Biological Conservation 197 (2016) 131–138

Contents lists available at ScienceDirect

Biological Conservation

journal homepage: www.elsevier.com/locate/bioc

Comparison of environmental DNA metabarcoding and conventional fish

survey methods in a river system
Jennifer L.A. Shaw a,e,⁎, Laurence J. Clarke a,c,d, Scotte D. Wedderburn b, Thomas C. Barnes b,
Laura S. Weyrich a, Alan Cooper a
a
Australian Centre for Ancient DNA, School of Biological Sciences, The University of Adelaide, North Terrace, Adelaide 5000, Australia 1
b
School of Biological Sciences, The University of Adelaide, Adelaide 5000, Australia
c
Australian Antarctic Division, Channel Highway, Kingston, Tasmania 7050, Australia
d
Antarctic Climate & Ecosystems Cooperative Research Centre, University of Tasmania, Hobart, Tasmania 7001, Australia
e
Commonwealth Science and Industrial Research Organisation, Land and Water Flagship, Waite Road, Adelaide, South Australia 5064, Australia

a r t i c l e i n f o a b s t r a c t

Article history: Regular biological surveys are essential for informed management of freshwater ecosystems. However, current
Received 21 August 2015 morphology-based biodiversity surveys can be invasive, time-consuming, and financially expensive. Recently,
Received in revised form 2 March 2016 environmental DNA (eDNA) sequencing has been suggested as an alternative non-invasive, time- and cost-
Accepted 8 March 2016
effective biological survey tool. However, eDNA sequencing tools require experimental validation in natural eco-
Available online 18 March 2016
systems before confidence in their use can be assumed. In this study, we compare fish community data obtained
Keywords:
via eDNA metabarcoding to that of conventional fyke netting within two complex and drought-prone river sys-
Freshwater tems. We also compare different eDNA sampling strategies and genetic markers for detecting rare and threatened
River Murray fish species. We were able to detect 100% of the fyke net caught-species from eDNA when appropriate sampling
eDNA strategies were used, including threatened and invasive species. Specifically, we found that two 1 L water sam-
NGS ples per site were insufficient for detecting less abundant taxa; however, five 1 L samples per site enabled a
Aquatic 100% detection rate. Further, sampling eDNA from the water column appeared to be more effective for detecting
Biomonitoring fish communities than eDNA from sediments. However, on a per site basis, community discrepancies existed
between the two methods, highlighting the benefits and limitations of both approaches. We demonstrate that
careful interpretation of eDNA data is crucial as bioinformatic identification of sequences, without logical infer-
ence or local knowledge, can lead to erroneous conclusions. We discuss these discrepancies and provide recom-
mendations for fish eDNA metabarcoding surveys.
© 2016 Elsevier Ltd. All rights reserved.

1. Introduction
Between 1995 and 2010 southern Australia experienced a ‘millennium’
drought, desiccating many freshwater systems and severely impacting
ecologically important native fish populations (Ellis et al., 2013;
Wedderburn et al., 2014a). When the drought ended, several species
such as Murray hardyhead (Craterocephalus fluviatilis, McCulloch 1912)
were reintroduced following severe population collapse (Hammer et al.,
2013; Bice et al., 2014). Despite these reintroductions, the recovery of
many populations has been regarded as unsuccessful, possibly hampered
by abundant alien species such as the piscivorous redfin perch (Perca
fluviatilis, Linnaeus 1758) and common carp (Cyprinus carpio, Linnaeus
1758) (Wedderburn et al., 2014a, 2014b).
⁎ Corresponding author at: CSIRO, Prescott Building, Waite Road, Urrbrae, South
Australia 5064, Australia.
E-mail address: jennifer.shaw@csiro.au (J.L.A. Shaw).
1
Indicates institutes where the research was carried out.
To assess the recovery of these south Australian river systems, rou-
tine biological surveys are often carried out. Fish populations are usually
assessed by methods involving capture and morphological identifica-
tion (Hill et al., 2005). However, the invasive nature of capture-based
methods can compromise animal health by increasing stress and preda-
tion risk (Rottmann et al., 1992; RIC, 1997), and some species may be
excluded from surveys due to selectivity of equipment (Pidgeon,
2004) or a lack of distinguishable morphological features (Bertozzi
et al., 2000). Further, due to often-limited equipment, personnel, and
funding, netting surveys are usually restricted both spatially and tempo-
rally. An ongoing decrease in the number of local taxonomists may also
hinder future morphology-based freshwater surveys (Hopkins and
Frekleton, 2002).
High throughput sequencing of DNA present in environmental sam-
ples, such as water or sediment, provides a non-invasive means to rap-
idly identify multiple taxa without the need for morphological
identification (Thomsen et al., 2012; Thomsen et al., 2011; Hajibabaei
et al., 2011; Taberlet et al., 2012). Sequencing environmental DNA
(eDNA) also enables identification of organisms that might not be

http://dx.doi.org/10.1016/j.biocon.2016.03.010
0006-3207/© 2016 Elsevier Ltd. All rights reserved.
132 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138
detected using conventional techniques, such as cryptic, immature or
juvenile taxa, providing a more complete picture of biodiversity. Fur-
ther, the rapid nature of eDNA sample collection and processing, and
the continually decreasing cost of sequencing (Mardis, 2011) makes
this approach suitable for increasing spatial and temporal coverage of
surveys.
Before multi-species eDNA sequencing (herein referred to as
‘metabarcoding’; Taberlet et al., 2012) can be used for routine biodiver-
sity surveys, an understanding of the various nuances associated with
the method, and guidance as to how well eDNA data reflects actual bio-
logical communities, is needed. Previous studies in controlled aquatic
settings, such as mesocosms (Kelly et al., 2014; Evans et al., 2016) and
small ponds (Thomsen et al. 2011), have found that all of the taxa pres-
ent can be detected from eDNA; however, it remains to be determined
whether these conclusions can be extended to larger and more complex
natural systems. Additionally, there is presently no consensus on exper-
imental protocols such as most appropriate sample type (i.e. sediment
or water), level of sampling effort required, or most suitable DNA mark-
er (genetic loci). As most fish species prefer to inhabit different zones
within an ecosystem (i.e. benthic species, reed-dwelling species, or
pelagic species), it is reasonable to expect that benthic species may be
more effectively detected from sediment samples and pelagic species
from water column samples. Further, the successful detection of abun-
dant species is likely to require less sampling effort compared with
the detection of less abundant taxa (Kelly et al., 2014; Thompsen
et al., 2012), but these hypotheses are yet to be formally tested. Further,
despite a number of studies assessing the suitability of different genetic
loci (Deagle et al., 2014; Ficetola et al., 2010; Riaz et al., 2011; Leray et al.,
2013; Mya et al., 2015) consensus on an optimal fish DNA marker has
yet to be reached.
The objective of this study was to establish an effective eDNA
metabarcoding survey protocol for detecting diverse fish communities
in a complex and ecologically-sensitive freshwater system: the River
Murray in South Australia. Ongoing fyke net surveys in the River
Murray, and other nearby river systems, provided an opportunity to
validate and optimize a metabarcoding survey approach against
morphological data. We compared the fish communities identified via
fyke net surveys to those identified from concurrent metabarcoding
surveys. A number of methodological variables were tested, such
as the effect of sample media (sediment versus water), number of
samples per site, and choice of DNA marker, as well as the effect of
species abundance on eDNA detection success. The findings of this
study will aid future eDNA metabarcoding survey designs and assist in
the development of rapid, non-invasive survey methods for freshwater
fish species.
2. Methods
2.1. Site information and sample collection
Two freshwater systems in South Australia were assessed during
this study. A preliminary survey took place in the North Para River
(NPR), which was sampled at six sites along the river system in April
2013 (SM-1). Two weeks prior, fyke net surveys had been carried out
at these sites by the Department of Environment, Water and Natural
Resources (DEWNR). The second, more extensive survey location, the
Lower River Murray Wetlands (LRMW), was sampled at nine sites
fringing Lake Alexandrina during November 2013 and again in early
March 2014 (SM-2). In this second location, fyke net surveys were
carried out concurrent to the eDNA sampling to allow temporally direct
comparisons of eDNA and fyke net data. In late March 2014, fyke net and
eDNA metabarcoding surveys were performed at two additional LRMW
sites (SM-2), thought to be inhabited by the threatened C. fluviatilis, to
address questions that arose during the initial November and March
surveys.
2.1.1. North Para River survey
Both sediment and water samples were collected from six sites
along the NPR to ascertain the best sample media for eDNA detection
of fish species. Two 1 L water samples were collected per site, 3–5 m
apart, in sterile bottles from 10 to 30 cm below the water surface and
immediately placed on ice. For the sediment samples, three sediment
cores (7 cm width) were taken per site, 3–5 m apart, at a depth between
30 and 70 cm, using sterile cores. The top 2 cm of sediment from each
core was collected and stored in sterile 15 mL tubes on ice. All equip-
ment was sterilized with bleach and ethanol prior to use. Samples
were transported to the laboratory on ice, and stored at 4 °C until DNA
extraction 16–24 h later.
2.1.2. River Murray Wetlands survey
In November 2013 and early March 2014, water samples were
collected as described above from nine sites in the LRMW. Fyke net sur-
veys were carried out concurrent to eDNA sampling by placing three
nets (6 m single-leader, 5 mm half mesh) at each site immediately
after water samples were taken. Fyke nets were located 10 m apart,
perpendicular to the riverbank. Grids (50 mm mesh) were placed at
the entrances of the nets to exclude turtles, but do not influence the cap-
ture of fishes (b 250 mm length; ~ 24 species) that inhabit the area
(Wedderburn et al., 2014a). The fyke nets were retrieved 15–19 h
later and all captured fish were identified to species and counted, except
for one taxon (Hypseleotris spp., Gill 1863) where the genus includes
several cryptic taxa and hybrids (Bertozzi et al., 2000).
2.1.3. Additional LRMW sampling to detect threatened species
Two additional sites, thought to be inhabited by the rare and threat-
ened C. fluviatilis, were sampled in late March 2014 to explore whether
eDNA detection of rare species could be improved by increasing the
number of water samples analyzed. Fyke nets were set as described
above and five 1 L water samples were collected as described above.
2.2. DNA extraction
For the sediment samples, DNA was extracted from 0.25 g of sedi-
ment using the MoBio PowerSoil DNA Isolation Kit (MoBio Laboratories
Inc., Solana Beach, CA) according to the manufacturer's protocol. For the
water samples, the entire 1 L of sample was vacuum filtered under
sterile conditions through 47 mm, 0.45 μm pore size nitrocellulose
membrane filters (Merck Millipore, Billerica, Massachusetts). Sterile
filter cups and membranes were used for each water sample, with the
membrane contact surface sterilized between samples by washing
with distilled water, followed by 70% ethanol and flaming. After filtra-
tion, membrane filters were placed into 5 mL tubes with lysis buffer
(C1) and garnet beads from the MoBio PowerSoil DNA Isolation kit.
The 5 mL tubes were agitated at room temperature overnight on an
orbital shaker at low speed to release DNA from the membrane. The fol-
lowing day, tubes were vortexed for 2 min, and the membrane filters
were removed and discarded. The lysis buffer was transferred into
MoBio kit screw-cap tubes, and the DNA extracted according to the
manufacturer's protocol (from Step 6). Extraction blank controls were
processed in parallel to assess potential background contamination
from laboratory reagents. For the water samples, 1 L distilled water
was filtered and extracted alongside the samples; for the sediment sam-
ples, 80 μL of DNA-free water was extracted along side the samples.
All DNA extracts were frozen at −20 °C until PCR amplification.
2.3. PCR and DNA library preparation
DNA was PCR-amplified using two fusion primer sets: a vertebrate-
specific 12S ribosomal DNA (rDNA) primer pair (Riaz et al., 2011) and a
fish-specific 16S rDNA primer pair (Table 1), both designed for sequenc-
ing on the Ion Torrent PGM (Life Technologies, Carlsbad, CA, USA). The
primer sets contained 7-basepair long sample-specific indexes to
 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138
Table 1
Primer sequences used for eDNA surveys and approximate PCR product size. Ion Torrent
platform specific adapter is shown in italics. Sample-specific tag is shown as ‘x’. Locus-
specific primers are shown in bold.
Name Primer sequence (5′ – 3′) Product size
16S fish-specific F CCATCTCATCCCTGCGTGTCTCCGACTC ~100 bp
AGxxxxxxxGGTCGCCCCAACCRAAG
16S fish-specific R CCTCTCTATGGGCAGTCGGTGATCGAG
AAGACCCTWTGGAGCTTIAG
12S vertebrate F (V5F) CCATCTCATCCCTGCGTGTCTCCGACTC 73–110 bp
AGxxxxxxxTTAGATACCCCACTATGC
12S vertebrate R (V5R) CCTCTCTATGGGCAGTCGGTGATTAGAA
CAGGCTCCTCTAG
allow eDNA sequences from different samples to be distinguished.
Extracts from the six NPR sites were initially amplified using only the
12S vertebrate-specific primer set, but following data analysis, 16S
rDNA ‘fish-specific’ primers (modified from Deagle et al., 2009) were
used to amplify extracts from three of the NPR sites to compare the
two DNA markers. Both the vertebrate-specific 12S and fish-specific
16S markers were subsequently used for all LRMW extracts. All extracts
(including extraction blanks) were PCR-amplified in triplicate reactions
to minimize PCR bias (Polz and Cavanaugh, 1998). DNA extraction, PCR
master-mix preparation, and addition of DNA to the PCR master-mix
were carried out in separate rooms within dedicated, ultraviolet irradi-
ated hoods.
2.3.1. PCR amplification
PCR reactions targeting the 12S vertebrate-specific genetic marker
(Riaz et al., 2011) contained 1× Amplitaq Gold PCR buffer, 2.5% DMSO,
1 mM dNTPs, 2 mM MgCl2, 0.5 mM of each primer, 0.05 U/L of Amplitaq
Gold, 2 μL extracted DNA template, and 9.2 μL of molecular grade H2O in
a total volume of 20 μL. PCR reactions targeting the 16S fish-specific
marker were prepared as 20 μL reactions, consisting of 1 × Amplitaq
Gold PCR buffer, 0.2 μg/mL BSA, 1 mM dNTPs, 2 mM MgCl2, 0.5 μM of
each primer, 0.05 U/L Amplitaq Gold, 2 μL of extracted DNA template,
and 9.8 μL of molecular grade H2O. Cycling conditions for both markers
consisted of initial denaturation at 95 °C for ten minutes, followed
by 35 cycles of 95 °C for 15 s, 55 °C for 30 s, and 72 °C for 45 s, with
a final extension at 72 °C for 5 min. PCR products were visualized by
electrophoresis on 2% agarose gels.
2.3.2. DNA library preparation
Triplicate PCR reactions were pooled and cleaned with Agencourt
AMPure XP beads, (Beckman Coulter, Brea, CA, USA). Samples were
quantified using fluorometric quantitation (Qubit 2.0, Life Technologies,
CA, USA) and pooled to equimolar concentrations (1.2 μg/μL). The
pooled DNA library was then quantified and sequenced on the Ion Tor-
rent PGM using 316 chips and 200 bp chemistry. A total of 6 PGM chips
were used: one chip per marker (16S and 12S) for the NPR preliminary
study and LRMW November survey, and one chip for the LRMW March
survey (both 16S and 12S combined), and one for the LRMW March
2014 additional sites (16S and 12S combined).
2.4. Data processing
Sequences were split into multiple files according to the sample-
specific indexes using a zero mismatch threshold, and primer and
index sequences were trimmed from the reads (CUTADAPT v1.1;
Martin, 2011). Only sequences greater than 80 bp and with a quality
score N Q20 for more than 90% of the read were retained (FASTX-toolkit
v0.0.13; http://hannonlab.cshl.edu/fastx_toolkit). The retained se-
quences were clustered to 97% similarity using UCLUST software
(Edgar, 2010). All negative controls were sequenced and subjected
to the same bioinformatic processes; however, following quality filter-
ing and clustering, the negative controls failed to retain any usable
133
sequences. BLASTn was used to assign taxonomy to clusters using
the online NCBI nr/nt database, and results were filtered and viewed
with MEGAN5 (Huson et al., 2011; software available from: www-
ab.informatik.uni-tuebingen.de/software/megan). A minimum support
of 20 sequences, a minimum bit score of 120, and matches within 2% se-
quence similarity of the top hit for each cluster were used in subsequent
analyses, as these parameters produced communities that were logical
(i.e. species known to occur in the area) and were validated against
the fyke net communities. Sequence files are available on NCBI's se-
quence read archive (SRA) at BioProject ID: PRJNA293920, BioSample
numbers: SAMNO4396390 through to SAMNO4396520. Information
of raw sequence counts and data processing are given in supplementary
file (SM-13).
2.5. Data analyses
Sequence counts were imported into PRIMER 7 software (Clarke
and Gorley, 2006) along with the species counts from the fyke nets.
eDNA data was compared to the fyke net data in both a species richness
(presence/absence) format, and also by comparing sequence counts and
species abundance. Species and sequence abundance data was stan-
dardized to proportions of the total sample, and square root transforma-
tion was applied to weight the contributions of common and rare
species in the multivariate representations. A Bray Curtis-based similar-
ity measure was used for both abundance and presence/absence data.
Analysis Of Similarities (ANOSIM) and RELATE tests were used to statis-
tically compare the composition of taxa detected by fyke and eDNA
methods, and visualized using nMDS plots. To compare the number of
species detected per site by each method, a paired t-test was performed
within SPSS (IBM Corporation, Armonk, NY, USA). To determine if in-
creased sampling effort could improve detection of less abundant spe-
cies, more intensive sampling (five 1 L samples per site) was carried
out at two additional LRMW sites in March 2014. Each liter sample
was processed and sequenced independently and the average number
of taxa detected in each liter was reported. From this information the
average number of taxa detected in each possible cumulative combina-
tion of one, two, three, and four liters, and finally the total number of
taxa detected (five liters) were plotted.
3. Results
3.1. Effect of sample media on eDNA species assemblage
The total number of identified fish species was higher when eDNA
was obtained from the water column (eight species) compared to sedi-
ment (three species), with three species common to both sample types
(Fig. 1). Of the six NPR sites assessed, fish species were detected from
water eDNA at four of the sites, whereas sediment samples only yielded
Fig. 1. Number and identity of fish species detected by conventional fyke netting and 12S
eDNA sequencing of sediment and water samples from six sites in the North Para River.
134 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138
fish DNA at two sites (SM-3 & 4). The fyke net survey carried out two
weeks prior to eDNA sampling identified a total of seven fish species
from the six sites combined. Five of the seven fyke net-caught species
were detected from the water eDNA (tench Tinca tinca Linneaus 1758,
and eastern mosquitofish Gambusia holbrooki Girard 1859 were not
detected), while only two of the seven species were detected in the
sediment eDNA (P. fluviatilis and Mountain galaxias Galaxias olidus
Gunther 1866). Three additional species not identified in the earlier
fyke-net survey were detected using the eDNA approach (common
carp Cyprinus carpio, black bream Acanthopagrus butcheri Munro 1949,
and mosquitofish Gambusia affinis Baird and Girard 1853). All three ad-
ditional species were detected in the water eDNA, and G. affinis was de-
tected in both the sediment and water. The two species Acanthopagrus
butcheri and G. affinis are not known to occur in the NPR. A. butcheri is
a coastal species known to occur in marine and estuarine waters in
South Australia (Gomon et al., 2008), and G. affinis is not known to
occur in South Australia (Hammer and Walker, 2004). However, upon
inspection the congeneric G. affinis and G. holbrooki were found to
have identical sequences for the 12S marker used. Thus detections of
G. affinis likely indicate the presence of G. holbrooki at these sites. Species
habitat preference (i.e. benthic versus pelagic species) did not appear to
affect eDNA detection success, as two of the three sediment eDNA-
associated species were also detected in the water eDNA. Further, blue
spot goby Pseudogobius olorum (Sauvage 1880) and flathead gudgeon
Philypnodon grandiceps (Krefft 1864) are typically benthic species yet
they were identified in the water eDNA but not in the sediment eDNA.
Based upon this data (and the greater ease of sample collection), only
water samples were used for the subsequent LRMW eDNA surveys.
3.2. Comparison of 12S and 16S genetic markers
Several NPR eDNA samples failed to yield any fish species, and
many of the 12S sequences were identified as mammalian and avian
(e.g. Trichosurus vulpecula — common brushtail possum, Dorcopsis sp. —
wallaby, Pseudocheirus peregrinus — common ringtail possum,
Oryctolagus cuniculus — European rabbit, Anas platyrhynchos — Mallard,
Chenonetta jubata — Australian wood duck, Gallinula chloropus — moor
hen). We hypothesized that the non-specificity of the 12S vertebrate
primers could lead to non-fish DNA sequences saturating the amplifica-
tion process, preventing detection of rare fish taxa. To determine if
a more specific marker would improve detection of fish eDNA, fish-
specific 16S rDNA primers were tested with eDNA extracts from
three NPR sites. Two fyke-net caught species not initially detected in
the 12S eDNA data were identified by the 16S primers (G. holbrooki and
T. tinca) (Fig. 2). When combined, the two genetic markers detected
100% of species identified within the fyke nets. However, the 16S primers
failed to detect five species that were identified in the 12S sequence data.
Fig. 2. Number and identity of fish species detected using eDNA (either 12S or 16S
ribosomal DNA) or fyke net surveys from three sites on the North Para River.
Of these five undetected species, two did not have 16S reference
sequences available on the NCBI database (P. olorum and A. butcheri),
explaining their absence from the data. However, 16S marker reference
sequences were available for the other three species (P. grandiceps,
C. carpio, and goldfish Carassius auratus Linnaeus 1758). Although fewer
taxa were detected across the three test sites with the 16S marker than
the 12S marker (4 and 7 species, respectively), the combination of the
two markers enabled all the fyke-caught species to be detected. As a
result, both markers were used for the subsequent LRMW surveys.
3.3. Comparison of fyke net and eDNA sequencing surveys
A total of 23 species were detected from the combined eDNA and
fyke net LRMW surveys, with only 13 species commonly detected by
both methods (Fig. 3 & SM-5). There was no significant difference
between total species detected per site for the fyke and eDNA data
(paired t-test: P = 0.730, df = 17, t-value = 0.35); however, multivar-
iate statistical analysis revealed community differences between the
two methods (PRIMER6 ANOSIM: 2-way crossed design collection
method x month; R = 0.242, P b 0.01; SM-6).
The eDNA metabarcoding approach detected five additional species
not detected during the fyke net surveys, including smallmouth
hardyhead Atherinosoma microstoma (Gunther 1861) and flathead
galaxias Galaxias rostratus (Klunzinger 1872). However, three of the
species identified from eDNA data are not known to occur at these
sites: orange chromide Etroplus maculatus (Bloch 1795), G. affinis (12S
only), and mulloway Argyrosomus japonicas (Temminck and Schlegel
1844). Five species were detected within fyke nets but not in the eDNA
data (Fig. 3a), and included unspecked hardyhead Craterocephalus
stercusmuscarum fulvus (Gunther 1867), lagoon goby Tasmanogobius
lasti (Hoese 1991), southern pygmy perch N. australis, Murray hardyhead
C. fluviatilis and a single estuarine greenback flounder Rhombosolea
tapirina (Gunther 1862). These species are typically present at low abun-
dances (SM-9). Further, as no 16S reference sequences exist for
C. fluviatilis or C. s. fulvus, these species can only be detected with the
12S primers (SM-7).
During the LRMW eDNA metabarcoding survey, differences were
again observed between the two DNA markers. The 16S primers detect-
ed 11 species, while the 12S detected 13 species, and only six species
were shared between data from both markers (Fig. 3b). The 16S marker
detected 39% of the fyke net-caught taxa, and the 12S marker detected
67% of fyke net-caught taxa, with a total of 72% of fyke net-caught
taxa detected when the two markers were combined (SM-7). As before,
it was not possible to detect some taxa due to a lack of reference
sequence data. At the time of writing, there are no 16S reference se-
quences on the NCBI database for C. fluviatilis, dwarf flathead gudgeon
Philypnodon macrostomus (Krefft 1864), Hypseleotris spp., P. olorum
and C. s. fulvus (SM-7). However, when considering only those for
which reference sequence data are available there is no difference
between the ability of the two markers to detect species, as the 12S
primers were able to detect 69.2% of fyke net-caught species when
12S reference sequences were available, and the 16S primers were
able to detect 68.4% of taxa when 16S reference sequences were avail-
able (SM-7). Further, the 16S primers were able to discriminate be-
tween closely related taxa, such as the congeneric Gambusia species,
where the 12S primers did not.
The LRMW was sampled during two time periods (November and
March). We found that eleven species were detected in both months,
with both the fyke and eDNA methods (SM 8), suggesting that these
species have relatively stable populations and are consistently present
at the sites. In contrast, detection of four other species varied over
time and between methods: N. australis and T. lasti were only detected
in the November fyke net surveys, and A. microstoma was only detected
by eDNA methods in November, possibly indicating either seasonal
variation or greater stochasticity in detecting less abundant species
(SM-8 & 9). Detection of other species was even more variable, for
 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138 135

Fig. 3. Venn diagram of [a] species detected by fyke net (pink) and eDNA (blue) surveys, and [b] species identified using the 16S marker (pink) and 12S marker (blue) from water samples
collected at nine sites within the Lower River Murray Wetlands. Surveys from November 2013 and March 2014 are combined.

instance P. olorum was only detected with eDNA in November and
with fyke nets in March. Multivariate analysis of community patterns
(SM-10) revealed that the eDNA and fyke net data were more closely
correlated in November (ANOSIM: R = 0.095, P = 0.052) compared
to March (ANOSIM: R = 0.388, P = 0.001).
3.4. Increased sample number improves detection of rare species
The mean number of identified species increased when eDNA from
additional water samples was obtained and analyzed (Fig. 4). Within
the 16S dataset, no additional species were detected beyond analysis
of three 1 L replicate samples; but this is likely to be a result of limited
16S reference sequences within online databases rather than the diver-
sity of the site being well characterized. In contrast, more taxa were
detected with each additional liter sample when using the 12S marker,
demonstrating that two 1 L samples per site was not adequate for
characterizing fish communities at these sites. When both markers
were combined, an average of 17 (± 1.4) taxa was detected per site
when five 1 L samples were assessed, whereas only 14.3 (± 1.3) taxa
were identified when two 1 L samples were assessed. Overall, a total
of 19 species were detected within the two additional sites when five
1 L samples were taken, while the fyke nets at the two sites only detected
13 species (SM-4 & 5). Using the five 1 L sampling approach, three addi-
tional rare taxa (C. fluviatilis, C. s. fulvus and T. lasti) were detected that
were absent in the earlier LRMW eDNA data. Further, A. microstoma was
again detected in the eDNA survey, but not in the fyke net data.
As less abundant taxa were more often detected when a higher
number of samples per site wereanalyzed, we also examined potential
correlations between sequence abundance and the number of individ-
uals counted in the fyke nets at these two sites. Five species (N. erebi,
G. maculatus, Australian smelt Retropinna semoni, congolli Pseudaphritis
urvillii, and P. fluviatilis) were chosen, as these species were present
136 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138
Fig. 4. The mean (±SD) number of taxa identified using eDNA within each liter or
combination of liters from two LRMW sites likely to be inhabited by C. fluviatilis. Data
from each genetic marker and both markers combined is plotted for each liter analyzed.
within both the fyke net and eDNA data sets, and had both 12S and 16S
reference sequences on the NCBI database. The number of individuals
caught in fyke nets ranged from 1 to 114. For the 16S marker, a strong
relationship was observed between fyke net and eDNA abundances at
one site (site 25: R2 = 0.97, P = 0.002 linear regression), but not the
other (site 26: R2 = 0.16, P = 0.502) (Fig. 5). For the 12S marker, a sim-
ilar trend was observed but neither were significant (site 25: R2 = 0.72,
P = 0.166, site 26: R2 = 0.000, P = 0.912 linear regression). Site 25 had
a more evenly distributed diversity, while site 26 was dominated by
G. maculatus, possibly skewing the relationship (fyke-net Evar-index:
site 25 = 0.29; site-26 = 0.18). The 16S marker sequence counts
more closely reflected the fyke net species counts (Site 25: R2 = 0.97,
site 26: R2 = 0.16) compared with the 12S marker sequence counts
(Site 25: R2 = 0.72, site 26: R2 = 0.00), which may be due to the fish-
specific nature of the 16S marker primer set. To determine if eDNA
metabarcoding data better reflects fyke net data when sequence- and
species- counts are compared (as opposed to species richness data)
we re-analyzed the data using both abundance information and species
richness information. The fyke net and eDNA data were less similar
(PRIMER6 ANOSIM: R = 0.399, P = 0.001; SM-12) when the abundance
information was used, compared with when presence/absence data was
used (ANOSIM: R = 0.242, P = 0.001; SM-6). This is likely because
eDNA sequence abundances are subject to biases such as preferential
amplification, and differences in animal biomass and/or gene copy
number across species.
4. Discussion
This study demonstrates the potential of eDNA metabarcoding
for monitoring freshwater fish communities, including both rare and
Fig. 5. Relationship between the sequence proportion of each species and the number of
individuals caught in fyke nets for two LRMW sites where five 1 L samples were
collected. Sequence counts were standardized as proportions of the total reads per sample.
abundant taxa. When appropriate sampling methods and DNA
markers are adopted, the high-throughput and rapid nature of eDNA
metabarcoding, combined with exponentially decreasing costs, makes
it a promising tool for the biomonitoring industry. However, this study
highlights a number of limitations that need to be addressed before
eDNA metabarcoding can be deemed a reliable tool for routine biodiver-
sity surveys. Here, we discuss these limitations and provide recommen-
dations based upon the findings of this and previous studies.
4.1. Spurious identifications
A number of taxa identified from eDNA data in this study are unlikely
to be physically present at the sampling sites. For example, A. butcheri
and A. japonicas are local estuarine and marine species respectively,
while E. maculatus and G. affinis are freshwater species not found in
Australia. G. rostratus has also not been detected at these survey sites
for over 100 years (Hammer et al., 2009). These spurious identifications
are likely caused by a combination of factors. In some cases, questionable
results are likely due to genetic similarities between closely related spe-
cies. For example, G. affinis is identical to G. holbrooki at the 12S genetic
region used in this study, but only G. holbrooki is known to inhabit
Australian rivers. Similarly, G. rostratus has a 16S gene region identical
to that of G. maculatus, which was morphologically identified in fyke
nets at these sites. E. maculatus is also likely to be a bioinformatical mis-
identification, although introductions of aquarium species to freshwater
systems via the aquarium trade are plausible (Padilla and Williams,
2004). Generating and using a local reference sequence database, con-
taining only species known to- or likely to- occur at the study site,
could avoid misidentifications of this type. Other spurious eDNA identifi-
cations may be due to transportation of eDNA by secondary vectors, such
as predator feces, boats, wetland birds, and water currents (Merkes et al.,
2014; Deiner and Altermatt, 2014). This may be the case for A. butcheri
and A. japonicas that inhabit nearby estuaries and marine waters. Alter-
natively, juveniles of these marine species may be physically present at
some sites. The short DNA fragments (~ 100 bp) used in this study
could also be a hindrance to accurate species identifications. Longer frag-
ments would increase the probability of accurate bioinformatic identifi-
cations and decrease the probability of sequencing highly degraded
and damaged eDNA. Since this study was completed, more advanced se-
quencing chemistry has become available and longer eDNA fragments
can now be sequenced. We recommend always using a relatively strict
quality score threshold to reduce the incidence of damaged DNA in
final datasets, and interpreting results with caution, applying biological
knowledge to the data before reporting conclusions.
4.2. Water eDNA better represents fish communities than sediment eDNA
We found that eDNA extracted from water samples generally
yielded a greater number of species and more closely reflected the
NPR fyke net communities compared with eDNA from sediments.
Recent studies have found that eDNA can be preserved in sediments
for longer periods of time, and that, gram for milliliter, sediments tend
to contain more DNA compared to water (Turner et al., 2015). Differ-
ences between sediment and water eDNA in this study may be caused
by sample volume bias introduced during DNA extraction (Deiner
et al., 2015). Specifically, Turner et al. (2015) found fish eDNA was up
to 1800 times more concentrated per gram of sediment compared to
per milliliter water, but we processed 4000 times more water (1 L) com-
pared to sediment (250 mg) per sample, as attempting to extract DNA
from larger sediment volumes would create undesirable technical diffi-
culties. The study by Turner et al. (2015) also used highly-targeted
single-species qPCR-based methods rather than the multi-species
metabarcoding approaches used in this study, which is likely to result
in greater recovery of individual species' eDNA. Due to the greater
ease of sampling large volumes of water compared with sediment, we
 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138
propose that water is the better media for obtaining contemporary bio-
logical community information from eDNA.
4.3. Careful primer design and choice is critical
We found that using multiple genetic markers increased the proba-
bility of species detection, and in some cases, compensated for inade-
quacies associated with specific gene regions, supporting the findings
of previous studies (Miya et al., 2015; Evans et al., 2016). For example,
only when data for both the 12S and 16S markers were combined
were all fyke net-caught taxa detected from eDNA. Before choosing a
primer set three factors should be considered: the number of reference
sequences available, primer PCR-bias, and the genetic resolution be-
tween taxa. This study found that using fish-specific 16S primers re-
duced the occurrence of non-target mammalian, reptilian and avian
sequences in the dataset; however, the 16S marker had fewer NCBI ref-
erence sequences available for Australian fish fauna compared to the
12S DNA marker. The second consideration, primer bias, is caused
when mismatches between the primer and template DNA leads to pref-
erential PCR amplification of some DNA fragments over others. This bias
will increase the chance of DNA from some species masking the DNA of
other species, and potentially exclude some taxa from the dataset. Prim-
er bias is generally unavoidable but can be minimized with careful
marker design or selection (Suzuki and Giovannoni, 1996). Finally, the
genetic resolution between all target species can be investigated in silico
with software such as ecoPrimer (Riaz et al., 2011) or GENEIOUS
(Kearse et al., 2012) prior to sampling to ensure that chosen markers
provide sufficient taxonomic resolution without substantial primer
bias. If the chosen genetic region is identical between closely related
taxa (e.g. congeneric species), species differentiation will not be possi-
ble; however, if only one congener is known to occur in the sites of in-
terest, then it may still be considered a sufficient marker.
4.4. A higher number of replicate samples is needed to detect rare taxa
We found that analyzing two 1 L samples was insufficient to fully
characterize fish communities at LRMW sites. Increasing the number
of replicate 1 L samples, from two to five per site, increased the number
of taxa detected and enabled 100% of the fyke net-caught taxa to be
identified. A previous eDNA metabarcoding study that measured fish
taxa in a controlled marine mesocosm found that diversity was higher
and more representative of the true diversity when three 1 L samples
were assessed compared with one 15 L sample (Kelly et al., 2014).
This is likely because DNA from rare taxa is at relatively low concentra-
tions and more sparsely distributed within the water column compared
to that from more abundant species. Therefore, in this study we opted to
measure the effectiveness of increasing the multiple spatial replicates
rather than increasing the volume of the samples. Increasing sampling
effort in this way increases the chance of detecting DNA fragments
from taxa that are patchily distributed throughout the environment
due to either low abundance or behavioral factors, such as shoaling. Ul-
timately, the sampling effort needed will depend on the target species
biomass, behaviors, and population density. We have demonstrated
the importance of adequate sampling design for detecting rarer species.
4.5. Future research suggestions
4.5.1. More published reference genomes are needed for effective eDNA
surveys
Currently, the Cytochrome Oxidase subunit 1 (CO1) and the 12S
marker gene regions are more widely used in fish DNA barcoding stud-
ies (Deagle et al., 2014; Hardy et al., 2011). However, previous studies
have suggested that the COI does not contain suitably conserved regions
for short amplicon-based eDNA applications (Deagle et al., 2014), and
we found that the 16S locus was able to discriminate between some
species where the 12S did not. The limited amount of reference
137
sequences for alternative DNA markers, such as the 16S marker used
in this study, highlights the need for extending genetic databases to in-
clude more gene regions, rather than relying on a few commonly used
regions that may not be suitable for the target community (Deagle
et al., 2014; Clarke et al., 2014). Unfortunately, we could not generate
these particular reference genomes during this study due to financial re-
strictions, but greater future investment in exploring alternative gene
regions, should be a priority.
4.5.2. Does survey timing matter?
We found significant differences between the LRMW fish communi-
ties in November and March, and the month of collection had a signifi-
cant impact on the relationship between the eDNA and fyke net data. In
November no significant difference was observed between the two sur-
vey methods, whereas in March the two methods detected significantly
different communities. The ability of eDNA metabarcoding to detect
taxa at all life stages (e.g. egg, larval, adult), compared to net-based ap-
proaches that only detect fish above a given size, may partially explain
the temporal differences between the survey method correlations.
These factors need to be taken into consideration when interpreting
eDNA-based survey data, as detection does not indicate mature
individuals.
4.5.3. Does sequence abundance correlate with taxa abundance?
We found some evidence of a positive relationship between species
abundance in fyke nets and DNA sequence counts for several species.
Sequence abundance reflected the number of individuals caught in
fyke nets reasonably well at one site but not another, and for one genetic
marker but not another. Many factors can affect sequence count (Deagle
et al., 2013; Evans et al., 2016; Takahara et al., 2015), including DNA ex-
traction method, sample storage, PCR bias, preferential amplification,
spatial biases, cell integrity, gene copy number, and sequencing error.
We suspect that community composition may also play a role, as we
identified a stronger relationship between the two methods when
data from the site with more even diversity was considered. We also
found that amplification of a more targeted locus (fish-specific 16S
marker) strengthened the relationship between sequence read- and
species- abundance. However, more research is needed before species
abundance can be reliably estimated from eDNA metabarcoding sur-
veys, as the relationship between eDNA and fyke net data was weaker
when sequence abundance data was used compared with when species
richness data was used. We suggest that the first step in developing
semi-quantitative eDNA metabarcoding methods is to first identify an
effective group-specific genetic marker for the suite of target taxa.
Once a highly targeted marker is determined, the weighting of each fac-
tor that influences the relationship between sequence abundance and
target taxa abundance can be assessed through careful experimental
validation and mathematical models. Until then, species-specific
qPCR-based eDNA approaches can provide reliable estimates of relative
taxa abundance across multiple samples (Laramie et al., 2015; Spear
et al., 2015; Sigsgaard et al., 2015), and could be used to complement
metabarcoding approaches.
5. Conclusion
This study addressed a number of key questions associated with
using eDNA metabarcoding for biomonitoring freshwater fish commu-
nities, including appropriate sample type (sediment versus water), the
number of replicates required, and appropriate genetic markers. We
found that five 1 L water samples per site and the use of two comple-
mentary genetic loci successfully enabled detection of 100% of the fish
taxa caught by conventional methods within ecologically important
wetlands. However, this study also highlighted several methodological
issues that need to be explored further. Environmental conditions,
DNA transfer by vectors, and bioinformatic parameter choice may all
contribute to inaccurate community data. Therefore, data should be
138 J.L.A. Shaw et al. / Biological Conservation 197 (2016) 131–138
interpreted cautiously, in light of the habitat and taxa likely to be
present at the site. It must also be noted that eDNA metabarcoding can-
not currently provide demographic information, such as sex, maturity,
age, and abundance; but, genetic markers may be developed to do so
in the future (e.g. Polanowski et al., 2014). Until then, it will be neces-
sary to use complementary methods, such as fyke and seine netting,
to obtain demographic information. However, we suggest that more
spatially extensive eDNA metabarcoding surveys could be used to better
inform fyke net placement, allowing traditional methods to be utilized
in key areas and less frequently to reduce costs and physical damage
to aquatic species and ecosystems. It is likely that eDNA metabarcoding
will be a highly useful tool for non-invasive biological surveys and will
become more widely used as the technique becomes more refined.
Acknowledgments
The LRMW fyke net sampling was funded by The Murray–Darling
Basin Authority's the Living Murray Initiative, and was managed by
Adrienne Rumbelow from the Department of Environment, Water and
Natural Resources (DEWNR), South Australia. The fyke net sampling
was conducted in accordance with South Australia's Fisheries Manage-
ment Act 2007 (exemption no. 9902595 and 9902676) and The Univer-
sity of Adelaide's Animal Ethics Policy (approval no. S-2012-167). We
would like to thank Douglas Green from DEWNR for providing the
fyke net data for the six NPR sites. The eDNA aspect of this project was
financially supported by the Australian Research Council (ARC) linkage
grant LP0991985.
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.biocon.2016.03.010.
References
Bertozzi, T., Adams, M., Walker, K.F., 2000. Species boundaries in carp gudgeons
(Eleotrididae: Hypseleotris) from the River Murray, South Australia: evidence for
multiple species and extensive hybridization. Mar. Freshw. Res. 51, 805–815.
Bice, C., Whiterod, N., Zampatti, B., Hammer, M., 2014. The Critical Fish Habitat Project:
assessment of reintroduction success of threatened species in the Coorong, Lower
Lakes and Murray Mouth region 2011–2014. SARDI Aquatic Sciences, Adelaide.
Clarke, K.R., Gorley, R.N., 2006. PRIMER v6: User Manual/Tutorial. PRIMER-E, Plymouth.
Clarke, L.J., Soubrier, J., Weyrich, L.S., Cooper, A., 2014. Environmental metabarcodes for
insectes: in silico PCR reveals potential for taxonomic bias. Mol. Ecol. Resour. 14,
1160–1170.
Deagle, B.E., Kirkwood, R., Jarman, S.N., 2009. Analysis of Australian fur seal diet by pyro-
sequencing prey DNA in faeces. Mol. Ecol. 18, 2022–2038.
Deagle, B.E., Thomas, A.C., Shaffer, A.K., Trites, A.W., Jarman, S.N., 2013. Quantifying
sequence proportions in a DNA-based diet study using Ion Torrent amplicon
sequencing: which counts count? Mol. Ecol. Resour. 13, 620–633.
Deagle, B.E., Jarman, S.N., Coissac, E., Pompanon, F., Taberlet, P., 2014. DNA metabarcoding
and the cytochrome c oxidase subunit 1 marker: not a perfect match. Biol. Lett. 10,
20140562.
Deiner, K., Altermatt, F., 2014. Transport distance of invertebrate environmental DNA in a
natural river. PLoS One 9, e88786.
Deiner, K., Walser, J., Machler, E., Altermatt, F., 2015. Choice of capture and extraction
method affect detection of freshwater biodiversity from environmental DNA. Biol.
Conserv. 183, 53–63.
Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinfor-
matics 26, 2460–2461.
Ellis, I.M., Stoessel, D., Hammer, M.P., Wedderburn, S.D., Suitor, L., Hall, A., 2013.
Conservation of an inauspicious endangered freshwater fish, Murray hardyhead
(Craterocephalus fluviatilis), during drought and competing water demands in the
Murray–Darling Basin, Australia. Mar. Freshw. Res. 64, 792–806.
Evans, N.T., Olds, B.P., Renshaw, M.A., Turner, C.R., Li, Y., Jerde, C.L., Mahon, A.R., Pfrender,
M.E., Lamberti, G.A., Lodge, D.M., 2016. Quantification of mesocosm fish and amphib-
ian species diversity via environmental DNA metabarcoding. Mol. Ecol. 16, 29–41.
Ficetola, G.F., Coissac, E., Zundel, S., Riaz, T., Shehzad, W., Bessiere, J., Taberlet, P.,
Pompanon, F., 2010. An In-silico approach for the evaluation of DNA barcodes. BMC
Genomics 11, 434–444.
Gomon, M., Bray, D., Kuiter, R., 2008. Fishes of Australia's Southern Coast. Reed New
Holand, Sydney.
Hajibabaei, M., Shokralla, S., Zhou, X., Singer, G.A.C., Baird, D.J., 2011. Environmental
barcoding: a next-generation sequencing approach for biomonitoring applications
using river benthos. PLoS One 6, e17497.
Hammer, M.P., Walker, K.F., 2004. A catalogue of South Australian freshwater fishes,
including new records, range extensions and translocations. Trans. R. Soc. S. Aust.
128, 85–97.
Hammer, M., Wedderburn, S., van Weenan, J., 2009. Action Plan for South Australian
Freshwater Fishes. Native Fish Australia (SA), Adelaide.
Hammer, M.P., Bice, C.M., Hall, A., Frears, A., Watt, A., Whiterod, N.S., Beheregaray, L.B.,
Harris, J.O., Zampatti, B.P., 2013. Freshwater fish conservation in the face of critical
water shortages in the southern Murray–Darling Basin, Australia. Mar. Freshw. Res.
64, 807–821.
Hardy, C.M., Adams, M., Jerry, D.R., Court, L.N., Morgan, M.J., Hartley, D.M., 2011. DNA
barcoding to support conservation: species identification, genetic structure and bio-
geography of fishes in the Murray–Darling River Basin, Australia. Mar. Freshw. Res.
62, 887–901.
Hill, D., Fasham, M., Tucker, G., Shewry, M., Shaw, P., 2005. Handbook of Biodiversity
Methods: Survey, Evaluation and Monitoring. University Press, Cambridge.
Hopkins, G., Frekleton, R., 2002. Declines in the numbers of amateur and professional
taxonomists: implications for conservation. Anim. Conserv. 5, 245–249.
Huson, D.H., Mitra, S., Ruscheweyh, H.J., Weber, N., Schuster, S.C., 2011. Integrative anal-
ysis of environmental sequences using MEGAN 4. Genome Res. 21, 1552–1560.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S.,
Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond,
A., 2012. Geneious Basic: an integrated and extendable desktop software platform
for the organisation and analysis of sequence data. Bioinformatics 28, 1647–1649.
Kelly, R.P., Port, J.A., Yamahara, K.M., Crowder, L.B., 2014. Using environmental DNA to
census marine fishes in a large mesocosm. PLoS One 9, e86175.
Laramie, M.B., Pilliod, D.S., Goldberg, C.S., 2015. Charecterising the distribution of an
endangered salmonid using eDNA analysis. Biol. Conserv. 183, 29–39.
Leray, M., Yang, J.Y., Meyer, C.P., Mills, S.C., Agudelo, N., Ranwez, V., Boehm, J.T., Machida,
R.J., 2013. A new versatile primer set targeting a short fragment of the mitochondrial
COI region for metabarcoding metazoan diversity: application for characterising coral
reef fish gut contents. Front. Zool. 10, 34.
Mardis, E., 2011. A decade's perspective on DNA sequencing technology. Nature 470,
198–203.
Martin, M., 2011. Cutadapt removes adapter sequences from high-throughput sequencing
reads. Bioinformat. in Action 17, 10–12.
Merkes, C.M., McCalla, S.G., Jensen, N.R., Gaikowski, M.P., Amberg, J.J., 2014. Persistence of
DNA in carcasses, slime and avian feces may affect interpretation of environmental
DNA data. PLoS One 9, e113346.
Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J.Y., Sato, K., Mnamoto, T., Yamamoto, S.,
Yamanaka, H., Araki, H., Kondoh, M., Iwasaki, I., 2015. MFish, a set of universal PCR
primers for metabarcoding environmental DNA from fishes: detection of more than
230 subtropical marine species. R. Soc. Open Sci. 2, 150088.
Padilla, D.K., Williams, S.L., 2004. Beyond ballast water: aquarium and ornamental trades
as sources of invasive species in aquatic ecosystems. Front. Ecol. Environ. 2, 131–138.
Pidgeon, R., 2004. A Review of Options for Monitoring Freshwater Fish Biodiversity in
the Darwin Harbour Catchment: Report Prepared for Water Monitoring Branch,
Natural Resource Management Division. Department of Infrastructure. Planning &
Environment.
Polanowski, A.M., Robbins, J., Chandler, D., Jarman, S.N., 2014. Epigenetic estimation of age
in humpback whales. Mol. Ecol. Resour. 14, 976–987.
Polz, M.F., Cavanaugh, C.M., 1998. Bias in template-to-product ratios in multitemplate
PCR. Appl. Environ. Microbiol. 64, 3724–3730.
Riaz, T., Shehzad, W., Viari, A., Pompanon, F., Taberlet, P., Coissac, E., 2011. ecoPrimers: in-
ference of new DNA barcode markers from whole genome sequence analysis. Nucleic
Acids Res. 39, e145.
RIC, 1997. Fish Collection Methods and Standards. Resources Inventory Committee,
Vancouver.
Rottmann, R.W., Francis-Floyd, R., Durborow, R., 1992. The Role of Stress in Fish Disease.
Southern Regional Aquaculture Center.
Sigsgaard, E.E., Carl, H., Moller, P.R., Thomsen, P.F., 2015. Monitoring the near extinct
European weather loach in Denmark based on environmental DNA from water.
Biol. Conserv. 183, 46–52.
Spear, S.F., Groves, J.D., Williams, L.A., Waits, L.P., 2015. Using environmental DNA
methods to improve detectability in a hellbender (Cryptobranchus alleganiensis)
monitoring program. Biol. Conserv. 183, 38–45.
Suzuki, M.T., Giovannoni, S.J., 1996. Bias caused by template annealing in the amplifica-
tion of mixtures of 16S rRNA genes by PCR. Appl. Environ. Microbiol. 62, 625–630.
Taberlet, P., Coissac, E., Hajibabaei, M., Rieseberg, L.H., 2012. Environmental DNA. Mol.
Ecol. 21, 1789–1793.
Takahara, T., Minamoto, T., Doi, H., 2015. Effects of sample processing on the detection
rate of environmental DNA from the common carp (Cyprinus carpio). Biol. Conserv.
183, 64–69.
Thomsen, P.F., Kielgast, J., Iversen, L.L., Wiuf, C., Rasmussen, M., Gilbert, M.T.P., Orlando, L.,
Willerslev, E., 2011. Monitoring endangered freshwater biodiversity using environ-
mental DNA. Mol. Ecol. 21.
Thomsen, P.F., Kielgast, J., Iversen, L.L., Moller, P.R., Rasmussen, M., Willerslev, E., 2012.
Detection of a diverse marine fish fauna using environmental DNA from seawater
samples. PLoS One 7, e41732.
Turner, C.R., Uy, K.L., Everhart, R.C., 2015. Fish environmental DNA is more concentrated
in aquatic sediments than surface water. Biol. Conserv. 183, 93102.
Wedderburn, S.D., Barnes, T.C., Hillyard, K.A., 2014a. Shifts in fish assemblages indicate
failed recovery of threatened species following prolonged drought in terminating
lakes of the Murray–Darling Basin, Australia. Hydrobiologia 730, 179–190.
Wedderburn, S.D., Bice, C.M., Barnes, T.C., 2014b. Prey selection and diet overlap of native
golden perch and alien redfin perch under contrasting hydrological conditions. Aust.
J. Zool. 62, 374–381.