From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

PHAGOCYTES, GRANULOCYTES, AND MYELOPOIESIS

Krox20/EGR2 deficiency accelerates cell growth and differentiation in the

monocytic lineage and decreases bone mass
Yankel Gabet,1,2 Sanjeev K. Baniwal,1,2 Nathalie Leclerc,1,2 Yunfan Shi,2 Alice E. Kohn-Gabet,2 Jon Cogan,2 Alexis Dixon,2
Marilyn Bachar,3 Lixin Guo,4 Jack E. Turman Jr,4 and Baruch Frenkel1,2,5
1Department of Biochemistry and Molecular Biology, Keck School of Medicine at the University of Southern California, Los Angeles, CA; 2Institute for Genetic

Medicine, Keck School of Medicine at the University of Southern California, Los Angeles, CA; 3Bone Laboratory, Faculty of Dental Medicine, Hebrew University
of Jerusalem, Jerusalem, Israel; 4Center for Craniofacial Molecular Biology, Keck School of Medicine at the University of Southern California, Los Angeles, CA;
and 5Department of Orthopedic Surgery, Keck School of Medicine at the University of Southern California, Los Angeles, CA

Krox20/EGR2, one of the 4 early growth
response genes, is a highly conserved
transcription factor implicated in hind-
brain development, peripheral nerve
myelination, tumor suppression, and
monocyte/macrophage cell fate determi-
nation. Here, we established a novel role
for Krox20 in postnatal skeletal metabo-
lism. Microcomputed tomographic analy-
sis of 4- and 8-week-old mice revealed a
low bone mass phenotype (LBM) in both
the distal femur and the vertebra of
Krox20ⴙ/ⴚ mice. This was attributable to
accelerated bone resorption as demon-
strated in vivo by increased osteoclast
number and serum C-terminal telopep-
tides, a marker for collagen degradation.
Krox20 haploinsufficiency did not reduce
bone formation in vivo, nor did it compro-
mise osteoblast differentiation in vitro. In
contrast, growth and differentiation were
significantly stimulated in preosteoclast
cultures derived from Krox20ⴙ/ⴚ spleno-
cytes, suggesting that the LBM is attribut-
able to Krox20 haploinsufficiency in the
monocytic lineage. Furthermore, Krox20
silencing in preosteoclasts increased
cFms expression and response to macro-
phage colony-stimulating factor, leading
to a cell-autonomous stimulation of
cell-cycle progression. Our data indicate
that the antimitogenic role of Krox20 in
preosteoclasts is the predominant mecha-
nism underlying the LBM phenotype of
Krox20-deficient mice. Stimulation of
Krox20 expression in preosteoclasts may
present a viable therapeutic strategy for
high-turnover osteoporosis. (Blood. 2010;
116(19):3964-3971)

Introduction
The family of early growth response (EGR) genes consists of
4 members, EGR1/Krox24, EGR2/Krox20, EGR3, and EGR4.1
Their expression is rapidly induced by serum and growth factors,
such as nerve growth factor, epidermal growth factor, and platelet-
derived growth factor.2-4 The 4 EGR proteins are transcription
factors that share a highly conserved DNA-binding domain com-
posed of 3 zinc fingers, which recognize G:C-rich DNA motifs1,5-7
in the promoters of target genes such as Hox-1.4,8 Hoxa-2 and
Hoxb-2,9 thymidine kinase,8,10 and synapsin I and II.11,12 The
transactivation activity of EGR factors is modulated by co-
activators such as host cell factor C113 and corepressors such as
NAB1,14 NAB2,15 and Ddx20.16
Early studies highlighted the role of EGR genes in cell
proliferation.4 In cancer cells of various origins, Krox20 plays a
role downstream of the PTEN tumor suppressor, and its deletion is
associated with cancer cell proliferation.17,18 Krox20 knockout
mice have severe abnormalities in hindbrain development19-21 and
impaired peripheral nerve myelination22 attributable to the role of
Krox20 in regulating Schwann cells growth and differentiation.22-24
Krox20 has also been implicated in fate determination in the
myeloid lineage. Specifically, it inhibits neutrophil- and activates
macrophage-specific genes such as c-fms, encoding the macro-
phage colony-stimulating factor (M-CSF) receptor.25,26 Krox20
interacts with PU.1, a master transcription factor critical in
macrophage differentiation, to enhance transcription of c-fms.26
Krox24 stimulates monocytic differentiation in myeloid cell lines
and murine marrow progenitors at the expense of granulopoi-
esis.27-30 Krox20 may also favor monocytic fate determination at
the expense of granulopoiesis by repressing transcription of Gfi-1,
a negative regulator of macrophage genes required for neutrophil
cell differentiation.25 Krox24 and Krox20 have redundant roles in
monocytic maturation.25
In vertebrates, bone mass and shape are determined by continu-
ous remodeling executed by the concerted action of osteoclasts, the
bone resorbing cells, and osteoblasts, the bone forming cells.
Therefore, both decreased bone formation and increased bone
resorption may result in bone loss. Little is known about the role of
EGRs in bone. Krox24-deficient mice have low bone mass,
attributable to increased expression of M-CSF in stromal cells and
increased bone turnover.31 In addition, retinoic acid and prostaglan-
din E2, which stimulate osteoblastic cell proliferation and differen-
tiation, increase the expression of Krox24.32,33 Krox20 is largely
expressed in long bone at the cartilage-trabecular bone transition
line, and its absence results in failure of embryonic trabecular bone
formation, which has been attributed to a differentiation block in
the chondroosteoblast lineage.34 Recently, we reported that Krox20
expression was up-regulated in vitro during late stages of osteo-
blast differentiation and was repressed by glucocorticoids.35 In vivo
investigation of the role of Krox20 in postnatal bone metabolism is
difficult because Krox20-null mice die within days after birth,
presumably due to neuronal defects.21 In this study, we employed
the viable mice haploinsufficient for Krox20 to assess its role in

Submitted January 12, 2010; accepted July 15, 2010. Prepublished online as payment. Therefore, and solely to indicate this fact, this article is hereby
Blood First Edition paper, August 17, 2010; DOI 10.1182/blood-2010-01-263830. marked ‘‘advertisement’’ in accordance with 18 USC section 1734.

The publication costs of this article were defrayed in part by page charge © 2010 by The American Society of Hematology

3964 BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19

 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19 KROX20 IN PREOSTEOCLASTS AND BONE MASS 3965

Table 1. Primers for genotyping and RT-qPCR (TRAP) staining and couterstaining with methyl green (Vector Inc).
Genotyping Sections were analyzed using a Zeiss Axioskop (Zeiss), with a 40⫻
Krox20 Fwd WT 5⬘ GCAGAAGGAACGGAAGAGCAG 3⬘ objective and a SPOT digital camera (Diagnostic Instruments). Metaphy-
Fwd Mutant 5⬘ GGCCGCTTTTCTGGATTCAT 3⬘ seal TRAP-labeled cells located at least 200 ␮m from the growth plate were
Rev 5⬘ ATCAAGGTCCTTTGCCCAGATC 3⬘ enumerated as either positive or negative for Krox20.
RT-qPCR
rpL10A Fwd 5⬘ CGCCGCAAGTTTCTGGAGAC 3⬘ CTX measurement
Rev 5⬘ CTTGCCAGCCTTGTTTAGGC 3⬘
Blood was drawn from 6-hour fasting animals at approximately 2 PM.
Krox20 Fwd 5⬘ TTGACCAGATGAACGGAGTG 3⬘
Levels of serum C-terminal telopeptides (CTX) were determined by
Rev 5⬘ CCAGAGAGGAGGTGGAAGTG 3⬘
enzyme-linked immunosorbent assay using RatLaps (Immunodiagnostic
Krox24 Fwd 5⬘ CCCTGACTATCTGTTTCC 3⬘
Systems) according to the manufacturer’s instructions.
Rev 5⬘ TCTGCTTTCTTGTCCTTC 3⬘
M-CSF Fwd 5⬘ AGTCTGTCTTCCACCTGCTG 3⬘
Rev 5⬘ TTCCACCTGTCTGTCCTCAT 3⬘
Tissue culture
cFms Fwd 5⬘ GGAGGTGGATTCCCTACCAT 3⬘ Splenocytes were extracted from 1-day-old pups, and preosteoclasts were
Rev 5⬘ GGCCCAGAACTGGTTGTAGA 3⬘ obtained after 3 days of culture in “standard” medium (␣-MEM, 10% FBS,
and 1% penicillin/streptomycin) supplemented with 100 ng/mL M-CSF.
For differentiation assay, adherent preosteoclasts were plated in 96-well
postnatal bone metabolism. We demonstrate that these mice have a plates with standard medium supplemented with 20 ng/mL M-CSF and
100 ng/mL receptor activator for nuclear factor ␬ B ligand (RANKL). On
low bone mass (LBM) phenotype attributable to increased bone
day 7, multinucleated osteoclasts were stained using a TRAP kit, and
resorption and that Krox20 attenuates osteoclast growth and
TRAP-positive surface was measured using ImageJ Version 1.41 software
differentiation in a cell autonomous manner. (National Institutes of Health). Alternatively, splenocytes were extracted,
plated in 96-well plates and treated from the first day with 20 ng/mL M-CSF
and 100 ng/mL RANKL for 8 days before TRAP staining. For proliferation
Methods assay, preosteoclasts were plated with standard medium supplemented with
100 ng/mL M-CSF, and cell number was assessed using the thiazolyl blue
Materials tetrazolium bromide (MTT) assay. Calvarial osteoblasts cultures were
prepared from 1-day-old pups as described previously.35 Cells were
All reagents were purchased from Sigma-Aldrich unless otherwise speci-
cultured on 12-well plates for reverse-transcription quantitative polymerase
fied. ␣-minimal essential medium and Dulbecco modified Eagle medium
chain reaction (RT-qPCR; see next paragraph) and mineralization assays.
were purchased from Gibco, fetal bovine serum (FBS) from Hyclone, and
For the latter, osteogenic medium containing ascorbic acid (50 ␮g/mL) and
culture plates from Corning. In splenocyte cultures, we used supernatant
␤-glycerophosphate (10mM) was initiated at confluence and alizarin red
from cardiomyogenic 14-12 cells, containing 1.3 ␮g/mL M-CSF.36
staining was performed at day 20. Mesenchymal stem cells were cultured
and analyzed as described previously.37
Animals

All experiments were approved by the Institutional Animal Care and Use
Committee of the University of Southern California. Krox20⫹/⫺ female
mice were compared with their littermate female controls. The mice were
either on a pure C57BL/6 background (The Jackson Laboratory) or on a
C57BL/6 ⫻ 129 background. Genotyping was performed as described
previously21 using primers listed in Table 1. To assess bone formation, mice
were injected intraperitoneally with calcein 4 and 1 day before sacrifice.37
Microcomputed tomography
Femora (1 per mouse) and third lumbar vertebrae were examined as
reported previously37 using Scanco microcomputed tomography ␮CT40
(Scanco Medical AG). Briefly, scans were performed at a 20-␮m resolution
in all 3 spatial dimensions. The mineralized tissues were differentially
segmented by a global thresholding procedure.38 Trabecular parameters
were measured in the secondary spongiosa of the distal femoral metaphysis
and in the entire trabecular bone compartment of the third lumbar vertebrae
body. Cortical parameters were determined in the mid-diaphyseal region.
Histomorphometry
Dynamic histomorphometric measurements and osteoclast counting were
performed as described previously using Media Cybernetic ImagePro Plus
Version 6.0 software.37 The terminology and units used for these measure-
ments were according to the convention of standardized nomenclature.39
mRNA and protein expression
RNA from cells was extracted and processed as described previously.37
mRNA levels were corrected for ribosomal protein L10A (rpL10A) mRNA.
Primers used for PCR are listed in Table 1. For Western blot analyses,
protein extraction, electrophoresis, and transfer were performed essentially
as previously described,35 and the Pierce Fast Western Blot kit (Thermo
Scientifics) was used for antibody binding and chemiluminescence. Antibod-
ies were purchased from Cell Signaling (anti–phospho extracellular-signal-
regulated kinase [ERK]1/2 Thr202/Tyr204, anti-Akt, and anti–phospho Akt
Ser473), Promega (anti-ERK1/2), and Sigma-Aldrich (anti-cFms). The
mouse monoclonal anti-Tubulin antibody, developed by Dr Charles Walsh,
was obtained from the Developmental Studies Hybridoma Bank under the
auspices of the National Institute of Child Health and Development and The
University of Iowa, Department of Biological Sciences, Iowa City, IA.
Krox20 silencing
We used Sigma Mission shRNA against Krox20 (shKrox20-1, Clone
567s1c1; shKrox20-2, Clone 788s1c1) or nonspecific (NS) shRNA as
control (SHC002). Lentiviral particles were generated by transfecting
HEK293T cells with the plasmids carrying the shRNA sequence.40 For
silencing, transduction of M-CSF–treated splenocytes was performed at
approximately 30% confluence. Medium was changed after 16 hours, and
cells were allowed to recover for 48 hours before further analysis.

Assessment of Krox20 expression in osteoclasts in vivo FACS analyses

Both femora from 4 wild-type (WT) mice were removed, fixed in 4%
paraformaldehyde, and decalcified in 10% EDTA (ethylenediaminetetraace-
tic acid) before paraffin embedding. Five-micrometer sections separated by
40 ␮m were incubated with Krox20 antibody (Covance) and labeled with
Avidin-Biotin. This was followed by tartrate-resistant acid phosphatase
For cell-cycle analysis, preosteoclasts were harvested by trypsinization
16 hours after medium change and analyzed with Fluorescence-activated
cell sorting (FACS) as previously described.41 To determine the monocytic
cells distribution in bone marrow, 1 femur per animal was cut at the
mid-diaphysis and the epiphysis removed. Then, bone marrow cells were
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

3966 GABET et al BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19

flushed out from the distal cut end and red blood cells were lysed using a
10␮M Tris-HCl buffer containing 0.74% NH4Cl. Then, an aliquot of
1 ⫻ 106 cells was stained with allophycocyanin-conjugated anti–mouse
CD115 (eBiosciences). Stained cells were analyzed and sorted on a
FACSCalibur machine (Becton Dickinson). For analysis of apoptosis,
trypsinized cells were stained with fluorescein isothiocyanate (FITC)–
conjugated annexin V and propidium iodide according to the manufactur-
er’s instructions (Clontech). Cells positive for annexin V and/or propidium
iodide were recorded by flow cytometry.

Statistical analysis

Values are expressed as mean ⫾ SEM. Values beyond the mean ⫾ 1.5 ⫻ SD
range were excluded from the analysis. Difference between groups was
defined as P ⬍ .05 using Student t test and 1-way analysis of variance when
2 and 3 groups were compared, respectively.

Results
Low bone mass phenotype in Krox20-haploinsufficient mice

Although a role for Krox20 in embryonic endochondral bone

formation was suggested 2 decades ago,34 its potential postnatal
role in the skeleton has not been determined. Here, we investigated
the postnatal skeletal role of Krox20 using heterozygous mice,
which display no overt phenotype and whose total body weight is
similar to that of sex/age-matched WT controls. Microcomputed
tomographic analysis of 4- and 8-week-old Krox20-haploinsuffi-
cient female mice revealed a LBM phenotype compared with
littermate controls (Figure 1 and Table 2). The trabecular bone
volume density measured in the distal femur of Krox20⫹/⫺ mice
was 32% and 42% lower than the WT controls at 4 and 8 weeks of
age, respectively (Table 2 and Figure 1A). No difference was Figure 1. Low trabecular bone mass in Krox20ⴙ/ⴚ mice. (A) ␮CT analysis of the
observed in the femoral length, mid-diaphyseal diameter, and distal femoral trabecular bone of 10 Krox20⫹/⫹ (white) and 9 Krox20⫹/⫺ (gray)
cortical thickness (Table 3). The trabecular bone volume density 8-week-old female mice. BV/TV indicates trabecular bone volume density; Tb.N,
trabecular number; Tb.Th, trabecular thickness; and Conn.D, connectivity density.
was also lower in the body of the third lumbar vertebra in
Data are mean ⫾ SEM. *P ⬍ .05 compared with WT controls. (B) ␮CT images of
4-week-old mice (Table 2), suggesting a global positive role for distal femoral trabecular bone of Krox20⫹/⫹ (left) and Krox20⫹/⫺ (right) mice with
Krox20 in the postnatal regulation of trabecular bone mass. median BV/TV values.

Krox20 haploinsufficiency increases bone resorption in vivo

In pursuit of the cellular mechanism underlying the LBM pheno-
type of Krox20⫹/⫺ mice, we measured indicators of bone resorption
and bone formation in vivo. First, we performed TRAP staining of
histologic sections obtained from distal femoral metaphyses of
8-week-old mice. As shown in Figure 2A-B, Krox20⫹/⫺ mice had a
significant 32% higher osteoclast number compared with WT
controls, suggesting that the Krox20⫹/⫺ LBM phenotype is attribut-
able to increased osteoclast activity. Further implicating bone
resorption in the LBM phenotype, Krox20⫹/⫺ mice exhibited a
significant 44% increase in serum CTXs, a biochemical marker of
bone resorption (Figure 2C). Because osteoclasts derive from
monocytes,42 we used FACS to compare CD115⫹ monocytes in
bone marrow of WT versus Krox20⫹/⫺ mice. However, the
monocyte count in the mutant mice was normal (Figure 2D),
suggesting that Krox20 haploinsufficiency does not exert its effect
during early monocyte differentiation but rather later during the
development of the osteoclast phenotype.
Because previous work with mouse embryos and cell culture
models suggested a possible role for Krox20 in cells of the
osteoblast lineage,34,35,43 we also tested whether the Krox20⫹/⫺
LBM phenotype was associated with reduced bone formation. We
used vital double calcein labeling to assess bone matrix apposition
in vivo in the distal femur of 8-week-old mice, but, as shown in
Figure 2E-G, the Krox20⫹/⫺ mice had normal mineralizing perim-
eter (a surrogate for osteoblast number), normal mineral apposition
rate (a surrogate for osteoblast activity), and therefore normal bone
formation rate. Thus, the LBM phenotype observed in Krox20-
heterozygous mice is attributable to increased bone resorption
rather than decreased bone formation.
Krox20 haploinsufficiency results in increased preosteoclast
proliferation in vitro
We next investigated the role of Krox20 in osteoclasts and
osteoblasts in vitro. M-CSF–treated splenocytes were used to study
the effects of Krox20 on osteoclast growth and differentiation. The
2-fold decrease in Krox20 expression in the preosteoclast cultures
derived from the heterozygous animals (Figure 3A) was associated
with a significant 70% increase in proliferation rate, as determined
by MTT assay (Figure 3B). We then tested whether the increased
proliferation of the osteoclast precursors led to more differentiated
osteoclasts. Splenocytes from WT and Krox20⫹/⫺ mice were plated
and treated with M-CSF and RANKL to promote differentiation
into preosteoclasts and then mature osteoclasts in the same culture.
Consistent with the increased proliferation (Figure 3B), the
Krox20⫹/⫺ splenocytes gave rise to significantly more osteoclasts
than did their WT counterparts (Figure 3C). Next, we specifically
tested the role of Krox20 in the growth and differentiation of
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19 KROX20 IN PREOSTEOCLASTS AND BONE MASS 3967

Table 2. Trabecular bone microarchitecture in distal femoral metaphysis and third lumbar vertebral body from 4-week-old WT and
Krox20ⴙ/ⴚ mice
Distal femur L3 vertebral body
Krox20ⴙ/ⴙ (n ⴝ 5) Krox20ⴙ/ⴚ (n ⴝ 5) P Krox20ⴙ/ⴙ (n ⴝ 7) Krox20ⴙ/ⴚ (n ⴝ 5) P

BV/TV (%) 6.9 ⫾ 0.8 4.7 ⫾ 0.5 .034 13.6 ⫾ 1.0 10.6 ⫾ 0.9 .028
Tb.N (mm⫺1) 1.8 ⫾ 0.1 1.3 ⫾ 0.1 .017 3.8 ⫾ 0.2 3.2 ⫾ 0.2 .024
Tb.Th (␮m) 38 ⫾ 0.2 36 ⫾ 0.1 .225 35 ⫾ 0.1 32 ⫾ 0.1 .077
Conn.D (mm⫺3) 29.5 ⫾ 5.8 16.5 ⫾ 2.8 .046 109.7 ⫾ 10.8 71.1 ⫾ 10.6 .015

Data are mean ⫾ SEM.

BV/TV indicates trabecular bone volume density; Tb.N, trabecular number; Tb.Th, trabecular thickness; and Conn.D, connectivity density.

monocytes that have already committed to the osteoclast pheno-
type. To this end, splenocytes were treated with M-CSF for 3 days,
and equal numbers of the resulting preosteoclasts from Krox20⫹/⫺
and WT mice were replated and induced to further differentiate by
the addition of RANKL. Following this protocol, we again
observed significantly more TRAP⫹ osteoclasts in cultures derived
from Krox20-haploinsufficient mice (Figure 3D-E). These results
suggest that the in vivo Krox20⫹/⫺ LBM phenotype is attributable
to increased growth and differentiation of the osteoclast precursors.
The role of Krox20 in the osteoblast lineage was investigated
using osteoblast cultures derived from either newborn mouse
calvariae or adult bone marrow. As in preosteoclasts, Krox20
expression was reduced, by as much as 3.5-fold, in osteoblast
cultures derived from calvariae of Krox20⫹/⫺ compared with
Krox20⫹/⫹ newborn mice (Figure 3F). However, this decrease was
not associated with compromised mineralization as assessed by
alizarin red staining of day-20 calvarial osteoblast cultures (Figure
3G-H). In mesenchymal stem cell cultures derived from the bone
marrow of Krox20 heterozygous mice, we again did not observe a
decrease in the potential for bone-like tissue formation. In fact, the
number of osteoblastic colony-forming units (CFU-Ob) was surpris-
ingly increased in Krox20⫹/⫺ cultures (Figure 3I). Further cell
proliferation in the osteoblast lineage, assessed by the average size
of the osteoblastic colonies, was unaffected by the Krox20 geno-
type (Figure 3J). Thus, consistent with the in vivo data (Figure 2),
the results of our ex vivo and culture assays indicate that the
Krox20⫹/⫺ LBM phenotype is attributable to increased bone
resorption and not to decreased bone formation.
Krox20 attenuates preosteoclast cell cycle in a cell
autonomous manner
To determine the mechanism by which Krox20 attenuates preoste-
oclasts proliferation, we initially profiled Krox20⫹/⫹, Krox20⫹/⫺,
and Krox20⫺/⫺ cells for their distribution among the phases of the
cell cycle. As shown in Figure 4A, reduction in the Krox20 gene
dosage was associated with a progressive, up to 3-fold, increase in
the percentage of cells in the S and G2/M phases, indicating a
negative control of the preosteoclast cell cycle by Krox20. The role
of Krox20 in preosteoclast survival was then assessed based on
annexin V staining and propidium iodide retention. As shown in
Figure 4B, reduction in the Krox20 gene dosage had a mild positive

Figure 2. Increased bone resorption in Krox20ⴙ/ⴚ

animals. (A) Histologic images showing increased oste-
oclast number and thinner trabeculae in the distal femur
of WT (left) and Krox20⫹/⫺ (right) animals. Arrows point at
TRAP⫹ lining osteoclasts. Images were acquired using a
Zeiss Axioskop, with a 40⫻ objective and a SPOT digital
camera. (B) Oc.N/BS, TRAP⫹ lining osteoclasts relative
to bone surface measured in histologic sections of the
distal femur from five 8-week-old mice per group.
(C) Serum CTX levels in 4 WT and 3 Krox20⫹/⫺ 6-week-
old mice. (D) FACS analysis of CD115⫹ monocytes in the
distal femoral metaphysis of 4 WT (left) and 5 Krox20⫹/⫺
(right) 6-week-old mice. Bars show the percentage
CD115⫹ monocytes from total red blood cell-free bone
marrow cells. (E-G) Parameters of bone formation were
measured in histologic sections of the distal femur from 5
8-week-old mice per group. (E) MAR indicates mineral
apposition rate. (F) Min.Peri indicates mineralizing perim-
eter. (G) BFR indicates bone formation rate. Bars are
mean ⫾ SEM with the Krox20⫹/⫺ values always on the
right. *P ⬍ .05 compared with WT controls.
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

3968 GABET et al BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19

Table 3. External and cortical dimensions of femora from 8-week-

old WT and Krox20ⴙ/ⴚ mice
Krox20ⴙ/ⴙ (n ⴝ 10) Krox20ⴙ/ⴚ (n ⴝ 9) P

Femoral length 14.76 ⫾ 0.23 14.65 ⫾ 0.27 .380

Dia.Dia 1.536 ⫾ 0.031 1.502 ⫾ 0.036 .235
Med.Dia 1.238 ⫾ 0.029 1.213 ⫾ 0.031 .279
Cort.Th 0.162 ⫾ 0.007 0.161 ⫾ 0.004 .492

Data are mean ⫾ SEM in mm.

Dia.Dia indicates mid-diaphyseal periosteal diameter; Med.Dia, mid-diaphyseal
medullary diameter; and Cort.Th, mid-diaphyseal cortical thickness.

effect on preosteoclast survival, attributable to decreased apoptosis,

measured by annexin V staining. Taken together, our results
indicate that Krox20 attenuates preosteoclast proliferation primar-
ily by restraining cell-cycle progression.
Although osteoclast growth and differentiation was increased in
the relatively pure splenocyte cultures from Krox20-deficient mice
(Figure 3B-D), these results do not necessarily indicate a cell
autonomous role of Krox20 because the splenocytes were extracted
from mice that were Krox20-compromised from conception and in
many cell types, including, for example, spleen stromal cells and
myeloid early precursors. To conclusively address the potential cell
autonomous effect of Krox20 in osteoclasts, we first confirmed the
expression of Krox20 in osteoclasts in vivo. Histologic sections of
mature bone were subjected to TRAP staining combined with
Krox20 immunohistochemistry as described in “Methods” (Figure
4C), and 263 TRAP⫹ cells were scored as either Krox20⫹ or
Krox20⫺. We found that 94% of the osteoclasts (248 cells)
expressed Krox20, indicating that Krox20 can have a cell autono-
mous role in osteoclasts in vivo.
To test whether the antiproliferative effect of Krox20 in
preosteoclasts is truly cell autonomous, we examined the effects of
Krox20 silencing in vitro. WT preosteoclasts were transduced with
lentiviruses encoding a shRNA against Krox20. To rule out off-target
effects, we used 2 different shRNA sequences, shKrox20-1 and Figure 3. Increased proliferation in osteoclast precursors derived from Krox20ⴙ/ⴚ
mice. (A) Splenocytes from WT and Krox20⫹/⫺ newborn mice were cultured for
shKrox20-2, which reduced Krox20 mRNA levels by 75% and 3 days with 100 ng/mL M-CSF. Krox20 and Krox24 mRNA expression in subconfluent
81%, respectively, compared with cells transduced with a lentivirus preosteoclasts cultures was assessed by RT-qPCR and corrected for the expression
encoding an NS shRNA (Figure 4D). As shown in Figure 4E, of rpL10A. (B) Spleen-derived preosteoclasts as in panel A were plated in 96-well
plates at 2000 cells per well and cultured with 100 ng/mL M-CSF. Medium was
Krox20 silencing by shKrox20-1 and shKrox20-2 resulted in 39%
changed on days 3 and 5, and proliferation was determined after 7 days using MTT
and 74% increase in preosteoclast proliferation, respectively, assay. (C) Splenocytes from WT and Krox20⫹/⫺ newborn mice were plated in 96-well
indicating that the antiproliferative effect of Krox20 does not plates at 150 000 cells per well and cultured from the first day with 20 ng/mL M-CSF
require involvement of other cells. Consistent with the cell-cycle and 100 ng/mL RANKL. Medium was changed on days 3 and 5, and TRAP staining
was performed on day 8. Bars represent relative TRAP⫹ area. (D-E) Spleen-derived
profiles of Krox20⫹/⫹, Krox20⫹/⫺, and Krox20⫺/⫺ preosteoclasts preosteoclasts pretreated with 100 ng/mL M-CSF alone as in panel A were plated in
(Figure 4A), the accelerated proliferation of the shKrox20- 96-well plates at 5000 cells per well and cultured with 20 ng/mL M-CSF and
transduced cells was associated with a 60% increase in the 100 ng/mL RANKL for 7 days. Medium was changed on days 3 and 5. Bars represent
relative TRAP⫹ area. (E) Representative images of TRAP-positive osteoclasts
percentage of cells in the S and G2/M phases of the cell cycle derived from WT (left) and Krox20⫹/⫺ (right) mice; bar ⫽ 0.5 mm. (F) Krox20 and
(Figure 4E-F). However, Krox20 silencing did not affect cell Krox24 mRNA in primary calvarial osteoblastic cultures from Krox20⫹/⫺ and control
survival (Figure 4G). Because the genetic approach suggested only mice was assessed by RT-qPCR and corrected for the expression of rpL10A.
(G-H) Primary calvarial osteoblast cultures from WT and Krox20⫹/⫺ mice were fixed
a minor role for Krox20 in preosteoclast apoptosis (Figure 4B), this
and stained with alizarin red 20 days after confluence. Bars represent percent alizarin
and the silencing approaches collectively support the conclusion red-positive area. (H) Representative images from WT- (left) and Krox20⫹/⫺-derived
that Krox20 inhibits cell proliferation primarily by attenuating (right) cultures. (I-J) Bone marrow–derived cultures from WT and Krox20⫹/⫺ mice.
preosteoclast cell-cycle progression in a cell autonomous manner. Number of alizarin red-positive CFU-Ob colonies (I) and mean colony size (J) were
determined in day-20 cultures after fixation and staining. Bars represent mean
⫾ SEM of Krox20⫹/⫹ (white) and Krox20⫹/⫺ (gray) cells. *P ⬍ .05 compared with
Krox20 attenuates cFms signaling in preosteoclasts
control littermates. Assays were performed in triplicate per animal, and the number of
animals is specified in parentheses inside each bar.
Preosteoclast proliferation is tightly regulated by binding of
M-CSF to its cFms receptor and the subsequent activation of the
phosphatidylinositol 3-kinase/Akt and MEK/ERK pathways.44 We As shown in Figure 5A-B, Krox20 silencing increased cFms
tested the hypothesis that Krox20 restrains cFms signaling in expression at both the mRNA and protein levels. Furthermore,
preosteoclasts by measuring cFms expression as well as M-CSF– analysis of Akt and ERK phosphorylation after M-CSF treatment
mediated activation of the phosphatidylinositol 3-kinase/Akt and demonstrated an augmented response in the Krox20-depleted cells
the MEK/ERK pathways in shKrox20-transduced preosteoclasts. (Figure 5C). These findings suggest that Krox20 attenuates the
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19 KROX20 IN PREOSTEOCLASTS AND BONE MASS 3969

Figure 4. Silencing of Krox20 in preosteoclasts accelerates cell-cycle progression. (A) Preosteoclasts derived from WT, Krox20⫹/⫺, and Krox20⫺/⫺ mice were plated in
12-well plates at 20 000 cells per well and cultured with 100 ng/mL M-CSF for 3 days before cell-cycle profiling. Bars represent percentage of cells in the S⫹G2/M phases.
(B) Apoptosis was assessed in preosteoclasts obtained as in panel A using annexin V and propidium iodide staining. Survival corresponds to the percentage of cells negative
for both FITC–annexin V labeling and propidium iodide. (A-B) Bars represent mean ⫾ SEM; n ⫽ 4; #P ⬍ .05, 1-way analysis of variance for the effect of gene dosage.
(C) Combined Krox20 immunohistochemistry (brown/black) and TRAP staining (purple) of a section from a WT distal femur, showing a representative Krox20-expressing
osteoclast. Arrow points at a brown/black granular immunohistochemical reaction product indicating nuclear Krox20. Arrowheads depict faint brown cytoplasmic Krox20
immunostaining. (D) Splenocytes from WT mice were cultured for 3 days with 100 ng/mL M-CSF, and Krox20 expression was silenced using 2 different shRNA-coding
lentiviruses (shKrox20-1 and shKrox20-2). Krox20 mRNA levels were determined by RT-qPCR and corrected for the corresponding expression of rpL10A. Bars represent
expression levels relative to cells transduced with a nonspecific (NS) shRNA lentivirus. (E) Preosteoclasts were plated in 48-well format at 6000 cells per well and cultured with
100 ng/mL M-CSF, and Krox20 expression was silenced as in panel D. Proliferation was determined between days 4 and 9 after transduction using MTT assay.
(F) Preosteoclasts were plated in 12-well plates at 20 000 cells per well and cultured with 100 ng/mL M-CSF. Cells were then transduced with lentiviruses encoding the
shKrox20-2 or the NS shRNA, and cell-cycle analysis was performed as in panel A. Representative cell-cycle profiles are shown on the right. (G) Apoptosis was assessed in
preosteoclasts obtained as in panel F. (D-G) Bars represent mean ⫾ SEM; n ⫽ 4; *P ⬍ .05 vs NS.

proliferation of preosteoclasts by down-regulating their cFms
levels and thus blunting their response to M-CSF.
Discussion
For the first time, this work establishes a postnatal role for Krox20
in bone metabolism. Krox20-haploinsufficiency in preosteoclasts
results in accelerated proliferation and cell-cycle progression,
likely due to increased cFms expression and signaling. This leads to
increased number of mature osteoclasts both in vitro and in vivo.
The resulting acceleration of bone resorption underlies the ob-
served LBM phenotype.
By in large, macrophages and preosteoclasts are closely related
as they both differentiate from monocytes after M-CSF stimulation.
Cellular events triggered by RANKL can then induce M-CSF–
stimulated monocytes to further differentiate into mature oste-
oclasts. Here, we found that the number of bone marrow monocytes
was not affected by the Krox20 gene dosage (Figure 2D). Krox20 is
also not critical for M-CSF–related differentiation of liver mono-
cytes into macrophages,45 likely because of the redundant role of
Krox24 in monocyte maturation and macrophage differentiation.25
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.
3970 GABET et al
In addition, our data suggest that Krox20 does not play a significant
role in terminal osteoclast differentiation, as the overall increase in
osteoclastogenesis in Krox20⫹/⫺ preosteoclasts cultures did not
exceed the increase in preosteoclast proliferation (Figure 3B-E).
Therefore, our findings imply that the LBM phenotype observed in
Krox20-haploinsufficient mice results from enhanced growth and
differentiation of osteoclast precursors.
Unlike the inhibitory effect of Krox20 on the preosteoclast cell
cycle, its role in apoptosis is more complex. We observed a mild
proapoptotic effect of Krox20 by comparing preosteoclasts from
Krox20⫹/⫹, Krox20⫹/⫺, and Krox20⫺/⫺ mice. This effect is prob-
ably indirect because apoptosis was not affected by Krox20
silencing in isolated WT cells. Interestingly, unlike our preoste-
oclast cultures, Bradley et al46 reported a prosurvival role for
Krox20 in mature osteoclasts in vitro. Be that as it may, the
increased proliferation of Krox20-compromised preosteoclasts in
vitro (Figures 3B and 4E) and the increased osteoclast number and
bone resorption in Krox20⫹/⫺ mice in vivo (Figure 2A-C) demon-
strate that inhibition of cell-cycle progression (Figure 4A,F) is the
overall predominant effect of Krox20 in the osteoclast lineage.
The present study demonstrates a major physiologic role for
osteoclastic Krox20 in postnatal bone mass control. However, we
cannot rule out a role for Krox20 in cells of the osteoblast lineage
as well. In fact, we report here that Krox20 haploinsufficiency
increases bone marrow–derived CFU-Ob (Figure 3I). This could
reflect a bona fide effect of Krox20 on early osteoblast progenitors,
similar to its effect on osteoclast progenitors. However, such a
putative effect does not result in increased net bone formation in
Krox20⫹/⫺ mice (Figure 2E-G). On the other hand, because
preosteoblasts significantly contribute to the bone marrow M-CSF
pool, the increased CFU-Ob may contribute to the elevated
osteoclastogenesis observed in the Krox20-compromised animals.
Indeed, although RT-qPCR analysis of Krox20⫹/⫺ newborn cal-
varial osteoblast cultures demonstrated normal M-CSF expression
BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19
Figure 5. Silencing of Krox20 in preosteoclasts increases cFms
signaling. (A) Wild type splenocytes were cultured for 3 days with
100 ng/mL M-CSF, and Krox20 expression was silenced using shKrox20-2
lentiviruses. cFms mRNA levels were determined by RT-qPCR and
corrected for the corresponding expression of rpL10A. Bars represent
mean ⫾ SEM of expression levels relative to cells transduced with a
nonspecific (NS) shRNA lentivirus (n ⫽ 5; *P ⬍ .05 vs NS). (B) Western
blot analysis of cFms was performed on preosteoclasts obtained as in
panel A. Tubulin was used as loading control. (C) Preosteoclasts obtained
as in panel A were serum-starved for 2 hours and treated with M-CSF for
5 and 30 minutes as indicated, followed by Western blot analysis of
phospho- and total Akt and ERK. A vertical line has been inserted to
indicate a repositioned gel lane.
(0.82 ⫾ 0.27 vs 1.00 ⫾ 0.25, respectively; n ⫽ 5; P ⫽ .64), total
M-CSF expression was elevated in RNA extracts from Krox20⫹/⫺
compared with WT femora (2.07 ⫾ 0.20 vs 1.00 ⫾ 0.18, respec-
tively, n ⫽ 5, P ⬍ .05). Furthermore, any increase in osteoblast-
derived M-CSF in Krox20⫹/⫺ bones is expected to be amplified due
to the cell-autonomous increase of cFms signaling in the Krox20⫹/⫺
preosteoclasts.
In contrast to our findings in preosteoclasts, Krox20 operates in
concert with PU.1 to enhance cFms expression in myeloid progeni-
tors.25,26 Conceivably, the Krox20/PU.1-binding element at the
cFms gene switches its function from a transcriptional enhancer to
a transcriptional repressor as monocytes differentiate to preoste-
oclasts. Such switch can occur as the cellular milieu changes,
resulting in replacement of Krox20 co-activators with
corepressors.15,25
In summary, we established Krox20 as a significant antiprolif-
erative transcription factor in preosteoclasts. Decreased levels of
Krox20 led to increased osteoclast number, increased bone resorp-
tion, and low bone mass. Thus, maintenance or stimulation of
Krox20 expression in preosteoclasts may present a viable therapeu-
tic strategy for high-turnover osteoporosis.
Acknowledgments
We thank Dr Steve Teitelbaum and Dr Jennifer Reeve (Washington
University, St Louis, MO) for sharing their expertise and for the
generous gifts of RANKL and the M-CSF–containing conditioned
medium. We also thank Dr Debbie Johnson and Dr Sandra Johnson
(University of Southern California) for sharing their expertise and
for the generous gifts of antibodies.
This work was supported by grant RO1 AR047052 from
NIH/NIAMS. Y.G. was partly supported by a Meyer Young
Investigator Fellowship and S.K.B. by a postdoctoral Innovative
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

BLOOD, 11 NOVEMBER 2010 䡠 VOLUME 116, NUMBER 19 KROX20 IN PREOSTEOCLASTS AND BONE MASS 3971

Chapter Research Award, both from the Arthritis Foundation
Southern California Chapter. B.F. is the holder of the J. Harold and
Edna L. LaBriola Chair in Genetic Orthopaedic Research at the
University of Southern California.
Authorship
Contribution: Y.G., N.L., and B.F. designed research; Y.G., S.K.B.,
N.L., Y.S., A.E.K.-G., J.C., A.D., M.B., and L.G. performed
research; S.K.B. contributed new reagents/analytic tools; Y.G.,
S.K.B., N.L., J.E.T., and B.F. analyzed data; and Y.G. and B.F.
wrote the paper.
Conflict-of-interest disclosure: The authors declare no compet-
ing financial interests.
Correspondence: Baruch Frenkel, DMD, PhD, Institute for
Genetic Medicine, University of Southern California Keck School
of Medicine, 2250 Alcazar St, IGM/CSC-240, Los Angeles, CA
90033; e-mail: frenkel@usc.edu; or Yankel Gabet, DMD, PhD,
Institute for Genetic Medicine, University of Southern California
Keck School of Medicine, 2250 Alcazar St, IGM/CSC-240, Los
Angeles, CA 90033; e-mail: gabet@usc.edu.

References
1. Gashler A, Sukhatme VP. Early growth response
protein 1 (Egr-1): prototype of a zinc-finger family
of transcription factors. Prog Nucleic Acid Res
Mol Biol. 1995;50:191-224.
2. Milbrandt J. A nerve growth factor-induced gene
encodes a possible transcriptional regulatory fac-
tor. Science. 1987;238:797-799.
3. Christy BA, Lau LF, Nathans D. A gene activated
in mouse 3T3 cells by serum growth factors en-
codes a protein with “zinc finger” sequences.
Proc Natl Acad Sci U S A. 1988;85:7857-7861.
4. Lemaire P, Revelant O, Bravo R, Charnay P. Two
mouse genes encoding potential transcription
factors with identical DNA-binding domains are
activated by growth factors in cultured cells. Proc
Natl Acad Sci U S A. 1988;85:4691-4695.
5. Chavrier P, Zerial M, Lemaire P, Almendral J,
Bravo R, Charnay P. A gene encoding a protein
with zinc fingers is activated during G0/G1 transi-
tion in cultured cells. Embo J. 1988;7:29-35.
6. Swirnoff AH, Milbrandt J. DNA-binding specificity
of NGFI-A and related zinc finger transcription
factors. Mol Cell Biol. 1995;15:2275-2287.
7. O’Donovan KJ, Tourtellotte WG, Millbrandt J,
Baraban JM. The EGR family of transcription-
regulatory factors: progress at the interface of
molecular and systems neuroscience. Trends
Neurosci. 1999;22:167-173.
8. Chavrier P, Vesque C, Galliot B, et al. The segment-
specific gene Krox-20 encodes a transcription factor
with binding sites in the promoter region of the Hox-
1.4 gene. EMBO J. 1990;9:1209-1218.
9. Nonchev S, Maconochie M, Vesque C, et al. The
conserved role of Krox-20 in directing Hox gene
expression during vertebrate hindbrain segmen-
tation. Proc Natl Acad Sci U S A. 1996;93:9339-
9345.
10. Molnar G, Crozat A, Pardee AB. The immediate-
early gene Egr-1 regulates the activity of the thy-
midine kinase promoter at the G0-to-G1 transition
of the cell cycle. Mol Cell Biol. 1994;14:5242-
5248.
11. Petersohn D, Schoch S, Brinkmann DR, Thiel G.
The human synapsin II gene promoter. Possible
role for the transcription factor zif268/egr-1, poly-
oma enhancer activator 3, and AP2. J Biol Chem.
1995;270:24361-24369.
12. Thiel G, Cibelli G. Regulation of life and death by
the zinc finger transcription factor Egr-1. J Cell
Physiol. 2002;193:287-292.
13. Luciano RL, Wilson AC. HCF-1 functions as a
coactivator for the zinc finger protein Krox20.
J Biol Chem. 2003;278:51116-51124.
14. Russo MW, Sevetson BR, Milbrandt J. Identifica-
tion of NAB1, a repressor of NGFI-A- and Krox20-
mediated transcription. Proc Natl Acad Sci U S A.
1995;92:6873-6877.
15. Svaren J, Sevetson BR, Apel ED, Zimonjic DB,
Popescu NC, Milbrandt J. NAB2, a corepressor of
NGFI-A (Egr-1) and Krox20, is induced by prolif-
erative and differentiative stimuli. Mol Cell Biol.
1996;16:3545-3553.
16. Gillian AL, Svaren J. The Ddx20/DP103 dead box
protein represses transcriptional activation by
Egr2/Krox-20. J Biol Chem. 2004;279:9056-9063.
17. Unoki M, Nakamura Y. Growth-suppressive ef-
fects of BPOZ and EGR2, two genes involved in
the PTEN signaling pathway. Oncogene. 2001;
20:4457-4465.
18. Stanbridge EJ. Human tumor suppressor genes.
Annu Rev Genet. 1990;24:615-657.
19. Wilkinson DG, Bhatt S, Chavrier P, Bravo R,
Charnay P. Segment-specific expression of a
zinc-finger gene in the developing nervous sys-
tem of the mouse. Nature. 1989;337:461-464.
20. Schneider-Maunoury S, Topilko P, Seitandou T, et
al. Disruption of Krox-20 results in alteration of
rhombomeres 3 and 5 in the developing hind-
brain. Cell. 1993;75:1199-1214.
21. Swiatek PJ, Gridley T. Perinatal lethality and de-
fects in hindbrain development in mice homozy-
gous for a targeted mutation of the zinc finger
gene Krox20. Genes Dev. 1993;7:2071-2084.
22. Topilko P, Schneider-Maunoury S, Levi G, et al.
Krox-20 controls myelination in the peripheral
nervous system. Nature. 1994;371:796-799.
23. Parkinson DB, Bhaskaran A, Droggiti A, et al.
Krox-20 inhibits Jun-NH2-terminal kinase/c-Jun
to control Schwann cell proliferation and death.
J Cell Biol. 2004;164:385-394.
24. Zorick TS, Syroid DE, Brown A, Gridley T, Lemke
G. Krox-20 controls SCIP expression, cell cycle
exit and susceptibility to apoptosis in developing
myelinating Schwann cells. Development. 1999;
126:1397-1406.
25. Laslo P, Spooner CJ, Warmflash A, et al. Multilin-
eage transcriptional priming and determination of
alternate hematopoietic cell fates. Cell. 2006;126:
755-766.
26. Krysinska H, Hoogenkamp M, Ingram R, et al. A
two-step, PU. 1-dependent mechanism for devel-
opmentally regulated chromatin remodeling and
transcription of the c-fms gene. Mol Cell Biol.
2007;27:878-887.
27. Nguyen HQ, Hoffman-Liebermann B, Liebermann
DA. The zinc finger transcription factor Egr-1 is
essential for and restricts differentiation along the
macrophage lineage. Cell. 1993;72:197-209.
28. Krishnaraju K, Hoffman B, Liebermann DA. The
zinc finger transcription factor Egr-1 activates
macrophage differentiation in M1 myeloblastic
leukemia cells. Blood. 1998;92:1957-1966.
29. Krishnaraju K, Hoffman B, Liebermann DA. Early
growth response gene 1 stimulates development
of hematopoietic progenitor cells along the mac-
rophage lineage at the expense of the granulo-
cyte and erythroid lineages. Blood. 2001;97:
1298-1305.
30. Krishnaraju K, Nguyen HQ, Liebermann DA,
Hoffman B. The zinc finger transcription factor Egr-1
potentiates macrophage differentiation of hematopoi-
etic cells. Mol Cell Biol. 1995;15:5499-5507.
31. Cenci S, Weitzmann MN, Gentile MA, Aisa MC,
Pacifici R. M-CSF neutralization and egr-1 defi-
ciency prevent ovariectomy-induced bone loss.
J Clin Invest. 2000;105:1279-1287.
32. Suva LJ, Ernst M, Rodan GA. Retinoic acid in-
creases zif268 early gene expression in rat
preosteoblastic cells. Mol Cell Biol. 1991;11:
2503-2510.
33. Fang MA, Noguchi GM, McDougall S. Prosta-
glandin E2 induces Egr-1 mRNA in MC3T3-E1
osteoblastic cells by a protein kinase C-depen-
dent pathway. Prostaglandins Leukot Essent
Fatty Acids. 1996;54:109-114.
34. Levi G, Topilko P, Schneider-Maunoury S, et al.
Defective bone formation in Krox-20 mutant mice.
Development. 1996;122:113-120.
35. Leclerc N, Noh T, Cogan J, Samarawickrama DB,
Smith E, Frenkel B. Opposing effects of glucocor-
ticoids and Wnt signaling on Krox20 and mineral
deposition in osteoblast cultures. J Cell Biochem.
2008;103:1938-1951.
36. Takeshita S, Kaji K, Kudo A. Identification and
characterization of the new osteoclast progenitor
with macrophage phenotypes being able to differ-
entiate into mature osteoclasts. J Bone Miner
Res. 2000;15:1477-1488.
37. Noh T, Gabet Y, Cogan J, et al. Lef1 haploinsuffi-
cient mice display a low turnover and low bone
mass phenotype in a gender- and age-specific
manner. PLoS One. 2009;4:e5438.
38. Ruegsegger P, Koller B, Muller R. A microtomo-
graphic system for the nondestructive evaluation of
bone architecture. Calcif Tissue Int. 1996;58:24-29.
39. Parfitt AM, Drezner MK, Glorieux FH, et al. Bone
histomorphometry: standardization of nomencla-
ture, symbols, and units. Report of the ASBMR
Histomorphometry Nomenclature Committee.
J Bone Miner Res. 1987;2:595-610.
40. Kim JH, Yang CK, Heo K, Roeder RG, An W,
Stallcup MR. CCAR1, a key regulator of mediator
complex recruitment to nuclear receptor tran-
scription complexes. Mol Cell. 2008;31:510-519.
41. Smith E, Redman RA, Logg CR, Coetzee GA,
Kasahara N, Frenkel B. Glucocorticoids inhibit
developmental stage-specific osteoblast cell
cycle. Dissociation of cyclin A-cyclin-dependent
kinase 2 from E2F4-p130 complexes. J Biol
Chem. 2000;275:19992-20001.
42. Boyle WJ, Simonet WS, Lacey DL. Osteoclast
differentiation and activation. Nature. 2003;423:
337-342.
43. Levi G, Topilko P, Schneider-Maunoury S, et al.
Role of Krox-20 in endochondral bone formation.
Ann N Y Acad Sci. 1996;785:288-291.
44. Ross FP. M-CSF, c-Fms, and signaling in oste-
oclasts and their precursors. Ann N Y Acad Sci.
2006;1068:110-116.
45. Carter JH, Tourtellotte WG. Early growth re-
sponse transcriptional regulators are dispensable
for macrophage differentiation. J Immunol. 2007;
178:3038-3047.
46. Bradley EW, Ruan MM, Oursler MJ. Novel pro-
survival functions of the Kruppel-like transcription
factor Egr2 in promotion of macrophage colony-
stimulating factor-mediated osteoclast survival
downstream of the MEK/ERK pathway. J Biol
Chem. 2008;283:8055-8064.
 From www.bloodjournal.org by guest on May 23, 2018. For personal use only.

2010 116: 3964-3971

doi:10.1182/blood-2010-01-263830 originally published
online August 17, 2010

Krox20/EGR2 deficiency accelerates cell growth and differentiation in

the monocytic lineage and decreases bone mass
Yankel Gabet, Sanjeev K. Baniwal, Nathalie Leclerc, Yunfan Shi, Alice E. Kohn-Gabet, Jon Cogan,
Alexis Dixon, Marilyn Bachar, Lixin Guo, Jack E. Turman Jr and Baruch Frenkel

Updated information and services can be found at:

http://www.bloodjournal.org/content/116/19/3964.full.html
Articles on similar topics can be found in the following Blood collections
Phagocytes, Granulocytes, and Myelopoiesis (654 articles)

Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

Information about ordering reprints may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.