Article

Glutathione Primes T Cell Metabolism for

Inflammation
Graphical Abstract Authors
Tak W. Mak, Melanie Grusdat,
Gordon S. Duncan, ..., Isaac S. Harris,
Karsten Hiller, Dirk Brenner

Correspondence
tmak@uhnresearch.ca (T.W.M.),
dirk.brenner@lih.lu (D.B.)

In Brief
Upon activation, T cells adapt their
metabolism to meet their increased
bioenergetic and biosynthetic needs.
Activated T cells produce ROS, which
trigger the antioxidative GSH response to
prevent cellular damage. Mak et al. report
that the GSH pathway plays an
unexpected role in metabolic integration
during inflammatory T cell responses.

Highlights
d Glutathione (GSH) is not needed for early T cell activation but
promotes T cell growth

d GSH supports mTOR and NFAT activity and drives glycolysis

and glutaminolysis

d Gclc-derived GSH buffers ROS and regulates Myc-

dependent metabolic reprogramming

d Ablation of Gclc in T cells impairs inflammatory responses

in vivo

Mak et al., 2017, Immunity 46, 675–689

April 18, 2017 ª 2017 Elsevier Inc.
http://dx.doi.org/10.1016/j.immuni.2017.03.019
Immunity

Article

Glutathione Primes
T Cell Metabolism for Inflammation
Tak W. Mak,1,2,16,* Melanie Grusdat,3,16 Gordon S. Duncan,1 Catherine Dostert,3 Yannic Nonnenmacher,4,5 Maureen Cox,1
Carole Binsfeld,3 Zhenyue Hao,1,6 Anne Bru € stle,7 Momoe Itsumi,8 Christian Ja €ger,5 Ying Chen,9 Olaf Pinkenburg,10
€ 10
Barbel Camara, Markus Ollert, 11,12 Carsten Bindslev-Jensen, Vasilis Vasiliou,9 Chiara Gorrini,1 Philipp A. Lang,13
12

Michael Lohoff,10 Isaac S. Harris,14 Karsten Hiller,4,5,15 and Dirk Brenner3,12,17,*

1The Campbell Family Cancer Research Institute and University Health Network, Toronto, ON M5G 2C1, Canada
2Departments of Medical Biophysics and Immunology, University of Toronto, Toronto, ON M5G 2M9, Canada
3Department of Infection and Immunity, Experimental and Molecular Immunology, Luxembourg Institute of Health, Esch-sur-Alzette, L-4354,

Luxembourg
4Technische Universita €t Braunschweig, Braunschweig Integrated Center of Systems Biology, Braunschweig D-38106, Germany
5Luxembourg Centre for Systems Biomedicine, University of Luxembourg, Belvaux, L-4367, Luxembourg
6The Donnelly Centre for Cellular and Biomolecular Research, University of Toronto, Toronto, ON M5S3E1 Canada
7Department of Immunology and Infectious Disease, John Curtin School of Medical Research, Australian National University, Canberra,

ACT 2601, Australia

8Department of Molecular Virology, Tokyo Medical and Dental University, Tokyo, 113-8510, Japan
9Department of Environmental Health Sciences, Yale School of Public Health, CT 06520, New Haven, USA
10Institute for Medical Microbiology and Hospital Hygiene, University of Marburg, Marburg, D-35032 Germany
11Department of Infection and Immunity, Allergy and Clinical Immunology, Luxembourg Institute of Health, Esch-sur-Alzette, L-4354,

Luxembourg
12Odense Research Center for Anaphylaxis, Department of Dermatology and Allergy Center, Odense University Hospital,

University of Southern Denmark, Odense, DK-5000, Denmark

13Department of Molecular Medicine II, Medical Faculty, University of Du€sseldorf, Du
€ sseldorf, D-40225, Germany
14Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA
15Computational Biology of Infection Research, Helmholtz Centre for Infection Research, Braunschweig, D-38124, Germany
16These authors contributed equally to this work
17Lead contact

*Correspondence: tmak@uhnresearch.ca (T.W.M.), dirk.brenner@lih.lu (D.B.)

http://dx.doi.org/10.1016/j.immuni.2017.03.019

SUMMARY INTRODUCTION

Activated T cells produce reactive oxygen species
(ROS), which trigger the antioxidative glutathione
(GSH) response necessary to buffer rising ROS and
prevent cellular damage. We report that GSH is
essential for T cell effector functions through its
regulation of metabolic activity. Conditional gene
targeting of the catalytic subunit of glutamate
cysteine ligase (Gclc) blocked GSH production
specifically in murine T cells. Gclc-deficient T cells
initially underwent normal activation but could not
meet their increased energy and biosynthetic re-
quirements. GSH deficiency compromised the acti-
vation of mammalian target of rapamycin-1 (mTOR)
and expression of NFAT and Myc transcription
factors, abrogating the energy utilization and Myc-
dependent metabolic reprogramming that allows
activated T cells to switch to glycolysis and glutami-
nolysis. In vivo, T-cell-specific ablation of murine
Gclc prevented autoimmune disease but blocked
antiviral defense. The antioxidative GSH pathway
thus plays an unexpected role in metabolic integra-
tion and reprogramming during inflammatory T cell
responses.
T cells are activated when their T cell receptors (TCRs) are
engaged by cognate peptide-MHC complexes. TCR triggering
initiates activation, proliferation, and differentiation associated
with effector function acquisition. Coordinated activation of
ERK, JNK, NFAT, and NF-kB signaling and responses to mito-
gens such as IL-2 are critical for T cell functionality (Brownlie
and Zamoyska, 2013). Activated T cells undergo clonal expan-
sion that dramatically raises their bioenergetic needs and re-
quires increased glucose and glutamine utilization (Carr et al.,
2010; Frauwirth et al., 2002; Pollizzi and Powell, 2014). This
heightened metabolic activity drives increased production of
reactive oxygen species (ROS) by the mitochondrial electron
transport chain (Gu €low et al., 2005; Sena et al., 2013; Yi et al.,
2006). Whereas low concentrations of ROS support cell survival
and proliferation, high concentrations of ROS initiate DNA dam-
age and cell death (Cairns et al., 2011; Gorrini et al., 2013; Sena
and Chandel, 2012). Activated T cells control their rising concen-
trations of ROS by using endogenous antioxidants, particularly
glutathione (GSH) (Meister, 1983). The rate-limiting step in
GSH synthesis is catalyzed by glutamate cysteine ligase (GCL),
composed of catalytic (GCLC) and modifier (GCLM) subunits
(Chen et al., 2005). Gene-targeting of Gclc in mice is embryoni-
cally lethal (Chen et al., 2007), precluding analysis of GSH func-
tions in adult mice.
Immunity 46, 675–689, April 18, 2017 ª 2017 Elsevier Inc. 675
 In this study, we analyzed conditional mutant mice lacking
Gclc (and thus GSH) specifically in T cells, and we report that
GSH is essential for the energy metabolism changes required
for T cell effector functions. GSH-deficient T cells initially un-
dergo normal activation but cannot reprogram their metabolism
to meet their rising energy needs. As a result, autoimmune re-
sponses are prevented, and antiviral defenses are inhibited
in vivo. Our data position the GSH pathway as a central meta-
bolic integrator in inflammatory responses mediated by T cells.
RESULTS
GSH Is Dispensable for Early T Cell Activation but
Promotes T Cell Growth
Because proliferating T cells accumulate ROS (Devadas et al.,
2002; Gu €low et al., 2005; Jackson et al., 2004; Yi et al., 2006),
we speculated that the GSH pathway might be upregulated in
these cells. We activated naive wild-type (WT) murine T cells
in vitro with anti-CD3 plus anti-CD28 antibodies (aCD3+aCD28)
and measured Gclc and Gclm mRNAs by quantitative RT-PCR.
Gclc mRNA, but not Gclm mRNA, was upregulated upon TCR
triggering (Figure 1A). This Gclc upregulation was inhibited by
the addition of buthionine sulfoximine (BSO), a specific inhibitor
of GCL activity (Figure S1A in the Supplemental Information on-
line), indicating that the GSH pathway is activated by TCR trig-
gering. We then crossed Cd4cre-expressing mice with Gclcfl/fl
mice to generate progeny (Cd4cre-Gclcfl/fl mice) in which Gclc
was deleted specifically in T cells (Figure S1B). GSH was minimal
in naive CD4+ and CD8+ T cells isolated from spleen and lymph
nodes (LNs) of these mutants but increased sharply in these cells
after activation with aCD3+aCD28 in vitro for 24 hr (Figure 1B) or
when the mice had been injected with anti-CD3 or Staphylo-
coccal enterotoxin B (SEB) so that T cells would be activated
in vivo (Figure 1C and Figure S1C). Cd4cre-Gclcfl/fl mice showed
normal thymocyte development but reduced peripheral CD8+
and CD4+ T cells (Figures S1E and S1F). Thus, Gclc is important
for T cell homeostasis and GSH synthesis.
We expected that Cd4cre-Gclcfl/fl T cells would accumulate
high concentrations of ROS, but DCF-DA staining and flow-cyto-
metric examination of activated control and mutant CD4+ and
CD8+ T cells showed that the concentrations of ROS were only
modestly increased in Gclc-deficient T cells activated in vitro (Fig-
ure 1D) or in vivo (Figure 1E and Figure S1D). CD69 and CD44
expression were comparably induced on T cells of both genotypes
in vivo (Figure 1F) and in vitro (Figure 1G), indicating that Gclc is
not crucial for the initial stages of T cell activation. Accordingly,
immunoblotting revealed similar activation kinetics of TCR-prox-
imal signaling molecules in control and Cd4cre-Gclcfl/fl T cells,
although p38, ERK and JNK phosphorylation were slightly greater
in the mutant cells (Figures S2A and S2B). However, the ability of
activated T cells to become large blasts was reduced by Gclc defi-
ciency both in vitro (Figure 1H) and in vivo (Figure S2C), and cell
death was increased upon 48 hr stimulation (Figure S2D). Thus,
GSH is dispensable for initial T cell activation but governs T cell
homeostasis in vivo and promotes activation-dependent growth.
T-Cell-Intrinsic Gclc Is Required for mTOR Activation
T cell blasts exhibit an increase in cell volume that is controlled
by mammalian target of rapamycin complex-1 (mTORC1) (Lap-
676 Immunity 46, 675–689, April 18, 2017
lante and Sabatini, 2012). We investigated whether Gclc
deficiency reduced mTOR activity in CD4+ and CD8+ T cells
stimulated with aCD3+aCD28 in vitro. Flow cytometry and
immunoblotting confirmed that Gclc deficiency blocked mTOR
S2448 phosphorylation as well as phosphorylation of the
mTORC1 targets S6 and 4E-BP1 (Figures 2A–2C). Addition of
the mTOR inhibitor rapamycin confirmed that the effect was
mTOR specific. Cells control mTOR activity via inhibitory phos-
phorylation of tuberous sclerosis complex 2 (TSC2) by AKT or
GSK3b (Inoki et al., 2006), but we found no differences in AKT
or GSK3b activation between control and mutant T cells (Fig-
ure S2B). To test whether elevated ROS reduced mTOR activity
in Cd4cre-Gclcfl/fl T cells, we stimulated T cells of both geno-
types with aCD3+aCD28 and treated them with GSH or another
antioxidant, N-acetyl-cysteine (NAC). The elevated concentra-
tions of ROS in activated Gclc-deficient T cells were reduced
to near-WT concentrations by NAC or GSH (Figure S2E). Both
mTOR activation and S6, p70, and 4E-BP1 phosphorylation
were partially restored (Figures 2D–2F), suggesting that these
signaling alterations in Gclc-deficient T cells were largely due
to a lack of ROS buffering.
Gclc Supports Glutamine Metabolism
mTOR responds to nutrient deficiency by stimulating the synthe-
sis of proteins, nucleotides, and lipids (Laplante and Sabatini,
2012). We speculated that Gclc deficiency in T cells might inhibit
mTOR activation and glutamine utilization. CD98 is a heterodi-
meric amino acid transporter that is induced in activated
T cells and crucial for glutamine uptake (Nicklin et al., 2009).
We found that activated Gclc-deficient T cells expressed less
surface CD98 than controls (Figure 3A). We then measured
glutamine anaplerosis into the TCA cycle by calculating the
molar difference between glutamine uptake and glutamate
secretion. The net influx of glutamine-derived carbon was
decreased in activated mutant T cells compared to controls
(Figure 3B). Next, we activated mutant and control T cells with
aCD3+aCD28 in the presence of U-13C-glutamine and deter-
mined its incorporation into downstream metabolites by
analyzing mass isotopomer distributions (MIDs) of TCA cycle in-
termediates under metabolic and isotopic steady-state condi-
tions (Figure 3C, left). Although the relative flux of glutamine
into TCA intermediates in activated T cells of both genotypes
was higher than steady-state values, this increase was less in
Gclc-deficient T cells (Figure 3C). Citrate M4 mass isotopomers
indicate oxidative TCA metabolism of glutamine. A subsequent
cycle generates M2 mass isotopomers (oxidative decarboxyl-
ation by isocitrate dehydrogenase and 2-oxoglutarate dehydro-
genase). An increased ratio of M2 to M4 citrate isotopologues
thus represents heightened TCA activity (Figure S3A). The ratio
of M2 to M4 citrate in activated mutant T cells was higher than
that in controls (Figure S3B), suggesting an increase in overall
TCA flux in the absence of GSH. However, because glutamine
anaplerosis is decreased in Gclc-deficient T cells, this increased
TCA activity must be driven by another carbon source.
Because glutamine is essential for T cell proliferation (Carr
et al., 2010; Hörig et al., 1993; Newsholme et al., 1985; Yaqoob
and Calder, 1997), we compared the proliferative capacities
of activated Cd4cre-Gclcfl/fl and control T cells. The mutant
T cells showed a striking lack of growth upon aCD3+aCD28
 A B *
C
*
* 0.4
18 Non-stimulated 6
Gclcfl/fl
mRNA expression (x-fold)

αCD3+αCD28 *

GSH per 1x10 cells

Cd4cre-Gclcfl/fl

Relative amount of
Gclc 0.3

RLU ( x105 )
6
12 Gclm * 4
0.2 *

6 2
0.1

0 0 0
0 4 12 24 0 4 12 24 [h] αCD3+αCD28
Gclcfl/fl Cd4cre- Gclcfl/fl Cd4cre-
αCD3+αCD28
Gclcfl/fl Gclcfl/fl
CD4+ T cells CD8+ T cells

D Gclcfl/fl E F
1500 Cd4cre-Gclcfl/fl
* Gclcfl/fl
* Gclcfl/fl 1000 4000 6000 Cd4cre-Gclcfl/fl
*
DCF-DA (MFI)

Cd4cre-Gclcfl/fl
1000 800

DCF-DA (MFI)

CD69 (MFI)
3000

CD44 (MFI)
4000
Counts

600
500 2000
400
2000
1000
200
0
- + - + - + - + PMA/Iono
0 0 0
CD4+ T cells CD8+ T cells ROS (MFI) αCD3+αCD28 αCD3+αCD28 αCD3+αCD28

G H
20000 * 40000 Gclcfl/fl
CD4+ CD4+ *
Cd4cre-Gclcfl/fl Gclcfl/fl Cd4cre-Gclcfl/fl
T cells T cells
15000 30000
CD69 (MFI)

CD44 (MFI)

10000 20000
CD4+
SSC

SSC
5000 10000

0 0
0 0.1 1 10 0 0.1 1 10 FSC FSC
αCD3+αCD28 (μg/mL) αCD3+αCD28 (μg/mL)

15000 20000 Gclcfl/fl Cd4cre-Gclcfl/fl

CD8+ CD8+ *
T cells * T cells
15000
CD69 (MFI)

CD44 (MFI)

10000
CD8+
SSC

SSC

*
* 10000

5000
5000

FSC FSC
0 0
0 0.1 1 10 0 0.1 1 10
αCD3+αCD28 (μg/mL) αCD3+αCD28 (μg/mL)

Figure 1. Gclc Deficiency Increases ROS Concentration in T Cells

(A) Quantitative RT-PCR analysis of Gclc and Gclm mRNAs in CD4+ T cells that were isolated from spleen and LN of WT mice and stimulated with aCD3+aCD28
for the indicated times. Data are means ± SEM (n = 3) and representative of two independent trials. *p < 0.05.
(B) LC-MS determination of GSH in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that were stimulated with aCD3+aCD28 for 24 hr. Results are expressed as
relative amounts of GSH per 1 3 106 T cells. Data are means ± SD for CD4+ (n = 3) and CD8+ (n = 2) T cells and representative of two independent trials.
(C) Determination of GSH in splenic and LN T cells isolated from Gclcfl/fl and Cd4cre-Gclcfl/fl mice 24 hr after i.p. injection with anti-CD3. Data are means ± SEM
(n = 3) and representative of two independent trials.
(D) Flow-cytometric determination of ROS in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that were stimulated with PMA and ionomycin for 24 hr and
stained with DCF-DA. Data are means ± SEM (n = 3) and representative of three independent trials.
(E) Flow-cytometric determination of ROS in splenic and LN CD4+ T cells that were isolated from Gclcfl/fl and Cd4cre-Gclcfl/fl mice at 24 hr after injection with anti-
CD3, followed by DCF-DA staining. Data are means ± SEM (n = 3) and representative of two independent trials.
(F and G) Flow-cytometric determination of surface expression of CD69 and CD44 by T cells that were either (F) isolated from Gclcfl/fl and Cd4cre-Gclcfl/fl mice
24 hr after injection with anti-CD3 or (G) stimulated in vitro for 24 hr with the indicated concentrations of aCD3+aCD28. Data are means ± SEM (n = 6) and
representative of two (F) or six (G) independent trials.
(H) Flow-cytometric FSC and SSC measurements of the cells in (G). Data are representative of six independent trials. See also Figures S1 and S2.

Immunity 46, 675–689, April 18, 2017 677

 A *
B Gclcfl/fl
2000 3000 *
Cd4cre-Gclcfl/fl
Gclcfl/fl + rapamycin

p-mTOR (MFI)
1500

p-S6 (MFI)
2000
Counts

Counts
CD4+ 1000
CD4+
T cells T cells 1000
500

0 0

2000
*
2500
*
2000

p-mTOR (MFI)
1500

p-S6 (MFI)
Counts

Counts
1500
CD8+ 1000 CD8+ 1000
T cells T cells
500
500

0 0

p-mTOR (MFI) p-S6 (MFI)

D
*
C *
CD4+ T cells CD8+ T cells Cd4Cre-Gclcfl/fl 1500 * * *
+ GSH
0 18 24 24 0 18 24 (h) 0 18 24 24 0 18 24 (h)

p-mTOR (MFI)
+Rap. +Rap. 1000
CD4Cre-Gclcfl/fl

Counts
p4E-BP1 + NAC
500

Actin CD4Cre-Gclcfl/fl

0
w/o NAC GSH
Gclcfl/fl Cd4cre-Gclcfl/fl Gclcfl/fl Cd4cre-Gclcfl/fl
Gclcfl/fl Gclcfl/fl
Cd4cre-Gclcfl/fl
p-mTOR (MFI)

E F
* Non-stim. αCD3+αCD28

Cd4cre-Gclcfl/fl * Gclcfl/fl Control KO Control KO Control KO

3000 __ __ __ __
+ GSH * Cd4cre-Gclcfl/fl NAC NAC

p4E-BP1
p-S6 (MFI)

2000
Cd4cre-Gclcfl/fl
Counts

+ NAC
1000 p-p70
Cd4cre-Gclcfl/fl

0
w/o NAC GSH Actin
Gclcfl/fl

p-S6 (MFI)

Figure 2. T-Cell-Intrinsic Gclc Drives mTOR Activation

(A and B) Intracellular flow-cytometric determination of phosphorylated mTOR (A) and phospho-S6 (B) in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that
were stimulated with aCD3+aCD28 ± rapamycin for 24 hr. Data are means ± SEM (n = 3) and representative of three independent trials.
(C) Immunoblot showing phospho-4EBP1 in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that were stimulated for the indicated times with aCD3+aCD28 ±
rapamycin. Loading control: actin. Data are representative of three independent trials.
(D and E) Intracellular flow-cytometric determination of p-mTOR (D) and p-S6 (E) in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated with
aCD3+aCD28 for 24 hr, with or without (w/o) NAC or GSH. Data are means ± SEM (n = 5) and representative of three independent trials.
(F) Immunoblot showing p-4EBP1 and p-p70 in Gclcfl/fl (control) and Cd4cre-Gclcfl/fl (KO) CD4+ T cells that were stimulated with aCD3+aCD28 for 24 hr ± NAC.
Data are representative of three independent trials.

stimulation, and this lack was not due to increased cell death affected the energy pool, we measured ATP in activated control
(Figure 3D and Figure S3C). However, this proliferation deficit and mutant T cells. Intracellular ATP was decreased in resting
could not be rescued by excess glutamine or a cell-permeable mutant T cells compared to controls and did not increase upon
a-ketoglutarate (aKG) derivative (dimethyl-aKG, DMK) (Figures activation (Figure 4A).
S3D and S3E). Thus, Gclc deficiency not only impairs glutaminol- To determine whether Gclc regulates aerobic glycolysis, we
ysis but has other effects on T cells. applied a glycolysis stress test to mutant and control CD4+
and CD8+ T cells that had been activated in vivo with SEB for
Gclc Regulates Metabolic Reprogramming 48 hr prior to isolation, as well as to isolated T cells that had
Proliferating T cells require fatty acids for lipid and membrane been activated in vitro with aCD3+aCD28 for 24 hr. Measure-
synthesis. These components are provided by increased glycol- ment of the extracellular acidification rate (ECAR) revealed that
ysis and glutaminolysis, which also fill the cellular energy pool Gclc ablation reduced glycolysis in mutant T cells activated
with ATP (Frauwirth et al., 2002; Gerriets and Rathmell, 2012; in vivo or in vitro (Figures 4B and 4C). Thus, GSH has an unex-
Pearce and Pearce, 2013). To investigate whether Gclc loss pected role in regulating glucose metabolism.

678 Immunity 46, 675–689, April 18, 2017

 A B 7 *
Gclcfl/fl 1500
*
Cd4cre-Gclcfl/fl Gclcfl/fl

Net glutamine uptake reate

6
* Cd4cre-Gclcfl/fl
5
Counts

CD98 (MFI)
1000

(fmol/cell/h)
4

3
5000
2

0
CD98 (MFI) - + - + αCD3+αCD28
CD4+ CD8+
T cells T cells

1
Gclcfl/fl
Extracellular
Cd4cre-Gclcfl/fl Non-stimulated
Intracellular
0.8 Gclcfl/fl
Cd4cre-Gclcfl/fl Stimulated
isotopomer abundance
Relative mass

0.6

0.4

0.2

0
M0 M1 M2 M3 M4 M5 M6

D
200000 150000
CD4+ CD8+ Gclcfl/fl
T cells T cells Cd4cre-Gclcfl/fl
Proliferation (cpm)

Proliferation (cpm)

150000
100000

100000

50000
50000

0 0
0 0.1 1 10 0 0.1 1 10
αCD3+αCD28 (μg/mL) αCD3+αCD28 (μg/mL)

Figure 3. Gclc Is Required for Glutaminolysis in Activated T Cells

(A) Flow-cytometric determination of surface CD98 expression by Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated for 24 hr with aCD3+aCD28. Data
on the right are means ± SEM (n = 3) and representative of three independent trials.
(B) Determination of glutamine anaplerosis in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ cells that were stimulated for 24 hr with aCD3+aCD28. Data are
means ± SEM (n = 3) and representative of three independent trials.
(C) Fluxmap of mammalian central carbon metabolism (left) and mass isotopomer distribution of citrate (right) for Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that
were incubated with U-13C-glutamine and stimulated with aCD3+aCD28 for 24 hr. Data are means ± SEM (n = 3) and representative of three independent trials.
(D) Proliferation assessment by 3H-thymidine incorporation of Gclcfl/fl and Cd4cre-Gclcfl/fl T cells that were stimulated with aCD3+aCD28 for 24 hr. Data are
means ± SEM (n = 3) and representative of three independent trials. See also Figure S3.

We next measured glucose consumption and lactate were observed (Figure 4F). Upon activation, flux through PDH
secretion by Gclc-deficient and control T cells activated with increased strongly in T cells of both genotypes, but reduced
aCD3+aCD28 over 24 hr. Mutant T cells consumed less glucose M2 citrate isotopologues were found in Cd4cre-Gclcfl/fl T cells,
and produced less lactate than controls (Figure 4D), and the ratio indicating decreased PDH activity. In contrast to M2 citrate,
of secreted lactate to consumed glucose (a measure of glycolytic there was no decrease in TCA cycle-derived M1 citrate isotopo-
ATP production) was decreased (Figure 4E). Thus, Gclc defi- logues in the absence of Gclc. M1 citrate is produced by subse-
ciency reduced the flux of glycolysis-derived pyruvate through quent cycling of M2 citrate, and the M1:M2 citrate ratio indicates
lactate dehydrogenase (LDH) over the 24 hr activation period, TCA cycling activity (Figure S3F). Thus, overall TCA cycle activity
indicating an altered glucose flux through pyruvate dehydroge- was increased in the mutant T cells despite their GSH deficit, in
nase (PDH) into the TCA cycle. When resting control and line with our glutamine tracing experiments (Figure 3C and
Cd4cre-Gclcfl/fl T cells were incubated with U-13C-glucose, Figure S3B).
equivalent fractions of M2 isotopologues of citrate, which repre- Although the relative contributions of glucose and glutamine
sent the relative flux of glucose-derived carbon through PDH, carbons to the TCA cycle were decreased in the absence of

Immunity 46, 675–689, April 18, 2017 679

 A Gclcfl/fl B C
Cd4cre-Gclcfl/fl
2.5
* * 150 *
* 24
*

ECAR (mpH/min)

ECAR (mpH/min)
2
ATP (relative level)

20
* Gclcfl/fl
* 100
1.5 16 Cd4cre-Gclcfl/fl

2 12 50
0.5 8

0 0
Basal Glucose Basal Glucose fl/fl fl/fl
Gclc Cd4cre- Gclc Cd4cre-
Control αCD3+αCD28 Gclc
fl/fl
Gclcfl/fl
Vβ8-CD4+ T cells Vβ8-CD8+ T cells
CD4+ CD8+
T cells T cells

D * * E
10
0.4 * Gclcfl/fl
Metabolite secretion rate

0 Cd4cre-Gclcfl/fl
*

Lactate / glucose ratio

0.3
(fmol/cell/h)

-10

-20 0.2

-30 Gclcfl/fl
*
Cd4cre-Gclcfl/fl 0.1

-40 *
Glc Lac Glc Lac 0
CD4+ T cells CD8+ T cells CD4+ CD8+
T cells T cells

F
Extracellular
1

Intracellular Gclcfl/fl
Cd4cre-Gclcfl/fl Non-stimulated
0.8
Gclcfl/fl
isotopomer abundance

Cd4cre-Gclcfl/fl Stimulated
Relative mass

0.6

0.4

0.2

0
M0 M1 M2 M3 M4 M5 M6

100

80
Fractional carbon
contribution (%)

60 Other
Palmitate
Glutamine
40 Glucose

20

0
Gclcfl/fl Cd4cre- Gclcfl/fl Cd4cre-
Gclcfl/fl Gclcfl/fl

Citrate Malate

(legend on next page)

680 Immunity 46, 675–689, April 18, 2017

GSH, the overall activity of the cycle was increased. This result
can only be explained by constant replenishment of the mito-
chondrial acetyl-CoA pool by another carbon source. To test
whether this source was increased fatty-acid oxidation, we incu-
bated mutant and control CD4+ T cells with U-13C-palmitate,
which is transported into mitochondria and oxidized to yield
acetyl-CoA. Indeed, fatty-acid b-oxidation was increased in
Gclc-deficient T cells compared to controls (Figure 4G). How-
ever, there was still a large contribution to TCA cycle intermedi-
ates by carbon sources other than glutamine, glucose, and
palmitate, and this contribution was greater in Cd4cre-Gclcfl/fl
T cells than in controls. Such sources might be fatty acids
(including palmitate) derived from FBS in the culture medium or
generated by the catabolism of branched-chain amino acids.
During metabolic reprogramming of activated T cells, mitochon-
drial oxidative phosphorylation is increased (Chang et al., 2013).
However, in accordance with their reduced ATP, the oxygen
consumption rate (OCR) in activated Gclc-deficient T cells lower
than that in controls (Figure S3G). Thus, the unknown additional
carbon sources cannot compensate for the energy gap in Gclc-
deficient T cells. GSH is therefore critical for metabolic reprog-
ramming during T cell activation.
Ablation of Gclc Impairs TCR-Induced Myc Expression
and NFAT Activation
The transcription factor Myc is involved in activation-induced
glycolysis and glutaminolysis in T cells (Douglas et al., 2001;
Verbist et al., 2016; Wang et al., 2011). To determine the role
of Gclc in Myc expression, we activated control and mutant
T cells with aCD3+aCD28 and visualized Myc protein by
immunoblotting. Gclc deficiency reduced TCR-driven Myc upre-
gulation (Figure 5A), revealing an unanticipated function for GSH
in the Myc-regulated switch of T cell metabolism to glycolysis. To
mimic Gclc deficiency in WT T cells, we treated them with BSO.
Activated BSO-treated WT T cells showed reduced GSH after
24 hr and accumulated higher ROS than untreated WT T cells
(Figure S4A and S4B). BSO-treated WT T cells also showed
decreased Myc that was restored by NAC co-incubation (Fig-
ure 5B) and ROS scavenging (Figure S4C). Myc controls the
alternative-splicing-mediated shift from pyruvate kinase (PKM)
1 to PKM2 expression (David et al., 2010) and facilitates glyco-
lytic lactate production (Wang et al., 2011). Indeed, PKM2 pro-
tein was downregulated in Cd4cre-Gclcfl/fl T cells (Figure S4D),
in line with the altered glucose flux through PDH and reduced
lactate production in these cells.
Next, we sought to determine which pathway mediates
GSH-dependent Myc expression in T cells. Although NFAT can
promote Myc production in cancer cells (Buchholz et al., 2006;
Köenig et al., 2010; Singh et al., 2010), the situation in T cells
is unclear. NFAT also drives mTOR expression, and mTOR
stabilizes Myc translation (Babcock et al., 2013; Du € vel
et al., 2010; Hosoi et al., 1998). We stimulated WT T cells with
aCD3+aCD28 plus the calcineurin inhibitor FK506 (which impairs
NFAT activation) or rapamycin. Immunoblotting showed that in-
hibition of either NFAT or mTOR reduced Myc protein (Figure 5C)
and that S6 phosphorylation was inhibited by FK506 (Figure 5C).
Thus, NFAT controls mTOR activity and Myc production in
T cells. Moreover, nuclear accumulation of NFAT was drastically
reduced in activated Gclc-deficient T cells compared to controls
(Figure 5D), despite comparable Ca2+ mobilization (Figure S4E).
Consequently, Gclc-deficient T cells secreted less IL-2, an NFAT
target and T cell mitogen (Figure 5E). However, addition of IL-2 to
Cd4cre-Gclcfl/fl T cell cultures did not restore normal proliferation
(Figure S4F), indicating that a lack of IL-2 is not the main factor
blocking mutant T cell expansion. BSO reduced nuclear but
not cytoplasmic NFAT in activated WT T cells (Figure 5F). Calci-
neurin normally dephosphorylates NFAT to allow its nuclear en-
try (Rusnak and Mertz, 2000). Calcineurin contains iron and zinc
in its active site, and these are sensitive to high ROS (Namga-
ladze et al., 2002). We found that BSO-exposed WT T cells
that we had treated with NAC to induce ROS scavenging easily
initiated NFAT nuclear translocation (Figure 5F and Figure S4C).
Accordingly, ROS buffering in Gclc-deficient T cells restored
NFAT expression and nuclear translocation, as well as activa-
tion-induced IL-2 secretion (Figures 5G and 5H). Lastly, addition
of NAC or GSH to Cd4cre-Gclcfl/fl T cells increased expression of
both Myc and its target CD98 in a manner sensitive to FK506 in-
hibition (Figure 5I). Thus, an antioxidative environment is needed
for NFAT activation, Myc expression, and CD98 production in
activated T cells. Our data show that ROS buffering by Gclc-
derived GSH allows NFAT and mTOR to control the metabolic
regulator Myc.
ROS Buffering Ensures the Integrity of T Cell Energy
Metabolism
To investigate the impact of antioxidants on T cell metabolism,
we activated Cd4cre-Gclcfl/fl and control T cells in the presence
of NAC or GSH and measured glucose consumption and lactate
secretion. Gclc-deficient cells consumed less glucose and
produced less lactate than controls, but they increased their

Figure 4. Gclc Mediates Metabolic Reprogramming and Glycolysis in Activated T Cells

(A) Luminescence determination of ATP in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated with aCD3+aCD28 for 24 hr. Data are means ± SEM
(n = 3) and representative of three independent trials.
(B) Extracellular acidification rates (ECAR) of Vb8+ CD4+ and CD8+ T cells that were isolated by cell sorting 48 hr after Gclcfl/fl and Cd4cre-Gclcfl/fl mice were
injected with 150 mg SEB. Data are means ± SEM (n = 3) and representative of two independent trials.
(C) ECAR determination of Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that were stimulated with aCD3+aCD28 in vitro for 24 hr. Data are means ± SEM
(n = 6) and representative of two independent trials.
(D and E) Extracellular glucose and lactate secretion rates (D), and the ratio of molecules of lactate produced per molecules of glucose consumed (E), in Gclcfl/fl
and Cd4cre-Gclcfl/fl CD4+ and CD8+ cells that were stimulated with aCD3+aCD28 for 24 hr. Data are means ± SEM of triplicate measurements of pooled cells
from four mice/genotype and are representative of three independent trials.
(F) Fluxmap of mammalian carbon metabolism (left) and mass isotopomer distribution of citrate (right) for Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were
incubated with U-13C-glucose and stimulated with aCD3+aCD28 for 24 hr. Data are means ± SEM (n = 3) and representative of three independent trials.
(G) Fractional carbon contribution of glucose, glutamine, and palmitate to citrate and malate in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated with
aCD3+aCD28 for 24 hr. Data are means ± SEM (n = 3) and representative of two independent trials.

Immunity 46, 675–689, April 18, 2017 681

 A CD4+ Tcells CD8+ Tcells αCD3+αCD28
B C
CD4+ T cells CD8+ T cells
0 24 0 24 0 24 0 24 (h) C N C N C N C N
Myc (high exp.) Myc Myc
Myc (low exp.) USF2 pS6
GAPDH
Actin Actin
w/o BSO - - FK Rap - - FK Rap

Gclcfl/fl

Gclcfl/fl
Gclcfl/fl

Cd4cre-Gclcfl/fl
Gclcfl/fl

Cd4cre-Gclcfl/fl
Cd4cre-Gclcfl/fl
Cd4cre-Gclcfl/fl
αCD3+αCD28 αCD3+αCD28
+ NAC

E 6000
*
Gclcfl/fl
Cd4cre-Gclcfl/fl
D CYT *
NUC

IL-2 (pg/mL)
4000
NFATc1 NFATc1

Actin USF-2 2000

αCD3+αCD28 - + - + - + - +
Gclcfl/fl Cd4cre- Gclcfl/fl Cd4cre-
Gclcfl/fl Gclcfl/fl
0
0 0.1 1 10 αCD3+αCD28 (μg/mL)

F αCD3+αCD28 G
C N C N C N C N CYT NUC
NFATc1 NFATc1
NFATc1
Actin
USF2 USF-2

GAPDH αCD3+αCD28 - + - + + Trolox - + - + + Trolox

Gclcfl/fl Cd4cre-Gclcfl/fl Gclcfl/fl Cd4cre-Gclcfl/fl

w/o BSO

+ NAC

H 2000 * 2500 Gclcfl/fl

*
Cd4cre-Gclcfl/fl
IL-2 (pg/mL)
IL-2 (pg/mL)

*
1500
1000

500
0 0
w/o NAC w/o GSH

I
Cd4cre-Gclcfl/fl *
+ GSH *
Gclcfl/fl
CD98 (MFI)

20000
w/o NAC GSH * Cd4cre-Gclcfl/fl
Cd4cre-Gclcfl/fl
Counts

Myc + NAC
10000

Cd4cre-Gclcfl/fl
Actin 0
w/o NAC GSH NAC
Gclcfl/fl FK506

CD98 (MFI)

Figure 5. NFAT Activation and Myc Expression Rely on Gclc

(A) Immunoblot showing Myc expression in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that were stimulated with aCD3+aCD28 for 24 hr. High and low
exposures of one blot representative of four independent trials are shown.
(B) Immunoblot to detect Myc expression in cytosolic (C) and nuclear (N) subcellular fractions of the T cells stimulated as in (A) with or without BSO or NAC. USF2
and GAPDH, loading controls. Data are representative of two independent experiments.
(C) Immunoblot showing Myc expression in WT CD4+ and CD8+ T cells that were left untreated, or stimulated with aCD3+aCD28 for 24h and treated (or not) with
FK506 (FK) or rapamycin (Rap). Data are representative of two independent trials.
(D) Immunoblot showing NFAT expression in cytoplasmic (CYT) and nuclear (NUC) fractions of Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated with
aCD3+aCD28 for 24 hr. Data are representative of four independent trials.
(E) ELISA of IL-2 secretion by Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ and CD8+ T cells that were stimulated with aCD3+aCD28 for 24 hr. Data are means ± SEM (n = 3)
and representative of two independent trials.
(F) Immunoblot showing cytoplasmic and nuclear NFAT expression in T cells that were stimulated, fractionated, and analyzed as in (B). Data are representative of
two independent experiments.
(G) Immunoblot showing cytoplasmic and nuclear NFAT expression in Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated, fractionated, and analyzed
for NFAT expression as in (D). T cells were also treated ± the ROS scavenger Trolox. Data are representative of four independent trials.

(legend continued on next page)

682 Immunity 46, 675–689, April 18, 2017

glycolytic activity in the presence of NAC or GSH (Figures 6A and
6B; see also Figures S5A and S5B). Measurement of glutamine
flux into the TCA cycle via U-13C-glutamine confirmed these
findings (Figure 6C). We next assayed glucose and glutamine
fluxes in activated WT T cells treated with BSO plus NAC or
GSH. As was true for Cd4cre-Gclcfl/fl T cells, pharmacological
inhibition of GCL in activated WT T cells reduced glucose and
glutamine fluxes, which were restored by NAC or GSH (Figures
S5C and S5D). Thus, GSH is critical for ROS buffering that allows
metabolic reprogramming during T cell activation.
ROS scavenging in activated Gclc-deficient T cells also
increased ATP and ‘‘recharged’’ these cells in a manner sup-
pressed by FK506-mediated NFAT inhibition (Figure 6D). Anti-
oxidant-treated ‘‘recharged’’ Gclc-deficient T cells mounted an
activation-induced proliferative response and contained less
ROS than untreated activated control T cells (Figure 6E and
Figure S5E). BSO-treated WT T cells showed reduced prolifera-
tion that was restored by NAC (Figure 6F). As expected, the
proliferation of NAC-treated activated Cd4cre-Gclcfl/fl T cells
was inhibited by FK506 or rapamycin, indicating that prolifera-
tion in the presence of antioxidants is NFAT- and mTOR-depen-
dent (Figures S5E and S5F).
One of our central hypotheses was that Gclc-controlled Myc
was crucial for T cell functionality. We had already shown that
both mTOR and NFAT control Myc in a manner influenced by an-
tioxidants. To confirm that Myc is indeed affected by Gclc loss,
we transduced Cd4cre-Gclcfl/fl T cells with a Myc-expressing
retrovirus for 24 hr (Figure 6G). Surface expression of the Myc
target CD98 was upregulated on Myc-expressing Gclc-deficient
T cells compared to GFP-transduced controls (Figure 6G).
Retroviral Myc expression also restored the proliferation of
activated Gclc-deficient T cells (Figure 6H). Because the prolifer-
ation of Myc-expressing Cd4cre-Gclcfl/fl cells depends on NFAT,
there must be a tight interaction between these pathways in
T cells. We conclude that GSH preserves T cell metabolic integ-
rity by supporting expression of Myc, which is closely linked to
T cell functionality.
Ablation of Gclc in T Cells Leads to EAE Resistance
in Mice
We next explored the consequences of the metabolic imbalance
in Gclc-deficient T cells in vivo. Because Gclc activity affects
T cell homeostasis, which is drastically disturbed in autoimmune
diseases, we investigated whether targeting the GSH-depen-
dent pathway might be a promising means of treating auto-
immunity. Experimental autoimmune encephalomyelitis (EAE)
is a mouse model of multiple sclerosis in which CD4+ T cells
are the major inflammatory drivers (Bru €stle et al., 2007; Langrish
et al., 2005). We induced EAE in age-matched Gclcfl/fl (control)
and Cd4cre-Gclcfl/fl mice and immunized them subcutaneously
(s.c.) with MOG peptide emulsion (MOG) plus pertussis toxin
(PT) to induce disease (Bru€stle et al., 2012). Gclcfl/fl mice devel-
oped severe EAE by day 30 (d30) post-induction, as expected,
(H) ELISA of IL-2 secretion by Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated for 24 hr with aCD3+aCD28 and with or without (w/o) NAC or GSH.
Data are means ± SEM (n = 3) and representative of two independent trials.
(I) Left: Immunoblot showing Myc accumulation in Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated and treated as in (H). Middle and right: Flow-
cytometric analysis of CD98surface expression. Data on the right are means ± SEM (n = 3). Results are representative of three independent trials. See also
Figure S4.
whereas no Cd4cre-Gclcfl/fl mouse showed any signs of EAE
during this period (Figure 7A). Histopathological analyses of
brain tissue at d30 post-MOG immunization revealed immune
cell infiltrates in control brains and spinal cords but not in those
from Cd4cre-Gclcfl/fl mice (Figure 7B and Figure S6A). The infil-
trates in the white matter of control (but not mutant) brains and
spinal cords consisted mainly of CD3+ T cells and activated
macrophages or microglia (Figure 7B and Figure S6A). Because
inflammatory T helper-17 (Th17) and Th1 cells are important for
EAE (Bru €stle et al., 2012), we analyzed these cells in control
and Cd4cre-Gclcfl/fl mice at d12 post-EAE induction. Cd4cre-
Gclcfl/fl CD4+ T cells showed dramatically reduced IL-17 and
IFN-g secretion in comparison to controls (Figure 7C). Thus,
Gclc is crucial for mounting an inflammatory T cell response in
an autoimmune context.
Clearance of Acute Viral Infections Depends on Gclc
Function in T Cells
The inability of Cd4cre-Gclcfl/fl mice to develop EAE suggested
that they might lack a natural T cell-mediated defense against
viral infections. We therefore measured T cell activation
in vivo after a challenge with lymphocytic choriomeningitis virus
(LCMV-Armstrong). We labeled CD8+ T cells isolated from
LCMV-specific (GP33 antigen) TCR transgenic (P14) Gclcfl/fl or
Cd4cre-Gclcfl/fl mice with CFSE or violet cell trace (VCT), respec-
tively, and transferred equal numbers of these cells into recipient
mice. Activation of splenic T cells was measured at 36 and 60 hr
post-LCMV infection of these recipients. In line with our in vivo
results (Figure 1F), Gclc deficiency did not block the initial
activation of LCMV-specific T cells in vivo (Figure 7D). However,
when we infected Cd4cre-Gclcfl/fl and control mice with LCMV
and monitored frequencies of antigen-specific CD8+ T cells by
tetramer staining (GP33, NP396) and flow cytometry, we found
dramatic differences in the anti-viral response. In control mice,
LCMV-reactive (GP33+, NP396+) T cells peaked at d8 post-infec-
tion, but only very low numbers of such T cells were detected in
Cd4cre-Gclcfl/fl mice (Figure 7E), and very few of these produced
inflammatory cytokines (Figure 7F). Accordingly, whereas
control mice cleared the virus by d8 post-infection, viral titers
remained high in the mutants (Figure 7G). At d60 post-infec-
tion, LCMV-specific memory CD8+ T cells (CD44high, CD62Lhigh,
CD127high, KLRG1low) and cytokine-producing cells were still
drastically reduced in Cd4cre-Gclcfl/fl mice compared to controls
(Figure 7H and Figure S6B). In contrast, activation of the innate
immune system was not obviously affected by T cell loss of
Gclc; equivalent secretion of type I IFN was detected in the
serum of control and mutant mice on d3 post-infection
(Figure S6C).
Our earlier data showed that Cd4cre-Gclcfl/fl mice have fewer
T cells (Figure S1F). To rule out the possibility that this altered
T cell homeostasis affected the response of Cd4cre-Gclcfl/fl
mice to LCMV, we adoptively transferred P14-specific,
VCT-labeled Cd4cre-Gclcfl/fl CD8+ T cells and P14-specific,
Immunity 46, 675–689, April 18, 2017 683
 A B C 0.8 Gclc
fl/fl
30 Cd4cre-Gclcfl/fl
w/o 1.0
Metabolite secretion rate

w/o Cd4cre-Gclcfl/fl + GSH

isotopomer abundance
20 NAC fl/fl

Lactate / glucose ratio

Cd4cre-Gclc + NAC
* NAC 0.6
0.8
(fmol/cell/h)

Relative mass
10 *

of fumarate
0.6
0 0.4

0.4
-10
0.2
* 0.2
-20

Glc Lac Glc Lac 0 0

Gclcfl/fl Cd4cre-Gclcfl/fl Gclcfl/fl Cd4cre- M0 M1 M2 M3 M4
Gclcfl/fl

Gclcfl/fl
D E
* Cd4cre-Gclcfl/fl non-treated
15000
* Cd4Cre-Gclc fl/f NAC
Proliferation (cpm)

2.0 1500
* * *
ATP (relative conc.)

10000

DCF-D A (MFI)
1.5

Counts
1000
5000
1.0
500
0.5 0
0 1 3 10
0 αCD3+αCD28 (μg/mL) 0
w/o NAC GSH NAC
FK506 ROS (MFI) αCD3+αCD28

F *
40000 w/o
BSO low
BSO high
30000
Proliferation (cpm)

BSO low + NAC *

BSO high + NAC
20000
*

10000

0
0 0.5 1 3
αCD3+αCD28 (μg/mL)

G H
FP

20000 * *
yc
M
G

Myc
GFP
Proliferation (cpm)

Myc 15000

Actin
Counts

10000

5000

0
CD98 (MFI) GFP Myc Myc
FK506

Figure 6. T-Cell-Intrinsic Gclc Controls the Integrity of T Cell Metabolism in a Myc-Dependent Manner
(A and B) Measurement of glucose and lactate secretion rates (A), and the ratio of molecules of lactate produced per molecules of glucose consumed (B), in
Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were stimulated with aCD3+aCD28 for 24 hr ± NAC. Data are means ± SEM of triplicate measurements of pooled
cells from four mice/genotype and representative of three independent trials.
(C) Mass isotopomer distribution of fumarate for Gclcfl/fl and Cd4cre-Gclcfl/fl CD4+ T cells that were incubated with U-13C-glutamine and stimulated with
aCD3+aCD28 for 24 hr ± NAC or GSH. Data are means ± SEM (n = 3) and representative of three independent trials.
(D) Determination of intracellular ATP concentrations in Gclcfl/fl and Cd4cre-Gclcfl/fl T cells that were stimulated for 24 hr with aCD3+aCD28 alone (w/o) or ± NAC,
GSH, or NAC+FK506. Data are means ± SEM (n = 3) and representative of two independent trials.
(E) Left: Proliferation assessment by 3H-thymidine incorporation of Gclcfl/fl and Cd4cre-Gclcfl/fl T cells that were stimulated with aCD3+aCD28 for 24 hr ± NAC.
Middle, right: ROS concentrations were assessed by DCF-DA staining and flow cytometry. Data are means ± SEM (n = 3) and representative of three
independent trials.
(F) Proliferation assessment by 3H-thymidine incorporation of WT T cells that were treated ± BSO (low, 200 mM; high, 1,000 mM) and stimulated with aCD3+aCD28
for 24 hr ± NAC. Data are means ± SEM (n = 3) and representative of two independent trials.

(legend continued on next page)

684 Immunity 46, 675–689, April 18, 2017

CFSE-labeled CD8+ T cells into recipient mice and infected these
animals with LCMV. Although the transferred cells were antigen-
specific (P14) and showed a similar degree of T cell activation (Fig-
ure 7D), P14-Cd4cre-Gclcfl/fl mice did not mount an anti-viral pro-
liferative response (Figure S6D). Thus, intrinsic Gclc expression in
T cells is required for antigen-specific anti-viral immunity.
DISCUSSION
Although moderate concentrations of ROS act as signaling mes-
sengers and modify protein function or structure by oxidation,
high concentrations of ROS lead to cell death, mutagenesis, or
tumorigenesis (Gorrini et al., 2013; Harris et al., 2015; Sena and
Chandel, 2012). TCR stimulation induces mitochondrial ROS pro-
duction that influences T cell activation, proliferation, and effector
functions (Devadas et al., 2002; Gu €low et al., 2005; Jackson et al.,
2004; Sena et al., 2013; Yi et al., 2006). Prevention of lipid oxida-
tion by glutathione peroxidase 4 (Gpx4) is crucial for T cell survival
and activation (Matsushita et al., 2015). However, prior to our
study, the importance of GCL function in T cells was unclear.
By targeting Gclc in T cells, we have demonstrated that antioxida-
tion by GSH supports an environment essential for activation-
induced metabolic reprogramming in T cells.
Cd4cre-Gclcfl/fl T cells did not proliferate upon TCR ligation,
and mTORC1 activation was impaired. These findings are in
line with mTOR’s regulation of cell growth, which is controlled
by a glutamine flux dependent on CD98 upregulation (Nakaya
et al., 2014; Nicklin et al., 2009; Sinclair et al., 2013). Glutamine
enters the TCA cycle as aKG. However, addition of glutamine
or DMK to cultures of Gclc-deficient T cells did not rescue their
metabolic deficit, indicating that GSH might be a master regulator
of metabolism in this cell type and is not limited to controlling
mTORC1 or glutaminolysis. Indeed, GSH is critical for Myc
expression in activated T cells, and Myc is linked to the glutami-
nolysis and glycolysis characteristic of metabolic reprogramming
(Verbist et al., 2016; Wang et al., 2011). Gclc-deficient T cells
accumulate moderate concentrations of ROS, which can inhibit
phosphatases via oxidation of their catalytic residues (Kamata
et al., 2005; McCubrey et al., 2006) and can block the phospha-
tase-sensitive MAPK- and NFAT-involving pathways that drive
Myc expression (Buchholz et al., 2006; Köenig et al., 2010; Singh
et al., 2010). Calcineurin dephosphorylates NFAT in the cytosol,
initiating NFAT nuclear translocation (Rusnak and Mertz, 2000).
Technical reasons prevented us from demonstrating inactivity
of calcineurin under conditions involving high concentrations of
ROS, but we did show that BSO treatment of activated WT cells
decreased NFAT nuclear translocation and led to the accumula-
tion of NFAT in the cytoplasm. This reduction in NFAT activity
suppressed Myc and CD98 expression and was directly linked
to elevated concentrations of ROS. Consequently, Cd4cre-
Gclcfl/fl T cells displayed dramatically reduced Myc, did not shift
their metabolism to glycolysis and glutaminolysis, and instead
utilized fatty-acid b-oxidation. Proliferation and functionality of
(G) Cd4cre-Gclcfl/fl T cells were stimulated with aCD3+aCD28 and infected with control or Myc-expressing retrovirus. T cells were sorted by flow cytometry and
reactivated in vitro with aCD3+aCD28 for 24 hr. Left: Immunoblot showing Myc accumulation. Right: Flow-cytometric determination of CD98 surface expression.
Data are representative of three independent trials.
(H) Proliferation assessment by 3H-thymidine incorporation of Cd4cre-Gclcfl/fl T cells that were infected and sorted as in (G). Data are means ± SEM (n = 3) and
representative of three independent trials. See also Figure S5.
Gclc-deficient T cells was restored by retroviral Myc expression,
identifying Myc as the central effector in this pathway.
Our data further imply that T cell activation imposes a metabolic
burden that slowly depletes the energy pool of Gclc-deficient
T cells, as confirmed by their decreased ATP. Low ATP abundance
can interfere with the mTOR pathway (Hardie et al., 2012), in line
with the reduced mTOR activation in Cd4cre-Gclcfl/fl T cells.
Notably, there is a ying-yang relationship between mTOR and
Myc. Myc represses transcription of TSC2, increasing mTOR ac-
tivity (Schmidt et al., 2009), but mTOR phosphorylates 4E-BP1
and releases the translation initiation factor eIF-4e, which drives
Myc translation (West et al., 1998).Thus, the low Myc expression
in Gclc-deficient T cells might negatively affect mTOR activation
and vice versa. Alternatively, AKT, which is regulated by PI3K
and PTEN (Laplante and Sabatini, 2012), can suppress mTOR ac-
tivity (Hahn-Windgassen et al., 2005; Inoki et al., 2002). However,
AKT activation was not altered by the loss of Gclc in T cells.
Gclc-deficient T cells underwent normal early activation
in vitro and in vivo but were unable to proliferate. Increased
glucose metabolism is important for proliferation, but mitochon-
drial respiration prior to proliferation is sufficient for T cell activa-
tion (Sena et al., 2013). High concentrations of ROS are known
to inhibit glyceraldehyde-3-phosphatase dehydrogenase and
thereby impede glycolysis (Hwang et al., 2009). During early pro-
liferation (24 hr after TCR ligation), activated T cells require fatty
acids for lipid and membrane synthesis. These components are
provided by metabolic reprogramming that increases acetyl-
CoA synthesis from glucose and glutamine and fuels the cellular
energy pool (Pearce and Pearce, 2013). Without Gclc and thus
GSH, this process is disturbed, and the fatty-acid oxidation
required for driving energy production and cell growth repre-
sents a severe metabolic burden to the T cell. If GSH-deficient
T cells cannot compensate for their ongoing deficit in acetyl-
CoA by using either glucose or glutamine as a carbon source,
they eventually succumb to cell death. In vivo, T cell-specific
ablation of the GSH pathway manifests as dysregulated autoim-
mune responses and impaired antiviral defense. Our results
demonstrate that the GSH antioxidative system tightly links the
metabolic reprogramming in activated T cells to the regulation
of immune homeostasis.
EXPERIMENTAL PROCEDURES
Mice
Gclcfl/fl mice were generated as described (Chen et al., 2007) and crossed with
Cd4cre-expressing mice obtained from K. Rajewsky’s lab and generated in C.B.
Wilson’s lab (Wolfer et al., 2001). C57BL/6 mice were from The Jackson Labora-
tory. All experiments used age- and sex-matched mice (6–12 weeks old).
T Cell Isolation, Activation, and Proliferation
CD4+ and CD8+ T cells were isolated from spleen and LNs by magnetic bead
sorting (Miltenyi). T cells were stimulated in vitro with PMA (Sigma, 200 ng/mL)
and calcium ionophore A23187 (Iono; Sigma, 200 ng/mL), with anti-CD3 anti-
body (BD Biosciences, 4 mg/mL) plus anti-CD28 antibody (BD Biosciences,
Immunity 46, 675–689, April 18, 2017 685
 Gclcfl/fl Cd4cre-Gclcfl/fl
A B

4 H&E
Gclcfl/fl
Cd4dre-Gclcfl/fl
3
EAE score

1
+ +
CD3
0
0 10 20 30
day

Mac-1

C
Gclcfl/fl Cd4cre-Gclcfl/fl
2.67 2.25 0.44 0.10

* 8
15

CD4+ T cells in LN (%)

CD4+ T cells in SP (%)

Gclc fl/fl

Cytokine expressing
Cytokine expressing

* fl/fl
6 Cd4cre-Gclc
10
IL-17

4
5 * * *
2

84.8 10.3 97.2 2.21 0 0

+ + + + + +
IL-17 IL-17 IFNγ IL-17 IL-17 IFNγ
IFNγ IFNγ IFNγ

D 100 Gclcfl/fl E
Cd4cre-Gclcfl/fl
80
Db (GP33) (% of CD8+ T cells)

Db (NP396) (% of CD8+ T cells)

CD69+ (%)

60 10 10
Gclc fl/fl
40
8 8 Cd4cre-Gclc fl/fl
20
0 6 6
80
4 4
60
CD25+ (%)

2 2
40
0 0
20
0 8 15 22 0 8 15 22
0 Days post infection Days post infection
36h 60h
post infection
F
TNF (% of CD8+ T cells)

IL-2 (% of CD8+ T cells)

IFNγ (% of CD8+ T cells)

6 * 3 * 0.15
Gclcfl/fl
Cd4cre-Gclcfl/fl
4 * 2 0.10

*
2 1 0.05

0 0 0
control GP33 NP396 control GP33 NP396 control GP33 NP396

G H
7 Gclcfl/fl
10 Cd4cre-Gclcfl/fl 10 7 Gclcfl/fl
Cd4cre-Gclcfl/fl
6
Number of Splenocytes

10
10 6
105 *
PFU/mL

*
*
104 10 5

103
limit of detection 10 4

0 5 10 15 20 25 CD8+ Db (GP33) Db (NP396) Db (GP276)

day

Figure 7. Autoimmune and Anti-viral Responses Depend on Gclc in T Cells

(A) EAE induction time course in Gclcfl/fl (n = 8) and Cd4cre-Gclcfl/fl (n = 8) mice that were immunized with MOG peptide. Data are means ± SEM and representative
of two independent trials.
(B) Histological analyses of brains of the mice in (A) on d30 post-EAE induction. Cross-sections of the same brain area were stained with H&E, anti-CD3 antibody
(for detection of T cells), or anti-Mac-1 antibody (macrophages, activated microglia). Scale bars represent 400 mm. Results are for one mouse/genotype
representative of three mice/group. Data are representative of two independent trials.

(legend continued on next page)

686 Immunity 46, 675–689, April 18, 2017
2 mg/mL), or with MOG peptide for the times or at the concentrations indicated
in the Figures.
In Vivo T Cell Activation
Mice were injected intraperitoneally (i.p.) with 150 mg/mouse Staphylococcal
enterotoxin B (Sigma). After 48 hr, T cells were analyzed for ROS as described
in the main text, analyzed for GSH amounts as described below, or sorted by
standard flow cytometry so that Vb8+ T cells could be isolated. Alternatively,
mice were injected i.p. with 50 mg/anti-CD3 (Biolegend). After 24 hr, T cells
were analyzed for ROS as described in the main text or analyzed for GSH
amounts as described below.
Study Approval
Animal procedures were approved by the University Health Network Institu-
tional Animal Care and Use Committee in Toronto and/or the Animal Welfare
Structure at the Luxembourg Institute of Health.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures
and six figures and can be found with this article online at http://dx.doi.org/
10.1016/j.immuni.2017.03.019.

Proliferation
For assessment of cell proliferation, 3H-thymidine incorporation was
measured with a Matrix 96 Direct b Counter (Canberra Packard) 24 hr after
stimulation, as described previously (Brenner et al., 2014).
EAE Induction
Mice were injected s.c. with MOG 35-55 peptide (Washington Biotech) plus
CFA (Difco) emulsion, followed by two intraperitoneal injections of pertussis
toxin (PT, List Biological), as described (Bru€stle et al., 2012). Clinical scores
were determined as described (Bru €stle et al., 2012). Brains and spinal cords
were obtained 30 days after EAE induction, and histological sections were
analyzed as described (Brenner et al., 2014; Bru €stle et al., 2012).
LCMV Infection
Mice were infected i.p. with 5 3 105 PFU LCMV-Armstrong. LCMV-specific
T cells were identified in peripheral blood or spleen via staining with GP33-,
NP396-, or GP276-specific tetramers (National Institutes of Health) followed
by flow cytometry. Virus titers were determined by plaque-forming assays
as described (Ahmed et al., 1984).
Intracellular ROS
T cells were stimulated with PMA (10 ng/mL) plus Iono (10 ng/mL) or with anti-
CD3 plus anti-CD28 antibodies (1mg), for 24 hr before 30 min incubation with
5 mM dichlorofluorescein diacetate (DCF-DA, Sigma). Cells were analyzed by
flow cytometry as described (Gu€low et al., 2005).
AUTHOR CONTRIBUTIONS
D.B., M.G., G.S.D., C.D., Y.N., M.C., C.B., A.B., M.I., C.J., O.P. B.C, P.A.L.
performed the experiments; D.B. and T.W.M designed the study. K.H.,
Y.N., M.G. C.D., G.S.D, and D.B. analyzed metabolic changes. D.B.,
G.S.D., M.G., M.C. P.A.L., A.B., M.C., and M.I. performed in vivo analyzes.
T.W.M., M.L., I.S.H., Y.C., C.G., Z.H. M.O., and C.B.J. provided expertise
and reagents. D.B. supervised the study and wrote the manuscript; K.H.
helped to write the manuscript.
ACKNOWLEDGMENTS
We thank L. Soriano Baguet and H. Kurniawan for assistance; L. Wybenga-
Groot, C. Fladd, and the SPARC BioCentre in Toronto for Seahorse experi-
ments; A. Elia for assistance with histology; and J. Haight and S. Storn and
the Luxembourg Institute of Health’s Animal Welfare Structure. We thank M.
Saunders for scientific editing and to M. Brenner for general support. D.B.
and K.H. are supported by the ATTRACT program and D.B. by a CORE grant
(C15/BM/10355103) of the National Research Fund Luxembourg (FNR). V.V.
holds a grant from the NIH NIAAA (5R24AA022057-05). This study was sup-
ported by the German Research Council (DFG, SFB974, LA-2558-5/1). M.L.
and O.P. are funded by the Deutsches Zentrum fu €r Infektionsforschung and
the University Hospital Giessen Marburg. T.W.M. holds grants from the Na-
tional Multiple Sclerosis Society (RG 5035-A-2) and the Canadian Institutes
of Health Research (143268, MOP-123276).

Isotopic Labeling Received: September 23, 2016

T cells were incubated for 24 hr in RPMI 1640 containing [U-13C]-glucose
(11.1 mmol/L; Cambridge Isotope Laboratories); [U-13C]-glutamine (2 mmol/L;
Cambridge Isotope Laboratories); or [U-13C]-palmitate (0.1 mmol/L, Sigma)
conjugated to bovine serum albumin (Sigma). Extraction of intracellular metab-
olites, GC-MS measurement, and calculation of mass isotopomer distributions
and fractional carbon contributions were performed as described (Battello
et al., 2016). Glucose, lactate, glutamine, and glutamate concentrations
were determined with a YSI 2950D Biochemistry Analyzer (YSI Incorporated).
Statistics
Data are means ± SEM, and p values were determined by unpaired Student’s
t test or two-way Anova test with Prism 7.0 (GraphPad). p values % 0.05 were
considered significant.
Revised: January 31, 2017
Accepted: March 29, 2017
Published: April 18, 2017
REFERENCES
Ahmed, R., Salmi, A., Butler, L.D., Chiller, J.M., and Oldstone, M.B. (1984).
Selection of genetic variants of lymphocytic choriomeningitis virus in spleens
of persistently infected mice. Role in suppression of cytotoxic T lymphocyte
response and viral persistence. J. Exp. Med. 160, 521–540.
Babcock, J.T., Nguyen, H.B., He, Y., Hendricks, J.W., Wek, R.C., and Quilliam,
L.A. (2013). Mammalian target of rapamycin complex 1 (mTORC1) enhances
bortezomib-induced death in tuberous sclerosis complex (TSC)-null cells

(C) Intracellular staining and flow cytometry showing IL-17 and IFN-g in CD4+ T cells from spleen (left, middle) and LN (right) of Gclcfl/fl and Cd4cre-Gclcfl/fl mice at
d12 post-EAE induction. Left: Data are gated on live CD4+ T cells. Middle, right: Data are means ± SEM (n = 4) and representative of three independent trials.
(D) CD8+ T cells from LCMV-specific TCR transgenic P14-Gclcfl/fl (n = 6) and P14-Cd4cre-Gclcfl/fl (n = 6) mice were isolated from spleen and LNs, labeled with
CFSE or VCT, respectively, and transferred into WT recipient mice. Recipients were infected with LCMV-Armstrong. At the indicated times after infection, splenic
T cells were isolated from recipients and analyzed for CD69 and CD25 surface expression by flow cytometry. Data are means ± SEM (n = 4) and representative of
two independent trials.
(E) Flow-cytometric determination of LCMV-reactive T cells in Gclcfl/fl (n = 12) and Cd4cre-Gclcfl/fl (n = 12) mice that were infected with LCMV-Armstrong. T cells
were stained with tetramers specific for the LCMV peptides GP33 (left) and NP396 (right) and evaluated at the indicated times. Data are means ± SEM and
representative of two independent trials.
(F) Intracellular flow-cytometric determination of expression of the indicated cytokines by splenic LCMV-specific CD8+ T cells measured at d8 post-infection.
Data are means ± SEM (n = 4/genotype) and representative of two independent trials.
(G) Viral titers in the mice in (E) were determined at the indicated times via plaque-forming assays. Data are means ± SEM (n = 5/genotype).
(H) Flow-cytometric quantitation of antigen-specific memory T cells at d60 post-LCMV infection. Data are means ± SEM (n = 6/genotype) and representative of
two independent trials. See also Figure S6.

Immunity 46, 675–689, April 18, 2017 687

by a c-MYC-dependent induction of the unfolded protein response. J. Biol.
Chem. 288, 15687–15698.
Battello, N., Zimmer, A.D., Goebel, C., Dong, X., Behrmann, I., Haan, C., Hiller,
K., and Wegner, A. (2016). The role of HIF-1 in oncostatin M-dependent meta-
bolic reprogramming of hepatic cells. Cancer Metab. 4, 3.
Brenner, D., Bru€stle, A., Lin, G.H., Lang, P.A., Duncan, G.S., Knobbe-
Thomsen, C.B., St Paul, M., Reardon, C., Tusche, M.W., Snow, B., et al.
(2014). Toso controls encephalitogenic immune responses by dendritic cells
and regulatory T cells. Proc. Natl. Acad. Sci. USA 111, 1060–1065.
Brownlie, R.J., and Zamoyska, R. (2013). T cell receptor signalling networks:
branched, diversified and bounded. Nat. Rev. Immunol. 13, 257–269.
€nter, C., Stadelmann, C., Yu, P.,
€stle, A., Heink, S., Huber, M., Rosenpla
Bru
Arpaia, E., Mak, T.W., Kamradt, T., and Lohoff, M. (2007). The development
of inflammatory T(H)-17 cells requires interferon-regulatory factor 4. Nat.
Immunol. 8, 958–966.
Bru€stle, A., Brenner, D., Knobbe, C.B., Lang, P.A., Virtanen, C., Hershenfield,
B.M., Reardon, C., Lacher, S.M., Ruland, J., Ohashi, P.S., and Mak, T.W.
(2012). The NF-kB regulator MALT1 determines the encephalitogenic potential
of Th17 cells. J. Clin. Invest. 122, 4698–4709.
Buchholz, M., Schatz, A., Wagner, M., Michl, P., Linhart, T., Adler, G., Gress,
T.M., and Ellenrieder, V. (2006). Overexpression of c-myc in pancreatic cancer
caused by ectopic activation of NFATc1 and the Ca2+/calcineurin signaling
pathway. EMBO J. 25, 3714–3724.
Cairns, R.A., Harris, I.S., and Mak, T.W. (2011). Regulation of cancer cell meta-
bolism. Nat. Rev. Cancer 11, 85–95.
Carr, E.L., Kelman, A., Wu, G.S., Gopaul, R., Senkevitch, E., Aghvanyan, A.,
Turay, A.M., and Frauwirth, K.A. (2010). Glutamine uptake and metabolism
are coordinately regulated by ERK/MAPK during T lymphocyte activation.
J. Immunol. 185, 1037–1044.
Chang, C.H., Curtis, J.D., Maggi, L.B., Jr., Faubert, B., Villarino, A.V.,
O’Sullivan, D., Huang, S.C., van der Windt, G.J., Blagih, J., Qiu, J., et al.
(2013). Posttranscriptional control of T cell effector function by aerobic glycol-
ysis. Cell 153, 1239–1251.
Chen, Y., Shertzer, H.G., Schneider, S.N., Nebert, D.W., and Dalton, T.P.
(2005). Glutamate cysteine ligase catalysis: dependence on ATP and modifier
subunit for regulation of tissue glutathione levels. J. Biol. Chem. 280,
33766–33774.
Chen, Y., Yang, Y., Miller, M.L., Shen, D., Shertzer, H.G., Stringer, K.F., Wang,
B., Schneider, S.N., Nebert, D.W., and Dalton, T.P. (2007). Hepatocyte-spe-
cific Gclc deletion leads to rapid onset of steatosis with mitochondrial injury
and liver failure. Hepatology 45, 1118–1128.
David, C.J., Chen, M., Assanah, M., Canoll, P., and Manley, J.L. (2010). HnRNP
proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in
cancer. Nature 463, 364–368.
Devadas, S., Zaritskaya, L., Rhee, S.G., Oberley, L., and Williams, M.S. (2002).
Discrete generation of superoxide and hydrogen peroxide by T cell receptor
stimulation: selective regulation of mitogen-activated protein kinase activation
and fas ligand expression. J. Exp. Med. 195, 59–70.
Douglas, N.C., Jacobs, H., Bothwell, A.L., and Hayday, A.C. (2001). Defining
the specific physiological requirements for c-Myc in T cell development. Nat.
Immunol. 2, 307–315.
Du€vel, K., Yecies, J.L., Menon, S., Raman, P., Lipovsky, A.I., Souza, A.L.,
Triantafellow, E., Ma, Q., Gorski, R., Cleaver, S., et al. (2010). Activation of a
metabolic gene regulatory network downstream of mTOR complex 1. Mol.
Cell 39, 171–183.
Frauwirth, K.A., Riley, J.L., Harris, M.H., Parry, R.V., Rathmell, J.C., Plas, D.R.,
Elstrom, R.L., June, C.H., and Thompson, C.B. (2002). The CD28 signaling
pathway regulates glucose metabolism. Immunity 16, 769–777.
Gerriets, V.A., and Rathmell, J.C. (2012). Metabolic pathways in T cell fate and
function. Trends Immunol. 33, 168–173.
Gorrini, C., Harris, I.S., and Mak, T.W. (2013). Modulation of oxidative stress as
an anticancer strategy. Nat. Rev. Drug Discov. 12, 931–947.
688 Immunity 46, 675–689, April 18, 2017
Gu€low, K., Kaminski, M., Darvas, K., Su €ss, D., Li-Weber, M., and Krammer,
P.H. (2005). HIV-1 trans-activator of transcription substitutes for oxidative
signaling in activation-induced T cell death. J. Immunol. 174, 5249–5260.
Hahn-Windgassen, A., Nogueira, V., Chen, C.C., Skeen, J.E., Sonenberg, N.,
and Hay, N. (2005). Akt activates the mammalian target of rapamycin by regu-
lating cellular ATP level and AMPK activity. J. Biol. Chem. 280, 32081–32089.
Hardie, D.G., Ross, F.A., and Hawley, S.A. (2012). AMPK: a nutrient and
energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol.
13, 251–262.
Harris, I.S., Treloar, A.E., Inoue, S., Sasaki, M., Gorrini, C., Lee, K.C., Yung,
K.Y., Brenner, D., Knobbe-Thomsen, C.B., Cox, M.A., et al. (2015).
Glutathione and thioredoxin antioxidant pathways synergize to drive cancer
initiation and progression. Cancer Cell 27, 211–222.
Hörig, H., Spagnoli, G.C., Filgueira, L., Babst, R., Gallati, H., Harder, F., Juretic,
A., and Heberer, M. (1993). Exogenous glutamine requirement is confined to
late events of T cell activation. J. Cell. Biochem. 53, 343–351.
Hosoi, H., Dilling, M.B., Liu, L.N., Danks, M.K., Shikata, T., Sekulic, A.,
Abraham, R.T., Lawrence, J.C., Jr., and Houghton, P.J. (1998). Studies
on the mechanism of resistance to rapamycin in human cancer cells. Mol.
Pharmacol. 54, 815–824.
Hwang, N.R., Yim, S.H., Kim, Y.M., Jeong, J., Song, E.J., Lee, Y., Lee, J.H.,
Choi, S., and Lee, K.J. (2009). Oxidative modifications of glyceraldehyde-3-
phosphate dehydrogenase play a key role in its multiple cellular functions.
Biochem. J. 423, 253–264.
Inoki, K., Li, Y., Zhu, T., Wu, J., and Guan, K.L. (2002). TSC2 is phosphorylated
and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 4,
648–657.
Inoki, K., Ouyang, H., Zhu, T., Lindvall, C., Wang, Y., Zhang, X., Yang, Q.,
Bennett, C., Harada, Y., Stankunas, K., et al. (2006). TSC2 integrates Wnt
and energy signals via a coordinated phosphorylation by AMPK and GSK3
to regulate cell growth. Cell 126, 955–968.
Jackson, S.H., Devadas, S., Kwon, J., Pinto, L.A., and Williams, M.S. (2004).
T cells express a phagocyte-type NADPH oxidase that is activated after
T cell receptor stimulation. Nat. Immunol. 5, 818–827.
Kamata, H., Honda, S., Maeda, S., Chang, L., Hirata, H., and Karin, M. (2005).
Reactive oxygen species promote TNFalpha-induced death and sustained
JNK activation by inhibiting MAP kinase phosphatases. Cell 120, 649–661.
Köenig, A., Linhart, T., Schlengemann, K., Reutlinger, K., Wegele, J., Adler, G.,
Singh, G., Hofmann, L., Kunsch, S., Bu€ch, T., et al. (2010). NFAT-induced his-
tone acetylation relay switch promotes c-Myc-dependent growth in pancreatic
cancer cells. Gastroenterology 138, 1189–99.e1, 2.
Langrish, C.L., Chen, Y., Blumenschein, W.M., Mattson, J., Basham, B.,
Sedgwick, J.D., McClanahan, T., Kastelein, R.A., and Cua, D.J. (2005). IL-23
drives a pathogenic T cell population that induces autoimmune inflammation.
J. Exp. Med. 201, 233–240.
Laplante, M., and Sabatini, D.M. (2012). mTOR signaling in growth control and
disease. Cell 149, 274–293.
Matsushita, M., Freigang, S., Schneider, C., Conrad, M., Bornkamm, G.W.,
and Kopf, M. (2015). T cell lipid peroxidation induces ferroptosis and prevents
immunity to infection. J. Exp. Med. 212, 555–568.
McCubrey, J.A., Lahair, M.M., and Franklin, R.A. (2006). Reactive oxygen
species-induced activation of the MAP kinase signaling pathways. Antioxid.
Redox Signal. 8, 1775–1789.
Meister, A. (1983). Selective modification of glutathione metabolism. Science
220, 472–477.
Nakaya, M., Xiao, Y., Zhou, X., Chang, J.H., Chang, M., Cheng, X., Blonska,
M., Lin, X., and Sun, S.C. (2014). Inflammatory T cell responses rely on amino
acid transporter ASCT2 facilitation of glutamine uptake and mTORC1 kinase
activation. Immunity 40, 692–705.
Namgaladze, D., Hofer, H.W., and Ullrich, V. (2002). Redox control of calci-
neurin by targeting the binuclear Fe(2+)-Zn(2+) center at the enzyme active
site. J. Biol. Chem. 277, 5962–5969.
Newsholme, E.A., Crabtree, B., and Ardawi, M.S. (1985). Glutamine meta-
bolism in lymphocytes: Its biochemical, physiological and clinical importance.
Q. J. Exp. Physiol. 70, 473–489.
Nicklin, P., Bergman, P., Zhang, B., Triantafellow, E., Wang, H., Nyfeler, B.,
Yang, H., Hild, M., Kung, C., Wilson, C., et al. (2009). Bidirectional transport
of amino acids regulates mTOR and autophagy. Cell 136, 521–534.
Pearce, E.L., and Pearce, E.J. (2013). Metabolic pathways in immune cell acti-
vation and quiescence. Immunity 38, 633–643.
Pollizzi, K.N., and Powell, J.D. (2014). Integrating canonical and metabolic
signalling programmes in the regulation of T cell responses. Nat. Rev.
Immunol. 14, 435–446.
Rusnak, F., and Mertz, P. (2000). Calcineurin: form and function. Physiol. Rev.
80, 1483–1521.
Schmidt, E.V., Ravitz, M.J., Chen, L., and Lynch, M. (2009). Growth controls
connect: interactions between c-myc and the tuberous sclerosis complex-
mTOR pathway. Cell Cycle 8, 1344–1351.
Sena, L.A., and Chandel, N.S. (2012). Physiological roles of mitochondrial
reactive oxygen species. Mol. Cell 48, 158–167.
Sena, L.A., Li, S., Jairaman, A., Prakriya, M., Ezponda, T., Hildeman, D.A.,
Wang, C.R., Schumacker, P.T., Licht, J.D., Perlman, H., et al. (2013).
Mitochondria are required for antigen-specific T cell activation through reac-
tive oxygen species signaling. Immunity 38, 225–236.
Sinclair, L.V., Rolf, J., Emslie, E., Shi, Y.B., Taylor, P.M., and Cantrell, D.A.
(2013). Control of amino-acid transport by antigen receptors coordinates the
metabolic reprogramming essential for T cell differentiation. Nat. Immunol.
14, 500–508.
Singh, G., Singh, S.K., König, A., Reutlinger, K., Nye, M.D., Adhikary, T.,
Eilers, M., Gress, T.M., Fernandez-Zapico, M.E., and Ellenrieder, V. (2010).
Sequential activation of NFAT and c-Myc transcription factors mediates
the TGF-beta switch from a suppressor to a promoter of cancer cell prolif-
eration. J. Biol. Chem. 285, 27241–27250.
ski, M.M., Wang, R.,
Verbist, K.C., Guy, C.S., Milasta, S., Liedmann, S., Kamin
and Green, D.R. (2016). Metabolic maintenance of cell asymmetry following
division in activated T lymphocytes. Nature 532, 389–393.
Wang, R., Dillon, C.P., Shi, L.Z., Milasta, S., Carter, R., Finkelstein, D.,
McCormick, L.L., Fitzgerald, P., Chi, H., Munger, J., and Green, D.R. (2011).
The transcription factor Myc controls metabolic reprogramming upon
T lymphocyte activation. Immunity 35, 871–882.
West, M.J., Stoneley, M., and Willis, A.E. (1998). Translational induction of
the c-myc oncogene via activation of the FRAP/TOR signalling pathway.
Oncogene 17, 769–780.
Wolfer, A., Bakker, T., Wilson, A., Nicolas, M., Ioannidis, V., Littman, D.R., Lee,
P.P., Wilson, C.B., Held, W., MacDonald, H.R., and Radtke, F. (2001).
Inactivation of Notch 1 in immature thymocytes does not perturb CD4 or
CD8T cell development. Nat. Immunol. 2, 235–241.
Yaqoob, P., and Calder, P.C. (1997). Glutamine requirement of proliferating
T lymphocytes. Nutrition 13, 646–651.
Yi, J.S., Holbrook, B.C., Michalek, R.D., Laniewski, N.G., and Grayson, J.M.
(2006). Electron transport complex I is required for CD8+ T cell function.
J. Immunol. 177, 852–862.
Immunity 46, 675–689, April 18, 2017 689
Immunity, Volume 46

Supplemental Information

Glutathione Primes
T Cell Metabolism for Inflammation
Tak W. Mak, Melanie Grusdat, Gordon S. Duncan, Catherine Dostert, Yannic
Nonnenmacher, Maureen Cox, Carole Binsfeld, Zhenyue Hao, Anne Brüstle, Momoe
Itsumi, Christian Jäger, Ying Chen, Olaf Pinkenburg, Bärbel Camara, Markus
Ollert, Carsten Bindslev-Jensen, Vasilis Vasiliou, Chiara Gorrini, Philipp A.
Lang, Michael Lohoff, Isaac S. Harris, Karsten Hiller, and Dirk Brenner
Supplemental Information

Supplemental Experimental Procedures

Immunoblotting
Immunoblotting was performed as described previously (Brenner et al., 2009). Antibodies
used were as follows: anti-pp38 (Cell Signaling), anti-pERK (Cell Signaling), anti-pJNK
(Santa Cruz), anti-pAKT (Cell Signaling), anti-pGSK3β (Cell Signaling), anti-GSK3β (Cell
Signaling), anti-Gclc (Santa Cruz), anti-actin (Sigma-Aldrich), anti-NFATc1 (Santa Cruz),
anti-IκBα (Santa Cruz), anti-PKM2 (Cell Signaling), and anti-MYC (Santa Cruz).

Cloning and retroviral transduction

The gene encoding murine full length c-Myc was cloned from plasmid pHCMV-Myc-wt
(Herold et al., 2002), kindly provided by S. Herold (University of Würzburg, Germany). This
cDNA was digested with BamHI (5‘ and 3‘) and cloned into the BglII-digested and
dephosphorylated pMIG vector. 293T/17 cells were transfected with pEco, pCGP and
pMIG or pMIG-cMyc plasmids using calcium phosphate precipitation. Viral supernatants
were collected at 24h and 48h post-transfection.
For retroviral transduction, purified naı̈ ve CD4+T cells were plated for 19h on culture
plates that were coated with anti-CD3 Abs. Fresh retroviral supernatants were added and
the cells were centrifuged at 2700 rpm for 1.5h at 37oC. After spin infection, the cells were
re-cultured in the stored culture medium. After 24h, T cells were sorted by flow cytometry
on the basis of coexpressed GFP and used for experiments

Quantitative RT-PCR
RNA was isolated from cell pellets using RNAeasy (Qiagen). cDNA was prepared using a
iScript cDNA synthesis kit (Bio-Rad), and RT-PCR was carried out using Sybrgreen Master
Mix (ABI) and the primers listed in Supplemental Table 1. Reactions were run on an ABI
7500HT Fast qRT-PCR instrument. Data were normalized to GAPDH transcription and
analyzed using the ∆∆Ct method.

1
Primer that have been used for quantitative RT-PCRs:
Gene Forward primer Reverse primer
Gclc GGCTCTCTGCACCATCACTT GTTAGAGTACCGAAGCGGGG
Gclm AGGAGCTTCGGGACTGTATCC GGGACATGGTGCATTCCAAAA
Gapdh ACGGCACAGTCAAGGCCGAG CACCCTTCAAGTGGGCCCCG

Surface markers, cytokines, inhibitors and viability

T cells were stimulated as indicated in the Figures and standard protocols were used for
surface marker staining. Antibodies used were: anti-B220 (RA3-6B2), anti-CD4 (RM4-5),
anti-CD8 (53-6.7), anti-CD25 (PC61), anti-CD44 (IM7), anti-CD62L (MEL-14), anti-CD69
(H1.2F3), anti-CD127 (A7R34), and anti-KLRG1 (2F1), (all from Biolegend); and anti-
phospho-mTOR (S2448) and anti-phospho-S6 Ribosomal (S235/S236) (both from
eBiosciences). Viability was assessed by flow cytometry following Annexin V plus 7AAD
staining. Cytokines in culture supernatants were quantified by ELISA using the appropriate
kits according to the manufacturers’ instructions: IL-2 (eBioscience), IFNα (PBL).
Intracellular staining to detect cytokines was performed using Cytofix/Cytoperm™ kits (BD).
Rapamycin (Sigma) and FK506 (Sigma) were used at a final concentration of 100nM. Trolox
(Sigma) was used at a concentration of 250µM and N-acetyl-cysteine (NAC; Sigma) at
10mM. If not otherwise indicated BSO (Sigma) was used at a concentration of 200µM.

Ca2+ measurement
Splenocytes were surface-stained with APC-labeled anti-CD4 and FITC-labeled anti-CD8
mAbs (Biolegend), washed, and labeled with Indo-1 (Invitrogen) at 37°C for 45 min. Washed
cells were warmed to 37°C and stimulated with anti-CD3 Ab and A23187 calcium ionophore
(Iono). Ca2+ flux was measured by flow cytometry using an LSRII cytometer (BD). The Indo-
1 violet:blue ratio over time was plotted using FloJo (Treestar) and Prism 7.0 (GraphPad).

Histology and immunohistochemistry

Specimens for histology and immunohistochemistry analyses were prepared and examined
as previously described (Brustle et al., 2012).

Determination of GSH and ATP

2
T cells were stimulated as indicated and 2x105 T cells/well were measured using the GSH-
Glo™ assay (Promega) for GSH or the CellTiter-Glo assay (Promega) for ATP (Verbist et
al., 2016) according to the manufacturer's protocol.
Alternatively GSH was measured by LC-MS as described below.

LC-MS measurement
Relative quantification of GSH was performed using an Agilent 1290 Series LC coupled to
an Agilent 6550 Q-TOF MS system equipped with a Dual Agilent Jet Stream ESI source.
Column used: Waters ACQUITY UPLC HSS T3 1.8 µm; Length, I.D., Particle Size: 100
mm x 2.1 mm x 1.8 µm; maintained at 45°C. The autosampler was kept at 4 °C and the
injection volume was 1 µL. The flow rate was set to 0.25 mL/min and the mobile phases
consisted of 0.1% formic acid in water (Eluent A) and 0.1% formic acid in methanol (Eluent
B). The run consisted of an isocratic delivery of 1% Eluent B over 5 min, followed by a
linear gradient to 95% Eluent B over 1 min, isocratic delivery of 95% Eluent B for 4 min,
and a re-equilibration phase on starting conditions with 1% Eluent B for 5 min.
MS experiments were performed using electrospray ionization in positive mode (+ESI)
with a capillary voltage of 3.5 kV. The protonated molecules of GSH were monitored in
high resolution mode (slicer position: 5) and Extended Dynamic Range (2GHz) with the
following Q-TOF MS conditions: drying gas temperature: 225°C, drying gas flow: 14 L/min
(nitrogen), nebulizer: 35 psig, sheath gas temperature: 350°C, sheath gas flow: 11 L/min,
fragmentor: 400 V, Oct RF Vpp: 750 V. Full scan spectra were acquired from m/z 100 to
1000 (2 spectra/sec). External mass calibration was performed before measurement of
each set of samples. All data were acquired with Agilent Mass Hunter LC/MS Data
Acquisition (ver B.06.01) and analyzed with Agilent Mass Hunter Qualitative Analysis (ver
B.07.00). The peak area of intracellular GSH (m/z 308.0911, protonated) was divided by
the peak area of the internal standard (m/z 311.0948, protonated) and normalized to the
corresponding cell number multiplied by 1 million.

Cell transfer experiments for LCMV infections

P14-Gclcfl/fl and P14-CD4Cre-Gclcfl/fl CD8+ T cells were purified from spleen and lymph
nodes utilizing the Dynabeads FlowComp Mouse CD8+ kit (Invitrogen). Following CD8+ T
cell isolation, control T cells were labeled with 2.5µM CellTracker Green (Molecular
Probes) for 9 minutes at 37 degrees Celsius. Gclc-deficient T cells were labeled with

3
2.5µM CellTrace Violet (Molecular Probes) for 9 minutes at 37 degrees Celsius. Following
labeling, cells were counted and mixed at a 1:1 ratio and injected intraperitoneally (i.p.)
into recipient CD45.1 animals so that each recipient received 1.6x106 P14-specific Tcells
of each genotype. The following day, recipient mice were infected with 2x105 plaque
forming units of LCMV-Armstrong i.p. Recipient mice were sacrificed 36 and 60 hours
post-infection. Donor P14 T cells were identified based on CD45.2 staining, and genotype
of the transferred T cells were discriminated based on CellTracker Green or CellTrace
Violet staining, respectively.

Supplemental Figure Legends

Supplemental Figure 1, related to Figure 1: Ablation of Gclc does not influence

thymocyte development.
(A) Colorimetric determination of GSH concentrations in WT CD4+ T cells isolated and
pooled from spleen plus lymph nodes (LN) and stimulated in vitro for 24h with the indicated
concentrations of anti-CD3/28 Abs, with or without the GCL inhibitor BSO. Data are derived
from kinetic measurements and are representative of 6 independent experiments. (B)
Immunoblot to detect GCLC protein in Gclcfl/fl and CD4Cre-Gclcfl/fl T cells that were activated
in vitro with 3µg/mL anti-CD3/28 for the indicated times. Actin, loading control. Data are
representative of 2 independent experiments. (C, D) Gclcfl/fl and CD4Cre-Gclcfl/fl mice were
injected i.p. with 150 µg/mouse SEB. After 48h, Vβ8+ CD4+ and CD8+ T cells were sorted
by flow cytometry, and GSH (C) and ROS levels (D) were determined as described in
Experimental Procedures. Data are the mean ± SEM (n=3) and representative of 2
independent experiments. (E) Flow cytometric determinations of thymocyte subsets in thymi
isolated from 6-week-old Gclcfl/fl and CD4Cre-Gclcfl/fl mice. Double negative (DN)
thymocytes were gated after exclusion of Lineage-positive cells
(CD4+/CD8+/CD11b+/CD11c+/Gr-1+/NK1.1+/B220+/TER119+). DN1: CD44+CD25-; DN2:
CD44+CD25+; DN3: CD44-CD25+; DN4: CD44- CD25-, Double positive (DP): CD4+CD8+.
Data are the mean ± SEM (n=6) and representative of 2 experiments. (F) Flow cytometric
analysis of lymphoid cell subsets that were harvested from peripheral blood of Gclcfl/fl and
CD4Cre-Gclcfl/fl mice. Data are the mean ± SEM (n=4) and representative of 3 experiments.
*p<0.05.

4
Supplemental Figure 2, related to Figure 1: Effects of Gclc deficiency on T cell
signaling and ROS levels.
(A) Immunoblots to detect the indicated proteins in CD4+ and CD8+ T cells that were isolated
from Gclcfl/fl or CD4Cre-Gclcfl/fl spleen plus LN and stimulated with PMA/Iono for the
indicated times. Data are representative of 3 independent experiments. (B) Immunoblot to
detect the indicated phosphorylated proteins in CD4+ T cells that were isolated from spleen
plus LN of Gclcfl/fl or CD4Cre-Gclcfl/fl mice and stimulated with PMA/Iono for the indicated
times. GSKβ, loading control. Data are representative of 3 experiments. (C) Flow cytometric
FSC/SSC measurement of the cells in Fig.1F. Data are representative of 2 trials. (D) Flow
cytometric determination of % viability of Gclcfl/fl and CD4Cre-Gclcfl/fl T cells that were
stimulated with the indicated concentrations of anti-CD3/28 Abs for 48hr and stained with
7AAD/AnnexinV. Data are the mean ± SEM (n=3) and representative of 6 independent
experiments. (E) Flow cytometric determination of DCF-DA staining of Gclcfl/fl and CD4Cre-
Gclcfl/fl CD4+ T cells that were stimulated with anti-CD3/28 for 24h and co-incubated with or
without NAC or GSH, as indicated. Data are representative of 4 independent experiments.

Supplemental Figure 3, related to Figure 3: Gclc deficiency alters T cell metabolism.

(A) Schematic illustration of a glutamine fluxmap and U-13C-glutamine isotopomer
distribution through progressive TCA cycling. (B) Mathematical determination of the M2/M4
citrate isotopologues ratio in activated Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ T cells. Data are
the mean ± SEM and representative of 3 independent experiments. ***p<0.001. (C) Flow
cytometric measurement of % viability of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ T cells that were
left unstimulated (non-stim.) or stimulated with 10µg/mL anti-CD3/28 Abs or PMA/Iono for
24h and stained with 7AAD/ AnnexinV. Data are the mean ± SEM of triplicate measurements
and representative of 3 independent experiments. (D) Proliferation assessment by 3H-
thymidine incorporation of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ T cells that were stimulated with
anti-CD3/28 Abs and supplemented with the indicated concentrations of glutamine for 48h.
Data are the mean ± SEM (n=3) and representative of 3 independent experiments. (E)
Proliferation assessment as in (C) of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ and CD8+ T cells that
were stimulated with anti-CD3/28 Abs and supplemented with the indicated concentrations
of dimethyl-α-ketoglutarate (DMK) for 24h. Data are the mean ± SEM (n=3) and
representative of 3 independent experiments. (F) Schematic illustration of a glucose fluxmap
and U-13C-glucose isotopomer distribution through progressive TCA cycling. (G)

5
Determination of the oxygen consumption rate (OCR) of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+
and CD8+ T cells that were stimulated with anti-CD3/28 Abs for 24h. Data are the mean ±
SEM (n=6) and representative of 2 independent experiments.

Supplemental Figure 4 related to Figure 5: BSO reduces GSH, increases ROS and
exogenous IL-2 cannot restore the proliferation of Gclc-deficient T cells.
(A, B,C) Determinations of GSH and ROS levels as in Suppl. Fig. 1C, D in WT CD4+ T cells
that were isolated from spleen and LN and activated in vitro with anti-CD3/28 Abs for 24h in
the presence or absence of BSO ± NAC. Data are the mean ± SEM (n=4) and representative
of 2 independent experiments. (B) Immunoblot to detect PKM2 protein in Gclcfl/fl and
CD4Cre-Gclcfl/fl CD4+ and CD8+ T cells that were left unstimulated (0) or stimulated for 24h
with anti-CD3/28 Abs. Data are representative of 2 independent experiments. (C) Flow
cytometric determination of Ca2+ mobilization in Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+
splenocytes that were stimulated with anti-CD3 or ionomycin at the indicated timepoints
(positive controls). Data are representative of 3 experiments. (C) Proliferation assessment
by 3H-thymidine incorporation of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ and CD8+ T cells that
were stimulated with the indicated concentrations of anti-CD3/28 Abs in the absence or
presence of 250U/ml IL-2. Data are the mean ± SEM (n=3) and representative of 2
independent experiments.

Supplemental Figure 5, related to Figure 6: ROS scavenging is needed to coordinate

metabolic fluxes in T cells.
(A, B) Measurement of the extracellular glucose and lactate secretion rates (A), and the
ratio of molecules of lactate produced per molecules of glucose consumed (B), in Gclcfl/fl
and CD4Cre-Gclcfl/fl CD4+ T cells that were stimulated with anti-CD3/28 Abs for 24h in the
presence or absence of GSH. Data are the mean ± SEM of triplicate measurements of
pooled cells from 4 mice/genotype and representative of 2 independent experiments. (C, D)
WT CD4+ T cells were incubated with U-13C-glutamine (C) or U-13C-glucose (D) and
stimulated with anti-CD3/28 Abs with or without BSO for 24h in the presence or absence of
NAC or GSH. Left: Fluxmaps. Right: Mass isotopomer distributions of citrate. Data are the
mean ± SEM (n=3) and representative of 2 independent experiments. (E, F) Proliferation
assessment by 3H-thymidine incorporation of CD4Cre-Gclcfl/fl T cells that were stimulated
with anti-CD3/28 Abs for 24h in the absence or presence of NAC, GSH or NAC plus FK506

6
(E) or NAC plus rapamycin (Rap.) (F). Data are the mean ± SEM (n=3) and representative
of 2 independent experiments.

Supplemental Figure 6, related to Figure 7: Gclc ablation in T cells affects adaptive,

but not innate, immune responses.
(A) Histological analysis of spinal cords of Gclcfl/fl and CD4Cre-Gclcfl/fl mice at day 30 (d30)
after EAE induction. Cross-sections were stained with H&E, anti-CD3 (T cells) or anti-Mac-
1 (macrophages, activated microglia). Scale bars: 400µm. Data are from one mouse of 3
mice per group and representative of 2 independent experiments. (B) Intracellular flow
cytometric determinations of the indicated populations of antigen-specific memory T cells
secreting the indicated cytokines in Gclcfl/fl and CD4Cre-Gclcfl/fl mice at d60 post-LCMV
infection. Data are the mean ± SEM (n=6) and representative of 2 experiments. (C) ELISA
determination of serum IFNα in Gclcfl/fl and CD4Cre-Gclcfl/fl mice on the indicated days post-
LCMV infection. Data are the mean ± SEM (n=6). (C) CD8+ T cells from LCMV-specific TCR
transgenic P14-Gclcfl/fl (n=6) and P14-CD4Cre-Gclcfl/fl (n=6) mice were isolated from LN and
spleen, labeled with CFSE or VCT, respectively, and transferred into WT recipient mice.
Recipient mice were infected with LCMV-Armstrong, and the proliferation of LN and splenic
T cells was analyzed at the indicated timepoints post-infection by flow cytometry. Data are
the mean ± SEM (n=4) and representative of 2 experiments.

Supplemental References
Brenner, D., Brechmann, M., Rohling, S., Tapernoux, M., Mock, T., Winter, D., Lehmann,
W.D., Kiefer, F., Thome, M., Krammer, P.H., and Arnold, R. (2009). Phosphorylation of
CARMA1 by HPK1 is critical for NF-kappaB activation in T cells. Proceedings of the National
Academy of Sciences of the United States of America 106, 14508-14513.

Brustle, A., Brenner, D., Knobbe, C.B., Lang, P.A., Virtanen, C., Hershenfield, B.M.,
Reardon, C., Lacher, S.M., Ruland, J., Ohashi, P.S., and Mak, T.W. (2012). The NF-kappaB
regulator MALT1 determines the encephalitogenic potential of Th17 cells. The Journal of
clinical investigation 122, 4698-4709.

Herold, S., Wanzel, M., Beuger, V., Frohme, C., Beul, D., Hillukkala, T., Syvaoja, J., Saluz,
H.P., Haenel, F., and Eilers, M. (2002). Negative regulation of the mammalian UV response
by Myc through association with Miz-1. Molecular cell 10, 509-521.

Verbist, K.C., Guy, C.S., Milasta, S., Liedmann, S., Kaminski, M.M., Wang, R., and Green,
D.R. (2016). Metabolic maintenance of cell asymmetry following division in activated T
lymphocytes. Nature 532, 389-393.

7
  …


*


2 3 4 5 6 2 3 4 5 6 7 8 9

‡
ƒ

‚
µ

: ; < ; 

 €

= > ? @ A

K L M K L

C H I J B C D C K L M K L
B C D C E F G

Ž    ‘ ’ “ ‘ ’ ” • –  — ˜ ™ Ž    ‘ ’ “ ‘ ’ ” • –  — ˜ ™

       

Ž    ‘ ’ “ ‘ ’
Ž    ‘ ’ “ ‘ ’


   

α α µ
ˆ ‰ Š ‹ Œ ‰
ˆ ‰ Š ‹ Œ 

β
    

 š š š

*
*
ˆ ‰ Š ‹ Œ ‰

β
ˆ ‰ Š ‹ Œ 

β ¤

œ š š š

Ÿ £

± ²

› š š š
ž

­ ®

¥ ¦ § ¨ © ª « ¬

¥ ¦ § ¨ © ª « ¬ ˆ ‰ Š ‹ Œ ‰
ˆ ‰ Š ‹ Œ 

β β

- ) 1 ) )

" '

³ ´ µ ´ ¶ · ¸ ¶ ·

&
$

- )

¹ º » ´ ¼ ½ ¾ ³ ´ µ ´ ¶ · ¸ ¶ ·

, )

"
'

# $

&
$

"

, )

+ )

$
#

"

+ )

* )

 

* )

 

) )

. / Y . + Y . -

. / * . / 0 . / + . Z

. / 1

N O P Q R S P T U V T W X U N O P Q R S P T U V T W X U

_ `

³ ´ µ ´ ¶ · ¸ ¶ ·

p
b

¹ º » ´ ¼ ½ ¾ ³ ´ µ ´ ¶ · ¸ ¶ ·

o
m

j
f

^ [

n
e

l m

] [
k

*
j

*
h j

*
h

g
\ [

b
f

d e

a b

 

u v w x x y z v w x x y { | } { | ~

z v w x x y z v w x x y
        
       

                    

                    





  
  

  
  

+ , + ,

κ α κ α

" $ " % & ' " $ "

" $ " % & ' " $ "

! " ! # # ! ( ) * ! " ! # #
! " ! # # ! ( ) * ! " ! # #

Z [ \ [ ] ^ _ ] ^
` a b [ c d e Z [ \ [
] ^ _ ] ^

- . / . 0 . - . / . 0 . 1 2 3 4 5

A B C D
SSC

SSC

β
A E F C G

β
E F C G

6 7 8 7 9
8 :

9
8 ; < =

7 > ? @ 6 7 8 7 9
8 :

9
8

FSC FSC

Y H
*
*
H
N

f g h f g i * Z [ \ [ ] ^ _ ] ^

` a b [ c d e Z [ \ [ ] ^ _ ] ^

*
M H

M H

L H

P T
U

P T U

P
R

K H

P Q
K H

P Q
O

J H

H H I J J J H

H H I J J J H

j k l m j k n o p

α α µ
j k l m j k n o p
q r s t u

α α µ
q r s t u

… † ‡
Counts

` a b [ c d e Z [ \ [
] ^ _ ] ^

~ ‚ ƒ „

x y z { | }
v w

` a b [ c d e Z [ \ [
] ^ _ ] ^
Counts

~  € 

` a b [ c d e Z [ \ [
] ^ _ ] ^

ˆ ‰ Š

Z [ \ [
] ^ _ ] ^
Counts

v w x y z { | }

w x y z { | }
v
         







   

        

 !  " # $         

*


            

*
A

@
 !  " # $         

*
9 = >

<

9 :

B C D E B C F G

α α
H I H J K L M N O P Q R S T I H I

*
W Z

*         

*  !  " # $         
% & ' & ( ) * ( * + , - . / 0 1 2 3 , 4 % 5

* U & V * & U V * & * U V + , - . W - X

W [

* *
*
*
    

* U & V * & U V * & * U V + , - . W - X

A
6  

*
9 u

  
<

  
?

\ ] ] ^ _ ` ^ _ a b c d e f g h d d i j k i j a b c d e f g

 

h d d i j k i j
\ ] ] ^ _ ` ^ _



l m o
l m n
 r o o s t u
p

s t u

U Q Q Q Q Q

*
* ~  €

~  €
r o o o

*
}

T Q Q Q Q Q

e
z

q
p
o o
*
d

x |

… †

S Q Q Q Q Q

b
ƒ
z

q o o o
 ‚

x
`

w
_

R Q Q Q Q Q

o o
p

V W X Y Z W [ \ ] ^

 v 

g h i j k l m n

Œ  Ž  Œ  "   ”

α α µ
‘ ’ “

s t u

‡ o o o ~  €

* *
C D E F G H I I J C D K F G H I I J

~  € ˆ ‰ Š ‹

z
r o o o
* * ' ' ( ) ( ) ( ) ( ) * + , -

. / 0 1

x
|

G N O P
M

q o o o

2 2 2

8 8

3 3 3

9 9

4 4 4

3 5 3 5 3 5
: :

5 5 5

; ;

6 6 6

7 ; 7 7

L L

o
6 6 6

< =

= =
< <

>

> >

 v 

; ;

? ?

; @

Œ  Ž  Œ  "   ”

; @ ; @

α α µ
‘ ’ “

A
@ @

B
A A

B B

A A

# $ % # $

   

# $ % # $

          

     &

                



α α

# $ % # $

   

# $ % # $

      ! "

     &

# $ % # $

          

# $ % # $

             ! "

 

 

 

Œ  Ž  Œ  "   ” Œ  Ž  Œ  "   ”

α α µ α α µ
‘ ’ “ ‘ ’ “
 G I G

F B G B H H

G I G

? @ A B C D E F B G B H H

G I G J K L M

? @ A B C D E F B G B H H

G I G

F B G B
H H

G I G

? @ A B C D E F B G B H H

G I G J K L M

? @ A B C D E F B G B H H

   

       

     

   

       

     

* *
+ ' ' '

* * * *
. / 0 / 1 2 3 1 2 . / 0 / 1 2 3 1 2

+ ' ' '

*



4 5 6 / 7 8 9 . / 0 / 1 2 3 1 2 4 5 6 / 7 8 9 . / 0 / 1 2 3 1 2


*
* ' ' '


 


* ' ' '

*


*


) ' ' '



) ' ' '

 

 




( ' ' '

( ' ' '

'

,
  ,





; < = >

# $
" %
& -
" # $ %
& -

 
 
 



  &

!
 !

  &

 

 
 a b c a b
^ _ ` _ a b c a b d e f _ g h i ^ _ ` _

j k l

m n o

p q r s t

 
IL-2 

1 + J K L J K
'

> ? @ ?

* *
)

  
* A B C ? D E F > ? @ ? G H I G H

  

 


'
-


,

     
  
 


* +

  "

 

& '

 


  !
α

# $

2 3 4 5 6 7 7 8 2 3 4 9 6 7 : ; 8 2 3 4 5 6 < = ; 8

 
TNF   IFNγ
* * 1
+
'
* *
*
1 +
'

)
* /

)
 

  

  

M N O P Q R P S T U V W X Y Z [ \ S X R ]

'
-

'
-

+
*

* +

  "

  "

&
'

& '

  !

  !

# $

# $

2 3 4 5 6 7 7 8 2 3 4 9 6 7 : ; 8 2 3 4 5 6 < = ; 8 2 3 4 5 6 7 7 8 2 3 4 9 6 7 : ; 8 2 3 4 5 6 < = ; 8

J K L J K

J K L J K

A B C ? D E F > ? @ ?
> ? @ ?

 v

 v

w x y z { w |