
inoculant, however protected the plants from the toxicity of hex-
avalent chromium leading thereby to a considerable increase in the
dry biomass, nutrient assimilation, seed yield and seed protein. The
increased growth of chickpea plants even in the presence of chro-
mium might have been due to several factors like (i) synthesis and
release of plant growth promoting substances such as phytohor-
mone, siderophores and EPS by P. aeruginosa OSG41 (ii) chromium
reducing ability of the test bacterial strain and (iii) ability of bac-
terial strain to overcome the proline accumulation in metal stressed
82 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
environment. Based on these properties, the bacterial strain OSG41
of P. aeruginosa could be developed as a bioinoculant for its ultimate
transfer to legume growers in order to enhance the production of
chickpea crop in soil contaminated with hexavalent chromium.
Conflict of interest
None.
Acknowledgements
One of the authors, Oves M., is extremely grateful to the Uni-
versity Grants Commission (UGC) and Council of Scientific and In-
dustrial Research (CSIR), Ministry of Science & Technology,
Government of India, New Delhi, India for providing financial
support in the form of scholarship.
References
[1] J. Musarrat, A. Zaidi, M.S. Khan, M.A. Siddiqui, A.A. Al-Khedhairy, Genotoxicity
assessment of heavy metal-contaminated soils, in: M.S. Khan, A. Zaidi, R. Goel,
J. Musarrat (Eds.), Biomanagement of Metal-Contaminated Soils, Springer
Wien, New York, 2011, pp. 323e342.
[2] P.A. Wani, M.S. Khan, A. Zaidi, Effect of metal tolerant plant growth promoting
Bradyrhizobium sp. (vigna) on growth symbiosis seed yield and metal uptake
by greengram plants, Chemosphere 70 (2007) 36e45.
[3] P.A. Wani, M.S. Khan, A. Zaidi, Chromium-reducing and plant growth-
promoting Mesorhizobium improves chickpea growth in chromium-
amended soil, Biotechnol. Lett. 30 (2008) 159e163.
[4] W. Shi, M. Bischoff, R. Turco, A. Konopka, Long-term effects of chromium and
lead upon the activity of soil microbial communities, J. Appl. Soil Ecol. 21
(2002) 169e177.
[5] E. Pajuelo, I.D. Rodríguez-Llorente, M. Dary, A.J. Palomares, Toxic effects of
arsenic on Sinorhizobium-Medicago sativa symbiotic interaction, Environ.
Pollut. 154 (2008) 203e211.
[6] P.A. Wani, M.S. Khan, A. Zaidi, Toxic effects of heavy metals on germination
and physiological processes of plants, in: M.S. Khan, A. Zaidi, P.A. Wani (Eds.),
Toxicity of Heavy Metals to Legumes and Bioremediation, Springer Wien, New
York, 2012, pp. 45e66.
[7] P.A. Wani, M.S. Khan, A. Zaidi, Effect of heavy metal toxicity on growth,
symbiosis, seed yield and metal uptake in pea grown in metal amended soil,
Bull. Environ. Cont. Toxicol. 81 (2008) 152e158.
[8] A.S.S. Ibrahim, M.A. El-Tayeb, Y.B. Elbadawi, A.A. Al-Salamah, Bioreduction of
Cr (vi) by potent novel chromate resistant alkaliphilic Bacillus sp. strain
KSUCr5 isolated from hypersaline Soda lakes, Afric. J. Biotechnol. 10 (2011)
7207e7218.
[9] P.A. Wani, M.S. Khan, A. Zaidi, Chromium reduction, plant growth promoting
potentials and metal solubilization by Bacillus sp. isolated from alluvial soil,
Curr. Microbiol. 54 (2007) 237e243.
[10] B. Joseph, R.R. Patra, R. Lawrence, Characterization of plant growth promoting
rhizobacteria associated with chickpea (Cicer arietinum L.), Int. J. Plant Prod. 2
(2007) 141e152.
[11] S.P. Kamaludeen, M. Megharaj, A.L. Juhasz, N. Sethunathan, R. Naidu, Chro-
mium microorganism interactions in soil: remediation implications, Rev.
Environ. Cont. Toxicol. 178 (2003) 93e164.
[12] A. Fargasová, Plants as models for chromium and nickel risk assessment,
Ecotoxicology 21 (2012) 1476e1483.
[13] C.S. Sheik, T.W. Mitchell, F.Z. Rizvi, Y. Rehman, M. Faisal, S. Hasnain,
M.J. McInerney, L.R. Krumholz, Exposure of soil microbial communities to
chromium and arsenic alters their diversity and structure, PLoS One 7 (2012)
e40059.
[14] O.N. Belyaeva, R.J. Haynes, O.A. Birukova, Barley yield and soil microbial and
enzyme activities as affected by contamination of two soils with lead, zinc or
copper, Biol. Fert. Soils 41 (2005) 85e94.
[15] S.P. Kourtev, H.C. Nakatsu, A. Konopka, Inhibition of nitrate reduction by
chromium (VI) in anaerobic soil microcosms, Appl. Environ. Microbiol. 75
(2009) 6249e6257.
[16] K.E. Giller, E. Witter, S.P. McGrath, Toxicity of heavy metals to microorganisms
and microbial processes in agricultural soils: a review, J. Soil Biol. Biochem. 30
(1998) 1389e1414.
[17] H. Shun-hong, P. Bing, Y. Zhi-hui, C. Li-yuan, Z. Li-cheng, Chromium accu-
mulation, microorganism population and enzyme activities in soils around
chromium-containing slag heap of steel alloy factory, Trans. Nonferrous Met.
Soc. China 19 (2009) 241e248.
[18] G. Henderson, A comparison of the effects of chromate, molybdate and cad-
mium oxide on respiration in the yeast Saccharomyces cerevisiae, Biol. Metals
2 (1989) 83e88.
[19] M. Bibi, M. Hussain, Effect of copper and lead on photosynthesis and plant
pigments in black gram (Vigna mungo L.), Bull. Environ. Cont. Toxicol. 74
(2005) 1126e1133.
[20] P.A. Wani, M.S. Khan, Bacillus species enhance growth parameters of chickpea
(Cicer arietinum L.) in chromium stressed soils, Food Chem. Toxicol. 48 (2011)
3262e3267.
[21] F. VanAssche, H. Clijsters, Effects of metals on enzyme activity in plants, Plant
Cell Environ. 13 (1990) 195e206.
[22] M. Hussain, M. Farooq, S.M.A. Basra, N. Ahmad, Influence of seed priming
techniques on the seedling establishment yield and quality of hybrid sun-
flower, Int. Agric. Biol. 8 (2006) 14e18.
[23] P.A. Wani, M.S. Khan, Heavy Metal Toxicity and Their Remediation by Soil
Microbes, Lambert Academic Publishing AG & Co., 2011.
[24] P.A. Wani, A. Zaidi, M.S. Khan, M. Oves, Role of plant growth promoting rhi-
zobacteria in the remediation of metal contaminated soils, Environ. Chem.
Lett. 7 (2009) 1e19.
[25] N. Das, L. Mathew, Chromium pollution and bioremediation: an overview, in:
M.S. Khan, A. Zaidi, R. Goel, J. Musarrat (Eds.), Biomanagement of Metal-
Contaminated Soils, Environmental Pollution, Springer Wien, New York,
2011, pp. 297e322.
[26] R.S. Laxman, S. More, Reduction of hexvalent chromium by Streptomyces
griseus, Miner. Eng. 15 (2002) 831e837.
[27] S. Congeevaram, S. Dhanarani, J. Park, M. Dexilin, K. Thamaraiselvi, Bio-
sorption of chromium and nickel by heavy metal resistant fungal and bacterial
isolates, J. Hazard. Mater. 146 (2007) 270e277.
[28] N. Khan, A. Mishra, P.S. Chauhan, Y.K. Sharma, C.S. Nautiyal, Paenibacillus
lentimorbus enhances growth of chickpea (Cicer arietinum L.) in chromium-
amended soil, Ant. Van Leeuwenhoek 101 (2012) 453e459.
[29] M. Oves, A. Zaidi, M.S. Khan, Role of metal tolerant microbes in legume
improvement, in: M.S. Khan, A. Zaidi, J. Musarrat (Eds.), Microbes for Legume
Improvement, Springer Wien, New York, 2010, pp. 337e352.
[30] M.S. Khan, A. Zaidi, Stimulatory effects of dual inoculation with phosphate
solubilising microorganism and arbuscular mycorrhizal fungus on chickpea,
Aust. J. Exp. Agric. 47 (2007) 1016e1022.
[31] S.P. McGrath, C.H. Cunliffe, A simplified method for the extraction of metals
Fe, Zn, Cu, Ni, Cd, Pb, Cr and Mn from soil and sewage sludge, J. Sci. Food Agric.
36 (1985) 794e798.
[32] J.G. Holt, N.R. Krieg, P.H.A. Sneath, J.T. Staley, S.T. Williams, Gram negative
aerobic/microaerophilic rods and cocci, in: Bergey’s Manual of Determinative
Bacteriology, ninth ed., Williams and Wilkins, Lippincott, Philadelphia, 1994,
pp. 93e168.
[33] S. Kumar, K. Tamura, M. Nei, MEGA 3: integrated software for molecular
evolutionary genetics analysis and sequence alignment, Briefings Bioinf. 5
(2004) 150e163.
[34] American Public Health Association (APHA), American water works Associa-
tion (AWWS); Water environment Federation (WEF), Standard Methods for
the Examination of Water and Wastewater, nineteenth ed., (1995). Wash-
ington, DC.
[35] C.H. Park, M. Keyhan, B. Wielinga, S. Fendorf, A. Matin, Purification to ho-
mogeneity and characterization of novel Pseudomonas putida chromoate
reductase, Appl. Environ. Microbiol. 66 (2000) 1788e1795.
[36] J.E. King, The colorimetric determination of phosphorus, Biochem. J. 26 (1932)
292e297.
[37] M.L. Jackson, Soil Chemical Analysis, Prentice Hall, New Delhi India, 1976.
[38] D.B. Alexander, D.A. Zuberer, Use of chrome azurol S reagents to evaluate
siderophore production by rhizosphere bacteria, Biol. Fert. Soils 12 (1991)
39e45.
[39] M.W. Reeves, L. Pine, J.B. Neilands, A. Balows, Absence of siderophore activity
in Legionella species grown in iron-deficient media, J. Bacteriol. 154 (1983)
324e329.
[40] S. Gordon, R.P. Weber, The colorimetric estimation of IAA, Plant Physiol. 26
(1951) 192e195.
[41] J.M. Bric, R.M. Bostock, S.E. Silversone, Rapid in situ assay for indole acetic acid
production by bacteria immobilized on nitrocellulose membrane, Appl. En-
viron. Microbiol. 57 (1991) 535e538.
[42] E. Glickmann, Y. Dessaux, A critical examination of the specificity of the sal-
kowski reagent for indolic compounds produced by phytopathogenic bacteria,
Appl. Environ. Microbiol. 61 (1995) 793e796.
[43] A.W. Bakker, B. Schipper, Microbial cyanide production in the rhizosphere in
relation to potato yield reduction and Pseudomonas sp. mediated plant growth
stimulation, Soil Biol. Biochem. 19 (1987) 451e457.
[44] D.W. Dye, The inadequacy of the usual determinative tests for the identifi-
cation of Xanthomonas sp. Nat. Sci. 5 (1962) 393e416.
[45] B.R. Mody, M.O. Bindra, V.V. Modi, Extracellular polysaccharides of cowpea
rhizobia: compositional and functional studies, Arch. Microbiol. 1 (1989)
2e5.
[46] D.T. Arnon, Copper enzymes in isolated chloroplast polyphenol oxidase in
Beta vulgaris, Appl. Environ. Microbiol. 55 (1949) 1665e1669.
[47] S. Sadasivum, A. Manickam, Biochemical Methods, New Age International
Publishers (P) Ltd., New Delhi, 1992.
[48] O.H. Lowery, N.J. Rosebrough, A.J. Farr, R.J. Randal, Protein measurement with
the folin phenol reagent, J. Biol. Chem. 193 (1951) 265e275.
[49] G.E. Ouzounidou, P. Eleftheriou, S. Karataglis, Ecophysiological and ultra-
structural effects of copper in Thlaspi ochroleucum (cruciferae), Can. J. Bot. 70
(1992) 947e957.
 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83
[50] L.S. Bates, R.P. Waldren, I.D. Teare, Rapid determination of free proline for
water stress studies, Plant Soil 39 (1973) 205e208.
[51] E. Dermou, A. Velissariou, D. Xeonos, Biological chromium Cr (VI) reduction
using a trickling filter, J. Hazard. Mater. B 126 (2005) 78e85.
[52] R. Stepanauskas, T.C. Glenn, C.H. Jagoe, R.C. Tuckfield, A.H. Lindell,
J.V. McArthur, Elevated microbial tolerance to metals and antibiotics in metal-
contaminated industrial environments, Environ. Sci. Technol. 39 (2005)
3671e3678.
[53] M. He, X. Li, L. Guo, S.J. Miller, C. Rensing, G. Wang, Characterization and
genomic analysis of chromate resistant and reducing Bacillus cereus strain SJ1,
BMC Microbiol. 19 (2010) 10e22.
[54] S.H.A. Hassan, R.N.N. Abskharon, S.M.F. Gad-El-Rab, A.A.M. Shoreit, Isolation
characterization of heavy metal resistant strain of Pseudomonas aeruginosa
isolated from polluted sites in Assiut city Egypt, J. Basic Microbiol. 48 (2008)
168e176.
[55] C.H. Raja, K. Anbazhagan, G.S. Selvam, Isolation and characterization of a
metal-resistant Pseudomonas aeruginosa strain, Nucleic Acids Res. 22 (2006)
577e585.
[56] L.H. Bopp, H.L. Ehrlich, Chromate resistance and reduction in Pseudomonas
fluorescens strain LB300, Arch. Microbiol. 155 (1988) 4426e4431.
[57] P.C. Wang, T. Mori, K. Toda, H. Ohtake, Membrane associated chromate
reductase activity from Enterobacter cloacae, J. Bacteriol. 172 (1990) 1670e
1672.
[58] A. Zahoor, A. Rehman, Isolation of Cr(VI) reducing bacteria from industrial
effluents and their potential use in bioremediation of chromium containing
wastewater, J. Environ. Sci. 21 (2009) 814e820.
[59] D.I. Stewart, I.T. Burke, R.J.G. Mortimer, Stimulation of microbial mediated
chromate reduction in alkaline soilewater systems, Geomicrobiol. J. 4 (2007)
655e669.
[60] M.R. Van Engelen, B.M. Peyton, M.R. Mormile, H.C. Pinkart, Fe(III), Cr(VI), and
Fe(II) mediated Cr(VI) reduction in alkaline media using a Halomonas isolate
from Soap Lake, Washington, Biodegradation 19 (2008) 841e850.
[61] M.U. Rahman, G.U.L. Shereen, U.Z.M. Haq, Reduction of chromium (VI) by
locally isolated Pseudomonas sp. C-171, Turk. J. Biol. 31 (2007) 161e166.
[62] M. Megharaj, S. Avudainayagam, R. Naidu, Toxicity of hexavalent chromium
and its reduction by bacteria isolated from soil contaminated with tannery
waste, Curr. Microbiol. 47 (2003) 51e54.
[63] N.V. Asatiani, M.K. Abuladze, T.M. Kartvelishvili, N.G. Bakradze, N.A. Sapojnikova,
N.Y. Tsibakhashvili, L.V. Tabatadze, L.V. Lejava, L.L. Asanishvili, H.Y. Holman, Ef-
fect of Cr(VI) action on Arthrobacter oxydans, Curr. Microbiol. 49 (2004) 321e326.
[64] Y. Bashan, G. Holguin, Azospirillum-plant relationship: environmental and
physiological advances, Can. J. Microbiol. 43 (1997) 103e121.
83
[65] A. Zaidi, M.S. Khan, M. Amil, Interactive effect of rhizotrophic microorganisms
on yield and nutrient uptake of chickpea (Cicer arietinum L.), Eur. J. Agron. 19
(2003) 15e21.
[66] K. Minamisawa, K. Fukai, Production of indole 3-acetic acid by Bradyrhizobium
japonicum: a correlation with genotype grouping and rhizobitoxine produc-
tion, Plant Cell Physiol. 32 (1991) 1e9.
[67] C.A. Bomfeti, L.A. Florentino, A.P. Guimarães, P.G. Cardoso, M.C. Guerreiro,
F.M. de Souza, Exopolysaccharides produced by the symbiotic nitrogen-fixing
bacteria of leguminosae, Rev. Bras. Ciênc. Solo 35 (2011) 657e671.
[68] N. Tank, M. Saraf, Phosphate solubilization, exopolysaccharide production and
indole acetic acid secretion by rhizobacteria isolated from Trigonella foenum-
graecum, Ind. J. Microbiol. 43 (2003) 37e40.
[69] A. Poli, G. Anzelmo, B. Nicolaus, Bacterial exopolysaccharides from extreme
marine habitats: production, characterization and biological activities, Mar.
Drugs 8 (2010) 1779e1802.
[70] M. Tripathi, H.P. Munot, Y. Shouche, J.M. Meyer, R. Goel, Isolation and func-
tional characterization of siderophore producing lead and cadmium resistant
Pseudomonas putida KNP9, Curr. Microbiol. 50 (2005) 233e237.
[71] A.M. Chaudri, C.M. Allain, V.L. Barbosa-Jefferson, F.A. Nicholson, B.J. Chambers,
S.P. McGrath, A study of the impacts of Zn and Cu on two rhizobial species in
soils of a long term field experiment, Plant Soil 22 (2000) 167e179.
[72] G.I. Burd, D.G. Dixon, B.R. Glick, A plant growth-promoting bacterium that
decreases nickel toxicity in seedlings, Appl. Environ. Microbiol. 64 (1998)
3663e3668.
[73] M. Faisal, S. Hasnain, Bacterial Cr(VI) reduction concurrently improves
sunflower (Helianthus annus L) growth, Biotechnol. Lett. 27 (2005)
943e947.
[74] P. Hare, W. Cress, Metabolic implications of stress-induced proline accumu-
lation in plants, J. Plant Growth Regul. 21 (1997) 79e102.
[75] L. Szabados, A. Savoure, Proline: a multifunctional amino acid, Trends Plant
Sci. 15 (2010) 89e97.
[76] H. Schat, S.S. Sharma, R. Vooijs, Heavy metal-induced accumulation of free
proline in a metal-tolerant and a non tolerant ecotype of Silene vulgaris,
Physiol. Plant 101 (1997) 477e482.
[77] A. Maggio, S. Miyazaki, P. Veronese, T. Fujita, J.I. Ibeas, B. Damsz, M.L. Narasimhan,
P.M. Hasegawa, R.J. Joly, R.A. Bressan, Does proline accumulation play an active
role in stress-induced growth reduction, Plant J. 31 (2002) 699e712.
[78] N. Smirnoff, Q.J. Cumbes, Hydroxyl radical scavenging activity of compatible
solutes, Phytochemistry 28 (1989) 1057e1060.
[79] G.K. Handique, A.K. Handique, Proline accumulation in lemongrass (Cymbo-
pogon flexuosus Stapf.) due to heavy metal stress, J. Environ. Biol. 30 (2009)
299e302.