Vous êtes sur la page 1sur 9

Fish & Shellfish Immunology 33 (2012) 277e285

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology


journal homepage: www.elsevier.com/locate/fsi

Pigment-producing granulomatous myopathy in Atlantic salmon: A novel


inflammatory response
Hilde A.S. Larsen a, Lars Austbø b, Turid Mørkøre c, Jim Thorsen d, Ivar Hordvik e, Uwe Fischer f,
Emilio Jirillo g, Espen Rimstad h, Erling O. Koppang a, *
a
Section of Anatomy and Pathology, Institute of Basic Science and Aquatic Medicine, Norwegian School of Veterinary Science, Ullevålsveien 72, PO Box 8146 Dep., 0033 Oslo, Norway
b
Section of Genetics, Department of Basic Science and Aquatic Medicine, Norwegian School of Veterinary Science, Oslo, Norway
c
Nofima Marin AS, Ås, Norway
d
Section of Cancer Cytogenetics, Institute for Medical Informatics, Oslo University Hospital HF, Oslo, Norway
e
Department of Biology, University of Bergen, Bergen, Norway
f
Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Institute of Infectology, Greifswald-Insel Riems, Germany
g
Department of Immunology, Faculty of Medicine, University of Bari, Bari, Italy
h
Section of Microbiology, Immunology and Parasitology, Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, Oslo, Norway

a r t i c l e i n f o a b s t r a c t

Article history: Melanin comprises a complex group of pigmented polymers whose primary function is ascribed to
Received 23 December 2011 dermal solar protection, but may also have an interesting role in innate immunity. In ectothermic
Received in revised form vertebrates, melanogenesis is reported in leukocyte populations, but it is not known if this occurs in
29 March 2012
connection with inflammatory reactions. Melanin accumulations in ectopic locations, in particular
Accepted 7 May 2012
Available online 14 May 2012
muscle, represent a serious quality problem in salmon production. Here, we investigated such changes
for the expression of dopachrome tautomerase and tyrosinase as well as some important immune genes
and pathogens. Furthermore, the nature of the pathological changes was addressed by morphological
Keywords:
Granulomatous inflammation
methods. Gene transcripts encoding key enzymes in melanogenesis, suggesting a de novo melanin
Melanin synthesis in pigmented muscle, were found. MHC class II transcripts were up-regulated and there was no
Melanogenesis indication of bacterial or viral infection. The histological examination revealed granulomatous inflam-
Melanin-producing leukocyte mation with distribution of MHC class II positive cells and T cells, analogous to the pattern found in
Pigmentation mammals. Importantly, in contrast to mammals pigmented cells were contributing in the inflammation.
We demonstrate that melanin production occurs in granulomatous inflammation in salmon, revealing
a close and hitherto unreported link between the pigmentary and immune systems.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction shown to produce several inflammatory mediators, suggesting


participation in the inflammatory response [4,6]. Interestingly, in
Melanocytes are melanin-producing cells, and in mammals, humans skin coloration correlates with susceptibility to certain
they derive from ectoderm [1]. The functions of melanin synthesis infectious diseases. This connection was indicated as early as in the
and deposition in dermal tissues have generally been attributed to beginning of the 19th century by Dr. William Charles Wells [7].
the need for solar protection. Nevertheless, there is an increasing During the Vietnam War, Allen et al. [8] found that the incidence of
interest to investigate the relationship between the pigmentary bacterial pyoderma among American troops was significantly
and the immune systems [2]. There are indications that melanin higher in Caucasians than African Americans. Melanin and mela-
plays a role in immune functions such as antimicrobial defense, nocytes are not only confined to the skin, but are also found in
suggesting that immune modulation exerted by the pigmentary ectoderm-derived cells in extracutaneous locations, i.e. the brain,
system might be an important and underestimated entity [2,3]. meninges, choroid of the eye and in the inner ear, where protective
Melanocytes respond to cytokines, including interferons, interleu- roles have been suggested [2]. Increased focus on the immuno-
kins and tumor necrosis factor [3e5]. Furthermore, they have been logical role of mammalian melanocytes invites comparison to non-
mammalian species and their extracutaneous melanocytes, which
seem to be closely linked to the immune system [6,9e11].
Abbrevations: Dct, dopachrome tautomerase; Tyr, tyrosinase.
* Corresponding author. Tel.: þ47 22 96 45 46; fax: þ47 22 96 47 64. In contrast to mammals and birds, ectothermic vertebrates
E-mail address: erling.o.koppang@nvh.no (E.O. Koppang). possess a second group of melanin-producing cells originating from

1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2012.05.012
278 H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285

mesenchymal, hematopoietic stem-cells [12]. These cells are


commonly termed melanomacrophages in the literature of ecto-
thermic vertebrates. A well-established Atlantic salmon (Salmo
salar) cell-line (SHK-1 cells), classified as headekidney derived
macrophages, expresses transcripts of the tyrosinase gene family
and produces melanosomes [13,14]. The principal genes related to
melanogenesis include the tyrosinase gene family, and the
expression of tyrosinase-related protein 2/dopachrome tautomer-
ase (TYRP-2/Dct) is considered to be specific for melanocytes and
their precursors [15]. Dct-expression is present in important
lymphatic organs of fish including the head, kidney and the spleen,
where melanomacrophages are found dispersed throughout the
tissue [14,16]. These cells are thought to be part of the antigen-
presenting cell system [16,17].
Inflammatory responses in fish show several similarities to
those of mammals [9]. However, it has been noted that, in contrast
to mammals, chronic inflammation in fish may appear with
abundant pigmentation [18,19]. The presence of melanin in ectopic
locations of farmed salmon, especially in the muscle fillet, repre-
sents a considerable quality problem for the salmon industry
affecting up to 20% of the fillets at the processing plants [20]. The
presence of possible melanin-producing leukocytes in salmon
indicates that melanin may play an active role in inflammation in
fish, and establishes a collaborative relationship between the
pigmentary and immune systems. This would be a unique finding,
as the leukocytes of mammals do not use melanin production in
their defense responses and such an inflammatory response has not
been described previously. The purpose of this work was to
investigate the possible de novo production of melanin at the site of
inflammation, and further to characterize pathological changes and
underlying molecular mechanisms associated with pigmentation of
the fillet, using and combining both morphological and gene-
transcriptional approaches.

2. Materials and methods Fig. 1. Gross pathological changes of investigated Atlantic salmon muscle. A. An area
with brown-black pigmentation, or a pigment spot. B. Section through a typical pig-
2.1. Samples from fish mented area. Bar ¼ 5 mm.

The fish sampled were vaccinated Atlantic salmon with


abnormal pigmentation of the muscle fillet. They originated in four a Biospec-Nano (Shimadzu Corporation, Kyoto, Japan). The cDNA
commercial farms and had routinely been intraperitoneally injec- synthesis was performed immediately after extraction using
ted with oil-adjuvant vaccines before transfer to sea water, w600 ng RNA/reaction, Oligo(dt)-primer and OmniscriptÒ kit
following standard procedures [21]. The fillets were collected from (QIAGEN). Real-time PCR reactions were set up using PlatinumÒ
slaughter-sized salmon harvested at four different locations - Quantitative PCR Supermix-UDG (Invitrogen AS, Oslo, Norway) and
Hjelmeland (8 fillets), Eggebønes (10 fillets), Romsdalsfjord (4 run on a Cromo 4Ô (Bio Rad Laboratories AB, Oslo, Norway). The
fillets) and Frøya (8 fillets). following genes were analyzed by real-time RT-PCR e tyrosinase
Tissue samples were collected from the areas of brownish (Tyr), dopachrome tautomerase (Dct), major histocompability
discoloration (Fig. 1A,B). In addition to the pigmented sample, non- complex class II (MHC class II), interferon a (IFNa), cluster of
pigmented control samples of apparently-normal muscle were differentiation 3 (CD3z), membrane bound and secretory immu-
obtained from the same fillet at various distances from the pig- noglobulin M (mIgM, sIgM). When possible, primers and probe
mented areas. Pigmented and non-pigmented tissue samples were were designed to span across intron sections [Table 1]. The level of
processed for histology and immunohistochemistry (IHC). Macro- expression was normalized using elongation factor 1AA (EF1AA) as
dissected tissues from the second and third sampling, i.e. a total the reference gene [22].
of 28 samples from 14 fillets, were analyzed by quantitative real- For laser-capture micro-dissection, tissue samples
time reverse transcriptase polymerase chain reaction (RT-qPCR). (10  10  3 mm) of pigmented muscle from eight individuals were
In addition, tissues from the last sampling were analyzed using immediately transferred to liquid nitrogen and stored at 70  C
laser-assisted micro-dissection. until further processing. Cryo-sections, 14 mm in thickness, were cut
with a cryostat and mounted on special membrane slides, as
2.2. Gene expression analysis described previously [23]. The sections were air dried for 1 h,
washed twice in xylene to remove fat and stained with RNase-free
Macro-dissected tissue samples (3  3  3 mm) intended for hematoxylin before air-drying for 1 h. Subsequently, a representa-
RT-qPCR were immediately transferred to RNAlaterÒ after sampling tive part of melanomacrophage accumulations (Fig. 2A,B) were
and kept at 4  C until processed. RNA was extracted using dissected [23]. Up to eight successive dissected sections, with
an RNeasy MiniÒ kit (QIAGEN, Hilden, Germany), and concentra- a total area ranging between 0.3 and 0.5 mm2, were cut and
tions and purity were measured spectrophotometrically with collected in tubes. From each individual, neighboring non-
H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285 279

Table 1
Gene assays used for quantitative real-time RT-PCR.

Genes GeneBank Assay concentration Sequence (50 e30 ) Ct value mean  SD


accession
EF1Aa X70165 Primers 900 mM F e CCCCTCCAGGACGTTTACAAA 26.33
Probe 200 mM R e CACACGGCCCACAGGTACA 1.50
P e FAM-ATCGGTGGTATTGGAAC-MGB
Tyra DQ408549 Custom TaqMan F e CTGGGCTACGAATACTCCTACCT 32.80
R e TGCATGTAGGGAGTCAGGAACT 2.05
p e FAM-CTCGTGCCTGGGTCAAG-MGB
Dcta,b DQ339140 Custom TaqMan F e TCTCACTCTGCAGCCAATGAC 36.54
R e CAGACTTCCTCATCCACTCATCAAA 1.14
P e FAM-CATGGATCACCAGAAAGA-MGB
MHC II X70165 Primers 900 mM F e CTCACTGAGCCCATGGTGTAT 25.32
Probe 200 mM R e GAGTCCTGCCAAGGCTAAGATG 1.95
P e FAM-CTGGGACCCGTCCCTG-BHQ1
CD3zeta BT060238 Primers 900 mM F e AACAGGGATCCAGAGAGTGCTG 32.35
Probe 200 mM R e AAGGGACGTGTAAGTGTCGTCA 1.87
P e FAM-ACGGCACGCGATAATCGCAGGA-BHQ1
IFNa1 AY216594 Custom TaqMan F e TCAACATTCTAGAACGCCAATTGGA 35.77
R e CGTTTCAGTCTCTTCTCAGGTTTCA 1.76
Pe FAM-CAGGTGATACACAGGATTTA-MGB
Mx U66475 Primers 900 mM F e GATGCTGCACCTCAAGTCCTATTA 29.21
Probe 200 mM R e CACCAGGTAGCGGATCACCAT 2.04
P e FAM-CTGATCAGCCAAACGTTGACTGGATATCCT-TAMRA
mIgM S48658 Primers 900 mM F e TGCGCTGTAGATCACTTGGAA 28.45
Probe 200 mM R e ATGGTGTTGCTGCATGGACA 3.02
P e FAM-AGGGAGACCGAGTGTCTCGTGTTGACTG-MGB
sIgM S48652 Primers 900 mM F e TGCGCTGTAGATCACTTGGAA 22.92
Probe 200 mM R e GCCAGCAGAAAGACAGATGGA 2.83
P e FAM-AGGGAGACCGGAGGAGATCCACAGC-MGB
RIG1 NM_001163699 Primers 900 mM F e ACAGCTGTTACACAGACGACATCA 29.82
Probe 200 mM R e TTTAGGGTGAGGTTCTGTCCGA 1.75
P e FAM-TCGTGTTGGACCCCACTCTGTTCTCTC-BHQ1
Vig-1 BT047610 Primers 900 mM F e AGCAATGGCAGCATGATCAG 34.95
Probe 200 mM R e TGGTTGGTGTCCTCGTCAAAG 3.22
P e FAM-AGTGGTTCCAAACGTATGGCGAATACCTG-BHQ1

Primers and probes used for realntime RT-PCR on pigmented and un-pigmented muscle tissue of Atlantic salmon. Primers and probe were design to span intron section and
exon-junction sites located in the probes, indicated in bold.
a
Primers and probe were custom designed by Assays-by-DesignSM service consisting of a 20 mix of unlabeled PCR primers and TaqManÒ MGB probes (FAMÔ dye labeled)
and used in a concentration of 900 nM (primer) and 200 nM (probe).
b
Samples with no detectable expression within 45 cycles could not be included in the calculation as this would result in an erroneous average value.

pigmented inflamed tissue was prepared for comparison presence of pancreas disease virus (SPDV), infectious pancreatic
(Fig. 2C,D). Total RNA was isolated from the laser-captured material necrosis virus (IPNV) and piscine reovirus (PRV) by RT-qPCR.
by using a Nucleo Spin RNA XS (Macherey & Nagel, Düren, In these expression studies, each sample was run in triplicate
Germany). This kit allows rapid purification of high-quality total and a control lacking the template for each master mix was always
RNA from extremely small samples. The RNA was eluted into 15 ml included in the experiments. Sequences and final concentration of
RNase-free H2O and directly used for cDNA synthesis without selected probes and primers are displayed in Table 1.
freezing the RNA samples. The manufacturer’s manual was fol-
lowed including an integrated DNase step. Reverse transcription of 2.3. Statistical analysis
13 mL total RNA solution was performed using M-MLV Reverse
transcriptase (Promega, Madison, WI 53711 USA). The cDNA Gene expression in pigmented and non-pigmented tissue
synthesis was prepared with oligo(dT) and random hexamer samples was evaluated using the paired t-test, comparing pig-
primers, in addition RNase inhibitor was added to prevent RNA mented to non-pigmented tissue within each fillet. The data were
degradation. Quantitative real-time PCR was performed using tested to examine whether they were sampled from a Gaussian
TaqMan Gene Expression Master Mix (Applied Biosystems, Carls- distribution using the KolmogoroveSmirnov normality test. Differ-
bad, CA 92008 USA) and carried out in a 7900HT fast real-time PCR ences in expression between pigmented and non-pigmented tissue
system (Applied Biosystems) according to the producer’s instruc- were considered to be significant at p < 0.05. The statistical calcu-
tions and running 45 cycles. Tyr and Dct were analyzed in the lations and graphical presentation in Figs. 3 and 4 were performed
micro-dissected material and the level of expression was normal- using Prism 5.0 software (GraphPad Software, San Diego, CA, USA).
ized using EF1AA as the reference gene.
To elucidate of the viral infection status, a selection of virus- 2.4. Histology
induced genes and sequences from viruses relevant to the local
environment were investigated. Retinoid-inducible gene (RIG1), Tissue samples (10  10  3 mm) were fixed in 10% buffered
a pattern recognizing cytosolic molecule primarily detecting viral formalin for 96 h, paraffin-embedded and cut in 4 mm sections,
nucleic acids based on structure and localization [24], virus mounted and dried at 37  C, before staining with hematoxylin and
inducible gene (vig-1) and antiviral IFN-induced gene Mx, the latter eosin (H&E), van Giesson, Sudan black, rubeanic acid or Pearl’s Berlin
two coding for interferon-inducible, virus inhibitory proteins blue. To confirm the presence of melanin, sections were stained with
[25,26], were investigated. The samples were also tested for the Masson/Fontana. For detection of prokaryotic and eukaryotic
280 H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285

Fig. 2. Laser-capture micro-dissection of areas with accumulations of melanomacrophages (A,B) and neighboring non-pigmented inflamed tissue (C,D). Hematoxylin stain.
Bar ¼ 50 mm.

Fig. 3. Relative transcription levels of Tyr (A), Dct (B), MHC class II (C) and mIgM (D) to EF1AA in pigmented lesions and non-pigmented tissue samples of muscle fillets of Atlantic
salmon. LCMD represents samples collected by laser-capture micro-dissection. The scatter plots show the transcript levels for each individual with mean for each group as obtained
by RT-qPCR analysis. Expression levels are presented relative to the mean of the control group that was given value 1. Error bars represent standard error of the mean (SEM).
p-values << 0,01 (significant).
H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285 281

Fig. 4. Histopathological investigations of formalin-fixed, paraffin-embedded sections of pigmented skeletal muscle tissue including immunohistochemistry. A. Degeneration and
repair, side by side. An empty vacuole encircled by macrophages and melanomacrophages in an area with fibrosis and fat-infiltration (asterisk). Acute degeneration of a muscle-fiber
(arrow). H&E stain. Bar ¼ 200 mm. B. A vacuole containing material stained for fat (black). Black droplets are also seen in the surrounding macrophages (arrowhead). Sudan black
stain. Bar ¼ 50 mm. C. Melanomacrophages encircling the vacuoles, creating a nearly dense rim of pigmentation. The larger vacuoles are surrounded by sparse amounts of leucocytes,
mainly consisting of pigmented and non-pigmented cells. Hematoxylin stain. Bar ¼ 50 mm. D. A large vacuole in an area with severe fibrosis and fat-infiltration (arrowhead).
Proliferating myoblasts with ineffective regeneration attempts; so-called muscle giant cells (arrow). H&E stain. Bar ¼ 200 mm. E. Cell-rich granulomas with various amounts of
melanin-containing cells displaying a heterogeneous morphology. H&E stain. Bar ¼ 200 mm. F. Transverse section of a necrotic myofibre encircled by MHC class IIþ macrophages
(red) (arrowhead). MHC class IIþ macrophages (red) entering the lumen and cleaning up the debris of a necrotic myofibre (arrow). MHC class II immune stain, hematoxylin counter
stain. Bar ¼ 200 mm. G. MHC class IIþ macrophages (red) in an area with abundant leukocyte infiltration. A vacuole encircled by macrophages and melanomacrophages is seen in the
upper left corner. Macrophages with only sparse amount of pigment-granules (arrowhead) are staining stronger than the heavily-pigmented cells that are encircling the vacuoles.
MHC class II immune stain, hematoxylin counter stain. Bar ¼ 50 mm. H. A cell-rich granuloma with central vacuoles and abundant MHC class IIþ macrophages (red). A few mel-
anomacrophages are present within the cell accumulation. MHC class II immune stain, hematoxylin counter stain. Bar ¼ 200 mm. I. T cells (red staining) encircling a cell-rich
granuloma. CD3 immune stain, hematoxylin counter stain. Bar ¼ 200 mm. J. IgMþ plasma in the vessel lumen staining intensely red. Only sparse single cells are IgMþ in the
pigmented areas. IgM immune stain, hematoxylin counter stain. Bar ¼ 50 mm. K. a-actinþ cells (red) interpreted as activated satellite cells in an area with repair, displayed by the
formation of myotubes with an internal chain of nuclei (arrowhead). a-actin immune stain, hematoxylin counter stain. Bar ¼ 100 mm. L. Negative control for the immunohisto-
chemistry lacking primary antisera. Hematoxylin counter stain. Bar ¼ 200 mm. H, I and L were produced in serial sections. (For interpretation of the references to color in this figure
legend, the reader is referred to the web version of this article.)

infectious agents, sections were stained with Ziel-Nielsen pattern of the leukocytes in the inflammatory response. Polyclonal
(Mycobacteria), periodic acid-Shiff (mucus of fungus) and Gram rabbit antisera recognizing MHC class II b-chain (dilution 1:1000)
(Gram bacteria). All stainings followed standard procedures [27]. [16], CD33 (dilution 1:600) [28], immunoglobulin M (IgM) (dilution
1:25,000; kindly provided by Dr. Knut Falk, The National Veterinary
2.5. Immunohistochemistry Institute, Oslo, Norway) [29], and monoclonal antibody against a-
actin (dilution 1:1000) (Thermo Fisher Scientific, Fremont, CA
Formalin-fixed, paraffin-embedded sections were subjected to 94538 USA) were used. Tissue sections (4 mm) were placed on
immunohistochemistry to elucidate the morphological distribution polysine-coated slides (Menzel-Gläser, Braunschweig, Germany)
282 H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285

and dried for at least 12 h at 37  C. After a standard de-waxing and 3.3. Histopathology
rehydration procedure, sections were autoclaved in citrate buffer
(10 mM citric acid monohydrate, pH 6.0) at 121  C for 15 min, The changes in the pigmented samples showed the character-
transferred to PBS and treated with 0.05% phenylhydrazine istic features of a chronic polyphasic necrotizing myopathy, with
(SigmaeAldrich, St. Louis, MI, USA) at 37  C for 40 min to inhibit the formation of granulomas and large extracellular vacuoles
endogenous peroxidase, and washed overnight in PBS at 4  C. The (Fig. 4A). Pigmentation by melanin-containing cells, interpreted as
next day, the sections were incubated for 20 min in normal caprine teleost melanomacrophages, occurred abundantly in well-
serum (SigmaeAldrich) diluted 1:50 in 5% bovine serum albumin organized granulomas and chronically inflamed areas with signs
(BSA) (SigmaeAldrich) in Tris-buffer solution (TBS). For immune of repair, whereas more acute lesions, indicated by the presence of
labeling, an indirect method (EnVisionÔ þ System HRP, Dako, CA destruction and lack of organization, showed only sparse infiltra-
93013, USA) was used according to the manufacturer’s instructions. tion by such cells. Vacuoles of various sizes and shapes were
The primary antibodies were diluted in 1% BSA. All incubations observed throughout the affected areas. The vacuoles seemed
were performed in a humid chamber on a rocking table at room empty, although a few contained an amorphous material staining
temperature. The sections were washed in distilled water and positive for fat, 4 (Fig. 4B). Abundant melanomacrophages encircled
either left unstained, or counterstained with hematoxylin, washed the vacuoles, creating a dense rim of pigmentation, apparently
in distilled water and mounted with polyvinyl alcohol mounting creating a barrier between the content of the vacuoles and the
medium, pH 8.2, and examined with a light microscope. Sections surrounding tissue. The larger vacuoles were surrounded by more
treated with pre-immune rabbit and mouse sera served as negative modest numbers of leucocytes, mainly consisting of pigmented and
controls in the experiment. Microphotographs were captured with non-pigmented macrophages (Fig. 4C). High levels of fibrosis and
a SpotRT Slider digital camera (Diagnostic Instruments, Sterling fatty infiltrates were present in areas with large vacuoles, con-
Heights, MI, USA). firming previous tissue destruction and subsequent repair by
scarring, rather than by restoration (Fig. 4D). Cell-rich granulomas
contained varying numbers of melanomacrophages (Fig. 4E) dis-
3. Results
playing differing cell-morphology. The melanomacrophages
surrounding the vacuoles were strongly elongated with densely-
3.1. Macroscopic pathology
packed melanin compartments. However, the appearance of pig-
mented cells varied strongly throughout the granulomatous tissue,
The body condition of the affected fish ranged from adipose to
from sparsely-pigmented, rounded macrophage-like cells to volu-
moderately reduced, evaluated from the fillet size, shape and
minous, dendritic-shaped cells containing abundant amounts of
texture. Areas of brown-black discoloration were seen on the
melanin (Fig. 5). This morphological variation of the melanoma-
muscle fillet after removal of the peritoneum and spine (Fig. 1A).
crophages was also observed in less organized areas of the inflamed
The pigmentation occurred mostly sub-peritoneally in the
tissue, like areas with abundant leukocyte infiltration and without
abdominal wall, but caudal and dorsal localizations remote from
vacuoles and granulomas.
the abdominal cavity were also observed. Some of the pigmented
Staining with Masson/Fontana technique confirmed the pres-
areas were found deep in the musculature, with no connection to
ence of melanin in the pigmented cells. Staining for iron and copper
the skin or peritoneum. Each affected fillet had mostly only one, but
proved negative, as did the search for infectious agents (staining
occasionally up to three areas with discoloration. Pigmented areas
with Ziel-Nielsen, PAS and Gram) (data not shown). This is
varied strongly in size and shape, from a few millimeters to several
consistent with previous reports [18].
centimeters in diameter (Fig. 1B). Occasionally, the pigmented areas
penetrated the entire muscle throughout to the skin. The larger
areas showed a firmness and contraction characteristic of scar
3.4. Immunohistochemistry
tissue.
Based on examinations of the inflamed and pigmented areas in
3.2. RT-qPCR all fillets, the immunostaining intensity was labeled as abundant,

In the macro-dissected tissue samples with pigmented lesions,


transcription of both Tyr and Dct was significantly up-regulated
compared to non-pigmented areas within the same fillet
(Fig. 3A,B). Transcription of Dct was detected in 13 out of 14
samples from pigmented areas, whereas only 1 out of 14 from non-
pigmented areas (Fig. 3B).Transcription of MHC class II (Fig. 3C) and
mIgM (Fig. 3D) was significantly higher in pigmented samples
compared to non-pigmented controls, while the opposite was
noted for RIG1 (not shown). No significant differences in the tran-
scription levels of CD3, sIgM, vig-1, IFNa or Mx were detected. Mean
ct-values are given in Table 1.
SAV, IPNV and PRV were not detected, which is consistent with
the transcription level of the virus-induced genes.
In the micro-dissected tissue samples transcription of both Tyr
and Dct was significantly up-regulated in areas containing accu-
mulations of melanomacrophages compared to non-pigmented
parts at the same site of inflammation (Fig. 3A,B). Additionally,
transcription level of Dct as measured relative to EF1AA was
significantly higher in the micro-dissected tissue compared to the Fig. 5. Voluminous melanomacrophage with dendritic shape. Hematoxylin stain.
macro-dissected. Bar ¼ 20 mm.
H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285 283

moderate, sparse or negative (no labeled cells detectable). Variation cells were interpreted as being activated satellite cells capable of
in labeling intensity and frequency between individuals was replacing degenerated myofibers [31]. The absence of detectable
present in all groups. infectious agents, the lack of granulocytes, the vacuoles staining
Anti-MHC class II reactivity was found in macrophages encir- positive for fat and the presence of granulomas, are indications of
cling necrotic muscle fibers (Fig. 4F), in sites with abundant a non-infectious, foreign-body type of inflammation, i.e. granulo-
leukocyte infiltration (Fig. 4G) and in cell-rich granulomas (Fig. 4H). matous inflammation.
Multifocal positive staining was also observed within melanoma- Granulomatous inflammation is dominated by cells of the
crophages, mainly in cells with sparse pigmentation and low den- monocyte-macrophage line, consisting of macrophages, epitheloid
dricity (Fig. 4G). Only sparse staining was observed in the cells and multinucleated giant cells [32]. The morphological
macrophages bordering the vacuoles (Fig. 4G). appearance in combination with abundant immunopositive stain
A broad rim of CD33þ cells was located in the periphery of cell- for MHC class II b-chain and the significant up-regulation of MHC
rich granulomas (Fig. 4I). Clusters of such cells were also seen class II expression, a receptor found on antigen-presenting cells
around necrotic muscle fibers and throughout areas with abundant including activated macrophages, strongly indicates that macro-
leukocyte infiltration. Immunopositive cells were often located in phages were the dominating inflammatory cell type in the pig-
close association with melanomacrophages. mented tissue. No definite macrophage cell marker is available for
Anti-IgM reactivity in the form of abundant positive staining salmonids. T cells, identified in our study by antisera recognizing
was seen in the lumen of vessels and capillaries containing blood the CD33 chain, participate in granuloma production. T cells here
(Fig. 4J) and in sparse single cells randomly distributed throughout are thought to be regulatory, preventing widespread tissue damage
the inflamed areas. by the activated macrophages [32]. In our material, a broad rim of T
In most lesions, focal to multifocal foci with a-actin-immuno- cells was seen encircling the cell-rich granulomas. This appearance
positive cells interpreted as myofibroblasts or satellite cells differ- is consistent with the architecture of mammalian granuloma
entiating into myoblasts were observed (Fig. 4K). The smooth formation [32]. The lack of significant up-regulation of CD3z-
musculature of the vessel walls stained in a similar manner, serving mRNAs compared to the positive immunostaining of the CD33 chain
as an internal positive control. Myotubes and mature skeletal may due to the dynamics of transcription and translation of the CD3
muscle fibers were negative. molecules. However, information is sparse about this matter in
salmon. Few cells stained positive for IgM, suggesting B cells to be
4. Discussion of lesser importance in the localized inflammatory response, also
consistent with granulomatous myopathy of mammals [32].
In this study, we have investigated abnormal pigmented Granulomas serve to demark pathogens/foreign bodies resisting
changes in muscles of Atlantic salmon. Affected muscle showed destruction. In our material, the well-organized granulomas with
expression of genes confined to melanin-synthesizing cells. There large central vacuoles and sparse leukocyte response were sur-
was a consistent up-regulation of Tyr-transcription in pigmented rounded by a solid rim of elongated melanomacrophages. Such cells
versus non-pigmented samples. Additionally, Dct-transcription, may function as a seal, isolating the self from the supposed foreign
exclusively occurring in cells capable of pigment production, was body, preventing repeated triggering of the immune response. This
detected in 13 of 14 pigmented tissue samples, and undetected in assumption may be supported by the sparse amount of MHC class II
13 of 14 control samples. The pathological changes of the fillets reactivity in macrophages and melanomacrophages adjacent to the
contained areas of inflammation with and without pigmentation. vacuoles. In mammals, chronic inflammation with macrophage-
Most control tissue was collected from healthy-appearing muscle lineage cells as a key component, although devoid of pigment
far distant from the lesion, but within the same fillet. However, in production has been linked to non-disposable materials likely to
sampling nr 3 (Romsdalsfjord, 4 fillets) control material was har- accumulate in macrophages. Such material could consist of oil-
vested in close vicinity to visible pigmentation. Nevertheless, as the based adjuvant amongst several others [33]. Additionally, degen-
samples selected for RT-qPCR cannot simultaneously be investi- erative diseases or trauma causing damaged and dying cells, can
gated by histology, there is no guarantee that the control samples also act as powerful adjuvant, stimulating chronic inflammation
were free from sparse melanomacrophages. The single sample with [33]. Hereby, antigen-presenting cells may be activated by alarm
a clear divergent result, gave room for suspicion concerning this signals from stressed or damaged tissues [34]. The granulomatous
matter. By applying the laser-dissection method we were able to inflammation pattern, together with the results from the immu-
make a more precise comparison, avoiding the risk of misinter- nohistochemical studies, show that the pathological changes in the
preting the results. Furthermore, by comparing the expression salmon share several similarities with homologous reactions in
pattern of Dct in the macro-dissected tissue with the more precise mammals [32]. However, the presence and production of melanin
micro-dissected, we found the relative expression to be signifi- represent a major difference. In addition to the flattened melano-
cantly higher in the latter, strongly connecting the transcription of macrophages surrounding vacuoles, large dendritic-shaped mela-
Dct to the pigmented cells. Histological analysis revealed a granu- nomacrophages, seemingly very active, were also encountered in
lomatous inflammation in the affected tissue with differently- the granulomatous tissue. Such cells may be the ones responsible
shaped melanin-containing cells, interpreted as melanomacroph- for the detection of transcripts of the tyrosinase gene family.
ages, a specialized type of leukocytes found in ectothermic verte- Pigment-producing leukocytes of ectothermic vertebrates (classi-
brates [12,17]. Seen together, these results strongly indicate fied by Sichel and co-workers [12]), are often referred to as mela-
enzymatic de novo production of melanin in the inflamed tissue, nomacrophages in the literature (reviewed by Agius & Roberts
excluding a non-enzymatic production as has been suggested to [17]). They can be distinguished from melanocytes of ectoderm
occur in the brain during synthesis of neuromelanin [30]. origin and from mammalian Langerhans cells or macrophages
The changes in the pigmented muscle were characterized as phagocytizing pigments, the last of which is referred to as mela-
chronic polyphasic necrotizing myopathy with melanin production nophages of human skin [35]. We assume that the melanoma-
and granuloma formation, indicating an ongoing degenerative crophages found in the muscle lesions are constitutively melanin-
process. New lesions have been forming simultaneously with producing leukocytes summoned to the site of inflammation
regeneration, displaying signs of repair side by side with acute together with other leukocyte populations. In salmonids, the main
necrosis [31]. Based on the morphological appearance, the a-actinþ concentration of such cells is normally found in the anterior part of
284 H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285

the kidney, a tissue considered to be the teleost equivalent to pigment, thereby preventing neuronal damage [30]. The selective
mammalian bone-marrow [14]. The gross pathology observations death of the neuromelanin-containing cells causes Parkinson’s
in the present study revealed in most cases a sub-peritoneal or disease, which is associated with oxidative stress [46]. Therefore,
profound localization of pigment, far distant from cutanous mela- melanin production in fish granulomatous tissue could also serve as
nocytes and without pathological changes in the skin. In mammals, a protective mechanism against oxidation in chronic inflammatory
visceral melanin deposition caused by migrating pigment- conditions, which may be important in salmon muscle tissue which
containing leukocytes (melanophages) is also well-known [36], is rich in polyunsaturated fatty acids.
but de novo synthesis by such cells has not been reported. In this study, we have shown that melanogenesis occurs in
A fundamental question is why granulomatous inflammation in muscle-located granulomas in the Atlantic salmon, thus indicating
salmon may involve melanin formation. One of the functions of an association between the immune and pigmentary systems. The
melanin, as part of the host antioxidant system is to trap radicals pigment-producing granulomas in salmon are a hitherto non-
[37,38]. This effect of melanin may be particularly relevant in long- described inflammatory reaction. Future studies on this inflam-
term functioning post-mitotic pigment cells, with protracted matory response could bridge important evolutionary gaps
exposure to oxidative stress, as would be the case for the mela- between the pigmentary and immune systems.
nomacrophages encircling the vacuoles staining for fat. Radicals
produced during melanogenesis are nevertheless believed to exert Authors contribution
strong antimicrobial activity over a short action radius [6]. Melanin
production could thus serve as a compensatory or additional H.L., study design, collection of material, performing experi-
defense mechanism to the innate immune system in poorly- ments, interpreting results and writing manuscript. L.A., study
vascularized tissue, such as tissue with severe scarring and design, collection of material, designing probes, statistical analysis,
mature granulomas. On the other hand, melanin per se seems to be interpreting results and editing manuscript. T.M., identification and
able to trigger the inflammatory pathway in macrophages also in collection of material. J.T., designing probes and primers for
the presence of LPS via a TLR-4 mediated mechanism [39]. Even if melanin genes. I.H., sequence analysis, probe design and antisera
TLR-4 presence and function in fish are still a matter of debate, one development. U.F. and E.J., providing antisera. E.R., study design,
can speculate that melanin is able, once produced, to maintain providing probes and primers for viruses and interpreting results.
a sort of vicious circle in the fish via release of proinflammatory E.O.K., study design, collection of material, providing antisera,
cytokines. interpreting results, editing manuscript and supervising the study.
Melanin synthesis occurs both in prokaryotes and in eukaryotes, All authors read and commented on the manuscript.
in the latter specialized melanocytes are dedicated to this
production. Throughout evolution, melanin has been an important Acknowledgment
factor for survival, and appeared long before the molecules of the
classical adaptive immune system, which first developed with the Marine Harvest AS, represented by Dr. Olav Breck, VMD Øyvind
introduction of jawed vertebrates [40]. Melanin is known to protect Oaland and others, have kindly provided material and assisted
microorganisms, like bacteria and fungus, against cell damage such harvesting of material. Valuable help have also been provided by
as solar exposure and reactive oxygen species (ROS) [41]. In some co-workers of the Norwegian School of Veterinary Science and the
pathogenic fungi and bacteria, melanin has also been found to InNoVacc research project (Project RCN 183196/S40). The Research
protect the microbe against host immune responses, thereby Council of Norway and The Fishery and Aquaculture Industry
contributing to their virulence [42]. A number of plants contain Research Fund supported this project financially (project: RCN
melanin, where its production may function as a defense mecha- 179022/S40 Regulatory processes of melanization in the Atlantic
nism during injury, herbivore or pathogen attack or during expo- salmon), and in addition, grants were obtained from the Norwegian
sure to external stresses [43]. In insects, the enzyme cascade of School of Veterinary Science.
which melanin is the end product is considered to be the central
antimicrobial defense system [44]. A well-known immune mech-
References
anism in insects involves using melanin to trap invading microor-
ganisms within humoral capsules [6]. The antimicrobial effect of [1] Hearing VJ, Tsukamoto K. Enzymatic control of pigmentation in mammals.
radicals would be especially prudent against phagocytized micro- FASEB J 1991;5:2902e9.
organisms compartmentalized within melanosomes, as seen in [2] Plonka PM, Passeron T, Brenner M, Tobin DJ, Shibahara S, Thomas A, et al.
What are melanocytes really doing all day long.? Exp Dermatol 2009;18:
insects [44]. 799e819.
Given the antimicrobial actions of melanin and melanogenesis [3] Burkhart CG, Burkhart CN. The mole theory: primary function of melanocytes
in evolutionary early defense mechanisms, it is possible that and melanin may be antimicrobial defense and immunomodulation (not solar
protection). Int J Dermatol 2005;44:340e2.
modern bony fishes or teleosts, being one of the first groups to [4] Le Poole IC, Mutis T, van den Wijngaard RM, Westerhof W, Ottenhoff T, de Vries RR,
possess an adaptive immune system based on the receptors of the et al. A novel, antigen-presenting function of melanocytes and its possible rela-
immunoglobulin superfamily, still rely on ancient immune tionship to hypopigmentary disorders. J Immunol 1993;151:7284e92.
[5] Slominski A, Tobin DJ, Shibahara S, Wortsman J. Melanin pigmentation in
responses related to melanin. Even in mammals, there seems to be mammalian skin and its hormonal regulation. Physiol Rev 2004;84:1155e228.
a relic of this system related to inflammatory changes in the skin [6] Mackintosh JA. The antimicrobial properties of melanocytes, melanosomes
[2], but mammalian leukocytes lack melanin-synthesizing abilities. and melanin and the evolution of black skin. J Theor Biol 2001;211:101e13.
[7] Wells WC. Some observations on the causes of the differences in colour and
It is possible that melanin production could serve as an ancient form between the white and negro races of men. Two essays: one: upon
compensatory mechanism for the innate immune system in tissue a single vision with two eyes, the other: on dew. London: Constable; 1818.
with poor vascularization, as would be the case for fat tissue of [8] Allen AM, Taplin D, Twigg L. Cutaneous streptococcal infections in Vietnam.
Arch Dermatol 1971;104:271e80.
morbidly obese persons as studied by Randhawa et al. [45]. In
[9] Koppang EO, Fischer U, Satoh M, Jirillo E. Inflammation in fish as seen from
humans and in some other mammals, melanin is also found in the a morphological point of view with special reference to the vascular
brain. Neuronal melanin is termed neuromelanin and is found compartment. Curr Pharm Des 2007;13:3649e55.
mainly in the substantia nigra of the brain stem. Due to its high [10] Raposo G, Fevrier B, Stoorvogel W, Marks MS. Lysosome-related organelles:
a view from immunity and pigmentation. Cell Struct Funct 2002;27:443e56.
affinity for a variety of organic and inorganic toxins, accumulation [11] Sichel G, Scalia M, Corsaro C. Amphibia Kupffer cells. Microsc Res Tech 2002;
of neuromelanin during aging is linked to the protective role of the 57:477e90.
H.A.S. Larsen et al. / Fish & Shellfish Immunology 33 (2012) 277e285 285

[12] Sichel G, Scalia M, Mondio F, Corsaro C. The amphibian Kupffer cells build and [29] Håvarstein LS, Aasjord PM, Ness S, Endresen C. Purification and partial char-
demolish melanosomes: an ultrastructural point of view. Pigment Cell Res acterization of an IgM-like serum immunoglobulin from Atlantic salmon
1997;10:271e87. (Salmo salar). Dev Comp Immunol 1988;12:773e85.
[13] Haugarvoll E, Thorsen J, Laane M, Huang Q, Koppang EO. Melanogenesis and [30] Zecca L, Tampellini D, Gerlach M, Riederer P, Fariello RG, Sulzer D. Substantia
evidence for melanosome transport to the plasma membrane in a CD83þ nigra neuromelanin: structure, synthesis, and molecular behaviour. Mol
teleost leukocyte cell line. Pigment Cell Res 2006;19:214e25. Pathol 2001;54:414e8.
[14] Thorsen J, Høyheim B, Koppang EO. Isolation of the Atlantic salmon tyrosinase [31] Valentine BA, McGavin MD. Skeletal muscle [Chapter 15]. In: McGavin MD,
gene family reveals heterogenous transcripts in a leukocyte cell line. Pigment Zachary JF, editors. Pathologic basis of veterinary disease. 4th ed. St. Louis:
Cell Res 2006;19:327e36. Mosby Elsevier; 2007. p. 973e1039.
[15] Kelsh RN, Schmid B, Eisen JS. Genetic analysis of melanophore development in [32] Tews DS, Pongratz DE. Immunohistological analysis of sarcoid myopathy.
zebrafish embryos. Dev Biol 2000;225:277e93. J Neurol Neurosurg Psychiatry 1995;59:322e5.
[16] Koppang EO, Hordvik I, Bjerkås I, Torvund J, Aune L, Thevarajan J, et al. [33] Hamilton JA. Nondisposable materials, chronic inflammation, and adjuvant
Production of rabbit antisera against recombinant MHC class II beta chain and action. J Leukoc Biol 2003;73:702e12.
identification of immunoreactive cells in Atlantic salmon (Salmo salar). Fish [34] Matzinger P. The danger model: a renewed sense of self. Science 2002;296:
Shellfish Immunol 2003;14:115e32. 301e5.
[17] Agius C, Roberts RJ. Melano-macrophage centres and their role in fish [35] Weiss JS, James WD, Cooper KD. Melanophages in inflammatory skin
pathology. J Fish Dis 2003;26:499e509. disease demonstrate the surface phenotype of OKM5þ antigen-
[18] Koppang EO, Haugarvoll E, Hordvik I, Aune L, Poppe TT. Vaccine-associated presenting cells and activated macrophages. J Am Acad Dermatol
granulomatous inflammation and melanin accumulation in Atlantic salmon, 1988;19:633e41.
Salmo salar L., white muscle. J Fish Dis 2005;28:13e22. [36] Plonka PM, Michalczyk D, Popik M, Handjiski B, Slominski A, Paus R. Splenic
[19] Poppe TT, Breck O. Pathology of Atlantic salmon Salmo salar intraperitoneally eumelanin differs from hair eumelanin in C57BL/6 mice. Acta Biochim Pol
immunized with oil-adjuvanted vaccine. A case report. Dis Aquat Org 1997; 2005;52:433e41.
29:219e26. [37] Scalia M, Geremia E, Corsaro C, Santoro C, Baratta D, Sichel G. Lipid perox-
[20] Mørkøre T, Heia K. Mørke flekker i laksefilet - omfang og målemetoder. Norsk idation in pigmented and unpigmented liver tissues: protective role of
Fiskeoppdrett 2012;3:50e3. melanin. Pigment Cell Res 1990;3:115e9.
[21] Sommerset I, Krossøy B, Biering E, Frost P. Vaccines for fish in aquaculture. [38] Sichel G, Corsaro C, Scalia M, Sciuto S, Geremia E. Relationship between
Expert Rev Vaccines 2005;4:89e101. melanin content and superoxide dismutase (SOD) activity in the liver of
[22] Olsvik PA, Lie KK, Jordal AE, Nilsen TO, Hordvik I. Evaluation of potential various species of animals. Cell Biochem Funct 1987;5:123e8.
reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol Biol [39] Oberg F, Haseeb A, Ahnfelt M, Ponten F, Westermark B, El-Obeid A. Herbal
2005;6:21. melanin activates TLR4/NF-kappaB signaling pathway. Phytomedicine 2009;
[23] Haugarvoll E, Bjerkås I, Nowak BF, Hordvik I, Koppang EO. Identification and 16:477e84.
characterization of a novel intraepithelial lymphoid tissue in the gills of [40] Cooper MD, Alder MN. The evolution of adaptive immune systems. Cell 2006;
Atlantic salmon. J Anat 2008;213:202e9. 124:815e22.
[24] Biacchesi S, LeBerre M, Lamoureux A, Louise Y, Lauret E, Boudinot P, et al. [41] Nosanchuk JD, Casadevall A. The contribution of melanin to microbial path-
Mitochondrial antiviral signaling protein plays a major role in induction of the ogenesis. Cell Microbiol 2003;5:203e23.
fish innate immune response against RNA and DNA viruses. J Virol 2009;83: [42] Liu GY, Nizet V. Color me bad: microbial pigments as virulence factors. Trends
7815e27. Microbiol 2009;17:406e13.
[25] Duschene KS, Broderick JB. The antiviral protein viperin is a radical SAM [43] Mayer AM. Polyphenol oxidases in plants and fungi: going places? A review.
enzyme. FEBS Lett 2010;584:1263e7. Phytochemistry 2006;67:2318e31.
[26] Robertsen B. Expression of interferon and interferon-induced genes in [44] Boman HG, Hultmark D. Cell-free immunity in insects. Annu Rev Microbiol
salmonids in response to virus infection, interferon-inducing compounds and 1987;41:103e26.
vaccination. Fish Shellfish Immunol 2008;25:351e7. [45] Randhawa M, Huff T, Valencia JC, Younossi Z, Chandhoke V, Hearing VJ, et al.
[27] Bancroft JD, Gamble M. Theory and practice of histological techniques. 5th ed. Evidence for the ectopic synthesis of melanin in human adipose tissue. FASEB
London: Churchill Livingstone; 2002. J 2009;23:835e43.
[28] Koppang EO, Fischer U, Moore L, Tranulis MA, Dijkstra JM, Köllner B, et al. [46] Zucca FA, Giaveri G, Gallorini M, Albertini A, Toscani M, Pezzoli G, et al. The
Salmonid T cells assemble in the thymus, spleen and in novel interbranchial neuromelanin of human substantia nigra: physiological and pathogenic
lymphoid tissue. J Anat 2010;217:728e39. aspects. Pigment Cell Res 2004;17:610e7.