MOLECULAR CHARACTERIZATION OF ANTIBIOTIC RESISTANCE PLASMIDS

IN SOME EXTENDED SPECTRUM β-LACTAMASE PRODUCING GRAM NEGATIVE

BACTERIAL ISOLATES RESISTANT TO METHANO LIC EXTRACT OF CARICA
PAPAYA

By

OMOLARA ADENAIKE

DEPARTMENT OF MICROBIOLOGY,

FACULTY OF SCIENCE

AHMADU BELLO UNIVERSITY, ZARIA

NIGERIA

MARCH, 2014

1
 MOLECULAR CHARACTERIZATION OF ANTIBIOTIC RESISTANCE PLASMIDS
IN SOME EXTENDED SPECTRUM β-LACTAMASE PRODUCING GRAM NEGATIVE
BACTERIAL ISOLATES RESISTANT TO METHANOLIC EXTRACT OF CARICA
PAPAYA

By

Omolara ADENAIKE
B.Sc (O.A.U. 1994), M.Sc (A.B.U. 2006)
Ph.D/Scien/00305/06-07

A DISSERTATION SUBMITTED TO THE SCHOOL OF POSTGRADUATE STUDIES

AHMADU BELLO UNIVERSITY, ZARIA

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE AWARD OF A

DOCTOR OF PHILOSOPHY DEGREE IN MICROBIOLOGY

DEPARTMENT OF MICROBIOLOGY,
FACULTY OF SCIENCE
AHMADU BELLO UNIVERSITY, ZARIA
NIGERIA

MARCH, 2014

2
 DECLARATION

I declare that the work in this dissertation entitled ―MOLECULAR CHARACTERIZATION

OF ANTIBIOTIC RESISTANCE PLASMIDS IN SOME EXTENDED SPECTRUM β-
LACTAMASE PRODUCING GRAM NEGATIVE BACTERIAL ISOLATES
RESISTANT TO METHANOLIC EXTRACT OF CARICA PAPAYA” was performed by me
in the laboratories of the Department of Microbiology, Ahmadu Bello University, Zaria, under
the supervision of Professors O.S. Olonitola, J.B. Ameh and C.M.Z. Whong.

The information derived from the literature has been duly acknowledged in the text and a list of
references provided. No part of this work has been presented for another degree or diploma at
this or any other institution.

______________________ __________ ___________

Name of Student Signature Date

3
 CERTIFICATION

This dissertation entitled “MOLECULAR CHARACTERIZATION OF ANTIBIOTIC

RESISTANCE PLASMIDS IN SOME EXTENDED SPECTRUM β-LACTAMASE
PRODUCING GRAM NEGATIVE BACTERIAL ISOLATES RESISTANT TO
METHANOLIC EXTRACT OF CARICA PAPAYA” by Omolara ADENAIKE meets the
regulations governing the award of the degree of Doctor of Philosophy of Ahmadu Bello
University, Zaria, and is approved for its contribution to knowledge and literary presentation.

____________________________ ________________ ______________

Chairman, Supervisory committee Signature Date

Prof. O.S. Olonitola

____________________________ ________________ ______________

Member, Supervisory committee Signature Date

Prof. J.B. Ameh

____________________________ ________________ ______________

Member, Supervisory committee Signature Date

Prof. C.M.Z. Whong

____________________________ ________________ ______________

Head of Department Signature Date
Prof. S.A. Ado

___________________________ ________________ ______________

Dean, School of Postgraduate Studies Signature Date
Prof. A. A. Joshua

4
 ACKNOWLEDGEMENTS

I give all the glory to God Almighty, the Giver of life and every good thing, for the privilege of
this additional degree, may His name be praised forever more. Amen.

I‘m greatly indebted to my Supervisors, Professors O.S. Olonitola, J.B. Ameh and C. M. Z.
Whong, for all I enjoyed in the course of the supervision of this work, their concern for the
progress of the work, the search for needed resources and their belief in my person that I could
bring forth a worthwhile research. May the Lord bless you abundantly in Jesus name. Amen.

I appreciate the concern and generosity of Prof. C.A. Okuofu, Dept. of Water Resources and
Environmental Engineering, for giving me a number of media and reagents for the first set of
analysis, and his concern for the completion of the work; also by extension the hand of
fellowship accorded me by Messers Alika and Yahaya of the same Department. The entire staffs
of the Dept. of Microbiology are instrumental to the success of this work. I want to appreciate
the efforts of Mr. Ayo Odewumi, Prof. E.D. Jatau, Dr. I.O. Abdullahi, Prof. A.A. Ahmad, Dr.
(Mrs.) H.I. Inabo, Dr. (Mrs.) Maryam Aminu-Muktar and the fatherly support of Dr. S.E.
Yakubu. Thanks to Mrs. T. E. Addai and Mr. Alexander Shaibu for permitting access to their
offices within a period of time in order to use the laboratory facilities therein. To Dr. E.E. Ella,
Messers Adamu Shittu and Shuaibu Garba, I owe you a million thanks. May God bless you.

I wish to appreciate the Head, and technical staff of the Department of Pharmacognosy and drug
development, Faculty of Pharmaceutical Sciences, A.B.U. Zaria; for providing bench space and
technical assistance for the plant extraction and phytochemical screening aspect of this work.

Also, I‘m grateful to the Management and Staff of DNALABS Nigeria, Kaduna. They are really
a team of research support group and wonderful people to work with. Their tremendous support
and consideration contributed immensely to success of the molecular aspect of this work.

I want to appreciate my loving Parents, Deacon and Mrs. D. O. Ogunwole, and my maternal
Aunt, Mrs. Adejoke Ajibola, for their prayers, moral and financial support to see to the success
of this work. Also, the concerns and support of my late Brother and his Sister in-laws, Mr. John
Adewale Adenaike and Mrs Adebimpe Adeborogun, are well appreciated. The tremendous
support of my siblings and their spouses cannot be overemphasized. So, to Elder and Mrs.

5
Kehinde Olugbeminiyi (Sogbesan), Prof. and Mrs. J. O. Ogunwole, Pastor and Mrs. Oladele
Olabode and lastly, Mr. and Mrs. Emmanuel Ibisagba, I say God bless you. Our cord of love will
ever remain binding.

I‘m grateful for the support and encouragement received from Prof. and Mrs. J. F. Iyun, Engr.
and Dr. (Mrs.) James Babatunde, Dr. and Mrs James Sambo, Mr. and Mrs Barnabas Jatau, Mrs.
Janet Sangowawa and Dr. (Mrs.) Olubunmi Negedu-Momoh. Also, I appreciate every assistance
from friends, fellow postgraduate students and co-workers in the laboratory, to mention a few are
Evelyn Fatokun, Tarfena Amapu, Grace Abakpa, Sakina Bello, Mrs Mulika Agboola Abdul-
rahman, Dr. (Mrs.) Grace Gberikon, Mrs Juliana Mohammed Christopher (Mama Jerry), Theresa
Tafida, Blessing Obasi, Mrs Helen Ibukun Ikilama, Sister Esther Femi Ojo, Mrs. Nike Oladokun,
Messers Hacinth Dapiya, Barnabas Olukotun, Oluwaseye Adedirin, Julius Okojukwu, Jacob
Koduah, Engr. James Shiraki and Dr. (Mrs.) Mercy Bassi. Others worthy of note are the
contributions and concerns of Bro. Johnson David, Dr. Asabe Dzikwi, Mary Okpe, Mrs Juliana
Gambo, Mr. Samuel Oyebode, Dr. Nura Sani Mohammed, Pst. Dr. Joseph Okopi and Mr. Joseph
Orabuike (Uncle Joe).

Finally, I‘m indebted to my husband, Dr. Emmanuel Adeoye Adenaike, for his cooperation,
moral and financial support to enhance the completion of this work. I sincerely appreciate his
endurance during those long hours of loneliness while I was away in the laboratory. Together,
we shall soar high. Thanks so much.

6
 TABLE OF CONTENTS

Page

Title Page…………………………………………………………………………………………..i
Dedication………………………………………………………………………………………....ii
Certification……………………………………………………………………………………....iii
Acknowledgements……………………………………………………………………………….iv
Table of Contents………………………………………………………………………………....vi
List of Figures………………………………………………………………………………...….xii
List of Tables………………………………………………………………………………..…..xiv
List of Plates…………………………………………………………………………………….xvi
List of Appendices…………………………………………………………………………..…xvii
Abbreviations……………………………………………………………………….………….xviii
Abstract……………………………………………………………………………….…. . ..…. .xx

1.0 INTRODUCTION………………………………………………………………….....…1

1.1 General Background………………………………………………………………..……1

1.2 Statement of Research Problem………………………………………………………...5

1.3 Justification for the Study…………………………………………….……………..…..6

1.4 Aim of Study ………………………………………………………………………..……7

1.5 Specific Objectives…………………………………………………………….……..…..7

1.6 Research Questions…………………………………………………………………..….8

2.0 LITERATURE REVIEW ……………………………………………………..………9

2.1 Medicinal Plants…………………………………………………………………….…..9

2.1.1 Major groups of bioactive components in medicinal plants………………………….….13

2.1.2 Solvent extraction of medicinal plants…………………………………………………...28

7
2.1.3 Carica papaya……………………………………………………………………………30

2.2 Food Safety………...……………………………………………………………………32

2.3 Microbial Food borne Disease……………………………………………………...….34

2.3.1 Indicators of bacterial food pathogens………………………………………………...35

2.4 Ready-to-Eat Foods…………………………………………………………………… 39

2.4.1 Processed meat (‗suya‘)…………………………………………………………….……41

2.4.2 Smoked fish……………………………………………………………………………...42

2.4.3 ‗Zoborodo‘…………………………………………………………………………….…43

2.4.4 ‗Kunun zaki‘……………………………………………………………………………..44

2.5 Antibiotics…………………………………………………………………………….…45

2.5.1 Antibiotics that inhibit cell wall synthesis……………………………………………….46

2.5.2 Antibiotics that disrupt cell membrane function…………………………………………46

2.5.3 Antibiotics that inhibit protein synthesis………………………………………………...47

2.5.4 Antibiotics that inhibit nucleic acid synthesis……………………………………….…..48

2.5.5 Antibiotics that act as antimetabolites…………………………………………….….....49

2.6 Beta-Lactam Antibiotics………………………………………………………………..50

2.6.1 Penicillins……………………………………………………………………………...…51

2.6.2 Cephalosporins….……………………………………………………………………….53

2.6.3 Monobactams…………………………………………………………………………….56

2.6.4 Carbapenems………………………………………………………….………………....56

2.7 Susceptibility Testing Methods……………………………………………………......58

8
2.7.1 Disk diffusion method…………………………………………………………………...59

2.7.2 Dilution method (broth and agar dilution method) ………………………………...…..61

2.7.3 Antimicrobial gradient method…………………………………….……………………63

2.7.4 Automated methods……………………………………………………………………..65

2.7.5 Mechanism-specific tests………………………………………………………………..66

2.7.6 Genotypic methods……………………………………………………………………..66

2.8 Antimicrobial Resistance………………………………………………………….……67

2.8.1 Beta-lactamases………………………………………………………………….……….71

2.8.2 Extended spectrum β- lactamases……………………………………………….……….74

2.8.3 β-lactamase inhibitors……………………………………………………………………78

2.8.4 Methods of detecting ESBLs……………………………………………………………79

2.8.5 Treatment of ESBLs……………………………………………………………………..82

2.8.6 Prevention and control……………………………………………………………….…..83

2.9 Plasmids and Antibiotic Resistance……………………………………………………83

3.0 MATERIALS AND METHODS………………………………………………………86

3.1 Study Area………………………………………………………………………………86

3.2 Media, Reagents and Sterilizations……………………………………………………86

3.3 Determination of Sample Size………………………………………………………….86

3.4 Collection of Food Samples………………………………………………….…….…....87

3.5 Enrichment and Serial Dilution…………………………………………..………....…87

3.6 Isolation of Test Organisms………………………………………………………....…87

3.7 Characterization of the Isolates……………………………………………………..…88

9
3.7.1 Carbohydrate utilization test………………………………………………………..……88

3.7.2 Sulphur Indole Motility (SIM) Test…………………………………………………..….88

3.7.3 Citrate Utilization Test……………………………………………………..…………….89

3.7.4 Methyl Red (MR) Test…………………………………………………….…………….90

3.7.5 Voges Proskauer (VP) Test………………………………………………………………90

3.7.6 Identification of the Isolates……………………………………………………………...91

3.8 Collection of Plant Materials…………………………………………………………..91

3.9 Pretreatment of plant parts…………….………….………………………………..……91

3.10 Preparation of Plant Extracts……………………………………………………...…..91

3.10.1 Extraction using the Soxhlet method……………………………………………….……91

3.10.2 Extraction by maceration using separating funnels………………………….....………96

3.11 Phytochemical Screening………………………………………………….….………93

3.11.1 Detection of Carbohydrates…………………………………………………….………. 93

3.11.2 Detection of Glycosides……………………………………………………………..…..93

3.11.3 Detection of Saponins (Frothing test)……………………………………………..…….94

3.11.4 Detection of Flavonoids (Sodium hydroxide test)………………………………………94

3.11.5 Detection of Tannins (Ferric chloride test)……………………………………………...95

3.11.6 Detection of Alkaloids……………………………………………………………..……95

3.11.7 Detection of Resins……………………………………….…………………………......95

3.11.8 Detection of Anthraquinone derivatives…………………………………………….…..95

3.11.9 Detection of Steroids and Triterpenes………………………………………………......96

3.12 Preparation of Different Concentrations for the Antibacterial Activity………..….97

10
3.13 Screening of Plant Extracts for Antibacterial Activity…………………………..…..97

3.14 Determination of Beta Lactamase Production using Nitrocefin Sticks……………..98

3.15 Antibiotic Susceptibility Testing………………………………………….….…….…98

3.15.1 Detection of ESBLs producing bacteria………………………..………………………99

3.16 Identification of Multidrug Resistant Strains………………………………….……100

3.17 Calculation of Multiple Antibiotic Resistance (MAR) Index…………………...…100

3.18 Genotypic detection of β-lactamase genes……………………...………………..….100

3.18.1 Plasmid DNA extraction………..…………………………………………………..…100

3.18.2 Primer design…..……………………………………………………………...….……101

3.18.3 PCR amplification of β-lactamase gene………………..…………………………....….102

3.18.4 Agarose gel electrophoresis………………………………………………..…………..102

3.18.5 Purification of PCR products…………….……………...……………………......…….103

3.18.6 Plasmid DNA sequencing……………..…………………………….………………….104

3.19 Statistical Analysis…………………………………………………………………….105

4.0 RESULTS……………………………………………………………………………..107

5.0 DISCUSSION………………………………………………………………………….146

6.0 SUMMARY, CONCLUSION AND RECOMMENDATIONS……………...…......155

6.1 Summary………………………………………………………………………………155

11
6.2 Conclusion………………………………………………………………………….…156

6.3 Recommendations………………………………………………………………….…157

6.4 Challenges………………………………………………………………… …………158

REFERENCES……………………………………………………………………….………..159

APPENDICES……………………………………………………………..…………………..175

12
 LIST OF FIGURES

Figure Page

2.1 Chemical structure of Catechol …………………..……………………………………..14

2.2 Chemical structure of Pyrogallol………………………………………………………..15

2.3 Chemical structure of Eugenol…………………………………………………………...16

2.4 Chemical structures of Quinones………………………………………………………...16

2.5 Chemical structures of Flavonoids…………………….…………………………………18

2.6 Chemical structure of Catechin…………………………………………………………..19

2.7 General structure of Tannins……………………………………………...……………...21

2.8 Chemical structure of Menthol…………………………..………………………………23

2.9 Chemical structure of Caffeine………………………………………………………..…24

2.10 Chemical structure of Morphine……………………………………………………...….25

2.11 Chemical Structure of Berberine………………………...………………………………26

2.12 Chemical structures of Penicillins and Cephalosporins ………………………….……52

2.13 Chemical structure of Aztreonam…………………………………………………...…...56

2.14 Carbapenem: Structure…………………………………………………………………..57

2.15 Agar plate of disk diffusion test showing different sizes of zones of inhibition………...60

2.16 A broth micro dilution susceptibility panel and disposable tray inoculators…………….62

2.17 The E-test gradient diffusion method…………………………………….…………...…64

2:18 Overview of classification and types of β-lactamases……………………………….…76

2: 19 Bacterial genomic and plasmid DNA………………………………………………......84

4.1 Distribution of Klebsiella spp. isolated from food samples…………………………....108

4.2 Broad spectrum resistance in E. coli isolated from smoked fish……………………….119

13
4.3 Percentage ESBLs producing E.coli from smoked fish………………………….……..119

4.4 Multiple antibiotic resistance indices of E. coli isolated from smoked fish ………..….120

4.5 Broad spectrum resistance in E. coli and Klebsiella spp. isolated from
suya………..…………………………………………………………………………………....125

4.6 ESBLs production among E. coli and Klebsiella spp. isolated from 'suya'…………….125

4.7 MAR indices of E.coli and Klebsiella spp. isolated from suya ………..…………. ..126

4.8 Broad spectrum resistance in E. coli and Klebsiella spp. isolated from 'zoborodo'
drink…………………………………………………………………………………………….131

4.9 ESBLs producing E. coli and Klebsiella spp. isolated from 'zoborodo' drink………....131

4.10 MAR indices of E.coli and Klebsiella spp. isolated from 'zoborodo' drink ……..….…132

4.11 Distribution of TEM and SHV genes in the tested organisms………………………….142

14
 LIST OF TABLES

Table Page

2.1 Groups and examples of β-lactam antimicrobial agents…………………………………55

2.2 Classification of beta-lactamases………………………………………………….…….73

3.1 Oligonucleotide primers used for detection of β-lactamase genes…………………….101

4.1 Distribution of bacterial isolates from food samples……………...………………….108

4.2 Phytochemical constituents of the Leaf, Root and Stem - bark of Carica papaya
extracts………………………………………………………………………………………….110

4.3 Zone diameters of inhibition (mm) of plant extracts against isolates from smoked
fish….………………………………………………………………………………………...…112
4.4 Zone diameters of inhibition (mm) of plant extracts against isolates from processed meat
‗suya‘…………………………………………………………………………………………....113

4.5 Zone diameters of inhibitions (mm) of plant extracts against isolates from ‗zoborodo‘
drink…………………………………………………………………………………………….114

4.6 Antibiotic sensitivity of E.coli isolated from smoked fish………………………….…116

4.7 Resistance pattern of E. coli isolated from smoked fish……………………………..…118

4.8 Antibiotic resistance of E.coli and Klebsiella spp. isolated from processed meat
‗suya‘……………………………………………………………………………………..……..122

4.9 Resistance pattern of E. coli and Klebsiella spp. isolated from ‗suya‘………...………124

4.10 Antibiotic resistance of E.coli and Klebsiella spp. isolated from ‗zoborodo‘……….....128

4.11 Resistance pattern of E. coli and Klebsiella spp. isolated from ‗zoborodo‘ drink….….130

4.12 Analysis of the pooled number (%) of antibiotic resistance of all the bacteria isolated
from the food samples………………………………………………………………………..…134

4.13 Sensitivity of nitrocefin sticks using disc diffusion test (DDT) as the gold
standard……………………………………………………………..…………………………..136

4.14 Antibiotic resistance profiles of the isolates used for molecular studies…………...…..141

15
4.15 Sequence analysis of TEM gene………………………………………………………..144

16
 LIST OF PLATES

Plate Page

I Gel electrophoresis of TEM amplicons……………………………………….…….….….138

II Gel electrophoresis of SHV amplicon…………………………………………….…….…139

III Carica papaya tree…………………………………………………………….…………..186

IV Microgen Identification kit…………………………………………………….…..….....186

V Soxhlet extraction ………………………………………………………………….…..….186

VI Maceration with separating funnels ………………………………………………….…...186

V II Susceptibility to plant extracts………………………………………………….…….…187

VIII Nitrocefin containing β-lactamase identification sticks…………………………...…..…187

IX Antibiotic susceptibility test……………………………………………….…….….….....187

17
 LIST OF APPENDICES

Appendix Page

I Microgen GN A substrate reference table…………………………………………..…175

II Microgen GN A Identification Results………………………………………………....176

III Zone Diameter Interpretative Standard Breakpoints (for Enterobacteriaceae)….........179

IV Screening and Confirmatory Tests for ESBLs in Klebsiella pneumoniae, K. Oxytoca,

Escherichia coli…………………………………………………………………..…….180

V Media Formulation……………………………………………………………………..181

VI Composition of Reagents……………………………………………………..…….….185

VII List of Plates……………………………………………………………………………186

VIII Statistical Analysis……………………………………………………………………...186

18
 ABBREVIATIONS

Acronyms Meanings

AGP Antimicrobial growth promoters

AmpC Class C β-lactamase

bla Beta-lactamase

CMY Cephamycin resistance

CTX-M Cefotaximase

DNA Deoxyribonucleic acid

ESBLs Extended spectrum -lactamases

FOX Cefoxitin resistance

GES Gulana extended-spectrum β-lactamase

IMP Imipenemase

KPC Klebsiella pneumonia carbapenemase

MDR Multidrug resistance

MOX Moxalactam resistance

NAFDAC National Agency for Food and Drug Administration Control

NDDIC National Digestive Diseases Information Clearinghouse

NDM New Delhi metallo-β-lactamase

OXA Oxacillinase

PABA Para-aminobenzoic acid

19
PBP Penicillin binding protein

SHV Sulphydryl variable

TEM Temoniera

VEB Vetnam extended spectrum -lactamases

VIM Verona integron-encoded-metallo- β-lactamase

WHO World Health Organization

20
 ABSTRACT

Some samples of ready-to-eat foods and drinks (‘zoborodo’, ‘kunun zaki’, smoked fish and
‘suya’) sold within the environs of Ahmadu Bello University, Zaria, Nigeria were assessed for
the presence of antibiotic resistant E. coli and Klebsiella spp. The bacteria isolated were
characterized using Microgen Gram negative identification kit and tested for their susceptibility
to prepared concentrations of methanolic extracts of the leaves, stem-bark and root of Carica
papaya using impregnated paper discs. Phytochemical screening revealed presence of more
active constituents in the leaf extract than in the extracts of the root and stem-bark. All the
organisms were found to be resistant to the Carica papaya methanolic extracts. Determination of
β-lactamase production using nitrocefin-containing beta-lactamase identification sticks was
carried out to test sensitivity of the rapid test. The test was found to produce false negatives and
so had 12.9% sensitivity but 100% specificity when compared with disc diffusion test.
Antibiogram of the test organisms to nine antibiotics showed 75% broad spectrum resistance
(i.e. resistance to ampicillin or cephalothin), 35% ESBLs production (i.e. resistance to
cefpodoxime or cefotaxime). Student t-test shows higher significant difference between the
numbers of E. coli and Klebsiella spp. Resistant to the antibiotic tested in the study. Pearson’s
correlation showed significant association between ESBLs production and multidrug resistance
in the entire sample populations. A high percentage of the bacteria had Multiple Antibiotic
Resistance (MAR) index greater than 0.2 which shows that the isolates were obtained from high
risk environment. Duncan multiple range test (DMRT) showed that the mean of antibiotic
resistance from isolates obtained from ‘suya’ was significantly higher than those obtained from
‘zoborodo’ or smoked fish. For the molecular studies, TEM and SHV β-lactamase genes were
assayed for among 12 isolates. TEM had a frequency of 66.7% while SHV had 8.3%. No isolate
was found to harbour both TEM and SHV genes together. Sequence analysis results showed that
the blaTEM in Sye10 (isolate 8) had 86% homology with β-lactamase TEM-1gene. The entire
blaTEM genes were not sequenced, so it cannot be stated categorically that the entire TEM genes
present were TEM-1. Sequence analysis of blaSHV in Syk2 (isolate 10) could not confirm the
subtype. The reason for this is not yet known but must be because the primers only amplified a
portion of the blaSHV open reading frame and not the entire portion. Sperman’s correlation
showed moderate correlation between the presence of any of the two genes and resistance to
third generation cephalosporins. Therefore, there is no significant correlation (rs = 0.258)
between the presence of any of the two genes and resistance to third generation cephalosporins
(p>0.05).

21
 CHAPTER 1

INTRODUCTION

1.1 General Background

Medicinal plants, since time immemorial have been used in virtually all cultures as sources of

medicine. The widespread use of herbal remedies and healthcare preparations, obtained from

commonly used traditional herbs and medicinal plants has been traced to the occurrence of

natural products with medicinal properties (Hoareau and DaSilva, 1999). Herbal medicine, in

several developing countries, using local traditions and beliefs, is still mainstay of healthcare. As

defined by World Health Organization (WHO), health is a state of complete physical, mental and

social well being and most merely the absence of disease or infirmity (Hoareau 90rely chiefly on

traditional medicines for their primary health care needs (Weignenand et al., 2004; Murugesan et

al., 2011; Velanganni et al., 2011). Some plant products have been historically used as

therapeutics in folk medicine to treat diseases caused by pathogens (Sanchez et al., 2010).

Medicinal plants would be the best source to obtain a variety of drugs and therefore such plants

should be investigated to understand better about their properties, safety and efficacy. They are

the major sources of obtaining antimicrobial drugs (Velanganni et al., 2011). Bioactive

compounds from a variety of natural sources have been used for the treatment of a number of

human diseases. Selection of plant species to be studied could be based on ethno-medicinal

information, chemotaxonomic relationship and the use of the plants in traditional medicine

(Salihu and Garba, 2008).

22
Africa is a rich source of medicinal plants yet not without its problems. One of the major

problems associated with the use of traditional medical remedies is the lack of standardization of

dosage. Hence, the call of its formulation into modern and appropriate dosage forms to remedy

this problem. This will guarantee the quality, safety and efficacy of the medicament (Olowosulu

and Ishaku, 2005). In Nigeria, a large proportion of the people depend on traditional medicine for

drug therapy. Over 60% of the rural dwellers depend on traditional medicine for the treatment of

their ailments. It is therefore pertinent to study Nigerian plants due to fear of their extinction

through bush burning, tree felling and agricultural requirement (Ayandele and Adebiyi, 2007;

Salihu and Garba, 2008). Several reports have been published on the scientifically confirmed

antimicrobial activity of some natural products derived from plants (Savoia et al., 2004). A large

number of plant species still need to be analyzed for their antimicrobial activity against diverse

bacteria, it is therefore critical to develop simple systems for rapid antimicrobial screening

(Sanchez et al., 2010). Despite the increasing use of medicinal plants, their future, seemingly, is

being threatened by complacency concerning their conservation. They are continuously under the

threat of extinction as a result of growth exploitation, environment-unfriendly, harvest

techniques, loss of growth habitats and unmonitored trade of medicinal plants (Hoareau and

DaSilva, 1999).

The pawpaw tree (Carica papaya) is a small tree, native to tropical America, but cultivated in

tropical areas throughout the world. It has a non-woody and hollow trunk, which produces large,

deeply lobed leaves, which are eaten as vegetable in some geographical areas but more

importantly, as antipyretic, for diuresis, antisyphilitic, abortifacient and antidiabetes. It is also

used to promote healing, as an antidote for venoms and rabies. Studies on its leaf extracts have

23
been found to exhibit antimicrobial action against disease-causing microbes such as Salmonella

typhimurium and opportunistic organisms such as Escherichia coli (Ojekale et al., 2006).

Food has a long association with the transmission of disease. Despite our increased knowledge,

food borne disease is perhaps the most widespread health problem in the contemporary world

and an important cause of reduced economic productivity. The various ways in which foods can

transmit illness clearly indicates that biological contaminants are the major cause (Adams and

Moss, 1999). When pathogens are discharged in faeces and urine, the hands of infected persons

may become contaminated by the materials which are easily transferred to foods. These, when

ingested find their way into the alimentary canal. Diseases such as typhoid and paratyphoid,

bacillary dysentery, food poisoning, are transmitted through the ingestion of contaminated food

or water (Okuofu, 2002).

Antimicrobial agents are one of the most useful groups of therapeutic agents available today. In

fact, they constitute the only group of therapeutic agent which has had a measurable effect on

overall mortality rate in the population. Unfortunately, the emergence of resistance against many

agents in almost all human pathogens is now widespread and a cause of great concern for future

therapeutic effectiveness (Berg et al., 2004). Recent studies have demonstrated that antibiotic

resistant bacteria occur in the community. In the past, these organisms were confined to

nosocomial (hospital) settings, but in recent years, community associated antibiotic resistant

bacteria are being identified in different parts of the world (Olonitola et al., 2006). Antimicrobial

drug failure may occur for many reasons, e.g., reduced adherence to drug therapy, suboptimal

dosing, diagnostic and laboratory error, ineffective infection control, counterfeit or altered drugs,

24
and resistance (innate or acquired). Although much attention is focused on the resistance patterns

of eubacteria, resistance is being found for virtually all microbial agents including mycobacteria,

viruses, parasites and fungi (MacPherson et al., 2009). The use, over-use, and misuse of

antibiotics has led to an alarming increase in the frequency of human pathogens that do not

respond to antibiotic therapy, underscoring the need for new antibiotics and a better

understanding of the origins of antibiotic resistance (Donato et al., 2010). In the developing

countries, individuals may purchase antibiotics in pharmacies, stores and even marked stalls

without laboratory susceptibility studies, without being dispensed by pharmacists and without a

prescription. Thus, there is a widespread and uncontrolled use of antibiotics and patients often do

not take a full course of treatment particularly if they are unable to afford it, coupled with the

poor qualities and potencies of many drugs locally manufactured (Olonitola et al., 2006).

The -lactam antibiotics are a family of antimicrobial agents consisting of four major groups: the

penicillins, cephalosporins, carbapenems and monobactams; in each case the molecules include a

four-membered nitrogen-containing ring, the -lactam ring. -lactam antibiotics act by

disrupting synthesis of the cell envelope in growing cells. In many of these antibiotics the -

lactam ring is susceptible to cleavage by certain bacterial enzymes ( -lactamases); such cleavage

destroys the antibiotic and organisms which produce the enzymes generally show at least some

degree of resistance to particular -lactam antibiotics(s) (Singleton, 1997; Samaha-Kfoury and

Araj, 2003). In recent years, the problem of gradually increasing resistance to antibiotics has

threathened the entire world. Production of -lactamases, which hydrolyses and inactivates -

lactam antibiotics, has been one of the resistance mechanisms of bacterial species, mainly in the

25
family Enterobacteriaceae (Bali et al., 2010). Many of the second and third generation

penicillins and cephalosporins were specifically designed to resist the hydrolytic action of major

β-lactamases. However, new β-lactamases emerged against each of the new classes of β-lactams

that were introduced and caused resistance. The latest in the arsenal of these enzymes has been

the evolution of extended spectrum -lactamases (ESBLs). These enzymes are commonly

produced by many members of Enterobacteriaceae, especially E. coli and Klebsiella pnemoniae

and efficiently hydrolyze oxyimino-cephalosporins conferring resistance to third generation

cephalosporins such as cefotaxime, ceftazidime, ceftriaxone and to monobactams such as

aztreonam (Kumar et al., 2006).

Human activity strongly affects acquired resistance. Emergence of drug resistance in

environments that enable sharing of drug-resistance genes between organisms has been

documented. Human activities that contribute to ecological niche pressures, such as

antimicrobial drug use and manufacturing or biological waste disposal into the environment can

support the development of resistance (MacPherson et al., 2009). Microbial identification and

typing systems, antibiograms and new technologies for identifying genetic clones and

‗fingerprints‘ of microbes are better at defining the origin and patterns of spread of multidrug

resistant (MDR) organisms. Local monitoring of susceptibility patterns combined with

knowledge of emerging drug resistance, regionally or internationally, is already recognized as a

component of some resistant infections. Growing population mobility makes local monitoring an

increasing important component of routine surveillance for antimicrobial resistance (MacPherson

et al., 2009).

26
1.2 Statement of Research Problem

The development of drug resistance in human pathogens against commonly used antibiotics has

necessitated a search for new antimicrobial substances from other sources including plants

(Balaraju et al., 2008a). The prevalence of extended spectrum -lactamases (ESBLs) among

members of Enterobacteriaceae constitutes a serious threat to current -lactam therapy leading

to treatment failure and consequent escalation of cost of treatment (Kumar et al., 2006). ESBLs

can be difficult to detect because of inoculum effects and substrate specificity, hence their

detection is a major challenge, organisms possessing genes for inducible -lactamases show false

susceptibility if tested in the un-induced state (Chaudhary and Aggrawai, 2004).

1.3 Justification for the Study

Multidrug resistance by various bacteria against the most commonly prescribed antibiotics is a

cause for concern among medical practitioners, pharmaceutical industries, research institutions

and the general populace (Mbuh et al., 2008).

Also, most patients from the tropics and particularly from Africa are from low socioeconomic

groups who can ill-afford imported and expensive medicines, hence the need for renewable,

affordable and readily available local alternatives cannot be overemphasized (Okeniyi et al.,

2007). This has resulted in many people, both in urban and rural areas, seeking for succor in

plants in search for cure of their infections (Mbuh et al., 2008).

More has been focused on hospitals as the primary reservoir and place of transmission of many

antimicrobial-resistant organisms, there is need to shift interest to the role of non-hospital

community, such as foods as a significant reservoir of resistant pathogens (Hunter et al., 2008).

27
Updated knowledge of the prevailing causative bacteria and their susceptibility patterns are

important for the proper selection and use of antimicrobial drugs and for the development of an

appropriate prescribing policy (Ahmed et al., 2000).

Extended-spectrum -lactamases (ESBLs) had been the largest source of resistance to broad

spectrum oxyimino-cephalosporins among the Enterobacteriaceae (Olonitola et al., 2007).

Some ESBLs may fail to reach a level to be detectable by disk diffusion tests but result in

treatment failure in the infected patient (Cornejo-Juarez et al., 2012).

Plasmid-encoded -lactamase genes are therefore characterized using molecular techniques such

as polymerase chain reaction (PCR) with primer sets specific for -lactamase and DNA

sequencing and because of the implications for treating such infections, particularly in

developing countries, the spread of ESBL producing Enterobacteriaceae merits close

surveillance (Frank et al., 2006).

Therefore, there is a need to use molecular detection methods that will enable the identification

and monitoring of the emergence of ESBL types (Xu et al., 2005).

1.4 Aim of Study

The aim of this study is to determine the antibiotic resistance pattern of Escherichia coli and

Klebsiella species that are resistant to methanolic extracts of Carica papaya and characterize

some of the plasmids responsible for the drug resistance.

1.5 Specific Objectives

28
 1. To isolate and characterize Escherichia coli and Klebsiella sp. from some ‗ready- to- eat‘

food items sold in A.B.U. Zaria main campus and its environs.

2. To prepare the leaf, stem-bark and root extracts of Carica papaya and determine the

phytochemical properties of the extracts.

3. To determine the antibacterial properties of the extracts against the isolates.

4. To determine antibiotic susceptibility pattern of the isolates as well as confirm ESBL

production from isolates identified as potential β-lactamase producers.

5. To isolate plasmid DNA of the isolates and amplify the β-lactamase genes (TEM and

SHV) from the plasmid DNAs by polymerase chain reaction using specific primers.

6. To characterize the β-lactamase genes by agarose gel electrophoresis and validate the

amplified genes by DNA sequencing.

1.6 Research Questions

This work tends to answer the following questions:

i. Will Carica papaya extracts be effective against the isolates?

ii. Will E. coli and Klebsiella spp. isolated from ‗ready-to-eat‘ food items be found to produce -

lactamase enzymes?

iii. Will ESBL production be detected among the resistant isolates?

iv. Is the resistance mediated by the possession of plasmids in these isolates?

29
 CHAPTER 2

LITERATURE REVIEW

2.1 Medicinal Plants

Over the years, plants have provided human beings with a source of essentials of life such as

food, medicine and raw materials for clothing and shelters (Akiniyi and Efiom, 2005). The use of

medicinal plants all over the world predates the introduction of antibiotics and other modern

drugs into Africa (Akinyemi et al., 2005). They are used locally in the treatment of infections

caused by fungi, bacteria, viruses and other parasites (Ayandele and Adebiyi, 2007). Currently,

plant products are considered to be important alternative sources of new antimicrobial drugs

against antibiotic-resistant microorganisms (Sanchez et al., 2010). According to Kuete et al.

(2011), infectious diseases are the first cause of death worldwide with more than 50% of the

death appearing in tropical countries. In the developing countries, treatment of such diseases is

complicated not only because of the occurrence of resistant microorganisms to the commonly

30
used antibiotics, but also because of the low income of the population, which drastically reduce

their accessibilities to appropriate drugs. It is reported that about 80% of the world population is

dependent (wholly or partially) on plant-based drugs. Scientific experiments on the antimicrobial

properties of plant components were first documented in the late 19th century. Naturally

occurring antimicrobials can be derived from plants, animal tissues, or microorganisms. The

short comings of the drugs available today propel the discovery of new pharmacotherapeutic

agents in herbal medicine (Kuete et al., 2011).

Industrial interest in exploiting plants for medicinal purpose is exclusively found in China and

Japan. Some African countries have also made advances in the area of the use of plants for the

production of new drugs (Olukemi and Kandakai-Olukemi, 2004). The industrial uses of

medicinal plants are many; these range from traditional medicines, herbal teas and health foods

such as nutriceuticals to galenicals, phytopharmaceuticals and industrially produced

pharmaceuticals. Furthermore, they constitute a source of valuable foreign exchange for most

developing countries, as they are a ready source of drugs such as quinine and reserpine. The

world market for plant-derived chemicals, pharmaceuticals, fragrances, flavours and colour

ingredients alone exceeds several billion dollars per year (Hoareau and DaSilva, 1999).

In the last few decades, medicinal plants have been the subject for every intense pharmacological

study. This has been brought about by the acknowledgement of their value as potential sources of

new compounds of therapeutic value and as sources of lead compounds in drug development

(Balaraju et al., 2008a). There is already increased shifting of interest from the use of synthetic

31
drug to the use of plant-derived drugs. It is believed that many of these phytomedicines have

fewer side effects compared with their synthetic alternatives (Olowosulu and Ishaku, 2005). The

increasing resistance to most synthetically derived antimicrobial agents is of utmost concern.

Microbial infections pose a health problem throughout the world with the alarming increase in

the rates of infection by antibiotic resistance in human pathogens against commonly used

antibiotics. This has necessitated a search for new antimicrobial substances from other sources

including plants (Balaraju et al., 2008b). Currently, plant products are considered to be important

alternative sources of new antimicrobial drugs against antibiotic-resistant microorganisms

(Sanchez et al., 2010).

Medicinal plants represent a rich source from which antimicrobial agents may be obtained.

Plants are used medicinally in different countries and have been found to be sources of many

potent and powerful drugs (Chaudhary and Khanam, 2008). Among the diseases that have been

successfully managed traditionally include malaria, epilepsy, infantile convulsion, diarrhea

dysentery, gonorrhea, flatulence, tonsillitis, sterility, asthma, scabies, eye aches, mental illness,

worm infections, and several other bacterial and fungal infections. Curative uses of these plants

include the administration of the roots, barks, stems, leaves, and seeds to the use of extract from

a whole plant (Ogbulie et al., 2004; Oyewale et al., 2006).

Medicinal plants constitute an effective source of both traditional and modern medicines. Herbal

medicine has been shown to have genuine utility and about 80% of rural population depends on

it as primary health care. Over the years, the World Health Organization (WHO) advocated that

32
countries should interact with traditional medicine with a view to identifying and exploiting

aspects that provide safe and effective remedies for ailments of both microbial and non-microbial

origins (Akinyemi et al., 2005). Evaluation of plant products for pharmacological and medicinal

effects is of interest as they contain many bioactive substances which have therapeutic potential

and because phytotherapy is cheap and locally available (Balaraju et al., 2008b).

In Nigeria today, the prevalence of infectious diseases and the fact that the average citizen cannot

afford the cost of modern chemotherapy makes the assay of plants important and more so herbal

medicine can be found in the remotest parts of the country where medical doctors are absent

(Olukemi and Kandakai-Olukemi, 2004; Oyewale et al., 2006). The World Health Organization

has recommended the evaluation of the effectiveness of plants in conditions where we lack safe

modern drugs (Balaraju et al., 2008b). Therefore, the integration of traditional and modern

medicine is now to be regarded as supplemental to each other as opposed to being competitive

(Satheesh and Pari, 2003).

According to Hoareau and DaSilva (1999), scientific validation of the antimicrobial properties of

plants has been extensively reported. In the pharmaceutical industry, medicinal plants are an

integral component of research development. Such researcher focuses on the isolation and direct

use of active medicinal constituents, or on the development of semi- synthetic drugs, or still

again on the active screenings of natural products to yield synthetic pharmacologically-active

compounds. (Hoareau and DaSilva, 1999). However, little information is available about the

mechanisms of action of antimicrobial compounds in bacteria. Several proposed mechanisms

33
include membrane damage, changes in intracellular pH, membrane potential, and ATP synthesis

(Sanchez et al., 2010).

In Germany, over 1,500 plant species encountered in some 200 families and 800 genera have

been processed into medicinal products. In South Africa likewise, some 500 species are

commercialized trade products. Today, Bulgaria, Germany and Poland are recognized as major

exporters of plant-based medicinal products (Hoareau and DaSilva, 1999). The development and

commercialization of medicinal plants based bioindustries in the developing countries is

dependent upon the availability of facilities and information concerning upstream and

downstream bioprocessing, extraction, purification and marketing of the industrial potential of

medicinal plants. Absence of such infrastructure compounded by lack of governmental interest

and financial support restricts the evolution of traditional herbal extracts into authenticated

market products. Furthermore, the absence of modernized socio-economic and public health care

systems reinforces reliance of rural and lower-income urban populations on the use of traditional

medicinal herbs and plants as complementary aid to routine pharmaceutical market products

(Hoareau and DaSilva, 1999).

2.1.1 Major groups of bioactive components in medicinal plants

Plants have an almost limitless ability to synthesize aromatic substances, most of which are

phenols or their oxygen-substituted derivatives (Cowan, 1999). Phenols and phenol derivatives

called phenolics disrupt cell membranes, denature proteins and inactivate enzymes. They are

used to disinfect surfaces and to destroy discarded cultures because their action is not impaired

by organic materials. Amphyl, which contains amylphenol, destroys vegetative forms of bacteria

34
and fungi, and inactivates viruses. It can be used on skin, medical instruments, dishes and

furniture. When used on surfaces, it retains its antimicrobial action for several days (Black,

2005). Phenols are compounds possessing one or more aromatic rings with one or more hydroxyl

groups. They are broadly distributed in the plant kingdom and are the most abundant secondary

metabolites of plants, with more than 8,000 phenolic structures currently known, ranging from

simple molecules such as phenolic acids to highly polymerized substances such as tannins. It is

known that phenolics are the most important compounds affecting flavour and colour difference

among white, pink and red wines; they react with oxygen and are critical to the preservation,

maturation and aging of the wine (Dai and Mumper, 2010).

The active principles of many drugs found in plants are secondary metabolites (Chaudhary and

Khanam, 2008). About 12,000 secondary metabolites from plants have been isolated, a number

estimated to be less than 10% of the total secondary metabolites found in plants. In many cases,

these substances serve as plant defense mechanism against predation by microorganisms, insects,

and herbivores (Salihu and Garba, 2008). Some, such as terpenoids, give plants their odors;

others (quinines and tannins) are responsible for plant pigment. Many compounds are

responsible for plant flavor (e.g., the terpenoid capsaicin from Chili peppers), and some of the

same herbs and spices used by humans to season food yield useful medicinal compounds

(Cowan, 1999).

2.1.1.1 Simple phenols and phenolic acids

Some of the simplest bioactive photochemical consist of a single substituted phenolic ring.

Cinnamic and caffeic acids are common representatives of a wide group of phenylpropane-

35
derived compounds which are in the highest oxidation state (Cowan, 1999). The common herbs

tarragon and thyme both contain caffeic acid, which is effective against viruses, bacteria and

fungi (Cowan, 1999).

Fig. 2.1 Chemical structure of catechol (Helmenstine, 2013)

Catechol and pyrogallol both are hydroxylated phenols, shown to be toxic to microorganisms.

Catechol has two-OH groups, and pyrogallol has three. The site(s) and number of hydroxyl

groups on the phenol group are thought to be related to their relative toxicity to microorganisms,

with evidence that increased hydroxylation results in increased toxicity. In addition, some

authors have found that more highly oxidized phenols are more inhibitory.

36
Fig. 2.2 Chemical structure of pyrogallol (Hardie et al., 2007)

The mechanisms thought to be responsible for phenol toxicity to microorganisms include

enzyme inhibition by the oxidized compounds, possibly through reaction with sulfhydryl groups

or through more non-specific interactions with proteins (Cowan, 1999). Phenolic compounds

possessing a C3 side chain at a lower level of oxidation and containing no oxygen are classified

as essential oils and often cited as antimicrobial as well. Eugenol is a well characterized

representative found in clove oil. Eugenol is considered bacteriostatic against both fungi and

bacteria (Cowan, 1999).

37
Fig. 2.3 Chemical structure of Eugenol (Helmenstine, 2013)

2.1.1.2 Quinones

Quinones are aromatic rings with two ketone substitutions. They are ubiquitous in nature and are

characteristically highly reactive (Cowan, 1999). These compounds, being colored, are

responsible for the browning reaction in cut or injured fruits and vegetables and are an

intermediate in the melanin synthesis pathway in human skin. Their presence in henna gives that

material its dyeing properties. The switch between diphenol (or hydroquinone) and diketone (or

quinone) occurs easily through oxidation and reduction reaction. Vitamin K is a complex

naptithoquinone. Its antihemorrhagic activity may be related to its ease of oxidation in body

tissues (Cowan, 1999).

Fig. 2.4 Structures of quinones (Khullar, 2010)

According to Cowan (1999), in addition to providing a source of stable free radicals, quinones

are known to complex irreversibly with nucleophilic amino acids in protein often leading to

inactivation of the protein and loss of function. For that reason, the potential range of quinone

38
antimicrobial effect is great. Probable targets in the microbial cell are surface-exposed adhesions,

cell wall polypeptides, and membrane bound enzymes. Quinones may also render substrates

unavailable to the microorganism. However, as with all plant-derived antimicrobials, the possible

toxic effects of quinones need to be thoroughly examined (Cowan, 1999). Anthraquinone from

Cassia italica, a Pakistani tree has been described to be bacteriostatic for Bacillus anthracis,

Corynebacterium pseudodiphthericum and Pseudomonas aeruginosa and bactericidal for

Pseudomonas pseudomalliae. Hypercin, another anthraquinone from St. John‘s wort (Hypericum

perforatum), has received much attention that it had general antimicrobial properties (Cowan,

1999).

2.1.1.3 Flavonoids

Flavonoids are the most abundant polyphenols in our diets. The basic flavonoid structure is the

flavan nucleus, containing 15 carbon atoms arranged in three rings (C6-C3-C6), which are

labelled as A, B and C. Flavonoids are themselves divided into six subgroups: flavones,

flavonols, flavanols, flavanones, isoflavones, and anthocyanins, according to the oxidation state

of the central C ring. Their structural variation in each subgroup is partly due to the degree and

pattern of hydroxylation,

methoxylation, prenylation, or

glycosylation (Dai and Mumper,

2010).

39
Fig. 2.5 Chemical structures of flavonoids (Ghasemzadeh and Ghasemzadeh, 2011)

Flavones are phenolic structures containing one carbonyl group (as opposed to the two carbonyls

in quinones). From the report of Cowan (1999), the addition of a 3-hydroxyl group yields a

flavonol. Flavonoids are also hydroxylated phenolic substances but occur as a C 6 –C3 unit linked

to an aromatic ring. Since they are known to be synthesized by plants in response to microbial

infection, it should not be surprising that they have been found in vitro to be effective

antimicrobial substances against a wide array of microorganisms. Their activity is probably due

to their ability to complex with bacterial cell walls, as described for quinones. More lipophilic

flavonoids may also disrupt microbial membranes (Cowan, 1999). Catechin, the most reduced

form of the C3 unit in Flavonoid compounds, deserve special mention. These flavonoids have

been extensively researched due to their occurrence in oolong green teas. It was observed some

time ago that these teas exerted antimicrobial activity and that they contain a mixture of catechin

compounds. These compounds inhibited Vibrio cholerae 01 in vitro, Streptococcus mutans,

Shigella and other bacteria and microorganisms (Cowan, 1999).

40
Fig. 2.6 Chemical structure of catechin (Maoela et al., 2009)

The catechins inactivated cholera toxin in Vibrio and inhibited isolated bacterial

glucosyltransferases in Streptococcus mutans, possibly due to complexing activities described

for quinones. This latter activity was borne out in in vivo tests of conventional rats. When the rats

were fed on a diet containing 0.1% tea catechins, fissure caries (caused by Streptococcus mutans)

was reduced by 40% (Cowan, 1999). According to Khullah (2010), flavonoid compounds

exhibit inhibitory effects against multiple viruses. Numerous studies have documented the

effectiveness of flavonoids such as swertifrancheside, glycyrrhizin (from licorice), and chrysin

against HIV (Khullah, 2010). More than one study has found that flavone derivatives are

inhibitory to respiratory syncytial virus (RSV). The average western daily diet contain

approximately one gram of mixed flavonoids; pharmacologically active concentrations are not

likely to be harmful to human host (Cowan, 1999). An isoflavone, found in a West Africa

legume, alpinumisoflavone, prevents schistosomal infection when applied topically (Cowan,

1999). Phloretin, found in certain serovars of apples, may have activity against a variety of

microorganisms. Galangin (3,5,7-trihydroxyflavone), derived from the perennial herb

Helichrysum aureonitens, seems to be a particularly useful compound, since it has shown

41
activity against a wide range of gram-positive bacteria as well as fungi and viruses, in particular

HSV-1 and coxsackie B virus type 1 (Cowan, 1999).

Delineation of the possible mechanism of action of flavones and flavonoids is hampered by

conflicting findings. Sharafati-Chaleshtori et al. (2010) reported that flavonoids lacking hydroxyl

groups on their β-rings are more active against microorganisms than are those with the – OH

groups; this finding supports the idea that their microbial target is the membrane (Sharafati-

Chaleshtori et al., 2010). Lipophilic compounds would be more disruptive of this structure.

However, several authors have also found the opposite effect; i.e. the more the hydroxylation, the

greater the antimicrobial activity. This latter finding reflects the similar result for simple

phenolics. It is safe to say that there is no clear predictability for the degree of hydroxylation and

toxicity of microorganisms (Cowan, 1999).

2.1.1.4 Tannins

Tannins are another major group of polyphenols in our diets and usually subdivided into two

groups: Hydrolysable tannins and condensed tannins (Dai and Mumper, 2010). Tannins consist

mainly of gallic acid residues that are linked to glucose via glycosidic bonds (Legesse and Emire,

2012). Tannin is a general descriptive name for a group of polymeric phenolic substance capable

of tanning leather or precipitating gelation from solution, a property known as astringency. Their

molecular weights range from 500 to 3,000 unit and are found in almost every plant part: bark,

wood, leaves, fruits and roots (Samy and Gopalakrishnakone, 2010). Hydrolysable tannins are

based on gallic acid, usually as multiple esters with D-glucose; while the more numerous

condensed tannins (often called proanthocyanidins) are derived from flavonoid monomers.

42
Tannins may be formed by condensations of flavan derivatives which have been transported to

woody tissues of plants. Alternatively, tannins may be formed by polymerization of quinone

units. This group of compounds has received a great deal of attention in recent years, since it was

suggested that the consumption of tannin-containing beverages, especially green teas and red

wines can cure or prevent a variety of illness (Cowan, 1999). They are known to possess

general antimicrobial and antioxidant activities (Sermakkani and Thangapandian, 2010).

Fig. 2.7 General structure of tannin (Gunduz et al., 2011)

Mode of antimicrobial action of tannins, as described for quinones, may be related to their ability

to inactivate microbial adhesives, enzymes, cell envelope transport proteins, etc they also

complex with polysaccharides. The antimicrobial significance of this particular activity has not

been explored. There is also evidence for direct inactivation of microorganisms: low tannin

concentrations modify the morphology of germ tubes of Crinipellis perniciosa. Tannins in plants

inhibit insect growth and disrupt digestive events in ruminant animals (Cowan, 1999). According

to previous studies, tannins can be toxic to filamentous fungi, yeast and bacteria and condensed

tannins have been determined to bind cell walls of ruminant bacteria, preventing growth and

43
protease activity (Cowan, 1999). Despite their wide distribution, the health effects of dietary

polyphenols have come to the attention of nutritionists only in recent years. Researchers and

food manufacturers have become more interested in polyphenols due to their potent antioxidant

properties, their abundance in the diet, and their credible effects in the prevention of various

oxidative stress associated diseases. The preventive effects of these plant metabolites in terms of

cardiovascular, neurodegenerative diseases and cancer are deduced from epidemiologic data as

well as in vitro and in vivo results in respective nutritional recommendations (Dai and Mumper,

2010). Furthermore, polyphenols were found to modulate the activity of a wide range of enzymes

and cell receptors. In this way, in addition to having antioxidant properties, polyphenols have

several other specific biological actions in preventing and or treating diseases (Dai and Mumper,

2010).

2.1.1.5 Terpenoids and essential oils

Among the antimicrobial extracts of plants, essential oils receive particular attention because of

the ease of extraction (Karou et al., 2007). The fragrance of plants is carried in the so called

Quinta essentia, or essential oil fractions. These oils are secondary metabolites that are highly

enriched in compounds based on an isoprene structures. They are called terpenes, their general

chemical structure is C10H16, and they occur as diterpenes, triterpenes and tetraterpenes (C20, C30

and C40), as well as hemiterpenes (C5) and sesquiterpenes (C15). When the compounds contain

additional elements, usually oxygen, they are termed terpenoids (Cowan, 1999). Terpenoids are

synthesized from acetate unit and as such they share their origins with fatty acids. They differ

from fatty acids in that they contain extensive branching and are cyclized. Examples of common

terpenoids are menthol and camphor (monoterpenes), also farnesol and artemisin

(sesquiterpenoids) (Cowan, 1999). Menthol is a flavour additive widely used in consumer and

44
medicinal products.It can be natural or synthetic and has a minty taste and aroma, and may have

cooling, analgesic or irritating properties. Menthol is an active ingredient in certain medicinal

products, such as cough drops and when used in medicinal products, it is regulated as a drug

(Menthol, 2013).

CH3

OH

Menthol
H3C CH3

Fig. 2.8 Chemical structure of Menthol (Menthol, 2013)

It is a naturally occurring chemical chiefly derived from the peppermint plant (Mentha piperita)

or the corn mint (Mentha arvensis) but it can also be synthetically produced. Menthol increases

blood flow at the site of application, which may also contribute to local aanalgesia. Menthol‘s

other attributes include antibacterial and antifungal properties and the ability to enhance topical

drugs and chemicals (Menthol, 2013). Artemisin and its derivative ά – arteether, also known by

the name ginghaosu, find current use as antimalarials. In 1985, the steering committee of the

scientific working group of the World Health Organization decided to develop the latter drug as

a treatment for cerebral malaria (Cowan, 1999).

Food scientists have found the terpenoids present in essential oils of plants to be useful in the

control of Listeria monocytogenes (Jamine et al. 2007). Oil of basil, a commercially available

45
herbal, was found to be as effective as 125 ppm chlorine in disinfecting lettuce leaves. A

terpenoid constituent, capsaicin was found to be bactericidal to Helicobacter pylori. Another hot-

tasting diterpene aframodial, from a Cameroonian spice, is a broad-spectrum antifungal (Cowan,

1999). Neem seed (Azadirachta indicia) oil extract has been found to show both antibacterial and

antifungal effects on food spoilage isolates due to the presence of phenolic compounds and

essential oils. The seed oil disrupt cell membrane synthesis in little concentrations hence its

application in medical, agricultural and household products (Idise, 2007).

2.1.1.6 Alkaloids

Alkaloids are a group of nitrogen-containing bases. Most of them are drugs, only a few (like

caffeine) are derived from purines or pyrimidines, while the large majority is produced from

amino acids. The amino acid, tyrosine is the starting product of a large family of alkaloids. The

first important intermediate is dopamine which is the starting product of the biosynthesis of

berberine, papaverine and morphine too (Sengbusch, 2008).

Fig. 2.9 Chemical structure of Caffeine (Helmenstine, 2013)

Alkaloids are heterocyclic nitrogen compounds. The first medically useful example of an

alkaloid was morphine isolated in 1805 from the opium poppy Papaver somniferum; the name

46
morphine comes from the Greek Morpheus, god of dreams. Codeine and heroin are both

derivatives of morphine (Cowan, 1999).

HO

N CH3
O

HO Morphine

Fig. 2.10 Structure of Morphine

www.sciencebase.com/images/structure_of_morphine

Diterpeniod alkaloids, commonly isolated from the plant of the Ranunculaceae, or butter cup

family, are commonly found to have antimicrobial properties. Solamargine, a glycoalkaloid from

the berries of Solanum khasianum, and other alkaloids may be useful in HIV infections

associated with AIDS (Cowan, 1999). While alkaloids have been found to have microbiocidal

effects (including against Giardia and Entamoeba species), the major anti-diarrhoeal effect is

probably due to their effects on transit time in the small intestine (Cowan, 1999). Furthermore,

Berberine is an important representative of the alkaloid group. It is potentially effective against

trypanosomes and plasmodia. The mechanism of action of alkaloids such as berberine and

harmane is attributed to their ability to intercalate with DNA (Cowan, 1999).

47
Fig. 2.11 Chemical structure of berberine (Singh et al., 2010)

Berberine is an isoquinoline alkaloid with a bright yellow color that is easily seen in most of the

herb materials that contain any significant amount of this compound. Berberine was isolated and

used as an herbal drug in China 50 years ago (the drug forms are usually the hydrochloride or

sulfate; the chloride, as used in the dye, may have the strongest antiseptic action). It has since

become an ingredient in several Western herbal products, particularly for treatment of intestinal

infections (Dharmananda, 2005). Tests of the antiseptic action of berberine against bacteria,

yeasts, viruses, and amoebas have shown a range of activity levels from apparent potent action to

mild suppression. Inhibition of Giardia and of Candida have been areas of considerable interest

and initial positive research results have led to development of several herb products for those

applications (Dharmananda, 2005).

48
The chewing stick is widely used in African countries as an oral hygiene aid (in place of a

toothbrush). Chewing sticks come from different species of plants, and within one stick the

chemically active component may be heterogeneous. Crude extracts of one species used for this

purpose, Serindeia werneckei, inhibited the periodontal pathogens Porphyromonas gingivalis

and Bacteroides melaninogenicus in vitro. The active component of the Nigerian chewing stick

(Fagara zanthoxyloides) was found to consist of various alkaloids. Whether these compounds

long utilized in developing countries, might find use in the Western world is not yet known

(Cowan, 1999).

2.1.1.7 Saponins

Saponins are natural detergents found in many plants. They have detergent or surfactant

properties by reason that they contain both water-soluble and fat-soluble components. Certain

desert plants are especially rich in saponins (Vaclavkova and Beckova, 2008). According to

Hassan et al. (2010), they are glycoside compounds whose chemical structures are composed of

a fat soluble nucleus (aglycone) that is either a triterpenoid (C-30) or neutral or alkaloid steroid

(C-27) attached to one or more side chains of water soluble sugars (glycone) through ester

linkages to the aglycone nucleus at different carbon site. Variability of saponin aglycone side

chains in terms of number, chemical composition, and specific point of attachment to the steroid

or triterpenoid nucleus is critical to saponins biological effects. Hassan et al. (2010) reported that

the mode of action of antibacterial activity of saponins against both gram-negative and gram-

positive bacteria is not yet clear. Some researchers noted that the aglycone part of the saponin is

the antibacterial determination suggesting that the sugar moiety is not important for the

antimicrobial efficacy while another study reported that saponins hydrolysed by bacterial

enzymes to its corresponding aglycone resulted in decreased antibacterial activity (Hassan et al.,

49
2010). The antifungal and antibacterial properties of saponins are important in cosmestic

applications, in addition to their emollient effects (Aghel et al., 2006).

2.1.1.8 Steroids

Plant steroids are known to be important for their cardiotonic activities, possess insecticidal and

antimicrobial properties. They are also in nutrition, herbal medicine and cosmetics (Sermakkani

and Thangapandian, 2010).

2.1.2 Solvent extraction of medicinal plants

The extraction of bioactive compounds from plant materials is the first step in the utilization of

phytochemicals in the preparation of dietary supplements or nutraceuticals, food ingredients,

pharmaceutical, and cosmetic products (Dai and Mumper, 2010). Initial screenings of plants for

possible antimicrobial activities typically begin by using crude aqueous or alcohol extraction can

be followed by various organic extraction methods. Since nearly all of the identified components

from plants active against microorganisms are aromatic or saturated organic compounds, they are

most often obtained through initial ethanol or methanol extraction. In fact, many studies avoid

the use of aqueous fractionation altogether. The exceptional water-soluble compounds, such as

polysaccharides (e.g., starch) and polypeptides, including fabatin and various lectins, are

commonly more effective as inhibitors of pathogen usually virus adsorption and would not be

identified in the screening techniques commonly used. Occasionally tannins and terpenoids will

be found in the aqueous phase, but they are more often obtained by treatment with less polar

solvents (Cowan, 2009). Solvent extractions are the most commonly used procedures to prepare

extracts from plant materials due to their ease of use, efficiency, and wide applicability (Dai and

Mumper, 2010). Scientists generally avoid using water extraction, which is the method used by

50
traditional healers in most cases, because of the complexity and difficulty involved in developing

a suitable workup procedure with aqueous extracts. Organic solvent extractions are therefore

used as a good alternative in evaluating the antimicrobial activities of plants. To this end, alcohol

or aqueous alcohol, in any case, is a good all-purpose solvent for preliminary extractions in a

screening program. Particularly, methyl or ethyl alcohol has the ability to extract a broad

spectrum of chemical substances (Rasoanaivo et al., 2004).

In the single-solvent extraction procedure, the plant material is subjected to extraction

exhaustively, by repeated maceration with alcohol or aqueous alcohol at room temperature. The

alcohol fraction in the combined extracts is evaporated off under reduced pressure at a

temperature not exceeding 450C, and the residual water extract is freeze dried or evaporated to

dryness by azeotropic methods by repeatedly adding 95% ethanol to the residual water until this

water is completely removed. As a general rule in some laboratories, approximately 25 g of dried

plant material is used for extraction in the primary screening (Rasoanaivo et al., 2004). Solvents,

such as methanol, ethanol, acetone, ethyl acetate, and their combinations have been used for the

extraction of phenolics from plant materials, often with different proportions of water. Selecting

the right solvent affects the amount and rate of polyphenols extracted. In particular, methanol has

been generally found to be more efficient in extraction of lower molecular weight polyphenols

while the higher molecular weight flavanols are better extracted with aqueous acetone. Ethanol is

another good solvent for polyphenol extraction and is safe for human consumption (Dai and

Mumper, 2010).

51
Extraction with alcohol in a soxhlet apparatus has been reported for various parts of medicinal

plants, but some scientists avoid the used of this technique because extracts are continuously

boiled with the solvent for several hours, which may alter labile constituents (Rasoanaivo et al.,

2004). Successive extractions with solvents in increasing order of polarity are also a useful

practice followed in several laboratories. In this procedure, plant material is defatted with

petroleum ether, cyclohexane or heptane, the use of heptane being avoided because of its toxicity

and flammability. The residual powdered plant is then extracted, preferably, with ethyl acetate

because of its lower toxicity compared to chlorinated hydrocarbon solvents or alternatively with

dichloromethane or chloroform. Thereafter, the residue is extracted with methanol or ethanol and

finally with water. The procedure is based on the old Roman principle of solubility: similia

similibus solvuntur (the similar dissolves the similar). Scientifically speaking, nonpolar solvents

dissolve selectively nonpolar compounds; polar solvents dissolve preferably polar compounds. A

reasonable alternative is to shorten the procedure by using only one nonpolar solvent

(ethylacetate) and one polar solvent (methanol or water) (Rasoanaivo et al., 2004).

2.1.3 Carica papaya

Carica Papaya L., more commonly known as the papaya, belongs to the Caricaceae. Its

classification is as follows: Division: Magnoliophyta, class: Magnoliopside, subclass:

Dilleniidae, Order: violales and as previously mentioned, Family: Caricaceae. It was first

described by the Spanish chronicler Oviedo in 1526, from the Caribbean coast of Panama and

Colombia (Dawson, 2007). Carica papaya is a fruit also called papaya, papaw, pawpaw, and

mamao or tree melon. It is found in virtually every tropical and subtropical country and soon

after it was grown throughout the tropics, its distribution was being aided by the abundance of its

seeds (Dawson, 2007; Okeniyi et al., 2007).

52
The papaya seed is viable for up to three years under cool, dry conditions and it is a herbaceous,

dicotyledonous plant that may produce fruits for more than twenty years. The plant usually has a

single trunk with several well developed branches. The melon- like fruit varies in size and shape,

and hangs from short, thick peduncles at the leaf axil. Its flowers are mostly dioecious and

resemble each other until they start to develop sexual organs. The species is polygamous and can

be classified into three sex types: male staminate, hermaphroditic (bisexual) and female pistillate.

In addition, some plants can produce more than one kind of flowers. The fruits which are orange-

yellow when ripen, are popular breakfast staple that also used in jellies, preserves, fruit juices

and as a beverage in certain Latin countries. In addition, the leaves and roots of the plants are

also used in variety of dishes. The bark can also be used for rope making and the leaves as a soap

substitute, being an excellent stain remover (Dawson, 2007). In Java, even the flowers are eaten

(Dawson, 2007).

Papain obtained from pawpaw is used to treat commercial beer, to degumm natural silk, and in

the production of chewing gums. Cosmetically, papain is used in shampoos and in a number of

face-lifting operations (Dawson, 2007). Dawson (2007) also stated that papaya can be used as

diuretic (the roots and leaves), antihelmintic (the leaves and seeds) and to treat bious conditions

(the fruit). Parts of the plant are also used to combat dyspepsia and other digestive disorders and

a liquid portion has been used to reduce enlarged tonsils (Dawson, 2007). In addition, pawpaw

juice is used against warts, cancers, tumors, corns and skin defects while the root is said to help

tumors of the uterus (Dawson, 2007). In Africa, a root infusion of papaya is also used for syphilis

53
and the leaf is smoked to relieve asthma attacks. The Javanese believes that eating papaya

prevents rheumatism and in Cuba the latex is used for psoriasis, ringworm and the removal of

cancerous growth (Dawson, 2007). Thus, the successful use of Carica papaya in ethno-medicine

offers cheap, natural, harmless, readily available monotherapy and preventive strategy against

several diseases, especially in tropical communities. Further and large-scale intervention studies

to compare C. papaya with standard antimicrobial preparations are desirous (Okeniyi et al.,

2007).

2.2 Food Safety

Food safety and security all over the world have no substitute. This essential commodity of life is

continuously threatened by spoilage through adverse changes caused by the presence of

enzymes, oxygen, light, loss of moisture, or most importantly, the action of microorganisms and

their enzymes (Shide and Whong, 2003). Food safety can be defined as assurance that food will

not cause harm to the consumer when it is prepared and \ or eaten according to its intended use

(NAFDAC, 2004). For food producers and manufacturers the guiding principle in hygiene is the

exclusion or elimination of pathogens or the reduction of contamination to safe (‗acceptable‘)

levels (Singleton, 1997). Microbiological limits of the set guidelines for ready-to-eats foods are

organized under three components (Microbiological Guidelines, 2007).

The Standard Plate Count (SPC), also referred to as the aerobic plate count or the total viable

count, is one of the most common tests applied to indicate the microbiological quality of food.

The significance of SPCs, however, varies markedly according to the type of food product and

54
the processing it has received. When SPC testing is applied on a regular basis it can be a useful

means of observing trends by comparing SPC results over time (Guidelines, 2001). It is generally

believed that high SPCs in foods indicate greater risks of pathogen being present in consumable

products, poor implementation of sanitation procedures or problems in process controls to which

a test food item has been subjected. It is generally used for descriptive evaluation of

microorganisms on nonselective media under mesophilic and aerobic conditions (Avanza, 2005).

It is useful for indicating the sanitary quality of food. Generally, it does not relate to food safety

hazards, but is taken as a food quality parameter (Microbiological Guidelines, 2009).

Indicator organisms refer to the selected surrogate markers employed to reflect the hygienic

quality of food. E. coli is commonly used as surrogate indicator. The native habitat for E. coli is

the enteric tract of humans and animals. Its presence in food generally indicates direct or indirect

fecal contamination. Substantial number of E. coli in food suggests a general lack of cleanliness

in handling and improper storage. The presence of E. coli in foods does not connote directly the

presence of a pathogen, but implies a certain risk that it may be present (Microbiological

Guidelines, 2009). The presence of E. coli in ready-to-eat foods is undesirable because it

indicates poor hygienic conditions which have led to contamination or inadequate heat treatment.

Ideally E. coli should not be detected and as such a level of <3 per gram (the limit of the Most

Probable Number test) has been given as the satisfactory criteria for this organism. Levels

exceeding 100 per gram are unacceptable and indicate a level of contamination, which may have

introduced pathogens or that pathogens, if present in the food prior to processing, may have

survived (Guidelines, 2001).

55
Specific pathogens refer to bacteria that may cause food poisoning. Mechanisms involved may

be toxins produced in food or intestinal infection. Nine specific bacterial pathogens included in

this set of guidelines are Campylobacter spp., E.coli O157, Listeria monocytogenes, Salmonella

spp., Vibrio cholerae, Vibrio parahaemolyticus, Staphylococcus aureus, Clostridium perfringes

and Bacillus cereus. The symptoms of food poisoning caused by these pathogens vary from

nausea to vomiting (e.g. caused by S. aureus), through diarrhoea and dehydration (Salmonella

spp. and Campylobacter spp.) to paralysis and death in the rare cases of botulism. The infectious

doses vary from less than ten (10) to more than a million (106) organisms (Microbiological

Guidelines, 2007).

2.3 Microbial Food Borne Diseases

Food borne diseases continue to be a common and serious threat to public health over the world

and are a major cause of morbidity (Blackburn and McClure, 2004). They are caused by eating

food or drinking beverages and/or water contaminated with bacteria, parasites or viruses

(NDDIC, 2007). Both industrialized and developing countries suffer large numbers of illnesses

and the incidence on a global basis appears to be increasing (Blackburn and McClure, 2004).

Most food borne illnesses are mild, and associated with gastrointestinal symptoms such as

diarrhoea and vomiting. Sometimes a food borne disease is much more serious and is life

threatening, particularly in children in developing countries, and infection can also be followed

by chronic sequalae or disability. In many countries, where information on food borne diseases

are documented the total number of cases has been increasing over the past 20-30 years

56
(Blackburn and McClure, 2004). In recent years, the epidemiology of food borne diseases has

been changing as new pathogens have emerged. ―Emerging diseases‖ are described as those that

have increased in prevalence in recent decades or are likely to do so in the near future, so it is not

necessary for an emerging pathogen to be evolved. Food borne diseases that are regarded as

emerging include illnesses caused by enterohaemorrhagic Escherichia coli [(EHEC) particularly

serovar O157:H7], Campylobacter jejuni, Salmonella typhimurium Definitive Type (DT) 104

(Blackburn and McClure, 2004). In some cases, diseases have been associated with food vehicles

only relatively recently. Examples of these pathogens include Listeria monocytogenes,

Cryptosporidium parvum and Cyclospora cayetanensis. Many of these food borne pathogens

have a non-human animal reservoir, and are termed zoonoses, but they do not necessarily cause

diseases in the animal. Previously, animal or carcass inspection was used as a method of

preventing zoonotic diseases being transferred through food, but this can no longer be relied

upon (Blackburn and McClure, 2004).

2.3.1 Indicators of bacterial food pathogens

All pathogenic microorganisms indicated in food borne diseases are considered enteric

pathogens, except Staphylococcus aureus, Bacillus cereus, Clostridium botulinum (except in the

case of infant botulism), Cl. perfringens, and toxicogenic molds. This means they can survive

and multiply or establish in the gastrointestinal (GI) tract of humans, food animals and birds. A

food contaminated directly or indirectly with faecal materials from these sources may

theoretically contain one or more pathogens and can thus be potentially hazardous to consumers.

To implement regulatory requirements and ensure consumer safety, it is necessary to know that a

food is either free of some enteric pathogens, such as Salmonella serovars and Escherichia coli

57
0157:H7, or contains low levels of some other enteric pathogens, such as Yersinia enterolitica

and Vibro parahaemolyticus (Ray, 2004).

Food samples are examined for the number (or level) of groups or a series of bacteria that are of

faecal or enteric origin, usually present in higher density than pathogens, but usually considered

to be non-pathogenic. Their presence is viewed as resulting from direct or indirect contamination

of a food with faecal materials and indicates the possible presence of enteric pathogens in the

food. These bacterial groups of species are termed indicators of enteric pathogens. Although,

Staphylococcus aureus, Costridium botulinum, Cl. perfringens and Bacillus cereus can be

present in faecal matters of humans and food animals, they, along with toxicogenic molds are not

considered classical enteric pathogens. Their presence in a food is not normally considered to be

because of faecal contamination, and the indicators of enteric pathogens are not very effective

for the purpose (Ray, 2004).

2.3.1.1 Coliforms

The term ‗coliform‘ does not have taxonomic value; rather, it represents a group of species from

several genera namely, Escherichia, Enterobacter, Klebsiella and Citrobacter (Ray, 2004). They

are all Gram negative non-spore forming rod-shaped bacteria, aerobic and facultative anaerobic

organisms that ferment lactose in 24-48 hr at 35oC (Okpokwasili, 2007). Some species grow at

higher temperature (44.5oC), whereas others can grow at 4-5oC. All are able to grow in foods

except in those that are at pH<0.92. All are sensitive to low-heat treatment and are killed by

pasteurization (Ray, 2004). Coliforms were historically used as indicator microorganisms to

serve as a measure of faecal contamination, and thus potentially of the presence of enteric

58
pathogens in foods (Cakir et al., 2002). Although with some disadvantages, coliforms are

probably the most useful and most extensively used indicators (Ray, 2004).

2.3.1.2 Faecal coliforms

Faecal coliforms also constitute a group of bacteria and include those coliforms whose

specificity as faecal contaminants is much higher than that of other coliforms. This group

includes mostly E.coli, along with some Klebsiella and Enterobacter spp. Non-faecal coliforms

are eliminated by using a high incubation temperature (44.5+0.2 or 45.0+0.2oC) for 24 hr in

selective broth containing lactose. Lactose fermentation with the production of gas is considered

a presumptive test (Ray, 2004). Faecal coliforms are therefore defined as bacteria which in the

presence of bile salts or other equivalent selective agents, can grow and produce acid and gas

from lactose when incubated at 44-45.5oC (Harrigan and McCance, 1976). In heated and ready-

to-eat products, presence of faecal coliforms especially above a certain level is viewed cautiously

for possible faecal contamination and presence of enteric pathogens. A food can be accepted or

rejected based on the numbers present. This group is extensively used as an indicator in foods of

marine origin (shellfish) and wastewater (Ray, 2004).

2.3.1.3 Escherichia coli

In contrast to either coliforms or faecal coliforms, E.coli has a taxonomic basis. It includes only

the Escherichia spp. of the coliform and faecal coliform groups. E.coli strains conform to the

general characteristics described for coliform groups. Following a great deal of the work on the

phenotypic characteristics of the bacteria, by the 1960s, the genus Escherichia was described as:

Gram negative, non-sporing rods; often motile, with peritrichate flagella. It is easy to cultivate on

ordinary laboratory media, aerobic and facultative anaerobic. According to Donnenberg and

59
Nataro (2000) all species ferment glucose with the formation of acid or and gas, both aerobically

and anaerobically. All reduce nitrate to nitrite and are oxidase negative but catalase positive.

Typically, they are intestinal parasites of humans and animals, though some species may occur in

other parts of the body, on plants and in the soil (Donnenberg and Nataro, 2000).

Biochemically, they are differentiated from other coliforms by the indole production from

tryptone, methyl red reduction due to acid production (red colouration), Voges Proskauer

reaction (production of acetyl-methyl carbinol from glucose) and citrate utilization as a sole

carbon-source (IMViC) reaction patterns. E. coli Type 1 and Type 2 give IMViC reaction

patterns respectively, of ++-- and -+--. The -+-- reaction pattern of E.coli type 2 could also be

due to slow or low production of indole from tryptone (or peptone) (Ray, 2004). By the mid-

1940s, a serogrouping scheme was developed that allowed E.coli to be divided into more than

170 different serogroups based on their somatic (O) antigen. In addition, over 50 flagella (H)

antigens and approximately 100 capsular (K) antigens are now also recognized and these are

used to further subdivide E. coli into serotypes. Serogroupings and serotyping, together with

other information such as biotype, phage type and enterotoxin production, now facilitates

distinction between those strains able to cause infectious diseases in humans and animals. Some

correlation has been established between the E.coli serogroup and virulence (Bell and

Kyriakides, 2004). E.coli has been found associated with diarrhoea (particularly in children),

haemorrhagic colitis, dysentery, bladder and kidney infections, surgical wound infection,

septicaemia, haemolytic uraemic syndrome, pneumonia and meningitis; some of these conditions

result in death (Bell and Kyriakides, 2004). E.coli may be the most versatile of human pathogens

(Donnenberg and Nataro, 2000). Strains that share virulence features with more than one group

60
have been identified and will likely be recognized with increasing frequency. The species is not

static, but is constantly evolving in leaps and bounds by the acquisition of new genetic

determinants. Organized by pathotype, six categories of diarrhoeagenic E.coli and two E.coli that

cause extraintestinal infections are identified (Donnenberg and Nataro, 2000).

E. coli, particularly serotype O157:H7 has become an important food borne pathogen responsible

for gastroenteritis epidermics in North America, Europe, Asia and Africa. The most frequently

implicated foods have been under cooked contaminated ground beef, raw milk, unpasteurised

cider and apple juice, bean sprouts or fresh leafy vegetables such as lettuce and spinach (Hosein

et al., 2008). The increased consumption of Ready-to-eat foods coupled with the associated risk

of disease to which consumers may be exposed, is a matter of great concern. It is difficult for one

to attest to the hygiene of the processors or to the sanitary conditions at points of preparation

(Oranusi and Olorunfemi, 2011).

2.3.1.4 Non-Escherichia coli coliforms

Coliform groups include species from genera Escherichia, Klebsiella, Enterobacter and

Citrobacter, all belonging to the family Enterobacteriaceae and thus sharing some common

characteristics. Previously, E.coli strains (both pathogenic and nonpathogenic) were thought to

mainly inhabit the intestinal tract of humans and warm blooded animals and birds, and most

species in the other three genera were thought to be mainly of non- intestinal origin. However,

other studies have shown that species and strains of Klebsiella, Enterobacter and Citrobacter

(together referred to as non E. coli coliforms) can colonize the human gut and produce potent

enterotoxins. In several acute and chronic cases of diarrhoea, they were isolated from stools and

61
the intestinal tract. Some isolates of Enterobacter cloacae, Klebsiella pneumonia and

Citrobacter spp. were found to produce enterotoxins similar to heat- labile or heat-stable toxins

of enterotoxigenic E.coli strains probably due to the intergeneric transfer of plasmids encoding

these phenotypes (Ray, 2004). Non E.coli coliforms are normally present in raw food materials

as well as in some pasteurized foods because of post-heat contamination. They can grow in many

foods if the growth parameters are not limiting. Some strains can grow at refrigerated

temperature. Temperature abuse during storage can also facilitate their rapid growth in a food.

The significance of their presence in a food may need to be reevaluated (Ray, 2004).

2.4 Ready-to-eat Foods

A ready-to-eat food is food in a form that is edible without washing, cooking or additional

preparation by the food establishment or the consumer, and is consumed in the ordinary

state (Microbiological Examination, 2010). Furthermore, ready-to-eat is defined as the

status of the food being ready for immediate consumption at the point of sale. It could

be raw or cooked, hot or chilled, and can be consumed without further heat-treatment

including re-heating (Microbiology Guidelines, 2007). It can also be defined as food that

62
is ordinarily consumed in the same state as that in which it is sold or distributed and

does not include nuts in the shell, raw fruits and vegetables that are intended for hulling,

peeling or washing by the consumer (Guidelines, 2001).

The presence of enteric bacteria in ready-to-eat foods provides undeniable evidence of the poor

microbiological quality of the foods in different countries (Owoseni and Onilude, 2011).

Contamination of food by enteric pathogens can occur from the farm if human sewage is used to

fertilize the soils or if sewage water is used to irrigate the crops. Such risks are further increased

if the food is mishandled during processing and preparations where pathogens could multiply

exponentially under favourable conditions (Nyenje et al., 2012). It is mandatory that foods must

be free from contaminants as much as possible. The presence of E.coli, S. aureus and B.cereus

demonstrates a potential health risk as these organisms are pathogenic and have been implicated

in food borne diseases. Foodborne illness can be prevented by good hygiene practices (Oranusi

et al., 2013). The category ready-to-eat can be considered as high risk foods because they do not

require any heating or process prior to consumption. In addition, food workers may transmit

pathogens to food from a contaminated surface, from another food, or from hands contaminated

with organisms from their gastrointestinal tract. Therefore, hand contact with ready-to-eat foods

represents a potentially important mechanism by which pathogens may enter the food supply

(Jacob, 2010). Inadequate refrigeration and/or sanitation that prepared ready-to-eat foods

experience might create conditions under which any existing bacteria may flourish, especially if

lack of proper handling practices occurs. Small corner markets in high poverty areas may be very

63
limited in their resources available to train employees in safe food handling and guarantee the

safest food supply to consumers (Jacob, 2010). The use of sensitive, quatitative methods for the

detection of food borne pathogens during food processing could be used to determine points in

the food production process where contamination occurs and where controls could be introduced

to reduce or eliminate enterobacteria from readt-to-eat food products, thereby reducing risk to the

consumer (Owoseni and Onilude, 2011).

2.4.1 Processed meat (‘suya’)

Processed meat products are defined as those in which the properties of fresh meat must have

been modified by the use of one or more procedures such as grinding, addition of seasoning

agents, alteration of color or heat treatment (Abdullahi et al., 2005). Processed meat in Nigeria

includes ‗Tsire‘ or ‗Suya‘, ‗Kilishi‘ and ‗Balangwu‘.

‗Suya‘ is a popular Nigerian traditional processed ready-to-eat smoked meat product. It is served

or sold in public places, along streets, in club houses, restaurants, picnics and homes. It is

prepared from boneless meat of animals such as mutton, beef or goat. The meat is trimmed from

associated connective tissues, nerves and vessels. The meat is artfully sliced into very thin

continuous sheets which are then cut into pieces. The pieces of meat are staked on sticks, spiced

with groundnut powder/flour, salt, vegetable oil and flavorings such as monosodium glutamate

or others. The sticks are then arranged round the fire place for the meat to roast, the duration of

roasting depend on such factors as fire intensity and pressure from consumers. The traditional

smoking of ‗suya‘ is usually done by wood smoke (Inyang et al., 2005). The prepared ‗suya‘

when being sold are usually packaged in newspapers and sometimes in cellophane or nylon bags

64
(Uzeh et al., 2006). Much of ready-to-eat foods, including processed meat, have been associated

with gastroenteritis of E. coli origin in many countries. Direct and indirect contamination of

these foods with fecal materials, along with improper storage temperature and inadequate heat

treatment, were involved in these incidences (Ray, 2004). Most of the stages of ‗suya‘

preparation, materials used and the surrounding environment can serve as sources of

contaminants to the meat product (Uzeh et al., 2006).

2.4.2 Smoked fish

Fish is endowed with one of the cheapest sources of protein (Whong et al., 2003). It competes

favourably with those of eggs, milk and meat in its amino acid composition. In fact, it often has

higher levels of essential lysine and methionine, both of which are lacking in tuber-based or

cereal based diet. This makes fish protein particularly valuable in many countries where the

staple diet consists of starchy foods like cassava, yam, rice, sorghum and millet. The lack of

livestock and fresh meat products in many parts of Nigeria makes fish protein all the more

essential (Daniel et al., 2006). Fish is however highly perishable if not properly processed and

preserved because of its high protein and fat content (Whong et al., 2003). It has been reported

that 40% of the total fish catch in Nigeria is lost annually due to improper storage and inadequate

preservation infrastructure. Hence, fish storage stability remains a serious factor affecting fish

supply in Nigeria (Adebayo et al., 2003).

Traditional fish smoking is one method of preserving fish against spoilage. It involves gutting,

cutting and then smoke-drying. Smoking remains an important means of preservation in most

developing countries, as it requires low capital investment. Common methods of fish smoking

involve the use of conical or rectangular mud or drum kilns, and pot oven. (Adebayo et al.,

65
2003). First of all, fish are smoked to obtain a product of high sensory virtues not containing

microorganisms (Sobota et al., 2006). Smoke contributes a pleasant and agreeable flavor to fish

and its chemical constituents, which include formic acid, acetic acid, propionic acid, phenol,

cresol, isobutyl alcohol, formaldehyde and acetaldehyde, confirm it as a preservative. These

organic compounds act as bacteriostatic, bactericidal and antioxidant chemicals in fish (Adebayo

et al., 2003; Whong et al., 2003).

In spite of its acceptability, there is need to determine the shelf life of smoked fish and the

nutritional change during storage. Nutritional and microbiological qualities are important

considerations for all forms of food processing. When fish are smoked, the duration of storage

poses a great challenge to product quality. Information on the storage period, within which the

fish will still retain its nutritional qualities, is invaluable to the processors and consumers of the

smoke fish products (Adebayo et al., 2003). Smoked dried fish are liable to water absorption and

during raining season such a situation is inevitable. Also, smoked fish containing moisture

content greater than 10% will be liable to microbial spoilage, shorter shelf-life, off-odor and

flavor. Such fish when consumed directly may result in food poisoning (Whong et al., 2003).

Most critical are the hygienic conditions for handling fish after smoking (Novotny et al., 2004).

2.4.3 ‘Zoborodo’

‗Zoborodo‘ drink is extracted from the dry calyces of Roselle plant (Hibiscus sabdariffa), a

member of the family Malvaceae. It is usually prepared as a sorrel drink. The product has today

become popular, with much acceptance in Nigeria and commonly referred to as ‗zobo‘

(Abdullahi and Elegbe, 2001; Ayo et al., 2004). ‗Zobo‘ drink is prepared by boiling the dry

66
calyces of Hibiscus sabdariffa in water for about 10-15 min from which the pigment or flavour

embedded is extracted. After extraction the filtrate may be taken hot as tea or allowed to cool and

packaged in plastic sachet containers then taken as a refreshing drink when chilled. The sharp

sour taste of the raw extract is usually sweetened with sugar cane or granulated sugar, pineapple,

orange or other fruits depending on choice. The sweetness of ‗zobo‘ drink does not last long due

spoilage by microbial activities. There is increase in the demand for ‗zobo‘ drinks due to its low

prices, nutritional and medicinal properties (Nwachukwu et al., 2007). Economically, zobo is

cheap and has been shown to be good source of natural carbohydrates, protein and vitamin C

which constitute a major reason for consuming the soft drink by the increasing population

(Braide et al., 2012). The greatest limitation for large-scale production of ‗zobo‘ drinks is the

rapid deterioration of the drink. Its shell-life is approximately twenty-four hours following

production if not refrigerated. Microorganisms associated with the dried calyx and the processing

for the production of ‗zobo‘ drinks and other factors may contribute to its spoilage (Nwachukwu

et al., 2007). ‗Zoborodo‘ is normally packed in sachet form or bottle and presented to the

consuming public at refrigeration temperature. Production and sale of ‗zoborodo‘ is still at the

local level. The low sanitary practice during production and sales accounts for the poor quality

and a cause for concern (Ayo et al., 2004). The production process of ‗zobo‘ however, is neither

standardized nor mechanized. This allows proliferation of the associated micro-organisms which

potentiate spoilage and the short shelf-life associated with this sorrel beverage. Some of these

organisms have been found to pose serious health risks to consumers as they are associated with

food spoilage and intoxication (Braide et al., 2012).

2.4.4 ‘Kunun zaki’

67
‗Kunun zaki‘ is one of the indigenous non-alcoholic beverages prepared from guinea corn

(Sorghum bicolor), millet (Pennisetum typhoides), maize (Zea mays), rice (Oryza sativa) and

wheat (Triticum aestivum).The fermented cereal beverage is widely consumed in most parts of

Northern Nigeria and beyond the Savanna region of Nigeria. It is taken at anytime of the day by

both adults and children, as breakfast drink, food complement, refreshing drink for visitors ,

appetizer, and is commonly served in social gatherings (Umoh et al., 2004). ‗Kunun zaki‘ is

spiced with ginger, cloves, red and black pepper, sweetened with sugar, packed for sale in

polythene bags, bottles, and as bulk package in large containers and distributed under ambient

temperature or cold in refrigerator where available (Umoh et al., 2004). Like other local

beverages, the traditional method of production and sales of ‗kunun zaki‘ exposes it to high level

of contamination by pathogenic organisms. Factors such as handling, spicing and the use of

untreated water have been reported to be contributing to the unwholesomeness of the drink (Ayo

et al., 2004).

2.5 Antibiotics

In the middle of the 20th century, the discovery of antibiotics dramatically changed tools

available to cure infectious disease (Donato et al., 2010). An antibiotic [Greek anti, against, and

bios, life], is a chemical substance produced by a microorganism that is able to kill or inhibit the

growth or activity of other microorganisms (Black, 2005). They were originally discovered as

secretions of fungi or soil bacteria (Antibiotics, 2010). In the 1940s, Selman Waksman, the

discoverer of streptomycin, defined an antibiotic as ―a chemical substance produced by

microorganisms which have the capacity to inhibit the growth of bacteria and even destroy

bacteria and other microorganisms in dilute solution‖. In contrast, agents synthesized in the

68
laboratory are called synthetic drugs. Some antimicrobial agents are synthesized by chemically

modifying a substance from a microorganism. Antimicrobial agents made partly by laboratory

synthesis and partly by microorganisms are called semi synthetic drugs (Black, 2005).

Antibiotics are selectively toxic to the microbes but not to the host (Thakur, 2006). The range of

different microbes against which an antimicrobial agent act is called spectrum of activity. Those

agents that are effective against a great number of microorganisms from a wide range of

taxonomic groups, including, both Gram-positive and Gram-negative bacteria, are said to have a

broad spectrum of activity. (Black, 2005). The mechanism of action of most antibacterial drugs

were worked out after the discovery that the molecules had effects on bacterial growth, either

showing growth dramatically (bacteriostatic) or killing (bactericidal). Molecules of clear

therapeutic utility and potential were then examined for the molecular basis of their antibacterial

properties, their selectivity, and their associated toxicity (Walsh, 2003). Five different modes of

action of antimicrobials are identified: Inhibition of cell wall synthesis, disruption of cell

membrane function, Inhibitors of protein synthesis, Inhibitors of nucleic acid synthesis and

action as antimetabolites (Black, 2005).

2.5.1 Antibiotics that inhibit cell wall synthesis

The most celebrated of the antibiotics that kill bacteria by blocking the crucial transpeptidations

that lead to mechanically strong peptidoglycan through the covalent cross-links of peptide

strands are the β-lactam antibiotics (Walsh, 2003). These antibiotics such as penicillins and

cephalosporins contain a chemical structure called β-lactam ring, which attaches to the enzymes

that cross- link peptidoglycans. By interfering with the cross-linking of tetrapeptidases, these

antibiotics prevent cell wall synthesis. Fungi and Archaea, whose cell walls lack peptidoglycan,

69
are unaffected by these antibiotics (Black, 2005). β-lactams account for approximately two-

thirds, by weight of all antibiotics administered to humans (Lachmayr et al., 2009).

2.5.2 Antibiotics that disrupt cell membrane function

Five polymyxins designated A, B, C, D, and E, have been obtained from the soil bacterium

Bacillus polymyxa (Black 2005). They have limited spectra of antimicrobial activity and

significant toxicity, with a unique fatty acid component that contribute to the detergent activity

(Talaro and Talaro, 2002; Yao and Moellering, 2007). Polymyxins are peptides which are active

against many Gram negative bacteria (Singleton, 1997). Acting like detergents or surfactants,

members of this group of antibiotics interact with the phospholipids of the bacterial cell

membrane, thereby increasing cell permeability and disrupting osmotic integrity. This process

results in leakage of intracellular constituents, leading to cell death (Yao and Moellering, 2007).

Polymyxins B and E are the most common clinically. They are usually applied topically, often

with bacitracin, to treat skin infections caused by Gram negative bacteria such as Pseudomonas.

Used internally, polymyxins can cause numbness in the extremities, serious kidney damage, and

respiratory arrest. They are administered by injection when the patient is hospitalized and kidney

function can be monitored (Black 2005).

2.5.3 Antibiotics that inhibit protein synthesis

In all cells, protein synthesis requires not only the information stored in DNA, plus several kinds

of RNA, but also ribosomes. Differences between bacterial (70S) and animal (80S) ribosomes

allow antimicrobial agents to attack bacterial cells – that is, with selective toxicity.

Aminoglycoside antibiotics, such as streptomycin, derived their name from the amino acids and

70
glycosidic bonds they contain. They act on the 30S portion of bacterial ribosomes by interfering

with the accurate reading (translation) of the mRNA message-that is, the incorporation of the

correct amino acids. Chloramphenicol and Erthromycin act on the 50S portion of bacteria

ribosomes, inhibiting the formation of the growing peptide. Because animal cell ribosomes

consist of 60S and 40S subunits, these antibiotics have little effect on host cells. Mitochondria,

however, which have 70S ribosomes, can be affected by such drugs (Black, 2005). Other

aminoglycosides, such as neomycin, kanamycin, amikacin, gentamicin, toramycin and

Netilmicin, also have special uses and display varying degrees of toxicity to the kidneys and

inner ear. At lower, less toxic doses, aminoglycosides tend to be bacteriostatic. They are usually

administered intramuscularly or intravenously because they are poorly absorbed when given

orally (Black, 2005). An important property of aminoglycosides is their ability to act

synergistically with other drugs- an aminoglycoside and another drug together often control an

infection better than either could alone. For example, gentamicin and penicillin or ampicillins are

effective against penicillin-resistant streptococci. In other synergistic actions, gentamicin or

tobramycin work with carbenicillin or ticarcillin to control Pseudomonas infections, especially in

burn patients, and aminoglycosides work with cephalosporins to control Klebsiella infections.

Other antibacterial agents that affect protein synthesis are the tetracyclines, chloramphenicol,

macrolides and lincosamides (Black, 2005).

2.5.4 Antibiotics that inhibit nucleic acid synthesis

From among the rifamycins produced by Streptomyces mediterranei, only the semi synthetic

rifampin is currently used. It blocks RNA transcription. Although, it is bactericidal and has a

wide spectrum of activity, it is approved in the United States only for treating tuberculosis and

eliminating meningococci from the nasopharynx of carriers. It is unusual among antibiotics in its

71
ability to interact with other drugs, and possibilities of such interactions should be considered

before the drug is given (Black, 2005).

The Quinolones are a new group of synthetic bactericidal analogs of nalidixic acid. They are

effective against many Gram-positive and Gram-negative bacteria. Quinolones‘ mode of action

is to inhibit bacterial DNA synthesis by blocking DNA gyrase, the enzyme that unwinds the

DNA double helix preparation to its replication. Norfloxacin, Ciprofloxacin (Cipro), and

enoxacin are examples of this group of antibiotics. They are especially effective in the treatment

of traveler‘s diarrhea and in urinary tract infections caused by multiple resistant organisms

(Black, 2005). A recent advancement has produced a hybrid class of antibiotics. One of these, a

quinolone-cephalosporin combination, is currently being tested. When the β-lactamase acts on

the cephalosporin component, the quinolone is released from the hybrid molecule and is

available to kill the cephalosporin-resistant organisms. The use of such a dual-acting synergistic

antibiotic may also prevent or delay development of antibiotic resistance organisms (Black,

2005).

2.5.5 Antibiotics that act as antimetabolites

The sulfonamides or sulfa drugs are a large group of entirely synthetic, bacteriostatic agents.

They act by blocking the synthesis of folic acid, which is needed to make the nitrogenous bases

of DNA (Black, 2005). In practice, sulfa drugs are very similar to the structural metabolic

compound PABA (para-aminobenzoic acid) acquired by the bacteria to synthesize the co-

enzyme tetrahydrofolic acid, which participates in the synthesis of purines and certain amino

acids. A sulfonamide molecule has high affinity for the PABA site on the enzyme and can

72
successfully compete in a ‗chemical race‘ with PABA to occupy those sites. This ultimately

causes an inadequate supply of tetrahydrofolic acid for purine production, which invariably halts

nucleic acid synthesis and prevents bacterial cells from multiplying (Talaro and Talaro, 2002).

Sulfonamides have been characterized as broad-spectrum antibiotics with a bacteriostatic mode

of action based on inhibition of folic acid metabolism (Olliver et al., 2010). Sulfonamides have

now been largely replaced by antibiotics because antibiotics are more specific in their actions

and less toxic than sulfonamides. When sulfonamides first came into use in the 1930s, they

frequently lead to kidney damage. Newer forms of these drugs usually do not damage kidneys,

but they do occasionally produce nausea and skin rashes. Certain sulfonamides are still used to

suppress intestinal micro flora prior to colon surgery. They are also used to treat some kinds of

meningitis because they enter cerebrospinal fluid more easily than do antibiotics. Cotrimoxazole

(Septra), a combination of sulfamethoxazole and trimethoprim, is used to treat urinary tract

infections and a few other infections. Cotrimoxazole is the primary drug of choice to control

Pneumocystis pneumonia, a common fungal complication to AIDS patients. Unfortunately, both

drugs are toxic to bone marrow and may cause nausea and skin rashes (Black, 2005). Isoniazid is

an antimetabolite for two vitamins-nicotinamide (niacin) and pyridoxal (vitamin B6). It binds to

and inactivates the enzyme that converts the vitamins to useful molecules. This bacteriostatic,

synthetic agent has little effect on most bacteria and is effective against the mycobacterium that

causes tuberculosis because of isoniazid-resistant organisms; isoniazid usually is given with

other two or three agents such as rifampin or ethambutol. Isoniazid kills the rapidly dividing

bacilli; the other agents kill slow or dormant bacilli. Dietary supplements of nicotinamide and

pyridoxal also should be given along with isoniazid (Black, 2005).

73
2.6 Beta-Lactam Antibiotics

Beta-lactam antibiotics are among the safest and most frequently prescribed antimicrobial drugs

in the world (Aminzadeh et al., 2008). They got their name from the characteristic ring structure-

the β-lactam ring. They work by interfering with the synthesis of the bacterial cell wall, a

structure that is not found in eukaryotes. The walls of bacteria are made of a complex polymeric

material called peptidoglycan. The beta-lactam antibiotics bind to and inhibit enzymes needed

for the synthesis of the peptidoglycan wall. While they have little effect on resting bacteria, they

are lethal to dividing bacteria as defective walls cannot protect the organism from bursting in

hypotonic surroundings (Antibiotics, 2010). β-lactams account for approximately two-thirds, by

weight of all antibiotics administered to humans (Lachmayr et al., 2009).

2.6.1 Penicillins

The penicillins are the oldest class of antibiotics (Bayarski, 2006). They are a group of natural

and semi synthetic antibiotics containing the chemical nucleus 6-aminopenicillanic acid, which

consists of a β-lactam ring fused to a thiazolidine ring. The naturally occurring compounds are

produced by a number of Penicillum spp. The penicillins differ from one another in the

substitution at position 6, where changes in the side chain may modify the pharmacokinetic and

antibacterial properties of the drug (Yao and Moellering, 2007). The semi-synthetic products are

those that have been chemically modified in the laboratory (and pharmaceutical facility) to

improve the efficacy of the natural product, reduce its side effects, circumvent developing

resistance by the target bacteria, and expand the range of bacteria that can be treated with it

(Antibiotics, 2010). The natural penicillins are based on the original penicillin-G structure

(Bayarski, 2006). Penicillin G is very effective against penicillin-susceptible Staphylococcus

74
aureus, Streptococcus pneumoniae, S. pyogenes, viridans group Streptococcus, S. bovis,

Neisseria gonorrhoeae, Neisseria meningitides, Pasteurella multocida, anaerobic cocci,

Clostridium spp., Fusobacterium spp., Prevotella spp. and Porphyromonas spp. However, the

occurrence of penicillin-resistant pneumococci has recently been increasing worldwide.

Penicillin V has a spectrum of activity similar to that of penicillin G except that it is less active

against Neisseria gonorrhoeae (Yao and Moellering, 2007). The aminopenicillins are

penicillinase-resistant. Methicillin is the prototype. They are primarily effective against

penicillinase-producing Staphylococci. They are also active against Streptococcus pneumoniae

and S. pyogenes, but not active against enterococci, members of the family Enterobacteriaceae,

Pseudomonas spp., or members of the Bacteroides fragilis group. Ampicillin and Amoxicillin

have spectra of activity similar to that of penicillin G, but they are more active against

enterococci and Listeria monocytogenes. Although, they are also more active against

Haemophilus influenzae and Haemophilus parainfluenzae, up to 35% of H. influenzae isolates

are resistant, usually because of β-lactamase production. Ampicillin is more effective against

Salmonellae. Both of these agents are degraded by β-lactamase and are inactive against many

Enterobacteriaceae and Pseudomonas spp. (Yao and Moellering, 2007). The carboxypenicillins

and ureidopenicillins have increased activity against gram-negative bacteria that are resistant to

ampicillin. Although, these drugs are susceptible to Staphylococcal penicillase, they are more

stable against hydrolysis by the β-lactamases of Enterobacteriaceae and Pseudomonas

aeruginosa. Carbenicillin and ticarcillin are relatively active against streptococci as well as

against Haemophilus spp., Neisseria spp., and a variety of anaerobes.

75
Fig. 2.12 Chemical structures of Penicillins and Cephalosporins

They inhibit Enterobacteriaceae but are inactive against Klebsiella spp. Although,

carboxypenicillins such as carbenicillin are not particularly active against the enterococci, they

may act synergistically with aminoglycosides against these organisms (Yao and Moellering,

2007). The ureidopenicillins such as piperacillin have greater in vitro activity against

streptococci and enterococci than do the carboxypenicillins, and they inhibit more than 75% of

Klebsiella spp. They have excellent activity against many Enterobacteriaceae of the Bacillus

fragilis group. These agents also act synergistically with aminoglycosides against Pseudomonas

aeruginosa (Yao and Moellering, 2007).

2.6.2 Cephalosporins

Acremonium chrysogenum (formerly named Cephalosporium acremonium) is the industrial

producer of the pharmaceutical relevant β-lactam antibiotic, cephalosporin C. Acremonium

chrysogenum was isolated from seawater close to a sewage outfall area at Cagliari (Sardinia,

Italy) in 1945 by Giuseppe Brotzu and was found to produce, among other antibiotics, a β-lactam

compound designated cephalosporin C, which is structurally related to penicillin. Today,

cephalosporin derivatives are widely used in the treatment of infectious diseases and are one of

76
the world‘s major biotechnological products, with a total world market of about $10 billion

(Poggeler et al., 2008). Cephalosporins contain a 7-aminocephalosporanic acid nucleus, which

consists of a β-lactam ring fused to a dihydrothiazine ring. Various substitutions at positions 3

and 7 alter their antibacterial activities and pharmacokinetic properties. The addition of a

methoxy group at position 7 of the β-lactam ring results in a new group of compounds called

cephamycins, which are highly resistant to a variety of β-lactamases (Yao and Moellering, 2007).

Cephalosporins have a mechanism of action identical to that of the penicillins, in that they

interfere with synthesis of the bacteria cell wall and so are bactericidal. However, the basic

chemical structure of the two differs in other respects, resulting in some difference in the

spectrum of antibacterial activity (Bayarski, 2006). They are classified by a well-accepted but

somewhat arbitrary scheme of grouping by generations based on general features of their

antibacterial activity (Yao and Moellering, 2007).

The first-generation (narrow spectrum) drugs have good activity against gram positive organisms

and relatively modest activity against gram-negative organisms. They are active against

penicillin-susceptible and resistant S. aureus as well as Streptococcus pnemoniae, S. pyogenes,

and other aerobic and anaerobic streptococcus. Methicillin-resistant S. aureus (MRSA),

Staphylococcus epidermidis, and enterococci are resistant. Some Enterobacteriaceae, including

many strains of E. coli, Klebsiella spp., and Proteus mirabilis, are susceptible. Pseudomonas spp.

(including P. aeruginosa), many Proteus spp., and Serratia and Enterobacter spp. are resistant.

These agents are active against penicillin-susceptible anaerobes except members of the Bacillus

fragilis group. They have only modest activity against H. influenzae (Yao and Moellering, 2007).

77
The second-generation (expanded-spectrum) cephalosporins are stable against certain β-

lactamases found in gram-negative bacteria and, as a result, have increased activity against gram-

negative organisms. They are also more active than narrow-spectrum drugs against E. coli,

Klebsiella spp. and Proteus spp. Their activity also extends to cover some Enterobacter and

Serratia strains, and they have good activity against Haemophilus spp., Neisseria spp., and many

anaerobes (Yao and Moellering, 2007).

Third-generation (broad spectrum) cephalosporins are generally less active than the narrow-

spectrum agents against gram-positive cocci, but they are much more active against the

Enterobacteriaceae and P. aeruginosa. Their potent broad spectra of activity against gram-

negative organisms are due to their stability against β-lactamases and their ability to pass through

the outer cell envelopes of gram-negative rods. Cefotaxime inhibits more than 90% of strains of

Enterobacteriaceae, including those resistant to aminoglycosides (Yao and Moellering, 2007).

They have the advantage of convenient dosing schedules, but they are expensive (Bayarski,

2006).

Table 2.1 Groups and examples of β-lactam antimicrobial agents

β lactam groups Examples of Antimicrobial Agents

PENICILLINS Penicillin G, Penicillin

Penicillinase resistant penicillins

methicillin, nafcillin, oxacillin, cloxacillin

Aminopenicillins: ampicillin, amoxicillin

Carboxypenicillins: Carbenicillin, ticarcillin

78
 Ureidopenicillins Meiocillin, piperacillin

CEPHALOSPORINS First generation cefazolin, cephalothin,

cephalexin

Second generation
cefuroxime, cefaclor, cefamandole,
cefamycins (cefotetan,cefoxitin)

Third generation: cefotaxime, ceftriaxone,

cefpodoxime, ceftizoxime, cefoperazone,
ceftazidime

Fourth generation cefepime, cefpirome

CARBAPENEMS imipenem, meropenem,ertapenem

MONOBACTAMS Aztreonam
(Samaha-Kfoury and Araj, 2003)

The fourth generation cephalosporins are extended spectrum agents with similar activity against

gram-positive organisms as first generation extended spectrum. They also have a greater

resistance to β-lactamases than the third generation cephalosporins. Many fourth generation

cephalosporins can cross blood brain barrier and are effective in meningitis (Bayarski, 2006).

2.6.3 Monobactams

Unlike other β-lactams, the monobactams contains a nucleus with no fused ring attached. Thus,

there is less probability of cross-sensitivity reactions (Beta-lactam Antibiotic, 2013). Aztreonam

is the only monobactam antibiotic currently in clinical use. The monobactams are β-lactams with

various side chains affixed to a monocyclic nucleus. Aztreonam binds primarily to penicillin

binding proteins (PBP 3) of gram-negative aerobes, including Pseudomonas aeruginosa, thereby

disrupting bacteria cell wall synthesis. It is not hydrolyzed by most commonly occurring

plasmid-mediated and chromosomally mediated β-lactamases, and it does not induce the
79
production of these enzymes. The antibacterial activity of aztreonam is limited to aerobic gram-

negative rods, inhibiting most Enterobacteriaceae, Neisseria spp. and Haemophilus spp. Bacterial

tolerance and inoculum effect are generally not seen with this agent. Aztreonam is not active

against gram-positive bacteria or anaerobes (Yao and Moellering, 2007).

Fig. 2.13 Chemical structure of aztreonam

2.6.4 Carbapenems

The carbapenems are structurally very similar to the penicillins, but the sulfur atom in position 1

of the structure has been replaced with a carbon atom, and hence the name of the group, the

carbapenems (Carbapenem: Structure, 2010). They are a unique class of β-lactam agents with the

widest spectrum of antibacterial activity of the currently available antibiotics. Structurally, they

differ from β-lactams in having a hydroxyethyl side chain in trans configuration at position 6 and

lacking a sulphur or oxygen atom in the bicyclic nucleus. The unique stereochemistry of the

hydroxyethyl side chain confers stability against β-lactamases.Carbapenem antibiotics have an

important niche in that they retain activity against the chromosomal cephalosporinases and

extended-spectrum beta-lactamases found in many gram-negative pathogens (Quale and

Spelman, 2011).

80
www.chemicalbook.com/chemicalProductProperty

Fig. 2.14 Carbapenem: Structure

Imipenem (N-formimidoyl thienamycin), a semi synthetic derivative of thienamycin produced by

Stretomyces spp., meropenem and ertapenem are the carbapenems currently available for clinical

use. Carbapenems bind to PBP 1 and PBP 2 of gram-negative and gram-positive bacteria,

causing cell elongation and lysis. More than 90% of Enterobacteriaceae, including those resistant

to other β-lactams and aminoglycosides are susceptible to carbanepems. They are highly active

against clinical isolates of extended spectrum β-lactamase-producing Klebsiella pneumonia and

E.coli (Yao and Moellering, 2007). They are the most potent β-lactams against anaerobes, with

activities comparable to those of clindamycin and metronidazole. Yao and Moellering (2007)

stated that they are excellent in vitro activities against aerobic gram-positive species but

methicillin-resistant Staphylococci are usually resistant to all carbapenems. The drug may show

in vitro antagonism when combined with broad-spectrum cephalosporins or extended-spectrum

penicillins as a result of its ability to induce class 1 β-lactamase production (Yao and Moellering,

2007). The emergence of carbapenem-hydrolyzing beta-lactamases has threathened the clinical

81
utility of this antibiotic class and brings us a step closer to the challenge of ‗extreme drug

resistance‘ in gram-negative bacilli (Quale and Spelman, 2011).

2.7 Susceptibility Test Methods

Antimicrobial susceptibility testing methods are in vitro procedures used to determine

antimicrobial resistance in individual bacterial isolates. Antibiotic sensitivity testing aims to

determine the susceptibility of an isolate to a range of potential therapeutic agents. There are

several antimicrobial susceptibility testing methods available today, and each one has its

respective advantages and disadvantages. They all have one and the same goal, which is to

provide a reliable prediction of whether an infection caused by a bacterial isolate will respond

therapeutically to a particular antibiotic treatment. These data may be utilized as guidelines for

chemotherapy, or at the population level as indicators of emergence and spread of resistance

based on passive or active surveillance (Microbiology module, 2013). The choice of

methodology to be used in individual laboratories may be based on factors such as relative ease

of performance, cost, flexibility in selection of drugs for testing, use of automated or semi

automated devices to facilitate testing, and the perceived accuracy of the methodology

(Jorgensen and Turnidge, 2007). Here is an overview of commonly used susceptibility testing

methods.

2.7.1 Disk diffusion method

In the disk diffusion method or Kirby-Bauer method, a standard quantity of the causative

organism is uniformly spread over an agar plate. Then, the several filter paper disks impregnated

with specific concentrations of selected chemotherapeutic agents are placed on the agar surface.

82
The disk diffusion susceptibility method is simple and practical and has been well standardized.

The test is performed by applying a bacterial inoculum of approximately 1–2 x 108 cfu/ml to the

surface of a large (150 mm diameter) Mueller-Hinton agar plate. Plates are incubated for 16–24 h

at 350C prior to determination of results (Jorgensen and Ferraro, 2009). During incubation, each

chemotherapeutic agent diffuses out from the disk in all directions. Agents with lower molecular

weights diffuse faster than those with higher molecular weights. Clear areas, called zones of

inhibition, appear on the agar around disks where the agents inhibit the organism. The size of a

zone diameter of inhibition is not necessarily a measure of the degree of inhibition because of

differences in the diffusion rates of chemotherapy. An agent of large molecular size might be a

powerful inhibitor even though it might diffuse only a small distance and produce a small zone

of inhibition. Standard measurements of zone diameters for particular media, quantity of

organisms, and drug concentrations have been established and correlated to zone diameters

(Black, 2005). The diameter of the zones of complete inhibition is measured (as judged by the

unaided eye), including the diameter of the disk. The Petri-dish is held a few inches above a

black, non reflecting background illuminated with reflected light. The zone margin is considered

the area showing no obvious, visible growth that can be detected with the unaided eye (CLSI,

2008). The diameter of the zone is related to the susceptibility of the isolate and to the diffusion

rate of the drug through the agar medium. The zone diameters of each drug are interpreted using

the criteria published by the Clinical and Laboratory Standards Institute (CLSI, formerly the

National Committee for Clinical Laboratory Standards or NCCLS) for the disks. The results of

the disk diffusion test are ―qualitative,‖ in that a category of susceptibility (i.e., susceptible,

intermediate, or resistant) is derived from the test (Jorgensen and Ferraro, 2009).

83
Fig. 2.15 Agar plate of disk diffusion test showing different sizes of zones of inhibition

The three interpretative categories are defined as follows. Susceptible indicates that an infection

caused by the tested microorganism may be appropriately treated with the usually recommended

dose of antibiotic. Intermediate indicates that the isolate may be inhibited by attainable

concentrations of certain drugs (e.g., the beta-lactams) if higher dosages can be used safely or if

the infection involves a body site indicating that the drug is physiologically concentrated (e.g.,

the urinary tract). The intermediate category also serves as a buffer zone that prevents slight

technical artifacts from causing major interpretive discrepancies. Resistant isolates are not

inhibited by the concentration of antimicrobial agent normally achievable with the recommended

dose and / or yield results that fall within a range indicating that specific resistance mechanisms

are likely to be present (Jorgensen and Turnidge, 2007). The advantages of the disk method are

the test simplicity that does not require any special equipment, the provision of categorical

results easily interpreted by all clinicians, and flexibility in selection of disks for testing. It is the

least costly of all susceptibility methods. The disadvantages of the disk test are the lack of

mechanization or automation of the test. Although not all fastidious or slow growing bacteria can

be accurately tested by this method, the disk test has been standardized for testing several

organisms such as streptococci, Haemophilus influenzae, and N. meningitides through use of

84
specialized media, incubation conditions, and specific zone size interpretive criteria (Jorgensen

and Ferraro, 2009).

2.7.2 Dilution method (broth and agar dilution method)

One of the earliest antimicrobial susceptibility testing methods was the macro broth or tube-

dilution method. This procedure involved preparing two-fold dilutions of antibiotics (e.g., 1, 2, 4,

8, and 16 mg/ml) in a liquid growth medium dispensed in test tubes. The antibiotic containing

tubes were inoculated with a standardized bacterial suspension of 1–5 x105 cfu/ml. Following

overnight incubation at 350C, the tubes were examined for visible bacterial growth as evidenced

by turbidity. The lowest concentration of antibiotic that prevented growth represented the

minimal inhibitory concentration (MIC). The advantage of this technique was the generation of a

quantitative result (i.e., the MIC) (Jorgensen and Ferraro, 2009). Finding an inhibitory agent by

the dilution method does no more to prove that it will kill the infectious organism in the patient

than finding one by the disk diffusion method. However, the dilution method allows a second

test to distinguish between bactericidal agents, which kill microorganisms, and bacteriostatic

agents, which merely inhibit their growth. Samples from tubes that show no growth but that

might contain inhibited organisms can be used to inoculate broth that contains no

chemotherapeutic agent. In this test, the lowest concentration of the chemotherapeutic agent that

yields no growth following this second inoculation, or subculturing, is the minimum

bactericidal concentration (MBC). Thus, both an effective chemotherapeutic agent and an

appropriate concentration to control an infection can be determined. That concentration should

be maintained at the sites of infection because it is the minimum concentration that will cure the

disease (Black, 2005). The principal disadvantages of the macro dilution method were the

tedious, manual task of preparing the antibiotic solutions for each test, the possibility of errors in

85
preparation of the antibiotic solutions, and the relatively large amount of reagents and space

required for each test (Jorgensen and Ferraro, 2009).

The miniaturization and mechanization of the test by use of small, disposable, plastic ―micro

dilution‖ trays has made broth dilution testing practical and popular. (Jorgensen and Ferraro,

2009).

Fig. 2.16 A broth micro dilution susceptibility panel and disposable tray inoculators

Standard trays contain 96 wells, each containing a volume of 0.1 ml that allows approximately

12 antibiotics to be tested in a range of 8 two-fold dilutions in a single tray Micro dilution panels

are typically prepared using dispensing instruments that aliquot precise volume of pre-weighed

and diluted antibiotics in broth into the individual wells of trays from large volume vessels.

Hundreds of identical trays can be prepared from a single master set of dilutions in a relatively

brief period (Jorgensen and Ferraro, 2009).

86
Few clinical microbiology laboratories prepare their own panels; instead frozen or dried micro

dilution panels are purchased from one of several commercial suppliers. Inoculation of panels

with the standard 5 x105 cfu/ml is accomplished using a disposable device that transfers 0.01 to

0.05 ml of standardized bacterial suspension into each well of the micro dilution tray or by use of

a mechanized dispenser. Following incubation, MICs are determined using a manual or

automated viewing device for inspection of each of the panel wells for growth. The advantages

of the micro dilution procedure include the generation of MICs, the reproducibility and

convenience of having pre-prepared panels, and the economy of reagents and space that occurs

due to the miniaturization of the test. There is also assistance in generating computerized reports

if an automated panel reader is used. The main disadvantage of the micro dilution method is

some inflexibility of drug selections available in standard commercial panels‘ growth. The

advantages of the micro dilution procedure include the generation of MICs, the reproducibility

and convenience of having pre-prepared panels, and the economy of reagents and space that

occurs due to the miniaturization of the test. There is also assistance in generating computerized

reports if an automated panel reader is used. The main disadvantage of the micro dilution method

is some inflexibility of drug selections available in standard commercial panels (Jorgensen and

Ferraro, 2009).

A procedure similar to broth dilution is agar dilution. Agar dilution method follows the principle

of establishing the lowest concentration of the serially diluted antibiotic concentration at which

bacterial growth is still inhibited (Microbiology module, 2013).

2.7.3 Antimicrobial gradient method

87
The antimicrobial gradient diffusion method uses the principle of establishment of an

antimicrobial concentration gradient in an agar medium as a means of determining susceptibility

(Jorgensen and Ferraro, 2009). It is a newer version of the diffusion test, called the E-

(epsilometer) test uses a plastic strip containing a gradient of concentration of antibiotic. Printed

on the strips are concentration values which allow the laboratory technician to directly read off

the minimum concentration needed to inhibit growth (Black, 2005). This method provides for a

convenient quantitative test of antibiotic resistance of a clinical isolate. However, a separate strip

is needed for each antibiotic, and therefore this method can be expensive (Microbiology module,

2013).

Fig. 2:17 The E-test gradient diffusion method

As many as 5 or 6 strips may be placed in a radial fashion on the surface of an appropriate 150-

mm agar plate that has been inoculated with a standardized organism suspension like that used

for a disk diffusion test. After overnight incubation, the tests are read by viewing the strips from

88
the top of the plate. The MIC is determined by the intersection of the lower part of the ellipse

shaped growth inhibition area with the test strip. The gradient diffusion method has intrinsic

flexibility by being able to test the drugs the laboratory chooses. This method is best suited to

situations in which an MIC for only 1 or 2 drugs is needed or when a fastidious organism

requiring enriched medium or special incubation atmosphere is to be tested (e.g., penicillin and

ceftriaxone with pneumococci). Generally, E-test results have correlated well with MICs

generated by broth or agar dilution methods. However, there are some systematic biases toward

higher or lower MICs determined by the E-test when testing certain organism-antimicrobial

agent combinations. This can represent a potential shortcoming when standard MIC interpretive

criteria derived from broth dilution testing are applied to E-test MICs that may not be identical

(Jorgensen and Ferraro, 2009).

2.7.4 Automated methods

Automated methods are now available to identify pathogenic organisms and to determine which

antimicrobial agents will effectively combat them (Black, 2005). These commercial systems

have been developed to provide conveniently prepared and formatted micro-dilution panels as

well as instrumentation and automated reading of plates. These methods are intended to reduce

technical errors and lengthy preparation times. Most automated antimicrobial susceptibility

testing systems provide automated inoculation, reading and interpretation. These systems have

the advantage of being rapid (some results can be generated within hours) and convenient, but

one major limitation for most laboratories is the cost entailed in initial purchase, operation and

maintenance of the machinery (Microbiology module, 2013). Machines vary in their degree of

automation and the speed with which results become available. Some require technicians to

perform some steps; others provide results in 3 to 6 hours and most provide them overnight,

89
although slow-growing organisms may require 48 hours (Black, 2005). Some examples of these

include: Vitek System (bioMerieux, France), Walk-Away System (Dade International,

Sacramento, Calif.), Sensititre ARIS (Trek Diagnostic Systems, East Grinstead, UK), Avantage

Test System (Abbott Laboratories, Irving, Texas), Micronaut (Merlin, Bornheim-Hesel,

Germany), Phoenix (BD Biosciences, Maryland) and many more (Microbiology module, 2013).

2.7.5 Mechanism-specific tests

Resistance may also be established through tests that directly detect the presence of a

particular resistance mechanism. For example, beta lactamase detection can be

accomplished using an assay such as the chromogenic cephalosporinase test

(Cefinase disk by BD Microbiology Systems, Cockeysville, MD and BBL DrySlide

Nitrocefin, Becton Dickinson, Sparks, MD) and detection for chloramphenicol modifying

enzyme chloramphenicol acetyltransferase (CAT) may utilize commercial colorimetric

assays such as a CAT reagent kit (Remel, Lenexa, Kansas) (Microbiology module,

2013).

2.7.6 Genotypic methods

90
Since resistance traits are genetically encoded, we can sometimes test for the specific

genes that confer antibiotic resistance. However, although nucleic acid-based

detections systems are generally rapid and sensitive, it is important to remember that

the presence of a resistance gene does not necessarily equate to treatment failure,

because resistance is also dependent on the mode and level of expression of these

genes. Some of the most common molecular techniques utilized for antimicrobial

resistance detection are as follows:

2.7.6.1 Polymerase chain reaction (PCR)

Polymerase chain reaction (PCR) is one of the most commonly used molecular

techniques for detecting certain DNA sequences of interest. This involves several cycles

of denaturation of sample DNA, annealing of specific primers to the target sequence (if

present), and the extension of this sequence as facilitated by a thermo stable

polymerase leading to replication of a duplicate DNA sequence, in an exponential

manner, to a point which will be visibly detectable by gel electrophoresis with the aid of

91
a DNA-intercalating chemical which fluoresces under UV light. (Microbiology module,

2013).

2.7.6.2 DNA hybridization

This is based on the fact that the DNA pyrimidines (cytosine and thymidine) specifically

pair up with purines (guanine and adenine; or uracil for RNA). Therefore, a labeled

probe with a known specific sequence can pair up with opened or denatured DNA from

the test sample, as long as their sequences complement each other. If this

“hybridization” occurs, the probe labels this with a detectable radioactive isotope,

antigenic substrate, enzyme or chemiluminescent compound. Whereas if no target

sequence is present or the isolate does not have the specific gene of interest, no

attachment of probes will occur, and therefore no signals will be detected (Microbiology

module, 2013).

2.7.6.3 Modifications of PCR and DNA hybridization

With the above basic principles, several modifications have been introduced which

further improve the sensitivity and specificity of these standard procedures. Examples of

92
such development were the use of 5’-fluorescence-labeled oligonucleotides, the

development of molecular beacons, development of DNA arrays and DNA chips, among

many others. (Microbiology module, 2013).

2.8 Antimicrobial Resistance

Antimicrobial resistance is a broad term with many meanings. It describes the response of a

multitude of microbes to a variety of agents by many different mechanisms. Broadly, it refers to

the ‗temporary or permanent ability of an organism and its progeny to remain viable and / or

multiply under conditions that would destroy or inhibit other members of the strain‘. Resistance

to antibiotics is generally genetically based and progeny of antibiotic-resistant bacteria are also

resistant. It can also result from spontaneous mutation in the absence of antibiotic use (McEntire

and Montville, 2007). Intrinsic characteristics or chromosomal resistance to antibacterial

substances depends upon mutants to emerge. Plasmid-mediated resistance (R-factor or acquired

resistance) is more complex (Evermann, 2000).

An increasing health problem is the appearance and spread of antimicrobial resistance (Rijavec

et al., 2007). The use, over-use, and misuse of antibiotics have led to an alarming increase in the

frequency of human pathogens that do not respond to antibiotic therapy, underscoring the need

for new antibiotics and a better understanding of the origins of antibiotic resistance (Donato et

al., 2010). The use of antibiotics in the treatment of clinical enteric infection has been heavily

93
compromised by emerging multidrug-resistant microbes (Rayamajhi et al., 2010). Antibiotic

resistance has been classified by the WHO as one of the three major public health threats of the

21st century (Lachmayr et al., 2009). It poses a significant, serious and increasing threat to

modern health care. Patients infected with or colonized by resistant pathogens are reported to

suffer greater mortality, require longer hospital stay, and cost the health service substantially

more than patients with antimicrobial-sensitive infections (Hunter et al., 2008).

Bacterial antibiotic-resistance can be either intrinsic or acquired. Intrinsic resistance is a natural

resistance present in all strains of a bacterial species, while acquired resistance is often

identifiable as a resistance found in only a certain number of members of a particular species.

Although intrinsic resistance is generally accepted to be non-transferable, acquired resistance

may be more easily transferred to other bacterial species, particularly if the resistance trait is

located on a plasmid in the carrier strain (Rosander et al., 2008). Identification of the main route

of the evolution of antibiotic resistance and its transmission to humans is essential for effective

mitigation (Manuzon et al., 2007). While there may be several contributing causes for the

increase in antimicrobial resistance in pathogenic bacteria, most researchers focus on increased

use of antimicrobial agents (Wagner et al., 2008). The use of antibiotics in treatments or as food

supplements for farm animals leaves behind drug-resistant microbes in milk, eggs and meat that

could encourage the development of resistant traits and transfer to other bacteria, making

consumers more vulnerable to the resistant varieties (Denwe, 2006). There is evidence that

antimicrobial use in animals select for resistance in both pathogenic and commensal organisms

(Wagner et al., 2008). A commensal organism of interest, Escherichia coli, may serve as

reservoir of transferable antimicrobial resistance genetic elements. Laboratory based studies have

94
shown that E .coli is capable of transferring resistance to other bacterial species, such as

Salmonella spp., which are disseminated through the human food chain. This mechanism of

transfer has been shown to occur within and between many different bacterial genera and has

been proposed to be a major cause behind the rapid spread of resistance genes during the last five

decades (Wagner et al., 2008). In developed countries, the main reservoirs for antimicrobial drug

resistance in enteric bacteria have been attributed to farm animals such as cattle, sheep, pigs and

poultry. Contact with these animals or consumption of food products from them has been the

main route of dissemination of resistance into the human populations. Therefore, transmission of

drug resistant bacteria from farms into the community and subsequently to patients in hospital

may occur through food. This demonstrates how resistant bacteria arising from indiscriminate

use of antibiotics in animals may impact on human health (Ombui et al., 2000).

The ‗prudent use of antimicrobials‘ has become a major objective of the human and veterinary

medical care establishment. The possibility of resistant organisms passing from animals to

humans has been recognized by the World Organization of Animal Health and the World Health

Organization (Wagner et al., 2008). Consequently, the role of antimicrobial administration and

the extent to which it affects the development of resistance in animals are receiving much

attention (Sharma et al., 2008). In North America, antibiotics are widely used in beef cattle

production as prophylactics or antimicrobial growth promoters (AGP). Used in this manner,

antibiotics are generally administered in the diet either at times of high disease risk or on a

continuous basis to improve feed efficiency. Employment of AGP in this manner may increase

the prevalence of commensal antimicrobial-resistant bacteria (Alexander et al., 2009).

95
A major public health concern is that use of third-generation cephalosporins, such as ceftiofur, in

food animals is leading to resistance to other extended-spectrum cephalosporins, such as

ceftriaxone and cephamycins, a group of antimicrobial agents used to treat a wide variety of

human infections (Dutil et al., 2010). Antimicrobial usage for livestock can be for therapeutic,

prophylactic, metaphylactic, or growth promotion purposes. Reportedly, 90% of the

antimicrobials used in animal agriculture are for growth promotion and prophylaxis and this

widespread use is suggested to be an important contributor to the emergence, selection and

dissemination of antimicrobial-resistant bacteria, as indicated in recent studies (Sharma et al.,

2008). Antibiotic resistant bacteria, including Escherichia coli, are frequently isolated from

commensal gut flora of food animals, and although the resistance they carry may not be a

problem per se, the transfer of resistant elements to zoonotic pathogens inhabiting the gut has

serious implications for animal and human health (Sharma et al., 2008). Antimicrobial drug

resistance phenotype is commonly described in terms of the resistance characteristics of the

organism. These characteristics are constitutionally based intrinsic characteristics of the

organism or resistance factors acquired through induced genetic expression or gene transfer

between organisms (MacPherson et al., 2009).

2.8.1 Beta lactamases

The ability of bacteria to produce enzymes that destroy the β-lactam antibiotics began even

before penicillin was developed. The first β-lactamase was identified in an isolate of Escherichia

coli in 1940 (Turner, 2005). Beta lactamases are enzymes which inactivate (susceptible) β-lactam

antibiotics by hydrolyzing the β- lactam ring (Singleton, 1997). Enzymatic inactivation of

96
antibiotics occurs with several of the natural product antibiotic classes but has not yet been

observed as a major route of resistance development for some classes of synthetic antibacterials:

the sulfamethoxazone-trimethoprim combination, the fluoroquinolones, or the oxazolidinones.

The most widespread mode of clinical resistance development to β-lactam antibiotics is the

expression of β-lactamases that hydrolyze the antibiotic (Walsh, 2003). Many of the 2nd and 3rd

generation penicillins and cephalosporins were specifically designed to resist the hydrolytic

action of major β-lactamases. However, new β-lactamases emerged against each of new classes

of β-lactams that were introduced and caused resistance. In fact, since β-lactam antibiotics came

into clinical use, β-lactamases have evolved with them (Okesola and Makanjuola, 2009).

Although β-lactamases are estimated to have existed for the past 2 billion years, their evolution

and spread have been highly correlated to the anthropogenic development and prolificacy of β-

lactam antibiotics during the past 60 years (Lachmayr et al., 2009).

Two systems are commonly used to classify beta-lactamases: the Ambler scheme and the Bush-

Medeiros-Jacoby system. They are summarized in the Table 2.2. Both systems are used

interchangeably in literature: ESBLs belong to group 2be in the Bush-Medeiros-Jacoby system

and to class A in the Ambler system (Perez et al., 2007). β-lactamase enzymes destroy the β-

lactam ring by two major mechanisms of action. Firstly, most common β-lactamases have a

serine based mechanism of action. They are divided into three classes (A, C and D) on the basis

of the amino acid sequences. They contain an active site consisting of a narrow longitudinal

groove, with a cavity on its floor (the oxyanion pocket), which is loosely constructed in order to

have conformational flexibility in terms of substrate binding. These enzymes are active against

many penicillins, cephalosporins and monobactams. Secondly, a less commonly encountered

97
group of β-lactamases is the metallo β-lactamases, or class B β-lactamases (Samaha-Kfoury and

Araj, 2003). The class B lactamases are zinc enzymes, containing a binuclear zinc cluster in the

active site. Unlike the class A, C and D lactamases, which do lactam ring opening via covalent

acyl enzyme intermediate , the class B lactamases use zinc to activate a water molecule and

catalyze its direct addition to the β-lactam ring (Walsh, 2003).

Table 2.2 Classification of beta-lactamases.

Bush-Jacoby- Major
Ambler System Main attributes
Medeiros system subgroups
Group 1 – C Usually chromosomal; Resistance to

98
Bush-Jacoby- Major
Ambler System Main attributes
Medeiros system subgroups
cephalosporinases (cephalosporinases) all β-lactams except carbapenems; Not
inhibited by clavulanate
Group 2 A (serine β-
2a Staphylococcal penicillinases
penicillinases lactamases)
(clavulanic acid Broad-spectrum – TEM-1, TEM-2,
2b A
susceptible) SHV-1
Extended-spectrum – TEM-3–160,
2be A
SHV-2–101
2br A Inhibitor resistant TEM (IRT)
2c A Carbenicillin-hydrolyzing
Cephalosporinases inhibited by
2e A
clavulanate
Carbapenemases inhibited by
2f A
clavulanate
D(oxacillin-
2d Cloxacillin-hydrolyzing (OXA)
hydrolyzing)
Group 3 metallo-β- 3a B (metalloenzymes) Zinc-dependent
Lactamase Carbapenemases
3b B
3c B
Miscellaneous enzymes, most not yet
Not classified
Group 4 sequenced
(Perez et al., 2007).

The metallo β-lactamases of type B are thought to be the major sub-class of hydrolases that

destroy the carbapenem antibiotics such as imipenem (thienamycin) and meropenem. Many

bacteria that produce the type D metallo hydrolases also produce a type A, C or D lactamase; for

example, a clinical isolate of Serratia marcescens carries a type A and a type B bla gene on a

plasmid (Walsh, 2003). Resistant bacteria may transfer resistance genes to other bacteria and

become important in the spread of antibiotic resistance. Indiscriminate use of antimicrobial

agents and antibiotic sale behaviour (for example, sale of antibiotics without prescription, sale of

99
under dose and substituting brands) enhances the development of drug resistance (Ombui et al.,

2000).

2.8.2 Extended spectrum β- lactamases

The persistent exposure of bacterial strains to a multitude of β-lactams has induced a dynamic

and continuous production and mutation of β-lactamases in bacteria, expanding their activity

even against the third and fourth generation cephalosporins such as ceftazidime, cefotaxime and

cefepime and against aztreonam. Thus, these new β- lactamases are called extended spectrum β-

lactamases (Samaha-Kfoury and Araj, 2003). ESBLs, first isolated in 1983 in Germany, spread

rapidly to the rest of Europe, US and Asia and are now found all over the world. Being plasmid

mediated, they are easily transmitted among members of Enterobacteriaceae thus facilitating the

dissemination of resistance not only to β-lactams but to other commonly used antibiotics (Kumar

et al., 2006). Extended spectrum -lactamases (ESBLs) are a group of enzymes that break down

antibiotics belonging to the penicillin and cephalosporin groups and render them ineffective.

ESBLs have traditionally been defined as transmissible beta-lactamases that can be inhibited by

clavulanic acid, tazobactam or sulbactam, and which are encoded by genes that can be

exchanged between bacteria (Strama, 2007). They are enzymes mediating resistance to most

beta-lactams used in human and veterinary medicine, including expanded spectrum-

cephalosporins but excluding carbapenems and cephamycins (Valat et al., 2012). ESBLs

production is often plasmid-mediated. They share highly conserved amino acid sequence with

penicillin binding proteins (PBPs). They are known to attack amide bonds in the -lactam ring of

penicillins and cephalosporins (Jeong et al., 2004; Olonitola et al., 2007). The presence of ESBL

has been associated with increased mortality, longer duration of hospitalization and increased

hospital cost (Cornejo-Juarez et al., 2012). Many clinical laboratories are not fully aware of the
100
importance of ESBLs and how to detect them. Laboratories may also lack the resources to curb

the spread of these resistance mechanisms. This lack of understanding or resources is responsible

for a continuing failure to respond appropriately to prevent the rapid worldwide dissemination of

pathogens possessing these β-lactamases (Sharma et al., 2010).

ESBL has traditionally been defined as transmissible beta- lactamases that can be inhibited by

clavulanic acid, tazobactam or sulbactam, and which are encoded by genes that can be

exchanged between bacteria (Strama, 2007). Extended spectrum -lactamases (ESBLs) are

enzymes conferring broad resistance to penicillins, aztreonam and cephalosporins (with the

exception of cephamycins). They generally result from point mutations in the genes of broad-

spectrum β-lactamase such as TEM or SHV (Deschamps et al., 2009). There are four classes of

β-lactamases based on the primary sequence. Classes A, C, and D involve a serine residue in the

active site. Class B enzymes are less abundant and require a catalytic zinc for activity (Petrosino

and Palzkill, 1996).

101
 Mutations

Extended-Spectrum
β-Lactamases
(ESBLs)

Fig. 2: 19 Overview of classification and types of β-lactamases

(Petrosino and Palkill, 1996).

They are usually located on plasmids that often carry genes responsible for resistance to other

antimicrobial agents making it extremely difficult to treat infections caused by bacteria that

produce ESBL enzymes (Iroha et al., 2008). The production of extended-spectrum β-lactamases

(ESBLs) is a major mechanism of resistance to third- generation cephalosporins, and plasmid-

encoded ESBLs are mostly of the TEM, SHV or CTX-M types. Over the last decade, CTX-M

enzymes have replaced TEM and SHV mutants as the most prevalent ESBLs worldwide, with E.

coli as a major host. They have been reported in both hospital and community settings. They

have also been detected in pets and farm animals, products of the food chain and sewage

(Deschamps et al., 2009). ESBLs belong to group 2be in the Bush-Medeiros-Jacoby system and

102
to class A in the Ambler system (Perez et al., 2007). Resistance to extended-spectrum β-lactam

antibiotics is mainly caused by extended-spectrum β-lactamases (ESBLs) such as blaTEM, blaSHV

and blaCTX-M (Cullik et al., 2010).

2.8.2.1 TEM-type extended spectrum β- lactamases

The first plasmid-mediated β-lactamase in gram-negative bacteria, TEM-1, was described in

1965. This occurred in a strain of E. coli isolated from culture of blood from a patient in Greece

(the designation ―TEM‖ came from the patient‘s name, Temoniera), because this β-lactamase

was plasmid borne, it soon spread to other members of the Enterobacteriaceae family,

Haemophilus influenzae, Neisseria gonorrhoeae, and Pseudomonas aeruginosa (Turner et al.,

2005). Up to 90% of ampicillin resistance in E.coli is due to the production of TEM-1 (Lim et

al., 2009). This enzyme is able to hydrolyze penicillins and early cephalosporins such as

cephalothin and cephaloridine. TEM-type β-lactamases are most often found in E. coli and K.

pneumonia and also in other species of gram-negative bacteria with increasing frequency

(Bradford, 2001).

2.8.2 .2 SHV-type extended spectrum β- lactamases

The SHV enzymes, named after the ‗sulfhydryl variable‘ active site, are commonly associated

with Klebsiella pneumonia (Samaha-Kfoury and Araj, 2003). The native SHV-1 β-lactamase,

found primarily in K. pneumoniae, is a plasmid or chromosomally encoded-enzyme that confers

resistance to penicillins and first-generation cephalosporins. Specific mutations within the

blaSHV-1 to extended-spectrum cephalosporins and monobactam. Fewer ESBL variants have been

described (Rupp and Fey, 2003). The first extended-spectrum SHV enzyme was described in

1983 in clinical isolates of K. pneumonia, K. ozaenae and Serratia marcescens. Because of its

103
similarity to SHV-1 the new enzyme was named SHV-2. A single amino acid substitution alters

the spectrum of activity of the SHV-1 β-lactamase to encompass extended spectrum

cephalosporins. Glycine at position 238 in SHV-1 is replaced by serine in SHV-2 (Heritage et

al., 1999).

2.8.3 β-lactamase inhibitors

Further attempt to combat resistance due hydrolytic lactamases has led to the screening for

inhibitors and inactivators of lactamase activity and then combine these molecules with a β-

lactam. This approach has had success (Walsh, 2003). The inhibitors include clavulanic acid,

tazobactam and sulbactam (Beta-lactam Antibiotic, 2010). The first is the natural product

clavulanate, an enol- β-lactam from Streptomyces clavuligerus, the second class is represented by

penicillin sulfone and a substituted congener taxobactam (Walsh, 2003). Although, they exhibit

negligible antimicrobial activity, and they contain the β-lactam ring. Their sole purpose is to

prevent the inactivation of β-lactam antibiotics by binding to the β-lactamases (Beta-lactam

Antibiotic, 2010). They are not potent enough as β-lactam antibiotics to be used on their own, as

such; they are co-administered with β-lactam antibiotics as follows:

Clavulanate + Amoxicillin→ Augmentin

Clavulanate + Ticarcillin → Timentin

Sulbactam + Ampicillin → Unasyn

Tazobactam + Piperacillin → Zocin

The combination of amoxicillin and clavulanate, known as Augmentin, for the augmenting

powers that clavulanate confers to amoxicillin, has been the most widely used form of penicillin

104
in recent years (Walsh, 2003). In general, sulbactam, clavulanate and tazobactam are all potent

inhibitors of staphylococcal penicillinase; chromosomal beta-lactamases produced by

Bacteroides species, Proteus vulgaris, Haemophilus influenza, Neisseria gonorrhoeae, and type

IV enzymes of Klebsiella species. Although sulbactam possesses activity against TEM-1 and

TEM-2 beta-lactamases, it does not have reliable activity against SHV-1 beta-lactamases.

Clavulanate and tazobactam are potent inhibitors of both TEM and SHV-1 beta-lactamases. P.

aeruginosa and some Enterobacteriaceae produce an inducible, extremely potent, broad spectrum

enzyme (type 1 beta lactamase). Tazobactam is the only currently available beta lactamase

inhibitor with activity against type 1 beta-lactamases; however, some enzymes are not inhibited

by tazobactam (Rotschafer and Ostergard, 1995).

2.8.4 Methods of detecting ESBLs

Identifying organisms that are ESBL producers is a major challenge for the clinical microbiology

laboratory. It however, appears that there is a difference in the ability of various susceptibility-

testing methods used for detecting cephalosporin resistance in an ESBL –producing strain

(Bradford, 2001). The Clinical Laboratory Institute Standard (CLSI) has developed broth

microdilution and disk diffusion screening tests using selected antimicrobial agents. These

selected antimicrobial agents are known as indicator cephalosporins for screening ESBL

production in bacteria. They are cefpodoxime, ceftazidime, aztreonam, cefotaxime and

ceftriaxone. The use of more than one of the five antimicrobial agents suggested for screening

will improve the sensitivity of detection. Cefpodoxime and ceftazidime show the highest

sensitivity for ESBL detection (Rawat and Nair, 2010). A number of investigators have

suggested that either dilution tests or disk diffusion susceptibility tests performed with

105
cefpodoxime detected more ESBLs than other cephalosporins such as ceftazidime, cefotaxime

and ceftriaxone (Bradford, 2001).

Cefpodoxime and ceftazidime have therefore been proposed as indicators of ESBL production

as compared to cefotaxime and ceftriaxone. Hence, an institution where only cefotaxime and

ceftriaxone are used in the routine sensitivity testing panel may have difficulty in detecting

ESBLs (Chaudhary and Aggarwai, 2004). Ideally, all Enterobacteriaceae isolates should be

tested with both ceftazidime and cefotaxime as this achieves the best sensitivity and specificity in

ESBL detection. If only a single cephalosporin can be accommodated in the testing scheme, then

the best choice is cefpodoxime, which has good sensitivity for detection of ESBL producers but

poorer specificity than testing both cefotaxime and ceftazidime (ESBLs, 2013). Also, these

enzymes can be induced by certain antibiotics, amino acids or body fluids. Organisms possessing

genes for inducible β-lactamase show false susceptibility if tested in the uninduced state

(Chaudhary and Aggarwai, 2004).

Generally, an isolate is suspected to be an ESBL producer when it shows in vitro susceptibility to

the second generation cephalosporins (cefoxitin, cefotan) but resistant to the third generation

cephalosporins and to aztreonam. Moreover, one should suspect these strains when treatment

with these agents for Gram negative infections fails despite reported in vitro susceptibility. Once

an ESBL producing strain is detected, the laboratory is expected to report it as ‗resistance‘ to all

penicillins, cephalosporins, and aztreonam, even if they test as susceptible. Other antimicrobial

agents can be reported as they are tested (Samaha-Kfoury and Araj, 2003). Several tests have

been developed to confirm the presence of ESBLs (Chaudhary and Aggarwai, 2004).

106
2.8.4.1 Double disc synergy test (DDST)

In this test, discs of third generation cephalosporins and augmentin are kept 30 mm apart from

center to centre on inoculated Mueller-Hinton Agar (MHA). A clear extension of the edge of the

inhibition zone of cephalosporin towards augmentin disc is interpreted as positive for ESBL

production (Chaudhary and Aggarwai, 2004). ESBLs are inhibited by β-lactamase inhibitors like

clavulanic acid, sulbactam and tazobactam and the property of specific inhibition is utilized in

this test for the detection and confirmation of ESBLs (Kumar et al., 2006).

2.8.4.2 Three dimensional test

This test provides the advantage of simultaneous determination of antibiotic susceptibility and β-

lactamase substrate profile. Inoculum produced in this method contains between 109and 1010

cfu/ml of cells that actively produced β-lactamase. Two types of inocula are prepared, one disc

diffusion test inoculum (optical density equal to that of 0.5 McFarland standard) and a three

dimensional inoculum (contain between 109 and1010 CFU of cells). Plate is inoculated by disc

diffusion procedure. Circular silt is cut on the agar 4mm inside the position at which the

antibiotic discs are placed. Conventional (two dimensional) disc diffusion susceptibility test

results are measured according to the recommendations of Clinical Laboratory Standard Institute

(CLSI). Distortion or discontinuity in the circular inhibition zone is positive for ESBL

production (Chaudhary and Aggarwal, 2004).

2.8.4.3 Inhibitor potentiated disc diffusion test

Cephalosporin disc is placed on clavulanate containing and without clavulanate containing

Mueller Hinton Agar (MHA) plates. More than 10 mm increase in the zone of inhibition on the

107
clavulanate containing MHA plates indicates ESBL production (Chaudhary and Aggarwal,

2004).

2.8.4.4 Disc approximation test

Cefoxitin (inducer) disc is placed at a distance of 2.5cm from cephalosporin disc. Production of

inducible β-lactamase is indicated by flattening of the zone of inhibition of the cephalosporin

disc towards inducer disc by >1mm (Chaudhary and Aggarwal, 2004).

2.7.4.5 MIC reduction test

An 8 fold reduction in the MIC of cephalosporin in the presence of clavulanic acid indicates

production of ESBL (Chaudhary and Aggarwal, 2004).

2.8.4.6 Vitex ESBL test

Four wells containing cards are inoculated. A pre-determined reduction in growth of

cephalosporin well containing clavulanic acid: when compared with the level of growth in well

with cephalosporin alone indicates presence of ESBL (Chaudhary and Aggarwal, 2004).

2.8.4.7 E-test

The E-test ESBL strip carries two gradients, on the one end, ceftazidime and on the opposite end

ceftazidime plus clavulanic acid. MIC is interpreted as the point of intersection of the inhibition

ellipse with the E-test strip edge: Ratio of ceftazidime MIC and ceftazidime-clavulanic acid MIC

equal to or greater than 8 indicates the presence of ESBL (Chaudhary and Aggarwal, 2004).

2.8.5 Treatment of ESBLs

108
Of all the available β-lactams, carbapenems are the drug of choice for treating ESBL producing

bacteria (Samaha-Kfoury and Araj, 2003). They are most effective and reliable as they are highly

resistant to the hydrolytic activity of all ESBL enzymes, due to the trans-6- hydroxyethyl group.

Meropenem is the most active with MICs generally lower than those of imipenem (0.03-

0.12μg/ml vs 0.06-0.5μg/ml). Several new carbapenems, ertapenem and faropenem are being

studied in the various phases of clinical trials. Alternately, fluoroquinolones and

aminoglycosides may be used if they show in vitro activity. Although, clinical data for their use

are absent, a β-lactam- β-lactamase inhibitor combination such as amoxillin-clavulanate or

piperacillin-tazobactam may also be a further option to consider. All these agents should be used

with caution, however, as their susceptibility varies among ESBL producers. Cefamycins, such

as cefoxitin and cefotetan, although active in vitro, are not recommended for treating infections

caused by enzyme producing bacteria or otherwise used with caution, because of the relative

ease with which these strains decrease the expression of outer membrane proteins, rendering

them resistant (Samaha-Kfoury and Araj, 2003; Chaudhary and Aggarwal, 2004).

2.8.6 Prevention and Control

Proper infection control practices and barriers are essential to prevent spreading and outbreaks of

ESBL producing bacteria. Essential infection control practices should include hand washing by

hospital personnels, increased barrier precautions, and isolation of patients colonized or infected

with ESBL producers. Other practices that have minimized the spread of such organisms include

clinical and bacteriological surveillance of patients admitted to intensive care units and antibiotic

recycling, as well as policies of restriction, especially on the empirical use of broad spectrum

antimicrobial agents (Samaha-Kfoury and Araj, 2003). Several studies have shown that by

limiting the use of these agents alone or in combination with infection control measures, the

109
frequency of ESBL isolates can be reduced substantially. Educational programs for medical staff

to increase awareness also should be developed (Chaudhary and Aggarwal, 2004).

2.9 Plasmids and Antibiotic Resistance

Plasmids are usually extrachromosomal, circular, double stranded DNA molecules found in

diverse bacteria. They replicate autonomously from bacterial chromosome. (Carattoli, 2011).

Plasmids range in size from a few hundred to several hundred thousand base pairs and are

present in most bacterial species.

Plasmids allow the movement of genetic material, including antimicrobial resistance genes,

between bacterial species and genera. They frequently mediate resistance to multiple

antimicrobials and can result in the acquisition by a pathogen of resistance to all or most

clinically relevant antimicrobials (Sherley et al., 2004). Plasmids may contain 20-500 genes that

can carry resistance to a number of different antibacterial substances, as well as specific

virulence factors (Evermann, 2000).

Fig. 2:19 Bacterial genomic and plasmid DNA

110
The most notorious property of plasmids lies in their ability to disseminate antibiotic resistance

genes (Dale and von Schantz, 2003). Plasmids are a major cause of spread of bacterial resistance,

as they can be transferred between Gram negative bacteria by conjugation and Gram positive

bacteria by bacterial viruses called transducing phages. This transferability is responsible for

many outbreaks of resistance, especially when appropriate infection control measures are

breached in hospital settings (Samaha-Kfoury and Araj, 2003). Plasmid-associated resistance

genes have been discovered for a majority of the known antimicrobials, including the quinolones

and fluoroquinolones, and it is not uncommon for a single plasmid to simultaneously mediate

resistance to five or six antimicrobials (Sherley et al., 2004).

Antibiotic resistance is not the limit of the ability of plasmids, nor the reason for their existence.

Apart from resistance to antibiotics, accessory functional region of plasmids may also bear

resistance genes to heavy metals, disinfectants, production of colicins (bacteriocins),

degradation of various compounds, and virulence functions (Carattoli et al., 2005). Interest

tends to focus on antibiotic resistance because of its importance in medical Microbiology, and

because of the ease with which resistance genes can be isolated and studied. However, many

naturally occurring plasmids code for other properties or even for none at all. Plasmids exist

because they can replicate within bacteria, and sometimes spread from one bacterium to another.

They are a form of DNA parasite. Any advantage they confer on the host bacterium is a bonus

that helps the plasmid to survive (Dale and von Schantz, 2003).

Extended-spectrum β-lactamases (ESBLs) genes are located on plasmids that can be easily

transferred between and within bacterial species. Some ESBL genes are mutant derivatives of

established plasmid-mediated β-lactamases (e.g., blaTEM/SHV), and others are mobilized from the

111
environment (blaCTX-M) (Overdevest et al., 2011). They have an extended substrate profile which

allows the hydrolysis of all cephalosporins, penicillins, and aztreonam. These enzymes are most

commonly produced by Klebsiella sp. and Escherichia coli (Sharma et al., 2010).

CHAPTER 3

MATERIALS AND METHODS

3.1 Study Area

The Study Area is Ahmadu Bello University, main campus, Samaru, Zaria. Kaduna state,

Nigeria. Ahmadu Bello University was founded in 1962 from 3 previously independent

institutions; the Nigerian college of Arts, Science and Technology, Institute of Administration in

Tudun Wada area of Zaria, and the Regional Research Station of the Ministry of Agriculture now

the Institute for Agricultural Research. The University is situated in Samaru, Zaria in the Sabon

Gari Local Government area of Kaduna State. It is located on latitude 11° 15‘N to 11°3‘N of the

equator and longitude 7° 30‘E to 7°45‘E of Greenwich Meridian (Abbas and Arigbede, 2012).

3.2 Media, Reagents and Steriliations

112
The brands and formulation of media used in this study as well as composition of reagents are

stated in Appendices V and VI of this write up. The temperature conditions for incubations and

sterilizations are stated in the methodology.

3.3 Determination of Sample Size

The sample size was determined using the equation n= Z2 P (1-P) (Bland, 1999)
d2

Where

n = sample size

Z= 95% confidence interval = 1.96

P= prevalence rate =16.8 (Mansouri and Ramazanzadeh, 2009)

d= precision allowable error = 5% = 0.05

n= (1.96)2 0.17 (0.83) = 3.84 x 0.1411 = 0.5418 = 216.72

(0.05)2 0.0025 0.0025

n 217

This was rounded off to 300 samples

3.4 Collection of Food Samples

A total of three hundred (300) samples of ‗ready- to eat‘ food and drinks items (75 samples from

each item namely, ‗zoborodo‘, ‗kunun zaki‘, processed meat [‗suya‘] and smoked fish) were

purchased from sellers in stores and markets within A.B.U. main campus and its environs. The

food items were immediately transported to the laboratory for microbiological analyses.

3.5 Enrichment and Serial Dilution

113
Upon arrival at the laboratory, 25 ml/25 g of each food sample was homogenized in 225 ml of

buffered peptone water. A disinfected blender (using 70% ethanol for disinfection) was used to

obtain the homogenate in the case of the solid food samples. The homogenate was pre-enriched

by incubating for 18-24 hr at 37oC before serial dilution. Ten fold serial dilutions were prepared

at the end of the enrichment using 1% buffered peptone water as diluent (Valentine-Bon et al.,

2008).

3.6 Isolation of Test Organisms

Eosin Methylene Blue (EMB) agar was used for the differential and selective culturing of the

faecal coliforms at 44.5oC within 18-24 hr (Ajayi et al., 2008). Colonies which appear pinkish-

red on MacConkey agar plates were considered lactose fermenters (Chapin and Lauderable,

2007). While colonies with greenish-black appearance with metallic sheen on and those with

dark purple appearance with no sheen were considered as presumptive E. coli and Klebsiella sp.

respectively. Representatives of bacterial colony types with the above features were picked and

sub-cultured on sterile EMB plates by streaking and incubated at 44.5oC for 24 hr. The isolates

were purified by repeated streaking on plates until pure culture was obtained before storing on

nutrient agar slants at 4oC as working and stock cultures (Ogunshe et al., 2006).

3.7 Characterization of the Isolates

The presumptive isolates were further subjected to a series of biochemical tests, which include

carbohydrate fermentation test, indole test, methyl red and Voges Proskaur tests, citrate

utilization test, hydrogen sulphide production and motility tests (Farasat et al., 2012).

3.7.1 Carbohydrate utilization test

114
The purple base broth was used for carbohydrate (lactose) fermentation test. Precisely, 35 g/L of

DEV Lactose Peptone Broth (Merck, Germany) was dissolved in distilled water by heating

gently and dispensed 10 ml of the broth in test-tubes. Inverted Durham tubes were afterward

inserted into the base of the test-tubes to trap any gas produced. Sterilization was done by

autoclaving at 121oC for 15mins. After cooling, the sterile tubes were inoculated with a loop-full

each of 18-24 hr old organism growing in test tubes containing nutrient broth . These were

labelled and incubated at 37oC for 24 hr. An uninoculated fermentation tube was used as the

control. Colour change of broth from purple to yellow indicated acid production while formation

of bubble in Durham tube indicates gas production.

3.7.2 Sulphur Indole Motility (SIM) test

Sulphur Indole Motility (SIM) medium was used for three (3) tests in one.

3.7.2.1 Production of hydrogen sulphide (H2S)

This test was used to determine metabolism of certain sulphur- containing amino acids to

produce hydrogen sulphide. Organisms which formed a lot of sulphide form visible amounts of

black ferrous sulphide in SIM medium. The SIM medium was stab-inoculated with a suspension

of 18-24 hr old culture on loop straight into the medium and incubate at 350C for 24-48 hr.

Medium turned black in hydrogen sulphide positive test.

3.7.2.2 Indole test

This test detected the ability of an organism to produce indole from the amino acid tryptophan.

The organism was grown for 48 hr in the SIM medium and then Kovàc‘s indole reagent was

added at the surface of the tube. The closed container was gently shaken. In the positive test,

115
indole (present in the culture) dissolved in the reagent which then became pink or red, and

formed a layer at the surface of the medium (Singleton, 1997). In the negative test, no change

will occurred when Kovàc‘s reagent was added.

3.7.2.3 Motility test

The test showed the way an organism grows on solid media. The SIM medium was stab-

inoculated with culture on straight wire into the medium and incubated at 350C for 18-24 hr. The

motile organisms spread throughout the medium from the stab while the motility negative

bacteria only grew in the stabbed region of the medium (Singleton, 1997).

3.7.3 Citrate utilization test

This test detected the ability of an organism to use citrate as the sole source of carbon. Precisely,

24.28 g/L of Simmon‘s citrate agar was prepared according to manufacturer‘s instruction. A

saline suspension of the test organism was made from growth on a solid medium. Using a

straight wire, Simmon‘s citrate agar was stabbed-inoculated with the suspension and incubated at

30-35oC for five days. Bacteria with citrate permease uptook citric acid, causing alkaline end

products that changed pH indicator to blue., hence slant changed to blue; for the citrate

utilization negative organism slant, remained green (Singleton, 1997).

3.7.4 Methyl red (MR) test

The MR test detected the ability of an organism, growing in a phosphate-buffered glucose-

peptone medium, to produce sufficient acid (from the metabolism of glucose) to reduce pH of the

medium from 7.5 to about 4.4 or below. The glucose medium was inoculated with and then

incubated for at least 48 hours at 37oC, following which the pH of the culture was tested xby

116
adding a few drops of methyl red (yellow at pH 6.2, red at pH 4.4); with a MR-positive organism

the culture became red (Singleton, 1997).

3.7.5 Voges Proskauer (VP) test

The test detected the ability of an organism to form acetoin (acetyl-methylcarbinol). A

phosphate-buffered glucose-peptone medium was inoculated with the test strain and incubated at

37oC for 2 days. Some 0.6 ml of 5% α-napthol, and 0.2 ml of 40% potassium hydroxide solution,

were added sequentially to 1 ml of culture; the tube was then shaken vigorously, placed in a

sloping position (for maximum exposure of the culture to air), and examined after 30 and 60

minutes. Acetoin (where present) was apparently oxidized to diacetyl (CH3.CO.CO CH3) which,

under test conditions, gave a red colouration (a positive VP test). [Singleton, 1997]. The VP test

was used to aid in the differentiation between genera (such as E. coli from the Klebsiella and

Enterobacter groups) and other species of the Enterobacteriaceae family (Chapin and

Lauderable, 2007).

3.7.6 Identification of the isolates

Isolates giving atypical responses to any of the above named tests were examined further using

MicrogenTMGram negative Identification A system. The data obtained by the Microgen GN-ID

A microwell strip was designed to generate a 4 digit octal code which was used to interpret the

result by the Microgen Identification System Software (Appendices I &II).

3.8 Collection of Plant Materials

117
Healthy, disease-free leaves, bark and roots of Carica papaya were collected within A.B.U.

Zaria main campus. Authentication of the plant was carried out at the Herbarium, by a

Taxonomist, Mr. U.S. Gallah of the Department of Biological Sciences, Ahmadu Bello

University, Zaria. The voucher specimen number was 285.

3.9 Pretreatment of plant parts

The leaves were cleaned with cloth; roots were washed under running tap water and then spread

out along with the stem-bark in the laboratory to air-dry away from sunlight. After proper drying

has been ensured, the plant materials were pulverized by mechanical grinding using mortal and

pestle. These were then weighed, packed in nylon bags and labelled.

3.10 Preparation of Plant Extracts

Plant extraction was carried out using the Soxhlet method and maceration with separating

funnels.

3.10.1 Extraction using the Soxhlet method

The Soxhlet apparatus was used for the extraction of the dry stem bark. The coarse plant material

(stem bark, 568 g) was placed in a porous container made of cotton, called timble. Methanol was

added to the distilling pot as well as the timble to soak the plant material and the condensed

methanol from the pot to extract continuously. The methanol vapour generated by gently heating

the reservoir condensed and it was allowed to drip back onto the timble. The liquid condensate

that dripped onto the sample performed the extraction which then passed through the container

and back into the reservoir. The cycle was repeated continuously and sustained as long as needed

until a clear solvent was obtained from the timble. As the extraction of the stem extract

118
progressed the bioactive components were concentrated in the reservoir. This was transferred

onto an evaporatory dish and concentrated in vacuo at about 45-500C to obtain 99.88 g chocolate

brown mass of the stem bark residue which is equivalent to 17.58% (w/w) and coded Methanol

extract stem bark (MESB) [Beginners, 2013].

3.10.2 Extraction by maceration using separating funnels

The coarse leaves (300 g) and roots (468 g) were separately extracted by maceration using

separating funnels. The separating funnels were suspended in iron rings (retort stand). The

stoppers were removed and made sure the stop clocks were closed. The plant materials were

added to about half the volume of the funnels and 300 ml methanol-water was added as the

solvent in the ratio 70:30, then the stoppers placed on the tops. These were allowed to stand for

72 hr; forming two separate layers (see Appendix 4, plate 3). The stoppers were then removed,

and the liquid extracts were drained into clean containers. This was followed by washing the

funnels with about 150 ml each of the methanol: water mixture. The liquid extracts obtained

were poured in evaporatory dishes and concentrated in avacuo at about 45-500C. The open

vessels were left to evaporate the last traces of the solvent to obtain 58.66 g and 54.44 g of the

leaf and root residue respectively (Beginners, 2013). The leaf extract gave a black mass of

19.55% while root bark extract was 11.63%.

3.11 Phytochemical Screening

3.11.1 Detection of Carbohydrates

3.11.1.1 Molisch‘s test

119
Two to three drops of Molisch reagent were added to 2 g of extract in a test tube and a small

quantity of concentrated tetra-oxo-sulphate (iv) acid (H2SO4) was allowed to run down the side

of the test tube. The presence of a lower, purple to violet colour at the interface indicated the

presence of carbohydrates (Trease and Evans, 1983).

3.11.1.2 Fehlings test for reducing sugar

The residue was redissolved in 5 ml of water in the water bath. To 2 ml of the solution in the test

tube, 1ml each of Fehling‘s solutions A and B were added. The mixture was shaken and heated

in a water bath for 10 min. A brick-red precipitate indicated presence of reducing sugar

(Onwukaeme et al., 2007).

3.11.2 Detection of Glycosides

About 5 ml of conc. H2SO4 was added to the extract and boiled for 15 min. This was then cooled

and neutralized with 20% KOH and was divided into two portions. Another part of the extract

was dissolved in distilled water, this was used as a control; no acid hydrolysis.

3.11.2.1 Fehling’s solution test

Five millilitres each of Fehling‘s solutions A and B were added to the first portion and boiled for

three minutes. A brick-red precipitate indicated the glycone portion as a result of hydrolysis of

glycoside.

3.11.2.2 Ferric chloride test

120
Two to three drops of ferric chloride solution were added to the second portion. Green to black

precipitate indicated phenolic aglycone as a result of hydrolysis of glycosides (Trease and Evans,

1983).

3.11.2.3 Test for cardiac glycosides (Kella Killiani’s test)

About 2 g of extract was dissolved in 10 ml glacier acetic acid containing traces of ferric

chloride. The test tube was held at an angle of 45 degree, 1 ml of conc. H2SO4 was added down

the side. Purple ring colour at the interface indicated cardiac glycosides (Trease and Evans,

1983).

3.11.2.4 Kadde’s test

About 1 ml of 2% 3,5-dinitrobenzoic acid in 5 ml 95% alcohol was added to the 2 g of the

extract. The solution was made alkaline with 2 ml 5% sodium hydroxide; appearance of purple-

blue colour indicated the presence of cardenolides in the ring (Trease and Evans, 1983).

3.11.3 Detection of Saponins (Frothing test)

To about 0.5 g of the coarse powder in a test tube, 5 ml of distilled water was added and

vigorously shaken for about 30 sec. A persistent froth that last for at least 15 min indicated

presence of saponins (Ibrahim et al., 2006).

3.11.4 Detection of Flavonoids (Sodium hydroxide test)

Two to three drops of aqueous NaOH were added to 5 ml of extract, a yellow colouration

showed the presence of flavonoid (Trease and Evans, 1983).

121
3.11.5 Detection of Tannins (Ferric chloride test)

About 0.5 g of extract was dissolved in 10 ml of distilled water and filtered. Two to three drops

of ferric chloride solution were added to the filtrate. Formation of a blue-black precipitate

indicated hydrolysable tannins while green precipitate indicated the presence of condensed

tannin (Trease and Evans, 1983).

3.11.6 Detection of Alkaloids

3.11.6.1 Mayer’s test

Two to three drops of Mayer‘s reagent were added to the extract in a test tube. A cream

precipitate indicated presence of alkaloids.

3.11.6.2 Dragendoff’s test

Two to three drops of Dragendoff‘s reagent were added to the extract in a test tube. A rose red

precipitate indicated presence of alkaloids.

3.11.6.3 Wagner’s test

Two to three drops of Wagner‘s reagent were added to the extract in a test tube. A whitish

precipitate indicated presence of alkaloids.

3.11.7 Detection of Resins

A portion of 2 g of the extract was dissolved in 10 ml of acetic anhydride. One drop of conc.

H2SO4 was added. Appearance of purple colour, which rapidly changed to violet, indicated

presence of resins (Ibrahim et al., 2006).

122
3.11.8 Detection of Anthraquinone derivatives

3.11.8.1 Test for free anthraquinones (Borntrager’s test)

An amount of 5 g of the extract was shaken with 10 ml of benezene and filtered. Five millilitres

(5 ml) of 10% of ammonia solution was added to the filtrate and stirred. The production of a

pink-red or violet colour indicated the presence of free anthraquinones.

3.11.8.2 Test for combined anthracene (Modified Borntrager’s test)

Two gram of the extract was boiled with 5 ml of 10% hydrochloric acid for 3 mins. This was to

hydrolyse the glycosides to yield aglycones which were soluble in hot water only. The solution

was filtered hot; the filterate was cooled and extracted with 5 ml of benzene. The benezene layer

was filtered off and shaken gently with half its volume of 10% ammonia solution. A rose-pink or

a cherry red colour indicated combined antracene (Trease and Evans, 1983).

3.11.9 Detection of Steroids and Triterpenes

3.11.9.1 Salkowsk’s test

An amount of 0.5 g of the extract was dissolved in 2 ml of chloroform and 3-4 drops of conc.

H2SO4 were added to form a lower layer. A reddish-brown colour indicated the presence of a

steroidal ring (Trease and Evans, 1983).

3.11.9.2 Lieberman-Burchard’s test

Five millilitres of acetic anhydride was added to 2 g of the extract. About 1ml of conc. H2SO4

was added down the side of the tube; the colour change was observed immediately and later

123
found to retain the colour. A red, pink or purple colour indicated the presence of triterpenes

while blue or blue-green indicated steroids (Trease and Evans, 1983).

3.12 Preparation of different concentrations of the extracts

Stock solutions were prepared according to the method of Rahman et al. (2011) with slight

modifications. The plant extracts were prepared at the concentration of 1gml-1(1000ugml-1) in

dimethylsulphoxide (DMSO) and used as stock solution. From the stock solutions, double fold

dilutions were prepared to obtain the following concentrations (500, 250 and 125μg ml-1).

Briefly, 10 g of the extract was dissolved in 10 ml of DMSO to obtain 1 gml-1 or 1000μg ml-1

which served as the stock solution. Four tubes were obtained and labelled 1, 2, 3, and 4. An

amount of 10 ml of the stock solution was dissolved in 10 ml of DMSO in tube 1 to obtain 500μg

ml-1. 10ml of the solution from tube 1 was further dissolved in 10 ml of DMSO in tube 2 to

obtain 250μg ml-1. In the same manner, solution in tube 3 was prepared to obtain 125μg ml-1.

Disc impregnated with only DMSO in tube 4 without the extract was used as negative control.

Standard drug used as positive control were ampicillin disc (10μg) and later amikacin as second

positive controls.

3.13 Screening of Plant Extracts for Antibacterial Activity

This was performed using paper disc diffusion assay method as described by Elayaraja et al.,

(2008). Paper discs of uniform size (8mm in diameter) were prepared using Whatmann No. 1

filter paper. The paper discs were sterilized in hot air oven at 1600C for one hour. The discs were

124
then impregnated with 0.1 ml of 500, 250 and 125μg ml-1 concentrations of the plant extracts.

The solvent dimethylsulphoxide (DMSO) was used as negative control. According to Bauer et

al. (1966) with a little modification, few pure colonies (3 to 10) of the 18-24 hr test organisms

were picked from nutrient agar plates and introduced onto Mueller-Hinton broth and incubated at

370C for 2-5 hrs to produce a bacterial suspension of moderate cloudiness. This suspension was

diluted (where necessary) with physiological saline to match 0.5 McFaland standard (0.5ml of

one percent BaCl2 to 99.5ml of one percent H2SO4) [equivalent to 3.0 x 108 bacterial density].

An aliquot of 0.1ml broth suspension was used to streak the large petridishes of sterile Mueller-

Hinton agar and allowed to dry for about 3-5 minutes before the extract paper discs were placed

on the agar plates with sterile forceps, gently pressed down to ensure contact. Plates were

incubated within 30 minutes at 350C for 18-24 hr. The zone diameters of inhibition were

measured using a transparent metre rule on the undersurface of the petridishes. The tests were

carried out in duplicates and average values were recorded.

3.14 Determination of Beta-Lactamase Production using nitrocefin sticks

All characterized isolates were tested for β-lactamase production using nitrocefin-containing

identification sticks (Oxoid Ltd., Basingstoke, Hamphire, England) [AppendixVII, plate VI]. The

container with the sticks was removed from freezer and allowed to attain room temperature (26-

280C). The technique according to the manufacturer‘s manual was carried out thus: An 18-24 hr

representative colony was selected from nutrient agar medium. A stick was removed from the

container, and holding the coloured end, touched the colony with the nitrocefin impregnated end

of the stick, the stick was rotated to pick off a small mass of cells from a 24 hr culture of test

bacteria and kept up to 24 hr in an incubator at 37oC. A change in the colour of the stick

indicated β-lactamase production (Oncel et al., 2004). The reaction required moisture, so the tip

125
of the stick was placed in the moisture condensate on the lid before picking up the organism.

Where condensate was not available in the inverted plate, a drop of distilled water was added to

the lid and used to moisten the tip of the stick.

3.15 Antibiotic Susceptibility Testing

Susceptibility of the isolates to some β-lactams and commonly used antibiotics was determined

using the disc- diffusion method as recommended by Clinical Laboratory Institute Standards

(CLSI, 2008). The bacterial isolates were grown for 18 to 24 h on nutrient agar. They were

suspended in 2 ml sterile normal saline and turbidity adjusted to match McFarland Opacity

Standard No0.5 (equivalent to 3.0 x 108 bacterial density). Bacterial suspensions of 0.1 ml were

dispensed on the surface of the Mueller-Hinton agar plate and spread evenly using a sterile

spreader. The inoculum was allowed to dry for 5 min and antibiotic discs were dispensed on the

surface of the media and incubated aerobically at 37oC for 18 h. Results were classified as

susceptible, intermediate or resistant, according to the approved clinical breakpoints (CLSI,

2008). A standard strain E.coli ATCC 25922, obtained from National Institute for

Pharmaceutical Research, Idu, Abuja was used as quality control. The following antimicrobial

agents (single discs, Oxoid Ltd., Basingstoke, Hamphire, England) were tested Ampicillin

(10μg), Cephalothin (30μg), Cefpodoxime (10μg), Ceftriaxone (30μg), Ciprofloxacin (5μg),

Trimethoprim/Sulphamethoxazole (25μg), Tetracycline (30μg) Amikacin (30μg) and

amoxicillin-clavulanic acid (25μg) [CLIS, 2008].

3.15.1 Detection of ESBLs Producing Bacteria

This was carried out in two stages.

126
Screening test- Measurement of diameter of zone of inhibition for cefpodoxime and ceftriaxone

taken in the susceptibility test was used. Organisms were considered potential ESBL-producer if

zone of inhibition measured less than 22mm and less than 25mm for cefpodoxime and

ceftriaxone discs respectively (CLIS, 2008).

Confirmatory test- The double disc synergy test (DDST) was performed. Discs of cefpodoxime

and ceftriaxone alone were placed at a distance of 25 mm to amoxicillin-clavulanic acid on a

Mueller Hinton agar plate earlier inoculated with a bacterial suspension of 0.5 McFarland

turbidity standards and incubated overnight at 35-370C for 18 hr. Organisms were confirmed

ESBLs producers if synergy between cefpodoxime and ceftriaxone and amoxicillin associated

with clavulanic acid was detected i.e zones of inhibitions of 5 mm or greater obtained when

compared with discs without clavulante (Tande et al., 2009. Tawfik et al., 2012).

3.16 Identification of Multidrug Resistance (MDR) Strains

The number of antibiotic each bacterium was resistant to in the disc diffusion test was noted for

identification of multidrugresistant strains. Multidrug resistance (MDR) was taken as resistant to

four or more antibiotics tested (Ezekiel et al., 2011).

3.17 Calculation of Multiple Antibiotic Resistance (MAR) Index

Multiple antibiotic resistance (MAR) index is a measure of the extent of antimicrobial agent

resistance for the isolates in the group studied. It was calculated as where a represents the

number of antibiotics to which the isolates were resistant and ‗b‘ represents the total number of

antibiotics to which the isolate was exposed (Apun et al., 2008).

3.18 Genotypic detection of β-lactamase genes

127
3.18.1 Plasmid DNA extraction

DNA extraction was carried out with Zyppy™ Plasmid Miniprep Kit (Inqaba Biotech, South
Africa) using the Manufacturer‘s protocol.

To a 1.5 ml microcentrifuge tube, 600 μl of bacterial culture grown overnight in LB medium

was added
Followed by the addition of 100 μl of lysis buffer (blue), this was mixed thoroughly by inverting
the tube 4-6 times.
Within 2 minutes of mixing with the lysis buffer, 350 μl of cold neutralization buffer2 (yellow),
was added and mixed thoroughly.
The sample turned yellow when the neutralization was completed and a yellowish precipitate
formed. Sample was inverted additional 2-3 times to ensure complete neutralization.
It was centrifuged at 13,500 x g for 3 minutes.
Approximately, 900 μl of the supernatant was transferred into the spin column.
Disturbance of the cell debris pellet was avoided by gently transferring the supernatant.
The column was placed into a collection tube and centrifuged at 13,500 x g for 15 seconds.
The flow-through was discarded and the column was placed back into the same collection tube.
This was followed by addition of 200 μl of Endo-Wash buffer3 to the column and centrifuge at
13,500 x g for 15 seconds.
After this, 400 μl of Zyppy™ wash buffer3 was added to the column and centrifuged at 13,500
x g for 30 seconds.
The column was transferred into a clean 1.5 ml microcentrifuge tube followed by addition of 30
μl Zyppy™ elution buffer (10 mM Tris-HCl, pH 8.5 and 0.1 mM EDTA) directly to the column
matrix and allowed to stand for one minute at room temperature.
Centrifugation was carried out at 13,500 x g for 15 seconds to elute the plasmid DNA.

1
LB medium- Luria Betani medium (Yeast extract 5g, Tryptone 10g and NaCl 5g)/L.
2
RNase A added to Neutralization buffer
3
Ethanol added to wash buffer

3.18.2 Primer design

128
The oligonucleotide primer sequences (Bioneer Inc., USA) used for the PCR assays were
obtained from Bali et al., (2010), and are as shown in Table 3.1.

Table 3.1: Oligonucleotide primers used for detection of β-lactamase genes.

Primers Melting Nucleotide References Expected
Temperature Sequences (GenBank Amplicon
(oC) (5’-3’) number) Size (bp)
SHV-F 50.6 CGCCTGTGTATTATCTCCCT EF125011 293
SHV-R 50.2 CGAGTAGTCCACCAGATCCT

TEM-F 56.2 TTTCGTGTCGCCCTTATTCC AB282997 403

TEM-R 50.1 ATCGTTGTCAGAAGTAAGTTGG

Key: F-Forward
R-Reversed

3.18.3 PCR amplification of β-lactamase gene

To amplify the sequences of TEM and SHV β-lactamase genes, PCR was carried out with the

primer sets as described by Chang et al. (2001) and Bali et al. (2010) with slight modifications.

Reactions were performed in a GeneAmp PCR system 2400 (Perkin-Elmer) in 20 µl reaction

mixtures containing 10 µl Premix with non-interfering dye (consisting of Taq DNA polymerase,

dNTPs, MgCl2, reaction buffer, PCR stabilizer and enchancer at optimer concentrations). Each

oligonucleotide primer concentration (i.e. forward and reversed) added was 0.5µl, while template

concentration added was 1.0µl. The PCR conditions used were 35 cycles of amplification at a

denaturation temperature of 940C for 3 mins (first cycle only), subsequently 940C for 45s, an

annealing temperature of 510C for 30s, and an extension temperature 720C for one min. This step

was followed by a final extension at 720C for one min.

3.18.4 Agarose gel electrophoresis

129
Ten microliters (10µl) of PCR products were loaded into wells of 1.0% agarose gel containing

ethidium bromide. A molecular size marker, O‘GeneRulerTM 100bp DNA ladder (Fermentas) or

at other times Perfect 1,000bp DNA ladder- SibGene was run on both sides with PCR products.

Electrophoresis was carried out in Tris Acetate EDTA buffer (1x contains; Tris 40mM, Acetic

Acid 20Mm, EDTA 1Mm, pH 8.0; BIOLAND SCIENTIFIC LLC) containing ethidium bromide

(20 ml of 50 X TAE and 4.0 µl of 10 µg/ml ethidium bromide per litre) at 90 V for 40min.

Plasmids were viewed on a U/V transilluminator and photographs taken using a gel documenting

machine (Gel doc 2000; BIO-RAD). Plasmid sizes were assessed and estimated from the

molecular sizes of the DNA ladder against their migration distance (Ombui et al., 2000).

3.18.5 Purification of PCR products

One strand each of the bands obtained for the genes were purified for sequencing. Protocol for

PCR purification using AccuPrep PCR purification kit (Bioneer Inc. USA) was carried out as

follows:

1. DNA fragments were excised from the agarose gel, and the gel slice was weighed in a
clean 1.5 ml micro-centrifuge tube.
2. Three volumes of buffer (1) (gel binding buffer) were added to one volume gel slice.
3. Incubation was carried out at 600C for 10 min while the tubes were vortexed every 2-
3min. during incubation for dissolution.
4. Further incubation and vortexing were repeated until complete dissolution was ensured
by the appearance of a yellow colour.
5. The mixtures were transferred into the DNA binding column tubes and centrifuge for
1min. at 13,000rpm.

130
 6. The flow-through is poured off and the DNA binding filter column re-assembled with the
2.0 ml collection tube.
7. To the DNA binding column tubes, 500 µl of buffer (2) was added and centrifuged for one
min. at 13,000 rpm. This step removes salts and soluble impurities in the DNA binding
column tube. The loss of DNA in this step is negligible.
8. The flow-through was poured off and the DNA filter column was re-assembled with the
2.0 ml collection tube.
9. Steps 7 and 8 were repeated.
10. Drying was carried out by additional centrifugation at 13,000rpm for one min to remove
the residual ethanol. The DNA binding filter column was transferred to the , new 1.5ml
micro-centrifuge tube.
11. Thirty microlitres (30µl) of buffer (3) was added to the centre of the DNA binding filter
column, and allowed to stand for at least one min, at room temperature for elution.
12. Fragment DNA were eluted by centrifugation at 13,000rpm for 1min.

3.18.6 Plasmid DNA sequencing

Sequencing of the purified PCR products were performed with the Dye Terminator Cycle

Sequencing (DTCS) Quick Start kit using the sequencer CEQ 2000 XL DNA Analysis System

(BECKMAN COULTER, U.S.A.). Sequence alignment and analysis were performed online

using the Basic Local Alignment Search Tool (BLAST) program of the National Centre for

Biotechnology Information (www.ncbi.nlm.nih.gov) (Kolar et al., 2000).

Procedure for sequencing reactions were as follows;

1. Preparation of the DNA sequencing reaction
Sequencing reactions were prepared in 0.2 ml thin-wall tubes and all the reagents were
added in the order listed below.
dH2O 8.0µl

131
 DNA template 2.0 µl
Primer 2.0 µl
DTCS Quick start Master Mix 8.0 µl

2. Thermal cycling programme

Initial temperature 960C for 20sec;
Annealing temperature 500C for 20sec;
Extension temperature 600C for 4min; for 30 cycles followed by holding at 40C.

3. Ethanol Precipitation
Precipitation in individual tubes was carried out as follows:
a. A labelled, sterile 0.5ml microfuge tube was prepared for each sample.
b. Fresh Stop Solution/Glycogen mixture was prepared as follows (per sequencing
reaction); 2 µl of 3 M Sodium Acetate (pH5.2), 2 µl of 100 mM Na2-EDTA
(pH8.0) and 1µl of 20 mg/ml of glycogen (supplied with the kit). To each of the
labelled tubes, 5 µl of the Stop Solution/glycogen was added.
c. The sequencing reaction was transferred to the appropriately labelled 0.5 ml
microfuge tubes and mixed thoroughly.
d. To the above, 60 µl cold 95% (v/v) ethanol from -200C freezer was added and
mixed thoroughly. Centrifugation was carried out immediately at 14,000rpm at
40C for 15 minutes. Supernatant was carefully removed using micropipettes. The
pellets were visible at this stage.
e. Pellets were rinsed twice with 200 µl 70% (v/v) ethanol from -200C freezer.
Centrifugation was carried out immediately at 14,000rpm at 40C for 4min.
Supernatant was carefully removed after centrifugation with a micropipette.
f. This was followed by vacuum drying for 10 min.
g. Samples were resuspended in 40 µl of the Sample Loading Solution (Provided in
the kit) and allowed to stand for 10 min.

4. Sample preparation for loading into the instrument:

132
 a. Resuspended samples were transferred to the appropriate wells of the sample
plate.
b. Each of the resuspended samples was overlaid with one drop of light mineral oil.
c. Sample plate was loaded into the instrument and the desired method started.

3.19 Statistical Analysis

Data obtained were subjected to statistical analysis using different tools. Student t-test was used

to compare if there were significant differences between the number of E.coli and Klebsiella spp.

resistant to each antibiotic used in this study (Tables 4.8 and 4.10). One way analysis of variance

was used to determine whether there significant differences in the response to the tested

antibiotics by the bacteria isolated from the different food samples. Duncan multiple range test

was used to separate the means. (Table 4.12). Pearson‘s correlation was used to establish

significance in association between multidrug resistance and ESBLs production (Appendix VII).

Finally, Spearman‘s rank correlation coefficient was used to identify whether there is a

relationship between the presence of either TEM or SHV genes and resistance to third generation

cephalosporins. All statistical analysis was performed at 95% confidence interval and p values

less than 0.05 were considered significant (Bland, 1999).

133
 CHAPTER 4

RESULTS

A total of 53 bacterial isolates identified as E.coli and Klebsiella spp. were obtained from the

ready-to-eat food and drink items. Characterization and identification of the isolates using

Microgen Identification kit is stated in Appendix II. E.coli were 49 (92%) while Klebsiella spp.

obtained were 4 (8%). Table 1 shows their distribution in the food samples. This showed that

E.coli was widely distributed in the food samples. Klebsiella spp. was not isolated from ‗kunun-

134
zaki‘ and smoked fish but was isolated from ‗zoborodo‘ and processed meat ‗suya‘. Three of the

Klebsiella spp. were K. oxytoca while one was K. ozaenae (Fig. 4.1). Unfortunately, the only

E.coli isolated from ‗kunun-zaki‘ was lost during subculture as it became unculturable after

characterization; hence fifty two (52) bacterial isolates were used in this study.

Table 4.1: Distribution of bacterial isolates from food samples

Type of No. of No. of No. of Total

Food food sample E. coli Klebsiella no.

sample analysed Isolates spp. isolates of isolates

‗Kununzaki‘ 75 1 0 1

‗Zoborodo‘ 75 11 2 13

Smoked fish 75 19 0 19

135
‗Suya‘ 75 18 2 20

TOTAL 300 49 4 53

2.5
Number of Klebsiella spp.

1.5

1
K.oxytoca
0.5 K. ozaenae

0
Zoborodo Suya
Fig. 4.1 Distribution of Klebsiella spp. isolated from
food samples

The results of the phytochemical analyses of the stem-bark, leaf and root extracts of Carica

papaya are shown in Table 4.2. The leaf extract contained more of the active components than

the root or stem-bark. Tannins, flavonoids, glycosides, steroids and triterpenes, resins,

carbohydrates were present in the leaf extract while only carbohydrates, saponins and steroids

136
were present in the root extract. The stem-bark contains carbohydrates, glycosides, saponins,

flavonoids, alkaloids, steroids and triterpenes.

Table 4.2: Phytochemical Constituents of the Leaf, Root and Stem bark of Carica papaya
extracts

Phytochemical Test Inferences

constituents Leaves Root Stem-bark

137
Carbohydrates Molisch’s test + + +

Reducing sugar Fehling’s test + - -

Glycosides

General tests Fehling’s test + - -

FeCl3 test + - +

Cardiac glycosides Kella-Killiani test + - +

Kadde test + - -

Anthraquinone derivatives

Free antraquinones
Combined anthracene Borntrager‘s test - - -
Modified Borntrager‘s test + - -

Resins
Acetic anhydride test + - -
Saponins
Frothing test - + +
Flavonoids
Sodium hydroxide test + - +
Tannins
Hydrolysable tannins
Ferric chloride test + - -

Alkaloids
Mayer‘s test - - +
Dragendoff‘s test - - +
Wagner‘s test - - +
Steroids and triterpenes
Steroids
Steroids and triterpenes Salkowsk‘s test + + +
Lieberman-Burchard‘s test +(T) - +(S)

Key: + = Present; - = Absent; T = Triterpene; S=Steroid

138
The methanolic extracts showed no antibacterial activity in all the concentrations prepared

(500µg, 250µg, 125µg,) for the E.coli reference strain ATCC 25922 and the bacterial strains

tested which were E.coli and Klebsiella spp. (Tables 4.3, 4.4 and 4.5). There was growth up to

the edge of the filter paper disks and so the 8 mm obtained in all the measurements was the size

of the Whatmann filter paper used. Ampicillin disc alone was used as positive control in the

sensitivity test against the bacteria isolated from smoked fish (Table 4.3). However, some strains

were resistant to it. The zones of inhibitions of 6 mm were obtained from plates where bacteria

grew to the edge of the ampicillin disc, and so what was left to measure was the diameter of the

disc which was 6 mm. The DMSO remained the negative control.

In Table 4.4, the antibiotic disc amikacin was added to the regimen of positive controls and was

found to be better as positive control than the ampicillin discs because all the bacterial strains

were susceptible to amikacin.

In Table 4.5 amikacin was also used along with ampicillin as positive controls. Several of the

bacterial strains were resistant to ampicillin with growth to the edge of the disc but all were

susceptible to amikacin.

139
 Table 4.3: Zone diameters of inhibition (mm) of plant extracts against isolates from smoked
fish

Isolate Conc. of Positive Conc. Of Positive Conc. Of Positive Nega-

Code root-bark controls stem-bark control leaf Controls tive
extract extract s extract control
(µg/ml) (µg/ml) (µg/ml)
500 250 125 A A 500 250 125 A AK 500 250 125 A AK D
M K M M M
P P P S
O
SFe1 8 8 8 19 ND 8 8 8 19 ND 8 8 8 20 ND 8
SFe2 8 8 8 6 ND 8 8 8 6 ND 8 8 8 6 ND 8
SFe3 8 8 8 7 ND 8 8 8 18 ND 8 8 8 16 ND 8
SFe4 8 8 8 19 ND 8 8 8 20 ND 8 8 8 20 ND 8
SFe5 8 8 8 18 ND 8 8 8 16 ND 8 8 8 16 ND 8
SFe6 8 8 8 16 ND 8 8 8 16 ND 8 8 8 16 ND 8
SFe7 8 8 8 18 ND 8 8 8 16 ND 8 8 8 18 ND 8
SFe8 8 8 8 19 ND 8 8 8 17 ND 8 8 8 16 ND 8
SFe9 8 8 8 17 ND 8 8 8 20 ND 8 8 8 16 ND 8
SFe10 8 8 8 20 ND 8 8 8 16 ND 8 8 8 18 ND 8
SFe11 8 8 8 18 ND 8 8 8 6 ND 8 8 8 6 ND 8
SFe12 8 8 8 10 ND 8 8 8 6 ND 8 8 8 6 ND 8
SFe13 8 8 8 6 ND 8 8 8 16 ND 8 8 8 16 ND 8
SFe14 8 8 8 20 ND 8 8 8 16 ND 8 8 8 18 ND 8
SFe15 8 8 8 20 ND 8 8 8 6 ND 8 8 8 6 ND 8
SFe16 8 8 8 19 ND 8 8 8 18 ND 8 8 8 18 ND 8
SFe17 8 8 8 20 ND 8 8 8 18 ND 8 8 8 18 ND 8
SFe18 8 8 8 22 ND 8 8 8 20 ND 8 8 8 18 ND 8
SFe19 8 8 8 16 ND 8 8 8 18 ND 8 8 8 16 ND 8
Key: AMP-Ampicillin; AK- Amikacin; DMSO-Dimethylsulphoxide; ND-Not determined
SFe-E.coli isolated from smoked fish
Zone diameterof paper disc is 8mm
Zone diameterof antibiotic disc is 6mm

140
 Table 4.4: Zone diameters of inhibition (mm) of plant extracts against isolates from
processed meat ‘suya’
Isolate Conc. of Positive Conc. Of PositiveConc. of Positive Nega-
Code root-bark controls stem-bark control leaf Controls tive
extract extract s extract contro
(µg/ml) (µg/ml) (µg/ml) l
500 250 125 A A 500 250 125 A AK 500 250 125 A AK D
M K M M M
P P P S
O
SYe1 8 8 8 6 23 8 8 8 6 23 8 8 8 6 24 8
SYe2 8 8 8 7 22 8 8 8 6 22 8 8 8 6 23 8
SYe3 8 8 8 8 18 8 8 8 13 18 8 8 8 13 19 8
SYe4 8 8 8 20 21 8 8 8 16 21 8 8 8 16 22 8
SYe5 8 8 8 21 21 8 8 8 18 21 8 8 8 18 22 8
SYe6 8 8 8 6 21 8 8 8 6 21 8 8 8 6 22 8
SYe7 8 8 8 6 25 8 8 8 6 25 8 8 8 6 26 8
SYe8 8 8 8 6 21 8 8 8 6 21 8 8 8 6 22 8
SYe9 8 8 8 6 22 8 8 8 6 22 8 8 8 6 23 8
SYe10 8 8 8 6 21 8 8 8 6 21 8 8 8 6 22 8
SYe11 8 8 8 20 25 8 8 8 18 25 8 8 8 18 26 8
SYe12 8 8 8 21 21 8 8 8 18 21 8 8 8 18 22 8
SYe13 8 8 8 15 20 8 8 8 12 20 8 8 8 12 21 8
SYe14 8 8 8 6 20 8 8 8 6 20 8 8 8 6 21 8
SYe15 8 8 8 21 22 8 8 8 21 22 8 8 8 21 23 8
SYe16 8 8 8 6 22 8 8 8 6 22 8 8 8 6 23 8
SYe17 8 8 8 6 20 8 8 8 6 20 8 8 8 6 21 8
SYe18 8 8 8 19 21 8 8 8 16 21 8 8 8 16 22 8
SYk1 8 8 8 6 22 8 8 8 6 22 8 8 8 6 23 8
SYk2 8 8 8 7 20 8 8 8 6 20 8 8 8 6 21 8
Key: AMP-Ampicillin; AK- Amikacin; DMSO-Dimethylsulphoxide
SYe- E.coli isolated from processed meat ‗suya‘
SYk-Klebsiella spp. isolated from processed meat ‗suya‘
Zone diameterof paper disc is 8mm
Zone diameterof antibiotic disc is 6mm

141
 Table 4.5: Zone diameters of inhibition (mm) of plant extracts against isolates from
‘zoborodo’ drink

Isolate Conc. of Positive Conc. Of PositiveConc. of Positive Nega-

Code root-bark controls stem-bark control leaf Controls tive
extract extract s extract contro
(µg/ml) (µg/ml) (µg/ml) l
500 250 125 A A 500 250 125 A AK 500 250 125 A AK D
M K M MP M
P P S
O
Ze1 8 8 8 18 26 8 8 8 20 26 8 8 8 16 25 8
Ze2 8 8 8 17 22 8 8 8 16 22 8 8 8 17 21 8
Ze3 8 8 8 18 25 8 8 8 16 24 8 8 8 16 24 8
Ze4 8 8 8 17 21 8 8 8 15 22 8 8 8 16 21 8
Ze5 8 8 8 6 24 8 8 8 6 24 8 8 8 6 24 8
Ze6 8 8 8 6 23 8 8 8 6 24 8 8 8 6 23 8
Ze7 8 8 8 6 24 8 8 8 6 24 8 8 8 6 24 8
Ze8 8 8 8 6 25 8 8 8 6 24 8 8 8 6 24 8
Ze9 8 8 8 6 20 8 8 8 6 21 8 8 8 6 21 8
Ze10 8 8 8 20 22 8 8 8 18 23 8 8 8 18 22 8
Ze11 8 8 8 6 27 8 8 8 6 26 8 8 8 6 25 8
Zk1 8 8 8 6 27 8 8 8 6 25 8 8 8 6 25 8
Zk2 8 8 8 6 25 8 8 8 6 24 8 8 8 6 25 8
Key: AMP-Ampicillin; AK- Amikacin; DMSO-Dimethylsulphoxide
Ze- E.coli isolated from ‗zoborodo‘ drink
Zk-Klebsiella spp. isolated from ‗zoborodo‘ drink
Zone diameterof paper disc is 8mm
Zone diameterof antibiotic disc is 6mm

142
Antibiotic sensitivity of E.coli isolated from smoked fish is shown on Table 4.6. The best activity

was found in ciprofloxacin, amikacin and amoxicillin-clavulanic acid with 100% activity against

all the isolates. This is followed by susceptibility to sulphamethoxazole-trimethoprim (84%).

Lowest activity was found in cephalothin and tetracycline with 53% and 42% resistance

respectively. Minimal resistance was observedin response to the third generation cephalosporins

i.e cefpodoxime and ceftriaxone having 26% and 21% resistance respectively. Resistance to

ampicillin was found in 7 (37%) of the isolates.

143
Table 4.6: Antibiotic sensitivity of E.coli isolated from smoked fish (n=19)

Antibiotics Abbreviation Disc Number (%) Number (%)

class/structural content resistant Susceptible
group µg organisms organisms
AMPICILLIN AMP 10 7 (37) 12 (63)
(β-lactam-amino-penicillin)

CEPHALOTHIN KF 30 10 (53) 9(47)

(β-lactam-1st generation
Cephalosporin)

CEFPODOXIME* CPD 10 5 (26) 14 (74)

(β-lactam-3rd generation
Cephalosporin)

CEFTRIAXONE* CRO 30 4 (21) 15 (79)

(β-lactam-3rd generation
Cephalosporin)

CIPROFLOXACIN CIP 5 0 (0) 19 (100)

(Fluoroquinone)

SULPHAMETHOXAZOLE/
TRIMETOPRIM SXT 25 3 (16) 16 (84)
(Sulphonamide)

144
TETRACYCLINE TE 30 8 (42) 11 (58)
(Tetracyclines)

AMIKACIN AK 30 0 (0) 19 (100)

(Aminoglycosides)

AMOXICILLIN-
CLAVULANIC ACID AMC 25 0 (0) 19 (100)
(β-lactam-β-lactamase inhibitor)

*One of the five indicator cephalosporins for detection of ESBLs production

The pattern of resistance is shown in Table 4.7. Ten resistance phenotypes were obtained with

single antibiotic resistance types (KF and AMP resistance) and eight multiple resistance types

with varying combinations of 2, 3, 4 and 6 antibiotics. Highest frequency (4) was found in

combinations with three antibiotics. Broad spectrum resistance (i.e. resistance to ampicillin or

cephalothin) was identified in 11 (58%) of the isolates (Fig. 4.2) while production of ESBLs was

detected in 5(26%) of the isolates (Fig. 4.3). Multidrug resistance (MDR) is regarded as

resistance to four or more antibiotics. Three (16%) of the E. coli isolates exhibited multidrug

resistance and two of the three MDR strains were ESBLs producers. Pearson correlation showed

highly significant correlation between ESBLs production and multidrug resistance (Appendix

VIII). Among the E. coli isolates from smoked fish, 10 (53%) of the tested bacteria had MAR

index greater than 0.2 (Fig. 4.4).

145
Table 4.7: Resistance pattern of E. coli isolated from smoked fish (n=19)

Single antibiotic Multiple antibiotic resistance

resistance
Number Resistance Number of Number of Resistance Phenotype
of Isolates Phenotype Antibiotic Isolates
(%) in the Combinations (%) with the
Category Pattern

1 (11) KF 2 1 (5) KF, TE

1 (5) AMP, KF
1 (5) AMP 1 (5) CPD, TE

3 1 (5) KF, CPD, CRO

2 (11) AMP, KF, TE
1 (5) CPD, CRO, TE

4 1 (5) AMP, KF, SXT, TE

6 2 (11) AMP, KF, CPD, CRO, SXT, TE

146
Key: AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-
Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-Tetracycline;
AK-Amikacin

42%
Broad spectrum resistance
58%
Non-broad spectrum
resistance

Fig. 4.2 Broad spectrum resistance in E. coli isolated from

smoked fish

147
 ESBLs E.
coli
26%

non-ESBLs
E. coli
74%

Fig. 4.3 Percentage ESBLs producing E.coli from

smoked fish

148
 35

30
% of E.coli with MARI

25

20

15

10

0
0 0.1 0.2 0.3 0.4 0.7

Multiple antibiotic resistance (MAR) Index

Fig. 4.4 Multiple antibiotics resistance indices of E. coli
isolated from smoked fish (53% of E. coli had MAR index of 0.2 and above)

149
Antibiotic resistance of E.coli and Klebsiella spp. isolated from processed meat ‗suya‘ is shown

in Table 4.8. The best activity was found in ciprofloxacin and amikacin with no resistant

isolate, which is 100% sensitivity. Two (11%) of the isolates were resistant to amoxicillin-

clavulanic acid. Lowest activity was recorded in cephalothin and ampicillin with 17(85%) and

15(75%) of the resistant isolates respectively. The two Klebsiella spp. were both resistant to

ampicillin, cephalothin and tetracycline. Student t-test was used to compare mean of resistance

of E. coli and Klebsiella spp. within the group and found that significant differences exist in

resistance to ampicillin, cephalothin, cefpodoxime and tetracycline (p<0.05). In all the cases the

mean antibiotic resistance in Klebsiella spp. were found to be higher than those of E.coli strains.

150
Table 4.8: Antibiotic resistance of E.coli and Klebsiella spp. isolated from processed meat
‘suya’ (n=20)

Bacteria Number Antibiotics tested

isolates of Number (%) of resistant bacteria to the antimicrobial agents
isolates
AMP KF CPD CRO CIP SXT TE AK AMC

E. coli 18 13 (72) 15 (83) 8 (44) 3 (17) 0 (0) 9 (50) 11 (61) 0 (0) 2 (11)

Klebsiella
spp.
2 2 (100) 2 (100) 1 (50) 0 (0) 0 (0) 1 (50) 2 (100) 0 (0) 0 (0)

Total 20 15 (75) 17 (85) 9 (45) 3 (15) 0 (0) 10(50) 13 (65) 0 (0) 2 (10)

t-value 7.778 9.192 6.965 3.000 0.000 6.363 2.000

p-value 0.008* 0.005* 0.045* 0.102 0.05 0.011* 0.147

Student t-test * =Significant at the 0.05 level (2-tailed)

Key: AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-
Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-Tetracycline;
AK-Amikacin; AMC- Amoxicillin-clavulanic acid (Augmentin)

151
The resistance pattern of E.coli and Klebsiella spp. isolated from ‗suya‘ is shown in Table 4.9.

Twelve resistance phenotypes were obtained with a single antibiotic resistance type (KF

resistance) and eleven (11) multiple resistance types with varying combinations of 2, 3, 4, 5, 6

and 7 antibiotics. Highest frequency of five (5) was found in combinations of five antibiotics.

Broad spectrum resistance (i.e. resistance to ampicillin or cephalothin) was identified in 15

(83%) of E. coli strains and one out of two (50%) of the Klebsiella spp. (Fig. 4.5) while

production of ESBLs was detected in 8 (44%) of the E. coli strains and one out of two (50%) of

the Klebsiella spp.. (Fig.4.6). Multidrug resistance (MDR) that is, resistance to four or more

antibiotics was exhibited by eleven (55%) of the entire isolates obtained from ‗suya‘, eight of the

MDR strains were ESBLs producers. Pearson correlation showed significant correlation (P<0.05)

between ESBLs production and multidrug resistance in E. coli and Klebsiella spp. isolated from

‗suya‘ (AppendixVII). Two (11%) E. coli strains were susceptible to all the antibiotics and

constitute the population with multiple antibiotic resistance index of 0.0 (Fig.4.7). A high

antibiotic resistance is observed in this category of organisms which had 67% E.coli strains and

100% Klebsiella spp. with MAR index greater than 0.2.

152
Table 4.9: Resistance pattern of E. coli and Klebsiella spp. isolated from ‘suya’

Single antibiotic Multiple antibiotic resistance

Resistance
Number Resistance Number of Number of Resistance
of Isolates Phenotype Antibiotic Isolates Phenotype
(%) in the Combinations (%) with
Category the
Pattern

153
 2 (10) KF 2 1 (5) SXT, TE
1 (5) AMP, KF

3 1 (5) AMP, KF, CPD

1 (5) AMP, KF, SXT
1 (5) AMP, KF, TE

4 3 (15) AMP, KF, SXT, TE

1 (5) AMP, KF, CPD, TE

5 2 (10) AMP, KF, CPD, CRO, TE

3 (15) AMP, KF, CPD, SXT, TE

6 1 (5) AMP, KF, CRO, SXT, TE, AMC

7 1 (5) AMP, KF, CPD, CRO, SXT, TE,

AMC

Key: AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-

Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-Tetracycline;
AK-Amikacin; AMC- Amoxycillin-clavulanic acid (Augmentin)

154
 120
100
100
83
Percentage resistance

80

60
E.coli
40 Klebsiella spp.
17
20
0
0
Broad spectrum Non broad spectrum
resistance resistance

Fig. 4.5 Broad spectrum resistance in E. coli and Klebsiella spp. isolated from 'suya'

60 56
50 50
50
44
Percentage resistance

40

30
E.coli
20 Klebsiella spp.
10

0
ESBLs production Non ESBLs
production

Fig. 4.6 ESBLs production among E. coli and Klebsiella spp. isolated from 'suya'

155
 60
% number of bacteria strains
50

40

30
E.coli
20
Klebsiella spp.
10

0
0 0.1 0.2 0.3 0.4 0.6 0.7 0.8

Multiple antibiotic resistance (MAR) index

Fig. 4.7 MAR indices of E.coli and Klebsiella spp. isolated from ‘suya’
(About 67% E.coli strains and 100% Klebsiella spp. had MAR index greater than 0.2)

156
Antibiotic resistance of E.coli and Klebsiella spp. isolated from ‗zoborodo‘ is shown in Table

4.10. The best activity was found in ciprofloxacillin and amikacin with no resistant isolate that is

100% subceptibility. Lowest activity was recorded in cephalothin with 92% resistance, followed

by ampicillin and tetracycline with 9(69%) and 7(54%) respectively. The two Klebsiella spp.

were both resistant to cefpodoxime but sensitive to ceftriaxone. Student t-test was used to

compare mean of resistance of E. coli and Klebsiella spp. within the group and found that

significant differences exist in resistance to ampicillin, cephalothin, sulphamethoxazole-

trimethoprim and tetracycline (p<0.05).

157
Table 4.10: Antibiotic resistance of E.coli and Klebsiella spp. isolated from ‘zoborodo’
(n=13)
Bacteria Number Antibiotics tested
isolates of Number (%) of resistant bacteria to the antimicrobial agents
isolates
AMP KF CPD CRO CIP SXT TE AK AMC

E. coli 11 7 (64) 10 (91) 2 (18) 1 (9) 0 (0) 1 (9) 6 (55) 0 (0) 0 (0)

Klebsiella 2 2 (100) 2 (100) 2(100) 0 (0) 0 (0) 1 (50) 1 (50) 0 (0) 2(100)
spp.

Total 13 9 (69) 12 (92) 4 (31) 1 (8) 0 (0) 2(15) 7 (54) 0 (0) 2 (15)

t-value 3.536 5.657 0.500 0.032 7.960 6.364 2.00

p-value 0.035* 0.015* 2.920 6.314 0.040* 0.012* 6.314

Student t-test * =Significant at the 0.05 level (2-tailed)

Key: AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-
Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-Tetracycline;
AK-Amikacin; AMC- Amoxicillin-clavulanic acid (Augmentin)

158
The pattern of resistance of E. coli and Klebsiella spp. isolated from ‗zoborodo‘ drink is shown

in Table 4.11. Seven resistance phenotypes were obtained with a single antibiotic resistance type

(KF resistance) and six (6) multiple resistance types with varying combinations of 2, 3, 4, 5 and

6 antibiotics. Highest frequency of four (4) was found in combinations of three antibiotics. Broad

spectrum resistance (i.e. resistance to ampicillin or cephalothin) was identified in 10 (91%) of the

E. coli strains and in the two Klebsiella spp. (100%) (Fig. 4.8) while production of ESBLs was

detected in two (18%) of E. coli strains and in the two (100%) Klebsiella spp. (Fig.4.9).

Multidrug resistance (MDR) that is, resistance to four or more antibiotics was exhibited by four

(31%) of the entire isolates and all were ESBLs producers. Pearson correlation showed complete

correlation (P= 0.00) between ESBLs production and multidrug resistance in E. coli and

Klebsiella spp. isolated from zoborodo‘ (Appendix VIII). One (9%) E. coli strain was susceptible

to all the antibiotics and had multiple antibiotic resistance index of 0.0 (Fig. 4.10). A high

antibiotic resistance was also observed in this category of bacteria with 54% E. coli and 100%

Klebsiella spp. having multiple antibiotic resistance (MAR) index greater than 0.2.

159
Table 4.11: Resistance pattern of E. coli and Klebsiella spp. isolated from ‘zoborodo’ drink
Single antibiotic Multiple antibiotic resistance
Resistance
Number Resistance Number of Number of Resistance
of Isolates Phenotype Antibiotic Isolates Phenotype
(%) in the Combinations (%) with the
Category Pattern

3 (23) KF 2 1 (8) AMP, KF

3 4(31) AMP, KF, TE

4 1 (8) AMP, KF, CPD, AMC

5 1 (8) AMP, KF, CPD, CRO, TE

AMP, KF, CPD, SXT, TE
1 (8) AMP, KF, CPD, SXT, TE, AMC

6 1 (8)

Key:AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-

Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-
Tetracycline; AK-Amikacin; AMC- Amoxycillin-clavulanic acid (Augmentin)

160
 120
100
% number of bacteria strains

100 91

80

60
E.coli
40 Klebsiella spp.
20 9
0
0
Broad spectrum Non-broad
resistance spectrum resistance

Fig. 4.8 Broad spectrum resistance in E.coli and Klebsiella spp.

isolated from zoborodo drink

120
% n umber of bacteria strains

100

80

60
100 E.coli
40 82 Klebsiella spp.
20
18 0
0
ESBLs production Non-ESBLs
production

161
Fig. 4.9 ESBLs producing E.coli and Klebsiella spp. isolated from zoborodo drink

50
% population of bacteria strains

45
40
35
30
25
20
15 E.coli
10 Klebsiella spp.
5
0
0 0.1 0.2
0.3 0.4 0.6 0.7

Multiple antibiotic resistance (MAR) index

Fig. 4.10 MAR indices of E.coli and Klebsiella spp. isolated from zoborodo drink.
(About 54% E.coli strains and 100% Klebsiella spp. had MAR index greater than 0.2)

162
Analysis of the pooled antibiotic resistance of all the isolates from the ready-to-eat food items is

shown in Table 4.12. As in the different food samples, all the isolates were sensitive to

ciprofloxacin and amikacin. Four (15%) isolates were resistant to amoxicillin-clavulanic acid.

Cephalothin and ampicillin had the lowest activity with 75% and 60% resistance, followed by

tetracycline having 54% resistance. Prevalence of ESBLs resistance obtained for all the isolates

was 35%. Analysis of variance was used to compare the means. Significance difference was

found to exist in the resistances to ampicillin, cephalothin, sulphamethoxazole-trimethoprim and

tetracycline. Duncan Multiple Range Test was used to separate the means. Values with different

superscripts are significantly different (p<0.05). Antibiotic resistance exhibited by isolates from

‗suya‘ were found to be higher than those of smoked fish or ‗zoborodo‘.

163
Table 4.12: Analysis of the pooled number (%) of antibiotic resistance of all the bacteria
isolated from the food samples; n=52

Sources No. Antibiotics tested

of bacteria of Number (%) of resistant bacteria to the antimicrobial agents
isolates isolates
AMP KF CPD CRO CIP SXT TE AK AMC

Suya 20 15 (75)a 17 (85)a 9 (45) 3 (15) 0 (0) 10(50) a 13 (65) a 0 (0) 2 (10)

Smoked fish 19
7 (37)b 10(53)b 5(26) 4 (21) 0 (0) 3 (16) b 8 (42) b 0 (0) 0(0)

Zoborodo 13 9 (69) b 12 (92) ab 4 (31) 1 (8) 0 (0) 2(15) b 7 (54) b 0 (0) 2 (15)

Total 52 31(60) 39(75) 18(35) 8(15) 0 (0) 15(29) 28(54) 0 (0) 4(8)

17.33 16.33 7.00 3.48 19.00 10.33 2.00

F-value

p-value 0.023* 0.024 0.074 0.165 0.020 0.045 0.281

Key: AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-

Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-Tetracycline;
AK-Amikacin; AMC- Amoxycillin-clavulanic acid (Augmentin)
*=Significant differences exist between the isolates from the different food samples
Values with different superscripts within the group are significantly different (p<0.05)
Means were separated using Duncan Multiple Range Test (DMRT)

164
Sensitivity of nitrocefin sticks was calculated in comparism to the disc diffusion test shown in

Table 4.13. The significance is that rapid β-lactamase tests can yield clinically relevant

information earlier than a MIC test or disc diffusion. In this test, the nitrocefin sticks detected β-

lactamase in only four (4) isolates while ampicillin resistance (due β-lactamase production) was

detected in 31 isolated using disc diffusion test. Sensitivity of the new and rapid test was

therefore calculated to be ×100=12.9%

165
Table 4.13: Sensitivity of nitrocefin sticks using disc diffusion test (DDT) as the gold
standard

Source of isolates Number Ampicillin β- Calculated

of Resistance lactamase sensitivity
organisms Using detection
DDT using
nitrocefin
sticks
Smoked fish 19 7 0 12.9%

Suya 20 15 1

Zoborodo 13 9 3

Total 52 31 4

166
For the molecular studies, a total of 12 isolates were used to assay for the presence of TEM and

SHV genes. TEM gene was detected in 8 (66.7%) bacterial isolates (Plate I) while the SHV gene

was harboured by only one (8.3%) isolate. It should be noted that there were two bands on the

SHV gel picture but that of lane 5 does not correspond to the expected base pair size and so it

was regarded as a contaminant (Plate II). No isolate was found to harbour both TEM and SHV

genes together. SHV gene was detected in one bacterium, Klebsiella oxytoca only, while TEM

genes were detected in only E.coli strains all through. One isolate SFe 16, that was susceptible to

all the antibiotics in the disc diffusion test (DDT) was found to harbour a TEM gene. The faint

band underneath the bands were said to be primer dimers and this was verified when running

SHV amplicons on gel. Two controls were prepared; one was tagged C-plus (C+), which

contained the premix, set of SHV primers, but no DNA template while the other control, C-

minus (C-), contained the premix only, no primers, no DNA template. Gel picture showed that

the faint band did not appear in the lane C- but present in all the lanes with primers. They are the

primer dimers.

167
M 1 2 3 M4 5 6 7 M8 9 10 M 11 12 C

1000bp

(a) (b)
Plate I: Gel electrophoresis of TEM amplicons
M-1000bp DNA Marker C-Negative Control

168
M1 2 3 4 5 6 7 8 9 10 11 12 C+ C- M

500bp

169
Plate II: Gel electrophoresis of SHV amplicon
M-100bp DNA Marker
C+-Negative control (plus primer)
C--Negative control (no primer)

Table 4.14 shows the antibiotic resistance profile of the isolates as obtained by phenotypic test

using disc diffusion test. Eleven (92%) of the isolates were resistant to Ampicillin and

Cephalothin which is broad spectrum resistance while 10 (83%) of them were resistant to

Cefpodoxime (CPD) and Ceftriaxone (CRO) or both which indicated extended spectrum

resistance. Fig. 4.11 shows the distribution of both genes in the bacterial isolates.

170
 Table 4.14: Antibiotic resistance profiles of the isolates used for molecular studies

S/no Isolate Identification Source No. of antibiotics Antibiotic β-lactamase

code of isolate of the isolate resistant genes
isolate is resistant to phenotype identified
1. 1 SFe15 E.coli Smoked fish 3 AMP, KF, TE Nil

2. 2 SFe16 E.coli Smoked fish - Nil TEM

3. 3 Ze11 E.coli Zoborodo *5 AMP, KF, TEM

CPD, CRO, TE

4. 4 Ze7 E.coli Zoborodo 3 AMP, KF, TEM

CPD, SXT, TE

171
5. 5 Zk2 Klebsiella Zoborodo 3 AMP, KF, CPD Nil
ozaenae

6. 6 Sye1 E.coli Suya *6 AMP, KF, TEM

CPD, SXT, TE,
AMC

7. 7 Sye8 E.coli Suya *5 AMP, KF, TEM

CPD, CRO, TE

8. 8 Sye10 E.coli Suya *5 AMP, KF, TEM

CPD, SXT, TE,

9. 9 Sye17 E.coli Suya *7 AMP, KF, TEM

CPD, CRO,
SXT, TE, AMC

10 Syk2 Klebsiella Suya *5 AMP, KF, SHV

oxytoca CPD, SXT, TE

11 Sye6 E.coli Suya *5 AMP, KF, Nil

CPD, SXT, TE

12 Sye9 E.coli Suya 3 AMP, KF, CPD TEM

Key: Sye -E.coli from suya; SFe- E.coli from smoked fish; Ze- E.coli from zoborodo; Zk- Klebsiella sp. from
zoborodo; *Multidrug resistance ; AMP-Ampicillin; KF- Cephalothin; CPD- Cefpodoxime; CRO-Ceftriaxone; CIP-
Ciprofloxacin; SXT- Sulphamethoxazole-trimethoprim (Co-trimethoprim); TE-Tetracycline; AK-Amikacin; AMC-
Amoxicillin-clavulanic acid (Augmentin)

172
 80
70 66.7

60
% frequency

50
40
30 25
20
8.3
10
0
0
TEM SHV Both genes No gene
β-lactamase genes

Fig. 4.11 Distribution of TEM and SHV genes in the tested bacterial strains

173
Result of nucleotide sequence in Sye10 (isolate 8) showed 86% homology with β-lactamase

TEM-1gene but the sub-type of SHV gene could not be confirmed by sequencing possibly

because the primer could not amplify the entire open reading frame of the blaSHV (Table 4.15).

174
Table 4.15: Sequence analysis of TEM gene

Sample Nucleotide Number of Sequence Query Maximum Accession

code blasted Base pairs identity coverage Identity Number
blasted via blast (%) (%)
Sye10 GGGACTTTTGTGGCCTTCCTGTT 347 Escherichia coli 87 86 JX976326.1
(Isolate 8) TGTTTGGCTCANCCCAGAAACG Plasmid pECDF
ACTGGGGTGGAAAGTAGAAAG 16
AATTGCTGAAGAATCAGTTGGG Extended
TTGCACGAGTGGGTTACATTCG spectrum 2
AACTGGATCTCAACAGCGGTAA (TEM-1)
GATCTGAGAGTTTTCGCCCGAA gene, complete
GAACGTTTTCCATTGATGAGCA cds
CTTTAAGTCTGCTATGTGGTGC
GTATATCCGTGTTGACGCCGGG
CAGAGCACTCGGTCGCGCATAC
CTATTCTCGANGACTGGGTGAG
TACTCACAGTACAGAAAGCTTC
TACGATGCTGACGTAGAAATAT
GCATGCGCCTACATATATACCG
CGCACTACTTGCGAAGA

175
Sperman‘s correlation shows moderate correlation (rs = 0.258) between the presence of any of

the two genes and resistance to third generation cephalosporins (p= 0.418). So, the correlation is

insignificant (AppendixVII).

176
 CHAPTER 5

DISCUSSION

From the results of this study, there was no antibacterial activity of Carica papaya extract

against the organisms by the paper disk diffusion test. This is similar to the result obtained by

Nweze and Eze (2009) where there was no antibacterial activity against E.coli both for the type

culture and the clinical isolate by a medicinal plant; Ocimium gratissimum leaf extract. The

explanation was that some of the secondary metabolites were absent and that when present,

probablyare in low concentrations or a slight alteration in the rate of diffusion of the test agent.

According to Agbagwa and Okolo (2012), plant extracts are usually more active against Gram

positive bacteria than Gram negative bacteria. Cheruiyot et al. (2009) found out that Vernonia

amygdalina showed no activity against E.coli and Pseudomonas aeruginosa thus indicating its

narrow spectrum of activity. These Scientists also stated that Lantana camara showed activity

against Staphylococcus aureus but was inactive against E.coli probably due to the cell wall

structure. In agreement with other Researchers, they stated that these observations were likely to

be due to the differences in the cell wall structure between Gram-negative outer membranes

acting as a barrier to many environmental substances, including antibiotics. Karou et al. (2007)

explained further that Gram positive bacteria are often found to be more susceptible to plant

extracts than the Gram-negative ones because Gram-positive bacteria have only an outer

177
peptidoglycan layer which is not an effective barrier while the Gram-negatives have an outer

phospholipid membrane that makes the cell wall impermeable to lipophilic solutes, while the

porines constitute a selective barrier to hydrophilic solutes. The test bacteria used in this study

were all Gram-negative organisms. The cell walls of E.coli and Klebsiella spp. used in this study

possibly inhibited the root, stem-bark and leaf extracts of Carica papaya.

The choice of the antibiotics regimen was useful in the determination of the spectra of resistance

since they represent the penicillin and cephalosporin structural subclasses as well as members of

other families of commonly used antibiotics for infections caused by the test bacteria. Broad-

spectrum resistance was taken as resistance to ampicillin or cephalothin. In this study, most of

the bacteria were resistant to cephalothin and had a pooled resistance of 75%. Cephalothin, a

prototype of first of generation cephalosporins, is a narrow spectrum drug, which has it‘s best

activity against Gram-positive pathogens except methicillin-resistant S. aureus (MRSA), and is

active against some Gram-negative organisms, such as E.coli and Klebsiella strains (Walsh,

2003). Ampicillin resistance followed with 31 resistant organisms (60%) as shown in Table 4.12.

This shows that almost all the organisms that are resistant to ampicillin are equally resistant to

cephalothin while the organisms that were resistant to just one antibiotic were resistant to either

ampicillin or cephalothin. Ampicillin-resistance is increasingly common and at an alarming rate.

Up to 90% of ampicillin resistance in E.coli is due to the production of TEM-1 (Lim et al.,

2009). This enzyme is able to hydrolyse penicillins and early cephalosporins such as cephalothin

and cephaloridine. The frequency of Tem-genes in the bacteria used for the molecular aspect of

this work was 66.7%. TEM-type β-lactamases are most often found in E. coli and K.

Pneumoniae, also in other species of gram-negative bacteria with increasing frequency

178
(Bradford, 2001). Anguzu and Olila (2007) obtained as low as 9.4% sensitivity to ampicillin

among Gram-negative organisms

Twenty eight (54%) of the isolates were resistant to tetracycline while only 15(29%) were

resistant to the action of co-trimoxazole. Tetracycline resistance is already emerging in clinical

isolates in many communities (Hassan et al., 2011).

ESBL was detected if organism was resistant to one of the indicator cephalosporins

(cefpodoxime and ceftriaxone) (Aminzadeh et al., 2008). ESBLs are able to hydrolyse 3rd

generation cephalosporins and monobactams (Bali et al., 2010). For this study, cefpodoxime and

ceftriaxone discs were used. The result reveals that ceppodoxime detected more ESBL than

ceftriaxone (Table 4.12). Best activity was found in ciprofloxacin (Fluoroquinolone) and

amikacin (Aminoglycoside) with 100% sensitivity to all the isolates. Ciprofloxacin is a broad

spectrum fluoroquinolone which has been found to possess excellent activity in vivo against

Enterobacteriaceae (Yao and Moellering, Jr. 2007). Several studies have established that

susceptibility to ciprofloxacin or other fluoroquinolones are quite high among ESBL producing

Enterobacteriaceae (Hassan et al., 2011). The Aminoglycosides are bactericidal agents that

inhibit bacterial protein synthesis and have been found to be particularly potent against the

Enterobacteriaceae among other aerobic Gram-negative rods (Yao and Moellering, Jr. 2007).

Aminazadeh et al. (2008) obtained 93.5% susceptibility of E.coli isolates to amikacin. Several

studies have shown that treating infection caused by ESBL with cephalosporins often do not

yield good therapeutic result and suggested that fluoroquinolones and aminoglycosides could be

alternative choices (Iroha et al., 2008). Very high susceptibility to amoxicillin-clavulanic acid

179
was also observed in the study. The combination of amoxicillin and clavulanate, known as

Augmentin, for the augmentin powers that clavulanate confers to amoxicillin, has been the most

widely used form of penicillin in recent years (Walsh, 2003). Clavulanic acid is a naturally

occurring, weak antimicrobial agent found initially in cultures of Streptomyces clavuligerus (Yao

and Moellering, Jr., 2007). On its own it is a poor substrate for PBP and so is not considered an

antibiotic. Its utility derives from its ‗suicide substrate‘ properties with β-lactamases (Walsh,

2003). It inhibits β-lactamases from Staphylococci and many Gram-negative bacteria, forming

an irreversible acyl enzyme complex with the β-lactamase, leading to loss of activity of the

enzyme. This synergistic effect of clavulanate and various penicillins and cephalosporins has

yielded much success in the battle against resistance due to β-lactamase production. Plasmid-

mediated TEM β-lactamases present in strains of K. pneumoniae and E.coli especially are

inactivated by this drug (Yao and Moellering, 2007). This result agrees with Edelstein et al.

(2003) which states that β-lactam- β-lactamase inhibitor combinations, carbapenems,

aminoglycosides and fluoroquinones are considered to be potentially active drugs against ESBL-

producing organisms.

Multidrug resistance (MDR) was taken as resistance to four or more antibiotics tested (Ezekiel et

al., 2011). Infections caused by ESBL-producers often exhibit a multidrug-resistance phenotype,

leaving only a few reliable therapeutic options (Fam and El-Damarawy, 2008). ESBLs

production is increasingly an important cause of transferable multidrug resistance in Gram-

negative bacteria throughout the World (Bali et al., 2010). In this study, Pearson correlation

showed significant correlation between ESBLs production and multi-drug resistance (p<0.005)

(AppendixVII).

180
Multiple antibiotic resistance (MAR) index is a measure of the extent of antimicrobial agent

resistance for the isolates in the group studied. (Apun et al., 2008). It gives an indirect

suggestion of the probable source of the organism (Olayinka et al., 2004). MAR index values

greater than 0.2 indicate that the isolates were recovered from samples originating from high-risk

sources (Apun et al., 2008). Most probably, there are no strict rules concerning antibiotic

prescriptions and usage in such areas.

Analysis of pooled antibiotic resistance of the isolates showed significally higher mean values of

antibiotic resistance of isolates from ‗suya‘ than from smoked fish or ‗zoborodo‘(Table 4:12).

The main reason still remains in the fact that ‗suya‘ is of animal origin while the other samples

were not. The use of antibiotics in food animals selects for bacteria resistant to antibiotics used in

humans. Resistance can be selected in food animals, and resistant bacteria can contaminate

animal-derived food (Philips et al., 2004). The dissemination of E.coli in food production units

may equally occur via faecal cross-contamination between groups of animals (or individuals),

and the contamination of food derived from animals may occur during processing in the abattoir

(Horton et al., 2011). Antibaoterial resistant bacteria have been identified along production path

of ‗suya‘. Amosun et al. (2012) confirmed that on-farm and slaughter cattle are important

sources of antibacterial resistant E.coli transmissible to humans through beef.

In developed countries, the main reservoirs for antimicrobial drug resistance in enteric bacteria

have been attributed to farm animals such as cattle, sheep, pigs and poultry (Ombui et al., 2000).

Contact with these animals or consumption of food products from them has been the main route

181
of dissemination of resistance into the human populations. Therefore, transmission of drug

resistant bacteria from farms into the community and subsequently to patients in hospitals may

occur through food. This demonstrates how resistant bacteria arising from indiscriminate use of

antibiotics in animals may impact on human health (Ombui et al., 2000). Of particular concern

are antimicrobial growth promoters that are used in both human and veterinary medical

applications (e.g. Tetracycline) or that share a common antibiotic family with antibiotic essential

for treatment of bacterial diseases in humans (Alexander et al., 2008) . Drug resistance in

animals is caused mainly by the large amount of antimicrobial drugs used in food production. In

addition to their presence in farm animals, ESBL genes have been found in retail meat

(Overdevest et al., 2011).

The sensitivity of the nitrocefin sticks was calculated as 12.9%. Different β-lactamase enzymes

have been found to exhibit differences in substrate specificities, this leads to partial colour

reactions and an increase in false negatives for the colour based test. For this study, another

factor could be storage conditions during shipping and handling. The sticks were to be stored

freezed at -10oC but this temperature was not achieved at all during the study. The implication is

that as good as these sticks may be, being a cold chain test kit reduces its sensitivity rate when

used in under-developed countries where power supply is inconsistent.

Among the most clinically and economically important antibiotic resistance genes are those

encoding the β-lactamases (bla genes) producing high level resistance to β-lactam antibiotics, the

most widely used antibiotics in clinical and veterinary practice (Brusetti et al., 2008). The

182
description of antibiotic resistant bacteria in non-clinical environments such as farm animals, fish

farms, sewage, drinking water, polluted rivers, and food items has mostly been on phenotypic

investigations of the antibiotic resistant bacteria. There is need to detect the specific antibiotic

resistance genes by molecular methods and their pattern of resistance can provide useful

information and aid in rational antibiotic therapy. This study also provides an assessment of the

presence of TEM and SHV genes in some of the bacterial isolates. Emphasis has been on clinical

and environmental samples, there is a need to assess Ready-to-Eat foods as reservoirs of ESBL-

encoding bacteria.

This study presents genotypic identification of TEM and SHV genes among 12 isolates that were

mostly resistant to broad spectrum cephalosporins from the phenotypic test (Disc diffusion test).

TEM gene had higher frequency of 66.7% compared to SHV gene with 8.3%. A fact similar to

previous studies (Lal et al., 2007; Zaniani et al., 2012). No isolate was found to harbour both

TEM and SHV genes together. This was also the case in the result of Zhang et al. (2010) where

none of the ESBLs producing bacteria had both TEM and SHV kind. Three (25%) isolates of

which two were categorized as ESBL producers based on double disk synergy test (DDST) did

not contain any of the genes. They must have contained other genes that were not tested for in

this study. Further studies are required for finding the other genes in ESBLs producing E. coli

and Klebsiella sp. from these foods.

It should also be noted that the isolates may have more than one blaTEM or blaSHV gene present,

and amplification and sequencing only detected a single genotype. This is probable because, if

multiple blaTEM and blaSHV genes are present, the predominant one will preferentially amplify and

183
produce sequence (Paterson et al., 2003). Recently, 167 TEM β-lactamases that are commonly

found in the Enterobacteriaceae family have been identified (Yazdi et al., 2011). The most

prevalent ESBL types have evolved through point mutations of key amino acid substitutions in

the parent TEM and SHV enzymes (Al-Jasser, 2006). Over 100 variations and point mutations in

TEM gene had been reported during DNA sequencing. These mutations are mostly responsible

for resistance to beta lactams in these isolates (Jain and Mondal, 2008).

It was also noted that while SHV gene was detected in Klebsiella oxytoca only, TEM genes were

detected in only E.coli all through. This is in agreement with the observations of Podbielski et al.

(1991) which stated that Klebsiella strains sometimes contain the plasmid-encoded β-lactamases

of the SHV-type and less often of the TEM-type. One isolate SFe 16, that was susceptible to all

the antibiotics in the DDT was found to harbour a TEM gene. This discrepancy in the DDT and

PCR could be due to inoculum effect and substrate specificity which may render the enzyme in

an un-induced state at the time of testing with DDT. This creates a major challenge in laboratory

routine susceptibility tests. The degree of resistance against third-generation cephalosporins can

be highly variable among different ESBL enzymes. While some ESBL producing strains have

overt resistance to broad spectrum β-lactam antibiotics, many will not be phenotypically resistant

(Jain and Mondal, 2008).

Sequencing results showed that the blaTEM in Sye10 (isolate 8) had 86% homology with β-

lactamase TEM-1gene. Higher identity would probably have been obtained but for two

nucleotides (designated as ―N‖), which were not specified by the sequencer (Table 4.15).

Although, the entire blaTEM genes were not sequenced and so we cannot categorically say that the

entire TEM genes present are TEM-1. However, TEM-1 is the most commonly encountered β -

184
lactamase in Gram-negative bacteria (Al-Jasser, 2006). Up to 90% of ampicillin resistance in

E.coli is due to the production of TEM-1 (Lim et al., 2009). This enzyme is able to hydrolyse

penicillins and early cephalosporins such as cephalothin and cephaloridine (Bradford, 2001).

That is not suprising because diverse point mutations in the blaTEM-1 gene have contributed to the

emergence of TEM-type extended-spectrum β-lactamases (ESBLs), resulting in simultaneous

resistance to penicillins and broad-spectrum cephalosporins (Balsalobre et al., 2010)

Sequence analysis of blaSHV in Syk2 (isolate 10) could not confirm the subtype. The reason for

this is not yet known but must be similar to the case of Lim et al. (2009), who could not confirm

specific SHV- subtypes in their study because their primers only amplified a portion of the

blaSHV reading frame. Kolar et al. (2010) also had a similar experience with blaTEM gene. The

SHV-type of ESBL may be found in clinical isolates more frequently than any other type of

ESBLs. Unlike the TEM-type β-lactamases, there were relatively few derivatives of SHV-1. The

majority of SHV variants possessing an ESBL phenotype were characterized by the substitution

of a serine for glycine at position 238. Some had a substitution of lysine for glutamate at position

240. The serine residue at position 238 is critical for efficient hydrolysis of ceftazidime while

lysine residue is critical for the efficient hydrolysis of cefotaxime. More than 50 SHV varieties

have been described worldwide. SHV-type of ESBLs has been detected in a wide range of

Enterobacteriaceae (Al-Jasser, 2006). A total of 40 types of SHV-type ESBL enzymes are

already reported (Jain and Mondal, 2008).

The fact that these genes also confer resistance to other commonly used antibiotics such as

Tetracycline and Co-trimethoprim is a well known fact and this was evident in the organisms

185
used for this study as 7 (58.3%) of the organisms exhibited multidrug resistance. However,

Sperman‘s correlation showed moderate correlation between the presence of any of the two

genes and resistance to third generation cephalosporins (rs = 0.258). There is no significant

correlation between the presence of any of the two genes and resistance to third generation

cephalosporins (p>0.05) (Appendix VIII).

CHAPTER 6

SUMMARY, CONCLUSION AND RECOMMENDATIONS

6.1 SUMMARY

This study presents to us the fact that the antibiotic resistance bacteria are no longer confined to

the hospitals and with nosocomial infections but are ever present in our environment, and

successfully gain access into the food chain through various means. The use of plant-based

systems continues to play an essential role in health care (Karou et al., 2007). This however, is

increasingly facing resistance by certain groups of microorganisms especially Gram-negative

bacteria. Although Gram-negative rods have several layers of the peptidoglycan, they are

overlaid with an outer membrane composed mainly of lipopolysaccharides. The outer

186
membrane is an important permeability barrier which provides protection against various

antibacterial materials (Shimamura et al., 2007). Ready-to-eat foods could be raw or cooked,

hot or chilled and can be consumed without any further heat treatment (Clarence et al., 2009).

As consumption of ready-to- eat foods increases, these categories of food have become potent

reservoirs for antimicrobial resistant genes. Concerns persist regarding the potential negative

impacts of antimicrobial use in livestock and, in particular the potential for the emergence of

antimicrobial resistance in human and animal pathogens. The introduction into clinical practice

of the oxyimino-cephalosporins for treatment of serious infections due to Gram-negative

bacteria was soon followed by emergence of the so-called extended spectrum β-lactamases

(ESBLs) .Third generation cephalosporins have important applications to both human and

veterinary medicine due to their broad spectrum, generally bactericidal effects (Singer et al.,

2008). Over reliance on third generation cephalosporins to treat Gram negative infections is one

prime factresponsible for increased resistance to this class of antibiotics (Kumar et al., 2006).

These enzymes are mostly plasmid-encoded derivatives of TEM-1, TEM-2 and SHV-1. They

confer resistance to third generation cephalosporins as well as to monobactams, in addition to

broad-spectrum penicillins and narrow-spectrum cephalosporins (Haeggman et al., 2004). The

ESBLs constitute a serious potential hazard for clinicians attempting to treat patients who are

infected with bacteria that express these resistance determinants. They also provide the

opportunity for continuing basic scientific research into the evolution and dissemination of

resistance determinants that threaten the continued use of a valuable family of antimicrobial

agent (Heritage et al., 1999).

6.2 CONCLUSION

187
The result from this study indicate that most of the ESBL-encoding genes especially blaTEM are

carried on plasmids which are transmissible, suggesting that the spread of ESBLs and other

antibiotic resistance determinants are most likely to be plasmid mediated. This is in agreement

with the conclusion of other Workers (Lim et al., 2009). Therefore, the widespread uses of

antibiotics, coupled with the transmissibility of resistance determinant mediated by plasmids,

transposons, and gene cassettes in integrons are factors that contribute to the increase in

antibiotic resistance in bacteria pathogens.

Determination of ESBL type in ESBL-producing bacteria could provide useful information for

management and control of antibiotic resistance spread in several regions. To achieve this,

molecular techniques, such as PCR and further characterization with sequencing are

indispensable since the phenotypic method cannot efficiently differentiate ESBL type.

6.3 RECOMMENDATIONS

i. Fast Detection and Identification of Reservoirs

The incorporation of fast and adequate tests for detection of ESBLs as a routine in all

Microbiology laboratories remained a main issue that needs to be addressed. This can be

obtained by using molecular-biological methods of gene analysis. A staggeringly diverse group

of species maintain a large capacity for carrying and mobilizing resistance genes. These bacteria

constitute a largely ignored ―reservoir‖ of resistance genes and provide multiple complex

pathways by which resistance genes propagated in animals can directly, or more likely indirectly,

188
make their way over time into human pathogens via food, water, and sludge and manure applied

as fertilizer (Marshall and Levy, 2011).

ii. Reduced and Appropriate Consumption of Antimicrobials both for Human and Animals
It is now generally accepted that the main risk factor for the increase in antibiotic resistance in

pathogenic bacteria is the increased use of antibiotics. This has inevitably led to the emergence

and dissemination of resistant bacteria and genes. This situation applies to antibiotic usage both

in animals and in humans. In both populations antibiotics are used for therapy and prophylaxis of

infectious diseases (van den Bogaard and Stobberingh, 2000).

iii. Strict Adherence to Standard Hygiene Practices

Available data suggest that food can contribute to the dissemination of resistant

Enterobacteriaceae in the community. To ensure that ready-to-eat food is microbiologically safe,

both the manipulators and the food need to be continually monitored. The commercial

manufacture of ready-to-eat foods consists of a small number of the operations, but this critical

process can lead to the introduction of the microorganisms or the proliferation of those already

present. Possible sources of the microbial contamination have been identified as a) unhygienic

handling; b) raw material; c) inadequate cleaning of the machines used to cut the food, knives,

contact surfaces, clothes and manipulators hands, and d) airborne contamination (de Sousa,

2008).

6.4 CHALLENGES

Carrying out this research work was not without several constrain; they include the following:

1. Insufficient fund

189
 2. Non availability of several needed equipment in the research laboratory

3. Scarcity of some media and reagents

4. Inconsistency of power supply

References

Abbas, I.I. and Arigbede, Y.A. (2012). Green Area Mapping of Ahmadu Bello University Main
Campus, Zaria, Nigeria using Remote Sensing (Rs) and Geographic Information
System (Gis) Techniques. Journal of Geography and Regional Planning 5(10)287-292.
Abdullahi, I.O. and Elegbe, S.T. (2001). Microbial Profile of ‗zobo‘ drink in Samaru, Zaria.
Proceeding of the 25th Annual NIFST Conference 5-9th Nov., Lagos. Pp163-164.

Abdullahi, I.O., Umoh, V. J., Ameh, J. B. and Galadima, M.(2005). Comparative Assessment of
the Microbiological Quality of three Local Meat Products sold in Zaria. Nigerian
Journal of Scientific Research 5:55-60

190
Adams, M.R. and Moss, M.O. (1999). Food Microbiology. The Royal Society of Chemistry,
Catmbridge p138.
Adebayo, O.T., Bello-Olusoji, A.O. and Seriki, B.M. (2003). Effect of Storage Period on the
Quality of Smoked African Catfish, Clarias gariepinus. Journal of Tropical Biosciences
3:1-2.
Agbagwa, O.E.and Okolo, I. (2012). Antibacterial Activity of Honey and Propolis Marketed in
Nigeria using well-in-agar and disc diffusion method. International Research Journal of
Microbiology (IRJM). 3 (3)101-105.

Aghel, N., Moghimipour, E. and Dana, A.R. (2006). Formulation of a Herbal Shampoo using
Total Saponins of Acanthophyllum squarrosum. Iranian Journal of Pharmaceutical
Research 6(3)168.

Ahmed, A. A., Osman, H., Mansour, A.M., Musa, H.A., Ahmed, A.B., Karrar, Z. and Hassan,
H.S. (2000). Antimicrobial Agent Resistance in Bacterial Isolates from Patients with
Diarrhea and Urinary Tract Infection in the Sudan. American Journal of Tropical
Medicine and Hygiene 63 (5, 6):259-263.
Ajayi, A.O., Balogun, S.A. and Adegbehingbe, K. (2008). Microorganisms in the Crude Oil-
producing Areas of Ondo State, Nigeria. Scientific Research and Essay 3(5)174-179.
Akiniyi J.A. and Efiom, O.O. (2005). Antibacterial Activities of Hexane and Ethanol Extract of
Cissampelos owariensis. Biological and Environmenta1 Journal for the Tropics 2(1)9.
Akinyemi, K.O., Oladapo, O. Okwara, C.E., Ibe, C.C. and Fasure, K.A. (2005). Screening of
Crude Extracts of six Medicinal Plants used in South-West Nigerian Unorthodox
Medicine for Anti-Methicillin Resistant Staphylococcus aureus Activity. BMC
Complementary and Alternative Medicine 2005, 5:6.
Alexander, T.W., Reuter, T., Sharma, R., Yanke, L.Y., Topp, E. and McAllister, T.A. (2009).
Longitudinal Characterization of Resistant E.coli in Fecal Deposits from Cattle Fed
Subtherapeutic levels of Antimicrobials. Applied and Environmental Microbiology
75(22)7125.
Alexander, T.W., Yanke, L.Y., Topp, E., Olson, M.E., Read, R.R., Morck, D.W. and McAllister,
T.A. (2008). Effect of Subtherapeutic Administration of Antibiotics on the Prevalence of
Antibiotic-Resistance Escherichia coli Bacteria in Feedlot Cattle. Applied and
Environmental Microbiology 74 (14)4405-4416.
Al-Jasser, A. M. (2006). Extended Spectrum Beta-Lactamases (ESBLs): A Global Problem.
Kuwait Medical Journal, 38 (3):171-185.
Aminov, R.I., Chee-Sanford, J. C.C., Garrigues, N., Mehboob, A. and Mackie, R.I. (2004).
Detection of Tetracycline Resistance Genes by PCR Methods. In: Methods in
Molecular Biology, vol. 268: Public Health Microbiology: Methods and Protocols.
Edited by J.F.T. Spencer and A.L. Ragout de Spencer. Humana Press Inc., Totowa, Nj
Pp3-4

191
Aminzadeh, Z., Kashi, M.S. and Sha‘bani M. (2008). Bacteriuria by Extended-Spectrum β-
lactamase-producing Escherichia coli and Klebsiella pneumonia Isolates in a
Governmental Hospital in South of Tehran, Iran. International Journal of kidney
diseases 2:197-200.
Amosun, E.A., Ojo, O.E., Alao, I.K. and Ajuwape, A.T.P. (2012). Antimicrobial Resistance
among commensal E.coli from cattle faeces and beef in Ibadan, Nigeria. African Journal
of Biotechnology, 11(58) 12240-12245. Doi: 10.5897/AJB12.1646.
Anguzu, J. and Olila, D. (2007). Drug Sensitivity Patterns of Bacterial isolates from Septic Post-
operative wounds in a regional referral hospital in Uganda. African Health Sciences
7(3): 148-154.
Antibiotics Antibacterial Agents (2010). www.microbiologyprocedure.com∕bacterial-
chemotherapy. Accessed 24th April, 2010.
Apun, K., Chong, Y.L., Abdullahi, M.T. and Micky, V. (2008). Antimicrobial Susceptibilities of
Escherichia coli Isolates from Food Animals and Wildlife Animals in Sarawak, East
Malaysia. Asian Journal of Animal and Veterinary Advances 3 (6) 409-416.
Avanza, P.V. (2005). Aerobic Plate Counts of Philippine Ready-to-eat Foods from Takeaway
Premises. Journal of Food Safety 25:80-97.
Ayandele, A.A. and Adebiyi, A.O. (2007). The Phytochemical Analysis and Antimicrobial
Screening of Extracts of Olax subscorpioidea. African Journal of Biotechnology, 6(7)
868-870.
Ayo, J. A., Umianze, H. and Gaffa, T. (2004). Microbiological Evaluation of ‗Kunun zaki‘ and
‗Zoborodo‘ Drink (Beverages), Locally Produced and Sold in a Polytechnic Community
in Nigeria. Nigerian Food Journal 22:119-120.
Balaraju, K., Arokiyaraj, S., Agastian, P., Paulraj, N.T. and Ignacimuthu, S. (2008b).
Antibacterial Activity of Swertia chirata Buch – Hams. A highly valuable Medical herb.
Journal of Pure and Applied Microbiology, 2(1) 223.
Balaraju, K., Arokiyaraj, S., Agastian, P., Perinbam, K. and Ignacimuthu, S. (2008a).
Antimicrobial Activity of Leaf Extracts of Pterocarpus santalinusL. (Fabaceae) Journal
of Pure and Applied Microbiology, 2(1) 161-164.
Bali, B.E.. Acik, L. and Sultan, N. (2010). Phenotypic and Molecular Characterization of SHV,
TEM, CTX-M and Extended-Spectrum β-lactamase Produced by Escherichia coli,
Acinobacter baumannii and Klebsiella Isolates in a Turkish Hospital. African Journal of
Research 4 (8) 650-654

192
Balsalobre, L. C., Dropa, M., de Oliveira, D. E., Lincopan, N., Mamizuka, E. M., Matté, G. R.
and Matté, M. H. (2010). Presence of blaTEM-116 in Environmental Isolates of
Aeromonas hydrophila and Aeromonas jandaei from Brazil. Brazilian Journal of
Microbiology 41:3.

Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Truck, M. (1966). Antibiotic Susceptibility
Testing by a Standardized Single Disc Method. The American Journal of Clinical
Pathology, 45:4:493.

Bayarski, Y. (2006). Antibiotics Classification and Side Effects.

http://ezinearticles.com/?Antibiotics-Classification-And-Side-Effects&id=288137.
Accessed April 24, 2010.

Beginners Guide to Soxlet Extractions

www.erowid.org/archive/rhodium/pdf/soxhlet/dummies.pdf Retrived on June 6, 2013.
Bell, C. and Kyriakides, A. (2004). Pathognic Escherichia coli. In: Foodborne Pathogens. Edited
by Clive de W. Blackburn and Peter J. McClure. Woodhead Publishing Limited, Pp 279-
295.
Berg, H.F., Tjhie, J.H.T., Scheffer, G., Peters, M.F., vanKeulen, P.H.J., Kluytmans, J.A.J.W. and
Stobheringh, E.E. (2004). Emergence and Persistence of Macrolide Resistance in
Oropharyngeal Flora and Elimination of Nasal Carriage of Staphylococcus aureus after
Therapy with Slow-release Clarithromycin: a Randomized, Double-Blind, Placebo-
controlled study. Antimicrobial Agents and Chemotheraphy 48(11):4183.
Beta- lactam Antibiotic (2013). The Chemistry Encyclopedia.
www.chemistrydaily.com/chemistry/Beta-lactam_antibiotic
Black, J.G. (2005). Microbiology: Principles and Explorations. 6th ed. John Wiley and Sons, Inc.
Pp336-371.
Blackburn, C. and McClure, P. (2004). Introduction. In: Foodborne Pathogens. Edited by Clive
de W. Blackburn and Peter J. McClure. Woodhead Publishing Limited. Pp 1-6.
Bland, M. (1999). An Introduction to Statistics. Oxford Medical Publication Pp 331-341.
Bradford, P.A. (2001). Extended Spectrum β-lactamases in the 21st Century: Characterization,
Epidemiology and Detection of this Important Resistant Threat. Clinical
Microbiological Reviews 14 (4) 933-951.
Braide, W., Oranusi, S. and Peter-Ikechukwu, A. I. (2012). Perspectives in the Hurdle
Techniques in the Preservation of a non-alcoholic beverage, ‗Zobo‘. African Journal of
Food Science and Technology, 3(2) 46-52.
Brusetti, L., Glad, T., Borin, S., Myren, P., Rizzi, A., Johnsen, P.J., Carter, P., Daffonchio, D.,
and Nelsen, K.M. (2008). Low prevalence of blaTEM genes in Arctic Environments and
Agricultural soil and Rhizosphere. Microbial Ecology in Health and Disease 20: 27-36

193
Cakir, I., Dogan, H.B., Baspinar, E., Keven, F. and Halkman, A. K. (2002). The need for
Confirmation in Coliform and E.coli Enumeration in Foods. Turkish Journalof
Veterinaryand Animal Science 26:1049
Carattoli, A. (2011). Plasmids in Gram negatives: Molecular typing of resistance plasmids.
International Journal of Medical Microbiology, 301: 654– 658.

Carbapenem: Structure (2010). http://www.servinghistory.com/topics/carbapenem

:sub::structure. Accessed 7th September, 2010.
Chang, F., Siu, L.K., Fung, C., Huang, M. and Ho, M. (2001). Diversity of SHV and TEM β-
Lactamases in Klebsiella pneumoniae: Gene Evolution in Northern Taiwan and Two
Novel β-Lactamases, SHV-25 and SHV-26. Antimicrobial Agents and Chemotherapy 45
(9) 2407–2413.

Chapin, K.C. and Lauderable, T. (2007). Reagents, Stains and Media: Bacteriology. In: Manual
of Clinical Microbiology, 9th edition, vol.1. Eds P.R.Murray, E.J.Baron, J.H.Jorgensen,
M.L. Landry and M.A.Pfaller. ASM press, Washington, D.C. U.S.A. Pp351-354.
Chaudhary, B.L. and Khanam, S. (2008). Evaluation of Preliminary Antibacterial Screening of
Jatropha curcas (L.): An in vitro study. Journal of Pure and Applied Microbiology,
2(1), 253-256.

Chaudhary, U. and Aggarwai, R. (2004). Extended Spectrum -lactamases (ESBLs). An

Emerging Threat to Clinical Therapeutics. Indian Journal of Medical Microbiology,
22(4) 75.
Cheruiyot, K.R., Olila, D. and Kateregga, J. (2009). In-vitro Antibacterial Activity of selected
Medicinal Plants from Longisa Region of Bomet District, Kenya. African Health
Sciences 9 (1) 42-46
Clarence, S.Y., Obinna, C.N. and Shalom, N.C. (2009). Assessment of Bacteriological Quality
Food of Ready-to-eat (Meat pie) in Benin City Metropolis, Nigeria. African Journal of
Microbiology Research 3(6)390-395
CLSI (2008). Clinical and Laboratory Stardards Institute. Performance Standards for
Antimicrobial Susceptibility Testing. Eighteenth Informational Supplement. M100-S18
vol. 28 no.1
Cornejo-Juarez P, Perez-Jimenez C, Silva-Sanchez J, Velazquez-Acosta C, Gonzalez-Lara F,
Reyna-Flores F, Sanchez-Perez A, Volkow-Fernandez P. (2012). Molecular Analysis
and Risk Factors for Escherichia coli Producing Extended-spectrum β-lactamase
Bloodstream Infection in Heamatological Malignancies. PLoS ONE Vol.7/ issue 4/
e35780, 2012.

Cowan, M.M. (1999). Plant Products as Antimicrobial Agents. Clinical Microbiology Reviews.
565-572.

194
Cullik, A., Pfeifer, Y., Prager, R., von Baum, H. and Witte, W. (2010). A novel IS26 structure
surrounds blaCTX-M genes in different plasmids from German clinical Escherichia coli
isolates. Journal of Medical Microbiology 59: 580–587.

Dai, J. and Mumper, R.J. (2010). Plant Phenolics: Extraction, Analysis and their Antioxidant and
Anticancer Properties. Molecules 15, 7313-7352.

Dale, J.W. and von Schantz, M. (2003). From Genes to Genomes: Concepts and Application of
DNA Technology. John Wiley and Sons, Ltd Pp65-66.

Daniel, E.U., Inyang, C.U. and Umeh, E.U. (2006). Microorganisms Associated with Fresh Fish
obtained from River Benue. Nigerian Journal of Microbiology, 20(3):1314.
Dawson, E. (2007). The Medicinal properties of the papaya, Carica papaya L.
www.sui.edu/ebi/leaflets/papaya.htm. Accessed 3rd August, 2007.
de Sousa, C.P. (2008). The Impact of Food Manufacturing Practices on Foodborne Diseases.
Brazilian Archives of Biology and Technology 51:4.

Denwe, S.D. (2006). Sensitivity Testing of Clinical Isolates of Staphylococcus aureus from some
hospitals in Kaduna metropolis, Nigeria. Biological and Environmental Sciences
Journal for the Tropics 3(1)152-153.

Deschamps, C., Clermont, O., Hipeaux, M.C., Arlet, G., Denamur, E. and Branger, C. (2009).
Multiple Acquisitions of CTX-M Plasmids in the rare D2 Genotype of Escherichia coli
provide Evidence for Convergent Evolution. Microbiology 155:1656–1668

Dharmananda, S. (2005). New Uses of Berberine. A Valuable Alkaloid from Herbs for ‗Damp-
Heat‘ Syndrome. http:www.itmonline.org/arts/berberine.htm Accessed 7th September,
2010.

Donato, J.J., Moe, L.A., Converse, B.J., Smart, K.D., Berklein, F.C., McManus, P.S. and
Handelsman, J. (2010).Metagenomic Analysis of Apple Orchard Soil Reveals Antibiotic
Resistance Genes Encoding Predicted Bifunctional Proteins. Applied and Environmental
Microbiology, 76(13)4396-4401.
Donnenberg, M.S. and Nataro, J.P. (2000). The Molecular Pathogenesis of Escherichia coli
Infections. In: Microbial Foodborne Diseases. Edited by J. W. Cary, J. E. Linz and D.
Bhatnagar. Technomic Publishing CO, Inc. Pp 3-115.
Dutil, L., Irwin, R., Finley, R., King Ng, L., Avery, B., Boerlin, P., Bourgault, A., Cole, L.,
Daignault, D., Desruisseau, A., Demczuk, W., Hoang, L., Horsman, G.B., Ismail, J.,
Jamieson, F., Maki, A., Pacagnella, A. and Pillai, D.R. (2010). Ceftiofur Resistance in
Salmonella enterica Serovar Heidelberg from Chicken Meat and Humans, Canada.
Emerging Infectious Diseases 16 (1) 48-49.
Elayaraja, A., Ramaha, S.A., Samantalu, G. and Garikapati, D.R. (2008). Antibacterial Activity
of Various Crude Extracts of Justicia tranquebariensis. Journal of Pure and Applied
Microbiology 2(1)232.

195
ESBLs, (2003). ESBLs-A Threat to Human and Animal Health? Report by the Joint Working
Group of DARC [Dept. of Environmental, Food and Rural Affairs Antimicrobial
Research Coordination Group] and ARHAI {Advisory Committee on Antimicrobial
Resistance and Healthcare Associated Infections}. www.vmd.defra.gov.uk/pdf/ESBL-
report.pdf
Evermann, J. (2000). Lecture 7: Antibiotics: Benefits and Dangers.
www.vetmed.wsu.edu/courses vm261/Evermann lect7. htm
Ezekiel, C.N., Olarinmoye, A.O., Oyinloye, J.M.A., Olaoye, O.B. and Edun, A.O. (2011).
Distribution, Antibiogram and Multidrug Resistance in Enterobacteriaceae from
Commercial Poultry Feeds in Nigeria. African Journal of Microbiology Research
5(3)294-301
Fam, N.S. and El-Damarawy, M.M. (2008). CTX-M-15 Extended Spectrum β-lactamases
Detected from Intensive Care Unit of an Egyptian Medical Research Institute. Research
Journal of Medicine and Medical Sciences 3 (1)84-91.
Farasat, T., Bilal, Z. and Yunus, F. (2012). Isolation and Biochemical Identification of
Escherichia coli from Wastewater effluents of Food and Beverage Industry. Journal of
Cell and Molecular Biology , 10(1):13-18

Frank, T., Arlet, G., Gautier, V., Talarmin, A. and Bercion, R. (2006). Extended-spectrum -
lactamase producing Enterobacteriaceae, Central African Republic. Emerging
Infectious Diseases, 12:5:863 – 865.
Ghasemzadeh, A. and Ghasemzadeh, N. (2011). Flavonoids and Phenolic Acids. Role and
Biochemical Activity in Plants and Human. Journal of Medicinal Plants Research 5(31)
6697-6703.
Guidelines for the Microbiological Examination of Ready-to-eat Foods-Food Standards Australia
New Zealand. (2001). (Accessed: September 27, 2010).

Gunduz, G., Aydemir, D., Onat, S. M.and Akgun, K. (2011). The Effects of Tannin and Thermal
Treatment on Physical and Mechanical Properties of Laminated Chestnut wood
Composites. BioResources 6 (2), 1543-1555.
Haeggman, S., Lofdahl, S., Paauw, A., Verhoef, J. and Brisse, S. (2004). Diversity and
Evolution of the Class A Chromosome beta-lactamase Gene in Klebsiella pneumoniae.
Antimicrobial Agents and Chemotherapy 48 (7)2400-2407.

Hardie, A.G., Dynes, J.J., Kozak, L.M. and Huang, P.M. (2007). Influence of Polyphenols on the
Integrated Polyphenols –maillard Reaction Humification Pathway as catalysed by
Birnessite. Annals of Environmental Science 1:91-110.
Harrigan, W.F. and McCance, M.E. (1976). Laboratory Methods in Food and Dairy
Microbiology. Academic Press London, Pp 139-141.

196
Hassan, S.A., Jamal, S.A. and Kamal, M. (2011).Occurrence of Multidrug Resistance and ESBL
Producing E.coli causing Urinary Tract Infections. Journal of Basic and Applied
Sciences 7(1)39-43.

Hassan, S.M., Haq, A.U., Byrd, J.A., Berhow, M.A., Cartwright, A.L. and Bailey, C.A. (2010).
Haemolytic and Antimicrobial Activities of Saponin-rich Extracts from Guar Meal. Food
Chemstry 119:600-605

Helmenstine, A.M. (2013). Chemical Structures starting with letter C.

Http://Chemistry.about.com/od/factsstructures/ig/Chemical-structures....C
/index.06.htm. Retrived on June 7, 2013.

Heritage, J., M‘Zali, F.H., Gascoyne-Binzi, D. and Hawkey, J., P.M. (1999). Evolution and
Spread of SHV Extended-Spectrum β-lactamases in Gram-negative Bacteria. Journal of
Antimicrobial Chemotherapy 44:309-318.

Hoareau, L. and DaSilva, E.J. (1999). Medicinal Plants: a re-emerging health aid. Electronic
Journal of Biotechnology, 2:2. 56.

Horton, R.A., Randall, L.P., Snary, E.L., Cockrem, H., Lotz, S., Wearing, H., Duncan, D., Rabie,
A., McLaren, I., Watson, E., La Ragione, R.M. and Coldham, N.G. (2011). Fecal
Carriage and Shedding Density of CTX-M Extended-Spectrum β-Lactamase-Producing
Esherichia coli in Cattle, Chickens, and Pigs: Implications for Environmental
Contamination and Food Production. Applied Environmental Microbiology, 77(11)
3715-3719.

Hunter, P.R., Wilkinson, D.C., Catling, L.A. and Barker, G.C. (2008). Meta-Analysis of
Experimental Data Concerning Antimicrobial Resistance Gene Transfer Rates during
Conjugation. Applied and Environmental Microbiology, 74(19)6085.
Hosein, A., Munoz, K., Sawh, K. and Adesiyun, A. (2008). Microbial Load and the Prevelence
of Escherichia coli, Salmonella spp. And Listeria spp. In Ready-to-eat Products in
Trinidad. The Open Food Science Journal 2:23-28.

Ibrahim, G., Mahmaoud, N., Yaro, A.H. and Ahmed, A. (2006). Phytochemical and Toxicity
evaluation on the Stem bark of Ficus sycomorous Linn. (Moraceae). Biological and
Environmental Sciences Journal for the Tropics 3(3)38.
Idise, O.E. (2007). Inhibition of Food Spoilage Organisms with Neem Seed Oil.Journal of Pure
and Applied Microbiology, 1(1), 52.

Inyang, C.U., Igyor, M.A. and Uma, E.N. (2005). Bacteria Quality of a Smoked Meat Product
(‗Suya‘). Nigeria Food Journal 23:239-240.
Iroha, I.R., Oji, A.E. and Esimone, C.O. (2008). Antimicrobial Resistance Pattern of Plasmid-
mediated Extended Spectrum -lactamase Producing Strains of Escherichia coli.
Sciencific Research and Essay 3(6)215-218.

197
Jacob, R. (2010). Microbial Quality of Ready-to-Eat Foods Available to Populations of Different
Demographics. Unpublished M.Sc Thesis. Drexel University. Philadelphia, PA 19104,
U.S.
Jain, A. and Mondal, R. (2008). TEM and SHV genes in Extended Spectrum b-lactamase
producing Klebsiella species and their Antimicrobial Resistance Pattern. Indian Journal
of Medical Research 128: 759-764.

Jamine, R., Daisy, P. and Selvakumar, B.N. (2007). A Novel Terpenoid from Elephantopus
scaber with Antibacterial Activity against Beta-lactamase-Producing Clinical Isolates.
Research Journal of Microbiology, 2:770-775.
Jeong, S.H., Bae, I.K., Kwom, S.B., Lee, J.H., Jung, H.I., Song, J.S., Jeong, B.C., Kim, S.J. and
Lee, S.H. (2004). Investigation of Extended-Spectrum -lactamases Produced by
Clinical Isolates of Klebsiella pneumoniae and Escherichia coli in Korea. Letters in
Applied Microbiology, 39:42.
Jorgensen, J.H. and Ferraro, M.J. (2009). Antimicrobial Susceptibility Testing: A Review of
General Principles and Contemporary Practices. Clinical Infectious Diseases 49:1249-
1255.
Jorgensen, J.H. and Turnidge, J.D. (2007). Susceptibility Test Methods: Dilution and Disk
Diffusion Methods. In: Manual of Clinical Microbiology, 9th edition. vol.1. Eds
P.R.Murray, E.J.Baron, J.H.Jorgensen, M.L. Landry and M.A.Pfaller. ASM press,
Washington, D.C. U.S.A. p1152.
Karou, D., Nadembega, W.M.C., Ouattara, L., Ilboudo, D. P., Canini, A., Nikiema, J.B.,
Simpore, J., Colizzi, V. and Traore, A.S. (2007). Medicinal and Aromatic Plant Science
and Biotechnology 1(1), x-y© 2007 Global Science Books.
Khullar, N. (2010). Antimicrobials from Plants and their use in Therapeutics and Drug
Discovery. Institute of Integrative Omics and Applied Biotechnology (IIOAB journal)
1(3)31-37.
Kolar, M., Bardon, J., Chroma1, M., Hricova1, K., Stosova1, T., Sauer, P. Koukalova, D.
(2000). ESBL and AmpC beta-lactamase-producing Enterobacteriaceae in poultry in the
Czech Republic. Veterinarni Medicina, 55 (3) 119–124

Kuete, V., Kamga, J., Sandjo, L.P., Bathelemy. N., Poumale, H.M.P., Ambassa, P. and Ngadjui,
B.T. (2011). Antimicrobial Activities of the Methanol Extract, Fractions and
Components from Ficus polita Vahl. (Moraceae). BMC Complementary and Alternative
Medicine 11:6. Doi: 10.1186/1472-6882-11-6.

Kumar, M.S., Lakshmi, V. and Rajagopalan, R. (2006). Occurence of Extended Spectrum -

lactamases among Enterobacteriaceae spp. isolated at a Tertiary Care Institute. Indian
Journal of Medical Microbiology, 24(3)208.

198
Lachmayr, K.L., Kerkhof, L. J., DiRienzo, A.G., Cavanaugh, C.M. and Ford, T.E. (2009).
Quantifying Nonspecific TEM β-Lactamase (blaTEM) Genes in a Wastewater Stream.
Applied and Environmental Microbiology, 75(1)203-204.
Lal, P., Kapil, A., Das, B.K. and Sood. S. (2007). Occurrence of TEM and SHV gene in
Extended Spectrum β-lactamases (ESBLs) producing Klebsiella sp. Isolated from a
Tertiary Care Hospital. Indian Journal Medical Research 125:173-178.
Legesse, M.B. and Emire S.A. (2012). Functional and Physicochemical Properties of Mango
Seed Kernels and Wheat Flour and their Blends for Biscuit Production. African Journal
of Food Science and Technology 3(9)193-203.

Lim, K., Yasin, R., Yeo, C., Puthucheary, S. and Thong, K. (2009). Characterization of Multi-
drug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia.
Journal of Biomedicine and Biotechnology. vol. 2009.
MacPherson, D.W., Gushulak, B. D., Braine, W.B., Bala, S.,Gubbins, P.O., Holtom, P. and
Segarra-Newnham, M.(2009). Population Mobility, Globalization and Antimicrobial
Drug Resistance. Emerging Infectious Diseases 15:1727-1730.

Mansouri, M. and Ramazanzadeh, R. (2009). Spread of Extended –Spectrum β-lactamase

Producing Escherichia coli Clinical Isolates in Sanandaj Hospitals. Journal of Biological
Science 9:362-366
Manuzon, M.Y., Hanna, S.E., Luo, H., Yu, Z., Hamper, W.J. and Wang, H.H. (2007).
Qualitative Assessment of The Tetracycline Resistance Gene Pool in Cheese Samples by
Real-Time TagMan PCR. Applied and Environmental Microbiology, 73(5)1676.
Marshall, B.M. and Levy, S.B. (2011). Food Animals and Antimicrobials: Impacts on Human
Health. Clinical Microbiology Reviews 24(4):718-33
Maoela, M.S., Arotiba, O.A., Baker, P.G.L., Mabusela, W.T., Jahed, N., Songa, E.A. and
Iwuoha, E.I. (2009). Electroanalytical Determination of Catechin Flavonoid in Ethyl
Acetate Extracts of Medicinal Plants. International Journal of Electrochemical Science
4(2009)1498.
Mbuh, F.A., Asika, I.S. and Doughari, J.H. (2008). Studies on Antibacterial Activity of Leaf
Extracts of Psidium guajava L. Biological and Environmental Sciences Journal for the
Tropics 5(1) 44.
McEntire, J.C. and Montville, T.J. (2007). Antimicrobial Resistance. In Food Microbiology:
Fundamentals and Frontiers, 3rd ed. Edited by M.P. Doyle and L.R. Beuchat. ASM
Press, Washington D.C. Pp24-25.

Menthol, (2013). The Physiological Effects of Menthol Cigarettes.

www.fda.gov/downloads/Advisorycommittees/committeesMeetingMaterials/Tobacco
ProductsScientificAdvise Retreived on June 6, 2013.

199
Microbiological Examination of Ready-to-eat Foods Essay on My Essays.com
http://sciencestage.com∕resources∕revised-guidelines-ready-e... Accessed April 24th,
2010.
Microbiological Guidelines for Ready-to-eat Food (2007). Centre for Food Safety. Food and
Environmental Hygiene Department, Hong Kong.
www.cfs.gov.hk\english\whatsnew\...\MBGL RTE%20food_e.
Microbiological Guidelines for Ready-to-eat Foods (2009). Supplementary Information to
Microbiological Guidelines for Ready-to-eat Food - May 2007 (Revised). Centre for
Food Safety. Food and Environmental Hygiene Department, Hong Kong.
http://www.cfs.gov.hk/english/fag_11.html
Microbiology Module (2013). Antimicrobial Resistance Learning Site.
Amrls.cvm.msu.edu/microbiology/detecting-antimicrobial-resistance/test-
methods/tools/module-pdf-files/microbiology. Accessed January 23rd, 2013.
Murugesan, S., Pannerselvam, A., and Tangavelou, A.C. (2011). Phytochemical Screening and
Antimicrobial Activity of the Leaves of Memecylon umbellatum burm. F. Journal of
Applied Pharmaceutical Science 01(01); 42-45.
NAFDAC (2004). Guidelines for Food Hygiene Practices. National Agency for Food and Drug
Administration and Control. Maiden Edition. p6.
NDDIC (2007). Bacteria and Foodborne Illness. National Digestive Disease Information
Clearinghouse. www.digestive.niddk.nih.gov/diseases/pub/bacteria

Novotny, L., Dvorska, L., Lorencova, A., Beran, V. and Pavlik, I. (2004). Fish: A Potential
source of Bacterial Pathogens for Human Beings. Veterinarni MedicinalCzech, 49 (9):
343-358.
Nwachukwu, E., Onovo, O.M. and Ezeama, C.F. (2007). Effect of Lime juice on the Bacterial
quality of Zobo Drinks Locally Produced in Nigeria. Research Journal of Microbiology
2: 787-791.

Nweze, E.I. and Eze, E.E. (2009).Justification for the use of Ocimum gratissimum L in herbal
medicine and its interaction with disc antibiotics. BMC Complementary and Alternative
Medicine, 9:37.

Nyenje, M.E., Odjadjare, C.E., Tanih, N.F., Green, E., and Ndip, R.N. (2012). Food borne
Pathogens Recovered from Ready-to-Eat Foods from Roadside Cafeterias and Retail
Outlets in Alice, Eastern Cape Province, South Africa: Public Health Implications.
International Journal of Environmental Research of Public Health. 9(8): 2608–2619.

Ogbulie, J.N., Ogueke, C.C. and Okorondu, S. I. (2004). Antibacterial Properties of A.

cordifolia, M. Fluvum, U. chamae, B. pinnatum, C. albidum and A. ciliata on some
Hospital Isolates, Nigerian Journal of Microbiology 18(1-2) 249.

200
Ogunshe, A.A.O., Iheanacho, N.I. and Oduyoye, O.M. (2006). Characterization and Recovery
Rates of Food-indicator Microorganisms from Home-made Oral Rehydration Solutions
in Nigeria. African Journal of Biotechnology 5(8), 603-608.
Ojekale, A.B., Adeleke, T., Ogundairo, E. and Ordiah, P. (2006). Antimicrobial Activities of
Crude and Partial Fractions of Aqueous and Ethanoic Leaf and Seed extracts of Carica
papaya (linn). Biological and Environmental Sciences Journal for the Tropics 3(1): 134-
135.
Okeniyi, J. A.O., Ogunlesi, T.A., Oyelami, O.A. and Adeyemi, L.A. (2007). Effectiveness of
Dried Carica papaya seeds Against Human Intestinal Parasitosis: A Pilot Study. Journal
of Medicinal Food. 10(1):194-196.
Okesola, A.O. and Makanjuola, O. (2009). Resistance to third-Generation Cephalosporins and
other Antibiotics by Enterobactereaceae in Western Nigeria. American Journal of
Infectious Diseases 5 (1):17-20.
Okpokwasili, G.S.C. (2007). Biotechnology and Clean Environment. Proceedings of the 20th
Annual Conference, Biotechnology Society of Nigeria (BSN), 14-17th November, 2007.
Ebonyi State University Abakaliki, Nigeria.
Okuofu, C.A. (2002). Elements of Public Health. Unpublished Lecture Notes WREN 717.
Ahmadu Bello University, Zaria, Nigeria.
Olayinka, B.O., Olonitola, O.S., Olayinka, A.T. and Agada, E.A. (2004). Antibiotic
Susceptibility Pattern and Multiple Antibiotic Resistance Index of Pseudomonas
aeruginosa Urine Isolates from a University Teaching Hospital. African Journal of
Clinical and Experimental Microbiology, 5 (2) 198-200. AJCEM/200330/2424. ISSN
1595-689X.
Olliver, J., Kleineidam, K., Reichel, R., Thiele-Bruhn, S., Kotzerke, A., Kindler, R., Wilke, B.
and Schloter, M. (2010). Effect of Sulfadiazine-Contaminated Pig Manure on the
Abundances of Genes and Transcripts Involved in Nitrogen Transformation in the Root-
Rhizosphere Complexes of Maize and Clover. Applied and Environmental
Microbiology, 76(24) 7903-7909.
Olonitola, O.S., Olayinka, A.T., Inabo, H.I. and Shuaibu, A.M. (2007). Production of Extended
Spectrum -lactamases of Urinary Isolates of Escherichiacoli and Klebsiellapneumoniae
in Ahmadu Bello University Teaching Hospital, Zaria, Nigeria. International Journal of
Biological and Chemical Sciences, 1(2): 181.
Olonitola, O.S., Oniye, S.J., Abdullahi, I.O., Olayinka, B. O., Yakubu, S.E. and Unogwu, J.U.
(2006). Community Reservoirs of Antibiotic Resistant Bacteria in Nigeria: Studies on
Prawns and Shrimps. Biological and Environmental Sciences Journal for the Tropics,
3(1)100 -101.
Olowosulu, A.K. and Ishaku, E.A. (2005). Evaluation of the Antiseptic Property of Formulated
Paints Containing Baphiaintida Heartwood Extract. Journal of Tropical Science. 5(1):
111 – 113.

201
Olukemi, M.A. and kandakai-Olukemi, Y.T. (2004). Antibacterial Activity of the Ethanolic
Extract of Daniella Oliveri, Annona senegalensis and Mitragyna sipulosa. Nigerian
Journal of Microbiology, 18(1-2) 235-240.

Ombui, J.N., Kimotho, A.M. and Nduhiu, J.G. (2000) Antimicrobial Resistance Patterns and
Plasmid Profiles of Staphylococcus aureus Isolated from Milk and Meat. East African
Medical Journal. 77 (9) 463-467.

Oncel, T., Ica, T. and Akan, M. (2004). Beta Lactamase Production Rate and Antimicrobial
Susceptibility of Staphylococcus aureus Isolated from Clinical and Subclinical Mastitis
cases in Turkey. Revue de Medecine Veterinaire 155 (7) 385-388.
Onwukaeme, D.N., Ikuegbvweha, T.B. and Asonye, C.C. (2007). Evaluation of Phytochemical
Constituents, Antibacterial Activities and Effects of Exudates of Pycanthus angolensis
Weld Warb (Myristiceae) on corneal ulcers in Rabbits. Tropical Journal of
Pharmaceutical Research, 6(2):726.
Oranusi, S. and Olorunfemi, O.J. (2011). Microbiological Safety Evaluation of Street vended
ready-to-eat fruits sold in Ota, Ogun state, Nigeria. International Journal of Research in
Biological Sciences 1(3):27-32.
Oranusi, S.U., Oguoma, O.I. and Agusi, E. (2013). Microbiological Quality Assessment of Foods
sold in Student‘s Cafeterias. Global Research Journal of Microbiology 3 (1):1-7.
Overdevest, I., Willemsen, I., Rijinsburger, M., Eustase, A., Xu, L., Hawkey, P., Heck, M.,
Savelkoul, P., Vandenbroucke-Grauls, C., van der Zwaluw, K., Huijsdens, X. and
Kluytmans, J. (2011). Extended-Spectrum β-Lactamase Genes of Escherichia coli in
Chicken Meat and Humans, the Netherlands Emerging Infectious Diseases 17(7) 1216-
1221.
Owoseni, A.A. and Onilude, A.A. (2011). Antibiotic Sensitivity and Sequence Amplification
Patterns of Genes in Multidrug Resistant Enterobacteria isolates from processed Foods
in some West Africa countries Polish Journal of Microbiology, 60:4:309-318.

Oyewale, A.O., Audu, O.T., Amupitan, J.O., Essien, N.E., Yakubu M. B. and Oladele, T.T.
(2006). Secondary Metabolites and Biological Activites of the leaf extracts of Nigeria
Waltheria americana Linn. Nigerian Journal of Scientific Research, 5: 1:75-79.
Perez, F., Endimiani, A., Hujer, K.M. and Bonomo, R.A. (2007). The Continuing Challenge of
ESBLs. Current Opinion in Pharmacology 7(5): 459–469.

Petrosino, J.F. and Palzkill, T. (1996). Systematic Mutagenesis of the Active Site Omega Loop
of TEM-1 β-Lactamase. Journal of Bacteriology 178:7:1821-1828.

Phillips. I., Casewell, M., Cox, T., De Groot, B., Friis, C., Jones, R., Nightingale, C., Preston, R.,
Waddell, J. (2004). Does the Use of Antibiotics in Food Animals Pose a Risk to Human
Health? A Critical Review of Published Data. Journal of Antimicrobial Chemotherapy.
53(1):28-52

202
Podbielski, A., Schonling, J., Melzer, B., Warmatz, K. And Leusch, H. (1991). Molecular
Characterization of a New Plasmid-encoded SHV-type β-lactamase (SHV-2) Variant
conferring High-level Cefotaxime resistance upon Klebsiella pneumoniae. Journal of
GeneralMicrobiology, 137:569-578.

Poggeler, S., Hoff, B., and Kuck, U. (2008). Asexual Cephalosporin C producer Acremonium
chrysogenum carries a Functional Mating Type Locus. Applied and Environmental
Microbiology, 74(19) 6006.
Quale, J. and Spelman, D. (2011). Carbapenemases.
http://www.uptodate.com/contents/carbapenemases. Accessed 14th August, 2011.
Rahman, S., Imran, M., Muhammed, N., Hassan, N., Chisthi, A.K., Khan, A.F., Sadozai, K. S.
and Khan, S.M. (2011). Antibacterial Screening of Leaves and Stem of Carica papaya.
Journal of Medicinal Plants Research 5 (20) 5167-5171.
Rasoanaivo, P., Deharo, E., Ratsimamang-urverg, S. and Frappier, F. (2004). Guidelines for the
Nonclinical Evaluation of the Efficacy of Traditional Antimalarials. In: Traditional
Medicinal Plants and Malaria (Traditional herbal medicines for modern times; vol.4)
Edited by M. Willocox, G. Bodeker and P. Rasoanaivo. CRC Press LLC p259.
Rawat, D. and Nair, D. (2010). Extended-Spectrum β-Lactamases in Gram Negative Bacteria.
Journal of Global Infectious Disease 2(3): 263–274.
Ray, B. (2004). Fundamental Food Microbiology. 3rd Edition. CRC press LLC. USA. Pp 402-
408.
Rayamajhi, N., Jung, B.Y., Cha, S.B., Shin, M.K., Kim, A., Kang, M.S., Lee, K.M. and Yoo,
H.S. (2010). Antibiotic Resistance Patterns and Detection of blaDHA-1 in Salmonella
Species Isolates from Chicken Farms in South Korea. Applied and Environmental
Microbiology, 76(14)4760-4764.
Rijavec, M., Budic, M., Mrak, P., Muller-premru, M., Podlesek, Z. and Zgur-Bertok, D. (2007).
Prevalence of Col E1-like Plasmids and Colicin K Production among Uropathogenic
Escherichia coli Strains and Quantification of Inhibitory Activity of Colicin K. Applied
and Environmental Microbiology, 73(3)1029.
Rosander, A., Connolly, E. and Roos, S. (2008). Removal of Antibiotic Resistance Gene
Carrying Plasmids from Lactobacillus reuteri ATCC 55730 and Characterization of the
Resulting Daughter Strain, L. reuteri DSM 17938. Applied and Environmental
Microbiology, 73(3)1029.
Rotschafer, J.C. and Ostergaard, B.E. (1995). Combination Beta-lactam and Beta-lactamase-
Inhibitor Products: Antimicrobial Activity and Efficiency of Enzyme Inhibition.
American Journal Health -System Pharmary. 15:52(6 Suppl 2):S15-22.

Rupp, M.E. and Fey, P.D. (2003). Extended Spectrum β-lactamase (ESBLs)- Producing
Enterobacteriaceae conditions for Diagnosis, Prevention and Drug Treatment. Drugs
63:353-365.

203
Salihu, L. and Garba, S. (2008). Preliminary Investigation of the Bioactive Constituents of some
Medicinal Plants. Biological and Environmental Sciences Journal for the Tropics,
5(1)164-168.

Samaha-Kfoury, J.N. and Araj, G.F. (2003). Recent Developments in -lactamases and Extended
Spectrum -lactamases. British Medical Journal 327: 1209-1213.
Samy, R.P. and Gopalakrishnakone, P. (2010). Therapeutic Potentials of Plants as Anti-
Microbials for Drug Discovery. Evidence-Based Complementary and Alternative
Medicine (eCAM journal) 7(3)285.
Sanchez, E., Garcia, S. and Heredia, N. (2010). Extracts of Edible Medicinal Plants Damage
Membranes of Vibrio cholerae. Applied and Environmental Microbiology, 76(20)6888-
6894.
Satheesh, M.A. and Pari, L. (2003). Effect of Red Hogweed (Boerhavia diffusa L.) on Plasma
Antioxidants in Alloxan-induced Diabetes. Journal of Herbs, Spices and Medicinal
Plants 10:4:126.
Savoia, D., Avanzini, C., Allice, T., Callone, E., Guella, G. and Dini, F. (2004). Antimicrobial
Activity of Euplotin C, the Sesquiterpene. Taxonomic Marker from the Marine Ciliate
Euplotes crassus. Antimicrobial Agents and Chemotherpy,
48(10)3828.
Sengbusch, P.V. (2008). Botany Online: The Secondary Metabolism of plants-alkaloids.
www.biologieuni-hamburg.de/b-online/e20/20a. Accessed February 13th, 2008.
Sermakkani, M. and Thangapandian, V. (2010). Phytochemical Screening for Active
Compounds in Pedalium murex L. Recent Research in Science and Technology 2
(1):110-114.
Sharafati-Chaleshtori, R., Sharafati-Chaleshtori, F. and Rafieian, M. (2010). Biological
Characterization of Iranian Walnut (Juglans regia) Leaves. Turkish Journal of Biology
35(2011) 635-639.
Sharma, J., Sharma, M. and Ray, P. (2010). Detection of TEM and SHV genes in Escherichia
coli and Klebsiella pneumonia isolates in a Tertiary care Hospital from India. Indian
Journal of Medical Research 13:332-336.
Sharma, R, Munns, K., Alexander, T., Entz, T., Mirzaagha, P., Yanke, L.J., Mulvey, M., Topp,
E. and McAllister, T. (2008). Applied and Environmental Microbiology, 74(20)6178-
6179.
Sherley, M., Gordon, D.M.and Collignon, P.J. (2004). Evolution of Multi-resistance Plasmids in
Australian Clinical Isolates of Escherichia coli. Microbiology 150:1539-1546.
Shide, E.G. and Whong, C.M.Z. (2003). Modelling Growth Response of a Mixed Culture of
Staphylococcus aureus (ATCC 17079) and Escherichia coli (NCTC 10418). Nigerian
Journal of Engineering 11:37.

204
Shimamura, T., Zhao, W. and Hu, Z. (2007). Mechanism of Action and Potential for use of Tea
Catechin as an Anti-infective Agent. Anti-Infective Agents in Medicinal Chemistry 6
(1):57-62.
Singer, R.S., Patterson, S.K. and Wallace, R.L. (2008). Effects of Therapeutic Ceftiofur
Administration to Daily Cattle on Escherichia coli Dynamics in the Intestinal Tract.
Applied and Environmental Microbiology, 74 (22) 6956-6962.
Singh, A., Duggal, S.., Kaur, N. And Singh, J. (2010). Berberine: Alkaloid with wide spectrum
of Pharmcological Activities. Journal of Natural Products 3:64-75.
Singleton, P. (1997). Bacteria in Biology, Biotechnology and Medicine. 4th ed. John Wiley and
Sons Ltd, New York. Pp 324-348.
Sobota, M., Laniewska-Trokenheim, L. and Warminska-Radyko, I. (2006). Resistance to
Antibiotics of Bacteria Isolated from Smoked Fish. IUFoST 1101-1104.
Strama (2007). ESBL resistance in Enteric Bacteria. Proposed Action Plan. Swedish Strategic
Programme Against Antibiotic Resistance.

Talaro, K.P. and Talaro, A. (2002). Foundations in Microbiology. McGraw-Hill Companies, Inc.
NewYork. Pp354-355.
Tande, D., Jallot, N., Bougoudogo, F., Montagnon, T., Gouriou, S. and Sizun, J. (2009).
Extended Spectrum β-lactamase Producing Enterobacteriaceae in Malian Orphanage.
Emerging Infectious Diseases. 15 (3): 472-474. DOI: 10.3201/eid 1503.071637.

Tawfik, A.F., Shibl, A.M., Aljohi, M.A., Altammami, M.A. and Al-Agamy, M.H. (2012).
Distribution of Ambler Class A, B and D β—lactamases among Pseudomonas
aeruginosa isolates. Burns 38:855-860.

Thakur, I. S. (2006). Environmental Biotechnology. Basic Concepts and Applications. I. K.

International Pvt. Ltd. New Delhi-India. p 435.
Trease G.E. and Evans W.C. (1983). Textbook of Pharmacognosy 12th Ed. Bailliere Tindal,
London. Pp 21-22.
Turner, P.J. (2005). Extended Spectrum β-lactamases. Clinical Infectious Diseases 41:(4): 273-
275.
Umoh, V. J., Oranusi, S.U. and Kwaga, J.K.P. (2004). The Public Health Significance of
Pathogens Isolated from ‗Kunun zaki‘, Sold in Retail outlets in Zaria, Nigeria. Nigerian
Food Journal 22:10-11.
Uzeh, R.E., Ohenhen, R.E. and Adeniji, O.O. (2006). Bacterial Contamination of Tsire-Suya, a
Nigerian Meat Product. Pakistan Journal of Nutrition 5 (5)458-460. ISSN 1680-5194.
Vaclavkova, E. and Beckova, R. (2008). Effect of Herbal Extract on Growth Parameters of
weaned Piglets. Research in Pig Breeding 2:36

205
Valat, C., Auvray, F., Forest, K., Metayer, V., Gay, E., Peytavin de Garam, C., Madec, J. and
Haenni, M. (2012). Phylogenetic Grouping and Virulence Potential of Extended-
Spectrum-β-lactamase-Producing Escherichia coli Strains in Cattle. Applied and
Environmental Microbiology 78 (13) 4677-4682.
Valentine-Bon, I., Jacobson, A., Monday, S.R. and Feng, P.C.H. (2008). Microbiological Quality
of Bagged Cut Spinach and Lettuce Mixes. Applied and Environmental Microbiology,
74(4)1240.
van den Bogaard, A.E. and Stobberingh, E.E (2000). Epidemiology of resistance to antibiotics
Links between animals and humans. International Journal of Antimicrobial Agents
14:327–335.

Velanganni, J., Kadamban, D. and Tangavelou, A.C. (2011). Phytochemical Screening and
Antimicrobial Activity of the Stem of Mallotus philippensis (Lam.) Muell. Arg.Var.
Philippensis (Euphorbiaceae). International Journal of Pharmacy and Pharmaceutical
Sciences 3(2)160-163.

Wagner, B.A., Straw, B.E., Fedorka-Cray, P.J. and Dargatz, D.A. (2008). Effect of
Antimicrobial Dosage Regimen on Salmonella and Escherichia coli Isolates from
Feeder Swine. Applied and Environmental Microbiology, 74(6) 1731-1739.
Walsh, C. (2003). Antibiotics: Actions, Origins, Resistance. ASM Press Washington D.C. Pp 42-
114.
Weignand, O., Husseini, A.A., Lall, N. and Meyer, J.J.M. (2004). Antibacterial activity of
Naphthoquinones and Triterpenoids from Eucleanatalensis Root Bark. Journal of
Natural Products, 67:1936.
Whong, C.M.Z., Oniye, S.J. and Otse, G. (2003). Bacteriological Quality of Smoke-dried
Clarias gariepinus (Cuvier and Valenciennes). Journal of Tropical Biosciences 3:99-
102.
Xu, L., Ensor, V., Gossain, S., Nye, K. and Hawkey, P. (2005). Rapid and simple detection of
blaCTX-M genes by multiplex PCR assay. Journal of Medical Microbiology 54: 1183–
1187

Yao, J.D.C. and Moellering, Jr., R.C. (2007). Antibacterial agents. In: Manual of Clinical
Microbiology. Eds. P.R. Murray, E.J. Baron, J.H. Jorgensen, M.L. Landry and
M.A.Pfaller. 9th edition. ASM press, Washington, D.C. Pp1078-1095.

Yazid, M.K.S., Dallal, M.M.S., Mirzaei, H.M.A., Sabbaghi, A., Mehrabadi, J.F., Lari, A.R.,
Eshraghian, M.R., Saneiee, A.F., Abdar, M.H. and Bakhtiari, R. (2011). Molecular
Detection of TEM broad spectrum β-lactamase in Clinical isolates of Escherichia coli.
African Journal of Biotechnology 10 (46) 9454-9458.

Zaniani, F. R., Meshkat, Z., Nasab, M. N., Khaje-Karamadini, M., Ghazvini, K., Rezaee, A.,
Esmaily, H., Nabavinia, M.S. and Hoseini, M.D. (2012). The Prevalence of TEM and

206
 SHV Genes among Extended-Spectrum Beta-Lactamases Producing Escherichia coli
and Klebsiella pneumoniae. Iranian Journal of Basic Medical Sciences 15:1:654-660

Zhang, C., Liu, Y. and Wang, J. (2010). Detection of ESBLs and Antimicrobial Susceptibility of
Escherichia coli isolated in Henan, China. Journal of Animal and Veterinary Advances 9
(15): 2030-2034.

APPENDICES

APPENDIX I: Microgen GN A substrate reference table

Well Reaction Description Positive Negative

1. Lysine Lysine decarboxylase-Bromothymol blue Green/Blue Yellow

changes to green/blue indicating the production

207
 of the amine cadaverine.

2. Ornithine Ornithine decarboxylase- Bromothymol blue Blue Yellow/Green

changes to blue indicating the production of the
amine putrescin.

3. H2S H2S production-Thiosulphate is reduced to H2S Brown/black Straw

that reacts with ferric salts producing a black
precipitate.

4. Glucose Fermentation- Bromothymol blue changes from Yellow Blue/green

blue to yellow as a result of acid produced from
5. Mannitol the carbohydrate fermentation.

6. Xylose

7. ONPG Hydrolysis-ONPGHydrolysis by B- Yellow Colourless

galactosidase results in the production of
yellow ortho-nitrophenol

8. Indole Indole is produced from tryptophan and gives a Pink/red Colourless

pink/red complex when Kovac‘s reagent is
added.

9. Urease Hydrolysis of urea results in the formation of V.Deep Pink Straw to pale salmon
ammonia leading to an increase in pH which pink colour
turns phenol red from yellow to pink/red.

10. VP Acetoin production from glucose is detected by Deep Pink/Red Colourless to Pale
the formation of a pink /red complex after the Pink
addition of alpha naphthol and creatine in the
presence of KOH.

11. Citrate Utilization of citrate (only carbon source) Blue Yellow/Pale Green
leading to a colour change in bromothymol blue
from green to blue.

12. TDA Indolepyruvic acid is produced from tryptophan Cherry red Straw colour
by tryptophan deaminase giving a cherry red
colour when ferric ions are added. Indole
positive isolates may give a brown colour- this
is a negative result.
Key: H2S-Hydrogen sulphide; ONPG-Ortho-nitrophenol- galactosidase; TDA-Tryptophan deaminase acid

APPENDIX II: MICROGEN GN A IDENTIFICATION RESULTS

208
 APPENDIX IIa: Microgen GN A Identification result (Suya Isolates)

Code Lys Orn H2S Glu Man Xyl ONPG Ind Ure VP Cit TDA Octal Identi-
code fication
Sye1 + + - + + + + + - - - - 6760 E.coli
Sye2 + + - + + + + + - - - - 6760 E.coli
Sye3 + - - + + + + + - - - - 4760 E.coli
Sye4 + - - + + + + + - - - - 4760 E.coli
Sye5 + + - + + + + + - - - - 6760 E.coli
Sye6 + - - + + + + + - - - - 4760 E.coli
Sye7 + - - + + + + + - - - - 4760 E.coli
Sye8 + + - + + + + + - - - - 6760 E.coli
Sye9 + - - + + + + + - - - - 4760 E.coli
Sye10 + + - + + + + + - - - - 6760 E.coli
Sye11 + - - + + + + + - - - - 4760 E.coli
Sye12 + - - + + + + + - - - - 4760 E.coli
Sye13 + - - + + + + + - - - - 4760 E.coli

Sye14 + - - + + + + + - - - - 4760 E.coli

Sye15 + - - + + + + + - - - - 4760 E.coli

Sye16 + + - + + + + + + - - - 6770 E.coli

Sye17 + - - + + + + + - - - - 4760 E.coli

Sye18 + - - + + + + + - - - - 4760 E.coli

Syk1 + - - + + + + + - - + - 4762 Klebsiella

Oxytoca
Syk2 + - - + + + + + - + - - 4764 Klebsiella
oxytoca

209
APPENDIX II b: Microgen GN A Identification result (Smoked fish Isolates)

Code Lys Orn H2S Glu Man Xyl ONPG Ind Ure VP Cit TDA Octal Identification

Code
SFe1 + + - + + + + + - - - - 6760 E.coli

SFe2 + - - + + + + + - - - - 4760 E.coli

SFe3 + - - + + + + + - - - - 4760 E.coli

SFe4 + - - + + + + + - - - - 4760 E.coli

SFe5 - - - + + + + + - - - - 0760 E.coli-inactive

SFe6 - + - + + + + + - - - - 2760 E.coli

SFe7 + + - + + + + + - - - - 6760 E.coli

SFe8 + + - + + + + + - - - - 6760 E.coli

SFe9 - - - + + + + + - - - - 0760 E.coli-inactive

SFe10 + + - + + + + + - - - - 6760 E.coli

SFe11 + + - + + + + + - - - - 6760 E.coli

SFe12 + + - + + + + + - - - - 6760 E.coli

SFe13 + + - + + + + + - - - - 6760 E.coli

SFe14 + + - + + + + + - - - - 6760 E.coli

SFe15 + + - + + + + + - - - - 6760 E.coli

SFe16 + + - + + + + + - - - - 6760 E.coli

SFe17 + + - + + + + + - - - - 6760 E.coli

SFe18 + + - + + + + + - - - - 6760 E.coli

SFe19 + + - + + + + + - - - - 6760 E.coli

Key:Lys-Lysine; Orn-Ornithine; H2S-Hydrogen sulphide; Glu-Glucose; Man-Mannitol; Xyl-Xylose; ONPG-Ortho-

nitrophenol- galactosidase; Ind-Indole; Ure-Urease; VP-Voges Proskauer; Cit-Citrate; TDA-Tryptophan
deaminase acid.

210
APPENDIX II c: Microgen GN A Identification result (Zoborodo Isolates)

Code Lys Orn H2S Glu Man Xyl ONPG Ind Ure VP Cit TDA Octal Identification
code
Ze1 + + - + + + + + - - - - 6760 E.coli

Ze2 + + - + + + + + - - - - 6760 E.coli

Ze3 + + - + + + + + - - - - 6760 E.coli

Ze4 + + - + + + + + - - - - 6760 E.coli

Ze5 + + - + + + + + - - - - 6760 E.coli

Ze6 + + - + + + + + - - - - 6760 E.coli

Ze7 + + - + + + + + - - - - 6760 E.coli

Ze8 + + - + + + + + + - - - 6770 E.coli

Ze9 + + - + + + + + - - - - 6760 E.coli

Ze10 + + - + + + + + - - + - 6762 E.coli

Ze11 + + - + + + + + - - - - 6760 E.coli

Zk1 + + - + - + + + + - + + 4573 Klebsiella

Oxytoca

Zk2 + - - + + + + - - - + - 2742 Klebsiella

ozaenae
Key: Lys-Lysine; Orn-Ornithine; H2S-Hydrogen sulphide; Glu-Glucose; Man-Mannitol; Xyl-
Xylose; ONPG-Ortho-nitrophenol- galactosidase; Ind-Indole; Ure-Urease; VP-Voges
Proskauer; Cit-Citrate; TDA-Tryptophan deaminase acid.

APPENDIX IId: Microgen GN A Identification result (Kunun zaki Isolate)

211
Code Lys Orn H2S Glu Man Xyl ONPG Ind Ure VP Cit TDA Octal Identification

code
Ke1 + + - + + + + + - - - - 6760 E.coli

Key:Lys-Lysine; Orn-Ornithine; H2S-Hydrogen sulphide; Glu-Glucose; Man-Mannitol; Xyl-Xylose; ONPG-Ortho-

nitrophenol- galactosidase; Ind-Indole; Ure-Urease; VP-Voges Proskauer; Cit-Citrate; TDA-Tryptophan
deaminase acid.

APPENDIX III: Zone Diameter Interpretative Standard

Breakpoints (for Enterobacteriaceae) of antibiotics used in this study.

Antimicrobial Disk Zone

Agents potency diameter
(μg) (mm)
R< I S Testing conditions
>
Ampicillin 10 13 14-16 17 Medium
Mueller-Hinton agar
Amoxicillin-clavulanic acid 20/10 13 14-17 18
Cephalothin 30 14 15-17 18 Inoculum
Growth method or direct
Cefpodoxime 10 17 18-20 21
colony suspension
Ceftriaxone 30 13 14-20 21 equivalent to a 0.5
McFarland Standard
Ciprofloxacin 5 15 16-20 21
Sulphamethoxazole/Trimethoprim 25 10 11-15 16 Incubation
35+20C,
Tetracycline 30 11 12-14 15
ambient air;
Amikacin 30 14 15-16 17 16-18hr

Key: R= Resistant I=Intermediate S=Sensitive

Source. CLSI, 2008

212
APPENDIX IV: Screening and Confirmatory Tests for ESBLs in Klebsiella pneumoniae, K.
oxytoca, Escherichia coli

Test Initial Screening Test Phenotypic Confirmatory Test

Test Method Disk diffusion Disk diffusion

Medium Mueller Hinton Agar Mueller Hinton Agar

Antimicrobial Cefpodoxime 10 µg or Ceftazidime 30 µg

Concentration Ceftazidime 30 µg or
Aztreonam 30 µg or
Cefotaxime 30 µg or
Ceftriaxone 30µg
(The use of more than one
antimicrobial agent for screening
improves the sensitivity of
detection)
Ceftazidime-clavulanic
30/10 µg and Cefotaxime 30µg
Cefotaxime-clavulanic acid 30/10 µg
(Confimatory testing requires use of both cefotaxime
and ceftazidime alone and in combination with
clavulanic acid)

Standard disk diffusion

Inoculum recommendations Standard disk diffusion recommendations

35+20C; ambient air

Incubation
conditions 35+20C; ambient air

16-18hr
Incubation length
16-18hr
Cefpodoxime zone < 17mm

213
 Ceftazzidime zone < 22mm
Result Aztreonam zone < 27mm
Cefotaxime zone < 27mm
Ceftriaxone zone < 25mm
Zones above may indicate ESBL
production
A < 5mm increase in a zone diameter for either
antimicrobial agent tested in combination with
clavulanic acid vs its zone when tested alone-ESBL
(e.g. ceftazidime zone-16; ceftazidime-clavulanic acid
zone-21)

For all confirmed ESBL-producing strains, the test

interpretation should be reported as resistant for all
Reporting penicillins, cephalosporins and aztreonam.
Source: CLSI, 2008

APPENDIX V: Media Formulation

1. DEV Lactose peptone broth (Merck, Germany)

g/L
Peptone from casein 10.0
Soyameal 3.0
Lactose 10.0
Sodium chloride 5.0
Bromocresol purple 0.02

2. Eosin methylene blue (EMB) agar (Biomark, India)

g/L
Peptic digest of animal tissue 10.0
Dipotassium phosphate 2.0
Lactose 5.0
Sucrose 5.0

214
 Eosin-Y 0.4
Metyhlene blue 0.065
Agar 13.5
pH 7.2 ±0.2

3. MacConkey agar (Antec, U.K)

g/L
Peptone 20.0
Agar 12.0
Lactose 10.0
Neutral red 0.05
Bile salts 5.0
Sodium chloride 5.0
pH 7.4 ± 0.2

4. Methyl Red Voges Proskauer Broth (Scharlau, Spain)

g/L
Peptone 7.0
Dextrose 5.0
Potassium phosphate 5.0
pH 7.0 ± 0.2

5. Mueller-Hinton-Agar (Merck, Germany)

g/L
Infusion from meat 2.0
Casein hydrolysate 17.5
Starch 1.5
Agar-Agar 13.0

215
 pH 7.4 ± 0.2

5. Nutrient broth (agar) (Oxoid, England)

g/L
Lab- Lemco powder 1.0
Yeast extract 2.0
Peptone 5.0
Sodium chloride 5.0
(Bacteriological agar) 15.0
pH 7.4 ± 0.2

7. Peptone water phosphate buffered (Scharlau, Spain)

g/L
Peptone 10.0
Sodium chloride 5.0
Disodium phosphate 3.5
Potassium phosphate 1.5
pH 7.2 ± 0.2

8. Plate count agar (Biotec, U.K.)

g/L
Tryptone 5.0
Yeast extract 2.5
Glucose 1.0
Agar No2 12.0
pH 7.0 ± 0.2

9. SIM medium (Oxoid, England)

216
 g/L
Tryptone 20.0
Peptone 6.0
Ferrous ammonium sulphate 0.2
Sodium thiosulphate 0.2
Agar 3.5
pH 7.3 ± 0.2

10. Simmon’s citrate agar (Biomark, India)

g/L
Magnesium sulphate 0.2
Ammonium dihydrogen phosphate 1.0
Dipotassium phosphate 1.0
Sodium citrate 2.0
Sodium chloride 5.0
Bromothymol blue 0.08
Agar 15.0
pH 6.8 ± 0.2

11. Tryptone Soya broth (Oxoid, England)

g/L
Pancreatic digest of casein 17.0
Enzymatic*digest of soya bean 3.0
Sodium chloride 5.0
Di-potassium hydrogen phosphate 2.5
Glucose 2.5
*(Contains papain)
pH 7.3 ± 0.2

217
 APPENDIX VI: Composition of reagents

1. Kovàc’s Indole Reagent

Para-dimethylaminobenzaldehyde 2g
Isoamyl alcohol (3-methyl-1-butanol) 30ml
Hydrochloric acid, concentrated 10ml

218
2. Methyl red solution

Methyl red (pH indicator) 0.05g

Absolute ethanol 28ml
Distilled water 22ml

3. 5%-alpha-napthol

Alpha-napthol 5g
Absolute ethanol 100ml

4. 40% Potassium hydroxide

Potassium hydroxide 40g

Distilled water 100ml

APPENDIX VII: List of Plates

219
Plate III: Carica papaya tree Plate IV: Microgen Identification kit

Plate V: Soxhlet extraction Plate VI: Maceration with separating funnels

220
 Plate VII: Susceptibility to plant extracts

1=500µg/ml; 2=250µg/ml; 3=125µg/ml; 4=DMSO (Negative control);

Ampicillin disc (Positive control)

Plate VIII: Nitrocefin containing β-lactamase Plate IX: Antibiotic susceptibility testing
Identification sticks

221
 APPENDIX VIII: Statistical Analysis

Correlation between ESBLs production and Multidrug resistance (MDR) in E. coli isolated
from smoked fish

MDR Strains Non MDR Total

strains
4ESBLs detected 2 3 5 (26%)

ESBLs not detected 1 13 14 (74%)

Total 3 (16%) 16 (84%) 19

P=0.000 **. Correlation is significant at the 0.01 level (2-tailed).

Correlation between ESBLs production and Multidrug resistance

(MDR) in E. coli and Klebsiella spp. isolated from ‘suya’

MDR Strains Non MDR Total

strains
ESBLs detected 8 1 9(45%)

ESBLs not detected 3 8 11 (55%)

Total 11 (55%) 9 (45%) 20

P=0.038 * Correlation is significant at the 0.05 level (2-tailed)

222
 Correlation between ESBLs production and Multidrug resistance
(MDR) in E. coli and Klebsiella spp, isolated from ‘zoborodo’ drink

MDR Strains Non MDR Total

strains
ESBLs detected 4 0 4 (31%)

ESBLs not detected 0 9 9 (69%)

Total 4 (31%) 9 (69%) 13

P=0.000 **. Correlation is significant at the 0.01 level (2-tailed).

Nonparametric Correlations

Correlations
Resistance Gene
Spearman's rho Resistance Correlation 1.000 .258
Coefficient
Sig. (2-tailed) . .418
N 12 12
Gene Correlation .258 1.000
Coefficient
Sig. (2-tailed) .418 .
N 12 12

Crosstabs
Case Processing Summary
Cases
Valid Missing Total
N Percent N Percent N Percent

223
 Case Processing Summary
Cases
Valid Missing Total
N Percent N Percent N Percent
Gene * 12 100.0% 0 .0% 12 100.0%
Resistance

Gene * ResistanceCrosstabulation
Count
Resistance
ESBLs ESBLs
Resistance Resistance
Presence Absent Total
Gene TEM/SHV Genes 8 1 9
present
TEM/SHV Absent 2 1 3
Total 10 2 12

Symmetric Measures
Asymp. Std. Approx. Approx.
Value Errora Tb Sig.
Interval by Pearson's R .258 .324 .845 .418c
Interval
Ordinal by Spearman .258 .324 .845 .418c
Ordinal Correlation
N of Valid Cases 12
a. Not assuming the null hypothesis.
b. Using the asymptotic standard error assuming the null hypothesis.
c. Based on normal approximation.

224